Ex-vivo Assessment of Coronary Artery Atherosclerosis by Magnetic Resonance Imaging: Correlation with Histopathology

PubMed Central

Gomes, Everli P. S. Gonçalves; Rochitte, Carlos Eduardo; Azevedo, Clerio F.; Lemos, Pedro A.; Gutierrez, Paulo Sampaio; César, Luiz Antonio M.

2014-01-01

Introduction: In recent years, high-resolution magnetic resonance imaging (MRI) has emerged as a very promising technique for studying atherosclerotic disease in humans. Aim: In the present study we sought to determine whether MRI allowed for the morphological characterization of the coronary vessel wall and atherosclerotic plaques using histopathological assessment as the reference standard. Methods: The study population consisted of 13 patients who died of acute myocardial infarction and underwent autopsy. The proximal portions of the coronary arteries were excised and were evaluated both by MRI and by histopathology. For each arterial segment, the following parameters were calculated through manual planimetry: 1. total vessel area (TVA); 2. luminal area (LA) and 3. plaque area (PA). Results: A total of 207 coronary artery cross-sections were found to be suitable for analysis by both MRI and histopathology and were included in the final analyses. Both methods demonstrated moderate to good agreement for the quantification of TVA (mean difference = 2.4±2.4 mm2, 95‰ limits of agreement from -2.4 to +7.2 mm2; CCC = 0.69, 95‰ CI from 0.63 to 0.75), LA (mean difference = 0.0±1.7 mm2, 95‰ limits of agreement from -3.3 to + 3.3 mm2; CCC = 0.84, 95‰ CI from 0.80 to 0.88) and PA (mean difference = 2.4±2.4 mm2, 95‰ limits of agreement from -2.3 to + 7.1 mm2; CCC = 0.64, 95‰ CI from 0.58 to 0.71). Conclusion: In this ex vivo experimental model we demonstrated good agreement between coronary artery morphometrical measurements obtained by high-resolution MRI and by histopathology. PMID:24847387

Comparative Confocal and Histopathological Study of Corneal Changes in Multiple Myeloma.

PubMed

Micali, Antonio; Roszkowska, Anna M; Postorino, Elisa I; Rania, Laura; Aragona, Emanuela; Wylegala, Edward; Nowinska, Anna; Ieni, Antonio; Calimeri, Sebastiano; Pisani, Antonina; Aragona, Pasquale; Puzzolo, Domenico

2017-01-01

Corneal opacities rarely occur in multiple myeloma (MM). Our study correlates the findings of in vivo confocal microscopy (IVCM), a useful diagnostic tool, with histopathological features of corneal opacities appearing in a patient with MM. Case report. A 53-year-old man developed corneal opacities in both eyes, more pronounced in the left eye. After IVCM examination, he underwent penetrating keratoplasty in the left eye, and the button was processed for light and electron microscopy and immunohistochemistry. The diagnosis of MM was made, as confirmed by the elevation of IgGk light chains. IVCM demonstrated hyperreflective areas at the epithelial level, hyperreflective keratocytes of dendritic and lamellar morphology in whole stroma, and hyperreflective endothelial cells. Histopathological examination disclosed many vacuoles in the epithelial cell cytoplasm and a homogenous granular material in the Bowman layer. In stroma, keratocytes of different shape and size, with vesicles laden with an abnormal material, were evident. In Descemet membrane, the posterior nonbanded zone had a honeycomb appearance because of the presence of many roundish spaces among wide-spaced collagen fibers. Endothelial cells demonstrated vesicles filled with a material of uneven electron density. Immunohistochemical analysis showed strong positivity for IgGk light chains in keratocytes and among stromal lamellae. This is the first study describing a correspondence between IVCM features and histopathological alterations observed in corneal opacities in MM. The results of this study improve the current understanding of the pictures obtained by IVCM studies.

Which is the best method of sterilization for recycled bone autograft in limb salvage surgery: a radiological, biomechanical and histopathological study in rabbit.

PubMed

Yasin, Nor Faissal; Ajit Singh, Vivek; Saad, Marniza; Omar, Effat

2015-04-15

Limb salvage surgery is a treatment of choice for sarcomas of the extremities. One of the options in skeletal reconstruction after tumour resection is by using a recycled bone autograft. The present accepted methods of recycling bone autografts include autoclaving, pasteurization and irradiation. At the moment there is lack of studies that compare the effectiveness of various sterilization methods used for recycling bone autografts and their effects in terms of bone incorporation. This study was performed to determine the effects of different methods of sterilization on bone autografts in rabbit by radiological, biomechanical and histopathological evaluations. Fresh rabbit cortical bone is harvested from the tibial diaphysis and sterilized extracorporeally by pasteurization (n = 6), autoclaving (n = 6), irradiation (n = 6) and normal saline as control group (n = 6). The cortical bones were immediately reimplanted after the sterilization process. The subsequent process of graft incorporation was examined over a period of 12 weeks by serial radiographs, biomechanical and histopathological evaluations. Statistical analysis (ANOVA) was performed on these results. Significance level (α) and power (β) were set to 0.05 and 0.90, respectively. Radiographic analysis showed that irradiation group has higher score in bony union compared to other sterilization groups (p = 0.041). ANOVA analysis of 'failure stress', 'modulus' and 'strain to failure' demonstrated no significant differences (p = 0.389) between treated and untreated specimens under mechanical loading. In macroscopic histopathological analysis, the irradiated group has the highest percentage of bony union (91.7 percent). However in microscopic analysis of union, the pasteurization group has significantly higher score (p = 0.041) in callus formation, osteocytes percentage and bone marrow cellularity at the end of the study indicating good union potential. This experimental study shown that both irradiation and pasteurization techniques have more favourable outcome in terms of bony union based on radiographic and histopathological evaluations. Autoclaving has the worst outcome. These results indicate that extracorporeal irradiation or pasteurization of bone autografts, are viable option for recycling bone autografts. However, pasteurization has the best overall outcomes because of its osteocytes preservation and bone marrow cellularity.

Histopathological Image Analysis: A Review

PubMed Central

Gurcan, Metin N.; Boucheron, Laura; Can, Ali; Madabhushi, Anant; Rajpoot, Nasir; Yener, Bulent

2010-01-01

Over the past decade, dramatic increases in computational power and improvement in image analysis algorithms have allowed the development of powerful computer-assisted analytical approaches to radiological data. With the recent advent of whole slide digital scanners, tissue histopathology slides can now be digitized and stored in digital image form. Consequently, digitized tissue histopathology has now become amenable to the application of computerized image analysis and machine learning techniques. Analogous to the role of computer-assisted diagnosis (CAD) algorithms in medical imaging to complement the opinion of a radiologist, CAD algorithms have begun to be developed for disease detection, diagnosis, and prognosis prediction to complement to the opinion of the pathologist. In this paper, we review the recent state of the art CAD technology for digitized histopathology. This paper also briefly describes the development and application of novel image analysis technology for a few specific histopathology related problems being pursued in the United States and Europe. PMID:20671804

Heterogeneous impact of smoking on major salivary gland cancer according to histopathological subtype: A case-control study.

PubMed

Sawabe, Michi; Ito, Hidemi; Takahara, Taishi; Oze, Isao; Kawakita, Daisuke; Yatabe, Yasushi; Hasegawa, Yasuhisa; Murakami, Shingo; Matsuo, Keitaro

2018-01-01

Major salivary gland cancers (M-SGCs) are rare, and have distinct heterogeneous histopathological subtypes. To the authors' knowledge, no consistent evidence of an association between cigarette smoking and the risk of M-SGCs has appeared to date. Furthermore, evidence of potential heterogeneity in the impact of smoking on histopathological subtypes is scarce, despite the fact that the histopathological subtypes of M-SGC exhibit different genetic features. The authors conducted a case-control study to investigate the association between smoking and M-SGC by histopathological subtype. Cases were 81 patients with M-SGCs and the controls were 810 age-matched and sex-matched first-visit outpatients without cancer treated at Aichi Cancer Center Hospital from 1988 to 2005. Odds ratios (OR) and 95% confidence intervals (95% CI) were assessed by conditional logistic regression analysis with adjustment for potential confounders. Smoking was found to be associated with a significantly increased risk of M-SGC overall, with an OR of 3.45 (95% CI, 1.58-7.51; P =.001) for heavy smokers compared with never-smokers. A significant dose-response relationship was observed (P for trend, .001). When stratified by histological subtype, no obvious impact of smoking was observed among patients with mucoepidermoid carcinoma (MEC). In contrast, smoking demonstrated a significantly increased risk of M-SGCs other than MEC, with an OR of 5.15 (95% CI, 2.06-12.87; P<.001) for heavy smokers compared with never-smokers. The authors observed possible heterogeneity with regard to the impact of smoking on risk between MEC and M-SGCs other than MEC (P for heterogeneity, .052). The results of the current study demonstrate a significant positive association between cigarette smoking and the risk of M-SGC overall. However, the impact of smoking appeared to be limited to M-SGCs other than MEC. Cancer 2018;124:118-24. © 2017 American Cancer Society. © 2017 American Cancer Society.

Computer-aided prognosis on breast cancer with hematoxylin and eosin histopathology images: A review.

PubMed

Chen, Jia-Mei; Li, Yan; Xu, Jun; Gong, Lei; Wang, Lin-Wei; Liu, Wen-Lou; Liu, Juan

2017-03-01

With the advance of digital pathology, image analysis has begun to show its advantages in information analysis of hematoxylin and eosin histopathology images. Generally, histological features in hematoxylin and eosin images are measured to evaluate tumor grade and prognosis for breast cancer. This review summarized recent works in image analysis of hematoxylin and eosin histopathology images for breast cancer prognosis. First, prognostic factors for breast cancer based on hematoxylin and eosin histopathology images were summarized. Then, usual procedures of image analysis for breast cancer prognosis were systematically reviewed, including image acquisition, image preprocessing, image detection and segmentation, and feature extraction. Finally, the prognostic value of image features and image feature-based prognostic models was evaluated. Moreover, we discussed the issues of current analysis, and some directions for future research.

Protective effects of edaravone combined puerarin on inhalation lung injury induced by black gunpowder smog.

PubMed

Wang, Zhengguan; Li, Ruibing; Liu, Yifan; Liu, Xiaoting; Chen, Wenyan; Xu, Shumin; Guo, Yuni; Duan, Jinyang; Chen, Yihong; Wang, Chengbin

2015-05-01

The present study aimed to investigate the combined effects of puerarin with edaravone on inhalation lung injury induced by black gunpowder smog. Male Wistar rats were divided into five groups (control group, edaravone group, puerarin group, edaravone combined with puerarin group and inhalation group). The severity of pulmonary injuries was evaluated after inducing acute lung injury. Arterial blood gas, inflammatory cytokines, biochemical, parameters, cell counting, W/D weight ratio and histopathology were analyzed. Results in lung tissues, either edaravone or puerarin treatment alone showed significant protective effects against neutrophil infiltration and tissue injury, as demonstrated by myeloperoxidase activity and histopathological analysis (all p<0.05). In addition, combined treatment with both edaravone and puerarin demonstrated additive protective effects on smog-induced lung injury, compared with single treatment. Combination of edaravone and puerarin shows promise as a new treatment option for acute lung injury/acute respiratory distress syndrome patients. Copyright © 2015 Elsevier B.V. All rights reserved.

Histopathological Image Classification using Discriminative Feature-oriented Dictionary Learning

PubMed Central

Vu, Tiep Huu; Mousavi, Hojjat Seyed; Monga, Vishal; Rao, Ganesh; Rao, UK Arvind

2016-01-01

In histopathological image analysis, feature extraction for classification is a challenging task due to the diversity of histology features suitable for each problem as well as presence of rich geometrical structures. In this paper, we propose an automatic feature discovery framework via learning class-specific dictionaries and present a low-complexity method for classification and disease grading in histopathology. Essentially, our Discriminative Feature-oriented Dictionary Learning (DFDL) method learns class-specific dictionaries such that under a sparsity constraint, the learned dictionaries allow representing a new image sample parsimoniously via the dictionary corresponding to the class identity of the sample. At the same time, the dictionary is designed to be poorly capable of representing samples from other classes. Experiments on three challenging real-world image databases: 1) histopathological images of intraductal breast lesions, 2) mammalian kidney, lung and spleen images provided by the Animal Diagnostics Lab (ADL) at Pennsylvania State University, and 3) brain tumor images from The Cancer Genome Atlas (TCGA) database, reveal the merits of our proposal over state-of-the-art alternatives. Moreover, we demonstrate that DFDL exhibits a more graceful decay in classification accuracy against the number of training images which is highly desirable in practice where generous training is often not available. PMID:26513781

Demonstration of the ability of a canine Lyme vaccine to reduce the incidence of histological synovial lesions following experimentally-induced canine Lyme borreliosis.

PubMed

Grosenbaugh, Deborah A; Rissi, Daniel R; Krimer, Paula M

2016-11-01

Lyme disease in dogs can be effectively prevented by vaccination against antigens expressed by the spirochete Borrelia burgdorferi during transmission by the tick vector Ixodes sp. Lyme vaccine efficacy has traditionally been based on indicators of infection following wild-caught tick challenge whereas most other types of vaccine are required to demonstrate protection from clinical signs of disease. In this vaccination-challenge study we sought to demonstrate the ability of a nonadjuvanted, outer surface protein A (OspA) vaccine to protect from infection and to prevent synovial lesions consistent with Borreliosis. Thirty, purpose-bred beagles were randomly divided into vaccinated and unvaccinated groups. The vaccinated group was administered two subcutaneous doses of a nonadjuvanted, purified, Borrelia burgdorferi OspA vaccine at a 21- day interval. Dogs were challenged by wild-caught, B. burgdorferi-infected ticks (Ixodes scapularis). Clinical signs, serology, Borrelia isolation and PCR evaluated antemortem vaccine efficacy. Postmortem histopathological analysis of synovial tissue was compared to antemortem infection status. Borreliosis was demonstrated by Borrelia isolation from skin biopsies in 13 out of 15 unvaccinated dogs. All unvaccinated dogs' Western blot profiles were consistent with infection. Two of 15 vaccinated dogs had at least one positive spirochete culture which cleared 91days post-challenge, and Western blot profiles were consistent with vaccination alone. No dogs, vaccinated or unvaccinated, exhibited clinical signs consistent with borreliosis. Based on a histopathological cumulative joint scoring system (CJS), all unvaccinated dogs had synovial lesions indicative of Lyme disease. Only one of the vaccinated dogs had a CJS that was greater than the statistical cut off score for the absence of synovial lesions. There was high correlation between clinical histopathology and spirochete isolation. Infection with B burgdorferi may produce inconsistent clinical signs of lameness. Histopathological changes in joints from infected dogs are reliable indicators of borreliosis and correlate well with other indicators of infection. This model provides support that vaccination with a nonadjuvanted, purified OspA vaccine offers protection from Borrelia infection and the resulting synovial lesions that can lead to clinical signs of lameness. Copyright © 2016 Elsevier B.V. All rights reserved.

ADC histogram analysis of muscle lymphoma - Correlation with histopathology in a rare entity.

PubMed

Meyer, Hans-Jonas; Pazaitis, Nikolaos; Surov, Alexey

2018-06-21

Diffusion weighted imaging (DWI) is able to reflect histopathology architecture. A novel imaging approach, namely histogram analysis, is used to further characterize lesion on MRI. The purpose of this study is to correlate histogram parameters derived from apparent diffusion coefficient- (ADC) maps with histopathology parameters in muscle lymphoma. Eight patients (mean age 64.8 years, range 45-72 years) with histopathologically confirmed muscle lymphoma were retrospectively identified. Cell count, total nucleic and average nucleic areas were estimated using ImageJ. Additionally, Ki67-index was calculated. DWI was obtained on a 1.5T scanner by using the b values of 0 and 1000 s/mm2. Histogram analysis was performed as a whole lesion measurement by using a custom-made Matlabbased application. The correlation analysis revealed statistically significant correlation between cell count and ADCmean (p=-0.76, P=0.03) as well with ADCp75 (p=-0.79, P=0.02). Kurtosis and entropy correlated with average nucleic area (p=-0.81, P=0.02, p=0.88, P=0.007, respectively). None of the analyzed ADC parameters correlated with total nucleic area and with Ki67-index. This study identified significant correlations between cellularity and histogram parameters derived from ADC maps in muscle lymphoma. Thus, histogram analysis parameters reflect histopathology in muscle tumors. Advances in knowledge: Whole lesion ADC histogram analysis is able to reflect histopathology parameters in muscle lymphomas.

5-ALA-induced fluorescence as a marker for diagnostic tissue in stereotactic biopsies of intracranial lymphomas: experience in 41 patients.

PubMed

Kiesel, Barbara; Millesi, Matthias; Woehrer, Adelheid; Furtner, Julia; Bavand, Anahita; Roetzer, Thomas; Mischkulnig, Mario; Wolfsberger, Stefan; Preusser, Matthias; Knosp, Engelbert; Widhalm, Georg

2018-06-01

OBJECTIVE Stereotactic needle biopsies are usually performed for histopathological confirmation of intracranial lymphomas to guide adequate treatment. During biopsy, intraoperative histopathology is an effective tool to avoid acquisition of nondiagnostic samples. In the last years, 5-aminolevulinic acid (5-ALA)-induced fluorescence has been increasingly used for visualization of diagnostic brain tumor tissue during stereotactic biopsies. Recently, visible fluorescence was reported in the first cases of intracranial lymphomas as well. The aim of this study is thus to investigate the technical and clinical utility of 5-ALA-induced fluorescence in a large series of stereotactic biopsies for intracranial lymphoma. METHODS This prospective study recruited adult patients who underwent frameless stereotactic needle biopsy for a radiologically suspected intracranial lymphoma after oral 5-ALA administration. During biopsy, samples from the tumor region were collected for histopathological analysis, and presence of fluorescence (strong, vague, or no fluorescence) was assessed with a modified neurosurgical microscope. In tumors with available biopsy samples from at least 2 different regions the intratumoral fluorescence homogeneity was additionally investigated. Furthermore, the influence of potential preoperative corticosteroid treatment or immunosuppression on fluorescence was analyzed. Histopathological tumor diagnosis was established and all collected biopsy samples were screened for diagnostic lymphoma tissue. RESULTS The final study cohort included 41 patients with intracranial lymphoma. Stereotactic biopsies with assistance of 5-ALA were technically feasible in all cases. Strong fluorescence was found as maximum level in 30 patients (75%), vague fluorescence in 2 patients (4%), and no visible fluorescence in 9 patients (21%). In 28 cases, samples were obtained from at least 2 different tumor regions; homogenous intratumoral fluorescence was found in 16 of those cases (57%) and inhomogeneous intratumoral fluorescence in 12 (43%). According to histopathological analysis, all samples with strong or vague fluorescence contained diagnostic lymphoma tissue, resulting in a positive predictive value of 100%. Analysis showed no influence of preoperative corticosteroids or immunosuppression on fluorescence. CONCLUSIONS The data obtained in this study demonstrate the technical and clinical utility of 5-ALA-induced fluorescence in stereotactic biopsies of intracranial lymphomas. Thus, 5-ALA can serve as a useful tool to select patients not requiring intraoperative histopathology, and its application should markedly reduce operation time and related costs in the future.

Generating region proposals for histopathological whole slide image retrieval.

PubMed

Ma, Yibing; Jiang, Zhiguo; Zhang, Haopeng; Xie, Fengying; Zheng, Yushan; Shi, Huaqiang; Zhao, Yu; Shi, Jun

2018-06-01

Content-based image retrieval is an effective method for histopathological image analysis. However, given a database of huge whole slide images (WSIs), acquiring appropriate region-of-interests (ROIs) for training is significant and difficult. Moreover, histopathological images can only be annotated by pathologists, resulting in the lack of labeling information. Therefore, it is an important and challenging task to generate ROIs from WSI and retrieve image with few labels. This paper presents a novel unsupervised region proposing method for histopathological WSI based on Selective Search. Specifically, the WSI is over-segmented into regions which are hierarchically merged until the WSI becomes a single region. Nucleus-oriented similarity measures for region mergence and Nucleus-Cytoplasm color space for histopathological image are specially defined to generate accurate region proposals. Additionally, we propose a new semi-supervised hashing method for image retrieval. The semantic features of images are extracted with Latent Dirichlet Allocation and transformed into binary hashing codes with Supervised Hashing. The methods are tested on a large-scale multi-class database of breast histopathological WSIs. The results demonstrate that for one WSI, our region proposing method can generate 7.3 thousand contoured regions which fit well with 95.8% of the ROIs annotated by pathologists. The proposed hashing method can retrieve a query image among 136 thousand images in 0.29 s and reach precision of 91% with only 10% of images labeled. The unsupervised region proposing method can generate regions as predictions of lesions in histopathological WSI. The region proposals can also serve as the training samples to train machine-learning models for image retrieval. The proposed hashing method can achieve fast and precise image retrieval with small amount of labels. Furthermore, the proposed methods can be potentially applied in online computer-aided-diagnosis systems. Copyright © 2018 Elsevier B.V. All rights reserved.

The road map towards providing a robust Raman spectroscopy-based cancer diagnostic platform and integration into clinic

NASA Astrophysics Data System (ADS)

Lau, Katherine; Isabelle, Martin; Lloyd, Gavin R.; Old, Oliver; Shepherd, Neil; Bell, Ian M.; Dorney, Jennifer; Lewis, Aaran; Gaifulina, Riana; Rodriguez-Justo, Manuel; Kendall, Catherine; Stone, Nicolas; Thomas, Geraint; Reece, David

2016-03-01

Despite the demonstrated potential as an accurate cancer diagnostic tool, Raman spectroscopy (RS) is yet to be adopted by the clinic for histopathology reviews. The Stratified Medicine through Advanced Raman Technologies (SMART) consortium has begun to address some of the hurdles in its adoption for cancer diagnosis. These hurdles include awareness and acceptance of the technology, practicality of integration into the histopathology workflow, data reproducibility and availability of transferrable models. We have formed a consortium, in joint efforts, to develop optimised protocols for tissue sample preparation, data collection and analysis. These protocols will be supported by provision of suitable hardware and software tools to allow statistically sound classification models to be built and transferred for use on different systems. In addition, we are building a validated gastrointestinal (GI) cancers model, which can be trialled as part of the histopathology workflow at hospitals, and a classification tool. At the end of the project, we aim to deliver a robust Raman based diagnostic platform to enable clinical researchers to stage cancer, define tumour margin, build cancer diagnostic models and discover novel disease bio markers.

Histopathological subgroups in knee osteoarthritis.

PubMed

Wyatt, L A; Moreton, B J; Mapp, P I; Wilson, D; Hill, R; Ferguson, E; Scammell, B E; Walsh, D A

2017-01-01

Osteoarthritis (OA) is a heterogeneous, multi-tissue disease. We hypothesised that different histopathological features characterise different stages during knee OA progression, and that discrete subgroups can be defined based on validated measures of OA histopathological features. Medial tibial plateaux and synovium were from 343 post-mortem (PM) and 143 OA arthroplasty donations. A 'chondropathy/osteophyte' group (n = 217) was classified as PM cases with osteophytes or macroscopic medial tibiofemoral chondropathy lesions ≥grade 3 to represent pre-surgical (early) OA. 'Non-arthritic' controls (n = 48) were identified from the remaining PM cases. Mankin histopathological scores were subjected to Rasch analysis and supplemented with histopathological scores for subchondral bone marrow replacement and synovitis. Item weightings were derived by principle components analysis (PCA). Histopathological subgroups were sought using latent class analysis (LCA). Chondropathy, synovitis and osteochondral pathology were each associated with OA at arthroplasty, but each was also identified in some 'non-arthritic' controls. Tidemark breaching in the chondropathy/osteophyte group was greater than in non-arthritic controls. Three histopathological subgroups were identified, characterised as 'mild OA', or 'severe OA' with mild or moderate/severe synovitis. Presence and severity of synovitis helps define distinct histopathological OA subgroups. The absence of a discrete 'normal' subgroup indicates a pathological continuum between normality and OA status. Identifying specific pathological processes and their clinical correlates in OA subgroups has potential to accelerate the development of more effective therapies. Copyright © 2016 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

In vivo reflectance confocal microscopy evaluation of cheilitis glandularis: a report of 5 cases.

PubMed

Lourenço, Silvia V; Kos, Eliana; Borguezan Nunes, Thais; Bologna, Sheyla B; Sangueza, Martin; Nico, Marcello M S

2015-03-01

Cheilitis glandularis (CG) is an uncommon condition of unknown origin; it is clinically characterized by variable degrees of macrocheilia associated with red dilated ostia of minor salivary glands on the vermilion area, which secrete viscous saliva. Histopathological characteristics of CG are comprised of chronic sialadenitis with engorged acinar lobules and dilated ducts; CG also features chronic sun damage (actinic cheilitis and squamous cell carcinoma). These changes may be localized, and a punch biopsy specimen might fail to reveal enough criteria to support the diagnosis of CG. Reflectance confocal microscopy (RCM) is a noninvasive imaging technique that enables an in vivo en face visualization of tissues with a resolution close to conventional histopathology. Its use allows analysis of the entire lip, without excision. We reported the evaluation of 5 cases of CG based on clinical RCM and histopathological correlation. RCM examination of the lip vermilion mainly revealed a bright aspect of the superficial epithelial layers, which corresponded to labial keratosis. Alteration of the classical epithelial honeycomb pattern was observed in RCM, which corresponded to epithelial changes in actinic cheilitis at histopathology. Round, dark empty spaces intermingling the epithelium, corresponded to the ectopic excretory salivary gland ducts that open their ostia within the lip vermilion. In the lamina propria, the most striking feature was superficial salivary gland lobules, seen as dark gray lobular structures. Our study, demonstrated the use of RCM in the evaluation of CG, showing that a correlation between the clinical, digital RCM images and histopathology improved the diagnostic skills in CG evaluation.

Impact of extracorporeal shock waves on the human skin with cellulite: A case study of an unique instance

PubMed Central

Kuhn, Christoph; Angehrn, Fiorenzo; Sonnabend, Ortrud; Voss, Axel

2008-01-01

In this case study of an unique instance, effects of medium-energy, high-focused extracorporeal generated shock waves (ESW) onto the skin and the underlying fat tissue of a cellulite afflicted, 50-year-old woman were investigated. The treatment consisted of four ESW applications within 21 days. Diagnostic high-resolution ultrasound (Collagenoson) was performed before and after treatment. Directly after the last ESW application, skin samples were taken for histopathological analysis from the treated and from the contra-lateral untreated area of skin with cellulite. No damage to the treated skin tissue, in particular no mechanical destruction to the subcutaneous fat, could be demonstrated by histopathological analysis. However an astounding induction of neocollageno- and neoelastino-genesis within the scaffolding fabric of the dermis and subcutis was observed. The dermis increased in thickness as well as the scaffolding within the subcutaneous fat-tissue. Optimization of critical application parameters may turn ESW into a noninvasive cellulite therapy. PMID:18488890

Hierarchical patch-based co-registration of differently stained histopathology slides

NASA Astrophysics Data System (ADS)

Yigitsoy, Mehmet; Schmidt, Günter

2017-03-01

Over the past decades, digital pathology has emerged as an alternative way of looking at the tissue at subcellular level. It enables multiplexed analysis of different cell types at micron level. Information about cell types can be extracted by staining sections of a tissue block using different markers. However, robust fusion of structural and functional information from different stains is necessary for reproducible multiplexed analysis. Such a fusion can be obtained via image co-registration by establishing spatial correspondences between tissue sections. Spatial correspondences can then be used to transfer various statistics about cell types between sections. However, the multi-modal nature of images and sparse distribution of interesting cell types pose several challenges for the registration of differently stained tissue sections. In this work, we propose a co-registration framework that efficiently addresses such challenges. We present a hierarchical patch-based registration of intensity normalized tissue sections. Preliminary experiments demonstrate the potential of the proposed technique for the fusion of multi-modal information from differently stained digital histopathology sections.

Antibacterial activity and the histopathological study of crude extracts and isolated tecomine from Tecoma stans Bignoniaceae in Iraq

PubMed Central

Al-Azzawi, Amad M.; Al-Khateeb, Ekbal; Al-Sameraei, Kulood; Al-Juboori, Alyaa G

2012-01-01

Background: Tecoma stans (Bignoniaceae) is a central and south American tree used for the control of diabetes, also known as Yellow Elder, it was collected from the gardens of Al-Jadria in Iraq. Materials and Methods: One of the main reported alkaloidal constituents, tecomine, was isolated and confirmed by spectral analysis. The bacteriological assay for different plant leaves extracts; aqueous, ethanolic, and isolated tecomine were conducted to evaluate the antibacterial effect against gram-negative and gram-positive bacteria. Results: Whole alcoholic and aqueous extract exhibited the antibacterial activity and isolated tecomine. Histopathological evaluation was demonstrated on the liver, spleen, and pancreas of the BALB/c mice given the whole alcoholic and aqueous extract that showed no significant changes in the organ texture. Conclusion: Biochemical analysis of the serum obtained showed decrease in the glucose level in the mice treated with plant extract at the most two higher concentrations used with no change in the cholesterol and triglyceride level. PMID:22224060

A comparative analysis of longitudinal computed tomography and histopathology for evaluating the potential of mesenchymal stem cells in mitigating radiation-induced pulmonary fibrosis.

PubMed

Perez, Jessica R; Lee, Sangkyu; Ybarra, Norma; Maria, Ola; Serban, Monica; Jeyaseelan, Krishinima; Wang, Li Ming; Seuntjens, Jan; Naqa, Issam El

2017-08-22

Radiation-induced pulmonary fibrosis (RIPF) is a debilitating side effect that occurs in up to 30% of thoracic irradiations in breast and lung cancer patients. RIPF remains a major limiting factor to dose escalation and an obstacle to applying more promising new treatments for cancer cure. Limited treatment options are available to mitigate RIPF once it occurs, but recently, mesenchymal stem cells (MSCs) and a drug treatment stimulating endogenous stem cells (GM-CSF) have been investigated for their potential in preventing this disease onset. In a pre-clinical rat model, we contrasted the application of longitudinal computed tomography (CT) imaging and classical histopathology to quantify RIPF and to evaluate the potential of MSCs in mitigating RIPF. Our results on histology demonstrate promises when MSCs are injected endotracheally (but not intravenously). While our CT analysis highlights the potential of GM-CSF treatment. Advantages and limitations of both analytical methods are contrasted in the context of RIPF.

Mouse models for the study of postnatal cardiac hypertrophy.

PubMed

Del Olmo-Turrubiarte, A; Calzada-Torres, A; Díaz-Rosas, G; Palma-Lara, I; Sánchez-Urbina, R; Balderrábano-Saucedo, N A; González-Márquez, H; Garcia-Alonso, P; Contreras-Ramos, A

2015-06-01

The main objective of this study was to create a postnatal model for cardiac hypertrophy (CH), in order to explain the mechanisms that are present in childhood cardiac hypertrophy. Five days after implantation, intraperitoneal (IP) isoproterenol (ISO) was injected for 7 days to pregnant female mice. The fetuses were obtained at 15, 17 and 19 dpc from both groups, also newborns (NB), neonates (7-15 days) and young adults (6 weeks of age). Histopathological exams were done on the hearts. Immunohistochemistry and western blot demonstrated GATA4 and PCNA protein expression, qPCR real time the mRNA of adrenergic receptors (α-AR and β-AR), alpha and beta myosins (α-MHC, β-MHC) and GATA4. After the administration of ISO, there was no change in the number of offsprings. We observed significant structural changes in the size of the offspring hearts. Morphometric analysis revealed an increase in the size of the left ventricular wall and interventricular septum (IVS). Histopathological analysis demonstrated loss of cellular compaction and presence of left ventricular small fibrous foci after birth. Adrenergic receptors might be responsible for changing a physiological into a pathological hypertrophy. However GATA4 seemed to be the determining factor in the pathology. A new animal model was established for the study of pathologic CH in early postnatal stages.

Long Circulating Enzyme Replacement Therapy Rescues Bone Pathology in Mucopolysaccharidosis VII Murine Model

PubMed Central

Rowan, Daniel J.; Tomatsu, Shunji; Grubb, Jeffrey H.; Haupt, Bisong; Montaño, Adriana M.; Oikawa, Hirotaka; Sosa, Catalina; Chen, Anping; Sly, William S.

2012-01-01

Mucopolysaccharidosis (MPS) type VII is a lysosomal storage disease caused by deficiency of the lysosomal enzyme β-glucuronidase (GUS), leading to accumulation of glycosaminoglycans (GAGs). Enzyme replacement therapy (ERT) effectively clears GAG storage in the viscera. Recent studies showed that a chemically modified form of GUS (PerT-GUS), which escaped clearance by mannose 6-phosphate and mannose receptors and showed prolonged circulation, reduced CNS storage more effectively than native GUS. Clearance of storage in bone has been limited due to the avascularity of the growth plate. To evaluate the effectiveness of long-circulating PerT-GUS in reducing the skeletal pathology, we treated MPS VII mice for 12 weeks beginning at 5 weeks of age with PerT-GUS or native GUS and used micro-CT, radiographs, and quantitative histopathological analysis for assessment of bones. Micro-CT findings showed PerT-GUS treated mice had a significantly lower BMD. Histopathological analysis also showed reduced storage material and a more organized growth plate in PerT-GUS treated mice compared with native GUS treated mice. Long term treatment with PerT-GUS from birth up to 57 weeks also significantly improved bone lesions demonstrated by micro-CT, radiographs and quantitative histopathological assay. In conclusion, long-circulating PerT-GUS provides a significant impact to rescue of bone lesions and CNS involvement. PMID:22902520

Intraoperative optical biopsy for brain tumors using spectro-lifetime properties of intrinsic fluorophores

NASA Astrophysics Data System (ADS)

Vasefi, Fartash; Kittle, David S.; Nie, Zhaojun; Falcone, Christina; Patil, Chirag G.; Chu, Ray M.; Mamelak, Adam N.; Black, Keith L.; Butte, Pramod V.

2016-04-01

We have developed and tested a system for real-time intra-operative optical identification and classification of brain tissues using time-resolved fluorescence spectroscopy (TRFS). A supervised learning algorithm using linear discriminant analysis (LDA) employing selected intrinsic fluorescence decay temporal points in 6 spectral bands was employed to maximize statistical significance difference between training groups. The linear discriminant analysis on in vivo human tissues obtained by TRFS measurements (N = 35) were validated by histopathologic analysis and neuronavigation correlation to pre-operative MRI images. These results demonstrate that TRFS can differentiate between normal cortex, white matter and glioma.

Ocular histopathology in Eastern equine encephalitis: A case report.

PubMed

Lad, Eleonora M; Ong, Sally S; Proia, Alan D

2017-04-01

To describe the ophthalmic symptoms and histopathological findings in a human case of Eastern equine encephalitis (EEE). The patient was a septuagenarian male whose presentation and clinical course were thought to be most consistent with viral meningoencephalitis. ELISA suggested recent infection with EEE virus. Microscopic analysis of the brain demonstrated perivascular lymphohistiocytic cuffing which was consistent with viral type encephalitis. Similarly, both eyes manifested a lymphohistiocytic infiltrate in the retina and optic nerve and a reduced number of ganglion cells. To our knowledge, this is the first report of ophthalmological and ocular pathology observations in an EEE patient. Interestingly, the inflammatory findings in the retina are reminiscent of the central nervous system effects of EEE virus. These findings are relevant given the recent epidemic of microcephaly and ophthalmic complications secondary to another arboviral virus, the Zika virus.

Actinic lesions in fishermen’s lower lip: clinical, cytopathological and histopathologic analysis

PubMed Central

Piñera-Marques, Karine; Lorenço, Silvia Vanessa; da Silva, Luiz Fernando Ferraz; Sotto, Mirian Nacagami; Carneiro, Paulo Campos

2010-01-01

INTRODUCTION Actinic cheilitis (AC) is considered to be a pre-malignant lesion or an incipient and superficial form of lip squamous cell carcinoma. It is commonly found in individuals whose occupational activities are related to chronic sun exposure and the definitive diagnosis is performed with biopsy. Althoug Exfoliative cytology has been used as a screening procedure to evaluate cancer of the oral cavity no studies have proposed the use of exfoliative cytologic analysis to evaluate and diagnose AC. OBJECTIVE The purpose of this study was to evaluate lower lip lesions on fishermen related to chronic solar exposure using clinical, cytologic and histopathologic analyses. PATIENTS AND METHODS Smears taken from the vermilion of the lower lips of 125 fishermen and 30 control individuals were subjected to cytologic analysis. RESULTS The harvested cells were sufficient for cytologic analysis in 83.2% of the samples. Sixteen fishermen exhibited prominent lower lip lesions that justified biopsy and histological studies. In total, 4 specimens were malignant (3.2%), and 12 displayed epithelial dysplasia, demonstrating that the prevalence of epithelial dysplasia and malignant lesions was high among the fishermen population. These conditions were strongly associated with infiltration and blurring of the vermilion margin of the lower lip. CONCLUSION The cytologic analysis was not useful for detecting epithelial dysplasia or malignant alterations. PMID:20454492

Evaluation of quantitative image analysis criteria for the high-resolution microendoscopic detection of neoplasia in Barrett's esophagus

NASA Astrophysics Data System (ADS)

Muldoon, Timothy J.; Thekkek, Nadhi; Roblyer, Darren; Maru, Dipen; Harpaz, Noam; Potack, Jonathan; Anandasabapathy, Sharmila; Richards-Kortum, Rebecca

2010-03-01

Early detection of neoplasia in patients with Barrett's esophagus is essential to improve outcomes. The aim of this ex vivo study was to evaluate the ability of high-resolution microendoscopic imaging and quantitative image analysis to identify neoplastic lesions in patients with Barrett's esophagus. Nine patients with pathologically confirmed Barrett's esophagus underwent endoscopic examination with biopsies or endoscopic mucosal resection. Resected fresh tissue was imaged with fiber bundle microendoscopy; images were analyzed by visual interpretation or by quantitative image analysis to predict whether the imaged sites were non-neoplastic or neoplastic. The best performing pair of quantitative features were chosen based on their ability to correctly classify the data into the two groups. Predictions were compared to the gold standard of histopathology. Subjective analysis of the images by expert clinicians achieved average sensitivity and specificity of 87% and 61%, respectively. The best performing quantitative classification algorithm relied on two image textural features and achieved a sensitivity and specificity of 87% and 85%, respectively. This ex vivo pilot trial demonstrates that quantitative analysis of images obtained with a simple microendoscope system can distinguish neoplasia in Barrett's esophagus with good sensitivity and specificity when compared to histopathology and to subjective image interpretation.

Serum metabonomic analysis of protective effects of Curcuma aromatica oil on renal fibrosis rats.

PubMed

Zhao, Liangcai; Zhang, Haiyan; Yang, Yunjun; Zheng, Yongquan; Dong, Minjian; Wang, Yaqiang; Bai, Guanghui; Ye, Xinjian; Yan, Zhihan; Gao, Hongchang

2014-01-01

Curcuma aromatica oil is a traditional herbal medicine demonstrating protective and anti-fibrosis activities in renal fibrosis patients. However, study of its mechanism of action is challenged by its multiple components and multiple targets that its active agent acts on. Nuclear magnetic resonance (NMR)-based metabonomics combined with clinical chemistry and histopathology examination were performed to evaluate intervening effects of Curcuma aromatica oil on renal interstitial fibrosis rats induced by unilateral ureteral obstruction. The metabolite levels were compared based on integral values of serum 1H NMR spectra from rats on 3, 7, 14, and 28 days after the medicine administration. Time trajectory analysis demonstrated that metabolic profiles of the agent-treated rats were restored to control levels after 7 days of dosage. The results confirmed that the agent would be an effective anti-fibrosis medicine in a time-dependent manner, especially in early renal fibrosis stage. Targeted metabolite analysis showed that the medicine could lower levels of lipid, acetoacetate, glucose, phosphorylcholine/choline, trimethylamine oxide and raise levels of pyruvate, glycine in the serum of the rats. Serum clinical chemistry and kidney histopathology examination dovetailed well with the metabonomics data. The results substantiated that Curcuma aromatica oil administration can ameliorate renal fibrosis symptoms by inhibiting some metabolic pathways, including lipids metabolism, glycolysis and methylamine metabolism, which are dominating targets of the agent working in vivo. This study further strengthens the novel analytical approach for evaluating the effect of traditional herbal medicine and elucidating its molecular mechanism.

Chronic Hypersensitivity Pneumonitis With a Usual Interstitial Pneumonia-Like Pattern: Correlation Between Histopathologic and Clinical Findings.

PubMed

Chiba, Sahoko; Tsuchiya, Kimitake; Akashi, Takumi; Ishizuka, Masahiro; Okamoto, Tsukasa; Furusawa, Haruhiko; Tateishi, Tomoya; Kishino, Mitsuhiro; Miyazaki, Yasunari; Tateishi, Ukihide; Takemura, Tamiko; Inase, Naohiko

2016-06-01

Hypersensitivity pneumonitis (HP) is an interstitial lung disease caused by the inhalation of environmental antigens. The relationship between clinical, radiologic, and histopathologic findings of chronic HP remains unclear. Sixteen patients with proven chronic bird-related HP with a usual interstitial pneumonia-like pattern were analyzed retrospectively. Histopathologic findings were semiquantitatively assessed and compared with clinical and radiologic findings. We also evaluated the histopathologic findings affecting prognosis. The extent of centrilobular fibrosis was negatively correlated with Pao2 (r = -0.55, P = .03). The extent of bridging fibrosis was positively correlated with the ratio of maximal expiratory flow at 50% of forced vital capacity to that at 25% (r = 0.60, P = .02). Patients with a greater extent of fibroblastic foci (FF) had more radiologic reticulation (P = .01), honeycombing (P = .01), and traction bronchiectasis (P = .02), and had significantly shorter survival time (P = .01) than patients with a lesser extent of FF. Multivariate analysis showed that the extent of FF was a significant prognostic factor (hazard ratio, 2.36; 95% confidence interval, 1.02-5.48; P = .04). Our findings demonstrated that the extent of FF was significantly associated with reticulation, honeycombing, and traction bronchiectasis on high-resolution CT scanning. Moreover, the extent of FF could be a useful predictor of mortality in chronic HP with a usual interstitial pneumonia-like pattern. Copyright © 2016 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

Automated discrimination of lower and higher grade gliomas based on histopathological image analysis.

PubMed

Mousavi, Hojjat Seyed; Monga, Vishal; Rao, Ganesh; Rao, Arvind U K

2015-01-01

Histopathological images have rich structural information, are multi-channel in nature and contain meaningful pathological information at various scales. Sophisticated image analysis tools that can automatically extract discriminative information from the histopathology image slides for diagnosis remain an area of significant research activity. In this work, we focus on automated brain cancer grading, specifically glioma grading. Grading of a glioma is a highly important problem in pathology and is largely done manually by medical experts based on an examination of pathology slides (images). To complement the efforts of clinicians engaged in brain cancer diagnosis, we develop novel image processing algorithms and systems to automatically grade glioma tumor into two categories: Low-grade glioma (LGG) and high-grade glioma (HGG) which represent a more advanced stage of the disease. We propose novel image processing algorithms based on spatial domain analysis for glioma tumor grading that will complement the clinical interpretation of the tissue. The image processing techniques are developed in close collaboration with medical experts to mimic the visual cues that a clinician looks for in judging of the grade of the disease. Specifically, two algorithmic techniques are developed: (1) A cell segmentation and cell-count profile creation for identification of Pseudopalisading Necrosis, and (2) a customized operation of spatial and morphological filters to accurately identify microvascular proliferation (MVP). In both techniques, a hierarchical decision is made via a decision tree mechanism. If either Pseudopalisading Necrosis or MVP is found present in any part of the histopathology slide, the whole slide is identified as HGG, which is consistent with World Health Organization guidelines. Experimental results on the Cancer Genome Atlas database are presented in the form of: (1) Successful detection rates of pseudopalisading necrosis and MVP regions, (2) overall classification accuracy into LGG and HGG categories, and (3) receiver operating characteristic curves which can facilitate a desirable trade-off between HGG detection and false-alarm rates. The proposed method demonstrates fairly high accuracy and compares favorably against best-known alternatives such as the state-of-the-art WND-CHARM feature set provided by NIH combined with powerful support vector machine classifier. Our results reveal that the proposed method can be beneficial to a clinician in effectively separating histopathology slides into LGG and HGG categories, particularly where the analysis of a large number of slides is needed. Our work also reveals that MVP regions are much harder to detect than Pseudopalisading Necrosis and increasing accuracy of automated image processing for MVP detection emerges as a significant future research direction.

The prognostic implications of growth-related gene product β in laryngeal squamous cell carcinoma.

PubMed

Tang, Mingming; Xu, Xinjiang; Chen, Juanjuan; Huang, Jiangfei; Jiang, Bin; Han, Liang

2017-09-01

Growth-related gene product β (GROβ) is an angiogenic chemokine that belongs to the CXC chemokine family, and a number of studies have suggested that GROβ is associated with tumor development and progression. However, a number of studies have investigated the association between GROβ expression and the clinical attributes of laryngeal squamous cell carcinoma (LSCC). In the present study, one-step quantitative polymerase chain reaction and immunohistochemistry analysis were used to detect GROβ expression and evaluate the association between its expression and the clinicopathological characteristics of LSCC. The results demonstrated that the GROβ mRNA and protein expression levels were significantly increased in LSCC compared with the corresponding non-cancerous tissues. GROβ protein expression in LSCC was associated with tumor-node-metastasis stage, lymph node metastasis and histopathological grade. The Kaplan-Meier method and Cox multi-factor analysis indicated that high GROβ expression, lymph node metastasis and histopathological grade were significantly associated with poor survival of patients with LSCC. These data indicated that GROβ may be a novel prognostic biomarker of LSCC.

Diffusion, Perfusion, and Histopathologic Characteristics of Desmoplastic Infantile Ganglioglioma.

PubMed

Ho, Chang Y; Gener, Melissa; Bonnin, Jose; Kralik, Stephen F

2016-07-01

We present a case series of a rare tumor, the desmoplastic infantile ganglioglioma (DIG) with MRI diffusion and perfusion imaging quantification as well as histopathologic characterization. Four cases with pathologically-proven DIG had diffusion weighted imaging (DWI) and two of the four had dynamic susceptibility contrast imaging. All four tumors demonstrate DWI findings compatible with low-grade pediatric tumors. For the two cases with perfusion imaging, a higher relative cerebral blood volume was associated with higher proliferation index on histopathology for one of the cases. Our results are discussed in conjunction with a literature review.

Diffusion, Perfusion, and Histopathologic Characteristics of Desmoplastic Infantile Ganglioglioma

PubMed Central

Ho, Chang Y; Gener, Melissa; Bonnin, Jose; Kralik, Stephen F

2016-01-01

We present a case series of a rare tumor, the desmoplastic infantile ganglioglioma (DIG) with MRI diffusion and perfusion imaging quantification as well as histopathologic characterization. Four cases with pathologically-proven DIG had diffusion weighted imaging (DWI) and two of the four had dynamic susceptibility contrast imaging. All four tumors demonstrate DWI findings compatible with low-grade pediatric tumors. For the two cases with perfusion imaging, a higher relative cerebral blood volume was associated with higher proliferation index on histopathology for one of the cases. Our results are discussed in conjunction with a literature review. PMID:27761184

Assessment of nerve regeneration across nerve allografts treated with tacrolimus.

PubMed

Haisheng, Han; Songjie, Zuo; Xin, Li

2008-01-01

Although regeneration of nerve allotransplant is a major concern in the clinic, there have been few papers quantitatively assessing functional recovery of animals' nerve allografts in the long term. In this study, functional recovery, histopathological study, and immunohistochemistry changes of rat nerve allograft with FK506 were investigated up to 12 weeks without slaughtering. C57 and SD rats were used for transplantation. The donor's nerve was sliced and transplanted into the recipient. The sciatic nerve was epineurally sutured with 10-0 nylon. In total, 30 models of transplantation were performed and divided into 3 groups that were either treated with FK506 or not. Functional recovery of the grafted nerve was serially assessed by the pin click test, walking track analysis and electrophysiological evaluations. A histopathological study and immunohistochemistry study were done in the all of the models. Nerve allografts treated with FK506 have no immune rejection through 12 weeks. Sensibility had similarly improved in both isografts and allografts. There has been no difference in each graft. Walk track analysis demonstrates significant recovery of motor function of the nerve graft. No histological results of difference were found up to 12 weeks in each graft. In the rodent nerve graft model, FK506 prevented nerve allograft rejection across a major histocompatibility barrier. Sensory recovery seems to be superior to motor function. Nerve isograft and allograft treated with FK506 have no significant difference in function recovery, histopathological result, and immunohistochemistry changes.

Quantification of Liver Proton-Density Fat Fraction in an 7.1 Tesla preclinical MR Systems: Impact of the Fitting Technique

PubMed Central

Mahlke, C; Hernando, D; Jahn, C; Cigliano, A; Ittermann, T; Mössler, A; Kromrey, ML; Domaska, G; Reeder, SB; Kühn, JP

2016-01-01

Purpose To investigate the feasibility of estimating the proton-density fat fraction (PDFF) using a 7.1 Tesla magnetic resonance imaging (MRI) system and to compare the accuracy of liver fat quantification using different fitting approaches. Materials and Methods Fourteen leptin-deficient ob/ob mice and eight intact controls were examined in a 7.1 Tesla animal scanner using a 3-dimensional six-echo chemical shift-encoded pulse sequence. Confounder-corrected PDFF was calculated using magnitude (magnitude data alone) and combined fitting (complex and magnitude data). Differences between fitting techniques were compared using Bland-Altman analysis. In addition, PDFFs derived with both reconstructions were correlated with histopathological fat content and triglyceride mass fraction using linear regression analysis. Results The PDFFs determined with use of both reconstructions correlated very strongly (r=0.91). However, small mean bias between reconstructions demonstrated divergent results (3.9%; CI 2.7%-5.1%). For both reconstructions, there was linear correlation with histopathology (combined fitting: r=0.61; magnitude fitting: r=0.64) and triglyceride content (combined fitting: r=0.79; magnitude fitting: r=0.70). Conclusion Liver fat quantification using the PDFF derived from MRI performed at 7.1 Tesla is feasible. PDFF has strong correlations with histopathologically determined fat and with triglyceride content. However, small differences between PDFF reconstruction techniques may impair the robustness and reliability of the biomarker at 7.1 Tesla. PMID:27197806

Epithelium-Stroma Classification via Convolutional Neural Networks and Unsupervised Domain Adaptation in Histopathological Images.

PubMed

Huang, Yue; Zheng, Han; Liu, Chi; Ding, Xinghao; Rohde, Gustavo K

2017-11-01

Epithelium-stroma classification is a necessary preprocessing step in histopathological image analysis. Current deep learning based recognition methods for histology data require collection of large volumes of labeled data in order to train a new neural network when there are changes to the image acquisition procedure. However, it is extremely expensive for pathologists to manually label sufficient volumes of data for each pathology study in a professional manner, which results in limitations in real-world applications. A very simple but effective deep learning method, that introduces the concept of unsupervised domain adaptation to a simple convolutional neural network (CNN), has been proposed in this paper. Inspired by transfer learning, our paper assumes that the training data and testing data follow different distributions, and there is an adaptation operation to more accurately estimate the kernels in CNN in feature extraction, in order to enhance performance by transferring knowledge from labeled data in source domain to unlabeled data in target domain. The model has been evaluated using three independent public epithelium-stroma datasets by cross-dataset validations. The experimental results demonstrate that for epithelium-stroma classification, the proposed framework outperforms the state-of-the-art deep neural network model, and it also achieves better performance than other existing deep domain adaptation methods. The proposed model can be considered to be a better option for real-world applications in histopathological image analysis, since there is no longer a requirement for large-scale labeled data in each specified domain.

Loss of SPEF2 Function in Mice Results in Spermatogenesis Defects and Primary Ciliary Dyskinesia1

PubMed Central

Sironen, Anu; Kotaja, Noora; Mulhern, Howard; Wyatt, Todd A.; Sisson, Joseph H.; Pavlik, Jacqueline A.; Miiluniemi, Mari; Fleming, Mark D.; Lee, Lance

2011-01-01

Primary ciliary dyskinesia (PCD) results from defects in motile cilia function. Mice homozygous for the mutation big giant head (bgh) have several abnormalities commonly associated with PCD, including hydrocephalus, male infertility, and sinusitis. In the present study, we use a variety of histopathological and cell biological techniques to characterize the bgh phenotype, and we identify the bgh mutation using a positional cloning approach. Histopathological, immunofluorescence, and electron microscopic analyses demonstrate that the male infertility results from shortened flagella and disorganized axonemal and accessory structures in elongating spermatids and mature sperm. In addition, there is a reduced number of elongating spermatids during spermatogenesis and mature sperm in the epididymis. Histological analyses show that the hydrocephalus is characterized by severe dilatation of the lateral ventricles and that bgh sinuses have an accumulation of mucus infiltrated by neutrophils. In contrast to the sperm phenotype, electron microscopy demonstrates that mutant respiratory epithelial cilia are ultrastructurally normal, but video microscopic analysis shows that their beat frequency is lower than that of wild-type cilia. Through a positional cloning approach, we identified two sequence variants in the gene encoding sperm flagellar protein 2 (SPEF2), which has been postulated to play an important role in spermatogenesis and flagellar assembly. A causative nonsense mutation was validated by Western blot analysis, strongly suggesting that the bgh phenotype results from the loss of SPEF2 function. Taken together, the data in this study demonstrate that SPEF2 is required for cilia function and identify a new genetic cause of PCD in mice. PMID:21715716

Maximized Inter-Class Weighted Mean for Fast and Accurate Mitosis Cells Detection in Breast Cancer Histopathology Images.

PubMed

Nateghi, Ramin; Danyali, Habibollah; Helfroush, Mohammad Sadegh

2017-08-14

Based on the Nottingham criteria, the number of mitosis cells in histopathological slides is an important factor in diagnosis and grading of breast cancer. For manual grading of mitosis cells, histopathology slides of the tissue are examined by pathologists at 40× magnification for each patient. This task is very difficult and time-consuming even for experts. In this paper, a fully automated method is presented for accurate detection of mitosis cells in histopathology slide images. First a method based on maximum-likelihood is employed for segmentation and extraction of mitosis cell. Then a novel Maximized Inter-class Weighted Mean (MIWM) method is proposed that aims at reducing the number of extracted non-mitosis candidates that results in reducing the false positive mitosis detection rate. Finally, segmented candidates are classified into mitosis and non-mitosis classes by using a support vector machine (SVM) classifier. Experimental results demonstrate a significant improvement in accuracy of mitosis cells detection in different grades of breast cancer histopathological images.

Development of a Reference Image Collection Library for Histopathology Image Processing, Analysis and Decision Support Systems Research.

PubMed

Kostopoulos, Spiros; Ravazoula, Panagiota; Asvestas, Pantelis; Kalatzis, Ioannis; Xenogiannopoulos, George; Cavouras, Dionisis; Glotsos, Dimitris

2017-06-01

Histopathology image processing, analysis and computer-aided diagnosis have been shown as effective assisting tools towards reliable and intra-/inter-observer invariant decisions in traditional pathology. Especially for cancer patients, decisions need to be as accurate as possible in order to increase the probability of optimal treatment planning. In this study, we propose a new image collection library (HICL-Histology Image Collection Library) comprising 3831 histological images of three different diseases, for fostering research in histopathology image processing, analysis and computer-aided diagnosis. Raw data comprised 93, 116 and 55 cases of brain, breast and laryngeal cancer respectively collected from the archives of the University Hospital of Patras, Greece. The 3831 images were generated from the most representative regions of the pathology, specified by an experienced histopathologist. The HICL Image Collection is free for access under an academic license at http://medisp.bme.teiath.gr/hicl/ . Potential exploitations of the proposed library may span over a board spectrum, such as in image processing to improve visualization, in segmentation for nuclei detection, in decision support systems for second opinion consultations, in statistical analysis for investigation of potential correlations between clinical annotations and imaging findings and, generally, in fostering research on histopathology image processing and analysis. To the best of our knowledge, the HICL constitutes the first attempt towards creation of a reference image collection library in the field of traditional histopathology, publicly and freely available to the scientific community.

Texture analysis of tissues in Gleason grading of prostate cancer

NASA Astrophysics Data System (ADS)

Alexandratou, Eleni; Yova, Dido; Gorpas, Dimitris; Maragos, Petros; Agrogiannis, George; Kavantzas, Nikolaos

2008-02-01

Prostate cancer is a common malignancy among maturing men and the second leading cause of cancer death in USA. Histopathological grading of prostate cancer is based on tissue structural abnormalities. Gleason grading system is the gold standard and is based on the organization features of prostatic glands. Although Gleason score has contributed on cancer prognosis and on treatment planning, its accuracy is about 58%, with this percentage to be lower in GG2, GG3 and GG5 grading. On the other hand it is strongly affected by "inter- and intra observer variations", making the whole process very subjective. Therefore, there is need for the development of grading tools based on imaging and computer vision techniques for a more accurate prostate cancer prognosis. The aim of this paper is the development of a novel method for objective grading of biopsy specimen in order to support histopathological prognosis of the tumor. This new method is based on texture analysis techniques, and particularly on Gray Level Co-occurrence Matrix (GLCM) that estimates image properties related to second order statistics. Histopathological images of prostate cancer, from Gleason grade2 to Gleason grade 5, were acquired and subjected to image texture analysis. Thirteen texture characteristics were calculated from this matrix as they were proposed by Haralick. Using stepwise variable selection, a subset of four characteristics were selected and used for the description and classification of each image field. The selected characteristics profile was used for grading the specimen with the multiparameter statistical method of multiple logistic discrimination analysis. The subset of these characteristics provided 87% correct grading of the specimens. The addition of any of the remaining characteristics did not improve significantly the diagnostic ability of the method. This study demonstrated that texture analysis techniques could provide valuable grading decision support to the pathologists, concerning prostate cancer prognosis.

In vivo hepatic differentiation potential of human umbilical cord-derived mesenchymal stem cells: Therapeutic effect on liver fibrosis/cirrhosis.

PubMed

Zhang, Guo-Zun; Sun, Hui-Cong; Zheng, Li-Bo; Guo, Jin-Bo; Zhang, Xiao-Lan

2017-12-14

To investigate the hepatic differentiation potential of human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) and to evaluate their therapeutic effect on liver fibrosis/cirrhosis. A CCl 4 -induced liver fibrotic/cirrhotic rat model was used to assess the effect of hUC-MSCs. Histopathology was assessed by hematoxylin and eosin (H&E), Masson trichrome and Sirius red staining. The liver biochemical profile was measured using a Beckman Coulter analyzer. Expression analysis was performed using immunofluorescent staining, immunohistochemistry, Western blot, and real-time PCR. We demonstrated that the infused hUC-MSCs could differentiate into hepatocytes in vivo . Functionally, the transplantation of hUC-MSCs to CCl 4 -treated rats improved liver transaminases and synthetic function, reduced liver histopathology and reversed hepatobiliary fibrosis. The reversal of hepatobiliary fibrosis was likely due to the reduced activation state of hepatic stellate cells, decreased collagen deposition, and enhanced extracellular matrix remodeling via the up-regulation of MMP-13 and down-regulation of TIMP-1. Transplanted hUC-MSCs could differentiate into functional hepatocytes that improved both the biochemical and histopathologic changes in a CCl 4 -induced rat liver fibrosis model. hUC-MSCs may offer therapeutic opportunities for treating hepatobiliary diseases, including cirrhosis.

In vivo hepatic differentiation potential of human umbilical cord-derived mesenchymal stem cells: Therapeutic effect on liver fibrosis/cirrhosis

PubMed Central

Zhang, Guo-Zun; Sun, Hui-Cong; Zheng, Li-Bo; Guo, Jin-Bo; Zhang, Xiao-Lan

2017-01-01

AIM To investigate the hepatic differentiation potential of human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) and to evaluate their therapeutic effect on liver fibrosis/cirrhosis. METHODS A CCl4-induced liver fibrotic/cirrhotic rat model was used to assess the effect of hUC-MSCs. Histopathology was assessed by hematoxylin and eosin (H&E), Masson trichrome and Sirius red staining. The liver biochemical profile was measured using a Beckman Coulter analyzer. Expression analysis was performed using immunofluorescent staining, immunohistochemistry, Western blot, and real-time PCR. RESULTS We demonstrated that the infused hUC-MSCs could differentiate into hepatocytes in vivo. Functionally, the transplantation of hUC-MSCs to CCl4-treated rats improved liver transaminases and synthetic function, reduced liver histopathology and reversed hepatobiliary fibrosis. The reversal of hepatobiliary fibrosis was likely due to the reduced activation state of hepatic stellate cells, decreased collagen deposition, and enhanced extracellular matrix remodeling via the up-regulation of MMP-13 and down-regulation of TIMP-1. CONCLUSION Transplanted hUC-MSCs could differentiate into functional hepatocytes that improved both the biochemical and histopathologic changes in a CCl4-induced rat liver fibrosis model. hUC-MSCs may offer therapeutic opportunities for treating hepatobiliary diseases, including cirrhosis. PMID:29290652

Location of injected polymethylmethacrylate microspheres influences the onset of late adverse effects: an experimental and histopathologic study

PubMed Central

de Jesus, Luciano Henrique; de Campos Hildebrand, Laura; Martins, Manoela Domingues; da Rosa, Francinne Miranda; Danilevicz, Chris Krebs; Sant’Ana Filho, Manoel

2015-01-01

Polymethylmethacrylate (PMMA) has been widely used in the correction of wrinkles because of its long-lasting cosmetic improvements. However, side effects and complications may occur, and its clinical appearance on the oral mucosa can be similar to that of inflammatory or neoplastic disease. The aim of this research was to compare the clinical and histopathologic responses to PMMA injected by two different methods. Twenty-two rats received an injection of PMMA using the tunneling technique (gold standard), with subcutaneous deposition of the filler in the face, or a variation of the technique with transcutaneous submucosal deposition of the filler in the cheek. The tissue reaction was analyzed clinically every 24 hours during the first week, then once a week for the following 3 months. Histologic evaluation was based on the local inflammatory response to the filler. No clinical changes were observed during the initial evaluation period (0–14 days). After 14 days, only the submucosal group showed extra-oral enlargement (n=4, 18.2%). Histopathologic analysis revealed nodule formation in four animals (18.2%) in the submucosal group, with no nodules observed in the subcutaneous group. The data obtained in this study demonstrate that the technique used to deliver the filler may influence the risk of adverse reactions. PMID:26346665

Two patterns of solar lentigines: a histopathological analysis of 40 Japanese women.

PubMed

Yonei, Nozomi; Kaminaka, Chikako; Kimura, Ayako; Furukawa, Fukumi; Yamamoto, Yuki

2012-10-01

Solar lentigines are common acquired pigmented lesions on sun-exposed skin. Their histopathological features have been reported as large numbers of melanocytes at the base of clubbed and budding rete ridges. In this study, biopsies were taken from facial solar lentigines in 40 Japanese women, and the sections were stained using hematoxylin-eosin, Fontana-Masson, and immunostained for melanocytes and Langerhans cells in order to verify the histological patterns of Japanese patients. We characterized the histopathological features of solar lentigines on the face and identified two patterns: one pattern (20/40 cases) demonstrated a flattened epidermis with basal melanosis, and the other pattern (20/40 cases) showed epidermal hyperplasia with elongated rete ridges composed of deeply pigmented basaloid cells. We termed the former pattern the "flattened epidermis" group, and the latter the "budding" group, respectively. The flattened epidermis group showed a significantly thinner epidermis, more severe solar elastosis and fewer Langerhans cells in the epidermis as compared with the budding group. We concluded that more severely sun-damaged solar lentigines might show the changes observed in the flattened epidermis group. Langerhans cells in the epidermis of solar lentigines might play a role in the remission of postinflammatory pigmentation due to aesthetic treatment. © 2012 Japanese Dermatological Association.

Hemangiopericytoma in a young dog: Evaluation of histopathological and immunohistochemical features.

PubMed

Namazi, Fatemeh; Abbaszadeh Hasiri, Mohammad; Oryan, Ahmad; Moshiri, Ali

2014-01-01

In the present study, we describe a subcutaneous mass between the left flank and hip in a 2-year-old male Great Dane dog. Histopathologically, cells appeared to be spindle shaped around a central capillary together with a fingerprint pattern. Immunohistochemical analysis presented that the neoplastic cells expressed vimentin, but did not stain for S-100 protein. On the basis of histopathology and immunohistochemical findings, the present tumor was diagnosed as canine hemangiopericytoma. Hemangiopericytoma could be considered in differential diagnosis list of any mass in the skin (even in young dogs) and must be identified histopathologically.

Hemangiopericytoma in a young dog: Evaluation of histopathological and immunohistochemical features

PubMed Central

Namazi, Fatemeh; Abbaszadeh Hasiri, Mohammad; Oryan, Ahmad; Moshiri, Ali

2014-01-01

In the present study, we describe a subcutaneous mass between the left flank and hip in a 2-year-old male Great Dane dog. Histopathologically, cells appeared to be spindle shaped around a central capillary together with a fingerprint pattern. Immunohistochemical analysis presented that the neoplastic cells expressed vimentin, but did not stain for S-100 protein. On the basis of histopathology and immunohistochemical findings, the present tumor was diagnosed as canine hemangiopericytoma. Hemangiopericytoma could be considered in differential diagnosis list of any mass in the skin (even in young dogs) and must be identified histopathologically. PMID:25568712

Histopathology reveals correlative and unique phenotypes in a high-throughput mouse phenotyping screen

PubMed Central

Adissu, Hibret A.; Estabel, Jeanne; Sunter, David; Tuck, Elizabeth; Hooks, Yvette; Carragher, Damian M.; Clarke, Kay; Karp, Natasha A.; Project, Sanger Mouse Genetics; Newbigging, Susan; Jones, Nora; Morikawa, Lily; White, Jacqueline K.; McKerlie, Colin

2014-01-01

The Mouse Genetics Project (MGP) at the Wellcome Trust Sanger Institute aims to generate and phenotype over 800 genetically modified mouse lines over the next 5 years to gain a better understanding of mammalian gene function and provide an invaluable resource to the scientific community for follow-up studies. Phenotyping includes the generation of a standardized biobank of paraffin-embedded tissues for each mouse line, but histopathology is not routinely performed. In collaboration with the Pathology Core of the Centre for Modeling Human Disease (CMHD) we report the utility of histopathology in a high-throughput primary phenotyping screen. Histopathology was assessed in an unbiased selection of 50 mouse lines with (n=30) or without (n=20) clinical phenotypes detected by the standard MGP primary phenotyping screen. Our findings revealed that histopathology added correlating morphological data in 19 of 30 lines (63.3%) in which the primary screen detected a phenotype. In addition, seven of the 50 lines (14%) presented significant histopathology findings that were not associated with or predicted by the standard primary screen. Three of these seven lines had no clinical phenotype detected by the standard primary screen. Incidental and strain-associated background lesions were present in all mutant lines with good concordance to wild-type controls. These findings demonstrate the complementary and unique contribution of histopathology to high-throughput primary phenotyping of mutant mice. PMID:24652767

Epidural application of spinal instrumentation particulate wear debris: a comprehensive evaluation of neurotoxicity using an in vivo animal model.

PubMed

Cunningham, Bryan W; Hallab, Nadim J; Hu, Nianbin; McAfee, Paul C

2013-09-01

The introduction and utilization of motion-preserving implant systems for spinal reconstruction served as the impetus for this basic scientific investigation. The effect of unintended wear particulate debris resulting from micromotion at spinal implant interconnections and bearing surfaces remains a clinical concern. Using an in vivo rabbit model, the current study quantified the neural and systemic histopathological responses following epidural application of 11 different types of medical-grade particulate wear debris produced from spinal instrumentation. A total of 120 New Zealand White rabbits were equally randomized into 12 groups based on implant treatment: 1) sham (control), 2) stainless steel, 3) titanium alloy, 4) cobalt chromium alloy, 5) ultra-high molecular weight polyethylene (UHMWPe), 6) ceramic, 7) polytetrafluoroethylene, 8) polycarbonate urethane, 9) silicone, 10) polyethylene terephthalate, 11) polyester, and 12) polyetheretherketone. The surgical procedure consisted of a midline posterior approach followed by resection of the L-6 spinous process and L5-6 ligamentum flavum, permitting interlaminar exposure of the dural sac. Four milligrams of the appropriate treatment material (Groups 2-12) was then implanted onto the dura in a dry, sterile format. All particles (average size range 0.1-50 μm in diameter) were verified to be endotoxin free prior to implantation. Five animals from each treatment group were sacrificed at 3 months and 5 were sacrificed at 6 months postoperatively. Postmortem analysis included epidural cultures and histopathological assessment of local and systemic tissue samples. Immunocytochemical analysis of the spinal cord and overlying epidural fibrosis quantified the extent of proinflammatory cytokines (tumor necrosis factor-α, tumor necrosis factor-β, interleukin [IL]-1α, IL-1β, and IL-6) and activated macrophages. Epidural cultures were negative for nearly all cases, and there was no evidence of particulate debris or significant histopathological changes in the systemic tissues. Gross histopathological examination demonstrated increased levels of epidural fibrosis in the experimental treatment groups compared with the control group. Histopathological evaluation of the epidural fibrous tissues showed evidence of a histiocytic reaction containing phagocytized inert particles and foci of local inflammatory reactions. At 3 months, immunohistochemical examination of the spinal cord and epidural tissues demonstrated upregulation of IL-6 in the groups in which metallic and UHMWPe debris were implanted (p < 0.05), while macrophage activity levels were greatest in the stainless-steel and UHMWPe groups (p < 0.05). By 6 months, the levels of activated cytokines and macrophages in nearly all experimental cases were downregulated and not significantly different from those of the operative controls (p > 0.05). The spinal cord had no evidence of lesions or neuropathology. However, multiple treatments in the metallic groups exhibited a mild, chronic macrophage response to particulate debris, which had diffused intrathecally. Epidural application of spinal instrumentation particulate wear debris elicits a chronic histiocytic reaction localized primarily within the epidural fibrosis. Particles have the capacity to diffuse intrathecally, eliciting a transient upregulation in macrophage/cytokine activity response within the epidural fibrosis. Overall, based on the time periods evaluated, there was no evidence of an acute neural or systemic histopathological response to the materials included in the current project.

Morphological and immunohistochemical analysis of apoptosis in the cerebellum of rats subjected to focal cerebral ischemia with or without alcoholism model.

PubMed

Carvalho, Camila Albuquerque Melo de; Tirapelli, Daniela Pretti da Cunha; Rodrigues, Andressa Romualdo; Lizarte, Fermino Sanches; Novais, Paulo Cézar; Silva, Jairo Pinheiro; Carlotti, Carlos Gilberto; Colli, Benedicto Oscar; Tirapelli, Luís Fernando

2016-09-01

To evaluated histopathological changes, morphometric and expression of proteins CASPASE-3, BCL-2 and XIAP related to apoptosis in the cerebellum after induction of temporary focal cerebral ischemia followed by reperfusion, with or without a model of chronic alcoholism. Fifty Wistar rats were used and divided into: control group (C), sham group (S), ischemic group (I), alcoholic group (A), and ischemic and alcoholic group (IA). The cerebellum samples collected were stained for histopathological and morphometric analysis and immunohistochemistry study. Histopathological changes were observed a greater degree in animals in groups A and IA. The morphometric study showed no difference in the amount of cells in the granular layer of the cerebellum between the groups. The expression of CASPASE-3 was higher than BCL-2 and XIAP in the groups A and IA. We observed correlation between histopathological changes and the occurrence of apoptosis in cerebellar cortex.

Preliminary study of the biomechanical behavior and physical characteristics of tantalum (Ta)-coated prostheses.

PubMed

Duan, Yonghong; Liu, Lie; Wang, Ling; Guo, Fei; Li, Haoping; Shi, Lei; Li, Mao; Yin, Dayu; Jiang, Chi; Zhu, Qingsheng

2012-03-01

Use of Ta biomaterials in medicine started in the middle of the last century. The good biocompatibility and chemical stability, and the unique physical characteristics of Ta metal have resulted in many possible developments of Ta biomaterials. In this study, histopathological observation, histomorphometric analysis, scanning electron microscope (SEM) observation, energy-dispersive X-ray spectroscopy (EDX) analysis, biomechanical testing, and examination of the coating's mechanical strength have been used to evaluate the value of clinical application of Ta-coated prostheses prepared by a plasma-spraying process. Histopathological observation has demonstrated that the periprosthetic new bone tissues tightly and stably adhere to the Ta coating after the implantation, with no signs of loosening. Early after implantation, there is no significant difference in periprosthetic bone volume and ultimate shear strength between Ta-coated and Ti-coated prostheses (P > 0.05). EDX analysis suggests that the ultimate shear stress does not damage Ta coating. Mechanical strength testing shows that the adhesive strength and Vicker's surface hardness (HV) of the Ta coating are significantly higher than those of the Ti coating (P < 0.01). Ta coating has good stability and bone biocompatibility; the extraordinary physical characteristics of Ta coating have great significance in maintaining prosthetic stability and surface porosity after implantation.

[MRT of the liver in Wilson's disease].

PubMed

Vogl, T J; Steiner, S; Hammerstingl, R; Schwarz, S; Kraft, E; Weinzierl, M; Felix, R

1994-01-01

To show that Wilson's disease is one likely cause of multiple low-intensity nodules of the liver we obtained MR images in 16 patients with clinically and histopathologically confirmed Wilson's disease. Corresponding to morphological changes MRI enabled the subdivision of the patients into two groups. Using a T2-weighted spin-echo sequence (TR/TE = 2000/45-90) liver parenchyma showed multiple tiny low-intensity-nodules surrounded by high-intensity septa in 10 out of 16 patients. 5 patients had also low-intensity nodules in T1-weighted images (TR/TE = 600/20). In patients of this group histopathology revealed liver cirrhosis (n = 7) and fibrosis (n = 2). Common feature of this patient group was marked inflammatory cell infiltration into fibrous septa, increase of copper concentration in liver parenchyma and distinct pathological changes of laboratory data. In the remaining 6 patients no pathological change of liver morphology was demonstrated by MRI corresponding to slight histopathological changes of parenchyma and normal laboratory data. As low-intensity nodules surrounded by high intensity septa can be demonstrated in patients with marked inflammatory infiltration of liver parenchyma MRI may help to define Wilson patients with poorer prognosis. In patients with low-intensity nodules of the liver and unknown cause of liver cirrhosis laboratory data and histopathology should be checked when searching for disorders of copper metabolism.

Neuroradiology and histopathology in two cases of adult medulloblastoma.

PubMed

Romero-Rojas, Alfredo E; Diaz-Perez, Julio A; Raju, Sharat; Lozano-Castillo, Alfonso

2014-04-01

Medulloblastoma (MB) is the most common central nervous system neoplasm in children and only rarely presents in the adult population. Recent molecular biology findings have characterized MB as a heterogeneous neoplasm distinguished by well-defined tumour subsets each with specific histologic and molecular features. Available immunohistochemical stains can now be used to differentiate the distinct molecular types of MB. This report analyzed the histopathologic and neuroradiologic features of two new cases of adult MB. Imaging studies in these patients revealed the morphological appearance of high-grade, well-circumscribed heterogeneous tumours with necrosis, located laterally within the posterior cranial fossa. Histopathology of resected samples demonstrated high-grade tumours (WHO grade IV) containing sheets of undifferentiated neural cells with high mitotic activity and evidence of necrosis. The histopathologic and molecular characteristics of these cases of MB are reviewed for potential applications in new molecular methods of imaging.

Pulmonary Abnormalities in Mice with Paracoccidioidomycosis: A Sequential Study Comparing High Resolution Computed Tomography and Pathologic Findings

PubMed Central

Hidalgo, José Miguel; de Oliveira Pascarelli, Bernardo Miguel; Patiño, Jairo Hernando; Lenzi, Henrique Leonel; Restrepo, Angela; Cano, Luz Elena

2010-01-01

Background Human paracoccidioidomycosis (PCM) is an endemic fungal disease of pulmonary origin. Follow-up of pulmonary lesions by image studies in an experimental model of PCM has not been previously attempted. This study focuses on defining patterns, topography and intensity of lung lesions in experimentally infected PCM mice by means of a comparative analysis between High Resolution Computed Tomography (HRCT) and histopathologic parameters. Methodology Male BALB/c mice were intranasally inoculated with 3×106 Paracoccidioides brasiliensis (Pb) conidia (n = 50) or PBS (n = 50). HRCT was done every four weeks to determine pulmonary lesions, quantify lung density, reconstruct and quantify lung air structure. Lungs were also analyzed by histopathology and histomorphometry. Results Three different patterns of lesions were evidenced by HRCT and histopathology, as follows: nodular-diffuse, confluent and pseudo-tumoral. The lesions were mainly located around the hilus and affected more frequently the left lung. At the 4th week post-challenge HRCT showed that 80% of the Pb-infected mice had peri-bronchial consolidations associated with a significant increase in upper lung density when compared with controls, (−263±25 vs. −422±10 HU, p<0.001). After the 8th and 12th weeks, consolidation had progressed involving also the middle regions. Histopathology revealed that consolidation as assessed by HRCT was equivalent histologically to a confluent granulomatous reaction, while nodules corresponded to individual compact granulomas. At the 16th week of infection, confluent granulomas formed pseudotumoral masses that obstructed large bronchi. Discrete focal fibrosis was visible gradually around granulomas, but this finding was only evident by histopathology. Conclusions/Significance This study demonstrated that conventional HRCT is a useful tool for evaluation and quantification of pulmonary damage occurring in experimental mouse PCM. The experimental design used decreases the need to sacrifice a large number of animals, and serves to monitor treatment efficacy by means of a more rational approach to the study of human lung disease. PMID:20614019

An open label trial of folate receptor-targeted intraoperative molecular imaging to localize pulmonary squamous cell carcinomas

PubMed Central

Predina, Jarrod D.; Newton, Andrew D.; Xia, Leilei; Corbett, Christopher; Connolly, Courtney; Shin, Michael; Sulyok, Lydia Frezel; Litzky, Leslie; Deshpande, Charuhas; Nie, Shuming; Kularatne, Sumith A.; Low, Philip S.; Singhal, Sunil

2018-01-01

Background Clinical applicability of folate receptor-targeted intraoperative molecular imaging (FR-IMI) has been established for surgically resectable pulmonary adenocarcinoma. A role for FR-IMI in other lung cancer histologies has not been studied. In this study, we evaluate feasibility of FR-IMI in patients undergoing pulmonary resection for squamous cell carcinomas (SCCs). Methods In a human clinical trial (NCT02602119), twelve subjects with pulmonary SCCs underwent FR-IMI with a near-infrared contrast agent that targets the folate receptor-α (FRα), OTL38. Near-infrared signal from tumors and benign lung was quantified to calculate tumor-to-background ratios (TBR). Folate receptor-alpha expression was characterized, and histopathologic correlative analyses were performed to evaluate patterns of OTL38 accumulation. An exploratory analysis was performed to determine patient and histopathologic variables that predict tumor fluorescence. Results 9 of 13 SCCs (in 9 of 12 of subjects) displayed intraoperative fluorescence upon NIR evaluation (median TBR, 3.9). OTL38 accumulated within SCCs in a FRα-dependent manner. FR-IMI was reliable in localizing nodules as small as 1.1 cm, and prevented conversion to thoracotomy for nodule localization in three subjects. Upon evaluation of patient and histopathologic variables, in situ fluorescence was associated with distance from the pleural surface, and was independent of alternative variables including tumor size and metabolic activity. Conclusions This work demonstrates that FR-IMI is potentially feasible in 70% of SCC patients, and that molecular imaging can improve localization during minimally invasive pulmonary resection. These findings complement previous data demonstrating that ∼98% of pulmonary adenocarcinomas are localized during FR-IMI and suggest broad applicability for NSCLC patients undergoing resection. PMID:29568374

Comparative evaluation of immunohistochemistry, histopathology and conventional radiography in differentiating periapical lesions.

PubMed

Saraf, Prahlad A; Kamat, Sharad; Puranik, R S; Puranik, Surekha; Saraf, Suma P; Singh, Bhanu Pratap

2014-03-01

Periapical lesions often present differently on the radiograph resulting in a dilemma in the mind of the dentist to arrive at a final diagnosis. Although, histopathologic diagnosis has been used for confirmation of the true nature of periapical lesion, the concept of transformation of periapical granulomas containing epithelium without cystification into cyst remains controversial. The aim of this in vivo study was to evaluate the efficacy of conventional radiography and histopathology in differentiating periapical lesions in adjunct with immunohistochemical analysis. Periapical lesions often present differently on the radiograph resulting in a dilemma in the mind of the dentist to arrive at a final diagnosis. Although, histopathologic diagnosis has been used for confirmation of the true nature of periapical lesion, the concept of transformation of periapical granulomas containing epithelium without cystification into cyst remains controversial. The aim of this in vivo study was to evaluate the efficacy of conventional radiography and histopathology in differentiating periapical lesions in adjunct with immunohistochemical analysis. Thirty patients having large periapical radiolucency that do not heal successfully with routine endodontic therapy in relation to either maxillary or mandibular anterior teeth were selected for the study. Intraoral periapical radiographs were obtained and provisional diagnosis of the apical areas were made. Endodontic surgery was performed to enable histopathogical investigation. The histopathological interpretation was done to arrive at a final diagnosis and selected questionable granulomas were subjected for cytokeratin (CK-14) stain. The histopathological profile of lesions consisted of 66.66% periapical granulomas, 10% cysts, 6.67% abscess and 16.67% granulomas with cystic potential. The radiographic and histopathologic correlation was found in only 30% of these cases. Strong CK-14 expression was observed in all five cases of periapical granuloma with cystic potential. The radiographic diagnosis of periapical lesions remains inconclusive. Although histopathologic examination of periapical lesions gives true nature, the precise nature of subsets of periapical granulomas may be achieved with adjunct use of immunohistochemical markers.

Comparative evaluation of immunohistochemistry, histopathology and conventional radiography in differentiating periapical lesions

PubMed Central

Saraf, Prahlad A; Kamat, Sharad; Puranik, R S; Puranik, Surekha; Saraf, Suma P; Singh, Bhanu Pratap

2014-01-01

Background and Aim: Periapical lesions often present differently on the radiograph resulting in a dilemma in the mind of the dentist to arrive at a final diagnosis. Although, histopathologic diagnosis has been used for confirmation of the true nature of periapical lesion, the concept of transformation of periapical granulomas containing epithelium without cystification into cyst remains controversial. The aim of this in vivo study was to evaluate the efficacy of conventional radiography and histopathology in differentiating periapical lesions in adjunct with immunohistochemical analysis. Aim: Periapical lesions often present differently on the radiograph resulting in a dilemma in the mind of the dentist to arrive at a final diagnosis. Although, histopathologic diagnosis has been used for confirmation of the true nature of periapical lesion, the concept of transformation of periapical granulomas containing epithelium without cystification into cyst remains controversial. The aim of this in vivo study was to evaluate the efficacy of conventional radiography and histopathology in differentiating periapical lesions in adjunct with immunohistochemical analysis. Materials and Method: Thirty patients having large periapical radiolucency that do not heal successfully with routine endodontic therapy in relation to either maxillary or mandibular anterior teeth were selected for the study. Intraoral periapical radiographs were obtained and provisional diagnosis of the apical areas were made. Endodontic surgery was performed to enable histopathogical investigation. The histopathological interpretation was done to arrive at a final diagnosis and selected questionable granulomas were subjected for cytokeratin (CK-14) stain. Results: The histopathological profile of lesions consisted of 66.66% periapical granulomas, 10% cysts, 6.67% abscess and 16.67% granulomas with cystic potential. The radiographic and histopathologic correlation was found in only 30% of these cases. Strong CK-14 expression was observed in all five cases of periapical granuloma with cystic potential. Conclusion: The radiographic diagnosis of periapical lesions remains inconclusive. Although histopathologic examination of periapical lesions gives true nature, the precise nature of subsets of periapical granulomas may be achieved with adjunct use of immunohistochemical markers. PMID:24778515

ESWT and alendronate sodium demonstrate equal protective effects in osteoarthritis of the knee

NASA Astrophysics Data System (ADS)

Wang, Ching-Jen; Chou, Wen-Yi; Hsu, Shan-Ling; Huang, Chien-Yiu; Cheng, Jai-Hong

2016-01-01

This study compared the effects of extracorporeal shock wave therapy (ESWT) and alendronate sodium (alendronate) in osteoarthritis (OA) of rat knees. The control group was subjected to a sham surgery and did not receive either ESWT or alendronate treatment. The OA group underwent anterior cruciate ligament transection (ACLT) and medial meniscectomy (MM) surgery and did not receive either ESWT or alendronate. The ESWT group underwent ACLT and MM surgery and received ESWT after the surgery. The alendronate group received alendronate after ACLT and MM surgery. The evaluations included radiograph, bone mineral density (BMD), serum C-telopeptide collagen II (CTX-II), cartilage oligomeric protein (COMP), alkaline phosphatase and osteocalcin, histopathological examination and immunohistochemical analysis. Radiographs at 12 weeks showed pronounced OA changes in the OA group. The BMD values, CTX-II, COMP, alkaline phosphatase and osteocalcin showed no significant difference between ESWT and alendronate groups. In histopathology, the Mankin and Safranin O scores significantly increased in the OA, ESWT and alendronate groups, but without any significant difference between the ESWT and alendronate groups. In immunohistochemical analysis, the von Willebrand factor (vWF), vascular endothelial factor (VEGF), soluble vascular cell adhesion molecule (sVCAM), proliferating cell nuclear antigen (PCNA), bone morphogenetic protein 2 (BMP-2), and osteocalcin expressions in articular cartilage and subchondral bone showed a significant decrease in the OA group, but no difference was noted between the ESWT and alendronate groups. In conclusion, ESWT and alendronate sodium demonstrate equal protective effects from developing osteoarthritis of the knee in rats.

Unsupervised color normalisation for H and E stained histopathology image analysis

NASA Astrophysics Data System (ADS)

Celis, Raúl; Romero, Eduardo

2015-12-01

In histology, each dye component attempts to specifically characterise different microscopic structures. In the case of the Hematoxylin-Eosin (H&E) stain, universally used for routine examination, quantitative analysis may often require the inspection of different morphological signatures related mainly to nuclei patterns, but also to stroma distribution. Nevertheless, computer systems for automatic diagnosis are often fraught by color variations ranging from the capturing device to the laboratory specific staining protocol and stains. This paper presents a novel colour normalisation method for H&E stained histopathology images. This method is based upon the opponent process theory and blindly estimates the best color basis for the Hematoxylin and Eosin stains without relying on prior knowledge. Stain Normalisation and Color Separation are transversal to any Framework of Histopathology Image Analysis.

The systemic pathology of cerebral malaria in African children

PubMed Central

Milner, Danny A.; Whitten, Richard O.; Kamiza, Steve; Carr, Richard; Liomba, George; Dzamalala, Charles; Seydel, Karl B.; Molyneux, Malcolm E.; Taylor, Terrie E.

2014-01-01

Pediatric cerebral malaria carries a high mortality rate in sub-Saharan Africa. We present our systematic analysis of the descriptive and quantitative histopathology of all organs sampled from a series of 103 autopsies performed between 1996 and 2010 in Blantyre, Malawi on pediatric cerebral malaria patients and control patients (without coma, or without malaria infection) who were clinically well characterized prior to death. We found brain swelling in all cerebral malaria patients and the majority of controls. The histopathology in patients with sequestration of parasites in the brain demonstrated two patterns: (a) the “classic” appearance (i.e., ring hemorrhages, dense sequestration, and extra-erythrocytic pigment) which was associated with evidence of systemic activation of coagulation and (b) the “sequestration only” appearance associated with shorter duration of illness and higher total burden of parasites in all organs including the spleen. Sequestration of parasites was most intense in the gastrointestinal tract in all parasitemic patients (those with cerebral malarial and those without). PMID:25191643

Multi-elemental imaging of paraffin-embedded human samples by laser-induced breakdown spectroscopy

NASA Astrophysics Data System (ADS)

Moncayo, S.; Trichard, F.; Busser, B.; Sabatier-Vincent, M.; Pelascini, F.; Pinel, N.; Templier, I.; Charles, J.; Sancey, L.; Motto-Ros, V.

2017-07-01

Chemical elements play central roles for physiological homeostasis in human cells, and their dysregulation might lead to a certain number of pathologies. Novel imaging techniques that improve the work of pathologists for tissue analysis and diagnostics are continuously sought. We report the use of Laser-Induced Breakdown Spectroscopy (LIBS) to perform multi-elemental images of human paraffin-embedded skin samples on the entire biopsy scale in a complementary and compatible way with microscope histopathological examination. A specific instrumental configuration is proposed in order to detect most of the elements of medical interest (i.e. P, Al, Mg, Na, Zn, Si, Fe, and Cu). As an example of medical application, we selected and analysed skin biopsies, including healthy skin tissue, cutaneous metastasis of melanoma, Merkel-cell carcinoma and squamous cell carcinoma. Clear distinctions in the distribution of chemical elements are observed from the different samples investigated. This study demonstrates the high complementarity of LIBS elemental imaging with conventional histopathology, opening new opportunities for any medical application involving metals.

Hyperhidrosis in naïve purpose-bred beagle dogs (Canis familiaris).

PubMed

Carrier, Catherine A; Seeman, Jennifer L; Hoffmann, Guenther

2011-05-01

This case study details the unusual clinical findings in a unique paw-pad disorder that recently emerged among 2 male and 1 female naïve purpose-bred beagle dogs (Canis familiaris) newly received into our facility. During acclimation period physical examinations, the affected dogs demonstrated constantly moist, soft paw pads on all 4 feet. No information was available regarding the epidemiology and pathogenesis of this pad condition in beagle dogs. Here, we report the results of physical examination, clinical chemistry analysis, hematology, histopathology, detailed observations, and novel testing techniques performed during the acclimation period. Histopathology of several sections of affected footpads was compared with that of an age-matched dog with clinically normal paw pads. We describe the morphologic features of a distinctive cutaneous canine footpad condition and discuss the possible differential diagnoses. The histologic and clinical features were most consistent with those of hyperhidrosis; to our knowledge, this report is the first description of hyperhidrosis as a distinct condition in purpose-bred beagle dogs.

Hyperhidrosis in Naïve Purpose-Bred Beagle Dogs (Canis familiaris)

PubMed Central

Carrier, Catherine A; Seeman, Jennifer L; Hoffmann, Guenther

2011-01-01

This case study details the unusual clinical findings in a unique paw-pad disorder that recently emerged among 2 male and 1 female naïve purpose-bred beagle dogs (Canis familiaris) newly received into our facility. During acclimation period physical examinations, the affected dogs demonstrated constantly moist, soft paw pads on all 4 feet. No information was available regarding the epidemiology and pathogenesis of this pad condition in beagle dogs. Here, we report the results of physical examination, clinical chemistry analysis, hematology, histopathology, detailed observations, and novel testing techniques performed during the acclimation period. Histopathology of several sections of affected footpads was compared with that of an age-matched dog with clinically normal paw pads. We describe the morphologic features of a distinctive cutaneous canine footpad condition and discuss the possible differential diagnoses. The histologic and clinical features were most consistent with those of hyperhidrosis; to our knowledge, this report is the first description of hyperhidrosis as a distinct condition in purpose-bred beagle dogs. PMID:21640037

Breast cancer histopathology image analysis: a review.

PubMed

Veta, Mitko; Pluim, Josien P W; van Diest, Paul J; Viergever, Max A

2014-05-01

This paper presents an overview of methods that have been proposed for the analysis of breast cancer histopathology images. This research area has become particularly relevant with the advent of whole slide imaging (WSI) scanners, which can perform cost-effective and high-throughput histopathology slide digitization, and which aim at replacing the optical microscope as the primary tool used by pathologist. Breast cancer is the most prevalent form of cancers among women, and image analysis methods that target this disease have a huge potential to reduce the workload in a typical pathology lab and to improve the quality of the interpretation. This paper is meant as an introduction for nonexperts. It starts with an overview of the tissue preparation, staining and slide digitization processes followed by a discussion of the different image processing techniques and applications, ranging from analysis of tissue staining to computer-aided diagnosis, and prognosis of breast cancer patients.

Histopathologic analysis of atrial tissue in patients with atrial fibrillation: comparison between patients with atrial septal defect and patients with mitral valvular heart disease.

PubMed

Kwak, Jae Gun; Seo, Jeong-Wook; Oh, Sam Se; Lee, Sang Yun; Ham, Eui Keun; Kim, Woong-Han; Kim, Soo-Jin; Bae, Eun Jung; Lim, Cheoung; Lee, Chang-Ha; Lee, Cheul

2014-01-01

Atrial fibrillation (AF) in adult patients with atrial septal defect (ASD) accompanies an enlarged right atrium (RA) with a less enlarged left atrium (LA), which is the opposite situation in patients with AF and mitral valvular disease. This study was to compare the histopathological change in the atrium of patients with AF of two different etiologies: ASD and mitral disease. Twenty-four patients were enrolled. Group 1 included patients with ASD (8), Group 2 included patients with ASD with AF (6), and Group 3 included patients with mitral disease with AF (10). Preoperative atrial volumes were measured. Atrial tissues were obtained during surgical procedures and stained with periodic acid-Schiff, smooth muscle actin, Sirius red, and Masson's trichrome to detect histopathologic changes compatible with AF. The severity of histopathological changes was represented with "positivity" and "strong positivity" after analyzing digitalized images of the staining. We investigated the relationship between the degree of atrial dilatation and severity of histopathological changes according to the groups and tissues. Group 2 and Group 3 patients showed a tendency toward an enlarged RA volume and enlarged LA volume, respectively, compared with each others. However, in the histopathologic analysis, "positivity" and "strong positivity" showed no significant positive correlations with the degree of atrial volume in special staining. A similar degree of histopathologic changes was observed in both atria in patients with AF (Group 2 and 3) regardless of the degree of dilatation of atrial volume and disease entities. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Basal Cell Carcinoma: Pathogenesis, Epidemiology, Clinical Features, Diagnosis, Histopathology, and Management

PubMed Central

Marzuka, Alexander G.; Book, Samuel E.

2015-01-01

Basal cell carcinoma (BCC) is the most common malignancy. Exposure to sunlight is the most important risk factor. Most, if not all, cases of BCC demonstrate overactive Hedgehog signaling. A variety of treatment modalities exist and are selected based on recurrence risk, importance of tissue preservation, patient preference, and extent of disease. The pathogenesis, epidemiology, clinical features, diagnosis, histopathology, and management of BCC will be discussed in this review. PMID:26029015

Cigarette smoke induced genotoxicity and respiratory tract pathology: evidence to support reduced exposure time and animal numbers in tobacco product testing

PubMed Central

Dalrymple, Annette; Ordoñez, Patricia; Thorne, David; Walker, David; Camacho, Oscar M.; Büttner, Ansgar; Dillon, Debbie; Meredith, Clive

2016-01-01

Abstract Many laboratories are working to develop in vitro models that will replace in vivo tests, but occasionally there remains a regulatory expectation of some in vivo testing. Historically, cigarettes have been tested in vivo for 90 days. Recently, methods to reduce and refine animal use have been explored. This study investigated the potential of reducing animal cigarette smoke (CS) exposure to 3 or 6 weeks, and the feasibility of separate lung lobes for histopathology or the Comet assay. Rats were exposed to sham air or CS (1 or 2 h) for 3 or 6 weeks. Respiratory tissues were processed for histopathological evaluation, and Alveolar type II cells (AEC II) isolated for the Comet assay. Blood was collected for Pig-a and micronucleus quantification. Histopathological analyses demonstrated exposure effects, which were generally dependent on CS dose (1 or 2 h, 5 days/week). Comet analysis identified that DNA damage increased in AEC II following 3 or 6 weeks CS exposure, and the level at 6 weeks was higher than 3 weeks. Pig-a mutation or micronucleus levels were not increased. In conclusion, this study showed that 3 weeks of CS exposure was sufficient to observe respiratory tract pathology and DNA damage in isolated AEC II. Differences between the 3 and 6 week data imply that DNA damage in the lung is cumulative. Reducing exposure time, plus analyzing separate lung lobes for DNA damage or histopathology, supports a strategy to reduce and refine animal use in tobacco product testing and is aligned to the 3Rs (replacement, reduction and refinement). PMID:27160659

Monitoring impacts of air pollution: PIXE analysis and histopathological modalities in evaluating relative risks of elemental contamination.

PubMed

Ejaz, Sohail; Camer, Gerry Amor; Anwar, Khaleeq; Ashraf, Muhammad

2014-04-01

Environmental toxicants invariably affect all biological organisms resulting to sufferings ranging from subclinical to debilitating clinical conditions. This novel research aimed to determine the toxic burdens of increased environmental elements in some vital organs/tissues of the wild animals (starling, owl, crow and pigeon), exposed to air polluted environment were assessed using particle induced X-ray emission and histopathological approaches. The presence of significantly elevated amounts of elemental toxicants namely: Aluminum (Al), Chlorine (Cl), Iron (Fe), Potassium (K), Magnesium (Mg), Manganese (Mn), Silicon (Si) and Vanadium (V) from the skin, muscle, lungs, liver and kidney of sampled animals were in concurrence with the observed histopathological changes. The skin of sampled starling, owl, pigeon and crow spotlighted highly significant increase (P < 0.001) in Al, Cl, Mg and Si. Muscle samples with myodegenerative lesions and mineral depositions highlighted substantial augmentation (P < 0.001) in the amount of Al, Fe, Mn, Si and V. The lungs of starling, owl, and pigeon were severely intoxicated (P < 0.001) with increased amount of Al, Fe, K, Mn and Si producing pulmonary lesions of congestion, edema, pneumonitis and mineral debris depositions. Liver samples revealed that the sampled animals were laden with Cl, Fe, Mg, Mn and V with histopathological profound degenerative changes and hepatic necrosis. Kidney sections presented severe tubular degenerative and necrotic changes that may be attributed to increased amounts of Cl and Fe. These current findings implied that the environmental/elemental toxicants and the accompanying lesions that were discerned in the organs/tissues of sampled birds may as well be afflicting people living within the polluted area. Further assessment to more conclusively demonstrate correlations of current findings to those of the populace within the area is encouraged.

Cigarette smoke induced genotoxicity and respiratory tract pathology: evidence to support reduced exposure time and animal numbers in tobacco product testing.

PubMed

Dalrymple, Annette; Ordoñez, Patricia; Thorne, David; Walker, David; Camacho, Oscar M; Büttner, Ansgar; Dillon, Debbie; Meredith, Clive

2016-06-01

Many laboratories are working to develop in vitro models that will replace in vivo tests, but occasionally there remains a regulatory expectation of some in vivo testing. Historically, cigarettes have been tested in vivo for 90 days. Recently, methods to reduce and refine animal use have been explored. This study investigated the potential of reducing animal cigarette smoke (CS) exposure to 3 or 6 weeks, and the feasibility of separate lung lobes for histopathology or the Comet assay. Rats were exposed to sham air or CS (1 or 2 h) for 3 or 6 weeks. Respiratory tissues were processed for histopathological evaluation, and Alveolar type II cells (AEC II) isolated for the Comet assay. Blood was collected for Pig-a and micronucleus quantification. Histopathological analyses demonstrated exposure effects, which were generally dependent on CS dose (1 or 2 h, 5 days/week). Comet analysis identified that DNA damage increased in AEC II following 3 or 6 weeks CS exposure, and the level at 6 weeks was higher than 3 weeks. Pig-a mutation or micronucleus levels were not increased. In conclusion, this study showed that 3 weeks of CS exposure was sufficient to observe respiratory tract pathology and DNA damage in isolated AEC II. Differences between the 3 and 6 week data imply that DNA damage in the lung is cumulative. Reducing exposure time, plus analyzing separate lung lobes for DNA damage or histopathology, supports a strategy to reduce and refine animal use in tobacco product testing and is aligned to the 3Rs (replacement, reduction and refinement).

Magnetic resonance imaging-based cerebral tissue classification reveals distinct spatiotemporal patterns of changes after stroke in non-human primates.

PubMed

Bouts, Mark J R J; Westmoreland, Susan V; de Crespigny, Alex J; Liu, Yutong; Vangel, Mark; Dijkhuizen, Rick M; Wu, Ona; D'Arceuil, Helen E

2015-12-15

Spatial and temporal changes in brain tissue after acute ischemic stroke are still poorly understood. Aims of this study were three-fold: (1) to determine unique temporal magnetic resonance imaging (MRI) patterns at the acute, subacute and chronic stages after stroke in macaques by combining quantitative T2 and diffusion MRI indices into MRI 'tissue signatures', (2) to evaluate temporal differences in these signatures between transient (n = 2) and permanent (n = 2) middle cerebral artery occlusion, and (3) to correlate histopathology findings in the chronic stroke period to the acute and subacute MRI derived tissue signatures. An improved iterative self-organizing data analysis algorithm was used to combine T2, apparent diffusion coefficient (ADC), and fractional anisotropy (FA) maps across seven successive timepoints (1, 2, 3, 24, 72, 144, 240 h) which revealed five temporal MRI signatures, that were different from the normal tissue pattern (P < 0.001). The distribution of signatures between brains with permanent and transient occlusions varied significantly between groups (P < 0.001). Qualitative comparisons with histopathology revealed that these signatures represented regions with different histopathology. Two signatures identified areas of progressive injury marked by severe necrosis and the presence of gitter cells. Another signature identified less severe but pronounced neuronal and axonal degeneration, while the other signatures depicted tissue remodeling with vascular proliferation and astrogliosis. These exploratory results demonstrate the potential of temporally and spatially combined voxel-based methods to generate tissue signatures that may correlate with distinct histopathological features. The identification of distinct ischemic MRI signatures associated with specific tissue fates may further aid in assessing and monitoring the efficacy of novel pharmaceutical treatments for stroke in a pre-clinical and clinical setting.

Animal models for treatment of unresectable liver tumours: a histopathologic and ultra-structural study of cellular toxic changes after electrochemical treatment in rat and dog liver.

PubMed

von Euler, Henrik; Olsson, Jerker M; Hultenby, Kjell; Thörne, Anders; Lagerstedt, Anne-Sofie

2003-04-01

Electrochemical treatment (EChT) has been taken under serious consideration as being one of several techniques for local treatment of malignancies. The advantage of EChT is the minimal invasive approach and the absence of serious side effects. Macroscopic, histopathological and ultra-structural findings in liver following a four-electrode configuration (dog) and a two-electrode EChT design (dog and rat) were studied. 30 female Sprague-Dawley rats and four female beagle dogs were studied with EChT using Platinum:Iridium electrodes and the delivered dose was 5, 10 or 90 C (As). After EChT, the animals were euthanized. The distribution of the lesions was predictable, irrespective of dose and electrode configuration. Destruction volumes were found to fit into a logarithmic curve (dose-response). Histopathological examination confirmed a spherical (rat) and cylindrical/ellipsoidal (dog) lesion. The type of necrosis differed due to electrode polarity. Ultra-structural analysis showed distinct features of cell damage depending on the distance from the electrode. Histopathological and ultra-structural examination demonstrated that the liver tissue close to the border of the lesion displayed a normal morphology. The in vivo dose-planning model is reliable, even in species with larger tissue mass such as dogs. A multi-electrode EChT-design could obtain predictable lesions. The cellular toxicity following EChT is clearly identified and varies with the distance from the electrode and polarity. The distinct border between the lesion and normal tissue suggests that EChT in a clinical setting for the treatment of liver tumours can give a reliable destruction margin.

Irreversible Electroporation (IRE) in the Epidural Space of the Porcine Spine: Effects on Adjacent Structures

PubMed Central

Tam, Alda L.; Figueira, Tomas A.; Gagea, Mihai; Ensor, Joe E.; Dixon, Katherine; McWatters, Amanda; Gupta, Sanjay; Fuentes, David T.

2018-01-01

Purpose To determine the effects of irreversible electroporation (IRE) on the neural tissues following ablation in the epidural space of the porcine spine. Material and Methods The institutional animal care and use committee approved this study. With the IRE electrode positioned in the right lateral recess of the spinal epidural space, twenty CT-guided IRE ablations were performed using different applied voltages in four terminal animals. Histopathology of the neural tissues was assessed and used to select a voltage for a survival study. Sixteen CT-guided IRE ablations in the epidural space were performed using 667 V in four animals that were survived for 7-days. Clinical observation, magnetic resonance imaging (MRI) findings (obtained 6-hours post-IRE and pre-euthanasia),, histopathology, and simulated electric field strengths were assessed. A one-way analysis of variance (ANOVA) was used to compare the simulated electric field strength to histological findings. Results The mean distance between the IRE electrode and the spinal cord or nerve root was 1.71 ± 0.90 mm and 8.47 + 3.44 mm, respectively. There was no clinical evidence of paraplegia after IRE ablation. MRI and histopathology showed no neural-tissue lesions within the spinal cord; however, 31.2% (5/16) of nerve roots demonstrated moderate Wallerian degeneration in the survival group. Severity of histopathological injury in the survival group was not significantly related to either the simulated electric field strength or the distance between the IRE electrode and neural structure, (p >.05). Conclusions While the spinal cord appears resistant to the toxic effects of IRE, injury to the nerve roots may be a limiting factor for the use of IRE ablation in the epidural space. PMID:27266723

Automated multimodal spectral histopathology for quantitative diagnosis of residual tumour during basal cell carcinoma surgery.

PubMed

Boitor, Radu; Kong, Kenny; Shipp, Dustin; Varma, Sandeep; Koloydenko, Alexey; Kulkarni, Kusum; Elsheikh, Somaia; Schut, Tom Bakker; Caspers, Peter; Puppels, Gerwin; van der Wolf, Martin; Sokolova, Elena; Nijsten, T E C; Salence, Brogan; Williams, Hywel; Notingher, Ioan

2017-12-01

Multimodal spectral histopathology (MSH), an optical technique combining tissue auto-fluorescence (AF) imaging and Raman micro-spectroscopy (RMS), was previously proposed for detection of residual basal cell carcinoma (BCC) at the surface of surgically-resected skin tissue. Here we report the development of a fully-automated prototype instrument based on MSH designed to be used in the clinic and operated by a non-specialist spectroscopy user. The algorithms for the AF image processing and Raman spectroscopy classification had been first optimised on a manually-operated laboratory instrument and then validated on the automated prototype using skin samples from independent patients. We present results on a range of skin samples excised during Mohs micrographic surgery, and demonstrate consistent diagnosis obtained in repeat test measurement, in agreement with the reference histopathology diagnosis. We also show that the prototype instrument can be operated by clinical users (a skin surgeon and a core medical trainee, after only 1-8 hours of training) to obtain consistent results in agreement with histopathology. The development of the new automated prototype and demonstration of inter-instrument transferability of the diagnosis models are important steps on the clinical translation path: it allows the testing of the MSH technology in a relevant clinical environment in order to evaluate its performance on a sufficiently large number of patients.

Correlation between clinical and histopathological diagnoses in periapical inflammatory lesions.

PubMed

Diegues, Liliane Lopes; Colombo Robazza, Carlos Roberto; Costa Hanemann, João Adolfo; Costa Pereira, Alessandro Antônio; Silva, Cléverson O

2011-08-01

  The purpose of the present study was to evaluate the correlation between clinical and histopathological diagnoses of periapical inflammatory lesions, focusing mainly on cystic conditions.   Files dating from 1998 to 2006 at the Oral Pathology Laboratory, School of Dentistry, Alfenas Federal University, Brazil, were reviewed to identify cases with histopathological diagnoses of periapical inflammatory lesions. A total of 1788 files were analyzed, and 255 cases were identified with clinical diagnoses of periapical inflammatory lesions.   The most prevalent clinical diagnosis was apical periodontal cyst (59%), followed by periapical granuloma (20%), and dentoalveolar abscess (2%). After histopathological analysis, 53% of the cases represented apical periodontal cyst, 42% periapical granuloma, and 5% dentoalveolar abscess.   The outcomes of the present study show a high prevalence of periapical cysts among periapical inflammatory lesions. Moreover, this study highlights the importance of histopathological evaluation for the correct diagnosis of periapical inflammatory lesions. © 2011 Blackwell Publishing Asia Pty Ltd.

The sensitivity and specificity of frozen-section histopathology in the management of benign oral and maxillofacial lesions.

PubMed

Aronovich, Sharon; Kim, Roderick Y

2014-05-01

The management of odontogenic cysts and tumors typically requires a biopsy, which may present significant challenges and prompt an additional visit to the operating room before definitive treatment. The aim of this study was to determine the validity of frozen-section diagnosis in the management of benign oral and maxillofacial lesions, allowing intraoperative diagnosis followed by definitive treatment under the same general anesthetic. A retrospective chart review of patients treated at the University of Michigan Health System was performed. Patients of all ages who had a diagnosis of a benign maxillofacial lesion by frozen-section and permanent histopathology reports were included for analysis. Patients were identified using the Current Procedural Terminology code for enucleation and curettage and International Classification of Diseases, Ninth Revision codes for benign cysts or tumors of skull, face, or lower jaw. Of 450 patients reviewed, 214 had intraoperative frozen-section examination available for comparison with permanent histopathology. There were 121 men (56.5%) and 93 women (43.5%), with a mean age of 41 years. Compared with final permanent histopathology, the overall sensitivity of frozen sections was 92.1%. Frozen-section histopathology had a sensitivity greater than 90% and a specificity greater than 95% for the diagnosis of dentigerous cyst and keratocyst odontogenic tumor. In this study of 214 patients with benign maxillofacial lesions, frozen-section histopathology was found to be a valid diagnostic modality with high sensitivity, specificity, and positive and negative predictive values. These results and analysis support the use of frozen-section histopathology for the treatment of benign maxillofacial lesions and underscore its value in the management of these lesions. Copyright © 2014 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

YERSINIA PSEUDOTUBERCULOSIS, SEROGROUP O:1A, INFECTION IN TWO AMAZON PARROTS (AMAZONA AESTIVA AND AMAZONA ORATRIX) WITH HEPATIC HEMOSIDEROSIS.

PubMed

Galosi, Livio; Farneti, Silvana; Rossi, Giacomo; Cork, Susan Catherine; Ferraro, Stefano; Magi, Gian Enrico; Petrini, Stefano; Valiani, Andrea; Cuteri, Vincenzo; Attili, Anna-Rita

2015-09-01

Necropsies were conducted on a female blue-fronted Amazon (Amazona aestiva) and a female yellow-headed Amazon (Amazona oratrix) that died after depression, ruffled feathers, diarrhea, and biliverdin in the urine. Gross and microscopic examinations revealed multifocal necrosis in the liver, spleen, lungs, kidneys, intestines, and heart caused by acute bacteremia. Yersinia pseudotuberculosis, serogroup O:1a, was isolated by culturing from the visceral lesions in the liver, intestines, and spleen. Virulence gene analysis showed the presence of the inv gene and the complete pathogenicity island: IS100, psn, yptE, irp1, irp2 ybtP-ybtQ, ybtX-ybtS, and int asnT-Int. Histopathologic findings and chemical analysis also demonstrated hepatic hemosiderosis. As has been demonstrated in other species, hemosiderosis may predispose Amazona spp. to systemic infection with Y. pseudotuberculosis after enteric disease.

Pretreatment of liver grafts in vivo by γ-aminobutyric acid receptor regulation reduces cold ischemia/warm reperfusion injury in rat

PubMed Central

Hori, Tomohide; Gardner, Lindsay B.; Hata, Toshiyuki; Chen, Feng; Baine, Ann-Marie T.; Uemoto, Shinji; Nguyen, Justin H.

2014-01-01

Summary Background: Gamma-aminobutyric acid (GABA) is found throughout the body. The regulation of GABA receptor (GABAR) reduces oxidative stress (OS). Ischemia/reperfusion injury after orthotopic liver transplantation (OLT) causes OS-induced graft damage. The effects of GABAR regulation in donors in vivo were investigated. Material/Methods: Donor rats received saline, a GABAR agonist or GABAR antagonist 4 h before surgery. Recipient rats were divided into four groups according to the donor treatments: laparotomy, OLT with saline, OLT with GABAR agonist and OLT with GABAR antagonist. Histopathological, biochemical and immunohistological examinations were performed at 6, 12 and 24 h after OLT. Protein assays were performed at 6 h after OLT. The 4-hydroxynonenal (4-HNE), ataxia-telangiectasia mutated kinase (ATM), phosphorylated histone H2AX (γH2AX), phosphatidylinositol-3 kinase (PI3K), Akt and superoxide dismutase (SOD) were assessed by western blot analysis. Results: In the univariate analysis, histopathological and biochemical profiles verified that the GABAR agonist reduced graft damage. Immunohistology revealed that the GABAR agonist prevented the induction of apoptosis. Measurement of 4-4-HNE levels confirmed OS-induced damage after OLT, and the GABAR agonist improved this damage. In the γH2AX, PI3K, Akt and antioxidant enzymes (SODs), ATM and H2AX were greatly increased after OLT, and were reduced by the GABAR agonist. In the multivariate analyses between multiple groups, histopathological assessment, aspartate aminotransferase level, immunohistological examinations for apoptotic induction and γH2AX showed statistical differences. Conclusions: A specific agonist demonstrated regulation of GABAR in vivo in the liver. This activation in vivo reduced OS after OLT via the ATM/H2AX pathway. PMID:23792534

Patterns of gene expression associated with recovery and injury in heat-stressed rats.

PubMed

Stallings, Jonathan D; Ippolito, Danielle L; Rakesh, Vineet; Baer, Christine E; Dennis, William E; Helwig, Bryan G; Jackson, David A; Leon, Lisa R; Lewis, John A; Reifman, Jaques

2014-12-03

The in vivo gene response associated with hyperthermia is poorly understood. Here, we perform a global, multiorgan characterization of the gene response to heat stress using an in vivo conscious rat model. We heated rats until implanted thermal probes indicated a maximal core temperature of 41.8°C (Tc,Max). We then compared transcriptomic profiles of liver, lung, kidney, and heart tissues harvested from groups of experimental animals at Tc,Max, 24 hours, and 48 hours after heat stress to time-matched controls kept at an ambient temperature. Cardiac histopathology at 48 hours supported persistent cardiac injury in three out of six animals. Microarray analysis identified 78 differentially expressed genes common to all four organs at Tc,Max. Self-organizing maps identified gene-specific signatures corresponding to protein-folding disorders in heat-stressed rats with histopathological evidence of cardiac injury at 48 hours. Quantitative proteomics analysis by iTRAQ (isobaric tag for relative and absolute quantitation) demonstrated that differential protein expression most closely matched the transcriptomic profile in heat-injured animals at 48 hours. Calculation of protein supersaturation scores supported an increased propensity of proteins to aggregate for proteins that were found to be changing in abundance at 24 hours and in animals with cardiac injury at 48 hours, suggesting a mechanistic association between protein misfolding and the heat-stress response. Pathway analyses at both the transcript and protein levels supported catastrophic deficits in energetics and cellular metabolism and activation of the unfolded protein response in heat-stressed rats with histopathological evidence of persistent heat injury, providing the basis for a systems-level physiological model of heat illness and recovery.

Histopathology-like categories based on endometrial imprint cytology in dysfunctional uterine bleeding.

PubMed

Baxi, Seema N; Panchal, Nirav S

2015-01-01

Cytology of the endometrium is an underused technique in diagnostic pathology. It has been used in the past for endometrial hyperplasia and carcinoma. Only few studies have used cytology in the diagnosis of dysfunctional uterine bleeding (DUB). Endometrial imprint cytology has been rarely used except for application of immunocytochemistry in diagnosis of endometrial carcinoma. The present study was conducted to evaluate whether it is possible to assign histopathology-like diagnosis by imprint cytology and also to evaluate its usefulness in the assessment of patients of dysfunctional uterine bleeding of low clinical suspicion. Imprint smears were made from 93 curettage materials during a study of DUB. Blinded analysis of imprint smears was performed by using McKenzie's criteria and some criteria devised for the requirements of this study. Results of cytology were correlated with histopathology. Statistical analysis was carried out by GraphpadInStat Demo. Majority of the patterns classifiable in histopathology could also be classified in this study on imprint cytology. The overall sensitivity and specificity of cytology in the detection of endometrial patterns in DUB patients were 91.23% and 83.87%, respectively, although the sensitivities and specificities differ according to the phase of endometrium. Histopathology-like categories can be assigned on imprint smears in the diagnosis of DUB. Endometrial imprint cytology can be helpful in centers where histopathology laboratories are not available and even in well-established institutes. It is possible to improve the sensitivity and specificity with better imprinting techniques.

Immunopathology of recurrent uveitis in spontaneously diseased horses.

PubMed

Deeg, C A; Ehrenhofer, M; Thurau, S R; Reese, S; Wildner, G; Kaspers, B

2002-08-01

Equine recurrent uveitis (ERU) is the most serious eye disease in horses worldwide. Despite the fact that ERU is generally considered to be immune mediated, a detailed description of the histopathology of the posterior part of ERU eyes is lacking. Here, we examined sections of paraffin-embedded eyes using histological and immunhistological methods. Twenty seven eyes of 20 horses with ERU and 30 eyes of 15 healthy control horses were included in this study. We could consistently demonstrate an involvement of the retina and the choroid in all examined eyes of horses with spontaneous ERU. In eyes with minimal histopathological changes, the infiltrates consisted almost exclusively of T-cells. Histopathological changes start with the destruction of the photoreceptor outer segments, which often leads to focal retinal detachment. In more severely affected eyes, there is additional disintegration of the ganglion cell layer and the inner nuclear layer. In almost all examined eyes, lymphoid follicle formation could be demonstrated. Typical localizations of these follicles were the iris stroma and the choroid underneath the transition zone of the retina without photoreceptor cells to the region containing photoreceptor cells. These follicles consist of a T-cell rich periphery with a small center of CD3-negative lymphocytes. In cases with extreme histopathological changes, the retinal architecture is widely disintegrated with massive infiltration of the retina, the choroid, and the ciliary body by several types of inflammatory cells. Necrotic remnants of the retina are end-stage findings and there is only a minor inflammatory infiltration left. This study provides clear evidence that the retina is involved in all stages of ERU. Inflammation is mainly driven by T-cells as T-cells were demonstrated in mild stages of the disease and are also the predominating cell type in all other stages of ERU.

Discrepancy between the clinical and histopathologic diagnosis of soft tissue vascular malformations.

PubMed

Horbach, Sophie E R; Utami, Amalia M; Meijer-Jorna, Lorine B; Sillevis Smitt, J H; Spuls, Phyllis I; van der Horst, Chantal M A M; van der Wal, Allard C

2017-11-01

Soft tissue vascular malformations are generally diagnosed clinically, according to the International Society for the Study of Vascular Anomalies (ISSVA) classification. Diagnostic histopathologic examination is rarely performed. We sought to evaluate the validity of the current diagnostic workup without routinely performed diagnostic histopathology. We retrospectively determined whether there were discrepancies between clinical and histopathologic diagnoses of patients with clinically diagnosed vascular malformations undergoing therapeutic surgical resections in our center (2000-2015). Beforehand, a pathologist revised the histopathologic diagnoses according to the ISSVA classification. Clinical and histopathologic diagnoses were discrepant in 57% of 142 cases. In these cases, the pathologist indicated the diagnosis was not at all a vascular malformation (n = 24; 17%), a completely different type of vascular malformation (n = 26; 18%), or a partially different type with regard to the combination of vessel-types involved (n = 31; 22%). Possible factors associated with the discrepancies were both clinician-related (eg, diagnostic uncertainty) and pathology-related (eg, lack of immunostaining). Retrospective analysis of a subgroup of patients undergoing surgery. The large discrepancy between clinical and histopathologic diagnoses raises doubt about the validity of the current diagnostic workup for vascular malformations. Clear clinical and histopathologic diagnostic criteria might be essential for a uniform diagnosis. Copyright © 2017 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Fast evaluation of 69 basal cell carcinomas with ex vivo fluorescence confocal microscopy: criteria description, histopathological correlation, and interobserver agreement.

PubMed

Bennàssar, Antoni; Carrera, Cristina; Puig, Susana; Vilalta, Antoni; Malvehy, Josep

2013-07-01

Fluorescence confocal microscopy (FCM) represents a first step toward a rapid "bedside pathology" in the Mohs surgery setting and in other fields of general pathology. To describe and validate FCM criteria for the main basal cell carcinoma (BCC) subtypes and to demonstrate the overall agreement with classic pathologic analysis of hematoxylin-eosin-stained samples. DESIGN A total of 69 BCCs from 66 patients were prospectively imaged using ex vivo FCM. Confocal mosaics were evaluated in real time and compared with classic pathologic analysis. Department of Dermatology, Hospital Clínic of Barcelona, Barcelona, Spain, between November 2010 and July 2011. Patients with BCC attending the Mohs Surgery Unit. Presence or absence of BCC and histological subtype (superficial, nodular, and infiltrating) in the confocal mosaics. Eight criteria for BCC were described, evaluated, and validated. Although there were minor differences among BCC subtypes, the most BCC-defining criteria were peripheral palisading, clefting, nuclear pleomorphism, and presence of stroma. These criteria were validated with independent observers (κ values >0.7 [corrected] for most criteria). We herein propose, describe, and validate FCM criteria for BCC diagnosis. Fluorescence confocal microscopy is an attractive alternative to histopathologic analysis of frozen sections during Mohs surgery because large areas of freshly excised tissue can be assessed in real time without the need for tissue processing while minimizing labor and costs.

DRAQ5 and Eosin (‘D&E’) as an Analog to Hematoxylin and Eosin for Rapid Fluorescence Histology of Fresh Tissues

PubMed Central

Elfer, Katherine N.; Sholl, Andrew B.; Wang, Mei; Tulman, David B.; Mandava, Sree H.; Lee, Benjamin R.; Brown, J. Quincy

2016-01-01

Real-time on-site histopathology review of biopsy tissues at the point-of-procedure has great potential for significant clinical value and improved patient care. For instance, on-site review can aid in rapid screening of diagnostic biopsies to reduce false-negative results, or in quantitative assessment of biospecimen quality to increase the efficacy of downstream laboratory and histopathology analysis. However, the only currently available rapid pathology method, frozen section analysis (FSA), is too time- and labor-intensive for use in screening large quantities of biopsy tissues and is too destructive for maximum tissue conservation in multiple small needle core biopsies. In this work we demonstrate the spectrally-compatible combination of the nuclear stain DRAQ5 and the anionic counterstain eosin as a dual-component fluorescent staining analog to hematoxylin and eosin intended for use on fresh, unsectioned tissues. Combined with optical sectioning fluorescence microscopy and pseudo-coloring algorithms, DRAQ5 and eosin (“D&E”) enables very fast, non-destructive psuedohistological imaging of tissues at the point-of-acquisition with minimal tissue handling and processing. D&E was validated against H&E on a one-to-one basis on formalin-fixed paraffin-embedded and frozen section tissues of various human organs using standard epi-fluorescence microscopy, demonstrating high fidelity of the staining mechanism as an H&E analog. The method was then applied to fresh, whole 18G renal needle core biopsies and large needle core prostate biospecimen biopsies using fluorescence structured illumination optical sectioning microscopy. We demonstrate the ability to obtain high-resolution histology-like images of unsectioned, fresh tissues similar to subsequent H&E staining of the tissue. The application of D&E does not interfere with subsequent standard-of-care H&E staining and imaging, preserving the integrity of the tissue for thorough downstream analysis. These results indicate that this dual-stain pseudocoloring method could provide a real-time histology-like image at the time of acquisition and valuable objective tissue analysis for the clinician at the time of service. PMID:27788264

Analysis of metaplastic breast carcinoma: FNAC; histopathology and immunohistochemistry are complementary for diagnosis.

PubMed

Abd El Hafez, Amal; Shawky, Abd El-Aty

2013-01-01

Metaplastic breast carcinoma (MBC) is a rare malignancy comprised of ductal, squamous and/or mesenchymal elements with problematic diagnosis. This study analyses MBC identifying its cytologic and histologic features and emphasizing the combined role of FNAC, histopathology and immunohistochemistry (IHC) in its diagnosis. Cytology and histopathology files search yielded 21 cases identified as MBC from January 2005 to December 2010. FNAC and the histopathology slides were re-examined for the presence and frequency of various elements. Cytological and histopathological diagnoses were made and the cases subtyped according to WHO classification. Cytokeratin and vimenten IHC were used to confirm diagnosis when required. On FNAC, 52.4% were diagnosed as malignant, 9.5% as suspicious for malignancy and 38.1% as benign lesions. Most frequent cytologic findings were squamous and spindle cell elements (52.4% each). Histopathology revealed 76.2% pure epithelial tumors and 23.8% mixed epithelial-mesenchymal tumors. Squamous cell carcinoma was the most frequent histological subtype (33.3%). Carcinosarcomas were dimorphic on IHC& spindle cell carcinomas were positive for both cytokeratin and vimentin. Presence of dual components, squamous, spindle elements, mesenchymal fragments and necrosis in moderate to high cellularity breast FNAC provides clues for the diagnosis of MBC. FNAC; histopathology and IHC complement for diagnosis.

The effect of low-intensity laser therapy on wound healing in Streptozotocin-induced diabetic rats

NASA Astrophysics Data System (ADS)

Rabelo, Sylvia B.; Villaverde, Antonio G. J. B.; Salgado, Miguel A. C.; Melo, Milene d. S.; Nicolau, Renata A.; Pacheco, Marcos T. T.

2004-10-01

Diabetes Mellitus is a condition that results in a delay of the wound healing process, that is associated with an insufficient production of collagen, a decrease of the amount of collagen fibrils and deficient blood flow in the wound area. It is sugested that Low Intensity Laser Therapy acts by improving wound healing in normal organisms, accelerating tissue regeneration. The aim of this work was to investigate the biostimulatory effect of the HeNe laser irradiation, at 632.8 nm, on wound healing in 15 male rats suffering from diabetes induced by Streptozotocin, compared to 15 control diabetic animals. Irradiation parameters were: laser power of 15mW, exposition time of 17 s., irradiated area of 0.025 cm2 and laser energy density of 10 J/cm2. Full-thickness skin squared samples, with 5 mm of non-injured tissue around the wound, were obtained at 4, 7 and 15 days after wounding procedure (5 treated and 5 control animals each time). The histopathologic analysis performed by haematoxylin-cosin staining. Results suggested that the irradiation of diabetic rats was efficient for wound healing. Treated group presented better quality of the wound tissues by the macroscopic observation than control group and the microscopic analysis demonstrated that treated animals had better histopathologic evaluation than non treated.

Multiclass cancer diagnosis using tumor gene expression signatures

DOE PAGES

Ramaswamy, S.; Tamayo, P.; Rifkin, R.; ...

2001-12-11

The optimal treatment of patients with cancer depends on establishing accurate diagnoses by using a complex combination of clinical and histopathological data. In some instances, this task is difficult or impossible because of atypical clinical presentation or histopathology. To determine whether the diagnosis of multiple common adult malignancies could be achieved purely by molecular classification, we subjected 218 tumor samples, spanning 14 common tumor types, and 90 normal tissue samples to oligonucleotide microarray gene expression analysis. The expression levels of 16,063 genes and expressed sequence tags were used to evaluate the accuracy of a multiclass classifier based on a supportmore » vector machine algorithm. Overall classification accuracy was 78%, far exceeding the accuracy of random classification (9%). Poorly differentiated cancers resulted in low-confidence predictions and could not be accurately classified according to their tissue of origin, indicating that they are molecularly distinct entities with dramatically different gene expression patterns compared with their well differentiated counterparts. Taken together, these results demonstrate the feasibility of accurate, multiclass molecular cancer classification and suggest a strategy for future clinical implementation of molecular cancer diagnostics.« less

Imaging features predict prognosis of patients with combined hepatocellular-cholangiocarcinoma.

PubMed

Mao, Y; Xu, S; Hu, W; Huang, J; Wang, J; Zhang, R; Li, S

2017-02-01

To evaluate the prognostic value of imaging patterns in combined hepatocellular-cholangiocarcinoma. A total of 36 patients with histopathologically confirmed combined hepatocellular-cholangiocarcinoma were enrolled. Pretreatment imaging was conducted to evaluate the tumour enhancement patterns, based on which the disease was classified as two subtypes: radiographic hepatocellular carcinoma-dominant (n=26) and radiographic cholangiocarcinoma-dominant (n=10). Moreover, based on the proportion of components, all combined hepatocellular-cholangiocarcinoma cases were divided into histopathological hepatocellular carcinoma-dominant (n=26) or histopathological cholangiocarcinoma-dominant (n=10). The Kaplan-Meier method was used to compare patient outcome between the two subtypes of each classification. Univariate Cox regression analysis were employed to evaluate the prognostic relevance of the imaging and histopathological classification. Consistency between histopathological and imaging classification was not high. Only 66.7% of patients had consistent classification. Moreover, the median overall survival of the radiographic cholangiocarcinoma-dominant and radiographic hepatocellular carcinoma-dominant population was 15.03 and 40.4 months, respectively (p=0.012); however, no significant difference was observed between histopathological type, with median overall survival being 32.07 and 40.4 months in the histopathological cholangiocarcinoma-dominant group and histopathological hepatocellular carcinoma-dominant group, respectively (p=0.784). There was an association between imaging patterns and overall survival in combined hepatocellular-cholangiocarcinoma. Postoperative re-evaluation of imaging patterns could help to assess patient outcome. Copyright © 2016 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

Histopathology of cutaneous sporotrichosis in Rio de Janeiro: a series of 119 consecutive cases.

PubMed

Quintella, Leonardo Pereira; Passos, Sonia Regina Lambert; do Vale, Antônio Carlos Francesconi; Galhardo, Maria Clara Gutierrez; Barros, Monica Bastos De Lima; Cuzzi, Tullia; Reis, Rosani Dos Santos; de Carvalho, Maria Helena Galdino Figueiredo; Zappa, Mônica Barbato; Schubach, Armando De Oliveira

2011-01-01

Sporotrichosis is the most common subcutaneous mycosis in Rio de Janeiro. Histopathological examination reveals diffuse granulomatous and suppurative dermatitis, and the fungus is rarely identifiable in tissue. We describe the histopathological features of cutaneous sporotrichosis, and investigate the association between them and the lack of visualization of the fungus. A total of 119 samples of confirmed sporotrichosis cases were studied. The characteristics of the inflammatory infiltrate, the presence of epidermal changes, necrosis and fibrosis, and the parasite burden were analyzed. The association between histopathological changes and the lack of visualization of the fungus was evaluated using prevalence ratios. Granulomas were observed in all samples, suppurative granulomas in 100 (84%) and diffuse dermatitis in 114 (95.8%). Liquefaction and caseous necrosis were present in 78 (65.5%) and 52 (43.7%) samples, respectively. The fungus was not seen in 77 (64.7%) samples. Epithelioid, tuberculoid or foreign-body-type granulomas, caseous, fibrinoid or absent necrosis, predominance of lymphocytes among nonphagocytic cells and fibrosis were associated with the lack of visualization of the fungus. The histopathological characteristics of sporotrichosis were variable when the causative fungus was not seen. In a proper context, the diagnosis of sporotrichosis remains a potential consideration even in the absence of demonstrable yeast. Copyright © 2010 John Wiley & Sons A/S.

Comparison of 3.0 T magnetic resonance imaging and X-ray mammography in the measurement of ductal carcinoma in situ: a comparison with histopathology.

PubMed

Pickles, Martin D; Gibbs, Peter; Hubbard, Anne; Rahman, Ayesha; Wieczorek, Joanna; Turnbull, Lindsay W

2015-04-01

To determine if MRI data obtained at 3.0 T can more accurately report the size of DCIS as compared to radiographic mammography, as a whole cohort and when subdivided by lesion characteristics. Thirty-nine participants underwent X-ray mammography and MRI prior to breast surgery for DCIS. Longest diameter (LD) measurements were recorded for each imaging modality and compared to histopathological LD via a logarithmic transformed Bland-Altman agreement plot methodology resulting in dimensionless mean difference and 95% limits of agreement (LoA). Data from 39 patients with a median age of 55 years (range 38-78 years) underwent analysis. Mastectomy was undertaken in 21 cases, while breast conserving surgery was performed in 18 subjects. Histopathological analysis revealed one low grade, nine intermediate grade, and 21 high grade lesions. The mean±standard deviation LD measurements for histopathology, X-ray mammography and MRI were 50.6±34.2 mm, 30.7±23.1 mm and 49.6±26.8 mm respectively. Bland-Altman agreement plot analysis for the whole cohort revealed not only a smaller logarithmic mean difference between MRI and histopathology (0.086), but also narrower 95% LoA (-0.941 to 1.113) compared with X-ray mammography and histopathology (mean difference -0.658, 95% LoA -3.503 to 2.187). When the level of agreement was assessed between clinically relevant subgroups additional significant differences were noted based on grade, hormonal receptor status, invasion, necrosis, mircocalcifications and growth pattern. MRI provides a more accurate estimation of DCIS size than X-ray mammography. MRI's superior ability was not only noted in general, but also for clinical relevant subdivisions such as grade and the presence or absence of necrosis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Glaucoma with Descemet's membrane detachment in five horses.

PubMed

Henriksen, Michala de Linde; La Croix, Noelle; Wilkie, David A; Lassaline-Utter, Mary; Brantman, Karen R; Beamer, Gillian L; Teixeira, Leandro B C; Dubielzig, Richard R

2017-05-01

To describe the clinical and histopathologic features of glaucoma associated with Descemet's membrane (DM) detachment in five horses without prior history of intraocular surgery. Three Appaloosa horses and two Thoroughbreds were included in this study. The affected horses ranged in age from 16 to 27 years and presented with severe diffuse corneal edema. Five eyes were enucleated due to intraocular hypertension and/or chronic corneal ulceration. The enucleated globes were evaluated by the Comparative Ocular Pathology Laboratory of Wisconsin (COPLOW). Each globe was routinely processed for histopathology and analyzed by light microscopy. A histologic diagnosis of glaucoma was reached by demonstrating a loss of optic nerve axonal tissue by measuring neurofilament-immunopositive axons with automated image analysis software. All five horses presented with unilateral severe diffuse corneal edema that had developed between 2 and 16 weeks prior to enucleation. Intraocular pressures for the affected eyes were between 9 and 87 mmHg prior to enucleation. Descemet's membrane detachment was identified histopathologically in all five globes (5/5, 100%). All five eyes had an avascular spindle cell proliferation filling the space between the displaced peripheral DM and the corneal stroma. Neurofilament immunostaining revealed axonal loss consistent with glaucoma. Equine glaucoma may be associated with Descemet's membrane detachment. This detachment and glaucoma is a possible differential diagnosis for severe equine corneal edema. In this case series, an eye with a DM detachment had a poor prognosis for retention. © 2016 American College of Veterinary Ophthalmologists.

Specificity of the histopathological triad for the diagnosis of toxoplasmic lymphadenitis: polymerase chain reaction study.

PubMed

Lin, M H; Kuo, T T

2001-08-01

Toxoplasmosis is a common cause of lymphadenopathy, but toxoplasmic cysts are not usually found in histological sections used for establishing diagnosis, except on extremely rare occasions. The histopathological triad of florid reactive follicular hyperplasia, clusters of epithelioid histiocytes, and focal sinusoidal distention by monocytoid B cells has been considered to be diagnostic of toxoplasmic lymphadenitis, but the validity of the histopathological triad is based indirectly on serological correlation only. The demonstration of Toxoplasma gondii DNA in lymph nodes displaying the histopathological triad will indicate the validity of the histopathological triad as the criterion for the histopathological diagnosis of toxoplasmic lymphadenitis. We used frozen tissues of 12 lymph nodes with the histopathological triad and tissues of 27 lymph nodes from patients with various other conditions (including 13 cases of follicular lymphoid hyperplasia, FLH; three cases of dermatopathic lymphadenopathy, DPL; two cases of plasmacytosis; two cases of Castleman's disease; two cases of metastatic adenocarcinoma; and five cases of lymphoma) to detect T. gondii DNA by polymerase chain reaction. Ten out of 12 lymph nodes with the triad and six out of 27 lymph nodes without the triad were positive for T. gondii DNA. Thus, the sensitivity of the triad was 62.5% (10/16) and the specificity was 91.3% (21/23). The predictive value of positive tests was 83.3% (10/12) and the predictive value of negative tests was 77.7% (21/27). The six cases positive for T. gondii DNA without the triad were four cases of FLH, one case of DPL, and one case of plasmacytosis. None of the neoplastic diseases was positive. The false positive and negative cases could be due to sampling problems or past T. gondii infection. The results confirm that the histopathological triad is highly specific for the diagnosis of toxoplasmic lymphadenitis and can be used confidently.

Evaluation of Masood’s and Modified Masood’s Scoring Systems in the Cytological Diagnosis of Palpable Breast Lump Aspirates

PubMed Central

Chithrabhanu, Savithri Moothiringode

2017-01-01

Introduction Fine Needle Aspiration Cytology (FNAC) has a leading role in the assessment of breast lesions. Masood’s Scoring Index (MSI) and its modification (Modified Masood’s scoring index; MMSI) has been proposed to aid in sub-grouping breast lesions and to help in subsequent management. Aim To assess and compare the diagnostic accuracy of MSI and MMSI by subsequent correlation with histopathology. Materials and Methods The study was cross-sectional in nature and was conducted in a tertiary care setting. The study included 207 cases presenting as palpable breast lump, which had undergone FNAC and subsequent excision biopsy for histopathology. Statistical Analysis The cases were grouped into four categories as suggested by Masood et al., (MSI) and Nandini et al., (MMSI) and concordance analysis with reference to histopathological diagnosis was done. Results In comparison to MSI, MMSI showed better concordance with histopathological diagnosis and superior diagnostic accuracy in non-proliferative breast disease category (p-value = 0.046) as well as in proliferative breast disease without atypia category. The overall diagnostic accuracy of the cytological scoring was 97.5%, with 94.5% sensitivity and 100% specificity. Conclusion Though both MSI and MMSI were found effective in subcategorizing breast lesions, MMSI was found to have better concordance with histopathology. Inclusion of cellular pattern and background material may further help in increasing the accuracy. PMID:28571141

Magnetic resonance imaging-guided core needle breast biopsies resulting in high-risk histopathologic findings: upstage frequency and lesion characteristics.

PubMed

Weinfurtner, R Jared; Patel, Bhavika; Laronga, Christine; Lee, Marie C; Falcon, Shannon L; Mooney, Blaise P; Yue, Binglin; Drukteinis, Jennifer S

2015-06-01

Analysis of magnetic resonance imaging-guided breast biopsies yielding high-risk histopathologic features at a single institution found an overall upstage rate to malignancy of 14% at surgical excision. All upstaged lesions were associated with atypical ductal hyperplasia. Flat epithelial atypia and atypical lobular hyperplasia alone or with lobular carcinoma in situ were not associated with an upstage to malignancy. The purpose of the present study w as to determine the malignancy upstage rates and imaging features of high-risk histopathologic findings resulting from magnetic resonance imaging (MRI)-guided core needle breast biopsies. These features include atypical ductal hyperplasia (ADH), atypical lobular hyperplasia (ALH), flat epithelial atypia (FEA), and lobular carcinoma in situ (LCIS). A retrospective medical record review was performed on all MRI-guided core needle breast biopsies at a single institution from June 1, 2007 to December 1, 2013 to select biopsies yielding high-risk histopathologic findings. The patient demographics, MRI lesion characteristics, and histopathologic features at biopsy and surgical excision were analyzed. A total of 257 MRI-guided biopsies had been performed, and 50 yielded high-risk histopathologic features (19%). Biopsy site and surgical excision site correlation was confirmed in 29 of 50 cases. Four of 29 lesions (14%) were upstaged: 1 case to invasive ductal carcinoma and 3 cases to ductal carcinoma in situ. ADH alone had an overall upstage rate of 7% (1 of 14), mixed ADH/ALH a rate of 75% (3 of 4), ALH alone or with LCIS a rate of 0% (0 of 7), and FEA a rate of 0% (0 of 4). Only mixed ADH/ALH had a statistically significant upstage rate to malignancy compared with the other high-risk histopathologic subtypes combined. No specific imaging characteristics on MRI were associated with an upstage to malignancy on the statistical analysis. MRI-guided breast biopsies yielding high-risk histopathologic features were associated with an overall upstage to malignancy rate of 14% at surgical excision. All upstaged lesions were associated with ADH. FEA and ALH alone or with LCIS were not associated with an upstage to malignancy. Copyright © 2015 Elsevier Inc. All rights reserved.

Constrained Deep Weak Supervision for Histopathology Image Segmentation.

PubMed

Jia, Zhipeng; Huang, Xingyi; Chang, Eric I-Chao; Xu, Yan

2017-11-01

In this paper, we develop a new weakly supervised learning algorithm to learn to segment cancerous regions in histopathology images. This paper is under a multiple instance learning (MIL) framework with a new formulation, deep weak supervision (DWS); we also propose an effective way to introduce constraints to our neural networks to assist the learning process. The contributions of our algorithm are threefold: 1) we build an end-to-end learning system that segments cancerous regions with fully convolutional networks (FCNs) in which image-to-image weakly-supervised learning is performed; 2) we develop a DWS formulation to exploit multi-scale learning under weak supervision within FCNs; and 3) constraints about positive instances are introduced in our approach to effectively explore additional weakly supervised information that is easy to obtain and enjoy a significant boost to the learning process. The proposed algorithm, abbreviated as DWS-MIL, is easy to implement and can be trained efficiently. Our system demonstrates the state-of-the-art results on large-scale histopathology image data sets and can be applied to various applications in medical imaging beyond histopathology images, such as MRI, CT, and ultrasound images.

Direct comparison between confocal and multiphoton microscopy for rapid histopathological evaluation of unfixed human breast tissue.

PubMed

Yoshitake, Tadayuki; Giacomelli, Michael G; Cahill, Lucas C; Schmolze, Daniel B; Vardeh, Hilde; Faulkner-Jones, Beverly E; Connolly, James L; Fujimoto, James G

2016-12-01

Rapid histopathological examination of surgical specimen margins using fluorescence microscopy during breast conservation therapy has the potential to reduce the rate of positive margins on postoperative histopathology and the need for repeat surgeries. To assess the suitability of imaging modalities, we perform a direct comparison between confocal fluorescence microscopy and multiphoton microscopy for imaging unfixed tissue and compare to paraffin-embedded histology. An imaging protocol including dual channel detection of two contrast agents to implement virtual hematoxylin and eosin images is introduced that provides high quality imaging under both one and two photon excitation. Corresponding images of unfixed human breast tissue show that both confocal and multiphoton microscopy can reproduce the appearance of conventional histology without the need for physical sectioning. We further compare normal breast tissue and invasive cancer specimens imaged at multiple magnifications, and assess the effects of photobleaching for both modalities using the staining protocol. The results demonstrate that confocal fluorescence microscopy is a promising and cost-effective alternative to multiphoton microscopy for rapid histopathological evaluation of ex vivo breast tissue.

Direct comparison between confocal and multiphoton microscopy for rapid histopathological evaluation of unfixed human breast tissue

PubMed Central

Yoshitake, Tadayuki; Giacomelli, Michael G.; Cahill, Lucas C.; Schmolze, Daniel B.; Vardeh, Hilde; Faulkner-Jones, Beverly E.; Connolly, James L.; Fujimoto, James G.

2016-01-01

Abstract. Rapid histopathological examination of surgical specimen margins using fluorescence microscopy during breast conservation therapy has the potential to reduce the rate of positive margins on postoperative histopathology and the need for repeat surgeries. To assess the suitability of imaging modalities, we perform a direct comparison between confocal fluorescence microscopy and multiphoton microscopy for imaging unfixed tissue and compare to paraffin-embedded histology. An imaging protocol including dual channel detection of two contrast agents to implement virtual hematoxylin and eosin images is introduced that provides high quality imaging under both one and two photon excitation. Corresponding images of unfixed human breast tissue show that both confocal and multiphoton microscopy can reproduce the appearance of conventional histology without the need for physical sectioning. We further compare normal breast tissue and invasive cancer specimens imaged at multiple magnifications, and assess the effects of photobleaching for both modalities using the staining protocol. The results demonstrate that confocal fluorescence microscopy is a promising and cost-effective alternative to multiphoton microscopy for rapid histopathological evaluation of ex vivo breast tissue. PMID:28032121

Histopathologic and immunohistochemical features of Hashimoto thyroiditis.

PubMed

Amani, H Kazem

2011-01-01

Intrathyroid lymphoid tissue is accrued in Hashimoto thyroiditis (HT). Histologically, this acquired lymphoid tissue bears a close resemblance to mucosa-associated lymphoid tissue (MALT) and can evolve to lymphoma. To demonstrate the morphological, and immunohistochemical profiles of Hashimoto thyroiditis and to ascertain the importance of light chain restriction in distinguishing HT with extensive lymphoplasmacytoid infiltrate from MALT lymphoma. We studied histopathologically and immunohistochemically (CD20, CD3, Igk, Igl and cytokeratin) 30 cases of HT for evaluation of the lymphoid infiltrate and the presence of lymphoepithelial lesions (LELs). Distinguishing between early thyroid lymphoma and HT was evaluated by light chain restriction. These findings were compared with two cases of primary thyroid lymphoma. The histopathological findings were characteristic of HT. Immunohistochemistry confirmed inconspicuous, rare B-cell LELs as well as a prominent T-lymphocyte population. Testing for light chain restriction showed polyclonal population of plasma cells. The cases of MALT lymphoma had distinct destructive lymphoepithelial lesions, B-cell immunophenotyping and showed kappa light chain restriction in the plasmacytoid population. Hashimoto thyroiditis differs both histopathologically and immunohistochemically from thyroid lymphoma. In suspicious cases, immunohistochemistry could be helpful in reaching a definitive diagnosis.

Histopathologic changes in punctal stenosis.

PubMed

Port, Alexander D; Chen, Yao-Tseng; Lelli, Gary J

2013-01-01

To describe the pathologic changes in punctal stenosis by reporting the histopathologic findings in a series of punctoplasty specimens. Observational retrospective chart review. Electronic health records of all patients having punctoplasty over a 2-year period at an academic oculoplastic practice were examined. All patients whose records included pathology reports were entered into a database. Twenty-four patients, representing 30 eyes, had pathology records in the electronic health records. Patients were 75% women and had an average age of 65 (19-88) years. Associated conditions included blepharitis (71%), dry eye syndrome, or Meibomian gland dysfunction (63%). Histopathologic examination demonstrated chronic inflammation in 11 eyes (36.7%), fibrosis in 7 eyes (23.3%), chronic inflammation and fibrosis in 4 eyes (13.3%), squamous metaplasia in 3 eyes (10%), normal conjunctival mucosa in 3 eyes (10%), and Actinomyces israelii canaliculitis in 2 eyes (6.7%). Nearly all histopathologic specimens revealed findings consistent with inflammation, fibrosis, or both. These findings provide evidence to support the hypothesis that the many etiologic causes of punctal stenosis are linked by a common pathophysiologic mechanism involving inflammation.

Direct comparison between confocal and multiphoton microscopy for rapid histopathological evaluation of unfixed human breast tissue

NASA Astrophysics Data System (ADS)

Yoshitake, Tadayuki; Giacomelli, Michael G.; Cahill, Lucas C.; Schmolze, Daniel B.; Vardeh, Hilde; Faulkner-Jones, Beverly E.; Connolly, James L.; Fujimoto, James G.

2016-12-01

Rapid histopathological examination of surgical specimen margins using fluorescence microscopy during breast conservation therapy has the potential to reduce the rate of positive margins on postoperative histopathology and the need for repeat surgeries. To assess the suitability of imaging modalities, we perform a direct comparison between confocal fluorescence microscopy and multiphoton microscopy for imaging unfixed tissue and compare to paraffin-embedded histology. An imaging protocol including dual channel detection of two contrast agents to implement virtual hematoxylin and eosin images is introduced that provides high quality imaging under both one and two photon excitation. Corresponding images of unfixed human breast tissue show that both confocal and multiphoton microscopy can reproduce the appearance of conventional histology without the need for physical sectioning. We further compare normal breast tissue and invasive cancer specimens imaged at multiple magnifications, and assess the effects of photobleaching for both modalities using the staining protocol. The results demonstrate that confocal fluorescence microscopy is a promising and cost-effective alternative to multiphoton microscopy for rapid histopathological evaluation of ex vivo breast tissue.

A comparative histopathological study of systemic candidiasis in association with experimentally induced breast cancer

PubMed Central

CHOO, Z.W.; CHAKRAVARTHI, S.; WONG, S.F.; NAGARAJA, H.S.; THANIKACHALAM, P.M.; MAK, J.W.; RADHAKRISHNAN, A.; TAY, A.

2010-01-01

Systemic candidiasis is a fungal infection which coupled with solid malignancies places patients at high risk of succumbing to the disease. Few studies have shown evidence of the relationship between systemic candidiasis and malignancy-induced immunosuppression disease especially in breast cancer. At present, animal studies that exclusively demonstrate this relationship have yet to be conducted. The exact causative mechanism of systemic candidiasis is currently under much speculation. This study therefore aimed to demonstrate this relationship by observing the histopathological changes of organs harvested from female Balb/c mice which were experimentally induced with breast cancer and inoculated with systemic candidiasis. The mice were randomly assigned to five different groups (n=12). The first group (group 1) was injected with phosphate buffer solution, the second (group 2) with systemic candidiasis, the third (group 3) with breast cancer and the final two groups (groups 4 and 5) had both candidiasis and breast cancer at two different doses of candidiasis, respectively. Inoculation of mice with systemic candidiasis was performed by an intravenous injection of Candida albicans via the tail vein following successful culture methods. Induction of mice with breast cancer occurred via injection of 4T1 cancer cells at the right axillary mammary fatpad after effective culture methods. The prepared slides with organ tissues were stained with hematoxylin and eosin, periodic acidic schiff and gomori methenamine silver stains for a histopathological analysis. Grading of primary tumour and identification of metastatic deposits, as well as scoring of inflammation and congestion in all the respective organs was conducted. Statistical tests performed to compare groups 2 and 4 showed that group 4 exhibited a highly statistically significant increase in organ inflammation and congestion (p<0.01). The median severity of candidiasis in the kidneys and liver also increased in group 4 as compared to group 2. In conclusion, based on the above evidence, systemic candidiasis significantly increased in mice with breast cancer. PMID:22966285

Thermal Injury in Human Subjects Due to 94-GHz Radio Frequency Radiation Exposures

DTIC Science & Technology

2016-02-24

5 3.1 Histopathology ...and third-degree reactions” (i.e., complete epidermal necrosis ) requires application of fluids at 48 °C for 18 min, 51 °C for 4 min, and 60 °C for 5...Human Effectiveness Directorate, Veterinary Sciences Branch (711 HPW/RHDV) for histopathologic processing and analysis. For each exposure, a

A domain-knowledge-inspired mathematical framework for the description and classification of H&E stained histopathology images.

PubMed

Massar, Melody L; Bhagavatula, Ramamurthy; Ozolek, John A; Castro, Carlos A; Fickus, Matthew; Kovačević, Jelena

2011-10-19

We present the current state of our work on a mathematical framework for identification and delineation of histopathology images-local histograms and occlusion models. Local histograms are histograms computed over defined spatial neighborhoods whose purpose is to characterize an image locally. This unit of description is augmented by our occlusion models that describe a methodology for image formation. In the context of this image formation model, the power of local histograms with respect to appropriate families of images will be shown through various proved statements about expected performance. We conclude by presenting a preliminary study to demonstrate the power of the framework in the context of histopathology image classification tasks that, while differing greatly in application, both originate from what is considered an appropriate class of images for this framework.

Adjacent slice prostate cancer prediction to inform MALDI imaging biomarker analysis

NASA Astrophysics Data System (ADS)

Chuang, Shao-Hui; Sun, Xiaoyan; Cazares, Lisa; Nyalwidhe, Julius; Troyer, Dean; Semmes, O. John; Li, Jiang; McKenzie, Frederic D.

2010-03-01

Prostate cancer is the second most common type of cancer among men in US [1]. Traditionally, prostate cancer diagnosis is made by the analysis of prostate-specific antigen (PSA) levels and histopathological images of biopsy samples under microscopes. Proteomic biomarkers can improve upon these methods. MALDI molecular spectra imaging is used to visualize protein/peptide concentrations across biopsy samples to search for biomarker candidates. Unfortunately, traditional processing methods require histopathological examination on one slice of a biopsy sample while the adjacent slice is subjected to the tissue destroying desorption and ionization processes of MALDI. The highest confidence tumor regions gained from the histopathological analysis are then mapped to the MALDI spectra data to estimate the regions for biomarker identification from the MALDI imaging. This paper describes a process to provide a significantly better estimate of the cancer tumor to be mapped onto the MALDI imaging spectra coordinates using the high confidence region to predict the true area of the tumor on the adjacent MALDI imaged slice.

Kidney biopsy in AA amyloidosis: impact of histopathology on prognosis.

PubMed

Kendi Celebi, Zeynep; Kiremitci, Saba; Ozturk, Bengi; Akturk, Serkan; Erdogmus, Siyar; Duman, Neval; Ates, Kenan; Erturk, Sehsuvar; Nergizoglu, Gokhan; Kutlay, Sim; Sengul, Sule; Ensari, Arzu; Keven, Kenan

2017-09-01

In AA amyloidosis, while kidney biopsy is widely considered for diagnosis by clinicians, there is no evidence that the detailed investigation of renal histopathology can be utilized for the prognosis and clinical outcomes. In this study, we aimed to obtain whether histopathologic findings in kidney biopsy of AA amyloidosis might have prognostic and clinical value. This is a retrospective cohort study that included 38 patients who were diagnosed with AA amyloidosis by kidney biopsy between 2005 and 2013.The kidney biopsy specimens of patients were evaluated and graded for several characteristics of histopathological lesions and their relationship with renal outcomes. Segmental amyloid deposition in the kidney biopsy was seen in 29%, global amyloid deposition in 71, diffuse involvement of glomeruli in 84.2%, focal involvement in 7%, glomerular enlargement in 53%, tubular atrophy in 75% and interstitial fibrosis in 78% of patients. Histopathologically, glomerular enlargement, interstitial fibrosis, tubular atrophy, interstitial inflammation and global amyloid deposition were significantly associated with lower estimated glomerular filtration rate (eGFR) (p = .02, p < .001, p = .001, p = .009, p = .002, respectively) in univariate analysis. In multivariate analysis, tubular atrophy was the only predictor of eGFR (p = .019 B = -20.573). In the follow-up at an average of 27 months, 18 patients developed end-stage renal disease (ESRD). Among them, global amyloid deposition was the only risk factor for the development of ESRD (p = .01, OR = 18.750, %95 CI= 2.021-173.942). This is the first study showing that the histopathological findings in kidney biopsy of AA amyloidosis might have a prognostic and clinical value for renal outcomes.

Implementation of an optical diagnosis strategy saves costs and does not impair clinical outcomes of a fecal immunochemical test-based colorectal cancer screening program.

PubMed

Vleugels, Jasper L A; Greuter, Marjolein J E; Hazewinkel, Yark; Coupé, Veerle M H; Dekker, Evelien

2017-12-01

 In an optical diagnosis strategy, diminutive polyps that are endoscopically characterized with high confidence are removed without histopathological analysis and distal hyperplastic polyps are left in situ. We evaluated the effectiveness and costs of optical diagnosis.  Using the Adenoma and Serrated pathway to Colorectal CAncer (ASCCA) model, we simulated biennial fecal immunochemical test (FIT) screening in individuals aged 55 - 75 years. In this program, we compared an optical diagnosis strategy with current histopathology assessment of all diminutive polyps. Base-case assumptions included 76 % high-confidence predictions and sensitivities of 88 %, 91 %, and 88 % for endoscopically characterizing adenomas, sessile serrated polyps, and hyperplastic polyps, respectively. Outcomes were colorectal cancer burden, number of colonoscopies, life-years, and costs.  Both the histopathology strategy and the optical diagnosis strategy resulted in 21 life-days gained per simulated individual compared with no screening. For optical diagnosis, €6 per individual was saved compared with the current histopathology strategy. These cost savings were related to a 31 % reduction in colonoscopies in which histopathology was needed for diminutive polyps. Projecting these results onto the Netherlands (17 million inhabitants), assuming a fully implemented FIT-based screening program, resulted in an annual undiscounted cost saving of € 1.7 - 2.2 million for optical diagnosis.  Implementation of optical diagnosis in a FIT-based screening program saves costs without decreasing program effectiveness when compared with current histopathology analysis of all diminutive polyps. Further work is required to evaluate how endoscopists participating in a screening program should be trained, audited, and monitored to achieve adequate competence in optical diagnosis.

Primary orbital precursor T-cell lymphoblastic lymphoma: Report of a unique case

PubMed Central

Stenman, Lisa; Persson, Marta; Enlund, Fredrik; Clasen-Linde, Erik; Stenman, Göran; Heegaard, Steffen

2016-01-01

Primary T-cell lymphoblastic lymphoma (T-LBL) in the eye region is very rare. The present study described a unique case of T-LBL involving the extraocular muscles. A 22-year-old male patient presented with a 3-week history of headache, reduced visual acuity and edema of the left eye. Clinical examination revealed left-sided exophthalmus, periorbital edema, chemosis, and reduced motility of the left eye. A magnetic resonance imaging scan revealed thickening of the left orbital muscles and a positron emission tomography-computed tomography scan also demonstrated activity in a subclavicular lymph node. Histopathological analysis of both lesions revealed infiltration by medium-sized neoplastic lymphoid cells with a high nuclear-cytoplasmic ratio and a high mitotic index. Immunostaining revealed positivity for CD2, CD3, CD99, Tia-1, and GranzymB, and variable positivity for CD4. There was no involvement of the bone marrow. Based on the clinical and histopathological findings, a diagnosis of T-LBL was made. There was no evidence of NOTCH1 mutation or rearrangements of the ETV6 and MLL genes and high-resolution array-based comparative genomic hybridization (arrayCGH) analysis revealed a normal genomic profile. The patient received chemotherapy according to the high-risk NOPHO protocol, followed by myeloablative allogenic bone marrow transplantation. At 35 months after diagnosis, the patient remained in complete first remission, but without light perception on his left eye. To the best of our knowledge, this is the first report of a case of T-LBL involving the extraocular muscles. Although primary T-LBL in the eye region is very rare, our findings demonstrate that lymphoma should be considered in the differential diagnosis of patients with similar symptoms. PMID:27900092

CT and histopathologic characteristics of lung adenocarcinoma with pure ground-glass nodules 10 mm or less in diameter.

PubMed

Wu, Fang; Tian, Shu-Ping; Jin, Xin; Jing, Rui; Yang, Yue-Qing; Jin, Mei; Zhao, Shao-Hong

2017-10-01

To evaluate CT and histopathologic features of lung adenocarcinoma with pure ground-glass nodule (pGGN) ≤10 mm in diameter. CT appearances of 148 patients (150 lesions) who underwent curative resection of lung adenocarcinoma with pGGN ≤10 mm (25 atypical adenomatous hyperplasias, 42 adenocarcinoma in situs, 38 minimally invasive adenocarcinomas, and 45 invasive pulmonary adenocarcinomas) were analyzed for lesion size, density, bubble-like sign, air bronchogram, vessel changes, margin, and tumour-lung interface. CT characteristics were compared among different histopathologic subtypes. Univariate and multivariate analysis were used to assess the relationship between CT characteristics of pGGN and lesion invasiveness, respectively. There were statistically significant differences among histopathologic subtypes in lesion size, vessel changes, and tumour-lung interface (P<0.05). Univariate analysis revealed significant differences of vessel changes, margin and tumour-lung interface between preinvasive and invasive lesions (P<0.05). Logistic regression analysis showed that the vessel changes, unsmooth margin and clear tumour-lung interface were significant predictive factors for lesion invasiveness, with odds ratios (95% CI) of 2.57 (1.17-5.62), 1.83 (1.25-2.68) and 4.25 (1.78-10.14), respectively. Invasive lesions are found in 55.3% of subcentimeter pGGNs in our cohort. Vessel changes, unsmooth margin, and clear lung-tumour interface may indicate the invasiveness of lung adenocarcinoma with subcentimeter pGGN. • Invasive lesions were found in 55.3% of lung adenocarcinomas with subcentimeter pGGNs • Lesion size, vessel changes, and tumour-lung interface showed different among histopathologic subtypes • Vessel changes, unsmooth margin and clear tumour-lung interface were predictors for lesion invasiveness.

Facial nerve hemangiomas: vascular tumors or malformations?

PubMed

Benoit, Margo McKenna; North, Paula E; McKenna, Michael J; Mihm, Martin C; Johnson, Matthew M; Cunningham, Michael J

2010-01-01

To reclassify facial nerve hemangiomas in the context of presently accepted vascular lesion nomenclature by examining histology and immunohistochemical markers. Cohort analysis of patients diagnosed with a facial nerve hemangioma between 1990 and 2008. Collaborative analysis at a specialty hospital and a major academic hospital. Seven subjects were identified on composite review of office charts, a pathology database spanning both institutions, and an encrypted patient registry. Clinical data were compiled, and hematoxylin-eosin-stained specimens were reviewed. For six patients, archived pathological tissue was available for immunohistochemical evaluation of markers specific for infantile hemangioma (glucose transporter protein isoform 1 [GLUT1] and Lewis Y antigen) and for lymphatic endothelial cells (podoplanin). All patients clinically presented with slowly progressive facial weakness at a mean age of 45 years without prior symptomatology. Hemotoxylin-eosin-stained histopathological slides showed irregularly shaped, dilated lesional vessels with flattened endothelial cells, scant smooth muscle, and no internal elastic lamina. Both podoplanin staining for lymphatic endothelial cells and GLUT1 and LewisY antigen staining for infantile hemangioma endothelial cells were negative in lesional vessels in all specimens for which immunohistochemical analysis was performed. Lesions of the geniculate ganglion historically referred to as "hemangiomas" do not demonstrate clinical, histopathological, or immunohistochemical features consistent with a benign vascular tumor, but instead are consistent with venous malformation. We propose that these lesions be classified as "venous vascular malformations of the facial nerve." This nomenclature should more accurately predict clinical behavior and guide therapeutic interventions.

The pituitary gland under infrared light - in search of a representative spectrum for homogeneous regions.

PubMed

Banas, A; Banas, K; Furgal-Borzych, A; Kwiatek, W M; Pawlicki, B; Breese, M B H

2015-04-07

The pituitary gland is a small but vital organ in the human body. It is located at the base of the brain and is often described as the master gland due to its multiple functions. The pituitary gland secretes and stores hormones, such as the thyroid-stimulating hormone (TSH), adrenocorticotropic hormone (ACTH), growth hormone (hGH), prolactin, gonadotropins, and luteinizing hormones, as well as the antidiuretic hormone (ADH). A proper diagnosis of pituitary disorders is of utmost importance as this organ participates in regulating a variety of body functions. Typical histopathological analysis provides much valuable information, but it gives no insight into the biochemical background of the changes that occur within the gland. One approach that could be used to evaluate the biochemistry of tissue sections obtained from pituitary disorders is Fourier Transform Infra-Red (FTIR) spectromicroscopy. In order to collect diagnostically valuable information large areas of tissue must be investigated. This work focuses on obtaining a unique and representative FTIR spectrum characteristic of one type of cell architecture within a sample. The idea presented is based on using hierarchical cluster analysis (HCA) for data evaluation to search for uniform patterns within samples from the perspective of FTIR spectra. The results obtained demonstrate that FTIR spectromicroscopy, combined with proper statistical evaluation, can be treated as a complementary method for histopathological analysis and ipso facto can increase the sensitivity and specificity for detecting various disorders not only for the pituitary gland, but also for other human tissues.

Prostaglandin Analogous and Antioxidant Activity Mediated Gastroprotective Action of Tabernaemontana divaricata (L.) R. Br. Flower Methanolic Extract against Chemically Induced Gastric Ulcers in Rats

PubMed Central

Mat Jais, Abdul Manan; Afreen, Adiba

2013-01-01

The present study was conducted to evaluate the antiulcerogenic effect and recognize the basic mechanism of action of Tabernaemontana divaricata (L.) R. Br. flowers. T. divaricata flower methanolic extract (TDFME) was screened for antiulcer activity versus aspirin and ethanol induced gastric ulcers at three doses—125, 250, and 500 mg/kg—orally using misoprostol as a standard. Besides histopathological examination, seven parameters, that is, ulcer index, total protein, nonprotein sulphhydryls, mucin, catalase, malondialdehyde, and superoxide dismutase levels, were estimated. In addition to HPLC profiling, GC-MS analysis and electrospray ionization—high resolution mass spectral (ESI-HRMS) analysis of crude TDFME were carried out in an attempt to identify known phytochemicals present in the extract on the basis of m/z value. The results revealed a significant increase in the levels of catalase, superoxide dismutase, mucin, and nonprotein sulphhydryls, while they revealed a reduction in ulcer index, the levels of total protein, and malondialdehyde. Histopathological observations also demonstrated the protective effect. Though all the doses of TDFME exhibited gastroprotective function, higher doses were found to be more effective. Mass spectral analysis gave a few characteristic m/z values suggesting the presence of a few known indole alkaloids, while HPLC profiling highlighted the complexity of the extract. TDFME was found to exhibit its gastroprotective effect through antioxidant mechanism and by enhancing the production of gastric mucous. PMID:24350249

Prostaglandin analogous and antioxidant activity mediated gastroprotective action of Tabernaemontana divaricata (L.) R. Br. flower methanolic extract against chemically induced gastric ulcers in rats.

PubMed

Ali Khan, Mohammed Safwan; Mat Jais, Abdul Manan; Afreen, Adiba

2013-01-01

The present study was conducted to evaluate the antiulcerogenic effect and recognize the basic mechanism of action of Tabernaemontana divaricata (L.) R. Br. flowers. T. divaricata flower methanolic extract (TDFME) was screened for antiulcer activity versus aspirin and ethanol induced gastric ulcers at three doses--125, 250, and 500 mg/kg--orally using misoprostol as a standard. Besides histopathological examination, seven parameters, that is, ulcer index, total protein, nonprotein sulphhydryls, mucin, catalase, malondialdehyde, and superoxide dismutase levels, were estimated. In addition to HPLC profiling, GC-MS analysis and electrospray ionization--high resolution mass spectral (ESI-HRMS) analysis of crude TDFME were carried out in an attempt to identify known phytochemicals present in the extract on the basis of m/z value. The results revealed a significant increase in the levels of catalase, superoxide dismutase, mucin, and nonprotein sulphhydryls, while they revealed a reduction in ulcer index, the levels of total protein, and malondialdehyde. Histopathological observations also demonstrated the protective effect. Though all the doses of TDFME exhibited gastroprotective function, higher doses were found to be more effective. Mass spectral analysis gave a few characteristic m/z values suggesting the presence of a few known indole alkaloids, while HPLC profiling highlighted the complexity of the extract. TDFME was found to exhibit its gastroprotective effect through antioxidant mechanism and by enhancing the production of gastric mucous.

Correlation between preoperative tomographic staging and definitive histopathologic results in gastric cancer at the Hospital Central Militar.

PubMed

López-Ramírez, M A; Lever-Rosas, C D; Motta-Ramírez, G A; Rebollo-Hurtado, V; Guzmán-Bárcenas, J; Fonseca-Morales, J V; Carreño-Lomeli, M A

In relation to the number of new cases diagnosed, gastric cancer is the fourth most common cancer worldwide, and the second cause of cancer death. The development of multidetector tomography has improved the preoperative staging of gastric cancer. To correlate preoperative tomographic studies with the definitive pathologic results according to the TNM staging system. A retrospective, cross-sectional study within the time frame of January 2009 to December 2013 was conducted that included the case records of 67 patients. They all had upper endoscopy and preoperative multidetector tomography examinations, underwent surgical resection, and had the corresponding histopathology study. Statistical analysis was carried out with the SPSS version 15.0 software and the sensitivity and specificity calculations were made using the Excel 2011 program for Mac. The majority of the patients included in the case series had clinical stage iii and iv disease. When compared with the histopathologic result, the overall accuracy of multidetector CT was 83% (T0 96%, T1 94%, T2 93%, T3 67%, and T4 67%) for tumor size (T) and was 70% (N0 72%, N1 73%, N2 70%, and N3 66%) for lymph node involvement (N). Overall sensitivity was 48% (T0 100%, T1 0%, T2 33%, T3 44%, and T4 65%) for T and was 41% (N0 58%, N1 56%, N2 15%, and N3 35%) for N. A strong association between the multidetector CT results and the pathology results was demonstrated through the Spearman's correlation, especially in T4 and N3. Multidetector computed tomography showed greater congruency in detecting stages T4, N0, and N3 in gastric cancer, when compared with the definitive histopathologic results. Copyright © 2017 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

Interobserver agreement for post mortem renal histopathology and diagnosis of acute tubular necrosis in critically ill patients.

PubMed

Glassford, Neil J; Skene, Alison; Guardiola, Maria B; Chan, Matthew J; Bagshaw, Sean M; Bellomo, Rinaldo; Solez, Kim

2017-12-01

The renal histopathology of critically ill patients dying with acute kidney injury (AKI) in intensive care units of high income countries remains uncertain. Retrospective observational assessment of interobserver agreement in the reporting of renal post mortem histopathology, and the ability of pathologists blinded to the clinical context to independently identify the presence of pre-mortem AKI from digital images of histological sections from 34 critically ill patients dying in teaching hospitals in Australia and Canada. We identified a heterogeneous cohort with a median age of 65 years (interquartile range [IQR], 56.5-77), APACHE II score of 27 (IQR, 19-33), and sepsis as the most common admission diagnosis (12/34; 35%). The most common proximate causes of death were cardiovascular (19/34; 56%) and respiratory (7/34; 21%) failure. AKI was common, with 23 patients (68%) developing RIFLE-F AKI, and 21 patients (62%) receiving renal replacement therapy. Structured reporting for tubular inflammation showed excellent agreement (kappa = 1), but no other subdomain demonstrated better than moderate agreement (kappa < 0.6). Only fair agreement (55.9% of cases; kappa = 0.23) was demonstrated on the diagnosis of moderate to severe acute tubular necrosis (ATN). Pathologist A predicted RIFLE-I or worse AKI with the diagnosis of ATN, with an overall accuracy of 61.8%; pathologist B predicted AKI with an accuracy of 35.3%. Post mortem assessment of the renal histopathology in critically ill patients is neither robust nor reproducible; independent pathologists agree poorly on the diagnosis of ATN, and their structural assessment appears dissociated from ante-mortem renal function.

Molecular Pathology of Patient Tumors, Patient-Derived Xenografts, and Cancer Cell Lines.

PubMed

Guo, Sheng; Qian, Wubin; Cai, Jie; Zhang, Likun; Wery, Jean-Pierre; Li, Qi-Xiang

2016-08-15

The Cancer Genome Atlas (TCGA) project has generated abundant genomic data for human cancers of various histopathology types and enabled exploring cancer molecular pathology per big data approach. We developed a new algorithm based on most differentially expressed genes (DEG) per pairwise comparisons to calculate correlation coefficients to be used to quantify similarity within and between cancer types. We systematically compared TCGA cancers, demonstrating high correlation within types and low correlation between types, thus establishing molecular specificity of cancer types and an alternative diagnostic method largely equivalent to histopathology. Different coefficients for different cancers in study may reveal that the degree of the within-type homogeneity varies by cancer types. We also performed the same calculation using the TCGA-derived DEGs on patient-derived xenografts (PDX) of different histopathology types corresponding to the TCGA types, as well as on cancer cell lines. We, for the first time, demonstrated highly similar patterns for within- and between-type correlation between PDXs and patient samples in a systematic study, confirming the high relevance of PDXs as surrogate experimental models for human diseases. In contrast, cancer cell lines have drastically reduced expression similarity to both PDXs and patient samples. The studies also revealed high similarity between some types, for example, LUSC and HNSCC, but low similarity between certain subtypes, for example, LUAD and LUSC. Our newly developed algorithm seems to be a practical diagnostic method to classify and reclassify a disease, either human or xenograft, with better accuracy than traditional histopathology. Cancer Res; 76(16); 4619-26. ©2016 AACR. ©2016 American Association for Cancer Research.

Rapid Screening of Cancer Margins in Tissue with Multimodal Confocal Microscopy

PubMed Central

Gareau, Daniel S.; Jeon, Hana; Nehal, Kishwer S.; Rajadhyaksha, Milind

2012-01-01

Background Complete and accurate excision of cancer is guided by the examination of histopathology. However, preparation of histopathology is labor intensive and slow, leading to insufficient sampling of tissue and incomplete and/or inaccurate excision of margins. We demonstrate the potential utility of multimodal confocal mosaicing microscopy for rapid screening of cancer margins, directly in fresh surgical excisions, without the need for conventional embedding, sectioning or processing. Materials/Methods A multimodal confocal mosaicing microscope was developed to image basal cell carcinoma margins in surgical skin excisions, with resolution that shows nuclear detail. Multimodal contrast is with fluorescence for imaging nuclei and reflectance for cellular cytoplasm and dermal collagen. Thirtyfive excisions of basal cell carcinomas from Mohs surgery were imaged, and the mosaics analyzed by comparison to the corresponding frozen pathology. Results Confocal mosaics are produced in about 9 minutes, displaying tissue in fields-of-view of 12 mm with 2X magnification. A digital staining algorithm transforms black and white contrast to purple and pink, which simulates the appearance of standard histopathology. Mosaicing enables rapid digital screening, which mimics the examination of histopathology. Conclusions Multimodal confocal mosaicing microscopy offers a technology platform to potentially enable real-time pathology at the bedside. The imaging may serve as an adjunct to conventional histopathology, to expedite screening of margins and guide surgery toward more complete and accurate excision of cancer. PMID:22721570

[Effects of nano-selenium on antioxidant capacity and histopathology of Cyprinus carpio liver under fluoride stress].

PubMed

Chen, Jian-Jie; Cao, Jin-Ling; Luo, Yong-Ju; Li, Ju-Yin

2013-10-01

To evaluate the protection effect of nano-selenium (NSe) on the antioxidant capacity and histopathology of Cyprinus carpio liver under fluoride stress, a total of 750 C. carpio individuals were randomly divided into five groups, i. e., no fluoride stress and NSe addition (CK), fluoride (100 mg F- x L(-1))-stressed (FS), and fluoride-stressed plus NSe added with a dosage of 0.1 mg Se x L(-1) (NSe L), 0.5 mg Se x L(-1) (NSe M), and 1.0 mg Se x kg(-1)(NSe H). The NSe was mixed with fish foods, and the fishes of FS and NSe groups were exposed to the fluoride stress for 30 days. As compared with CK, fluoride stress decreased the SOD, CAT, and GSH-Px activities and increased the MDA content of C. carpio liver, and induced a definite damage on the histopathology of the liver. Compared with FS, NSe increased the liver SOD, CAT, and GSH-Px activities, decreased the liver MDA content, and mitigated the damage of fluoride stress on the histopathology of the liver. The results demonstrated that in some extent, the addition of NSe into fish foods could alleviate the decline of the antioxidant capacity of C. carpio liver and the damage on the liver histopathology caused by fluoride stress.

Hypopigmented macules secondary to imatinib for the treatment of chronic myeloid leukemia: a histopathologic and immunohistochemical study.

PubMed

Llamas-Velasco, Mar; Fraga, Javier; Kutzner, Heinz; Steegmann, Juan Luis; García-Diez, Amaro; Requena, Luis

2014-05-01

A few series addressing the cutaneous side effects related to imatinib in the skin have been published, but only one described scarce histopathologic information in seven patients. To characterize these lesions and compare the number of melanocytes between hypopigmented lesions and normal appearing skin. We retrieved clinical data of the patients and performed 24 skin biopsies (13 from hypopigmented skin and 11 from normal-appearing skin) within a cohort of 41 patients with chronic myeloid leukemia treated with imatinib. We classified the biopsies into three patterns. About 45% of patients presented with periocular hypopigmentation. Perifollicular fibrosis was observed in hypopigmented skin biopsies (76.9%) and in normal-appearing skin (45.5%). Epidermal melanin, as determined with Masson-Fontana staining, and melanocyte number, as evaluated with MiTF, Melan A and c-kit immunostains, were lower in hypopigmented skin. Histopathologic study of hypopigmented macules demonstrates the presence of melanin with a statistically significant decrease in the number of melanocytes. Therefore, these findings differ from vitiligo, as melanocytes are present. Three histopathological patterns may be found, namely (a) perifollicular fibrosis, (b) lichen planopilaris-like and (c) apparently normal skin. One of the most striking histopathologic finding consisted of the presence of perifollicular fibrosis in both hypopigmented lesions and apparently normal skin. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Non-thermal plasma mills bacteria: Scanning electron microscopy observations

NASA Astrophysics Data System (ADS)

Lunov, O.; Churpita, O.; Zablotskii, V.; Deyneka, I. G.; Meshkovskii, I. K.; Jäger, A.; Syková, E.; Kubinová, Š.; Dejneka, A.

2015-02-01

Non-thermal plasmas hold great promise for a variety of biomedical applications. To ensure safe clinical application of plasma, a rigorous analysis of plasma-induced effects on cell functions is required. Yet mechanisms of bacteria deactivation by non-thermal plasma remain largely unknown. We therefore analyzed the influence of low-temperature atmospheric plasma on Gram-positive and Gram-negative bacteria. Using scanning electron microscopy, we demonstrate that both Gram-positive and Gram-negative bacteria strains in a minute were completely destroyed by helium plasma. In contrast, mesenchymal stem cells (MSCs) were not affected by the same treatment. Furthermore, histopathological analysis of hematoxylin and eosin-stained rat skin sections from plasma-treated animals did not reveal any abnormalities in comparison to control ones. We discuss possible physical mechanisms leading to the shred of bacteria under non-thermal plasma irradiation. Our findings disclose how helium plasma destroys bacteria and demonstrates the safe use of plasma treatment for MSCs and skin cells, highlighting the favorability of plasma applications for chronic wound therapy.

Non-thermal plasma mills bacteria: Scanning electron microscopy observations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lunov, O., E-mail: lunov@fzu.cz; Churpita, O.; Zablotskii, V.

2015-02-02

Non-thermal plasmas hold great promise for a variety of biomedical applications. To ensure safe clinical application of plasma, a rigorous analysis of plasma-induced effects on cell functions is required. Yet mechanisms of bacteria deactivation by non-thermal plasma remain largely unknown. We therefore analyzed the influence of low-temperature atmospheric plasma on Gram-positive and Gram-negative bacteria. Using scanning electron microscopy, we demonstrate that both Gram-positive and Gram-negative bacteria strains in a minute were completely destroyed by helium plasma. In contrast, mesenchymal stem cells (MSCs) were not affected by the same treatment. Furthermore, histopathological analysis of hematoxylin and eosin–stained rat skin sections frommore » plasma–treated animals did not reveal any abnormalities in comparison to control ones. We discuss possible physical mechanisms leading to the shred of bacteria under non-thermal plasma irradiation. Our findings disclose how helium plasma destroys bacteria and demonstrates the safe use of plasma treatment for MSCs and skin cells, highlighting the favorability of plasma applications for chronic wound therapy.« less

Oral submucous fibrosis: A clinico-histopathological correlational study.

PubMed

Biradar, Sudharani Basawaraj; Munde, Anita Dnyanoba; Biradar, Basawaraj Chanabasappa; Shaik, Safia Shoeb; Mishra, Shweta

2018-01-01

The aim of this study was to correlate the clinical staging (clinical severity) with the histopathological staging (histopathological changes) of oral submucous fibrosis (OSF) patients, which would further assist the clinicians to formulate a definite treatment plan. The study group consisted of 50 subjects who were clinically and histologically diagnosed as OSF. Detailed information was gathered in a pretested proforma with emphasis on the various addictions. The clinical findings were noted; punch biopsy was performed followed by histological examination. Clinical and histological staging were divided into four stages, as Stages I-IV according to Khanna and Andrade classification. The 50 subjects were in the age range of 18-70 years, of which 20 patients were in clinical Group III, 15 were in histopathological stage III, 2, 1, and 2 in Stage II, Stage I, and Stage IV, respectively, out of 5 patients in clinical Group IV, 4 were in histopathological staging IV and 1 was in Stage III, out of 5 patients in clinical Group I, 3 and 2 were in histologic Stages II and I, respectively. Statistical analysis with Chi-square test showed high significance with P < 0.001. The correlation of clinical and histopathological staging was found to be highly significant, thus suggesting that the subject with clinically advanced OSF had extensive fibrosis histologically.

Fruit peel polyphenols demonstrate substantial anti-tumour effects in the model of breast cancer.

PubMed

Kubatka, Peter; Kapinová, Andrea; Kello, Martin; Kruzliak, Peter; Kajo, Karol; Výbohová, Desanka; Mahmood, Silvia; Murin, Radovan; Viera, Tischlerová; Mojžiš, Ján; Zulli, Anthony; Péč, Martin; Adamkov, Marián; Kassayová, Monika; Bojková, Bianka; Stollárová, Nadežda; Dobrota, Dušan

2016-04-01

Fruit and vegetable intake is inversely correlated with cancer; thus, it is proposed that an extract of phytochemicals as present in whole fruits, vegetables, or grains may have anti-carcinogenic properties. Thus, the anti-tumour effects of fruit peel polyphenols (Flavin7) in the chemoprevention of N-methyl-N-nitrosourea-induced mammary carcinogenesis in female rats were evaluated. Lyophilized substance of Flavin7 (F7) was administered at two concentrations of 0.3 and 3 % through diet. The experiment was terminated 14 weeks after carcinogen administration, and mammary tumours were removed and prepared for histopathological and immunohistochemical analysis. In addition, using an in vitro cytotoxicity assay, apoptosis and proliferation after F7 treatment in human breast adenocarcinoma (MCF-7) cells were performed. High-dose F7 suppressed tumour frequency by 58 % (P < 0.001), tumour incidence by 24 % (P < 0.05), and lengthened latency by 8 days (P > 0.05) in comparison with the control rats, whereas lower dose of F7 was less effective. Histopathological analysis of tumours showed significant decrease in the ratio of high-/low-grade carcinomas after high-dose F7 treatment. Immunohistochemical analysis of rat carcinoma cells in vivo found a significant increase in caspase-3 expression and significant decrease in Bcl-2, Ki67, and VEGFR-2 expression in the high-dose group. Both doses demonstrated significant positive effects on plasma lipid metabolism in rats. F7 significantly decreased survival of MCF-7 cells in vitro in MTT assay by dose- and time-dependent manner compared to control. F7 prevented cell cycle progression by significant enrichment in G1 cell populations. Incubation with F7 showed significant increase in the percentage of annexin V-/PI-positive MCF-7 cells and DNA fragmentation. Our results reveal a substantial tumour-suppressive effect of F7 in the breast cancer model. We propose that the effects of phytochemicals present in this fruit extract are responsible for observed potent anti-cancer activities.

Clinical and Histopathological Investigation of Seborrheic Keratosis

PubMed Central

Roh, Nam Kyung; Hahn, Hyung Jin; Lee, Yang Won; Choe, Yong Beom

2016-01-01

Background Seborrheic keratosis (SK) is one of the most common epidermal tumors of the skin. However, only a few large-scale clinicohistopathological investigations have been conducted on SK or on the possible correlation between histopathological SK subtype and location. Objective The aim of this study was to analyze the clinical and histopathological features of a relatively large number of cases of diagnosed SK. Methods Two hundred and seventy-one pathology slides of skin tissue from patients with clinically diagnosed SK and 206 cases of biopsy-proven SK were analyzed. The biopsy-proven cases of SK were assessed for histopathological subclassification. The demographic, clinical, and histopathological data of the patients were collected for analysis of associated factors. Results The most frequent histopathological subtype was the acanthotic type, followed by mixed, hyperkeratotic, melanoacanthoma, clonal, irritated, and adenoid types; an unexpectedly high percentage (9.2%) of the melanoacanthoma variant was observed. The adenoid type was more common in sun-exposed sites than in sun-protected sites (p=0.028). Premalignant and malignant entities together represented almost one-quarter (24.2%) of the clinicopathological mismatch cases (i.e., mismatch between the clinical and histopathological diagnoses). Regarding the location of SK development, the frequency of mismatch for the sun-exposed areas was significantly higher than that for sun-protected areas (p=0.043). Conclusion The adenoid type was more common in sun-exposed sites. Biopsy sampling should be performed for lesions situated in sun-exposed areas to exclude other premalignant or malignant diseases. PMID:27081260

Fatty Acid Metabolism is Associated With Disease Severity After H7N9 Infection.

PubMed

Sun, Xin; Song, Lijia; Feng, Shuang; Li, Li; Yu, Hongzhi; Wang, Qiaoxing; Wang, Xing; Hou, Zhili; Li, Xue; Li, Yu; Zhang, Qiuyang; Li, Kuan; Cui, Chao; Wu, Junping; Qin, Zhonghua; Wu, Qi; Chen, Huaiyong

2018-06-22

Human infections with the H7N9 virus could lead to lung damage and even multiple organ failure, which is closely associated with a high mortality rate. However, the metabolic basis of such systemic alterations remains unknown. This study included hospitalized patients (n = 4) with laboratory-confirmed H7N9 infection, healthy controls (n = 9), and two disease control groups comprising patients with pneumonia (n = 9) and patients with pneumonia who received steroid treatment (n = 10). One H7N9-infected patient underwent lung biopsy for histopathological analysis and expression analysis of genes associated with lung homeostasis. H7N9-induced systemic alterations were investigated using metabolomic analysis of sera collected from the four patients by using ultra-performance liquid chromatography-mass spectrometry. Chest digital radiography and laboratory tests were also conducted. Two of the four patients did not survive the clinical treatments with antiviral medication, steroids, and oxygen therapy. Biopsy revealed disrupted expression of genes associated with lung epithelial integrity. Histopathological analysis demonstrated severe lung inflammation after H7N9 infection. Metabolomic analysis indicated that fatty acid metabolism may be inhibited during H7N9 infection. Serum levels of palmitic acid, erucic acid, and phytal may negatively correlate with the extent of lung inflammation after H7N9 infection. The changes in fatty acid levels may not be due to steroid treatment or pneumonia. Altered structural and secretory properties of the lung epithelium may be associated with the severity of H7N9-infection-induced lung disease. Moreover, fatty acid metabolism level may predict a fatal outcome after H7N9 virus infection. Copyright © 2018. Published by Elsevier B.V.

Near-infrared Raman spectroscopy for estimating biochemical changes associated with different pathological conditions of cervix

NASA Astrophysics Data System (ADS)

Daniel, Amuthachelvi; Prakasarao, Aruna; Ganesan, Singaravelu

2018-02-01

The molecular level changes associated with oncogenesis precede the morphological changes in cells and tissues. Hence molecular level diagnosis would promote early diagnosis of the disease. Raman spectroscopy is capable of providing specific spectral signature of various biomolecules present in the cells and tissues under various pathological conditions. The aim of this work is to develop a non-linear multi-class statistical methodology for discrimination of normal, neoplastic and malignant cells/tissues. The tissues were classified as normal, pre-malignant and malignant by employing Principal Component Analysis followed by Artificial Neural Network (PC-ANN). The overall accuracy achieved was 99%. Further, to get an insight into the quantitative biochemical composition of the normal, neoplastic and malignant tissues, a linear combination of the major biochemicals by non-negative least squares technique was fit to the measured Raman spectra of the tissues. This technique confirms the changes in the major biomolecules such as lipids, nucleic acids, actin, glycogen and collagen associated with the different pathological conditions. To study the efficacy of this technique in comparison with histopathology, we have utilized Principal Component followed by Linear Discriminant Analysis (PC-LDA) to discriminate the well differentiated, moderately differentiated and poorly differentiated squamous cell carcinoma with an accuracy of 94.0%. And the results demonstrated that Raman spectroscopy has the potential to complement the good old technique of histopathology.

Confocal microscopy to guide laser ablation of basal cell carinoma: a preliminary feasibility study

NASA Astrophysics Data System (ADS)

Larson, Bjorg A.; Sierra, Heidy; Chen, Jason; Rajadhyaksha, Milind

2013-03-01

Laser ablation may be a promising method for removal of skin lesions, with the potential for better cosmetic outcomes and reduced scarring and infection. An obstacle to implementing laser ablation is that the treatment leaves no tissue for histopathological analysis. Pre-operative and intra-operative mapping of BCCs using confocal microscopy may guide the ablation of the tumor until all tumor is removed. We demonstrate preliminary feasibility of confocal microscopy to guide laser ablation of BCCs in freshly excised tissue from Mohs surgery. A 2940 nm Er:YAG laser provides efficient ablation of tumor with reduced thermal damage to the surrounding tissue.

Primary hyperparathyroidism with classic and severe skeletal involvement.

PubMed

Sandoval, Mark Anthony S; Paz-Pacheco, Elizabeth

2010-08-26

A 63-year-old woman has had multiple repeated fractures. A diagnosis of primary hyperparathyroidism (PHPT) was made after she was found to be hypercalcaemic with an elevated level of intact parathyroid hormone (iPTH). Radiographs revealed classic and severe bone findings in PHPT, features which were common in the past but are thought to be rare at this modern age. She also had nephrolithiasis and osteoporosis. An enlarged parathyroid gland was seen on ultrasound and CT scan, and hyperfunction was demonstrated by scintigraphy. Parathyroidectomy was performed. Histopathologic analysis revealed a parathyroid adenoma. She developed the hungry-bone syndrome 7 days postoperatively, which resolved with with administration of calcium and calcitriol.

Delayed vertebral body collapse after stereotactic radiosurgery and radiofrequency ablation: Case report with histopathologic-MRI correlation.

PubMed

Wallace, Adam N; Vyhmeister, Ross; Hsi, Andy C; Robinson, Clifford G; Chang, Randy O; Jennings, Jack W

2015-12-01

Stereotactic radiosurgery and percutaneous radiofrequency ablation are emerging therapies for pain palliation and local control of spinal metastases. However, the post-treatment imaging findings are not well characterized and the risk of long-term complications is unknown. We present the case of a 46-year-old woman with delayed vertebral body collapse after stereotactic radiosurgery and radiofrequency ablation of a painful lumbar metastasis. Histopathologic-MRI correlation confirmed osteonecrosis as the underlying etiology and demonstrated that treatment-induced vascular fibrosis and tumor progression can have identical imaging appearances. © The Author(s) 2015.

Occurrence of fruiting structures allows determination of Purpureocillium lilacinum as an inciting agent of pleuritis and pneumonia in a loggerhead sea turtle (Caretta caretta) by histopathologic correlation to culture.

PubMed

Schumacher, V L; Mangold, B; Lenzycki, J; Hinckley, L; Sutton, D A; Frasca, S

2014-10-01

Purpureocillium lilacinum and Beauveria bassiana were isolated from lung sampled at necropsy of a 12 year-old female loggerhead sea turtle (Caretta caretta) that had displayed abnormal buoyancy. Histopathologic evaluation revealed pleuritis and pneumonia with non-melanized, septate hyphae and fruiting structures identical to those of P. lilacinum. This case emphasizes the importance of a histological correlate to fungal culture when environmental fungi are isolated and demonstrates the infrequent phenomenon of fruiting or conidial production in tissue.

Short Time Exposure (STE) test in conjunction with Bovine Corneal Opacity and Permeability (BCOP) assay including histopathology to evaluate correspondence with the Globally Harmonized System (GHS) eye irritation classification of textile dyes.

PubMed

Oliveira, Gisele Augusto Rodrigues; Ducas, Rafael do Nascimento; Teixeira, Gabriel Campos; Batista, Aline Carvalho; Oliveira, Danielle Palma; Valadares, Marize Campos

2015-09-01

Eye irritation evaluation is mandatory for predicting health risks in consumers exposed to textile dyes. The two dyes, Reactive Orange 16 (RO16) and Reactive Green 19 (RG19) are classified as Category 2A (irritating to eyes) based on the UN Globally Harmonized System for classification (UN GHS), according to the Draize test. On the other hand, animal welfare considerations and the enforcement of a new regulation in the EU are drawing much attention in reducing or replacing animal experiments with alternative methods. This study evaluated the eye irritation of the two dyes RO16 and RG19 by combining the Short Time Exposure (STE) and the Bovine Corneal Opacity and Permeability (BCOP) assays and then comparing them with in vivo data from the GHS classification. The STE test (first level screening) categorized both dyes as GHS Category 1 (severe irritant). In the BCOP, dye RG19 was also classified as GHS Category 1 while dye RO16 was classified as GHS no prediction can be made. Both dyes caused damage to the corneal tissue as confirmed by histopathological analysis. Our findings demonstrated that the STE test did not contribute to arriving at a better conclusion about the eye irritation potential of the dyes when used in conjunction with the BCOP test. Adding the histopathology to the BCOP test could be an appropriate tool for a more meaningful prediction of the eye irritation potential of dyes. Copyright © 2015 Elsevier Ltd. All rights reserved.

96 h LC50, behavioural alterations and histopathological effects due to wastewater toxicity in a freshwater fish Channa punctatus.

PubMed

Kaur, Rajbir; Dua, Anish

2015-04-01

The aim of the study was to evaluate the toxic impact of wastewater from sites 1 and 2 of Tung Dhab drain in the state of Punjab, India, on fish behaviour, morphology and gill histopathological biomarkers in comparison to control group. Static non-renewal tests were conducted for 96 h to determine LC50 of the wastewater for both sites using five concentrations (6.25-100%). Fish were regularly noticed for any deviation in behaviour and external morphology. Physico-chemical analysis of wastewater was done using standard methods recommended by APHA/AWWA/WEF (2005). Chronic toxicity tests were conducted for 15 and 30 days with sublethal concentrations of wastewater (50-90% of LC50) and gill histopathology was assessed. Wastewater near a paper mill was more toxic as observed from LC50 values of 72.45%. There was evident deterioration of water quality as the recorded values of some parameters were higher than the standard discharge limits. The test fish exhibited increased air gulping and surfacing, erratic movements initially and decreased opercular movements as the exposure period increased. Morphological observations include increased body colouration, mucus secretion, scale loss and haemorrhages on the skin and lower lip. Alterations in the gill histology such as complete lamellar fusion, epithelial lifting and intraepithelial oedema, haemorrhages, lamellar necrosis and aneurysm were noted in the test fish. Results demonstrate that the fish exposed to wastewater from both sites showed significantly greater change in gill organ index (IG) as compared to control fish for 15 and 30 days.

Graph run-length matrices for histopathological image segmentation.

PubMed

Tosun, Akif Burak; Gunduz-Demir, Cigdem

2011-03-01

The histopathological examination of tissue specimens is essential for cancer diagnosis and grading. However, this examination is subject to a considerable amount of observer variability as it mainly relies on visual interpretation of pathologists. To alleviate this problem, it is very important to develop computational quantitative tools, for which image segmentation constitutes the core step. In this paper, we introduce an effective and robust algorithm for the segmentation of histopathological tissue images. This algorithm incorporates the background knowledge of the tissue organization into segmentation. For this purpose, it quantifies spatial relations of cytological tissue components by constructing a graph and uses this graph to define new texture features for image segmentation. This new texture definition makes use of the idea of gray-level run-length matrices. However, it considers the runs of cytological components on a graph to form a matrix, instead of considering the runs of pixel intensities. Working with colon tissue images, our experiments demonstrate that the texture features extracted from "graph run-length matrices" lead to high segmentation accuracies, also providing a reasonable number of segmented regions. Compared with four other segmentation algorithms, the results show that the proposed algorithm is more effective in histopathological image segmentation.

The Age-Related Macular Degeneration Complex: Linking Epidemiology and Histopathology Using the Minnesota Grading System (The Inaugural Frederick C. Blodi Lecture).

PubMed

Olsen, Timothy W; Bottini, Alexander R; Mendoza, Pia; Grossniklausk, Hans E

2015-09-01

To describe the histopathologic findings of the four stages of age-related macular degeneration (AMD) as defined by the Age-Related Eye Disease Study (AREDS) using the Minnesota grading system (MGS). There are no animal models for AMD. Eye banks enable access to human tissue with AMD. The level of AMD (grades 1 through 4) as defined by AREDS is determined ex vivo using the MGS. The AREDS has the largest collection to date of prospectively gathered data on the natural history of AMD. Since the MGS uses the same clinical criteria as AREDS, the addition of histopathologic findings of graded tissue confirms important pathophysiology at each stage of AMD. Four eye bank eyes were graded according to the MGS. Only the right eyes were dissected for phenotype grading. The fellow (left) eyes were fixed for histopathologic study. The eyes were serially sectioned (7 μm) through the macula. Individual slides were examined, and a two-dimensional reconstruction of the topography of the macula was created for each donor. Selected, unstained slides were used for immunohistochemical staining. In one donor, portions of tissue were obtained for transmission electron microscopic (TEM) processing. Donor 1 had a rare hard, nodular druse (MGS1). Donor 2 had intermediate confluent drusen (MGS2). Donor 3 had numerous intermediate drusen (MGS3) in the right eye. Histopathology of the fellow left showed basal laminar deposits (BLamD), soft drusen, and an area of occult choroidal neovascularization underlying the retinal pigment epithelium (RPE) with endothelial cells (CD31-positive). Donor 4 also had MGS 3 along with reticular pseudodrusen (RPD). Histologic and TEM examination demonstrated diffuse BLamD, thickening of Bruch's membrane, hard drusen, and focal nodules underlying the RPE that corresponded to the RPD. EM examination demonstrated both BLamD and electron-dense material located just external to the elastic layer of Bruch's membrane. Eye bank eyes graded using the MGS serve as an important link to the phenotypic and epidemiologic data from the AREDS. Thus, the MGS serves as a system to study the histopathology at each stage of AMD to better understand the relevant pathophysiologic changes in disease progression.

The Age-Related Macular Degeneration Complex: Linking Epidemiology and Histopathology Using the Minnesota Grading System (The Inaugural Frederick C. Blodi Lecture)

PubMed Central

Olsen, Timothy W.; Bottini, Alexander R.; Mendoza, Pia; Grossniklausk, Hans E.

2015-01-01

Purpose To describe the histopathologic findings of the four stages of age-related macular degeneration (AMD) as defined by the Age-Related Eye Disease Study (AREDS) using the Minnesota grading system (MGS). Clinical Relevance There are no animal models for AMD. Eye banks enable access to human tissue with AMD. The level of AMD (grades 1 through 4) as defined by AREDS is determined ex vivo using the MGS. The AREDS has the largest collection to date of prospectively gathered data on the natural history of AMD. Since the MGS uses the same clinical criteria as AREDS, the addition of histopathologic findings of graded tissue confirms important pathophysiology at each stage of AMD. Methods Four eye bank eyes were graded according to the MGS. Only the right eyes were dissected for phenotype grading. The fellow (left) eyes were fixed for histopathologic study. The eyes were serially sectioned (7 μm) through the macula. Individual slides were examined, and a two-dimensional reconstruction of the topography of the macula was created for each donor. Selected, unstained slides were used for immunohistochemical staining. In one donor, portions of tissue were obtained for transmission electron microscopic (TEM) processing. Results Donor 1 had a rare hard, nodular druse (MGS1). Donor 2 had intermediate confluent drusen (MGS2). Donor 3 had numerous intermediate drusen (MGS3) in the right eye. Histopathology of the fellow left showed basal laminar deposits (BLamD), soft drusen, and an area of occult choroidal neovascularization underlying the retinal pigment epithelium (RPE) with endothelial cells (CD31-positive). Donor 4 also had MGS 3 along with reticular pseudodrusen (RPD). Histologic and TEM examination demonstrated diffuse BLamD, thickening of Bruch’s membrane, hard drusen, and focal nodules underlying the RPE that corresponded to the RPD. EM examination demonstrated both BLamD and electron-dense material located just external to the elastic layer of Bruch’s membrane. Conclusion Eye bank eyes graded using the MGS serve as an important link to the phenotypic and epidemiologic data from the AREDS. Thus, the MGS serves as a system to study the histopathology at each stage of AMD to better understand the relevant pathophysiologic changes in disease progression. PMID:27895380

High-throughput 3D whole-brain quantitative histopathology in rodents

PubMed Central

Vandenberghe, Michel E.; Hérard, Anne-Sophie; Souedet, Nicolas; Sadouni, Elmahdi; Santin, Mathieu D.; Briet, Dominique; Carré, Denis; Schulz, Jocelyne; Hantraye, Philippe; Chabrier, Pierre-Etienne; Rooney, Thomas; Debeir, Thomas; Blanchard, Véronique; Pradier, Laurent; Dhenain, Marc; Delzescaux, Thierry

2016-01-01

Histology is the gold standard to unveil microscopic brain structures and pathological alterations in humans and animal models of disease. However, due to tedious manual interventions, quantification of histopathological markers is classically performed on a few tissue sections, thus restricting measurements to limited portions of the brain. Recently developed 3D microscopic imaging techniques have allowed in-depth study of neuroanatomy. However, quantitative methods are still lacking for whole-brain analysis of cellular and pathological markers. Here, we propose a ready-to-use, automated, and scalable method to thoroughly quantify histopathological markers in 3D in rodent whole brains. It relies on block-face photography, serial histology and 3D-HAPi (Three Dimensional Histology Analysis Pipeline), an open source image analysis software. We illustrate our method in studies involving mouse models of Alzheimer’s disease and show that it can be broadly applied to characterize animal models of brain diseases, to evaluate therapeutic interventions, to anatomically correlate cellular and pathological markers throughout the entire brain and to validate in vivo imaging techniques. PMID:26876372

Histopathologic analysis of successful endothelial keratoplasty following multiple failed keratoplasties.

PubMed

Epstein, Rachel H; Mamalis, Nick; Price, Francis W; Price, Marianne O

2015-02-01

A 68-year-old woman with bilateral keratoconus presented with persistent visual acuity deficits following cataract extraction with a neodymium:YAG capsulotomy in the right eye 2 years earlier. Penetrating keratoplasty (PKP) had been performed for keratoconus in the right eye without complications until steroid drops were discontinued after 10 years because of persistent elevated intraocular pressure. The right eye experienced immunologic rejection and failure of 3 PKPs, 1 Descemet-stripping endothelial keratoplasty (DSEK), and a trabeculectomy with an eventual anatomically successful DSEK before the patient died at 95 years of age. The left eye improved following a single PKP. Postmortem histopathologic analysis of the cornea showed an anatomically successful DSEK graft with intact donor Descemet membrane and viable graft endothelial cells. To our knowledge, this is the first histopathologic analysis of an anatomically successful DSEK after multiple failed PKPs and trabeculectomy. The course in this case supports early consideration of lamellar keratoplasty, especially in patients with ocular comorbidities. No author has a financial or proprietary interest in any material or method mentioned. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Visual Pattern Analysis in Histopathology Images Using Bag of Features

NASA Astrophysics Data System (ADS)

Cruz-Roa, Angel; Caicedo, Juan C.; González, Fabio A.

This paper presents a framework to analyse visual patterns in a collection of medical images in a two stage procedure. First, a set of representative visual patterns from the image collection is obtained by constructing a visual-word dictionary under a bag-of-features approach. Second, an analysis of the relationships between visual patterns and semantic concepts in the image collection is performed. The most important visual patterns for each semantic concept are identified using correlation analysis. A matrix visualization of the structure and organization of the image collection is generated using a cluster analysis. The experimental evaluation was conducted on a histopathology image collection and results showed clear relationships between visual patterns and semantic concepts, that in addition, are of easy interpretation and understanding.

Histopathology of breast cancer after magnetic resonance-guided high-intensity focused ultrasound and radiofrequency ablation.

PubMed

Knuttel, Floortje M; Waaijer, Laurien; Merckel, Laura G; van den Bosch, Maurice A A J; Witkamp, Arjen J; Deckers, Roel; van Diest, Paul J

2016-08-01

Magnetic resonance-guided high-intensity focused ultrasound (MR-HIFU) ablation and radiofrequency ablation (RFA) are being researched as possible substitutes for surgery in breast cancer patients. The histopathological appearance of ablated tissue has not been studied in great detail. This study aimed to compare histopathological features of breast cancer after MR-HIFU ablation and RFA. MR-HIFU ablation and RFA were performed in- and ex-vivo. Tumours in six mastectomy specimens were partially ablated with RFA or MR-HIFU. In-vivo MR-HIFU ablation was performed 3-6 days before excision; RFA was performed in the operation room. Tissue was fixed in formalin and processed to haematoxylin and eosin (H&E) and cytokeratin-8 (CK-8)-stained slides. Morphology and cell viability were assessed. Ex-vivo ablation resulted in clear morphological changes after RFA versus subtle differences after MR-HIFU. CK-8 staining was decreased or absent. H&E tended to underestimate the size of thermal damage. In-vivo MR-HIFU resulted in necrotic-like changes. Surprisingly, some ablated lesions were CK-8-positive. Histopathology after in-vivo RFA resembled ex-vivo RFA, with hyper-eosinophilic stroma and elongated nuclei. Lesion borders were sharp after MR-HIFU and indistinct after RFA. Histopathological differences between MR-HIFU-ablated tissue and RF-ablated tissue were demonstrated. CK-8 was more reliable for cell viability assessment than H&E when used directly after ablation, while H&E was more reliable in ablated tissue left in situ for a few days. Our results contribute to improved understanding of histopathological features in breast cancer lesions treated with minimally invasive ablative techniques. © 2016 John Wiley & Sons Ltd.

Gastroprotective effect of esculin on ethanol-induced gastric lesion in mice.

PubMed

Li, Weifeng; Wang, Yu; Wang, Xiumei; Zhang, Hailin; He, Zehong; Zhi, Wenbing; Liu, Fang; Niu, Xiaofeng

2017-04-01

The gastroprotective effect of esculin was investigated in a mouse model of ethanol-induced gastric lesion. Administration of esculin at doses of 5, 10, and 20 mg/kg body weight prior to ethanol ingestion led to significant gastroprotection compared with untreated mice. Gastric mucosal lesions were evaluated by macroscopic and histopathological alterations, lesion index, and myeloperoxidase (MPO) activity. Pretreatment with esculin significantly reduced macroscopic and histopathological damage, gastric lesion index, and MPO activity in a dose-dependent manner. Moreover, esculin significantly reduced nitric oxide (NO) production, inducible NO synthase (iNOS) levels, and nuclear factor-kappa B (NF-κB) p65 protein expression in gastric tissues after ethanol challenge. Analysis of inflammatory cytokines indicated that esculin pretreatment markedly suppressed the increased expression of tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6) in ethanol-treated mice. The results demonstrate a protective effect of esculin against gastric injury and suggest that the underlying mechanism might be associated with inhibition of NF-κB activation, which subsequently reduces expression of iNOS, TNF-α, and IL-6. © 2016 Société Française de Pharmacologie et de Thérapeutique.

Safety Validation of Repeated Blood-Brain Barrier Disruption Using Focused Ultrasound.

PubMed

Kobus, Thiele; Vykhodtseva, Natalia; Pilatou, Magdalini; Zhang, Yongzhi; McDannold, Nathan

2016-02-01

The purpose of this study was to investigate the effects on the brain of multiple sessions of blood-brain barrier (BBB) disruption using focused ultrasound (FUS) in combination with micro-bubbles over a range of acoustic exposure levels. Six weekly sessions of FUS, using acoustical pressures between 0.66 and 0.80 MPa, were performed under magnetic resonance guidance. The success and degree of BBB disruption was estimated by signal enhancement of post-contrast T1-weighted imaging of the treated area. Histopathological analysis was performed after the last treatment. The consequences of repeated BBB disruption varied from no indications of vascular damage to signs of micro-hemorrhages, macrophage infiltration, micro-scar formations and cystic cavities. The signal enhancement on the contrast-enhanced T1-weighted imaging had limited value for predicting small-vessel damage. T2-weighted imaging corresponded well with the effects on histopathology and could be used to study treatment effects over time. This study demonstrates that repeated BBB disruption by FUS can be performed with no or limited damage to the brain tissue. Copyright © 2016 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Clinical study of noninvasive in vivo melanoma and nonmelanoma skin cancers using multimodal spectral diagnosis

PubMed Central

Lim, Liang; Nichols, Brandon; Migden, Michael R.; Rajaram, Narasimhan; Reichenberg, Jason S.; Markey, Mia K.; Ross, Merrick I.; Tunnell, James W.

2014-01-01

Abstract. The goal of this study was to determine the diagnostic capability of a multimodal spectral diagnosis (SD) for in vivo noninvasive disease diagnosis of melanoma and nonmelanoma skin cancers. We acquired reflectance, fluorescence, and Raman spectra from 137 lesions in 76 patients using custom-built optical fiber-based clinical systems. Biopsies of lesions were classified using standard histopathology as malignant melanoma (MM), nonmelanoma pigmented lesion (PL), basal cell carcinoma (BCC), actinic keratosis (AK), and squamous cell carcinoma (SCC). Spectral data were analyzed using principal component analysis. Using multiple diagnostically relevant principal components, we built leave-one-out logistic regression classifiers. Classification results were compared with histopathology of the lesion. Sensitivity/specificity for classifying MM versus PL (12 versus 17 lesions) was 100%/100%, for SCC and BCC versus AK (57 versus 14 lesions) was 95%/71%, and for AK and SCC and BCC versus normal skin (71 versus 71 lesions) was 90%/85%. The best classification for nonmelanoma skin cancers required multiple modalities; however, the best melanoma classification occurred with Raman spectroscopy alone. The high diagnostic accuracy for classifying both melanoma and nonmelanoma skin cancer lesions demonstrates the potential for SD as a clinical diagnostic device. PMID:25375350

Patients with intolerance reactions to total knee replacement: combined assessment of allergy diagnostics, periprosthetic histology, and peri-implant cytokine expression pattern.

PubMed

Thomas, Peter; von der Helm, Christine; Schopf, Christoph; Mazoochian, Farhad; Frommelt, Lars; Gollwitzer, Hans; Schneider, Josef; Flaig, Michael; Krenn, Veit; Thomas, Benjamin; Summer, Burkhard

2015-01-01

We performed a combined approach to identify suspected allergy to knee arthroplasty (TKR): patch test (PT), lymphocyte transformation test (LTT), histopathology (overall grading; T- and B-lymphocytes, macrophages, and neutrophils), and semiquantitative Real-time-PCR-based periprosthetic inflammatory mediator analysis (IFNγ, TNFα, IL1-β, IL-2, IL-6, IL-8, IL-10, IL17, and TGFβ). We analyzed 25 TKR patients with yet unexplained complications like pain, effusion, and reduced range of motion. They consisted of 20 patients with proven metal sensitization (11 with PT reactions; 9 with only LTT reactivity). Control specimens were from 5 complicated TKR patients without metal sensitization, 12 OA patients before arthroplasty, and 8 PT patients without arthroplasty. Lymphocytic infiltrates were seen and fibrotic (Type IV membrane) tissue response was most frequent in the metal sensitive patients, for example, in 81% of the PT positive patients. The latter also had marked periprosthetic IFNγ expression. 8/9 patients with revision surgery using Ti-coated/oxinium based implants reported symptom relief. Our findings demonstrate that combining allergy diagnostics with histopathology and periprosthetic cytokine assessment could allow us to design better diagnostic strategies.

Clinical study of noninvasive in vivo melanoma and nonmelanoma skin cancers using multimodal spectral diagnosis

NASA Astrophysics Data System (ADS)

Lim, Liang; Nichols, Brandon; Migden, Michael R.; Rajaram, Narasimhan; Reichenberg, Jason S.; Markey, Mia K.; Ross, Merrick I.; Tunnell, James W.

2014-11-01

The goal of this study was to determine the diagnostic capability of a multimodal spectral diagnosis (SD) for in vivo noninvasive disease diagnosis of melanoma and nonmelanoma skin cancers. We acquired reflectance, fluorescence, and Raman spectra from 137 lesions in 76 patients using custom-built optical fiber-based clinical systems. Biopsies of lesions were classified using standard histopathology as malignant melanoma (MM), nonmelanoma pigmented lesion (PL), basal cell carcinoma (BCC), actinic keratosis (AK), and squamous cell carcinoma (SCC). Spectral data were analyzed using principal component analysis. Using multiple diagnostically relevant principal components, we built leave-one-out logistic regression classifiers. Classification results were compared with histopathology of the lesion. Sensitivity/specificity for classifying MM versus PL (12 versus 17 lesions) was 100%;/100%;, for SCC and BCC versus AK (57 versus 14 lesions) was 95%;/71%, and for AK and SCC and BCC versus normal skin (71 versus 71 lesions) was 90%/85%. The best classification for nonmelanoma skin cancers required multiple modalities; however, the best melanoma classification occurred with Raman spectroscopy alone. The high diagnostic accuracy for classifying both melanoma and nonmelanoma skin cancer lesions demonstrates the potential for SD as a clinical diagnostic device.

Tuberculosis prevalence in forensic autopsies.

PubMed

Ozsoy, Sait; Demirel, Birol; Albay, Ali; Kisa, Ozgul; Dinc, Ahmet H; Safali, Mukerrem

2010-03-01

According to the 2008 World Health Organization report, in 2006, 9.2 million new cases were determined, and 1.7 million people have lost their life due to tuberculosis (TB) in all around the world. In our country (Turkey), it is estimated that 35,000 to 40,000 people have TB disease annually. The Ministry of Health could just determine 18,500 of these cases, and only 6500 patient could be treated effectively. According to the Tuberculosis Dispensary records, the incidence for TB in Turkey is 28/100,000. It is aimed to determine the infection with Mycobacterium tuberculosis using acidoresistant bacilli microscopy, TB culture, and histopathological methods in tissue samples that were obtained from lungs of forensic cases whose autopsies had been performed in Council of Forensic Medicine Ankara Department Morgue Specialized Committee. A total of 3 tissue samples that were obtained from lungs of randomized 302 cases, were positive for TB in Löwenstein-Jensen medium. Granuloma with caseating necrosis was found in histopathological examination and acidoresistant (+) bacilli (1+, 2+, and 2+, respectively) in microscopically analysis were also demonstrated in this 3 tissue samples. For this reason, we think that autopsy workers have to be careful about tuberculosis during their autopsy working.

Histopathological, immunohistochemical, and ultrastructural evidence of spontaneous Senecavirus A-induced lesions at the choroid plexus of newborn piglets.

PubMed

Oliveira, Thalita E S; Michelazzo, Mariana M Z; Fernandes, Thiago; de Oliveira, Admilton G; Leme, Raquel A; Alfieri, Alice F; Alfieri, Amauri A; Headley, Selwyn A

2017-11-29

Epidemic Transient Neonatal Losses (ETNL) is a disease of piglets caused by Senecavirus A (SVA) in which the method of dissemination and associated lesions are not well-defined. This study investigated the possible SVA-induced lesions by examining spontaneous infections in newborn piglets. Histopathology revealed ballooning degeneration of transitional epithelium, nonsuppurative meningoencephalitis, plexus choroiditis, and atrophic enteritis. RT-PCR identified SVA in all tissues evaluated and sequencing confirmed these results. Positive immunoreactivity to SVA was observed in endothelial and epithelial tissues of all organs evaluated. Semithin analysis revealed vacuolization of apical enterocytes of the small intestine, balloon degeneration and necrosis of endothelial cells of the choroid plexus (CP) and nonsuppurative choroid plexitis. Ultrathin evaluation demonstrated hydropic degeneration of apical enterocytes, degeneration and necrosis of endothelium of CP fenestrated capillaries, degeneration of ependymocytes associated with intralesional viral particles. It is proposed that SVA initially infects apical enterocytes of newborn piglets and probably enters the circulatory system with entry to the brain via the CP, by first producing an initial inflammatory reaction, with subsequent encephalitic dissemination. Consequently, SVA probably uses an enteric-neurological method of dissemination.

Development of Raman microspectroscopy for automated detection and imaging of basal cell carcinoma

NASA Astrophysics Data System (ADS)

Larraona-Puy, Marta; Ghita, Adrian; Zoladek, Alina; Perkins, William; Varma, Sandeep; Leach, Iain H.; Koloydenko, Alexey A.; Williams, Hywel; Notingher, Ioan

2009-09-01

We investigate the potential of Raman microspectroscopy (RMS) for automated evaluation of excised skin tissue during Mohs micrographic surgery (MMS). The main aim is to develop an automated method for imaging and diagnosis of basal cell carcinoma (BCC) regions. Selected Raman bands responsible for the largest spectral differences between BCC and normal skin regions and linear discriminant analysis (LDA) are used to build a multivariate supervised classification model. The model is based on 329 Raman spectra measured on skin tissue obtained from 20 patients. BCC is discriminated from healthy tissue with 90+/-9% sensitivity and 85+/-9% specificity in a 70% to 30% split cross-validation algorithm. This multivariate model is then applied on tissue sections from new patients to image tumor regions. The RMS images show excellent correlation with the gold standard of histopathology sections, BCC being detected in all positive sections. We demonstrate the potential of RMS as an automated objective method for tumor evaluation during MMS. The replacement of current histopathology during MMS by a ``generalization'' of the proposed technique may improve the feasibility and efficacy of MMS, leading to a wider use according to clinical need.

Developing the Quantitative Histopathology Image Ontology (QHIO): A case study using the hot spot detection problem.

PubMed

Gurcan, Metin N; Tomaszewski, John; Overton, James A; Doyle, Scott; Ruttenberg, Alan; Smith, Barry

2017-02-01

Interoperability across data sets is a key challenge for quantitative histopathological imaging. There is a need for an ontology that can support effective merging of pathological image data with associated clinical and demographic data. To foster organized, cross-disciplinary, information-driven collaborations in the pathological imaging field, we propose to develop an ontology to represent imaging data and methods used in pathological imaging and analysis, and call it Quantitative Histopathological Imaging Ontology - QHIO. We apply QHIO to breast cancer hot-spot detection with the goal of enhancing reliability of detection by promoting the sharing of data between image analysts. Copyright © 2016 Elsevier Inc. All rights reserved.

The intervention research on treatment by Xianchen to rabbits model of chemotherapeutic phlebitis.

PubMed

Zhang, Jing; Shen, Juan; Yin, Weiwei; Wei, Xiaoyu; Wu, Ligao; Liu, Hao

2016-08-01

To develop a chemotherapeutics induced phlebitis and explore the effects of Xianchen on the phlebitis treatment. Forty-eight rabbits were divided into two series. Phlebitis model induced by vincristine was established at each series. The first series had 24 rabbits, which were divided into four groups (6 hours, 12 hours, 18 hours, 24 hours) after vincristine infusion. The grades of phlebitis through visual observation and histopathological examination were observed. The second series had also 24 rabbits. Interventions were performed 12 hours after vincristine infusion. These rabbits were randomly divided into four groups, according to treatment: Hirudoid (bid), Xianchen (daily), Xianchen (tid), Xianchen (five times a day). Four days after intervention, the venous injury through visual observation and histopathological examination were evaluated. Series 1: Phlebitis appeared 12 hours after infusion of vincristine through visual observation. There was a significant difference (p<0.05) between 6 hours and 24 hours, 6 hours and 18 hours through visual observation. However, the inflammation happened 6 hours after infusion, the loss of venous endothelial cells demonstrated differences among four groups through histopathological evaluation (p<0.05). There were significant differences (p<0.05) after 4 days among the intervention groups through visual observation, the effects of Xianchen group (five times a day) were better than Xianchen group (tid) (p<0.01). The treatment of edema demonstrated differences among groups through histopathological evaluation (p<0.05), Xianchen (five times a day) better relieved the degree of edema (p<0.05). The study showed that inflammatory reaction of phlebitis appeared early. Xianchen can treat vincristine induced phlebitis, as well as Hirudoid. It is particularly effective in the treatment of edema, and there is a remarkable dose-response relationship.

Longitudinal Imaging of Cancer Cell Metastases in Two Preclinical Models: A Correlation of Noninvasive Imaging to Histopathology

PubMed Central

Adiseshaiah, Pavan P.; Patel, Nimit L.; Ileva, Lilia V.; Kalen, Joseph D.; Haines, Diana C.; McNeil, Scott E.

2014-01-01

Metastatic spread is the leading cause of death from cancer. Early detection of cancer at primary and metastatic sites by noninvasive imaging modalities would be beneficial for both therapeutic intervention and disease management. Noninvasive imaging modalities such as bioluminescence (optical), positron emission tomography (PET)/X-ray computed tomography (CT), and magnetic resonance imaging (MRI) can provide complementary information and accurately measure tumor growth as confirmed by histopathology. Methods. We validated two metastatic tumor models, MDA-MD-231-Luc and B16-F10-Luc intravenously injected, and 4T1-Luc cells orthotopically implanted into the mammary fat pad. Longitudinal whole body bioluminescence imaging (BLI) evaluated metastasis, and tumor burden of the melanoma cell line (B16-F10-Luc) was correlated with (PET)/CT and MRI. In addition, ex vivo imaging evaluated metastasis in relevant organs and histopathological analysis was used to confirm imaging. Results. BLI revealed successful colonization of cancer cells in both metastatic tumor models over a 4-week period. Furthermore, lung metastasis of B16-F10-Luc cells imaged by PET/CT at week four showed a strong correlation (R 2 = 0.9) with histopathology. The presence and degree of metastasis as determined by imaging correlated (R 2 = 0.7) well with histopathology findings. Conclusions. We validated two metastatic tumor models by longitudinal noninvasive imaging with good histopathology correlation. PMID:24724022

Histopathological characterization of the oral lichenoid disease subtypes and the relation with the clinical data.

PubMed

Alberdi-Navarro, J; Marichalar-Mendia, X; Lartitegui-Sebastián, M-J; Gainza-Cirauqui, M-L; Echebarria-Goikouria, M-A; Aguirre-Urizar, J-M

2017-05-01

The aim of the study was to analyze the histopathological characteristics of samples with a diagnosis of oral lichenoid disease (OLD) and their link with the location and the type of clinical lesion, and the clinicopathological subtypes. Retrospective study on 85 consecutive patients diagnosed with OLD (58 women and 27 men, mean age of 57.7 years). Clinical and histopathological characterization of each case (modified WHO criteria). Collection of the clinical and histopathological data of the lesions. Descriptive and comparative statistical analysis of the results. The 78.8% of the cases were considered clinically typical while the 21.2% were considered compatible. Histologically, 52.9% were classified as typical and 47.1% as compatible. Biopsies from "plaque-like" lesions presented hyperkeratosis (p>0.001) and epithelial dysplasia (p=0.06) more frequently. Furthermore, acute inflammation was more evident in erosive-ulcerative lesions (p=0.001). Differences regarding the location of the biopsy were statistically non-significant. However, 42.9% of the tongue biopsies showed epithelial dysplasia. The histopathological aspect of this disorder is not specific and does not allow us to differentiate between the main subtypes. Therefore, the main reasons to perform a biopsy in this disorder are to define the differential diagnosis and to rule out epithelial dysplasia or a carcinoma. The final histopathological result may be subject to the type of lesion that is biopsied.

Performances of different diagnostic tests for feline infectious peritonitis in challenging clinical cases.

PubMed

Giori, L; Giordano, A; Giudice, C; Grieco, V; Paltrinieri, S

2011-03-01

Feline infectious peritonitis (FIP) can be difficult to diagnose. Histopathology is considered the gold standard test but immunohistochemistry (IHC) is mandatory to confirm/exclude the disease. This study aimed to assess the performances of tests carried out in vivo or at postmortem examination in challenging cases in which FIP was confirmed or excluded based on IHC or on adequate follow-up. Twelve cases (four without FIP, eight with FIP) were retrospectively studied. Clinical findings, serum protein electrophoresis (SPE), analysis of the effusions (AE), antifeline coronavirus serology, serum concentration of α1-acid glycoprotein (AGP) and histopathology were classified as consistent, doubtful or non-consistent with FIP. Sensitivity, specificity and concordance (κ) with the final diagnosis were calculated. Concordance was absent for serology (κ=-0·08) and AE (κ=-0·52), poor for histopathology (κ=0·09), fair for SPE (κ=0·25) and perfect for AGP (κ=1·00). Sensitivity was high for AGP (100%) and low for AE (50%), SPE (37·5%) and histopathology (37·5%). Specificity was high for AGP or histopathology (100%) and low for SPE (50%) and AE (0%). IHC must always be performed to confirm FIP. If this is not possible, when histopathology is controversial, elevated AGP concentrations may support the diagnosis of FIP. © 2011 British Small Animal Veterinary Association.

The impact of routine histopathological examination on cholecystectomy specimens from an Asian demographic.

PubMed

Chin, K F; Mohammad, A A; Khoo, Y Y; Krishnasamy, T

2012-04-01

Most gallbladder carcinoma cases are suspected pre-operatively or intra-operatively. In Malaysia histopathological examination of cholecystectomy specimens has become routine practice. The aim of this study was to assess the impact of routine histological examinations on cholecystectomy specimens from an Asian demographic, which may differ from a Caucasian demographic. A retrospective study was performed of all histopathology reports for cholecystectomies (laparoscopic and open) undertaken over a period of 12 years (1997-2008) in a single teaching hospital. A total of 1,375 gallbladder specimens were sent for histopathological analysis, with 7 (0.5%) being reported as malignant while only three (0.2%) were found to contain primary gallbladder carcinoma. Other premalignant findings included two specimens with dysplastic changes of the mucosa and one tubulovillous adenoma with a dysplastic epithelium. From the ten malignant and premalignant specimens, seven were diagnosed pre-operatively, two were suspected intra-operatively and one was diagnosed with dysplastic changes on the histopathology report post-operatively. This study supports earlier research carried out in the UK and the demographic difference does not affect the impact of the histology examination on cholecystectomy specimens in diagnosing this disease. A selective policy is recommended in Malaysia.

Utility of texture analysis for quantifying hepatic fibrosis on proton density MRI.

PubMed

Yu, HeiShun; Buch, Karen; Li, Baojun; O'Brien, Michael; Soto, Jorge; Jara, Hernan; Anderson, Stephan W

2015-11-01

To evaluate the potential utility of texture analysis of proton density maps for quantifying hepatic fibrosis in a murine model of hepatic fibrosis. Following Institutional Animal Care and Use Committee (IACUC) approval, a dietary model of hepatic fibrosis was used and 15 ex vivo murine liver tissues were examined. All images were acquired using a 30 mm bore 11.7T magnetic resonance imaging (MRI) scanner with a multiecho spin-echo sequence. A texture analysis was employed extracting multiple texture features including histogram-based, gray-level co-occurrence matrix-based (GLCM), gray-level run-length-based features (GLRL), gray level gradient matrix (GLGM), and Laws' features. Texture features were correlated with histopathologic and digital image analysis of hepatic fibrosis. Histogram features demonstrated very weak to moderate correlations (r = -0.29 to 0.51) with hepatic fibrosis. GLCM features correlation and contrast demonstrated moderate-to-strong correlations (r = -0.71 and 0.59, respectively) with hepatic fibrosis. Moderate correlations were seen between hepatic fibrosis and the GLRL feature short run low gray-level emphasis (SRLGE) (r = -0. 51). GLGM features demonstrate very weak to weak correlations with hepatic fibrosis (r = -0.27 to 0.09). Moderate correlations were seen between hepatic fibrosis and Laws' features L6 and L7 (r = 0.58). This study demonstrates the utility of texture analysis applied to proton density MRI in a murine liver fibrosis model and validates the potential utility of texture-based features for the noninvasive, quantitative assessment of hepatic fibrosis. © 2015 Wiley Periodicals, Inc.

Electronic Cigarettes Are as Toxic to Skin Flap Survival as Tobacco Cigarettes.

PubMed

Rau, Aline Sabrina; Reinikovaite, Viktorija; Schmidt, Eric P; Taraseviciene-Stewart, Laima; Deleyiannis, Frederic White-Brown

2017-07-01

Electronic cigarettes (e-cigarettes) have become increasingly popular. However, information about the health risks associated with e-cigarette use is sparse. Currently, no published studies examine the effects of chronic e-cigarette exposure on microcirculation or perfusion. Using a rat skin flap model, we examined the toxic microcirculatory effects e-cigarettes may have in comparison with tobacco cigarettes. Fifty-eight rats were randomized to either exposure to room air, tobacco cigarette smoke, medium-nicotine content (1.2%) e-cigarette vapor, or a high-nicotine content (2.4%) e-cigarette vapor. After 4 weeks of exposure, a random pattern, 3 × 9 cm skin flap was elevated on the dorsum of the rats. At 5 weeks, flap survival was evaluated quantitatively, and the rats were euthanized. Plasma was collected for nicotine and cotinine analysis, and flap tissues were harvested for histopathological analysis. Evaluation of the dorsal skin flaps demonstrated significantly increased necrosis in the vapor and tobacco groups. The average necrosis within the groups was as follows: control 19.23%, high-dose vapor 28.61%, medium-dose vapor 35.93%, and tobacco cigarette 30.15%. Although the e-cigarette and tobacco cigarette groups did not differ significantly, each individual group had significantly more necrosis than the control group (P<0.05). These results were corroborated with histopathological analysis of hypoxic tissue. Both the medium-content and high-nicotine content e-cigarette exposure groups had similar amounts of flap necrosis and hypoxia when compared with the tobacco cigarette exposure group. Nicotine-containing e-cigarette vapor is similarly toxic to skin flap survival as tobacco cigarettes.

The enhanced value of combining conventional and 'omics' analyses in early assessment of drug-induced hepatobiliary injury

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ellinger-Ziegelbauer, Heidrun, E-mail: heidrun.ellinger-ziegelbauer@bayerhealthcare.com; Adler, Melanie; Amberg, Alexander

2011-04-15

The InnoMed PredTox consortium was formed to evaluate whether conventional preclinical safety assessment can be significantly enhanced by incorporation of molecular profiling ('omics') technologies. In short-term toxicological studies in rats, transcriptomics, proteomics and metabolomics data were collected and analyzed in relation to routine clinical chemistry and histopathology. Four of the sixteen hepato- and/or nephrotoxicants given to rats for 1, 3, or 14 days at two dose levels induced similar histopathological effects. These were characterized by bile duct necrosis and hyperplasia and/or increased bilirubin and cholestasis, in addition to hepatocyte necrosis and regeneration, hepatocyte hypertrophy, and hepatic inflammation. Combined analysis ofmore » liver transcriptomics data from these studies revealed common gene expression changes which allowed the development of a potential sequence of events on a mechanistic level in accordance with classical endpoint observations. This included genes implicated in early stress responses, regenerative processes, inflammation with inflammatory cell immigration, fibrotic processes, and cholestasis encompassing deregulation of certain membrane transporters. Furthermore, a preliminary classification analysis using transcriptomics data suggested that prediction of cholestasis may be possible based on gene expression changes seen at earlier time-points. Targeted bile acid analysis, based on LC-MS metabonomics data demonstrating increased levels of conjugated or unconjugated bile acids in response to individual compounds, did not provide earlier detection of toxicity as compared to conventional parameters, but may allow distinction of different types of hepatobiliary toxicity. Overall, liver transcriptomics data delivered mechanistic and molecular details in addition to the classical endpoint observations which were further enhanced by targeted bile acid analysis using LC/MS metabonomics.« less

Ultrasound and MRI predictors of surgical bowel resection in pediatric Crohn disease.

PubMed

Rosenbaum, Daniel G; Conrad, Maire A; Biko, David M; Ruchelli, Eduardo D; Kelsen, Judith R; Anupindi, Sudha A

2017-01-01

Imaging predictors for surgery in children with Crohn disease are lacking. To identify imaging features of the terminal ileum on short-interval bowel ultrasound (US) and MR enterography (MRE) in children with Crohn disease requiring surgical bowel resection and those managed by medical therapy alone. This retrospective study evaluated patients 18 years and younger with Crohn disease undergoing short-interval bowel US and MRE (within 2 months of one another), as well as subsequent ileocecectomy or endoscopy within 3 months of imaging. Appearance of the terminal ileum on both modalities was compared between surgical patients and those managed with medical therapy, with the following parameters assessed: bowel wall thickness, mural stratification, vascularity, fibrofatty proliferation, abscess, fistula and stricture on bowel US; bowel wall thickness, T2 ratio, enhancement pattern, mesenteric edema, fibrofatty proliferation, abscess, fistula and stricture on MRE. A two-sided t-test was used to compare means, a Mann-Whitney U analysis was used for non-parametric parameter scores, and a chi-square or two-sided Fisher exact test compared categorical variables. Imaging findings in surgical patients were correlated with location-matched histopathological scores of inflammation and fibrosis using a scoring system adapted from the Simple Endoscopic Score for Crohn Disease, and a Spearman rank correlation coefficient was used to compare inflammation and fibrosis on histopathology. Twenty-two surgical patients (mean age: 16.5 years; male/female: 13/9) and 20 nonsurgical patients (mean age: 14.8; M/F: 8/12) were included in the final analysis. On US, the surgical group demonstrated significantly increased mean bowel wall thickness (6.1 mm vs. 4.7 mm for the nonsurgical group; P = 0.01), loss of mural stratification (odds ratio [OR] = 6.3; 95% confidence interval [CI]: 1.4-28.4; P = 0.02) and increased fibrofatty proliferation (P = 0.04). On MRE, the surgical group showed increased mean bowel wall thickness (9.1 mm vs. 7.2 mm for the nonsurgical group; P = 0.02), increased mean T2 ratio (4.6 vs. 3.6 for the nonsurgical group; P = 0.03), different enhancement patterns (P = 0.03), increased mesenteric edema (P = 0.001) and increased stricture formation (OR = 8.2; 95% CI: 1.8-36.4; P = 0.005). Nineteen of 22 ileocecectomy specimens showed severe inflammation and 21/22 showed severe fibrosis, with significant correlation between inflammation and fibrosis scores (ρ = 0.55; P = 0.008); however, correlation with imaging findings was limited by the uniformity of findings on histopathology. Children with terminal ileal Crohn disease requiring surgical bowel resection demonstrate more severe manifestations of imaging features traditionally associated with both active inflammation and chronic fibrosis than those managed medically on US and MRE, findings that are corroborated by histopathology. These features may potentially serve as imaging biomarkers indicating the necessity for surgical intervention.

Clinical and histopathological results of the adult patients with unilateral cryptorchidism

PubMed Central

Ateş, Ferhat; Soydan, Hasan; Okçelik, Sezgin; Çırakoğlu, Abdullah; Yılmaz, İsmail; Malkoç, Ercan; Karademir, Kenan

2016-01-01

Objective To evaluate the clinical and histopathological results of adult unilateral cryptorchidism patients. Material and methods Data from adult unilateral cryptorchidism patients that underwent orchiectomy in our clinic between between January 2004 and March 2013 were retrospectively evaluated. Patients were divided into three groups as intra-abdominal, inguinal canal and superficial inguinal region according to the location of the undescended testes. Patients were also grouped according to their testicular volume (<4 cc, 4.1–12 cc, and >12 cc). Histopathology results of orchiectomy specimens were classified as follows: 1. Sertoli cells only, testicular atrophy and vanished testis (anorchia) 2. Hypospermatogenesis, and 3. Maturation arrest. Patients were grouped as normospermia, azoospermia and oligo/astheno/teratospermia groups according to semen analysis results. Correlations between testicular localization, testicular size, semen analysis and pathology results were evaluated. Incidental tumor detection rates were also calculated. Results Two hundred and forty-four adult unilateral cryptorchidism patients underwent orchiectomy in our clinic. There was no a significant relationship between location of the testis and testicular pathology results (p=0.707). Most common semen analysis results was normospermia in patients with high testicular volume group however azoospermia and oligoasthenospermia observed commonly in patients with low testicular volume group. There was a significant relationship between testicular volume and semen analysis results (p=0.023). No significant relationship was observed between semen analysis and pathological results (p=0.929). After an evaluation of all factors with possible effects on the semen analysis results, only testicular volume (p=0.036) was found to have a significant impact. Only one case (0.4%) was incidentally diagnosed seminoma after a review of 233 patients with available histopathological results on record. Conclusion Adult unilateral cryptorchidism has a minimal effect on male fertility or even this effect can be overlooked. Low detection rates of incidental germ cell tumors also make an orchiectomy decision questionable in such cases. PMID:27274891

Histopathology mapping of biochemical changes in myocardial infarction by Fourier transform infrared spectral imaging.

PubMed

Yang, Tian T; Weng, Shi F; Zheng, Na; Pan, Qing H; Cao, Hong L; Liu, Liang; Zhang, Hai D; Mu, Da W

2011-04-15

Fourier transform infrared (FTIR) imaging and microspectroscopy have been extensively applied in the identification and investigation of both healthy and diseased tissues. FTIR imaging can be used to determine the biodistribution of several molecules of interest (carbohydrates, lipids, proteins) for tissue analysis, without the need for prior staining of these tissues. Molecular structure data, such as protein secondary structure and collagen triple helix exhibits, can also be obtained from the same analysis. Thus, several histopathological lesions, for example myocardial infarction, can be identified from FTIR-analyzed tissue images, the latter which can allow for more accurate discrimination between healthy tissues and pathological lesions. Accordingly, we propose FTIR imaging as a new tool integrating both molecular and histopathological assessment to investigate the degree of pathological changes in tissues. In this study, myocardial infarction is presented as an illustrative example of the wide potential of FTIR imaging for biomedical applications. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

NI-16INTRA-OPERATIVE USE OF FLUORESCEIN FOR MALIGNANT GLIOMA RESECTION DIFFERENTIATES TUMOR FROM NORMAL BRAIN TISSUE BASED ON HISTOPATHOLOGIC ANALYSIS

PubMed Central

Decker, Matthew; Kresak, Jesse; Yachnis, Anthony; Bova, Frank; Rahman, Maryam

2014-01-01

OBJECTIVES: To determine whether the use of IV fluorescein during surgery for malignant glioma can reliably be used to differentiate between infiltrative tumor and normal brain tissue. BACKGROUND: Fluorescein sodium is a molecular compound with fluorescent capabilities between light wavelengths of 520-530nm, appearing yellow-green (1). Neurosurgical application of fluorescein has been studied primarily for increasing intra-operative visibility of malignant gliomas (1). The mechanism of action has been hypothesized to involve disruption of the blood brain barrier (BBB) (2). Cells in areas with disrupted BBB take up fluorescein with a sensitivity of 94% and specificity of 89% for high-grade gliomas (2). We performed histopathologic analysis on tissue obtained during fluorescein-guided tumor resections to evaluate the differences between fluorescent and non-fluorescent tissue. METHODS: Two adult patients with suspected high-grade gliomas underwent surgical resection. Prior to opening of the dura 3mg/kg of IV fluorescein was given. A Zeiss OPMI Pentero microscope (Carl Zeiss Meditech Inc.) with a yellow 560nm filter was used to visualize the tumor. At the tumor margins, tissue was identified as "bright" and "dark" and sent as separate specimens for histopathological analysis. RESULTS: Histological sections of specimens labeled "bright" contained infiltrating glioma with focal microvascular proliferation. Histological sections of specimens labeled "dark" contained gray matter and focal subcortical white matter with no high-grade glioma identified. Final grading for both patients was WHO Grade IV, glioblastoma. CONCLUSION: Intra-operative use of fluorescein in surgical resection of malignant gliomas can help to distinguish between infiltrating tumor and normal brain tissue based on histopathological analysis. Further evaluation of the utility of flurorescein during high and low-grade glioma surgery is necessary.

Mazabraud's syndrome: case report and literature review

PubMed Central

Munksgaard, Peter Svenssen; Salkus, Giedrius; Iyer, Victor V; Fisker, Rune Vincents

2013-01-01

Mazabraud's syndrome is a rare disorder characterized by the association of single or multiple intramuscular myxomas with fibrous dysplasia. Here, we present the first case of Mazabraud's syndrome visualized on 18F-FDG PET/CT with histopathological confirmation of the myxoma. Our case demonstrates a slightly increased FDG uptake (SUVmax 2.1) within the myxomas and a moderately to highly increased tracer uptake (SUVmax 7.0) within the fibrous dysplastic lesions. The typical histological appearance of the intramuscular myxoma confirmed the radiological diagnosis. Further, we discuss the imaging findings and the histopathological features of this rare case with a review of the related literature. PMID:24198959

Adam (MDMA) and Eve (MDEA) misuse: an immunohistochemical study on three fatal cases.

PubMed

Fineschi, V; Centini, F; Mazzeo, E; Turillazzi, E

1999-09-30

Three fatal cases of MDMA/MDEA misuse have been examined. These referred to white males between 19 and 20 years of age, in which post-mortem toxicology showed the presence of MDMA (in one case), MDEA (in one case) and both (in one case). The clinical data were analysed and the histopathological findings were studied following immunohistochemical investigations. A complete immunohistochemical study has made it possible to demonstrate rhabdomyolysis and myoglobinuria with alterations of the organs typical of a DIC. Clinical, histopathological and toxicological data suggest that severe or fatal complications following ecstasy ingestion could be related to idiosyncratic response.

Evaluation of prophylactic and therapeutic effects of sildenafil on acute radiation proctitis in rats.

PubMed

Yavuz, Erkan; Ercan, Gulcin; Karagulle, Onur Olgac; Bayrak, Busra Yaprak; Biricik, Aytac; Ercetin, Candas; Gokcek, Berk; Yigitbas, Hakan; Kusaslan, Ramazan; Celik, Atilla; Gulcicek, Osman Bilgin

2018-04-01

To investigate the prophylactic and therapeutical effects of sildenafil in a model of acute radiation proctitis (ARP). All experimental procedures of this study was examined by histopathological, immunohistochemical and transmission electron microscopic analysis. Our histopathological evaluations indicated significant increases in lesion severity, cryptic apsis, cryptitis, cryptic distortion, reactive atypia and infiltration depth of the control (proctitis) group. While the prophylaxis group and the treatment group had significantly lower scores. High-dose group showed similar results as prophylaxis group. Histopathological findings of the prophylaxis group was more significant than the treatment group. Immunoreactivities of IL-1β, FGF-2, TNF- α and HIF-1α increased in the control group especially in the epithelial and cryptic regions. On the contrary, sildenafil application caused significant decreases of inflammatory markers in all treatment groups, specifically better results in the prophylaxis group. The sildenafil has anti-inflammatory effects on ARP, as well as protective effects against ARP and the protective effect of sildenafil surpasses its therapeutic effect histopathologically.

Histopathology of femoral head donations: a retrospective review of 6161 cases.

PubMed

Mackie, Katherine E; Zhou, Ziqiang; Robbins, Peter; Bulsara, Max; Zheng, Ming H

2011-08-17

Although total hip arthroplasty is one of the most common orthopaedic surgical procedures, it remains unclear whether histopathological examination of the excised femoral head adds to the quality of patient care. We propose that assessment of femoral heads resected during total hip arthroplasty and donated for allograft use may provide a profile of femoral head pathology that benefits total hip arthroplasty patients and bone donors. We retrospectively analyzed the histological findings reported for 6161 femoral heads donated for allograft use between 1993 and 2006. Specimens obtained during total hip arthroplasty and specimens donated at death were reviewed. Follow-up investigations that resulted from abnormal histopathological findings were also reviewed. The Western Australian Cancer Registry was used to determine whether patients with a suspected neoplasm were subsequently diagnosed with such a disease. A retrospective review of the histopathological findings was conducted to evaluate and reclassify all previous observations of abnormalities. One hundred and five femoral heads demonstrated abnormal or reactive histopathological features not reported prior to surgery and were rejected for allograft use. A reactive lymphocytic infiltrate, most likely due to osteoarthritis, was the most commonly identified feature (forty-five cases). Other features observed in twenty-seven cases were also most likely due to the presence of severe osteoarthritis. Ten femoral heads demonstrated plasmacytosis, which may have been related to osteoarthritis. Two patients were diagnosed with Paget's disease, and two, with rheumatoid arthritis. Nineteen patients had a suspected neoplasm. Of these nineteen, eight cases of non-Hodgkin's lymphoma or chronic lymphocytic leukemia and one case of myelodysplastic syndrome were confirmed on further investigation. One subsequently confirmed malignancy was detected per 770 femoral heads examined. Our findings indicate that, even with a detailed medical history and careful physical examination, clinically important diseases including neoplasms and Paget's disease are observed in patients diagnosed with osteoarthritis prior to total hip arthroplasty. Histological examination plays an integral role in quality assurance in femoral head banking, and it also represents a possible early diagnostic test for bone and bone-marrow-related diseases in patients undergoing total hip arthroplasty.

Congenital bronchopulmonary malformation: CT histopathological correlation.

PubMed

Kyncl, Martin; Koci, Martin; Ptackova, Lea; Hornofova, Ludmila; Ondrej, Fabian; Snajdauf, Jiri; Pychova, Marcela

2016-12-01

This study evaluated the accuracy of postnatal computed tomography (CT) imaging in the identification of congenital bronchopulmonary malformation (BPM) in comparison with histopathological analysis. CT scans of prenatally diagnosed BPMs from 24 patients with available histology were analysed retrospectively. The CT images were reviewed blinded to histological findings by two radiologists. Specific diagnosis was assigned based on predetermined criteria. The accuracy of CT was evaluated. The agreement rate in CT diagnosis between two radiologists was 100%. In 75% the lesions were located in the lower lobes. An overlap of 71% in CT and histopathological diagnoses was reached. The least matching diagnosis was type 2 CPAM. Contrast enhanced chest CT is very accurate in characterizing the BPM spectrum and provides important information on lesion type and structure.

First detection of koi herpesvirus from koi, Cyprinus carpio L. experiencing mass mortalities in Iran: clinical, histopathological and molecular study.

PubMed

Rahmati-Holasoo, H; Zargar, A; Ahmadivand, S; Shokrpoor, S; Ezhari, S; Ebrahimzadeh Mousavi, H A

2016-10-01

Koi herpesvirus (KHV) is the aetiological agent of an emerging disease (KHVD) associated with mass mortalities in koi and common carp and reported from at least 30 countries. We report the first detection of KHV from koi in Iran using clinical, histopathological and molecular studies. KHV-infected fish showed reduced swimming activity, sunken eyes and increased mucus production on skin and fins. On post-mortem examination, gill necrosis was observed in the majority of fish. Histopathologically, the gill showed diffuse necrosis of the branchial epithelial cells. Margination of chromatin was detected in gills, kidney, heart, spleen, intestine and brain. In addition, sequence analyses of the TK gene, ORF 136 and marker I and II, demonstrates that Iranian KHV isolates were identical and classified as variant A1 of TUSMT1 (J strain) and displayed the I(++) II(+) allele of this Asian genotype. © 2016 John Wiley & Sons Ltd.

Transesophageal echocardiographic strain imaging predicts aortic biomechanics: Beyond diameter.

PubMed

Emmott, Alexander; Alzahrani, Haitham; Alreishidan, Mohammed; Therrien, Judith; Leask, Richard L; Lachapelle, Kevin

2018-03-11

Clinical guidelines recommend resection of ascending aortic aneurysms at diameters 5.5 cm or greater to prevent rupture or dissection. However, approximately 40% of all ascending aortic dissections occur below this threshold. We propose new transesophageal echocardiography strain-imaging moduli coupled with blood pressure measurements to predict aortic dysfunction below the surgical threshold. A total of 21 patients undergoing aortic resection were recruited to participate in this study. Transesophageal echocardiography imaging of the aortic short-axis and invasive radial blood pressure traces were taken for 3 cardiac cycles. By using EchoPAC (GE Healthcare, Madison, Wis) and postprocessing in MATLAB (MathWorks, Natick, Mass), circumferential stretch profiles were generated and combined with the blood pressure traces. From these data, 2 in vivo stiffness moduli were calculated: the Cardiac Cycle Pressure Modulus and Cardiac Cycle Stress Modulus. From the resected aortic ring, testing squares were isolated for ex vivo mechanical analysis and histopathology. Each square underwent equibiaxial tensile testing to generate stress-stretch profiles for each patient. Two ex vivo indices were calculated from these profiles (energy loss and incremental stiffness) for comparison with the Cardiac Cycle Pressure Modulus and Cardiac Cycle Stress Modulus. The echo-derived stiffness moduli demonstrate positive significant covariance with ex vivo tensile biomechanical indices: energy loss (vs Cardiac Cycle Pressure Modulus: R 2  = 0.5873, P < .0001; vs Cardiac Cycle Stress Modulus: R 2  = 0.6401, P < .0001) and apparent stiffness (vs Cardiac Cycle Pressure Modulus: R 2  = 0.2079, P = .0378; vs Cardiac Cycle Stress Modulus: R 2  = 0.3575, P = .0042). Likewise, these transesophageal echocardiography-derived moduli are highly predictive of the histopathologic composition of collagen and elastin (collagen/elastin ratio vs Cardiac Cycle Pressure Modulus: R 2  = 0.6165, P < .0001; vs Cardiac Cycle Stress Modulus: R 2  = 0.6037, P < .0001). Transesophageal echocardiography-derived stiffness moduli correlate strongly with aortic wall biomechanics and histopathology, which demonstrates the added benefit of using simple echocardiography-derived biomechanics to stratify patient populations. Copyright © 2018. Published by Elsevier Inc.

The role of histopathology in forensic practice: an overview.

PubMed

Dettmeyer, R B

2014-09-01

The role of forensic histopathology in routine practice is to establish the cause of death in particular cases. This is achieved on the basis of microscopic analysis of representative cell and tissue samples taken from the major internal organs and from abnormal findings made at autopsy. A prerequisite of this is adherence to the quality standards set out for conventional histological/cytological staining and enzyme histochemical and immunohistochemical methods. The interpretation of histological findings is performed by taking into account macroscopic autopsy findings and information on previous history. Histological analysis may prompt postmortem biochemical and chemical-toxicological investigations. The results of histological analysis need to be classified by experts in the context of the available information and the need to withstand the scrutiny of other experts.

Smartphone confocal microscopy for imaging cellular structures in human skin in vivo.

PubMed

Freeman, Esther E; Semeere, Aggrey; Osman, Hany; Peterson, Gary; Rajadhyaksha, Milind; González, Salvador; Martin, Jeffery N; Anderson, R Rox; Tearney, Guillermo J; Kang, Dongkyun

2018-04-01

We report development of a low-cost smartphone confocal microscope and its first demonstration of in vivo human skin imaging. The smartphone confocal microscope uses a slit aperture and diffraction grating to conduct two-dimensional confocal imaging without using any beam scanning devices. Lateral and axial resolutions of the smartphone confocal microscope were measured as 2 and 5 µm, respectively. In vivo confocal images of human skin revealed characteristic cellular structures, including spinous and basal keratinocytes and papillary dermis. Results suggest that the smartphone confocal microscope has a potential to examine cellular details in vivo and may help disease diagnosis in resource-poor settings, where conducting standard histopathologic analysis is challenging.

Smartphone confocal microscopy for imaging cellular structures in human skin in vivo

PubMed Central

Freeman, Esther E.; Semeere, Aggrey; Osman, Hany; Peterson, Gary; Rajadhyaksha, Milind; González, Salvador; Martin, Jeffery N.; Anderson, R. Rox; Tearney, Guillermo J.; Kang, Dongkyun

2018-01-01

We report development of a low-cost smartphone confocal microscope and its first demonstration of in vivo human skin imaging. The smartphone confocal microscope uses a slit aperture and diffraction grating to conduct two-dimensional confocal imaging without using any beam scanning devices. Lateral and axial resolutions of the smartphone confocal microscope were measured as 2 and 5 µm, respectively. In vivo confocal images of human skin revealed characteristic cellular structures, including spinous and basal keratinocytes and papillary dermis. Results suggest that the smartphone confocal microscope has a potential to examine cellular details in vivo and may help disease diagnosis in resource-poor settings, where conducting standard histopathologic analysis is challenging. PMID:29675328

Transmission of the haplosporidian parasite MSX Haplosporidium nelsoni to the eastern oyster Crassostrea virginica in an upweller system.

PubMed

Sunila, I; Karolus, J; Lang, E P; Mroczka, M E; Volk, J

2000-08-31

The haplosporidian oyster parasite MSX (Multinucleated Sphere X) Haplosporidium nelsoni was transmitted to eastern oysters Crassostrea virginica. Hatchery-raised, MSX-free juvenile oysters were placed in upweller tanks. Water to the tanks was filtered through a screen with 1 mm2 openings and originated from the water column overlaying naturally infected oysters beds (MSX prevalence 17 to 57%). MSX was diagnosed by histopathological analysis. MSX-disease (57% prevalence) with increased mortality (19%) was observed 11 wk after the beginning of the exposure and mortality of 80% after 16 wk. The study demonstrates transmission of MSX via water-borne infectious agents capable of passing through a 1 mm filter.

Sensitivity and specificity of real-time reverse transcription polymerase chain reaction, histopathology, and immunohistochemical labeling for the detection of Rift Valley fever virus in naturally infected cattle and sheep.

PubMed

Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J

2014-01-01

Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.

Diagnosing basal cell carcinoma in vivo by near-infrared Raman spectroscopy: a Principal Components Analysis discrimination algorithm

NASA Astrophysics Data System (ADS)

Silveira, Landulfo, Jr.; Silveira, Fabrício L.; Bodanese, Benito; Pacheco, Marcos Tadeu T.; Zângaro, Renato A.

2012-02-01

This work demonstrated the discrimination among basal cell carcinoma (BCC) and normal human skin in vivo using near-infrared Raman spectroscopy. Spectra were obtained in the suspected lesion prior resectional surgery. After tissue withdrawn, biopsy fragments were submitted to histopathology. Spectra were also obtained in the adjacent, clinically normal skin. Raman spectra were measured using a Raman spectrometer (830 nm) with a fiber Raman probe. By comparing the mean spectra of BCC with the normal skin, it has been found important differences in the 800-1000 cm-1 and 1250-1350 cm-1 (vibrations of C-C and amide III, respectively, from lipids and proteins). A discrimination algorithm based on Principal Components Analysis and Mahalanobis distance (PCA/MD) could discriminate the spectra of both tissues with high sensitivity and specificity.

Deep Learning Nuclei Detection in Digitized Histology Images by Superpixels.

PubMed

Sornapudi, Sudhir; Stanley, Ronald Joe; Stoecker, William V; Almubarak, Haidar; Long, Rodney; Antani, Sameer; Thoma, George; Zuna, Rosemary; Frazier, Shelliane R

2018-01-01

Advances in image analysis and computational techniques have facilitated automatic detection of critical features in histopathology images. Detection of nuclei is critical for squamous epithelium cervical intraepithelial neoplasia (CIN) classification into normal, CIN1, CIN2, and CIN3 grades. In this study, a deep learning (DL)-based nuclei segmentation approach is investigated based on gathering localized information through the generation of superpixels using a simple linear iterative clustering algorithm and training with a convolutional neural network. The proposed approach was evaluated on a dataset of 133 digitized histology images and achieved an overall nuclei detection (object-based) accuracy of 95.97%, with demonstrated improvement over imaging-based and clustering-based benchmark techniques. The proposed DL-based nuclei segmentation Method with superpixel analysis has shown improved segmentation results in comparison to state-of-the-art methods.

Sudden unexpected death related to enterovirus myocarditis: histopathology, immunohistochemistry and molecular pathology diagnosis at post-mortem

PubMed Central

2012-01-01

Background Viral myocarditis is a major cause of sudden unexpected death in children and young adults. Until recently, coxsackievirus B3 (CVB3) has been the most commonly implicated virus in myocarditis. At present, no standard diagnosis is generally accepted due to the insensitivity of traditional diagnostic tests. This has prompted health professionals to seek new diagnostic approaches, which resulted in the emergence of new molecular pathological tests and a more detailed immunohistochemical and histopathological analysis. When supplemented with immunohistochemistry and molecular pathology, conventional histopathology may provide important clues regarding myocarditis underlying etiology. Methods This study is based on post-mortem samples from sudden unexpected death victims and controls who were investigated prospectively. Immunohistochemical investigations for the detection of the enteroviral capsid protein VP1 and the characterization and quantification of myocardial inflammatory reactions as well as molecular pathological methods for enteroviral genome detection were performed. Results Overall, 48 sudden unexpected death victims were enrolled. As for controls, 37 cases of unnatural traffic accident victims were studied. Enterovirus was detected in 6 sudden unexpected death cases (12.5 %). The control samples were completely enterovirus negative. Furthermore, the enteroviral capsid protein VP1 in the myocardium was detected in enterovirus-positive cases revealed by means of reverse transcriptase-polymerase chain reaction (RT-PCR). Unlike control samples, immunohistochemical investigations showed a significant presence of T and B lymphocytes in sudden unexpected death victims. Conclusions Our findings demonstrate clearly a higher prevalence of viral myocarditis in cases of sudden unexpected death compared to control subjects, suggesting that coxsackie B enterovirus may contribute to myocarditis pathogenesis significantly. PMID:22966951

FGF-2 and Anosmin-1 are selectively expressed in different types of multiple sclerosis lesions.

PubMed

Clemente, Diego; Ortega, María Cristina; Arenzana, Francisco Javier; de Castro, Fernando

2011-10-19

Multiple sclerosis is a demyelinating disease that affects ≈ 2,000,000 people worldwide. In the advanced stages of the disease, endogenous oligodendrocyte precursors cannot colonize the lesions or differentiate into myelinating oligodendrocytes. During development, both FGF-2 and Anosmin-1 participate in oligodendrocyte precursor cell migration, acting via the FGF receptor 1 (FGFR1). Hence, we performed a histopathological and molecular analysis of these developmental modulators in postmortem tissue blocks from multiple sclerosis patients. Accordingly, we demonstrate that the distribution of FGF-2 and Anosmin-1 varies between the different types of multiple sclerosis lesions: FGF-2 is expressed only within active lesions and in the periplaque of chronic lesions, whereas Anosmin-1 is upregulated within chronic lesions and is totally absent in active lesions. We show that the endogenous oligodendrocyte precursor cells recruited toward chronic-active lesions express FGFR1, possibly in response to the FGF-2 produced by microglial cells in the periplaque. Also in human tissue, FGF-2 is upregulated in perivascular astrocytes in regions of the normal-appearing gray matter, where the integrity of the blood-brain barrier is compromised. In culture, FGF-2 and Anosmin-1 influence adult mouse oligodendrocyte precursor cell migration in the same manner as at embryonic stages, providing an explanation for the histopathological observations: FGF-2 attracts/enhances its migration, which is hindered by Anosmin-1. We propose that FGF-2 and Anosmin-1 are markers for the histopathological type and the level of inflammation of multiple sclerosis lesions, and that they may serve as novel pharmacogenetic targets to design future therapies that favor effective remyelination and protect the blood-brain barrier.

Radiomics biomarkers for accurate tumor progression prediction of oropharyngeal cancer

NASA Astrophysics Data System (ADS)

Hadjiiski, Lubomir; Chan, Heang-Ping; Cha, Kenny H.; Srinivasan, Ashok; Wei, Jun; Zhou, Chuan; Prince, Mark; Papagerakis, Silvana

2017-03-01

Accurate tumor progression prediction for oropharyngeal cancers is crucial for identifying patients who would best be treated with optimized treatment and therefore minimize the risk of under- or over-treatment. An objective decision support system that can merge the available radiomics, histopathologic and molecular biomarkers in a predictive model based on statistical outcomes of previous cases and machine learning may assist clinicians in making more accurate assessment of oropharyngeal tumor progression. In this study, we evaluated the feasibility of developing individual and combined predictive models based on quantitative image analysis from radiomics, histopathology and molecular biomarkers for oropharyngeal tumor progression prediction. With IRB approval, 31, 84, and 127 patients with head and neck CT (CT-HN), tumor tissue microarrays (TMAs) and molecular biomarker expressions, respectively, were collected. For 8 of the patients all 3 types of biomarkers were available and they were sequestered in a test set. The CT-HN lesions were automatically segmented using our level sets based method. Morphological, texture and molecular based features were extracted from CT-HN and TMA images, and selected features were merged by a neural network. The classification accuracy was quantified using the area under the ROC curve (AUC). Test AUCs of 0.87, 0.74, and 0.71 were obtained with the individual predictive models based on radiomics, histopathologic, and molecular features, respectively. Combining the radiomics and molecular models increased the test AUC to 0.90. Combining all 3 models increased the test AUC further to 0.94. This preliminary study demonstrates that the individual domains of biomarkers are useful and the integrated multi-domain approach is most promising for tumor progression prediction.

Endoscopic and histopathological analysis of incidental focal colorectal 18 F-fluorodeoxyglucose uptake in PET/CT scan: Colonoscopic evaluation is warranted.

PubMed

Valente, Michael A

2018-03-01

Unexpected focal colorectal 18  F-fluorodeoxyglucose uptake has become a common clinical dilemma. The aim of this study was to identify the clinical significance of incidentally detected colorectal lesions on PET/CT scans by comparing positive PET/CT findings with endoscopic and histopathological analysis. A retrospective analysis of a colonoscopy database was reviewed. All patients that underwent colonoscopy secondary to focal incidental uptake on PET/CT were evaluated. PET/CT findings were correlated with endoscopic and histopathological results. 84 patients underwent colonoscopy secondary to incidental focal colorectal uptake on PET/CT. A total of 63 patients had an endoscopic and histological confirmation of the area of abnormality, for a positive predictive value of 75%. Newly diagnosed colorectal carcinoma was discovered in 13 patients (15.4%) and forty-four patients (52.3%) were discovered to have a premalignant lesion. Incidental focal colorectal uptake of 18  F-fluorodeoxyglucose is associated with a substantial risk of underlying neoplastic colorectal lesions. Early identification of these lesions may alter patient management and treatment plans. Copyright © 2017 Elsevier Inc. All rights reserved.

Histologic, Serologic, and Molecular Analysis of Persistent Ehrlichiosis in a Murine Model

PubMed Central

Olano, Juan P.; Wen, Gary; Feng, Hui-Min; McBride, Jere W.; Walker, David H.

2004-01-01

Human monocytotropic ehrlichiosis caused by Ehrlichia chaffeensis was reported in 1987. An animal model to study acute fatal ehrlichiosis in mice that has been developed closely resembles the fatal form of human monocytotropic ehrlichiosis. However, animal models for persistent infection in the genus Ehrlichia in immunocompetent mice have not been characterized. We report the histopathological progression of Ehrlichia muris infection in immunocompetent mice (AKR and C57BL/6 strains) correlated with their antibody response determined by indirect immunofluorescence and Western immunoblotting, and the distribution and quantity of the ehrlichial load by immunohistochemistry, polymerase chain reaction (PCR), and real-time PCR in lungs, liver, and spleen. Mild to moderate correlation was observed between histopathological grading in these organs and relative ehrlichial loads. The highest ehrlichial loads were present between days 4 and 14 after infection. E. muris was detected in tissues examined up to 150 days after infection by real-time PCR. Analysis of the serological response revealed several immunodominant antigens, including 200-, 180-, 100-, 73/75-, 45-, and 28-kd proteins. In conclusion, we have provided for the first time a complete histopathological, serological, immunohistochemical, and quantitative analysis of an animal model for the study of persistent ehrlichial infection. PMID:15331423

Histopathologic characteristics of bone infection complicating foot ulcers in diabetic patients.

PubMed

Cecilia-Matilla, Almudena; Lázaro-Martínez, José Luis; Aragón-Sánchez, Javier; García-Morales, Esther; García-Álvarez, Yolanda; Beneit-Montesinos, Juan Vicente

2013-01-01

A universally accepted histopathologic classification of diabetic foot osteomyelitis does not currently exist. We sought to evaluate the histopathologic characteristics of bone infection found in the feet of diabetic patients and to analyze the clinical variables related to each type of bone infection. We conducted an observational prospective study of 165 diabetic patients with foot ulcers who underwent surgery for bone infection. Samples for microbiological and histopathologic analyses were collected in the operating room under sterile conditions. We found four histopathologic types of osteomyelitis: acute osteomyelitis (n = 46; 27.9%), chronic osteomyelitis (n = 73; 44.2%), chronic acute osteomyelitis (n = 14; 8.5%), and fibrosis (n =32; 19.4%). The mean ± SD time between the initial detection of ulcer and surgery was 15.4 ± 23 weeks for acute osteomyelitis, 28.6 ± 22.4 weeks for chronic osteomyelitis, 35 ± 31.3 weeks for chronic acute osteomyelitis, and 27.5 ± 27.3 weeks for the fibrosis stage (analysis of variance: P = .03). Bacteria were isolated and identified in 40 of 46 patients (87.0%) with acute osteomyelitis, 61 of 73 (83.5%) with chronic osteomyelitis, 11 of 14 (78.6%) with chronic acute osteomyelitis, and 25 of 32 (78.1%) with fibrosis. Histopathologic categorization of bone infections in the feet of diabetic patients should include four groups: acute, chronic, chronic acute, and fibrosis. We suggest that new studies should identify cases of fibrosis to allow comparison with the present results.

The quality of tumor size assessment by contrast-enhanced spectral mammography and the benefit of additional breast MRI.

PubMed

Lobbes, Marc B I; Lalji, Ulrich C; Nelemans, Patty J; Houben, Ivo; Smidt, Marjolein L; Heuts, Esther; de Vries, Bart; Wildberger, Joachim E; Beets-Tan, Regina G

2015-01-01

Background - Contrast-enhanced spectral mammography (CESM) is a promising new breast imaging modality that is superior to conventional mammography for breast cancer detection. We aimed to evaluate correlation and agreement of tumor size measurements using CESM. As additional analysis, we evaluated whether measurements using an additional breast MRI exam would yield more accurate results. Methods - Between January 1(st) 2013 and April 1(st) 2014, 87 consecutive breast cancer cases that underwent CESM were collected and data on maximum tumor size measurements were gathered. In 57 cases, tumor size measurements were also available for breast MRI. Histopathological results of the surgical specimen served as gold standard in all cases. Results - The Pearson's correlation coefficients (PCC) of CESM versus histopathology and breast MRI versus histopathology were all >0.9, p<0.0001. For the agreement between measurements, the mean difference between CESM and histopathology was 0.03 mm. The mean difference between breast MRI and histopathology was 2.12 mm. Using a 2x2 contingency table to assess the frequency distribution of a relevant size discrepancy of >1 cm between the two imaging modalities and histopathological results, we did not observe any advantage of performing an additional breast MRI after CESM in any of the cases. Conclusion - Quality of tumor size measurement using CESM is good and matches the quality of these measurement assessed by breast MRI. Additional measurements using breast MRI did not improve the quality of tumor size measurements.

The Quality of Tumor Size Assessment by Contrast-Enhanced Spectral Mammography and the Benefit of Additional Breast MRI

PubMed Central

Lobbes, Marc B.I.; Lalji, Ulrich C.; Nelemans, Patty J.; Houben, Ivo; Smidt, Marjolein L.; Heuts, Esther; de Vries, Bart; Wildberger, Joachim E.; Beets-Tan, Regina G.

2015-01-01

Background - Contrast-enhanced spectral mammography (CESM) is a promising new breast imaging modality that is superior to conventional mammography for breast cancer detection. We aimed to evaluate correlation and agreement of tumor size measurements using CESM. As additional analysis, we evaluated whether measurements using an additional breast MRI exam would yield more accurate results. Methods - Between January 1st 2013 and April 1st 2014, 87 consecutive breast cancer cases that underwent CESM were collected and data on maximum tumor size measurements were gathered. In 57 cases, tumor size measurements were also available for breast MRI. Histopathological results of the surgical specimen served as gold standard in all cases. Results - The Pearson's correlation coefficients (PCC) of CESM versus histopathology and breast MRI versus histopathology were all >0.9, p<0.0001. For the agreement between measurements, the mean difference between CESM and histopathology was 0.03 mm. The mean difference between breast MRI and histopathology was 2.12 mm. Using a 2x2 contingency table to assess the frequency distribution of a relevant size discrepancy of >1 cm between the two imaging modalities and histopathological results, we did not observe any advantage of performing an additional breast MRI after CESM in any of the cases. Conclusion - Quality of tumor size measurement using CESM is good and matches the quality of these measurement assessed by breast MRI. Additional measurements using breast MRI did not improve the quality of tumor size measurements. PMID:25561979

Assessment of the histopathological lesions and chemical analysis of feral cats to the smoke from Kuwait oil fires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moeller, R.B.; Kalasinsky, V.F.; Razzaque, M.

Twenty-six adult or subadult feral cats were collected from Kuwait approximately 8 months after the ignition of the Kuwait oil wells. These animals were obtained from two sources: 12 animals from Kuwait City, a relatively Co smoke-free area, and 14 from the city of Alimadi, an area with heavy smoke. Animals were euthanized and a complete set of tissues consisting of all 0 major organs was taken for histopathology. Samples of lung, liver, kidney, urine, and blood were also taken for toxicology. Histopathological lesions observed in the lung were mild accumulations of anthracotic pigment in the lungs of 17 cats.more » Hyperplasia of the bronchial and bronchiolar gland in 8 cats, and smooth muscle hyperplasia of bronchioles in 14 cats. Iracheal gland hyperplasia was observed in 7 cats, and minimal squamous metaplasia of the tracheal mucosa in 17 cats, Laryngeal lesions consisted of submucosal gland hyperplasia in 2 cats and squamous metaplasia of the mucosa in 5 cats. Hyperplasia of the nasal submucosal glands was observed in 6 animals. The pharyngeal mucosa as well as other organs and organ systems (a) were normal in all cats. Atomic absorption analysis for 11 metals was performed; vanadium and nickel levels (two metals that were present in the smoke from the oil fires) are not indicative of substantial exposure to the oil fires. Based on the histopathological findings and toxicological analysis, it is felt that inhalation of air contaminated with smoke from the oil fires had little or no long-term effect on the animals examined.« less

Assessment of the histopathological lesions and chemical analysis of feral cats to the smoke from the Kuwait oil fires.

PubMed

Moeller, R B; Kalasinsky, V F; Razzaque, M; Centeno, J A; Dick, E J; Abdal, M; Petrov, I I; DeWitt, T W; al-Attar, M; Pletcher, J M

1994-01-01

Twenty-six adult or subadult feral cats were collected from Kuwait approximately 8 months after the ignition of the Kuwait oil wells. These animals were obtained from two sources: 12 animals from Kuwait City, a relatively smoke-free area, and 14 from the city of Ahmadi, an area with heavy smoke. Animals were euthanized and a complete set of tissues consisting of all major organs was taken for histopathology. Samples of lung, liver, kidney, urine, and blood were also taken for toxicology. Histopathological lesions observed in the lung were mild accumulations of anthracotic pigment in the lungs of 17 cats. Hyperplasia of the bronchial and bronchiolar gland in 8 cats, and smooth muscle hyperplasia of bronchioles in 14 cats. Tracheal gland hyperplasia was observed in 7 cats, and minimal squamous metaplasia of the tracheal mucosa in 17 cats, Laryngeal lesions consisted of submucosal gland hyperplasia in 2 cats and squamous metaplasia of the mucosa in 5 cats. Hyperplasia of the nasal submucosal glands was observed in 6 animals. The pharyngeal mucosa as well as other organs and organ systems were normal in all cats. Atomic absorption analysis for 11 metals was performed; vanadium and nickel levels (two metals that were present in the smoke from the oil fires) are not indicative of substantial exposure to the oil fires. Based on the histopathological findings and toxicological analysis, it is felt that inhalation of air contaminated with smoke from the oil fires had little or no long-term effect on the animals examined.

Sutureless laparoscopic heminephrectomy using laser tissue soldering.

PubMed

Ogan, Kenneth; Jacomides, Lucas; Saboorian, Hossein; Koeneman, Kenneth; Li, Yingming; Napper, Cheryl; Hoopman, John; Pearle, Margaret S; Cadeddu, Jeffrey A

2003-06-01

Widespread application of laparoscopic partial nephrectomy has been limited by the lack of a reliable means of attaining hemostasis. We describe laser tissue welding using human albumin as a solder to control bleeding and seal the collecting system during laparoscopic heminephrectomy in a porcine model. Laparoscopic left lower-pole heminephrectomy was performed in five female domestic pigs after occluding the hilar vessels. Using an 810-nm pulsed diode laser (20 W), a 50% liquid albumin-indocyanine green solder was welded to the cut edge of the renal parenchyma to seal the collecting system and achieve hemostasis. Two weeks later, an identical procedure was performed on the right kidney, after which, the animals were sacrificed and both kidneys were harvested for ex vivo retrograde pyelograms and histopathologic analysis. All 10 heminephrectomies were performed without complication. The mean operative time was 82 minutes, with an average blood loss of 43.5 mL per procedure. The mean warm ischemia time was 11.7 minutes. For each heminephrectomy, a mean of 4.2 mL of solder was welded to the cut parenchymal surface. In three of the five acute kidneys and all five 2-week kidneys, ex vivo retrograde pyelograms demonstrated no extravasation. In addition, no animal had clinical evidence of urinoma or delayed hemorrhage. Histopathologic analysis showed preservation of the renal parenchyma immediately beneath the solder. Laser tissue welding provided reliable hemostasis and closure of the collecting system while protecting the underlying parenchyma from the deleterious effect of the laser during porcine laparoscopic heminephrectomy.

Stacked Sparse Autoencoder (SSAE) for Nuclei Detection on Breast Cancer Histopathology Images.

PubMed

Xu, Jun; Xiang, Lei; Liu, Qingshan; Gilmore, Hannah; Wu, Jianzhong; Tang, Jinghai; Madabhushi, Anant

2016-01-01

Automated nuclear detection is a critical step for a number of computer assisted pathology related image analysis algorithms such as for automated grading of breast cancer tissue specimens. The Nottingham Histologic Score system is highly correlated with the shape and appearance of breast cancer nuclei in histopathological images. However, automated nucleus detection is complicated by 1) the large number of nuclei and the size of high resolution digitized pathology images, and 2) the variability in size, shape, appearance, and texture of the individual nuclei. Recently there has been interest in the application of "Deep Learning" strategies for classification and analysis of big image data. Histopathology, given its size and complexity, represents an excellent use case for application of deep learning strategies. In this paper, a Stacked Sparse Autoencoder (SSAE), an instance of a deep learning strategy, is presented for efficient nuclei detection on high-resolution histopathological images of breast cancer. The SSAE learns high-level features from just pixel intensities alone in order to identify distinguishing features of nuclei. A sliding window operation is applied to each image in order to represent image patches via high-level features obtained via the auto-encoder, which are then subsequently fed to a classifier which categorizes each image patch as nuclear or non-nuclear. Across a cohort of 500 histopathological images (2200 × 2200) and approximately 3500 manually segmented individual nuclei serving as the groundtruth, SSAE was shown to have an improved F-measure 84.49% and an average area under Precision-Recall curve (AveP) 78.83%. The SSAE approach also out-performed nine other state of the art nuclear detection strategies.

Mammalian Toxicity of Munition Compounds. Phase II. Effects of Multiple Doses. Part III. 2,6-Dinitrotoluene

DTIC Science & Technology

1976-07-01

Histopathology , Statistical Analysis, and Normal Values ..... ...... ........... 131 I Ii A.mmALIAN TOXICITY OF MUNITION COMPOUNDS PHASE II: Effects of...chemistry tests and histopathology , and the normal values are given in Appendix I. The concentrations of Ca 2+, Mg2 +, Na+ and K+ in serum were determined...mice fed 2,6-DNT included focal epicarditis or myocarditis, focal cystitis, chronic murine pneumonia or bronchopneumonia, metritis and focal myositis

Identification of sperm mRNA biomarkers associated with testis injury during preclinical testing of pharmaceutical compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dere, Edward

The human testis is sensitive to toxicant-induced injury but current methods for detecting adverse effects are limited, insensitive and unreliable. Animal studies use sensitive histopathological endpoints to assess toxicity, but require testicular tissue that is not available during human clinical trials. More sensitive and reliable molecular biomarkers of testicular injury are needed to better monitor testicular toxicity in both clinical and preclinical. Adult male Wistar Han rats were exposed for 4 weeks to compounds previously associated with testicular injury, including cisplatin (0, 0.2, 0.3, or 0.4 mg/kg/day), BI665915 (0, 20, 70, 100 mg/kg/d), BI665636 (0, 20, 100 mg/kg/d) or BI163538more » (0, 70, 150, 300 mg/kg/d) to evaluate reproductive toxicity and assess changes in sperm mRNA levels. None of the compounds resulted in any significant changes in body, testis or epididymis weights, nor were there decreases in testicular homogenization resistant spermatid head counts. Histopathological evaluation found that only BI665915 treatment caused any testicular effects, including minor germ cell loss and disorganization of the seminiferous tubule epithelium, and an increase in the number of retained spermatid heads. A custom PCR-array panel was used to assess induced changes in sperm mRNA. BI665915 treatment resulted in a significant increase in clusterin (Clu) levels and decreases in GTPase, IMAP family member 4 (Gimap4), prostaglandin D2 synthase (Ptgds) and transmembrane protein with EGF like and two follistatin like domains 1 (Tmeff1) levels. Correlation analysis between transcript levels and quantitative histopathological endpoints found a modest association between Clu with retained spermatid heads. These results demonstrate that sperm mRNA levels are sensitive molecular indicators of testicular injury that can potentially be translated into a clinical setting. - Highlights: • Testing of pharmaceutical compounds identified altered sperm mRNA transcripts. • Altered sperm mRNAs correlated with changes in testicular histopathology. • Sperm mRNAs can potentially be used as surrogates to assess testis injury.« less

Multiparametric and semiquantitative scoring systems for the evaluation of mouse model histopathology - a systematic review

PubMed Central

2013-01-01

Background Histopathology has initially been and is still used to diagnose infectious, degenerative or neoplastic diseases in humans or animals. In addition to qualitative diagnoses semiquantitative scoring of a lesion`s magnitude on an ordinal scale is a commonly demanded task for histopathologists. Multiparametric, semiquantitative scoring systems for mouse models histopathology are a common approach to handle these questions and to include histopathologic information in biomedical research. Results Inclusion criteria for scoring systems were a first description of a multiparametric, semiquantiative scoring systems which comprehensibly describe an approach to evaluate morphologic lesion. A comprehensive literature search using these criteria identified 153 originally designed semiquantitative scoring systems for the analysis of morphologic changes in mouse models covering almost all organs systems and a wide variety of disease models. Of these, colitis, experimental autoimmune encephalitis, lupus nephritis and collagen induced osteoarthritis colitis were the disease models with the largest number of different scoring systems. Closer analysis of the identified scoring systems revealed a lack of a rationale for the selection of the scoring parameters or a correlation between scoring parameter value and the magnitude of the clinical symptoms in most studies. Conclusion Although a decision for a particular scoring system is clearly dependent on the respective scientific question this review gives an overview on currently available systems and may therefore allow for a better choice for the respective project. PMID:23800279

HISTOPATHOLOGICAL PATTERNS IN PAEDIATRIC IDIOPATHIC STEROID RESISTANT NEPHROTIC SYNDROME.

PubMed

Shah, Syed Sajid Hussain; Akhtar, Naureen; Sunbleen, Faiza; ur Rehman, Mohammad Fahim; Ahmed, Tausif

2015-01-01

Steroid-resistant nephrotic syndrome (SRNS) is a common problem but difficult to treat for pediatric nephrologists. Due to paucity of studies done in few centres in southern Pakistan regarding the histopathological aspects in paediatric patients with SRNS, this study was conducted to determine the histopathological spectrum in children with SRNS at our centre. This descriptive study has been conducted at the Nephrology department, The Children's Hospital Lahore from February 2014 to January 2015. Based upon history, physical examination and laboratory results, all patients diagnosed as idiopathic SRNS were included in the study and renal biopsy was done to determine the underlying pathology. Histopathology reports were retrieved and data analysis done using SPSS-20.0. There were a total of 96 patients, 64 (66.7%) males and 32 (33.3%) females. The age range was from 0.80 to 15 years with mean age of presentation being 6.34+3.75 years. The most common histo-pathological pattern was mesangio-proliferative Glomerulonephritis found in 79 (82.3%) cases followed by Focal segmental glomerulosclerosis (FSGS) in 9 (9.4%) patients while Minimal change disease (MCD) was seen in 5 (5.2%) subjects. Mesangioproliferative glomerulonephritis is the most common histological pattern seen in children presenting with idiopathic SRNS at our centre followed by FSGS and MCD.

Histopathology Image Analysis in Two Long-Term Animal Experiments with Helical Flow Total Artificial Heart.

PubMed

Wotke, Jiri; Homolka, Pavel; Vasku, Jaromír; Dobsak, Petr; Palanova, Petra; Mrkvicova, Veronika; Konecny, Petr; Soska, Vladimir; Pohanka, Michal; Novakova, Marie; Yurimoto, Terumi; Saito, Itsuro; Inoue, Yusuke; Isoyama, Takashi; Abe, Yusuke

2016-12-01

Histopathological analysis can provide important information in long-term experiments with total artificial heart (TAH). Recently, a new type of blood pump, the helical flow total artificial heart (HF-TAH) was developed. This study aimed to investigate the changes in selected vital organs in animal experiments with implanted HF-TAH. Samples from lung, liver, and kidneys from two female goats (No. 1301 and No. 1304) with implanted HF-TAH were analyzed. Tissue samples were fixed in 10% formaldehyde and 4 µm thick transverse sections were stained with hematoxylin-eosin (HE). Additional staining was done for detection of connective tissue (Masson-Goldner stain) and for detection of iron (hemosiderin) deposits (Perls stain). Sections were scanned at 100× and 500× magnification with a light microscope. Experiment no. 1301 survived 100 days (cause of termination was heavy damage of the right pump); experimental goat no.1304 survived 68 days and was sacrificed due to severe right hydrodynamic bearing malfunction. Histopathological analysis of liver samples proved signs of chronic venostasis with limited focal necrotic zones. Dilated tubules, proteinaceous material in tubular lumen, and hemosiderin deposits were detected in kidney samples. Contamination of the organs by embolized micro-particles was suspected at the autopsy after discovery of visible damage (scratches) of the pump impeller surface (made from titanium alloy) in both experiments. Sporadic deposits of foreign micro-particles (presumably titanium) were observed in most of the analyzed parenchymal organs. However, the described deposits were not in direct connection with inflammatory reactions in the analyzed tissues. Histopathological analysis showed the presence of minimal contamination of the lung, kidney, and liver tissue samples by foreign material (titanium very likely). The analysis showed only limited pathological changes, especially in liver and kidneys, which might be attributed to the influence of artificial perfusion often observed in chronic TAH experiments. © 2016 Wiley Periodicals, Inc. and International Center for Artificial Organs and Transplantation.

Automated high-throughput assessment of prostate biopsy tissue using infrared spectroscopic chemical imaging

NASA Astrophysics Data System (ADS)

Bassan, Paul; Sachdeva, Ashwin; Shanks, Jonathan H.; Brown, Mick D.; Clarke, Noel W.; Gardner, Peter

2014-03-01

Fourier transform infrared (FT-IR) chemical imaging has been demonstrated as a promising technique to complement histopathological assessment of biomedical tissue samples. Current histopathology practice involves preparing thin tissue sections and staining them using hematoxylin and eosin (H&E) after which a histopathologist manually assess the tissue architecture under a visible microscope. Studies have shown that there is disagreement between operators viewing the same tissue suggesting that a complementary technique for verification could improve the robustness of the evaluation, and improve patient care. FT-IR chemical imaging allows the spatial distribution of chemistry to be rapidly imaged at a high (diffraction-limited) spatial resolution where each pixel represents an area of 5.5 × 5.5 μm2 and contains a full infrared spectrum providing a chemical fingerprint which studies have shown contains the diagnostic potential to discriminate between different cell-types, and even the benign or malignant state of prostatic epithelial cells. We report a label-free (i.e. no chemical de-waxing, or staining) method of imaging large pieces of prostate tissue (typically 1 cm × 2 cm) in tens of minutes (at a rate of 0.704 × 0.704 mm2 every 14.5 s) yielding images containing millions of spectra. Due to refractive index matching between sample and surrounding paraffin, minimal signal processing is required to recover spectra with their natural profile as opposed to harsh baseline correction methods, paving the way for future quantitative analysis of biochemical signatures. The quality of the spectral information is demonstrated by building and testing an automated cell-type classifier based upon spectral features.

International quality assurance project in colorectal cancer-unifying diagnostic and histopathological evaluation.

PubMed

Jannasch, O; Udelnow, A; Romano, G; Dziki, A; Pavalkis, D; Lippert, H; Mroczkowski, P

2014-04-01

Several European countries are undertaking quality control projects in colorectal cancer. These efforts have led to improvements in survival, but a comparison between different projects reveals questionable results. The aim of this study is the presentation of results from hospitals in three different European countries participating in the International Quality Assurance in Colorectal Cancer (IQACC) project. For this publication, patients with cancer of the colon or rectum treated in 2009 and 2010 and recorded in the IQACC (Germany, Poland and Italy) were analysed. The comparison included number of patients, age, preoperative diagnostics (CT of the abdomen and thorax, MRI, colonoscopy, ultrasound, tumour markers), surgical approach, metastasis, height of rectal cancer and histopathological examination of a specimen (T stage, N stage and MERCURY classification for rectum resection). For short-term outcomes, general complications, wound dehiscence, tumour-free status at discharge, anastomotic leakage and in-hospital mortality were analysed. A total of 12,691 patients (6,756 with colon cancer, 5,935 with rectal cancer) were included in the analysis. Preoperative diagnostics differed significantly between countries. For pT and pN stages, several quality differences could be demonstrated, including missing stages (colon cancer: pT 5.7-12.5 %, pN 2.5-11.0 %; rectal cancer: pT 1.1-5.6 %, pN 1.1-15.5 %). The most relevant differences for short-term outcomes in colon cancer were found in general complications (4.2-22.8 %) and tumour-free status at discharge (74.5-91.7 %). In-hospital deaths ranged between 2.5 and 4.3 % and did not show significant differences. For rectal cancer, the country with the highest percentage of tumours localised less than 4 cm from the anal verge (16.0 %) showed the lowest frequency of amputation (8.5 %). Outcome differences were found for general complications (3.2-18.8 %), anastomotic leakage (0-4.3 %) and tumour-free status at discharge (72.9-87.6 %). In-hospital deaths ranged between 1.1 and 3.2 %. This study demonstrates the feasibility of an international quality assurance project in colorectal cancer. This concept ensures data analysis based on a comparable data input. Differences in preoperative diagnostics, completeness of histopathological evaluation and short-term outcomes for Germany, Poland and Italy might result from disparities in socioeconomic factors and implementation of existing guidelines. Further activities are necessary to warrant the use of common standards in outcome control.

The gingival Stillman's clefts: histopathology and cellular characteristics.

PubMed

Cassini, Maria Antonietta; Cerroni, Loredana; Ferlosio, Amedeo; Orlandi, Augusto; Pilloni, Andrea

2015-01-01

Stillman's cleft is a mucogingival triangular-shaped defect on the buccal surface of a root with unknown etiology and pathogenesis. The aim of this study is to examine the Stillman's cleft obtained from excision during root coverage surgical procedures at an histopathological level. Harvesting of cleft was obtained from two periodontally healthy patients with a scalpel and a bevel incision and then placed in a test tube with buffered solution to be processed for light microscopy. Microscopic analysis has shown that Stillman's cleft presented a lichenoid hand-like inflammatory infiltration, while in the periodontal patient an inflammatory fibrous hyperplasia was identified. Stillman's cleft remains to be investigated as for the possible causes of such lesion of the gingival margin, although an inflammatory response seems to be evident and active from a strictly histopathological standpoint.

In vivo MR guided boiling histotripsy in a mouse tumor model evaluated by MRI and histopathology.

PubMed

Hoogenboom, Martijn; Eikelenboom, Dylan; den Brok, Martijn H; Veltien, Andor; Wassink, Melissa; Wesseling, Pieter; Dumont, Erik; Fütterer, Jurgen J; Adema, Gosse J; Heerschap, Arend

2016-06-01

Boiling histotripsy (BH) is a new high intensity focused ultrasound (HIFU) ablation technique to mechanically fragmentize soft tissue into submicrometer fragments. So far, ultrasound has been used for BH treatment guidance and evaluation. The in vivo histopathological effects of this treatment are largely unknown. Here, we report on an MR guided BH method to treat subcutaneous tumors in a mouse model. The treatment effects of BH were evaluated one hour and four days later with MRI and histopathology, and compared with the effects of thermal HIFU (T-HIFU). The lesions caused by BH were easily detected with T2 w imaging as a hyper-intense signal area with a hypo-intense rim. Histopathological evaluation showed that the targeted tissue was completely disintegrated and that a narrow transition zone (<200 µm) containing many apoptotic cells was present between disintegrated and vital tumor tissue. A high level of agreement was found between T2 w imaging and H&E stained sections, making T2 w imaging a suitable method for treatment evaluation during or directly after BH. After T-HIFU, contrast enhanced imaging was required for adequate detection of the ablation zone. On histopathology, an ablation zone with concentric layers was seen after T-HIFU. In line with histopathology, contrast enhanced MRI revealed that after BH or T-HIFU perfusion within the lesion was absent, while after BH in the transition zone some micro-hemorrhaging appeared. Four days after BH, the transition zone with apoptotic cells was histologically no longer detectable, corresponding to the absence of a hypo-intense rim around the lesion in T2 w images. This study demonstrates the first results of in vivo BH on mouse tumor using MRI for treatment guidance and evaluation and opens the way for more detailed investigation of the in vivo effects of BH. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Role of acellular collagen matrix surgisis in the endoscopic management of ureteropelvic junction obstruction.

PubMed

Yohannes, Paulos; Rotariu, Paul; Liatsikos, Evangelos; Malik, Aftab; Alexianu, Mihai; Pinkasov, David; Morgenstern, Nora; Lee, Benjamin R; Smith, Arthur D

2002-10-01

To investigate the role of acellular collagen matrix (Surgisis during endopyelotomy. Nine female pigs (25-35 kg) were enrolled in our protocol. The pigs were categorized as follows. Group I (N = 3) had endopyelotomy + insertion of SIS, Group II (N = 3) creation of UPJ stricture + endopyelotomy + insertion of SIS, and Group III (N = 3) Davis intubated ureterotomy using SIS. The contralateral side served as a control for each group (one pig in each group). In three pigs (two in Group III and one in Group II), Surgisis was treated with India ink prior to insertion at the endopyelotomy site. An endopyelotomy stent (14/8 F x 24 cm) was used to stent the ureteropelvic junction (UPJ) for 4 weeks. Four weeks after the stent was removed, laparoscopic nephroureterectomy was performed, and the animals were euthanized. Histopathologic analysis of the Surgisis-regenerated segment of the UPJ was performed using hematoxylin and eosin, reticular (collagen), smooth muscle actin, and S-100 (nerve) stains. All animals tolerated the procedure. The mean operative time was 162 minutes. One pig (Group II) developed pyonephrosis; one pig (Group III) developed significant ascites and was sacrificed 2 week before the end of the experiment. Histopathologic analysis showed complete epithelializaton at 8 weeks. Reticular stain demonstrated abundant collagen matrix in the submucosa. Smooth muscle staining revealed myofibroblastic proliferation within the SIS-regenerated tissue adjacent to disorganized smooth muscle cells. India ink-stained SIS-regenerated tissue did not show smooth muscle cells. The S-100 stain did not demonstrate neurons at 8 weeks; however, in three pigs, peristaltic activity was noted across the UPJ. The use of acellular collagen matrix in the endoscopic management of UPJ obstruction is a promising technique. The abundance of myofibroblasts and absence of abundant smooth muscle regeneration indicates a need to investigate the role of growth factors in SIS regeneration of host tissue.

Effect of Curcuma longa and Ocimum sanctum on myocardial apoptosis in experimentally induced myocardial ischemic-reperfusion injury

PubMed Central

Mohanty, Ipseeta; Arya, Dharamvir Singh; Gupta, Suresh Kumar

2006-01-01

Background In the present investigation, the effect of Curcuma longa (Cl) and Ocimum sanctum (Os) on myocardial apoptosis and cardiac function was studied in an ischemia and reperfusion (I-R) model of myocardial injury. Methods Wistar albino rats were divided into four groups and orally fed saline once daily (sham, control IR) or Cl (100 mg/kg; Cl-IR) or Os (75 mg/kg; Os-IR) respectively for 1 month. On the 31st day, in the rats of the control IR, Cl-IR and Os-IR groups LAD occlusion was undertaken for 45 min, and reperfusion was allowed for 1 h. The hemodynamic parameters{mean arterial pressure (MAP), heart rate (HR), left ventricular end-diastolic pressure (LVEDP), left ventricular peak positive (+) LVdP/dt (rate of pressure development) and negative (-) LVdP/dt (rate of pressure decline)} were monitored at pre-set points throughout the experimental duration and subsequently, the animals were sacrificed for immunohistopathological (Bax, Bcl-2 protein expression & TUNEL positivity) and histopathological studies. Results Chronic treatment with Cl significantly reduced TUNEL positivity (p < 0.05), Bax protein (p < 0.001) and upregulated Bcl-2 (p < 0.001) expression in comparison to control IR group. In addition, Cl demonstrated mitigating effects on several myocardial injury induced hemodynamic {(+)LVdP/dt, (-) LVdP/dt & LVEDP} and histopathological perturbations. Chronic Os treatment resulted in modest modulation of the hemodynamic alterations (MAP, LVEDP) but failed to demonstrate any significant antiapoptotic effects and prevent the histopathological alterations as compared to control IR group. Conclusion In the present study, significant cardioprotection and functional recovery demonstrated by Cl may be attributed to its anti-apoptotic property. In contrast to Os, Cl may attenuate cell death due to apoptosis and prevent the impairment of cardiac performance. PMID:16504000

Long-term treatment with royal jelly improves bleomycin-induced pulmonary fibrosis in rats.

PubMed

Zargar, Hamid Reza; Hemmati, Ali Asghar; Ghafourian, Mehri; Arzi, Ardeshir; Rezaie, Anahita; Javad-Moosavi, Seyed Ali

2017-01-01

This study investigated the anti-fibrotic potential of royal jelly (RJ) powder against bleomycin-induced pulmonary fibrosis in rats. The rats were given RJ orally (25, 50, and 100 mg/kg per day) for 7 consecutive days before the administration of single intratracheal instillation of bleomycin (BLM) at 7.5 IU/kg. RJ doses were continued for 21 days after BLM exposure. Fibrotic changes in the lungs were studied by cell count and analysis of cytokine levels in the bronchoalveolar lavage fluid (BALF), histopathological examination, and assaying oxidative stress biomarkers in lung tissue. The results showed that BLM administration significantly increased the fibrotic changes, collagen content, and levels of malondialdehyde and decreased total thiol and glutathione peroxidase antioxidant contents in the rats' lung tissue. An increase in the level of cell counts and pro-inflammatory and pro-fibrotic cytokines such as TNF-α and TGF-β in BALF was observed. Also, it significantly decreased IFN-γ, an anti-fibrotic cytokine, in BALF. However, RJ (50 and 100 mg/kg) reversed all of these biochemical indices as well as histopathological alterations induced by BLM. The present study demonstrates that RJ, by its antioxidant and anti-inflammatory properties, attenuates oxidative damage and fibrosis induced by BLM.

Protective Effect of Baccharis trimera Extract on Acute Hepatic Injury in a Model of Inflammation Induced by Acetaminophen

PubMed Central

Pádua, Bruno da Cruz; Rossoni Júnior, Joamyr Victor; de Brito Magalhães, Cíntia Lopes; Chaves, Míriam Martins; Silva, Marcelo Eustáquio; Pedrosa, Maria Lucia; de Souza, Gustavo Henrique Bianco; Brandão, Geraldo Célio; Rodrigues, Ivanildes Vasconcelos; Lima, Wanderson Geraldo; Costa, Daniela Caldeira

2014-01-01

Background. Acetaminophen (APAP) is a commonly used analgesic and antipyretic. When administered in high doses, APAP is a clinical problem in the US and Europe, often resulting in severe liver injury and potentially acute liver failure. Studies have demonstrated that antioxidants and anti-inflammatory agents effectively protect against the acute hepatotoxicity induced by APAP overdose. Methods. The present study attempted to investigate the protective effect of B. trimera against APAP-induced hepatic damage in rats. The liver-function markers ALT and AST, biomarkers of oxidative stress, antioxidant parameters, and histopathological changes were examined. Results. The pretreatment with B. trimera attenuated serum activities of ALT and AST that were enhanced by administration of APAP. Furthermore, pretreatment with the extract decreases the activity of the enzyme SOD and increases the activity of catalase and the concentration of total glutathione. Histopathological analysis confirmed the alleviation of liver damage and reduced lesions caused by APAP. Conclusions. The hepatoprotective action of B. trimera extract may rely on its effect on reducing the oxidative stress caused by APAP-induced hepatic damage in a rat model. General Significance. These results make the extract of B. trimera a potential candidate drug capable of protecting the liver against damage caused by APAP overdose. PMID:25435714

Swept-source optical coherence tomography of lower limb wound healing with histopathological correlation

NASA Astrophysics Data System (ADS)

Barui, Ananya; Banerjee, Provas; Patra, Rusha; Das, Raunak Kumar; Dhara, Santanu; Dutta, Pranab K.; Chatterjee, Jyotirmoy

2011-02-01

Direct noninvasive visualization of wound bed with depth information is important to understand the tissue repair. We correlate skin swept-source-optical coherence tomography (OCT) with histopathological and immunohistochemical evaluation on traumatic lower limb wounds under honey dressing to compare and assess the tissue repair features acquired noninvasively and invasively. Analysis of optical biopsy identifies an uppermost brighter band for stratum corneum with region specific thickness (p < 0.0001) and gray-level intensity (p < 0.0001) variation. Below the stratum corneum, variation in optical intensities is remarkable in different regions of the wound bed. Correlation between OCT and microscopic observations are explored especially in respect to progressive growth and maturation of the epithelial and subepithelial components. Characteristic transition of uniform hypolucid band in OCT image for depigmented zone to wavy highly lucid band in the pigmented zone could be directly correlated with the microscopic findings. The transformation of prematured epithelium of depigmented area, with low expression of E-cadherin, to matured epithelium with higher E-cadherin expression in pigmented zone, implicated plausible change in their optical properties as depicted in OCT. This correlated evaluation of multimodal images demonstrates applicability of swept-source-OCT in wound research and importance of integrated approach in validation of new technology.

Somatostatin receptor immunohistochemistry in neuroendocrine tumors: comparison between manual and automated evaluation

PubMed Central

Daniel, Kaemmerer; Maria, Athelogou; Amelie, Lupp; Isabell, Lenhardt; Stefan, Schulz; Luisa, Peter; Merten, Hommann; Vikas, Prasad; Gerd, Binnig; Paul, Baum Richard

2014-01-01

Background: Manual evaluation of somatostatin receptor (SSTR) immunohistochemistry (IHC) is a time-consuming and cost-intensive procedure. Aim of the study was to compare manual evaluation of SSTR subtype IHC to an automated software-based analysis, and to in-vivo imaging by SSTR-based PET/CT. Methods: We examined 25 gastroenteropancreatic neuroendocrine tumor (GEP-NET) patients and correlated their in-vivo SSTR-PET/CT data (determined by the standardized uptake values SUVmax,-mean) with the corresponding ex-vivo IHC data of SSTR subtype (1, 2A, 4, 5) expression. Exactly the same lesions were imaged by PET/CT, resected and analyzed by IHC in each patient. After manual evaluation, the IHC slides were digitized and automatically evaluated for SSTR expression by Definiens XD software. A virtual IHC score “BB1” was created for comparing the manual and automated analysis of SSTR expression. Results: BB1 showed a significant correlation with the corresponding conventionally determined Her2/neu score of the SSTR-subtypes 2A (rs: 0.57), 4 (rs: 0.44) and 5 (rs: 0.43). BB1 of SSTR2A also significantly correlated with the SUVmax (rs: 0.41) and the SUVmean (rs: 0.50). Likewise, a significant correlation was seen between the conventionally evaluated SSTR2A status and the SUVmax (rs: 0.42) and SUVmean (rs: 0.62).Conclusion: Our data demonstrate that the evaluation of the SSTR status by automated analysis (BB1 score), using digitized histopathology slides (“virtual microscopy”), corresponds well with the SSTR2A, 4 and 5 expression as determined by conventional manual histopathology. The BB1 score also exhibited a significant association to the SSTR-PET/CT data in accordance with the high affinity profile of the SSTR analogues used for imaging. PMID:25197368

Quantitative pre-clinical screening of therapeutics for joint diseases using contrast enhanced micro-computed tomography.

PubMed

Willett, N J; Thote, T; Hart, M; Moran, S; Guldberg, R E; Kamath, R V

2016-09-01

The development of effective therapies for cartilage protection has been limited by a lack of efficient quantitative cartilage imaging modalities in pre-clinical in vivo models. Our objectives were two-fold: first, to validate a new contrast-enhanced 3D imaging analysis technique, equilibrium partitioning of an ionic contrast agent-micro computed tomography (EPIC-μCT), in a rat medial meniscal transection (MMT) osteoarthritis (OA) model; and second, to quantitatively assess the sensitivity of EPIC-μCT to detect the effects of matrix metalloproteinase inhibitor (MMPi) therapy on cartilage degeneration. Rats underwent MMT surgery and tissues were harvested at 1, 2, and 3 weeks post-surgery or rats received an MMPi or vehicle treatment and tissues harvested 3 weeks post-surgery. Parameters of disease progression were evaluated using histopathology and EPIC-μCT. Correlations and power analyses were performed to compare the techniques. EPIC-μCT was shown to provide simultaneous 3D quantification of multiple parameters, including cartilage degeneration and osteophyte formation. In MMT animals treated with MMPi, OA progression was attenuated, as measured by 3D parameters such as lesion volume and osteophyte size. A post-hoc power analysis showed that 3D parameters for EPIC-μCT were more sensitive than 2D parameters requiring fewer animals to detect a therapeutic effect of MMPi. 2D parameters were comparable between EPIC-μCT and histopathology. This study demonstrated that EPIC-μCT has high sensitivity to provide 3D structural and compositional measurements of cartilage and bone in the joint. EPIC-μCT can be used in combination with histology to provide a comprehensive analysis to screen new potential therapies. Copyright © 2016 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Deep convolutional neural networks for automatic classification of gastric carcinoma using whole slide images in digital histopathology.

PubMed

Sharma, Harshita; Zerbe, Norman; Klempert, Iris; Hellwich, Olaf; Hufnagl, Peter

2017-11-01

Deep learning using convolutional neural networks is an actively emerging field in histological image analysis. This study explores deep learning methods for computer-aided classification in H&E stained histopathological whole slide images of gastric carcinoma. An introductory convolutional neural network architecture is proposed for two computerized applications, namely, cancer classification based on immunohistochemical response and necrosis detection based on the existence of tumor necrosis in the tissue. Classification performance of the developed deep learning approach is quantitatively compared with traditional image analysis methods in digital histopathology requiring prior computation of handcrafted features, such as statistical measures using gray level co-occurrence matrix, Gabor filter-bank responses, LBP histograms, gray histograms, HSV histograms and RGB histograms, followed by random forest machine learning. Additionally, the widely known AlexNet deep convolutional framework is comparatively analyzed for the corresponding classification problems. The proposed convolutional neural network architecture reports favorable results, with an overall classification accuracy of 0.6990 for cancer classification and 0.8144 for necrosis detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Clinical and histopathological features of myositis associated with anti-mitochondrial antibodies].

PubMed

Shimizu, Jun

2013-01-01

Anti-mitochondrial antibodies (AMA) are known to be characteristic markers of primary biliary cirrhosis (PBC). The association of PBC with myositis has been reported mainly as case reports, and comprehensive studies of the clinical and histopathological features of patients with myositis and AMAs or PBC have not been conducted thus far. We retrospectively reviewed 212 patients with inflammatory myopathies in our laboratory and found 24 patients with AMA-positive myositis (11%) (seven patients with PBC and 17 patients without PBC). The analysis of clinical and histopathological features revealed that myositis associated with AMAs frequently include patients with a clinically chronic disease course, muscle atrophy, cardiopulmonary involvement and granulomatous inflammation, regardless of the presence or absence of PBC. We also reviewed and analyzed the clinical features of previously reported patients. The analysis of 75 patients, which have been described in previous case reports including the ones of meeting abstracts, also showed the similar results about clinical features of myositis associated with AMAs and supported our findings. Our study suggests that myositis associated with AMAs form a characteristic subgroup.

Arachidonic acid with taurine enhances pulmonary absorption of macromolecules without any serious histopathological damages.

PubMed

Miyake, Masateru; Minami, Takanori; Yamazaki, Hiroyuki; Emoto, Chie; Mukai, Tadashi; Toguchi, Hajime

2017-05-01

Therapeutic peptides and protein are being used in several indications; however, their poor permeability still remains to be solved. This study focused on the pulmonary route of macromolecules. First, the effects of arachidonic acid (AA) as an absorption enhancer on drug serum concentration, after intratracheal administration, were investigated in rats. Second, the safety of AA was assessed in rats in an acute toxicity study for 7days. AA enhanced the exposure of both interferon-α (IFN-α) and fluorescein isothiocyanate 4000 (FD-4). In addition, the histopathological analysis indicated that AA caused alveolitis and bronchitis in rats. In combination with Taurine (Tau), these lung injuries were prevented through the histopathological analysis. The combined use of Tau with AA did not show any changes in the pharmacokinetics of FD-4. From these results, we suggest the combined use of AA with Tau as a novel formulation on the pulmonary route of macromolecule drugs. This formulation could improve the bioavailability of macromolecule drugs without any serious local damage to the lungs. Copyright © 2017 Elsevier B.V. All rights reserved.

Rapid Diagnostic Test Performance Assessed Using Latent Class Analysis for the Diagnosis of Plasmodium falciparum Placental Malaria.

PubMed

Liu, Yunhao; Mwapasa, Victor; Khairallah, Carole; Thwai, Kyaw L; Kalilani-Phiri, Linda; Ter Kuile, Feiko O; Meshnick, Steven R; Taylor, Steve M

2016-10-05

Placental malaria causes low birth weight and neonatal mortality in malaria-endemic areas. The diagnosis of placental malaria is important for program evaluation and clinical care, but is compromised by the suboptimal performance of current diagnostics. Using placental and peripheral blood specimens collected from delivering women in Malawi, we compared estimation of the operating characteristics of microscopy, rapid diagnostic test (RDT), polymerase chain reaction, and histopathology using both a traditional contingency table and a latent class analysis (LCA) approach. The prevalence of placental malaria by histopathology was 13.8%; concordance between tests was generally poor. Relative to histopathology, RDT sensitivity was 79.5% in peripheral and 66.2% in placental blood; using LCA, RDT sensitivities increased to 93.7% and 80.2%, respectively. Our results, if replicated in other cohorts, indicate that RDT testing of peripheral or placental blood may be suitable approaches to detect placental malaria for surveillance programs, including areas where intermittent preventive therapy in pregnancy is not used. © The American Society of Tropical Medicine and Hygiene.

Acquired bilateral telangiectatic macules: a distinct clinical entity.

PubMed

Park, Ji-Hye; Lee, Dong Jun; Lee, Yoo-Jung; Jang, Yong Hyun; Kang, Hee Young; Kim, You Chan

2014-09-01

We evaluated 13 distinct patients with multiple telangiectatic pigmented macules confined mostly to the upper arms to determine if the clinical and histopathological features of these cases might represent a specific clinical entity. We retrospectively investigated the clinical, histopathologic, and immunohistochemical features of 13 patients with multiple telangiectatic pigmented macules on the upper arms who presented between January 2003 and December 2012. Epidermal pigmentation, melanogenic activity, melanocyte number, vascularity, epidermal thickness, and perivascular mast cell number of the specimens were evaluated. Clinically, the condition favored middle-aged men. On histopathologic examination, the lesional skin showed capillary proliferation and telangiectasia in the upper dermis. Histochemical and immunohistochemical analysis revealed basal hyperpigmentation and increased melanogenic activity in the lesional skin (P < .05). No significant difference in epidermal thickness or mast cell number was observed between the normal perilesional skin and the lesional skin. The clinical and histopathologic features of these lesions were relatively consistent in all patients. In addition, the features are quite distinct from other diseases. Based on clinical and histologic features, we suggest the name acquired bilateral telangiectatic macules for this new entity.

Breast cancer mitosis detection in histopathological images with spatial feature extraction

NASA Astrophysics Data System (ADS)

Albayrak, Abdülkadir; Bilgin, Gökhan

2013-12-01

In this work, cellular mitosis detection in histopathological images has been investigated. Mitosis detection is very expensive and time consuming process. Development of digital imaging in pathology has enabled reasonable and effective solution to this problem. Segmentation of digital images provides easier analysis of cell structures in histopathological data. To differentiate normal and mitotic cells in histopathological images, feature extraction step is very crucial step for the system accuracy. A mitotic cell has more distinctive textural dissimilarities than the other normal cells. Hence, it is important to incorporate spatial information in feature extraction or in post-processing steps. As a main part of this study, Haralick texture descriptor has been proposed with different spatial window sizes in RGB and La*b* color spaces. So, spatial dependencies of normal and mitotic cellular pixels can be evaluated within different pixel neighborhoods. Extracted features are compared with various sample sizes by Support Vector Machines using k-fold cross validation method. According to the represented results, it has been shown that separation accuracy on mitotic and non-mitotic cellular pixels gets better with the increasing size of spatial window.

Periodontal Status in Smokers and Nonsmokers: A Clinical, Microbiological, and Histopathological Study

PubMed Central

Sreedevi, Maddipati; Ramesh, Alampalli; Dwarakanath, Chini

2012-01-01

A case-control study was done to assess the influence of smoking on clinical, microbiological, and histopathological parameters. Methods. Two hundred dentate male patients (100 smokers and 100 nonsmokers) ranging between 25 and 50 years were enrolled in the study. Periodontal parameters were recorded. Plaque samples were collected for microbial analysis for BANA test. Gingival biopsies were obtained from selected site for assessing histopathological changes. Results. Both groups showed almost similar plaque levels (P=0.258), but smokers had reduced gingival (0.62 ± 0.31) and bleeding indices (28.53 ± 17.52) and an increased calculus index (1.62 ± 0.36). Smokers had an increased probing depth of 4–7 mm (P=0.009) and overall increased CAL. No difference in microbiota was found between the two groups. Histopathologically smokers showed a decreased blood vessel density (8.84 ± 0.96) and inflammatory cells (52.00 ± 9.79). Conclusions. It is quite possible that many of the pathogenic mechanisms involved in tissue degradation in periodontitis in smokers could be quite different from those in nonsmokers. PMID:22505904

Classification of human coronary atherosclerotic plaques using ex vivo high-resolution multicontrast-weighted MRI compared with histopathology.

PubMed

Li, Tao; Li, Xin; Zhao, Xihai; Zhou, Weihua; Cai, Zulong; Yang, Li; Guo, Aitao; Zhao, Shaohong

2012-05-01

The objective of our study was to evaluate the feasibility of ex vivo high-resolution multicontrast-weighted MRI to accurately classify human coronary atherosclerotic plaques according to the American Heart Association classification. Thirteen human cadaver heart specimens were imaged using high-resolution multicontrast-weighted MR technique (T1-weighted, proton density-weighted, and T2-weighted). All MR images were matched with histopathologic sections according to the landmark of the bifurcation of the left main coronary artery. The sensitivity and specificity of MRI for the classification of plaques were determined, and Cohen's kappa analysis was applied to evaluate the agreement between MRI and histopathology in the classification of atherosclerotic plaques. One hundred eleven MR cross-sectional images obtained perpendicular to the long axis of the proximal left anterior descending artery were successfully matched with the histopathologic sections. For the classification of plaques, the sensitivity and specificity of MRI were as follows: type I-II (near normal), 60% and 100%; type III (focal lipid pool), 80% and 100%; type IV-V (lipid, necrosis, fibrosis), 96.2% and 88.2%; type VI (hemorrhage), 100% and 99.0%; type VII (calcification), 93% and 100%; and type VIII (fibrosis without lipid core), 100% and 99.1%, respectively. Isointensity, which indicates lipid composition on histopathology, was detected on MRI in 48.8% of calcified plaques. Agreement between MRI and histopathology for plaque classification was 0.86 (p < 0.001). Ex vivo high-resolution multicontrast-weighted MRI can accurately classify advanced atherosclerotic plaques in human coronary arteries.

[Improving the teaching quality by multiple tools and technology in oral histopathology experimental course].

PubMed

Tian, Zhen; Wang, Li-Zhen; Hu, Yu-Hua; Zhang, Chun-Ye; Li, Jiang

2017-04-01

Oral histopathology is a course which needs to be combined with theory and practice closely. Experimental course plays an important role in teaching oral histopathology. Here, we aim to explore a series of effective measures to improve the teaching quality of experimental course and tried to train observation, thinking, analysis and problem solving skills of dental students. We re-edited and updated the experimental textbook "guidelines of experimental course of oral histopathology", and published the reference book for experimental course--"color pocket atlas of oral histopathology: experiment and diadactic teaching". The number of clinicopathological cases for presentation and class discussion was increased, and high-quality teaching slides were added and replaced the poor-quality or worn out slides. We established a variety of teaching methods based on the internet, which provided an environment of self-directed learning for dental students. Instead of simple slice-reading examination, a new evaluation system based on computer was established. The questionnaire survey showed that the students spoke positively on the teaching reform for experimental course. They thought that the reform played a significant role in enriching the teaching content, motivating learning interest and promoting self-study. Compared with traditional examination, computer-based examination showed a great advantage on mastering professional knowledge systematically and comprehensively. The measures adopted in our teaching reform not only effectively improve the teaching quality of experimental course of oral histopathology, but also help the students to have a clear, logical thinking when facing complicated diseases and have the ability to apply theoretical knowledge into clinical practice.

Histopathologic grading of anaplasia in retinoblastoma.

PubMed

Mendoza, Pia R; Specht, Charles S; Hubbard, G Baker; Wells, Jill R; Lynn, Michael J; Zhang, Qing; Kong, Jun; Grossniklaus, Hans E

2015-04-01

To determine whether the degree of tumor anaplasia has prognostic value by evaluating its correlation with high-risk histopathologic features and clinical outcomes in a series of retinoblastoma patients. Retrospective clinicopathologic study. The clinical and pathologic findings in 266 patients who underwent primary enucleation for retinoblastoma were reviewed. The histologic degree of anaplasia was graded as retinocytoma, mild, moderate, or severe as defined by increasing cellular pleomorphism, number of mitoses, nuclear size, and nuclear hyperchromatism. Nuclear morphometric characteristics were measured. The clinical and pathologic data of 125 patients were compared using Kaplan-Meier estimates of survival. Fisher exact test and multivariate regression were used to analyze the association between anaplasia grade and high-risk histologic features. Increasing grade of anaplasia was associated with decreased overall survival (P = .003) and increased risk of metastasis (P = .0007). Histopathologic features that were associated with anaplasia included optic nerve invasion (P < .0001), choroidal invasion (P < .0001), and anterior segment invasion (P = .04). Multivariate analysis considering high-risk histopathology and anaplasia grading as predictors of distant metastasis and death showed that high-risk histopathology was statistically significant as an independent predictor (P = .01 for metastasis, P = .03 for death) but anaplasia was not (P = .63 for metastasis, P = .30 for death). In the absence of high-risk features, however, severe anaplasia identified an additional risk for metastasis (P = .0004) and death (P = .01). Grading of anaplasia may be a useful adjunct to standard histopathologic criteria in identifying retinoblastoma patients who do not have high-risk histologic features but still have an increased risk of metastasis and may need adjuvant therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

Histopathological Identification of Colon Cancer with Microsatellite Instability

PubMed Central

Alexander, Julian; Watanabe, Toshiaki; Wu, Tsung-Teh; Rashid, Asif; Li, Shuan; Hamilton, Stanley R.

2001-01-01

Cancer with high levels of microsatellite instability (MSI-H) is the hallmark of hereditary nonpolyposis colorectal cancer syndrome, and MSI-H occurs in ∼15% of sporadic colorectal carcinomas that have improved prognosis. We examined the utility of histopathology for the identification of MSI-H cancers by evaluating the features of 323 sporadic carcinomas using specified criteria and comparing the results to MSI-H status. Coded hematoxylin and eosin sections were evaluated for tumor features (signet ring cells; mucinous histology; cribriforming, poor differentiation, and medullary-type pattern; sponge-like mucinous growth; pushing invasive margin) and features of host immune response (Crohn’s-like lymphoid reaction, intratumoral lymphocytic infiltrate, and intraepithelial T cells by immunohistochemistry for CD3 with morphometry). Interobserver variation among five pathologists was determined. Subjective interpretation of histopathology as an indication for MSI testing was recorded. We found that medullary carcinoma, intraepithelial lymphocytosis, and poor differentiation were the best discriminators between MSI-H and microsatellite-stable cancers (odds ratio: 37.8, 9.8, and 4.0, respectively; P = 0.000003 to <0.000001) with high specificity (99 to 87%). The sensitivities, however, were very low (14 to 38%), and interobserver agreement was good only for evaluation of poor differentiation (kappa, 0.69). Mucinous histopathological type and presence of signet ring cells had low odds ratios of 3.3 and 2.7 (P = 0.005 and P = 0.02) with specificities of 95% but sensitivities of only 15 and 13%. Subjective interpretation of the overall histopathology as suggesting MSI-H performed better than any individual feature; the odds ratio was 7.5 (P < 0.000001) with sensitivity of 49%, specificity of 89%, and moderate interobserver agreement (kappa, 0.52). Forty intraepithelial CD3-positive lymphocytes/0.94 mm2, as established by receiver operating characteristic curve analysis, resulted in an odds ratio of 6.0 (P < 0.000001) with sensitivity of 75% and specificity of 67%. Our findings indicate that histopathological evaluation can be used to prioritize sporadic colon cancers for MSI studies, but morphological prediction of MSI-H has low sensitivity, requiring molecular analysis for therapeutic decisions. PMID:11159189

Rasmussen encephalitis with dual pathology in a patient without seizures: case report and literature review.

PubMed

Ravindra, Vijay M; Mazur, Marcus D; Mohila, Carrie A; Sweney, Matthew T; Hersh, Aimee; Bollo, Robert J

2015-11-01

Rasmussen encephalitis without seizures is rare. We report a case of Rasmussen encephalitis and cortical dysplasia without epilepsy as well as describe the imaging, pathology, and clinical course and review the literature to investigate whether this may represent a rare subset of Rasmussen encephalitis. We report the case of a 12-year-old girl with a history of cognitive decline and right arm weakness. Magnetic resonance imaging demonstrated diffuse left hemispheric cortical and subcortical atrophy suggestive of Rasmussen encephalitis. The patient had no clinical history of seizures, and electroencephalography did not demonstrate epileptiform abnormalities. Craniotomy for open brain biopsy was performed, and histopathologic evaluation identified Rasmussen encephalitis with cortical dysplasia (dual pathology). To the best of our knowledge, this is the third case of Rasmussen encephalitis diagnosed by both imaging and histopathology that had no clinical or electroencephalographic evidence of seizures and is the only case of Rasmussen encephalitis with cortical dysplasia without epilepsy.

Primary extraskeletal myxoid chondrosarcoma of the vulva.

PubMed

Sawada, Morio; Tochigi, Naobumi; Sasajima, Yuko; Hasegawa, Tadashi; Kasamatsu, Takahiro; Kitawaki, Jo

2011-11-01

Primary extraskeletal myxoid chondrosarcoma (EMC) of the vulva is extremely rare. There is little available information about the biological behavior and treatment strategy for primary EMC of the vulva. We report a rare case of primary EMC of the vulva treated surgically. A 24-year-old Japanese woman had demonstrated a small and elastic mass of the vulva and underwent enucleation of the mass at a previous hospital, but a definitive histopathological diagnosis was not obtained. Therefore, the patient was referred to our hospital for further evaluation and treatment. We histopathologically diagnosed the tumor as primary EMC of the vulva and performed vulvectomy with vulvoperineal reconstruction. Microscopic examination of the resected specimens demonstrated residual tumor nodules of EMC. However, there were no viable tumor cells at the surgical margin. Approximately two years after wide local excision was performed, the patient is doing well and there is no apparent recurrence of EMC. © 2011 The Authors. Journal of Obstetrics and Gynaecology Research © 2011 Japan Society of Obstetrics and Gynecology.

1H NMR spectroscopic analysis detects metabolic disturbances in rat urine on acute exposure to heavy metal tungsten alloy based metals salt.

PubMed

Tyagi, Ritu; Rana, Poonam; Gupta, Mamta; Bhatnagar, Deepak; Srivastava, Shatakshi; Roy, Raja; Khushu, Subash

2014-03-25

Heavy metal tungsten alloys (HMTAs) have been found to be safer alternatives for making military munitions. Recently, some studies demonstrating the toxic potential of HMTAs have raised concern over the safety issues, and further propose that HMTAs exposure may lead to physiological disturbances as well. To look for the systemic effect of acute toxicity of HMTA based metals salt, (1)H nuclear magnetic resonance ((1)H NMR) spectroscopic profiling of rat urine was carried out. Male Sprague Dawley rats were administered (intraperitoneal) low and high dose of mixture of HMTA based metals salt and NMR spectroscopy was carried out in urine samples collected at 8, 24, 72 and 120 h post dosing (p.d.). Serum biochemical parameters and liver histopathology were also conducted. The (1)H NMR spectra were analysed using multivariate analysis techniques to show the time- and dose-dependent biochemical variations in post HMTA based metals salt exposure. Urine metabolomic analysis showed changes associated with energy metabolism, amino acids, N-methyl nicotinamide, membrane and gut flora metabolites. Multivariate analysis showed maximum variation with best classification of control and treated groups at 24h p.d. At the end of the study, for the low dose group most of the changes at metabolite level reverted to control except for the energy metabolites; whereas, in the high dose group some of the changes still persisted. The observations were well correlated with histopathological and serum biochemical parameters. Further, metabolic pathway analysis clarified that amongst all the metabolic pathways analysed, tricarboxylic acid cycle was most affected at all the time points indicating a switchover in energy metabolism from aerobic to anaerobic. These results suggest that exposure of rats to acute doses of HMTA based metals salt disrupts physiological metabolism with moderate injury to the liver, which might indirectly result from heavy metals induced oxidative stress. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Correlation of renal histopathology with renal echogenicity in dogs and cats: an ex-vivo quantitative study.

PubMed

Zotti, Alessandro; Banzato, Tommaso; Gelain, Maria Elena; Centelleghe, Cinzia; Vaccaro, Calogero; Aresu, Luca

2015-04-25

Increased cortical or cortical and medullary echogenicity is one of the most common signs of chronic or acute kidney disease in dogs and cats. Subjective evaluation of the echogenicity is reported to be unreliable. Patient and technical-related factors affect in-vivo quantitative evaluation of the echogenicity of parenchymal organs. The aim of the present study is to investigate the relationship between histopathology and ex-vivo renal cortical echogenicity in dogs and cats devoid of any patient and technical-related biases. Kidney samples were collected from 68 dog and 32 cat cadavers donated by the owners to the Veterinary Teaching Hospital of the University of Padua and standardized ultrasonographic images of each sample were collected. The echogenicity of the renal cortex was quantitatively assessed by means of mean gray value (MGV), and then histopathological analysis was performed. Statistical analysis to evaluate the influence of histological lesions on MGV was performed. The differentiation efficiency of MGV to detect pathological changes in the kidneys was calculated for dogs and cats. Statistical analysis revealed that only glomerulosclerosis was an independent determinant of echogenicity in dogs whereas interstitial nephritis, interstitial necrosis and fibrosis were independent determinants of echogenicity in cats. The global influence of histological lesions on renal echogenicity was higher in cats (23%) than in dogs (12%). Different histopathological lesions influence the echogenicity of the kidneys in dogs and cats. Moreover, MGV is a poor test for distinguishing between normal and pathological kidneys in the dog with a sensitivity of 58.3% and specificity of 59.8%. Instead, it seems to perform globally better in the cat, resulting in a fair test, with a sensitivity of 80.6% and a specificity of 56%.

Assessment of the histopathological lesions and chemical analysis of feral cats to the smoke from the Kuwait oil fires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moeller, R.B. Jr.; Dick, E.J.; Pletcher, J.M.

Twenty-six adult or subadult feral cats were collected from Kuwait approximately 8 months after the ignition of the Kuwait oil wells. These animals were obtained from two sources: 12 animals from Kuwait City, a relatively smoke-free area, and 14 from the city of Ahmadi, an area with heavy smoke. Animals were euthanized and a complete set of tissues consisting of all major organs was taken for histopathology. Samples of lung, liver, kidney, urine, and blood were also taken for toxicology. Histopathological lesions observed in the lung were mild accumulations of anthracotic pigment in the lungs of 17 cats. Hyperplasia ofmore » the bronchial and bronchiolar gland in 8 cats, and smooth muscle hyperplasia of bronchioles in 14 cats. Tracheal gland hyperplasia was observed in 7 cats, and minimal squamous metaplasia of the tracheal mucosa in 17 cats, Laryngeal lesions consisted of submucosal gland hyperplasia in 2 cats and squamous metaplasia of the mucosa in 5 cats. Hyperplasia of the nasal submucosal glands was observed in 6 animals. The pharyngeal mucosa as well as other organs and organ systems were normal in all cats. Atomic absorption analysis for 11 metals was performed; vanadium and nickel levels (two metals that were present in the smoke from the oil fires) are not indicative of substantial exposure to the oil fires. Based on the histopathological findings and toxicological analysis, it is felt that inhalation of air contaminated with smoke from the oil fires had little or no long-term effect on the animals examined. 36 refs., 3 figs., 7 tabs.« less

PROGNOSTIC SIGNIFICANCE OF CLINICAL, HISTOPATHOLOGICAL, AND MOLECULAR CHARACTERISTICS OF MEDULLOBLASTOMAS IN THE PROSPECTIVE HIT2000 MULTICENTER CLINICAL TRIAL COHORT

PubMed Central

Pietsch, Torsten; Schmidt, Rene; Remke, Marc; Korshunov, Andrey; Hovestadt, Volker; Jones, David TW; Felsberg, Jörg; Kaulich, Kerstin; Goschzik, Tobias; Kool, Marcel; Northcott, Paul A.; von Hoff, Katja; von Bueren, André O.; Friedrich, Carsten; Skladny, Heyko; Fleischhack, Gudrun; Taylor, Michael D.; Cremer, Friedrich; Lichter, Peter; Faldum, Andreas; Reifenberger, Guido; Rutkowski, Stefan; Pfister, Stefan M.

2014-01-01

BACKGROUND: This study aimed to prospectively evaluate clinical, histopathological and molecular variables for outcome prediction in medulloblastoma patients. METHODS: Patients from the HIT2000 cooperative clinical trial were prospectively enrolled based on the availability of sufficient tumor material and complete clinical information. This revealed a cohort of 184 patients (median age 7.6 years), which was randomly split at a 2:1 ratio into a training (n = 127), and a validation (n = 57) dataset. All samples were subjected to thorough histopathological investigation, CTNNB1 mutation analysis, quantitative PCR, MLPA and FISH analyses for cytogenetic variables, and methylome analysis. RESULTS: By univariable analysis, clinical factors (M-stage), histopathological variables (large cell component, endothelial proliferation, synaptophysin pattern), and molecular features (chromosome 6q status, MYC amplification, TOP2A copy-number, subgrouping) were found to be prognostic. Molecular consensus subgrouping (WNT, SHH, Group 3, Group 4) was validated as an independent feature to stratify patients into different risk groups. When comparing methods for the identification of WNT-driven medulloblastoma, this study identified CTNNB1 sequencing and methylation profiling to most reliably identify these patients. After removing patients with particularly favorable (CTNNB1 mutation, extensive nodularity) or unfavorable (MYC amplification) markers, a risk score for the remaining “intermediate molecular risk” population dependent on age, M-stage, pattern of synaptophysin expression, and MYCN copy-number status was identified and validated, with speckled synaptophysin expression indicating worse outcome. CONCLUSIONS: Methylation subgrouping and CTNNB1 mutation status represent robust tools for the risk-stratification of medulloblastoma. A simple clinico-pathological risk score for “intermediate molecular risk” patients was identified, which deserves further validation. SECONDARY CATEGORY: Pediatrics.

Dysplastic naevi: to shave, or not to shave? A retrospective study of the use of the shave biopsy technique in the initial management of dysplastic naevi.

PubMed

Armour, Katherine; Mann, Stephen; Lee, Stephen

2005-05-01

The management of dysplastic naevi is a controversial subject. This study sought to assess the usefulness of the shave biopsy technique in the initial management of dysplastic naevi, and to demonstrate the advantages over the punch biopsy technique. We report a retrospective observational study of histopathology specimens examined in one histopathology practice over a 14-month period. Patients who had a clinical diagnosis of 'dysplastic naevus', which had initially been biopsied using either a shave or punch biopsy, and then followed up with a full-thickness elliptical excision, were included in the study. Histopathological concordance between the shave and punch biopsy specimens and their respective follow-up elliptical excisions was compared. We found that 21 of 22 (95.5%) shave biopsies were concordant with their respective excision specimens, and that 29 of 41 (70.7%) punch biopsies were concordant with their respective elliptical excision specimens. Of the shave biopsy specimens reviewed, 66% showed that the dysplastic naevi were completely excised with the initial biopsy, compared with 21.2% of the punch biopsy specimens. These findings confirm that shave biopsies provide accurate diagnostic information in the assessment of dysplastic naevi. Shave biopsies enable the entire lesion to be submitted for histopathological assessment, improving the chances of an accurate diagnosis.

Automated Segmentation of Nuclei in Breast Cancer Histopathology Images.

PubMed

Paramanandam, Maqlin; O'Byrne, Michael; Ghosh, Bidisha; Mammen, Joy John; Manipadam, Marie Therese; Thamburaj, Robinson; Pakrashi, Vikram

2016-01-01

The process of Nuclei detection in high-grade breast cancer images is quite challenging in the case of image processing techniques due to certain heterogeneous characteristics of cancer nuclei such as enlarged and irregularly shaped nuclei, highly coarse chromatin marginalized to the nuclei periphery and visible nucleoli. Recent reviews state that existing techniques show appreciable segmentation accuracy on breast histopathology images whose nuclei are dispersed and regular in texture and shape; however, typical cancer nuclei are often clustered and have irregular texture and shape properties. This paper proposes a novel segmentation algorithm for detecting individual nuclei from Hematoxylin and Eosin (H&E) stained breast histopathology images. This detection framework estimates a nuclei saliency map using tensor voting followed by boundary extraction of the nuclei on the saliency map using a Loopy Back Propagation (LBP) algorithm on a Markov Random Field (MRF). The method was tested on both whole-slide images and frames of breast cancer histopathology images. Experimental results demonstrate high segmentation performance with efficient precision, recall and dice-coefficient rates, upon testing high-grade breast cancer images containing several thousand nuclei. In addition to the optimal performance on the highly complex images presented in this paper, this method also gave appreciable results in comparison with two recently published methods-Wienert et al. (2012) and Veta et al. (2013), which were tested using their own datasets.

Automated Segmentation of Nuclei in Breast Cancer Histopathology Images

PubMed Central

Paramanandam, Maqlin; O’Byrne, Michael; Ghosh, Bidisha; Mammen, Joy John; Manipadam, Marie Therese; Thamburaj, Robinson; Pakrashi, Vikram

2016-01-01

The process of Nuclei detection in high-grade breast cancer images is quite challenging in the case of image processing techniques due to certain heterogeneous characteristics of cancer nuclei such as enlarged and irregularly shaped nuclei, highly coarse chromatin marginalized to the nuclei periphery and visible nucleoli. Recent reviews state that existing techniques show appreciable segmentation accuracy on breast histopathology images whose nuclei are dispersed and regular in texture and shape; however, typical cancer nuclei are often clustered and have irregular texture and shape properties. This paper proposes a novel segmentation algorithm for detecting individual nuclei from Hematoxylin and Eosin (H&E) stained breast histopathology images. This detection framework estimates a nuclei saliency map using tensor voting followed by boundary extraction of the nuclei on the saliency map using a Loopy Back Propagation (LBP) algorithm on a Markov Random Field (MRF). The method was tested on both whole-slide images and frames of breast cancer histopathology images. Experimental results demonstrate high segmentation performance with efficient precision, recall and dice-coefficient rates, upon testing high-grade breast cancer images containing several thousand nuclei. In addition to the optimal performance on the highly complex images presented in this paper, this method also gave appreciable results in comparison with two recently published methods—Wienert et al. (2012) and Veta et al. (2013), which were tested using their own datasets. PMID:27649496

In situ assessment of two catfish species (pisces, Ariidae) to evaluate pollution in a harbor

NASA Astrophysics Data System (ADS)

Neta, Raimunda Nonata Fortes Carvalho; Junior, Audalio Rebelo Torres; Sousa, Débora Batista Pinheiro; de Sousa de Oliveira Mota Andrade, Ticianne; Torres, Hetty Salvino; da Silva Castro, Jonatas; da Silva de Almeida, Zafira; Santos, Débora Martins Silva; Tchaicka, Lígia

2016-12-01

A histopathological and biometric database for the catfish Sciades herzbergii and Bagre bagre from São Luís Island (Harbor area) and Caranguejos Island (reference area) in Brazil is presented. Branchial and hepatic lesions were classified into three reaction patterns: 1) circulatory or inflammatory disturbances; 2) regressive changes; 3) progressive changes. The total length (Lt), standard length (Ls), furcal length (Lf), total weight (Wt), and gonad weight (Wg) of each fish were recorded. As expected, most populations of catfish considered in this study are highly heterogeneous, with lengths and weights deviating from the reference sample. No histopathological lesions were observed in Sciades herzbergii examined at the reference site (Caranguejos Island). In contrast, 90% of the catfish S. herzbergii from sites located in the Harbor Area (São Luís Island) had one or more types of branchial and hepatic lesions. As opposed to what was observed in S. herzbergii, more than 86.33% of Bagre bagre individuals showed histopathological alterations in both areas. The utility of histopathological lesions and biometric data as sensitive indicators of the health of wild catfish populations has been demonstrated. Sciades herzbergii proved to be a better species for biomonitoring because it was able to differentiate one impacted site (Port Area/ São Luís Island) from a region relatively free of contaminants (Reference Area/ Caranguejos Island).

Polymerase chain reaction analysis for viruses in paraffin-embedded myocardium from dogs with dilated cardiomyopathy or myocarditis.

PubMed

Maxson, T R; Meurs, K M; Lehmkuhl, L B; Magnon, A L; Weisbrode, S E; Atkins, C E

2001-01-01

To perform polymerase chain reaction (PCR) analysis on paraffin-embedded myocardium from dogs with dilated cardiomyopathy (DCM) and dogs with myocarditis to screen for canine parvovirus, adenovirus types 1 and 2, and herpesvirus. Myocardial specimens from 18 dogs with an antemortem diagnosis of DCM and 9 dogs with a histopathologic diagnosis of myocarditis were evaluated. Paraffin-embedded myocardial specimens were screened for viral genome by PCR analysis. Positive-control specimens were developed from cell cultures as well as paraffin-embedded tissue specimens from dogs with clinical and histopathologic diagnoses of viral infection with canine parvovirus, adenovirus types 1 and 2, and herpesvirus. The histologic characteristics of all myocardial specimens were classified regarding extent, location, and type of inflammation and fibrosis. Canine adenovirus type 1 was amplified from 1 specimen from a dog with DCM. Canine parvovirus, adenovirus type 2, and herpesvirus were not amplified from any myocardial specimens. Histologic analysis of specimens from dogs with DCM revealed variable amounts of fibrosis; myocardial inflammation was observed in 1 affected dog. Histopathologic analysis of specimens from dogs with myocarditis disclosed variable degrees of inflammation and fibrosis. Viral agents canine parvovirus, adenovirus types 1 and 2, and herpesvirus are not commonly associated with DCM or active myocarditis in dogs. Additional studies evaluating for nucleic acid from viruses that less commonly affect dogs or different types of infectious agents may be warranted to gain insight into the cause of DCM and myocarditis in dogs.

¹H NMR-based metabolic profiling of naproxen-induced toxicity in rats.

PubMed

Jung, Jeeyoun; Park, Minhwa; Park, Hye Jin; Shim, Sun Bo; Cho, Yang Ha; Kim, Jinho; Lee, Ho-Sub; Ryu, Do Hyun; Choi, Donwoong; Hwang, Geum-Sook

2011-01-15

The dose-dependent perturbations in urinary metabolite concentrations caused by naproxen toxicity were investigated using ¹H NMR spectroscopy coupled with multivariate statistical analysis. Histopathologic evaluation of naproxen-induced acute gastrointestinal damage in rats demonstrated a significant dose-dependent effect. Furthermore, principal component analysis (PCA) of ¹H NMR from rat urine revealed a dose-dependent metabolic shift between the vehicle-treated control rats and rats treated with low-dose (10 mg/kg body weight), moderate-dose (50 mg/kg), and high-dose (100 mg/kg) naproxen, coinciding with their gastric damage scores after naproxen administration. The resultant metabolic profiles demonstrate that the naproxen-induced gastric damage exhibited energy metabolism perturbations that elevated their urinary levels of citrate, cis-aconitate, creatine, and creatine phosphate. In addition, naproxen administration decreased choline level and increased betaine level, indicating that it depleted the main protective constituent of the gastric mucosa. Moreover, naproxen stimulated the decomposition of tryptophan into kynurenate, which inhibits fibroblast growth factor-1 and delays ulcer healing. These findings demonstrate that ¹H NMR-based urinary metabolic profiling can facilitate noninvasive and rapid diagnosis of drug side effects and is suitable for elucidating possible biological pathways perturbed by drug toxicity. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

MRI and histopathologic study of a novel cholesterol-fed rabbit model of xanthogranuloma.

PubMed

Chen, Yuanxin; Hamilton, Amanda M; Parkins, Katie M; Wang, Jian-Xiong; Rogers, Kem A; Zeineh, Michael M; Rutt, Brian K; Ronald, John A

2016-09-01

To develop a rabbit model of xanthogranuloma based on supplementation of dietary cholesterol. The aim of this study was to analyze the xanthogranulomatous lesions using magnetic resonance imaging (MRI) and histological examination. Rabbits were fed a low-level cholesterol (CH) diet (n = 10) or normal chow (n = 5) for 24 months. In vivo brain imaging was performed on a 3T MR system using fast imaging employing steady state acquisition, susceptibility-weighted imaging, spoiled gradient recalled, T1 -weighted inversion recovery imaging and T1 relaxometry, PD-weighted and T2 -weighted spin-echo imaging and T2 relaxometry, iterative decomposition of water and fat with echo asymmetry and least-squares estimation, ultrashort TE MRI (UTE-MRI), and T2* relaxometry. MR images were evaluated using a Likert scale for lesion presence and quantitative analysis of lesion size, ventricular volume, and T1 , T2 , and T2* values of lesions was performed. After imaging, brain specimens were examined using histological methods. In vivo MRI revealed that 6 of 10 CH-fed rabbits developed lesions in the choroid plexus. Region-of-interest analysis showed that for CH-fed rabbits the mean lesion volume was 8.5 ± 2.6 mm(3) and the volume of the lateral ventricle was significantly increased compared to controls (P < 0.01). The lesions showed significantly shorter mean T2 values (35 ± 12 msec, P < 0.001), longer mean T1 values (1581 ± 146 msec, P < 0.05), and shorter T2* values (22 ± 13 msec, P < 0.001) compared to adjacent brain structures. The ultrashort T2* components were visible using UTE-MRI. Histopathologic evaluation of lesions demonstrated features of human xanthogranuloma. Rabbits fed a low-level CH diet develop sizable intraventricular masses that have similar histopathological features as human xanthogranuloma. Multiparametric MRI techniques were able to provide information about the complex composition of these lesions. J. Magn. Reson. Imaging 2016;44:673-682. © 2016 International Society for Magnetic Resonance in Medicine.

Seven cases of fatal aconite poisoning: forensic experience in China.

PubMed

Liu, Qian; Zhuo, Luo; Liu, Liang; Zhu, Shaohua; Sunnassee, Ananda; Liang, Man; Zhou, Lan; Liu, Yan

2011-10-10

This paper presents seven fatal cases of aconite poisoning encountered in the Tongji Center for Medicolegal Expertise in Hubei (TCMEH), China, from 1999 to 2008 retrospectively. In six of the cases, deaths occurred after drinking homemade medicated liquor containing aconite, and in one case death was due to ingestion of traditional Chinese medication containing aconite. Forensic autopsy and pathological examinations ruled out the presence of physical trauma or life-threatening diseases. Diagnosis of aconite poisoning was made after postmortem toxicological analysis. Animal experiment was performed in one case demonstrating that the medicated liquor could cause death rapidly. We present the autopsy and histopathological findings, toxicological analysis, and results of animal experiment done on samples from those seven cases. As an important herbal Chinese medicine, Aconitum species deserve special attention, especially because it contains poisonous alkaloids. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Deep Learning Nuclei Detection in Digitized Histology Images by Superpixels

PubMed Central

Sornapudi, Sudhir; Stanley, Ronald Joe; Stoecker, William V.; Almubarak, Haidar; Long, Rodney; Antani, Sameer; Thoma, George; Zuna, Rosemary; Frazier, Shelliane R.

2018-01-01

Background: Advances in image analysis and computational techniques have facilitated automatic detection of critical features in histopathology images. Detection of nuclei is critical for squamous epithelium cervical intraepithelial neoplasia (CIN) classification into normal, CIN1, CIN2, and CIN3 grades. Methods: In this study, a deep learning (DL)-based nuclei segmentation approach is investigated based on gathering localized information through the generation of superpixels using a simple linear iterative clustering algorithm and training with a convolutional neural network. Results: The proposed approach was evaluated on a dataset of 133 digitized histology images and achieved an overall nuclei detection (object-based) accuracy of 95.97%, with demonstrated improvement over imaging-based and clustering-based benchmark techniques. Conclusions: The proposed DL-based nuclei segmentation Method with superpixel analysis has shown improved segmentation results in comparison to state-of-the-art methods. PMID:29619277

Cavisoma magnum (Cavisomidae), a unique Pacific acanthocephalan redescribed from an unusual host, Mugil cephalus (Mugilidae), in the Arabian Gulf, with notes on histopathology and metal analysis

PubMed Central

Amin, Omar M.; Heckmann, Richard A.; Bannai, Majid A.

2018-01-01

Cavisoma magnum (Southwell, 1927) Van Cleave, 1931 was originally described from a sea bass, Serranus sp. and spotted surgeonfish, Ctenochaetus strigosus (Perciformes) off Sri Lanka before its more recent redescription from milkfish in the Philippines in 1995. These reports were based on only light infections of their host fishes. Of the few flathead grey mullets, Mugil cephalus (Mugilidae), that we examined in the Arabian Gulf, one fish was infected with 1,450 worms. One milkfish, Chanos chanos (Chanidae), from the same location in the Arabian Gulf, was also heavily infected with specimens of C. magnum. The descriptions of this unique large worm are revised and for the first time, we provide SEM images, new systematic observations, metal analysis of hooks showing extremely high levels of sulfur, and histopathology in the mullet intestinal tissue. Adjustments and corrections of previous descriptive accounts are made. The histopathology studies show extensive damage to the host intestinal tissue including epithelial necrosis, hemorrhaging and worm encapsulation. There is an extensive amount of host connective tissue surrounding the worm. Results of x-ray analysis displayed high levels of sulfur in proboscis hooks, especially at the tips and edges of these attachment structures. PMID:29424340

Low-level laser therapy induces an upregulation of collagen gene expression during the initial process of bone healing: a microarray analysis

NASA Astrophysics Data System (ADS)

Tim, Carla Roberta; Bossini, Paulo Sérgio; Kido, Hueliton Wilian; Malavazi, Iran; von Zeska Kress, Marcia Regina; Carazzolle, Marcelo Falsarella; Rennó, Ana Cláudia; Parizotto, Nivaldo Antonio

2016-08-01

This study investigates the histological modifications produced by low level laser therapy (LLLT) on the first day of bone repair, as well as evaluates the LLLT effects on collagen expression on the site of a fracture. Twenty Wistar rats were distributed into a control group (CG) and a laser group (LG). Laser irradiation of Ga-Al-As laser 830 nm, 30 mW, 94 s, 2.8 J was performed in five sessions. Animals were euthanized on day 5 postsurgery. Histopathological analysis showed that LLLT was able to increase deposition of granulation tissue and newly formed bone at the site of the injury. In addition, picrosirius analysis showed that collagen fiber organization in the LG was enhanced compared to CG. Microarray analysis demonstrated that LLLT produced an upregulation type I collagen (COL-I). Immunohistochemical analysis revealed that the subjects that were treated presented a higher immunoexpression of COL-I. Our findings indicated that LLLT improves bone healing by producing a significant increase in the expression of collagen genes.

Differential histopathologic parameters in colorectal cancer liver metastases resected after triplets plus bevacizumab or cetuximab: a pooled analysis of five prospective trials.

PubMed

Cremolini, Chiara; Milione, Massimo; Marmorino, Federica; Morano, Federica; Zucchelli, Gemma; Mennitto, Alessia; Prisciandaro, Michele; Lonardi, Sara; Pellegrinelli, Alessio; Rossini, Daniele; Bergamo, Francesca; Aprile, Giuseppe; Urbani, Lucio; Morelli, Luca; Schirripa, Marta; Cardellino, Giovanni Gerardo; Fassan, Matteo; Fontanini, Gabriella; de Braud, Filippo; Mazzaferro, Vincenzo; Falcone, Alfredo; Pietrantonio, Filippo

2018-04-01

Many factors, including histopathologic parameters, seem to influence the prognosis of patients undergoing resection of colorectal cancer liver metastases (CRCLM), although their relative weight is unclear. Histopathologic growth patterns (HGPs) of CRCLM may affect sensitivity to antiangiogenics. We aimed at evaluating differences in histopathologic parameters of response according to the use of bevacizumab or cetuximab as first-line targeted agents, and at exploring the prognostic and predictive role of HGPs. We performed a comprehensive histopathologic characterisation of CRCLM from 159 patients who underwent secondary resection, after receiving triplets FOLFOXIRI (folinic acid, 5-fluorouracil, oxaliplatin, and irinotecan) or COI (capecitabine, oxaliplatin, and irinotecan) plus bevacizumab (N = 103) vs cetuximab (N = 56) in five first-line no-profit clinical trials. Both major histopathologic response (tumour regression grade TRG1-2, 32 vs 14%, p = 0.013) and infarct-like necrosis (80 vs 64%, p = 0.035) were significantly higher in the bevacizumab than in the cetuximab group. Achieving major response positively affected relapse-free survival (RFS) (p = 0.012) and overall survival (OS) (p = 0.045), also in multivariable models (RFS, p = 0.008; OS, p = 0.033). In the desmoplastic HGP (N = 28), a higher percentage of major response was reported (57 vs 17% in pushing and 22% in replacement HGP, p < 0.001) and an unsignificant advantage from cetuximab vs bevacizumab was evident in RFS (p = 0.116). In the pushing HGP (N = 66), a significant benefit from bevacizumab vs cetuximab (p = 0.017) was observed. No difference was described in the replacement HGP (N = 65, p = 0.615). The histopathologic response is the only independent determinant of survival in patients resected after triplets plus a biologic. When associated with triplet chemotherapy, bevacizumab induces a higher histopathologic response rate than cetuximab. The assessment of HGPs should be further explored as a predictor of benefit from available targeted agents.

A Complete Color Normalization Approach to Histopathology Images Using Color Cues Computed From Saturation-Weighted Statistics.

PubMed

Li, Xingyu; Plataniotis, Konstantinos N

2015-07-01

In digital histopathology, tasks of segmentation and disease diagnosis are achieved by quantitative analysis of image content. However, color variation in image samples makes it challenging to produce reliable results. This paper introduces a complete normalization scheme to address the problem of color variation in histopathology images jointly caused by inconsistent biopsy staining and nonstandard imaging condition. Method : Different from existing normalization methods that either address partial cause of color variation or lump them together, our method identifies causes of color variation based on a microscopic imaging model and addresses inconsistency in biopsy imaging and staining by an illuminant normalization module and a spectral normalization module, respectively. In evaluation, we use two public datasets that are representative of histopathology images commonly received in clinics to examine the proposed method from the aspects of robustness to system settings, performance consistency against achromatic pixels, and normalization effectiveness in terms of histological information preservation. As the saturation-weighted statistics proposed in this study generates stable and reliable color cues for stain normalization, our scheme is robust to system parameters and insensitive to image content and achromatic colors. Extensive experimentation suggests that our approach outperforms state-of-the-art normalization methods as the proposed method is the only approach that succeeds to preserve histological information after normalization. The proposed color normalization solution would be useful to mitigate effects of color variation in pathology images on subsequent quantitative analysis.

Histopathological spectrum of cutaneous tuberculosis and non-tuberculous mycobacterial infections.

PubMed

Min, Kyueng-Whan; Ko, Joo Yeon; Park, Chan Kum

2012-06-01

The non-specific clinical findings and variable histopathological features of cutaneous tuberculosis and non-tuberculous mycobacterial infections often make it difficult to establish a diagnosis and initiate appropriate therapy. We investigated 25 patients diagnosed with mycobacterial infections of the skin in Hanyang University Hospital between 2001 and 2011. Skin biopsy specimens were re-evaluated by various histopathological criteria and molecular studies. To identify the mycobacteria, we performed staining for acid-fast bacilli and also completed polymerase chain reaction analysis. The non-tuberculous mycobacterium species were identified by genetic sequencing of formalin-fixed, paraffin-embedded tissues. Immunocompromised status was more frequent in non-tuberculous mycobacterial infections than in tuberculosis (p = 0.017) while disease duration was longer in tuberculosis (p = 0.026). Microscopically, neutrophil infiltration, interstitial granuloma, small vessel proliferation and increased numbers of bacilli were found to be associated with non-tuberculous mycobacterial infections (all p < 0.05). In contrast, giant cells, plasma cells, tuberculoid granulomas and necrosis were associated with tuberculosis (all p < 0.05). There were no species-specific histopathological findings in non-tuberculous mycobacterial infections. The significant histopathological differences between cutaneous tuberculous and non-tuberculous mycobacterial infections are helpful in considering differential diagnoses. In addition, molecular techniques together with clinico-pathological findings may assist in making accurate diagnoses of cutaneous non-tuberculous mycobacterial infections. Copyright © 2012 John Wiley & Sons A/S.

Association between culture results of corneal scrapings and culture and histopathology results of corneal tissues in therapeutic keratoplasty.

PubMed

Das, Sujata; Sharma, Savitri; Priyadarshini, Omega; Sahu, Srikant K; Kar, Sarita; Vemuganti, Geeta K

2011-09-01

To correlate the culture results of corneal scrapings with culture and histopathology results of corneal tissues in therapeutic keratoplasty. A retrospective analysis of the culture results of corneal scrapings and corneal tissues of eyes that received therapeutic penetrating keratoplasty at a tertiary eye care center between December 2006 and November 2008 was conducted. As per the preferred practice, those cases that did not respond to appropriate antimicrobial therapy and/or presented with a large infiltrate/perforation received therapeutic keratoplasty. The microbiology and histopathology findings of the corneal tissues were compared. Thirty-eight therapeutic keratoplasties were performed on 36 patients. Although all cases had histopathology and culture of the corneal tissue, corneal scrapings were not performed in 4 cases. Corneal scrapings and corneal tissues were culture-positive in 76% (26 of 34) and 60% (23 of 38) of cases, respectively. In 8 cases, the corneal scrapings and corneal tissues yielded identical organisms, whereas different organisms grew in 4 cases. In 6 cases, the corneal tissues were culture-positive but the corneal scrapings were sterile. In 20 cases, the corneal tissues were culture-positive for fungus and also showed fungal filaments in their corresponding histopathology specimens. Corneal tissue culture can provide additional information in cases undergoing therapeutic keratoplasty. It helps to determine the management of patients after keratoplasty.

Classical metaphyseal lesions thought to be pathognomonic of child abuse are often artifacts or indicative of metabolic bone disease.

PubMed

Miller, Marvin; Mirkin, L David

2018-06-01

The objective of the present study was to review the histopathology in the original articles by authors Kleinman and Marks that described the specificity of the classical metaphyseal lesion for child abuse and to determine if there were any oversights in the authors' analysis. We reviewed the histopathology of the original studies that equated the classical metaphyseal lesion with child abuse. We compared this with the histopathology of metaphyseal fractures caused by known accidental, severe trauma in children and reviewed the histopathology of artifacts that can sometimes be produced in bone histology preparations. Acute classical metaphyseal lesions showed no hemorrhage, and the chronic classical metaphyseal showed islands of cartilage proliferation at the metaphyses and growth plate, findings consistent with rickets and other metabolic bone disorders. Some of the acute metaphyseal lesions were consistent with artifacts. We believe the original studies that equate the classical metaphyseal lesion with child abuse are flawed. The most compelling observation that challenges the histopathology of the classical metaphyseal lesion as being a fracture is the absence of hemorrhage in the acute classical metaphyseal lesion. We hypothesize that some of the classical metaphyseal lesions were artifacts or represent metabolic bone disorders that were not considered and that these two non-traumatic explanations may have been the basis of the abnormal bone findings. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Radiomics-based features for pattern recognition of lung cancer histopathology and metastases.

PubMed

Ferreira Junior, José Raniery; Koenigkam-Santos, Marcel; Cipriano, Federico Enrique Garcia; Fabro, Alexandre Todorovic; Azevedo-Marques, Paulo Mazzoncini de

2018-06-01

lung cancer is the leading cause of cancer-related deaths in the world, and its poor prognosis varies markedly according to tumor staging. Computed tomography (CT) is the imaging modality of choice for lung cancer evaluation, being used for diagnosis and clinical staging. Besides tumor stage, other features, like histopathological subtype, can also add prognostic information. In this work, radiomics-based CT features were used to predict lung cancer histopathology and metastases using machine learning models. local image datasets of confirmed primary malignant pulmonary tumors were retrospectively evaluated for testing and validation. CT images acquired with same protocol were semiautomatically segmented. Tumors were characterized by clinical features and computer attributes of intensity, histogram, texture, shape, and volume. Three machine learning classifiers used up to 100 selected features to perform the analysis. radiomics-based features yielded areas under the receiver operating characteristic curve of 0.89, 0.97, and 0.92 at testing and 0.75, 0.71, and 0.81 at validation for lymph nodal metastasis, distant metastasis, and histopathology pattern recognition, respectively. the radiomics characterization approach presented great potential to be used in a computational model to aid lung cancer histopathological subtype diagnosis as a "virtual biopsy" and metastatic prediction for therapy decision support without the necessity of a whole-body imaging scanning. Copyright © 2018 Elsevier B.V. All rights reserved.

A histological study on the effect of pressure therapy on the activities of myofibroblasts and keratinocytes in hypertrophic scar tissues after burn.

PubMed

Li-Tsang, Cecilia W P; Feng, Beibei; Huang, Lin; Liu, Xusheng; Shu, Bin; Chan, Yvonne T Y; Cheung, Kwok-Kuen

2015-08-01

Although pressure therapy (PT) has been widely used as the first-line treatment for hypertrophic scars (HS), the histopathological changes involved have seldom been studied. This study aimed to examine the longitudinal effect of PT on the histopathological changes in HS. Ten scar samples were selected from six patients with HS after burn and they were given a standardized PT intervention for 3 months while 16 scar samples were obtained on those without PT. The scar biopsies were collected pre-treatment, 1 and 3 months post-intervention for both clinical and histopathological examinations. Clinical assessments demonstrated significant improvement in the thickness and redness of the scars after PT. Histological examination revealed that cell density in the dermal layer was markedly reduced in the 3-months post-pressurized scar tissues, while the arrangement of the collagen fiber was changed from nodular to wave-like pattern. The α-smooth muscle actin immunoreactivity was significantly decreased after 1-month pressure treatment. There was a significant reduction of myofibroblasts population and a concomitant increase in the apoptotic index in the dermal layer in the 3-months' post-pressurized scars. A significant negative correlation was found between the myofibroblasts population and the apoptotic index. The keratinocyte proliferation was found inhibited after PT. Results demonstrated that PT appeared to promote HS maturation by inhibiting the keratinocyte proliferation and suppressing myofibroblasts population, the latter possibly via apoptosis. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

Grover Disease With Epidermal Dysmaturation Pattern: a Common Histopathologic Finding.

PubMed

Aljarbou, Ohoud Z; Asgari, Masoud; Al-Saidi, Nagla; Silloca-Cabana, Elizabeth O; Alathamneh, Mamoun; Sangueza, Omar

2018-02-06

Grover disease is an entity whose diagnosis is based on clinicopathologic correlation. Histopathologically, focal acantholysis is the most common finding. In some cases, there is prominent squamous atypia which can prove to be very challenging and the lesion may be confused with an epidermal neoplasm. To report on atypical histopathological changes in Grover disease and to provide helpful clues to differentiate between the epidermal atypia seen in some cases of Grover disease and epithelial neoplasms. We analyzed 33 cases of Grover disease histologically diagnosed at Wake Forest Baptist Medical Center, NC, between 2011 and 2017. Atypical changes in keratinocytes were defined as epithelial buds, nuclear pleomorphism, and dyskeratosis in all layers of epidermis or altered granular layer. Twenty cases (64%) showed foci with alteration of the normal keratinocytic maturation, whereas 18 cases demonstrated nuclear pleomorphism. Buds of epithelial cells emanating from the basal layer of the epidermis and granular cell alteration was present in 19 cases. The findings especially the presence of an altered granular layer may represent a diagnostic clue in cases of Grover disease with atypical changes.

Breast Histopathological Image Retrieval Based on Latent Dirichlet Allocation.

PubMed

Ma, Yibing; Jiang, Zhiguo; Zhang, Haopeng; Xie, Fengying; Zheng, Yushan; Shi, Huaqiang; Zhao, Yu

2017-07-01

In the field of pathology, whole slide image (WSI) has become the major carrier of visual and diagnostic information. Content-based image retrieval among WSIs can aid the diagnosis of an unknown pathological image by finding its similar regions in WSIs with diagnostic information. However, the huge size and complex content of WSI pose several challenges for retrieval. In this paper, we propose an unsupervised, accurate, and fast retrieval method for a breast histopathological image. Specifically, the method presents a local statistical feature of nuclei for morphology and distribution of nuclei, and employs the Gabor feature to describe the texture information. The latent Dirichlet allocation model is utilized for high-level semantic mining. Locality-sensitive hashing is used to speed up the search. Experiments on a WSI database with more than 8000 images from 15 types of breast histopathology demonstrate that our method achieves about 0.9 retrieval precision as well as promising efficiency. Based on the proposed framework, we are developing a search engine for an online digital slide browsing and retrieval platform, which can be applied in computer-aided diagnosis, pathology education, and WSI archiving and management.

Simple and robust image-based autofocusing for digital microscopy.

PubMed

Yazdanfar, Siavash; Kenny, Kevin B; Tasimi, Krenar; Corwin, Alex D; Dixon, Elizabeth L; Filkins, Robert J

2008-06-09

A simple image-based autofocusing scheme for digital microscopy is demonstrated that uses as few as two intermediate images to bring the sample into focus. The algorithm is adapted to a commercial inverted microscope and used to automate brightfield and fluorescence imaging of histopathology tissue sections.

Molecular biological analysis in a patient with multiple lung adenocarcinomas.

PubMed

Wakayama, Tomoshige; Hirata, Hirokuni; Suka, Shunsuke; Sato, Kozo; Tatewaki, Masamitsu; Souma, Ryosuke; Satoh, Hideyuki; Tamura, Motohiko; Matsumura, Yuji; Imada, Hiroki; Sugiyama, Kumiya; Arima, Masafumi; Kurasawa, Kazuhiro; Fukuda, Takeshi; Fukushima, Yasutsugu

2018-05-01

The utility of molecular biological analysis in lung adenocarcinoma has been demonstrated. Herein we report a rare case presenting as multiple lung adenocarcinomas with four different EGFR gene mutations detected in three lung tumors. After opacification was detected by routine chest X-ray, the patient, a 64-year-old woman, underwent chest computed tomography which revealed a right lung segment S4 ground-glass nodule (GGN). Follow-up computed tomography revealed a 42 mm GGN nodule with a 26 mm nodule (S6) and a 20 mm GGN (S10). Histopathology of resected specimens from the right middle and lower lobes revealed all three nodules were adenocarcinomas. Four EGFR mutations were detected; no three tumors had the same mutations. Molecular biological analysis is a promising tool for the diagnosis of primary tumors in patients with multiple lung carcinomas of the same histotype, enabling appropriate treatment. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

68Ga-HBED-CC-PSMA PET/CT Versus Histopathology in Primary Localized Prostate Cancer: A Voxel-Wise Comparison

PubMed Central

Zamboglou, Constantinos; Schiller, Florian; Fechter, Tobias; Wieser, Gesche; Jilg, Cordula Annette; Chirindel, Alin; Salman, Nasr; Drendel, Vanessa; Werner, Martin; Mix, Michael; Meyer, Philipp Tobias; Grosu, Anca Ligia

2016-01-01

Purpose: We performed a voxel-wise comparison of 68Ga-HBED-CC-PSMA PET/CT with prostate histopathology to evaluate the performance of 68Ga-HBED-CC-PSMA for the detection and delineation of primary prostate cancer (PCa). Methodology: Nine patients with histopathological proven primary PCa underwent 68Ga-HBED-CC-PSMA PET/CT followed by radical prostatectomy. Resected prostates were scanned by ex-vivo CT in a special localizer and histopathologically prepared. Histopathological information was matched to ex-vivo CT. PCa volume (PCa-histo) and non-PCa tissue in the prostate (NPCa-histo) were processed to obtain a PCa-model, which was adjusted to PET-resolution (histo-PET). Each histo-PET was coregistered to in-vivo PSMA-PET/CT data. Results: Analysis of spatial overlap between histo-PET and PSMA PET revealed highly significant correlations (p < 10-5) in nine patients and moderate to high coefficients of determination (R²) from 42 to 82 % with an average of 60 ± 14 % in eight patients (in one patient R2 = 7 %). Mean SUVmean in PCa-histo and NPCa-histo was 5.6 ± 6.1 and 3.3 ± 2.5 (p = 0.012). Voxel-wise receiver-operating characteristic (ROC) analyses comparing the prediction by PSMA-PET with the non-smoothed tumor distribution from histopathology yielded an average area under the curve of 0.83 ± 0.12. Absolute and relative SUV (normalized to SUVmax) thresholds for achieving at least 90 % sensitivity were 3.19 ± 3.35 and 0.28 ± 0.09, respectively. Conclusions: Voxel-wise analyses revealed good correlations of 68Ga-HBED-CC-PSMA PET/CT and histopathology in eight out of nine patients. Thus, PSMA-PET allows a reliable detection and delineation of PCa as basis for PET-guided focal therapies. PMID:27446496

Helicobacter pylori induces an antimicrobial response in rhesus macaques in a cag pathogenicity island-dependent manner.

PubMed

Hornsby, Michael J; Huff, Jennifer L; Kays, Robert J; Canfield, Don R; Bevins, Charles L; Solnick, Jay V

2008-04-01

We used the rhesus macaque model to study the effects of the cag pathogenicity island (cag PAI) on the H pylori host-pathogen interaction. H pylori-specific pathogen-free (SPF) monkeys were experimentally challenged with wild-type (WT) H pylori strain J166 (J166WT, n = 4) or its cag PAI isogenic knockout (J166Deltacag PAI, n = 4). Animals underwent endoscopy before and 1, 4, 8, and 13 weeks after challenge. Gastric biopsies were collected for quantitative culture, histopathology, and host gene expression analysis. Quantitative cultures showed that all experimentally challenged animals were infected with J166WT or its isogenic J166Deltacag PAI. Histopathology demonstrated that inflammation and expansion of the lamina propria were attenuated in animals infected with J166Deltacag PAI compared with J166WT. Microarray analysis showed that of the 119 up-regulated genes in the J166WT-infected animals, several encode innate antimicrobial effector proteins, including elafin, siderocalin, DMBT1, DUOX2, and several novel paralogues of human-beta defensin-2. Quantitative RT-PCR confirmed that high-level induction of each of these genes depended on the presence of the cag PAI. Immunohistochemistry confirmed increased human-beta defensin-2 epithelial cell staining in animals challenged with J166WT compared with either J166Deltacag PAI-challenged or uninfected control animals. We propose that one function of the cag PAI is to induce an antimicrobial host response that may serve to increase the competitive advantage of H pylori in the gastric niche and could even provide a protective benefit to the host.

Intravascular laser speckle imaging for the mechanical analysis of coronary plaques (Conference Presentation)

NASA Astrophysics Data System (ADS)

Hosoda, Masaki; Wang, Jing; Tsikudi, Diane; Nadkarni, Seemantini

2016-02-01

Acute myocardial infarction is frequently caused by the rupture of coronary plaques with severely compromised viscoelastic properties. We have developed a new optical technology termed intravascular laser speckle imaging (ILSI) that evaluates plaque viscoelastic properties, by measuring the time scale (time constant, τ) of temporally evolving laser speckle fluctuations. To enable coronary evaluation in vivo, an optical ILSI catheter has been developed that accomplishes omni-directional illumination and viewing of the entire coronary circumference without the need for mechanical rotation. Here, we describe the capability of ILSI for evaluating human coronary atherosclerosis in cadaveric hearts. ILSI was conducted in conjunction with optical coherence tomography (OCT) imaging in five human cadaveric hearts. The left coronary artery (LCA), left anterior descending (LAD), left circumflex artery (LCx), and right coronary artery (RCA) segments were resected and secured on custom-developed coronary holders to enable accurate co-registration between ILSI, OCT, and histopathology. Speckle time constants, τ, calculated from each ILSI section were compared with lipid and collagen content measured from quantitative Histopathological analysis of the corresponding Oil Red O and Picrosirius Red stained sections. Because the presence of low viscosity lipid elicits rapid speckle fluctuations, we observed an inverse correlation between τ measured by ILSI and lipid content (R= -0.64, p< 0.05). In contrast, the higher viscoelastic modulus of fibrous regions resulted in a positive correlation between τ and collagen content (R= 0.54, p< 0.05). These results demonstrate the feasibility of conducting ILSI evaluation of arterial mechanical properties using a miniaturized omni-directional catheter.

Reversal of progressive necrotizing vasculitis with intravenous pulse cyclophosphamide and methylprednisolone.

PubMed

Fort, J G; Abruzzo, J L

1988-09-01

We describe a patient with polyarteritis nodosa who, despite therapy with daily doses of oral prednisone and cyclophosphamide, developed acute renal failure. Renal histopathologic examination demonstrated crescentic glomerulonephritis. Treatment with intravenous pulse cyclophosphamide and methylprednisolone resulted in clinical improvement and significant recovery of renal function.

Histopathologic Grading of Anaplasia in Retinoblastoma

PubMed Central

Mendoza, Pia R.; Specht, Charles S.; Hubbard, G. Baker; Wells, Jill R.; Lynn, Michael J.; Zhang, Qing; Kong, Jun; Grossniklaus, Hans E.

2014-01-01

Purpose To determine whether the degree of tumor anaplasia has prognostic value by evaluating its correlation with high-risk histopathologic features and clinical outcomes in a series of retinoblastoma patients. Design Retrospective clinicopathologic study. Methods The clinical and pathologic findings in 266 patients who underwent primary enucleation for retinoblastoma were reviewed. The histologic degree of anaplasia was graded as retinocytoma, mild, moderate, or severe as defined by increasing cellular pleomorphism, number of mitoses, nuclear size, and nuclear hyperchromatism. Nuclear morphometric characteristics were measured. The clinical and pathologic data of 125 patients were compared using Kaplan-Meier estimates of survival. Fisher's exact test and multivariate regression were used to analyze the association between anaplasia grade and high-risk histologic features. Results Increasing grade of anaplasia was associated with decreased overall survival (p=0.003) and increased risk of metastasis (p=0.0007). Histopathologic features that were associated with anaplasia included optic nerve invasion (p<0.0001), choroidal invasion (p=<0.0001), and anterior segment invasion (p=0.04). Multivariate analysis considering high-risk histopathology and anaplasia grading as predictors of distant metastasis and death showed that high-risk histopathology was statistically significant as an independent predictor (p=0.01 for metastasis, p=0.03 for death) but anaplasia was not (p=0.63 for metastasis, p=0.30 for death). In the absence of high-risk features, however, severe anaplasia identified an additional risk for metastasis (p=0.0004) and death (p=0.01). Conclusion Grading of anaplasia may be a useful adjunct to standard histopathologic criteria in identifying retinoblastoma patients who do not have high-risk histologic features but still have an increased risk of metastasis and may need adjuvant therapy. PMID:25528954

Multimodal 18F-Fluciclovine PET/MRI and Ultrasound-Guided Neurosurgery of an Anaplastic Oligodendroglioma.

PubMed

Karlberg, Anna; Berntsen, Erik Magnus; Johansen, Håkon; Myrthue, Mariane; Skjulsvik, Anne Jarstein; Reinertsen, Ingerid; Esmaeili, Morteza; Dai, Hong Yan; Xiao, Yiming; Rivaz, Hassan; Borghammer, Per; Solheim, Ole; Eikenes, Live

2017-12-01

Structural magnetic resonance imaging (MRI) and histopathologic tissue sampling are routinely performed as part of the diagnostic workup for patients with glioma. Because of the heterogeneous nature of gliomas, there is a risk of undergrading caused by histopathologic sampling errors. MRI has limitations in identifying tumor grade and type, detecting diffuse invasive growth, and separating recurrences from treatment induced changes. Positron emission tomography (PET) can provide quantitative information of cellular activity and metabolism, and may therefore complement MRI. In this report, we present the first patient with brain glioma examined with simultaneous PET/MRI using the amino acid tracer 18 F-fluciclovine ( 18 F-FACBC) for intraoperative image-guided surgery. A previously healthy 60-year old woman was admitted to the emergency care with speech difficulties and a mild left-sided hemiparesis. MRI revealed a tumor that was suggestive of glioma. Before surgery, the patient underwent a simultaneous PET/MRI examination. Fused PET/MRI, T1, FLAIR, and intraoperative three-dimensional ultrasound images were used to guide histopathologic tissue sampling and surgical resection. Navigated, image-guided histopathologic samples were compared with PET/MRI image data to assess the additional value of the PET acquisition. Histopathologic analysis showed anaplastic oligodendroglioma in the most malignant parts of the tumor, while several regions were World Health Organization (WHO) grade II. 18 F-Fluciclovine uptake was found in parts of the tumor where regional WHO grade, cell proliferation, and cell densities were highest. This finding suggests that PET/MRI with this tracer could be used to improve accuracy in histopathologic tissue sampling and grading, and possibly for guiding treatments targeting the most malignant part of extensive and eloquent gliomas. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Contoured technique for lentigo maligna*

PubMed Central

Mateus, Monica Jidid; Tortelly, Violeta Duarte; Barcaui, Carlos Baptista; Jourdan, Carla Araujo; Simão, Tassiana; Maceira, Juan Manuel Piñeiro

2015-01-01

The surgical approach to lentigo maligna is a challenge to dermatologists, given the difficulty of clinical delimitation of borders. We report here a case of a 69-year-old female patient presenting with brownish macules on her face, since 10 years ago, with histopathological diagnosis of lentigo maligna. The surgical management employed was excision of visible borders with the contoured technique and immediate submission of these borders for histopathological analysis before complete excision of the tumor. This technique is a variant of staged excision, with lower rates of recurrence and acceptable aesthetic results. PMID:25672308

Toxicity and Pharmacokinetic Profile for Single-Dose Injection of ABY-029: a Fluorescent Anti-EGFR Synthetic Affibody Molecule for Human Use.

PubMed

Samkoe, Kimberley S; Gunn, Jason R; Marra, Kayla; Hull, Sally M; Moodie, Karen L; Feldwisch, Joachim; Strong, Theresa V; Draney, Daniel R; Hoopes, P Jack; Roberts, David W; Paulsen, Keith; Pogue, Brian W

2017-08-01

ABY-029, a synthetic Affibody peptide, Z03115-Cys, labeled with a near-infrared fluorophore, IRDye® 800CW, targeting epidermal growth factor receptor (EGFR) has been produced under good manufacturing practices for a US Food and Drug Administration-approved first-in-use human study during surgical resection of glioma, as well as other tumors. Here, the pharmacology, phototoxicity, receptor activity, and biodistribution studies of ABY-029 were completed in rats, prior to the intended human use. Male and female Sprague Dawley rats were administered a single intravenous dose of varying concentrations (0, 245, 2449, and 24,490 μg/kg corresponding to 10×, 100×, and 1000× an equivalent human microdose level) of ABY-029 and observed for up to 14 days. Histopathological assessment of organs and tissues, clinical chemistry, and hematology were performed. In addition, pharmacokinetic clearance and biodistribution of ABY-029 were studied in subgroups of the animals. Phototoxicity and ABY-029 binding to human and rat EGFR were assessed in cell culture and on immobilized receptors, respectively. Histopathological assessment and hematological and clinical chemistry analysis demonstrated that single-dose ABY-029 produced no pathological evidence of toxicity at any dose level. No phototoxicity was observed in EGFR-positive and EGFR-negative glioma cell lines. Binding strength and pharmacokinetics of the anti-EGFR Affibody molecules were retained after labeling with the dye. Based on the successful safety profile of ABY-029, the 1000× human microdose 24.5 mg/kg was identified as the no observed adverse effect level following intravenous administration. Conserved binding strength and no observed light toxicity also demonstrated ABY-029 safety for human use.

Comparative analysis of histopathologic effects of synthetic meshes based on material, weight, and pore size in mice.

PubMed

Orenstein, Sean B; Saberski, Ean R; Kreutzer, Donald L; Novitsky, Yuri W

2012-08-01

While synthetic prosthetics have essentially become mandatory for hernia repair, mesh-induced chronic inflammation and scarring can lead to chronic pain and limited mobility. Mesh propensity to induce such adverse effects is likely related to the prosthetic's material, weight, and/or pore size. We aimed to compare histopathologic responses to various synthetic meshes after short- and long-term implantations in mice. Samples of macroporous polyester (Parietex [PX]), heavyweight microporous polypropylene (Trelex[TX]), midweight microporous polypropylene (ProLite[PL]), lightweight macroporous polypropylene (Ultrapro[UP]), and expanded polytetrafluoroethylene (DualMesh[DM]) were implanted subcutaneously in mice. Four and 12 wk post-implantation, meshes were assessed for inflammation, foreign body reaction (FBR), and fibrosis. All meshes induced varying levels of inflammatory responses. PX induced the greatest inflammatory response and marked FBR. DM induced moderate FBR and a strong fibrotic response with mesh encapsulation at 12 wk. UP and PL had the lowest FBR, however, UP induced a significant chronic inflammatory response. Although inflammation decreased slightly for TX, marked FBR was present throughout the study. Of the three polypropylene meshes, fibrosis was greatest for TX and slightly reduced for PL and UP. For UP and PL, there was limited fibrosis within each mesh pore. Polyester mesh induced the greatest FBR and lasting chronic inflammatory response. Likewise, marked fibrosis and encapsulation was seen surrounding ePTFE. Heavier polypropylene meshes displayed greater early and persistent fibrosis; the reduced-weight polypropylene meshes were associated with the least amount of fibrosis. Mesh pore size was inversely proportional to bridging fibrosis. Moreover, reduced-weight polypropylene meshes demonstrated the smallest FBR throughout the study. Overall, we demonstrated that macroporous, reduced-weight polypropylene mesh exhibited the highest degree of biocompatibility at sites of mesh implantation. Copyright © 2012 Elsevier Inc. All rights reserved.

Transduction of Photoreceptors With Equine Infectious Anemia Virus Lentiviral Vectors: Safety and Biodistribution of StarGen for Stargardt Disease

PubMed Central

Binley, Katie; Widdowson, Peter; Loader, Julie; Kelleher, Michelle; Iqball, Sharifah; Ferrige, Georgina; de Belin, Jackie; Carlucci, Marie; Angell-Manning, Diana; Hurst, Felicity; Ellis, Scott; Miskin, James; Fernandes, Alcides; Wong, Paul; Allikmets, Rando; Bergstrom, Christopher; Aaberg, Thomas; Yan, Jiong; Kong, Jian; Gouras, Peter; Prefontaine, Annick; Vezina, Mark; Bussieres, Martin; Naylor, Stuart; Mitrophanous, Kyriacos A.

2013-01-01

Purpose. StarGen is an equine infectious anemia virus (EIAV)-based lentiviral vector that expresses the photoreceptor-specific adenosine triphosphate (ATP)-binding cassette transporter (ABCA4) protein that is mutated in Stargardt disease (STGD1), a juvenile macular dystrophy. EIAV vectors are able to efficiently transduce rod and cone photoreceptors in addition to retinal pigment epithelium in the adult macaque and rabbit retina following subretinal delivery. The safety and biodistribution of StarGen following subretinal delivery in macaques and rabbits was assessed. Methods. Regular ophthalmic examinations, IOP measurements, ERG responses, and histopathology were carried out in both species to compare control and vector-treated eyes. Tissue and fluid samples were obtained to evaluate the persistence, biodistribution, and shedding of the vector following subretinal delivery. Results. Ophthalmic examinations revealed a slightly higher level of inflammation in StarGen compared with control treated eyes in both species. However, inflammation was transient and no overt toxicity was observed in StarGen treated eyes and there were no abnormal clinical findings. There was no StarGen-associated rise in IOP or abnormal ERG response in either rabbits or macaques. Histopathologic examination of the eyes did not reveal any detrimental changes resulting from subretinal administration of StarGen. Although antibodies to StarGen vector components were detected in rabbit but not macaque serum, this immunologic response did not result in any long-term toxicity. Biodistribution analysis demonstrated that the StarGen vector was restricted to the ocular compartment. Conclusions. In summary, these studies demonstrate StarGen to be well tolerated and localized following subretinal administration. PMID:23620430

Vascular perfusion kinetics by contrast-enhanced ultrasound are related to synovial microvascularity in the joints of psoriatic arthritis.

PubMed

Fiocco, Ugo; Stramare, Roberto; Coran, Alessandro; Grisan, Enrico; Scagliori, Elena; Caso, Francesco; Costa, Luisa; Lunardi, Francesca; Oliviero, Francesca; Bianchi, Fulvia Chieco; Scanu, Anna; Martini, Veronica; Boso, Daniele; Beltrame, Valeria; Vezzù, Maristella; Cozzi, Luisella; Scarpa, Raffaele; Sacerdoti, David; Punzi, Leonardo; Doria, Andrea; Calabrese, Fiorella; Rubaltelli, Leopoldo

2015-11-01

The purpose of the study was to assess the relationship of the continuous mode contrast-enhanced harmonic ultrasound (CEUS) imaging with the histopathological and immunohistochemical (IHC) quantitative estimation of microvascular proliferation on synovial samples of patients affected by sustained psoriatic arthritis (PsA). A dedicated linear transducer was used in conjunction with a specific continuous mode contrast enhanced harmonic imaging technology with a second-generation sulfur hexafluoride-filled microbubbles C-agent. The examination was carried out within 1 week before arthroscopic biopsies in 32 active joints. Perfusional parameters were analyzed including regional blood flow (RBF); peak (PEAK) of the C-signal intensity, proportional to the regional blood volume (RBV); beta (β) perfusion frequency; slope (S), representing the inclination of the tangent in the origin; and the refilling time (RT), the reverse of beta. Arthroscopic synovial biopsies were targeted in the hypervascularity areas, as in the same knee recesses assessed by CEUS; the synovial cell infiltrate and vascularity (vessel density) was evaluated by IHC staining of CD45 (mononuclear cell) and CD31, CD105 (endothelial cell) markers, measured by computer-assisted morphometric analysis. In the CEUS area examined, the corresponding time-intensity curves demonstrated a slow rise time. Synovial histology showed slight increased layer lining thickness, perivascular lymphomonocyte cell infiltration, and microvascular remodeling, with marked vessel wall thickening with reduction of the vascular lumen. A significant correlation was found between RT and CD31+ as PEAK and CD105+ vessel density; RT was inversely correlated to RBF, PEAK, S, and β. The study demonstrated the association of the CEUS perfusion kinetics with the histopathological quantitative and morphologic estimation of synovial microvascular proliferation, suggesting that a CEUS imaging represents a reliable tool for the estimate of the synovial hypervascularity in PsA.

Influence of the Bottom Sediment Characteristics on the Bivalve Mollusk Anadara kagoshimensis Histopathology's Variability in the Northeastern Coast of the Black Sea

NASA Astrophysics Data System (ADS)

Kolyuchkina, G. A.; Budko, D. F.; Chasovnikov, V. K.; Chzhu, V. P.

2017-11-01

With increasing anthropogenic impact on the environment, investigations of organism's response to the contamination of natural habitats, are especially relevant. In the present study, we sought to identify the correlation between the bottom sediments and local variability in histopathology of Anadara kagoshimensis (Bivalvia) in four sites of the north-eastern coast of the Black Sea. Bottom sediment grain size, redox potential of pore water, heavy metals, benzo-α-pyrene and DDT concentrations have been used as characteristics of bottom sediments. Analysis of the data revealed differences in the geochemical background of the studied sites and the histopathological state of the molluscs from these areas. Among the 10 studied elements as well as benzo-α-pyrene and DDT, only Ni has shown an exceedance of statutory limits of concentration in bottom sediments. The study reveals a relationship between Ni concentration in the bottom sediments and frequency of heavy histopathologies in the molluscs. In addition to causes directly related to pollution, mild pathology may be influenced by "natural" causes; in particular, the high content of brown cells in the connective tissue of the digestive gland may be due to the age of molluscs.

Histopathology findings of non-mass cancers on breast ultrasound.

PubMed

Kim, Hye Rin; Jung, Hae Kyoung

2018-06-01

There is little research done on non-mass cancers (NMCs) on breast ultrasound (US). To evaluate large-sectional histopathology findings of NMCs on breast US. The mammographic and histopathology features of biopsy proven 36 breast cancers which showed pure non-mass lesions on US were retrospectively reviewed. The most common mammographic finding was microcalcification (23/35, 65.7%); fine pleomorphic microcalcification was predominant (18/23, 78.3%). The main tumor type was pure ductal carcinoma in situ (DCIS) (14/36, 38.9%) and DCIS with micro- or minimal invasion (11/36, 30.6%). Among the 25 DCIS, histologic grade was high in 15 (60.0%) and intermediate in nine (36%); comedo necrosis was seen in 17 (68%). Immunohistochemical analysis was available in 27 lesions and showed HER2-overexpression in 12 (44.4%) and triple-negative in two (7.4%). According to our limited patient sample, NMCs on breast US were mainly associated with high-grade DCIS.

Deep learning in mammography and breast histology, an overview and future trends.

PubMed

Hamidinekoo, Azam; Denton, Erika; Rampun, Andrik; Honnor, Kate; Zwiggelaar, Reyer

2018-07-01

Recent improvements in biomedical image analysis using deep learning based neural networks could be exploited to enhance the performance of Computer Aided Diagnosis (CAD) systems. Considering the importance of breast cancer worldwide and the promising results reported by deep learning based methods in breast imaging, an overview of the recent state-of-the-art deep learning based CAD systems developed for mammography and breast histopathology images is presented. In this study, the relationship between mammography and histopathology phenotypes is described, which takes biological aspects into account. We propose a computer based breast cancer modelling approach: the Mammography-Histology-Phenotype-Linking-Model, which develops a mapping of features/phenotypes between mammographic abnormalities and their histopathological representation. Challenges are discussed along with the potential contribution of such a system to clinical decision making and treatment management. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

[Histopathological analysis of organs submitted by legal medicine experts in Baojii City: 358 forensic identification cases].

PubMed

Dong, Du-xuan; Shi, Ping-xia; Li, Yun-li; Tian, San-hu; Yang, Jia; Gao, Gang; Zheng, Yun; Jia, Le; Ju, Hong-ya; Sun, Lu-ying; Chen, Ni; Wang, Xiao-bao

2014-08-01

To analyze pathological characteristics of organs recovered during forensic autopsy submitted by legal medicine experts. From Baoji city, 358 cases of forensic autopsy specimens from a series of routine exams were collected. And histopathological diagnoses were reviewed. Majority of the 358 cases were young men. The major causes of death were trauma, sudden death and poisoning. The cause of death was determined with histology in 250 cases. No typical histological changes were noted in 101 cases. The tissue autolysis and decomposition were present in 7 cases. The major pathological diagnosis was cardiovascular disease, followed by diseases in respiratory, nervous, and digestive systems. Forensic autopsy with its professional characteristics, is different from regular autopsy. When diagnosing cause of death by histopathological examination, pathologists should collaborate with legal medicine experts to know the details of the cases, circumstances surrounding the death, and specific forensic pathological characteristics.

A Novel Vaccine against Crimean-Congo Haemorrhagic Fever Protects 100% of Animals against Lethal Challenge in a Mouse Model

PubMed Central

Buttigieg, Karen R.; Dowall, Stuart D.; Findlay-Wilson, Stephen; Miloszewska, Aleksandra; Rayner, Emma; Hewson, Roger; Carroll, Miles W.

2014-01-01

Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. Between 15–70% of reported cases are fatal. There is no approved vaccine available, and preclinical protection in vivo by an experimental vaccine has not been demonstrated previously. In the present study, the attenuated poxvirus vector, Modified Vaccinia virus Ankara, was used to develop a recombinant candidate vaccine expressing the CCHF virus glycoproteins. Cellular and humoral immunogenicity was confirmed in two mouse strains, including type I interferon receptor knockout mice, which are susceptible to CCHF disease. This vaccine protected all recipient animals from lethal disease in a challenge model adapted to represent infection via a tick bite. Histopathology and viral load analysis of protected animals confirmed that they had been exposed to challenge virus, even though they did not exhibit clinical signs. This is the first demonstration of efficacy of a CCHF vaccine. PMID:24621656

A novel vaccine against Crimean-Congo Haemorrhagic Fever protects 100% of animals against lethal challenge in a mouse model.

PubMed

Buttigieg, Karen R; Dowall, Stuart D; Findlay-Wilson, Stephen; Miloszewska, Aleksandra; Rayner, Emma; Hewson, Roger; Carroll, Miles W

2014-01-01

Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. Between 15-70% of reported cases are fatal. There is no approved vaccine available, and preclinical protection in vivo by an experimental vaccine has not been demonstrated previously. In the present study, the attenuated poxvirus vector, Modified Vaccinia virus Ankara, was used to develop a recombinant candidate vaccine expressing the CCHF virus glycoproteins. Cellular and humoral immunogenicity was confirmed in two mouse strains, including type I interferon receptor knockout mice, which are susceptible to CCHF disease. This vaccine protected all recipient animals from lethal disease in a challenge model adapted to represent infection via a tick bite. Histopathology and viral load analysis of protected animals confirmed that they had been exposed to challenge virus, even though they did not exhibit clinical signs. This is the first demonstration of efficacy of a CCHF vaccine.

The Morphometrical and Histopathological Changes which were Observed after Topical Ozone Therapy on an Exophytic Fibrous Gingival Lesion: A Case Report.

PubMed

Patel, Punit Vaibhav; Gujjari, Sheela Kumar

2013-06-01

We are presenting 2 cases where ozone therapy was used in the form of ozonated oil on an exophytic fibrous gingival lesion. A 42-years female patient was selected, who presented with a mild to moderately painful, exophytic, fibrous lesion on the upper anterior gingiva. This gingival lesion was treated with 2ml of ozonated oil, thrice daily for one week. After the ozone therapy, the postoperative outcomes were measured and analyzed. Finally, the lesion was subjected to an excisional biopsy and a histopathological evaluation. After the ozone therapy, the patient revealed that there was less pain. On examination of the lesion, an improvement was observed in the clinical sign of the inflammation and also a reduction in the surface ulceration. During the final biopsy, less bleeding was observed. The morphometrical analysis showed a reduction in the size of the lesion. The histopathological analysis showed a reduction in the collagen fibres and in the inflammatory cells in the connective tissue stroma. Topical ozone therapy provides potential benefits for the treatment of exophytic gingival lesions. The observed benefits in present case report needs to be verified in future with well-controlled clinical trials.

A novel experimental animal model of arterial stenosis based on endovascular radiofrequency energy application.

PubMed

Lazoura, Olga; Zacharoulis, Dimitris; Kanavou, Theodora; Rountas, Christos; Katsimboulas, Michael; Tzovaras, George; Habib, Nagy

2011-01-01

To develop a new rabbit model of arterial stenosis using endovascular radiofrequency (RF) energy. Ten rabbits were used for multiple endovascular RF applications to the aorta and left common carotid artery through the Habib™ VesCoag™ catheter. Angiography and color Doppler ultrasound were used to assess vessel patency immediately following the procedure and six weeks later. One rabbit was sacrificed following the procedure for histopathologic analysis of the vessel wall. Two rabbits died of aortic and carotid rupture, respectively, immediately after the procedure. The remaining seven rabbits were sacrificed after six-week follow-up for histopathological analysis. Optimal RF generator settings to induce significant arterial stenosis (>50%) without complications were standardized at 24-26 watts (W) for 1.5 min for the aorta and 6 W for 1 min for the common carotid artery. The six-week follow-up showed permanent results in all surviving rabbits. Histopathology revealed intima and medial smooth muscle layer necrosis. We have developed a novel rabbit model of arterial stenosis using endovascular RF energy. Our model is fast, safe, inexpensive, and reproducible. It would be useful for experimental investigations and new therapeutic devices.

Correlations between pathologic subtypes/immunohistochemical implication and CT characteristics of lung adenocarcinoma ≤ 1 cm with ground-glass opacity.

PubMed

Wu, Fang; Cai, Zu-long; Tian, Shu-ping; Jin, Xin; Jing, Rui; Yang, Yue-qing; Li, Ying-na; Zhao, Shao-hong

2015-04-01

To discuss the correlation of pathologic subtypes and immunohistochemical implication with CT features of lung adenocarcinoma 1 cm or less in diameter with focal ground-glass opacity (fGGO). CT appearances of 59 patients who underwent curative resection of lung adenocarcinoma ≤ 1 cm with fGGO were analyzed in terms of lesion location, size, density, shape (round, oval, polygonal, irregular), margin (smooth, lobular, spiculated, lobular and spiculated), bubble-like sign, air bronchogram, pleural tag, and tumor-lung interface. Histopathologic subtypes were classified according to International Association for the Study of Lung Cancer/ American Thoracic Society/European Respiratory Society classification of lung adenocarcinoma. Common molecular markers in immunohistochemical study included human epidermal growth factor receptor (HER)-1,HER-2,Ki-67, vascular endothelial growth factor (VEGF) and DNA topoisomerase 2Α.Patients' age and lesions' size and density were compared with pathologic subtypes using analysis of variance or nonparametric Wilcoxon tests. Patients' gender, lesion location, shape and margin, bubble-like sign, air bronchogram, pleural tag, and tumor-lung interface were compared with histopathologic subtypes and immunohistochemical implication using ψ² test or Fisher's exact test. The patients' gender, age, lesion location, shape, air bronchogram, pleural tag, and tumor-lung interface were not significantly different among different histopathologic subtypes (P=0.194, 0.126, 0.609, 0.678, 0.091, 0.374, and 0.339, respectively), whereas the lesion size,density,bubble-like sign, and margin showed significant differences (P=0.028, 0.002, 0.003, 0.046, respectively). The expression of Ki-67 significantly differed among nodules with different shapes(P=0.015). Statistically significant difference also existed between tumor-lung interface and HER-1 expression (P=0.019) and between bubble sign and HER-2 expression (P=0.049). Of lung adenocarcinoma ≤ 1 cm with fGGO,bubble-like sign occurs more frequently in invasive pulmonary adenocarcinoma and less frequently in atypical adenomatous hyperplasia. In addition, preinvasive lesions (atypical adenomatous hyperplasia and adenocarcinoma in situ) more frequently demonstrates smooth margin,while invasive lesions (minimally invasive adenocarcinoma and invasive pulmonary adenocarcinoma) more frequently demonstrates lobular and spiculated margin. Some CT features are associated with immunohistochemical implication of lung adenocarcinoma ≤ 1 cm with fGGO.

Hypoplastic left heart syndrome and pulmonary veno-occlusive disease in an infant.

PubMed

D'Souza, Marise; Vergales, Jeffrey; Jayakumar, K Anitha

2013-01-01

This report describes an infant with heterotaxy syndrome and severe hypoplasia of the left heart who presented with profound cyanosis at birth despite a large patent ductus arteriosus. Pulmonary venous return was difficult to demonstrate by echocardiography. Angiography showed total anomalous pulmonary venous return via a plexus that drained through the paravertebral veins and bilateral superior vena cavae. Autopsy confirmed these findings, and histopathology demonstrated severe occlusive changes within the pulmonary veins.

Histopathological and immunohistochemical aspects of American cutaneous leishmaniasis before and after different treatments.

PubMed

Viana, Agostinho Gonçalves; Mayrink, Wilson; Fraga, Carlos Alberto de Carvalho; Silva, Luciana Maria; Domingos, Patrícia Luciana Batista; Bonan, Paulo Rogério Ferreti; Paula, Alfredo Maurício Batista de; Botelho, Ana Cristina de Carvalho

2013-01-01

The histopathology and immune responses of the healing process of leishmaniasis are still poorly studied. This study aimed to examine the histopathological and immunological aspects of lesions of patients with cutaneous leishmaniasis before and after different therapeutic methods. We studied 23 individuals grouped according to the treatments: Glucantime, Glucantime + Leishvacin and Glucantime + Leishvacin associated with Bacillus Calmette-Guerin. For analysis of the histopathological changes present in the dermis and epidermis, histological sections were stained with hematoxylin and eosin. The samples were immunostained before and after treatment to analyze the expression of interferon (IFN)-γ, interleukin (IL) 12, IL-10 and IL-4. Before treatment the presence of intense infiltrates of mononuclear cells was noticed and after treatment, even with a diagnosis of clinical cure, the subjects still showed a moderate inflammatory process. In the immunohistochemical analyses, we noticed a difference between the cytokines, with increased expression of cytokines IFN-γ and IL-12 compared to IL 10 and IL-4, both before and after treatment and, comparatively, the difference in this expression was more intense before treatment. However, the cytokine expression analyzed by treatment group showed no statistically significant difference. We conclude that a clinical cure does not always coincide with the histopathological one, and that before treatment there is a predominance of Th1 cytokines. In terms of treatment type, there was no difference in the progression of healing for all the three types of treatment, indicating their clinical equivalence.

Histopathological and immunohistochemical aspects of American cutaneous leishmaniasis before and after different treatments*

PubMed Central

Viana, Agostinho Gonçalves; Mayrink, Wilson; Fraga, Carlos Alberto de Carvalho; Silva, Luciana Maria; Domingos, Patrícia Luciana Batista; Bonan, Paulo Rogério Ferreti; de Paula, Alfredo Maurício Batista; Botelho, Ana Cristina de Carvalho

2013-01-01

BACKGROUND The histopathology and immune responses of the healing process of leishmaniasis are still poorly studied. OBJECTIVES This study aimed to examine the histopathological and immunological aspects of lesions of patients with cutaneous leishmaniasis before and after different therapeutic methods. METHODS We studied 23 individuals grouped according to the treatments: Glucantime, Glucantime + Leishvacin and Glucantime + Leishvacin associated with Bacillus Calmette-Guerin. For analysis of the histopathological changes present in the dermis and epidermis, histological sections were stained with hematoxylin and eosin. The samples were immunostained before and after treatment to analyze the expression of interferon (IFN)-γ, interleukin (IL) 12, IL-10 and IL-4. RESULTS Before treatment the presence of intense infiltrates of mononuclear cells was noticed and after treatment, even with a diagnosis of clinical cure, the subjects still showed a moderate inflammatory process. In the immunohistochemical analyses, we noticed a difference between the cytokines, with increased expression of cytokines IFN-γ and IL-12 compared to IL 10 and IL-4, both before and after treatment and, comparatively, the difference in this expression was more intense before treatment. However, the cytokine expression analyzed by treatment group showed no statistically significant difference. CONCLUSION We conclude that a clinical cure does not always coincide with the histopathological one, and that before treatment there is a predominance of Th1 cytokines. In terms of treatment type, there was no difference in the progression of healing for all the three types of treatment, indicating their clinical equivalence. PMID:23539001

Induction of osteoarthritis by injecting monosodium iodoacetate into the patellofemoral joint of an experimental rat model.

PubMed

Takahashi, Ikufumi; Matsuzaki, Taro; Kuroki, Hiroshi; Hoso, Masahiro

2018-01-01

This study aimed to investigate the histopathological changes in the patellofemoral joint using a rat model of osteoarthritis that was induced using monosodium iodoacetate, and to establish a novel model of patellofemoral osteoarthritis in a rat model using histopathological analysis. Sixty male rats were used. Osteoarthritis was induced through a single intra-articular injection of monosodium iodoacetate in both knee joints. Animals were equally divided into two experimental groups based on the monosodium iodoacetate dose: 0.2 mg and 1.0 mg. Histopathological changes in the articular cartilage of the patellofemoral joint and the infrapatellar fat pad were examined at 3 days, 1 week, 2 weeks, 4 weeks, 8 weeks, and 12 weeks after the monosodium iodoacetate injection. In the 1.0-mg group, the representative histopathological findings of osteoarthritis were observed in the articular cartilage of the patellofemoral joint over time. Additionally, the Osteoarthritis Research Society International scores of the patellofemoral joint increased over time. The synovitis scores of the infrapatellar fat pad in both groups were highest at 3 days, and then the values decreased over time. The fibrosis score of the infrapatellar fat pad in the 1.0-mg group increased with time, whereas the fibrosis score in the 0.2-mg group remained low. Representative histopathological findings of osteoarthritis were observed in the articular cartilage of the patellofemoral joint in a rat model of osteoarthritis induced using monosodium iodoacetate. With appropriate selection, this model may be regarded as an ideal patellofemoral osteoarthritis model.

Correlation between transvaginal ultrasound measured endometrial thickness and histopathological findings in Turkish women with abnormal uterine bleeding.

PubMed

Ozer, Alev; Ozer, Serdar; Kanat-Pektas, Mine

2016-05-01

The present study aims to determine how transvaginal ultrasonography and histopathological examination findings are correlated in a cohort of premenopausal and postmenopausal Turkish women with abnormal uterine bleeding. This is a retrospective review of 350 Turkish women who underwent transvaginal ultrasonography and suction curettage as a result of abnormal uterine bleeding. Sonographic appearance of the endometrium was normal in 244 patients (69.7%), while homogeneous thickening was detected in 47 patients (13.4%) and cystic thickening in 21 patients (6.0%). A sonographic diagnosis of endometrial polyp was made in 38 patients (10.9%). Histopathological analysis of endometrial samplings revealed proliferative endometrium (36%), secretory endometrium (24.6%), decidualization (10.9%), endometrial polyp (8.3%), endometritis (6.8%), endometrial hyperplasia (4.6%), irregular shedding (3.7%), atrophic endometrium (3.1%), endometrial cancer (1.1%) and placental retention (0.9%). The sonographic and histopathological findings correlated significantly (χ(2) = 122 768, P = 0.001; r = 0.215, P = 0.001). Approximately 51% of the women with homogeneous endometrial thickening had proliferative endometrium. Only 44.7% of the women with ultrasonographically visualized endometrial polyps had histopathologically diagnosed endometrial polyps. Nearly 57% of the women with cystic endometrial thickening had proliferative endometrium. If there is no facility for hysteroscopy or hysteroscopy-guided endometrial biopsy for women with abnormal uterine bleeding, transvaginal ultrasonography findings can be efficiently used to make a preliminary diagnosis and, thus, notify the pathologists. © 2016 Japan Society of Obstetrics and Gynecology.

Impact of donor histology on survival following liver transplantation for chronic hepatitis C virus infection: a Scandinavian single-center experience.

PubMed

Ydreborg, Magdalena; Westin, Johan; Lagging, Martin; Castedal, Maria; Friman, Styrbjörn

2012-06-01

Survival following liver transplantation for hepatitis C virus (HCV) infection is affected by several factors. The aims of this single-center study were to evaluate survival from 1992 to 2006 in HCV-infected liver transplant recipients and to identify factors influencing patient and graft survival, with particular focus on donor liver histopathology. Survival among 84 patients transplanted for HCV-related liver disease at the Sahlgrenska University Hospital during the above period was evaluated. Median follow-up time was 57 months (range 28-87). A perioperative liver biopsy from the donor liver graft was available in 68 cases. Biopsies were assessed for fibrosis, necroinflammatory activity, and degree of steatosis. Patient and graft survival according to relevant factors including donor histopathology were analyzed by Kaplan-Meier analysis. We found an association between donor liver fibrosis and patient survival (p = 0.016) as well as between graft survival and portal inflammation in the donor liver (p = 0.026). Both these associations remained significant in multivariate analysis (p = 0.007 and 0.017 respectively). Moreover, recipient age over 60 was found predictive of patient survival and repeated steroid boluses or steroid-resistant rejection of graft survival. Donor age was high throughout the study period. Histopathological features, especially portal inflammation and stage of fibrosis, in the donor liver may deleteriously affect graft and patient survival following HCV-related liver transplantation. Thus, pretransplant evaluation of donor histopathology may be of value in the selection of donors for transplantation of HCV-positive individuals, especially among donors older than 60 years.

Correlation between 18F-FDG Positron-Emission Tomography 18F-FDG Uptake Levels at Diagnosis and Histopathologic and Immunohistochemical Factors in Patients with Breast Cancer

PubMed Central

Uğurluer, Gamze; Yavuz, Sinan; Çalıkuşu, Züleyha; Seyrek, Ertuğrul; Kibar, Mustafa; Serin, Meltem; Ersöz, Canan; Demircan, Orhan

2016-01-01

Objective In this study, we aimed to determine the correlation between pretreatment-staging 18F-FDG total body positron-emission tomography/computed tomography (PET/CT) maximum standardized uptake value (SUVmax) levels and histopathologic and immunohistochemical predictive and prognostic factors in patients with breast cancer. Materials and Methods One hundred thirty-nine women with breast cancer who were treated between 2009 and 2015 at our hospital and who had pretreatment-staging PET/CT were included in the study. SUVmax levels and histopathologic and immunohistochemical results were compared. Results The median age was 48 years (range, 29–79 years). The mean tumor diameter was 33.4 mm (range, 7–120 mm). The histology was invasive ductal carcinoma in 80.6% of the patients. In the univariate analysis, SUVmax levels were significantly higher in patients with invasive ductal carcinoma; in patients with a maximum tumor diameter more than 2 cm; patients who were estrogen, progesterone, and combined hormone receptor-negative, triple-negative patients, and in tumors with higher grades (p<0.05). In HER2-positive patients, SUVmax levels were higher even if it was not statistically significant. There was no correlation between lymph node metastases and pathologic stage. In multivariate analysis, tumor diameter was an independent factor. Conclusion SUVmax levels are correlated with known histopathologic and immunohistochemical prognostic factors. PET/CT could be useful in preoperative evaluation of patients with breast cancer to predict biologic characteristics of tumors and prognosis. PMID:28331746

Predictors of Post-Operative Pain Relief in Patients with Chronic Pancreatitis Undergoing the Frey or Whipple Procedure.

PubMed

Sinha, Amitasha; Patel, Yuval A; Cruise, Michael; Matsukuma, Karen; Zaheer, Atif; Afghani, Elham; Yadav, Dhiraj; Makary, Martin A; Hirose, Kenzo; Andersen, Dana K; Singh, Vikesh K

2016-04-01

Post-operative pain relief in chronic pancreatitis (CP) is variable. Our objective was to determine clinical imaging or histopathologic predictor(s) of post-operative pain relief in CP patients undergoing the Whipple or Frey procedure. All patients who underwent a Whipple (n = 30) or Frey procedure (n = 30) for painful CP between January 2003 and September 2013 were evaluated. A toxic etiology was defined as a history of alcohol use and/or smoking. The pre-operative abdominal CT was evaluated for calcification(s) and main pancreatic duct (MPD) dilation (≥5 mm). The post-operative histopathology was evaluated for severe fibrosis. Clinical imaging and histopathologic features were evaluated as predictors of post-operative pain relief using univariable and multivariable regression analysis. A total of 60 patients (age 51.6 years, 53% males) were included in our study, of whom 42 (70%) reported post-operative pain relief over a mean follow-up of 1.1 years. There were 37 (62%) patients with toxic etiology, 36 (60%) each with calcification(s) and MPD dilation. A toxic etiology, calcifications, and severe fibrosis were associated with post-operative pain relief on univariable analysis (all p < 0.01). However, only a toxic etiology was an independent predictor of post-operative pain relief (OR 5.7, 95% CI 1.3, 24.5, p = 0.02). Only a toxic etiology, and not imaging or histopathologic findings, independently predicts post-operative pain relief in CP patients undergoing the Whipple or Frey procedure.

Evaluation of clinical and histopathologic prognostic factors for survival in canine osteosarcoma of the extracranial flat and irregular bones.

PubMed

Kruse, M A; Holmes, E S; Balko, J A; Fernandez, S; Brown, D C; Goldschmidt, M H

2013-07-01

Osteosarcoma is the most common bone tumor in dogs. However, current literature focuses primarily on appendicular osteosarcoma. This study examined the prognostic value of histological and clinical factors in flat and irregular bone osteosarcomas and hypothesized that clinical factors would have a significant association with survival time while histological factors would not. All osteosarcoma biopsy samples of the vertebra, rib, sternum, scapula, or pelvis were reviewed while survival information and clinical data were obtained from medical records, veterinarians, and owners. Forty-six dogs were included in the analysis of histopathological variables and 27 dogs with complete clinical data were included in the analysis of clinical variables. In the histopathologic cox regression model, there was no significant association between any histologic feature of osteosarcoma, including grade, and survival time. In the clinical cox regression model, there was a significant association between the location of the tumor and survival time as well as between the percent elevation of alkaline phosphatase (ALP) above normal and survival time. Controlling for ALP elevation, dogs with osteosarcoma located in the scapula had a significantly greater hazard for death (2.8) compared to dogs with tumors in other locations. Controlling for tumor location, every 100% increase in ALP from normal increased the hazard for death by 1.7. For canine osteosarcomas of the flat and irregular bones, histopathological features, including grade do not appear to be rigorous predictors of survival. Clinical variables such as increased ALP levels and tumor location in the scapula were associated with decreased survival times.

High resolution Physio-chemical Tissue Analysis: Towards Non-invasive In Vivo Biopsy

NASA Astrophysics Data System (ADS)

Xu, Guan; Meng, Zhuo-Xian; Lin, Jian-Die; Deng, Cheri X.; Carson, Paul L.; Fowlkes, J. Brian; Tao, Chao; Liu, Xiaojun; Wang, Xueding

2016-02-01

Conventional gold standard histopathologic diagnosis requires information of both high resolution structural and chemical changes in tissue. Providing optical information at ultrasonic resolution, photoacoustic (PA) technique could provide highly sensitive and highly accurate tissue characterization noninvasively in the authentic in vivo environment, offering a replacement for histopathology. A two-dimensional (2D) physio-chemical spectrogram (PCS) combining micrometer to centimeter morphology and chemical composition simultaneously can be generated for each biological sample with PA measurements at multiple optical wavelengths. This spectrogram presents a unique 2D “physio-chemical signature” for any specific type of tissue. Comprehensive analysis of PCS, termed PA physio-chemical analysis (PAPCA), can lead to very rich diagnostic information, including the contents of all relevant molecular and chemical components along with their corresponding histological microfeatures, comparable to those accessible by conventional histology. PAPCA could contribute to the diagnosis of many diseases involving diffusive patterns such as fatty liver.

Cavisoma magnum (Cavisomidae), a unique Pacific acanthocephalan redescribed from an unusual host, Mugil cephalus (Mugilidae), in the Arabian Gulf, with notes on histopathology and metal analysis.

PubMed

Amin, Omar M; Heckmann, Richard A; Bannai, Majid A

2018-01-01

Cavisoma magnum (Southwell, 1927) Van Cleave, 1931 was originally described from a sea bass, Serranus sp. and spotted surgeonfish, Ctenochaetus strigosus (Perciformes) off Sri Lanka before its more recent redescription from milkfish in the Philippines in 1995. These reports were based on only light infections of their host fishes. Of the few flathead grey mullets, Mugil cephalus (Mugilidae), that we examined in the Arabian Gulf, one fish was infected with 1,450 worms. One milkfish, Chanos chanos (Chanidae), from the same location in the Arabian Gulf, was also heavily infected with specimens of C. magnum. The descriptions of this unique large worm are revised and for the first time, we provide SEM images, new systematic observations, metal analysis of hooks showing extremely high levels of sulfur, and histopathology in the mullet intestinal tissue. Adjustments and corrections of previous descriptive accounts are made. The histopathology studies show extensive damage to the host intestinal tissue including epithelial necrosis, hemorrhaging and worm encapsulation. There is an extensive amount of host connective tissue surrounding the worm. Results of x-ray analysis displayed high levels of sulfur in proboscis hooks, especially at the tips and edges of these attachment structures. © O.M. Amin et al., published by EDP Sciences, 2018.

MICROCOMPUTED TOMOGRAPHIC, MORPHOMETRIC, AND HISTOPATHOLOGIC ASSESSMENT OF CONGENITAL BONE MALFORMATIONS IN TWO NEOTROPICAL VIPERIDS.

PubMed

de Carvalho, Marcelo Pires Nogueira; Sant'Anna, Sávio Stefanini; Grego, Kathleen Fernandes; de Campos Fonseca-Pinto, Ana Carolina Brandão; Lorigados, Carla Aparecida Batista; Queiroz-Hazarbassanov, Nicolle Gilda Teixeira; Catão-Dias, José Luiz

2017-10-01

Congenital malformations have been reported in all classes of vertebrates and may be a determinant of life span and survival. In reptiles, the incidence of congenital malformations can be associated with genetic and environmental causes, including pollution. The characterization of pathological processes involved in the development of congenital malformations of bone in snakes is rare in the literature, but is of great relevance in the field of reptile conservation and environmental health. We describe congenital bone lesions in 50 newborn jararaca (Bothrops jararaca) and 26 South American rattlesnakes (Crotalus durissus terrificus) born from wild-caught pregnant females in Southeastern Brazil. Lesions were evaluated by morphometric quantitative analysis, x-ray microtomography, and histopathologic descriptive analysis. Morphometric analysis showed that jararaca presented more severe axial lesions (kyphosis, scoliosis, and kyphoscoliosis) than rattlesnakes. Female rattlesnakes presented more severe axial lesions than did males. In rattlesnakes, spinal deformities were more frequently diagnosed in the caudal segment of the body. We present x-ray microtomographic assessments and images of malformed snakes (n=9) and characterized novel malformations, such as the agenesis of frontal, parietal, and supraoccipital bones in a jararaca specimen. Histopathologic findings included vertebral body fusion, myositis, coagulation necrosis, and disorganization of periaxial muscle fibers. The new methods and results presented in this study will be useful and informative for future research in pathology, teratology, embryology, and ecotoxicology in snakes.

Novel histopathologic feature identified through image analysis augments stage II colorectal cancer clinical reporting

PubMed Central

Caie, Peter D.; Zhou, Ying; Turnbull, Arran K.; Oniscu, Anca; Harrison, David J.

2016-01-01

A number of candidate histopathologic factors show promise in identifying stage II colorectal cancer (CRC) patients at a high risk of disease-specific death, however they can suffer from low reproducibility and none have replaced classical pathologic staging. We developed an image analysis algorithm which standardized the quantification of specific histopathologic features and exported a multi-parametric feature-set captured without bias. The image analysis algorithm was executed across a training set (n = 50) and the resultant big data was distilled through decision tree modelling to identify the most informative parameters to sub-categorize stage II CRC patients. The most significant, and novel, parameter identified was the ‘sum area of poorly differentiated clusters’ (AreaPDC). This feature was validated across a second cohort of stage II CRC patients (n = 134) (HR = 4; 95% CI, 1.5– 11). Finally, the AreaPDC was integrated with the significant features within the clinical pathology report, pT stage and differentiation, into a novel prognostic index (HR = 7.5; 95% CI, 3–18.5) which improved upon current clinical staging (HR = 4.26; 95% CI, 1.7– 10.3). The identification of poorly differentiated clusters as being highly significant in disease progression presents evidence to suggest that these features could be the source of novel targets to decrease the risk of disease specific death. PMID:27322148

TFM classification and staging of oral submucous fibrosis: A new proposal.

PubMed

Arakeri, Gururaj; Thomas, Deepak; Aljabab, Abdulsalam S; Hunasgi, Santosh; Rai, Kirthi Kumar; Hale, Beverley; Fonseca, Felipe Paiva; Gomez, Ricardo Santiago; Rahimi, Siavash; Merkx, Matthias A W; Brennan, Peter A

2018-04-01

We have evaluated the rationale of existing grading and staging schemes of oral submucous fibrosis (OSMF) based on how they are categorized. A novel classification and staging scheme is proposed. A total of 300 OSMF patients were evaluated for agreement between functional, clinical, and histopathological staging. Bilateral biopsies were assessed in 25 patients to evaluate for any differences in histopathological staging of OSMF in the same mouth. Extent of clinician agreement for categorized staging data was evaluated using Cohen's weighted kappa analysis. Cross-tabulation was performed on categorical grading data to understand the intercorrelation, and the unweighted kappa analysis was used to assess the bilateral grade agreement. Probabilities of less than 0.05 were considered significant. Data were analyzed using SPSS Statistics (version 25.0, IBM, USA). A low agreement was found between all the stages depicting the independent nature of trismus, clinical features, and histopathological components (K = 0.312, 0.167, 0.152) in OSMF. Following analysis, a three-component classification scheme (TFM classification) was developed that describes the severity of each independently, grouping them using a novel three-tier staging scheme as a guide to the treatment plan. The proposed classification and staging could be useful for effective communication, categorization, and for recording data and prognosis, and for guiding treatment plans. Furthermore, the classification considers OSMF malignant transformation in detail. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

New breast cancer prognostic factors identified by computer-aided image analysis of HE stained histopathology images

PubMed Central

Chen, Jia-Mei; Qu, Ai-Ping; Wang, Lin-Wei; Yuan, Jing-Ping; Yang, Fang; Xiang, Qing-Ming; Maskey, Ninu; Yang, Gui-Fang; Liu, Juan; Li, Yan

2015-01-01

Computer-aided image analysis (CAI) can help objectively quantify morphologic features of hematoxylin-eosin (HE) histopathology images and provide potentially useful prognostic information on breast cancer. We performed a CAI workflow on 1,150 HE images from 230 patients with invasive ductal carcinoma (IDC) of the breast. We used a pixel-wise support vector machine classifier for tumor nests (TNs)-stroma segmentation, and a marker-controlled watershed algorithm for nuclei segmentation. 730 morphologic parameters were extracted after segmentation, and 12 parameters identified by Kaplan-Meier analysis were significantly associated with 8-year disease free survival (P < 0.05 for all). Moreover, four image features including TNs feature (HR 1.327, 95%CI [1.001 - 1.759], P = 0.049), TNs cell nuclei feature (HR 0.729, 95%CI [0.537 - 0.989], P = 0.042), TNs cell density (HR 1.625, 95%CI [1.177 - 2.244], P = 0.003), and stromal cell structure feature (HR 1.596, 95%CI [1.142 - 2.229], P = 0.006) were identified by multivariate Cox proportional hazards model to be new independent prognostic factors. The results indicated that CAI can assist the pathologist in extracting prognostic information from HE histopathology images for IDC. The TNs feature, TNs cell nuclei feature, TNs cell density, and stromal cell structure feature could be new prognostic factors. PMID:26022540

Feasibility of in situ, high-resolution correlation of tracer uptake with histopathology by quantitative autoradiography of biopsy specimens obtained under 18F-FDG PET/CT guidance.

PubMed

Fanchon, Louise M; Dogan, Snjezana; Moreira, Andre L; Carlin, Sean A; Schmidtlein, C Ross; Yorke, Ellen; Apte, Aditya P; Burger, Irene A; Durack, Jeremy C; Erinjeri, Joseph P; Maybody, Majid; Schöder, Heiko; Siegelbaum, Robert H; Sofocleous, Constantinos T; Deasy, Joseph O; Solomon, Stephen B; Humm, John L; Kirov, Assen S

2015-04-01

Core biopsies obtained using PET/CT guidance contain bound radiotracer and therefore provide information about tracer uptake in situ. Our goal was to develop a method for quantitative autoradiography of biopsy specimens (QABS), to use this method to correlate (18)F-FDG tracer uptake in situ with histopathology findings, and to briefly discuss its potential application. Twenty-seven patients referred for a PET/CT-guided biopsy of (18)F-FDG-avid primary or metastatic lesions in different locations consented to participate in this institutional review board-approved study, which complied with the Health Insurance Portability and Accountability Act. Autoradiography of biopsy specimens obtained using 5 types of needles was performed immediately after extraction. The response of autoradiography imaging plates was calibrated using dummy specimens with known activity obtained using 2 core-biopsy needle sizes. The calibration curves were used to quantify the activity along biopsy specimens obtained with these 2 needles and to calculate the standardized uptake value, SUVARG. Autoradiography images were correlated with histopathologic findings and fused with PET/CT images demonstrating the position of the biopsy needle within the lesion. Logistic regression analysis was performed to search for an SUVARG threshold distinguishing benign from malignant tissue in liver biopsy specimens. Pearson correlation between SUVARG of the whole biopsy specimen and average SUVPET over the voxels intersected by the needle in the fused PET/CT image was calculated. Activity concentrations were obtained using autoradiography for 20 specimens extracted with 18- and 20-gauge needles. The probability of finding malignancy in a specimen is greater than 50% (95% confidence) if SUVARG is greater than 7.3. For core specimens with preserved shape and orientation and in the absence of motion, one can achieve autoradiography, CT, and PET image registration with spatial accuracy better than 2 mm. The correlation coefficient between the mean specimen SUVARG and SUVPET was 0.66. Performing QABS on core-biopsy specimens obtained using PET/CT guidance enables in situ correlation of (18)F-FDG tracer uptake and histopathology on a millimeter scale. QABS promises to provide useful information for guiding interventional radiology procedures and localized therapies and for in situ high-spatial-resolution validation of radiopharmaceutical uptake. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

Detection of Prostate Cancer: Quantitative Multiparametric MR Imaging Models Developed Using Registered Correlative Histopathology.

PubMed

Metzger, Gregory J; Kalavagunta, Chaitanya; Spilseth, Benjamin; Bolan, Patrick J; Li, Xiufeng; Hutter, Diane; Nam, Jung W; Johnson, Andrew D; Henriksen, Jonathan C; Moench, Laura; Konety, Badrinath; Warlick, Christopher A; Schmechel, Stephen C; Koopmeiners, Joseph S

2016-06-01

Purpose To develop multiparametric magnetic resonance (MR) imaging models to generate a quantitative, user-independent, voxel-wise composite biomarker score (CBS) for detection of prostate cancer by using coregistered correlative histopathologic results, and to compare performance of CBS-based detection with that of single quantitative MR imaging parameters. Materials and Methods Institutional review board approval and informed consent were obtained. Patients with a diagnosis of prostate cancer underwent multiparametric MR imaging before surgery for treatment. All MR imaging voxels in the prostate were classified as cancer or noncancer on the basis of coregistered histopathologic data. Predictive models were developed by using more than one quantitative MR imaging parameter to generate CBS maps. Model development and evaluation of quantitative MR imaging parameters and CBS were performed separately for the peripheral zone and the whole gland. Model accuracy was evaluated by using the area under the receiver operating characteristic curve (AUC), and confidence intervals were calculated with the bootstrap procedure. The improvement in classification accuracy was evaluated by comparing the AUC for the multiparametric model and the single best-performing quantitative MR imaging parameter at the individual level and in aggregate. Results Quantitative T2, apparent diffusion coefficient (ADC), volume transfer constant (K(trans)), reflux rate constant (kep), and area under the gadolinium concentration curve at 90 seconds (AUGC90) were significantly different between cancer and noncancer voxels (P < .001), with ADC showing the best accuracy (peripheral zone AUC, 0.82; whole gland AUC, 0.74). Four-parameter models demonstrated the best performance in both the peripheral zone (AUC, 0.85; P = .010 vs ADC alone) and whole gland (AUC, 0.77; P = .043 vs ADC alone). Individual-level analysis showed statistically significant improvement in AUC in 82% (23 of 28) and 71% (24 of 34) of patients with peripheral-zone and whole-gland models, respectively, compared with ADC alone. Model-based CBS maps for cancer detection showed improved visualization of cancer location and extent. Conclusion Quantitative multiparametric MR imaging models developed by using coregistered correlative histopathologic data yielded a voxel-wise CBS that outperformed single quantitative MR imaging parameters for detection of prostate cancer, especially when the models were assessed at the individual level. (©) RSNA, 2016 Online supplemental material is available for this article.

Distribution of Pancreatic Polypeptide-secreting Endocrine Cells in Nondiabetic and Diabetic Cases.

PubMed

Śliwińska-Mossoń, Mariola; Milnerowicz, Halina

2017-07-01

The aim of the study was to demonstrate the effects of cigarette smoking and ongoing inflammation in chronic pancreatitis on the functioning of pancreatic polypeptide (PP)-secreting cells and to determine the relationship between the occurrence of an increased number of PP cells in the pancreas, the change in their location, and the intensity of their inflammatory changes in the course of pancreatitis and diabetes. Samples of tissues from healthy persons and from patients were verified histopathologically, and then PP was localized by immunohistochemical staining using the monoclonal anti-human PP antibody. The histopathologic evaluation of the hormone expression intensity in tissue sections was carried out using the semiquantitative method and was calculated with digital image analysis. The present study showed a very strong PP expression in the pancreatic tissue (especially in the head of the pancreas) derived from smoking patients with diabetes. The increase in the percentage of cells in the PP islets, between the acinar cells in smoking patients with diabetes and a statistically significant increase in the expression of PP, indicates a pancreatic endocrine dysfunction and suggests that cigarette smoking has a negative impact on the organ's efficiency. Because of its properties, the PP appears to be a useful marker of the endocrine insufficiency of the pancreas and a specific prognostic parameter of developing diabetes due to chronic pancreatitis.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

The efficacy of oral brush biopsy with computer-assisted analysis in identifying precancerous and cancerous lesions

PubMed Central

2011-01-01

Background Cancer of the oral cavity is the sixth most common malignancy reported worldwide and one with the highest mortality rate among all malignancies. There is a paucity of reliable diagnostic methods to detect early malignancies. This study was performed to evaluate the sensitivity and specificity of brush biopsy in identifying oral premalignant and malignant lesions. Methods Oral brush and scalpel biopsies were performed on 85 consecutive patients presenting with an oral lesion deemed to be minimally suspicious by clinical examination and the results were compared. Results Of 79 patients with adequate brush biopsy samples with matching scalpel biopsies, 27 revealed histopathologic evidence of dysplasia or carcinoma, 26 of which were independently identified with the oral brush biopsy (sensitivity: 96.3% - 95% CI, 87%-100%). 52 oral lesions did not reveal any histopathologic evidence of dysplasia or carcinoma and of these, brush biopsy reported 47 as "negative" and 5 as "atypical"(specificity of "positive" brush biopsy result is 100%- 95% CI, 93%-100%; specificity for "atypical" brush biopsy result is 90.4%- 95% CI, 82%-97%. The positive predictive value of an abnormal oral brush biopsy was 84% and the negative predictive value was 98%. Conclusion Our study demonstrated that the oral brush biopsy is an accurate test in identifying oral premalignant and malignant lesions, even if minimally suspicious. PMID:21864339

An analysis of pharmaceutical experience with decades of rat carcinogenicity testing: support for a proposal to modify current regulatory guidelines.

PubMed

Sistare, Frank D; Morton, Daniel; Alden, Carl; Christensen, Joel; Keller, Douglas; Jonghe, Sandra De; Storer, Richard D; Reddy, M Vijayaraj; Kraynak, Andrew; Trela, Bruce; Bienvenu, Jean-Guy; Bjurström, Sivert; Bosmans, Vanessa; Brewster, David; Colman, Karyn; Dominick, Mark; Evans, John; Hailey, James R; Kinter, Lewis; Liu, Matt; Mahrt, Charles; Marien, Dirk; Myer, James; Perry, Richard; Potenta, Daniel; Roth, Arthur; Sherratt, Philip; Singer, Thomas; Slim, Rabih; Soper, Keith; Fransson-Steen, Ronny; Stoltz, James; Turner, Oliver; Turnquist, Susan; van Heerden, Marjolein; Woicke, Jochen; DeGeorge, Joseph J

2011-06-01

Data collected from 182 marketed and nonmarketed pharmaceuticals demonstrate that there is little value gained in conducting a rat two-year carcinogenicity study for compounds that lack: (1) histopathologic risk factors for rat neoplasia in chronic toxicology studies, (2) evidence of hormonal perturbation, and (3) positive genetic toxicology results. Using a single positive result among these three criteria as a test for outcome in the two-year study, fifty-two of sixty-six rat tumorigens were correctly identified, yielding 79% test sensitivity. When all three criteria were negative, sixty-two of seventy-six pharmaceuticals (82%) were correctly predicted to be rat noncarcinogens. The fourteen rat false negatives had two-year study findings of questionable human relevance. Applying these criteria to eighty-six additional chemicals identified by the International Agency for Research on Cancer as likely human carcinogens and to drugs withdrawn from the market for carcinogenicity concerns confirmed their sensitivity for predicting rat carcinogenicity outcome. These analyses support a proposal to refine regulatory criteria for conducting a two-year rat study to be based on assessment of histopathologic findings from a rat six-month study, evidence of hormonal perturbation, genetic toxicology results, and the findings of a six-month transgenic mouse carcinogenicity study. This proposed decision paradigm has the potential to eliminate over 40% of rat two-year testing on new pharmaceuticals without compromise to patient safety.

Synthesis, Characterization, and Acute Oral Toxicity Evaluation of pH-Sensitive Hydrogel Based on MPEG, Poly(ε-caprolactone), and Itaconic Acid

PubMed Central

Tan, Liwei; Song, Jia; Luo, Feng

2013-01-01

A kind of chemically cross-linked pH-sensitive hydrogels based on methoxyl poly(ethylene glycol)-poly(caprolactone)-acryloyl chloride (MPEG-PCL-AC, PECA), poly(ethylene glycol) methyl ether methacrylate (MPEGMA, MEG), N,N-methylenebisacrylamide (BIS), and itaconic acid (IA) were prepared without using any organic solvent by heat-initiated free radical method. The obtained macromonomers and hydrogels were characterized by 1H NMR and FT-IR, respectively. Morphology study of hydrogels was also investigated in this paper, and it showed that the hydrogels had good pH-sensitivity. The acute toxicity test and histopathological study were conducted in BALB/c mice. The results indicated that the maximum tolerance dose of the hydrogel was higher than 10000 mg/kg body weight. No morality or signs of toxicity were observed during the whole 7-day observation period. Compared to the control groups, there were no important adverse effects in the variables of hematology routine test and serum chemistry analysis both in male or female treatment group. Histopathological study also did not show any significant lesions, including heart, liver, lung, spleen, kidney, stomach, intestine, and testis. All the results demonstrated that this hydrogel was nontoxic after gavage. Thus, the hydrogel might be the biocompatible potential candidate for oral drug delivery system. PMID:24364030

A Transverse Colectomy is as Safe as an Extended Right or Left Colectomy for Mid-Transverse Colon Cancer.

PubMed

Leijssen, Lieve G J; Dinaux, Anne M; Amri, Ramzi; Kunitake, Hiroko; Bordeianou, Liliana G; Berger, David L

2018-03-19

Although extended colectomy is often chosen for patients with transverse colon cancer, the optimal surgical approach for mid-transverse colon cancer has not been established. We identified patients who underwent a transverse (TC) or an extended colectomy (EC) for mid-transverse colon cancer between 2004 and 2014. To adjust for potential selection bias between the groups, a propensity score matching analysis was performed. A total of 103 patients were included, of whom 63% underwent EC (right 47%, left 17%) and 37% TC. EC patients tend to have worse short-term outcomes. Although fewer lymph nodes were harvested after TC, 5-year overall (OS) ad disease-free survival (DFS) was comparable between the groups. When comparing long-term outcomes stage-by-stage, worse OS and DFS were seen in stage-II. All stage-II patients died of a non-cancer-related cause and recurrence occurred in pT4 TC patients who did not receive adjuvant therapy. The propensity-matched cohort demonstrated similar postoperative morbidity, but more laparoscopic procedures in EC. Additionally, TC tumors were correlated with poorer histopathological features and disease recurrence was only seen after TC. Our study underlines the oncological safety of a transverse colectomy for mid-transverse colon cancer. Although TC tumors were associated with poorer histopathological features, survival rates were comparable.

Alterations in expression of mucin, tenascin-c and syndecan-1 in the conjunctiva following retinal surgery and plaque radiotherapy.

PubMed

Heimann, H; Coupland, S E; Gochman, R; Hellmich, M; Foerster, M H

2001-07-01

Disturbances of the ocular tear film layer and dry eye symptoms are common complications following retinal surgery and ocular tumour therapy. Examined were the histopathological changes of the conjunctiva following posterior segment surgery and plaque radiotherapy. Biopsy specimens of the superior bulbar conjunctiva were obtained during cataract surgery between 2 weeks and 7 years following vitrectomy (n=92) or plaque radiotherapy for uveal melanoma (n=20) and from control subjects without previous ocular surgery (n=29). These were examined using conventional histology (HE, PAS, Van Gieson) and immunochemistry [APAAP, using antibodies directed against MUC1, MUC5AC, syndecan-1 and tenascin-C (TN-C)]. The histopathological changes were graded and statistical analysis was performed using Wilcoxon and Kruskal-Wallis rank sum tests. Conjunctival specimens of patients following vitrectomy or plaque radiotherapy for uveal melanoma demonstrated increased epithelial stratification, a significant decrease in the number of PAS- and MUC5AC-positive goblet cells, and distributional changes in expression of MUC1, syndecan- and TN-C within conjunctival epithelium or stroma. These alterations - in particular the goblet cell reduction and stromal fibrosis - were most prominent in those patients who had undergone radiotherapy. Posterior segment surgery can lead to morphological alterations of the conjunctiva and distributional changes in ocular mucins, which may cause dry eye symptoms.

Morphological, histopathological and molecular characterization of Thelohanellus theinensis n. sp. (Cnidaria: Myxosporea) infecting an Indian major carp, Labeo bata in a cold water wetland in Punjab (India).

PubMed

Gupta, Aditya; Kaur, Harpreet

2017-09-01

A myxozoan parasite belonging to the genus Thelohanellus Kudo, 1933 (Myxosporea, Bivalvulida) was isolated from the gill lamellae of Labeo bata (Hamilton, 1822) inhabiting Ranjit Sagar Wetland in Northern parts of Punjab, India. Histopathology of the infected gills indicated lamellar distortion due to the presence of plasmodia. The intensity of infection was recorded to be moderate as indicated by gill plasmodial index (GPI = 2). The plasmodia were microscopic, ovoid, creamish white, 2.0-4.0 mm in diameter containing 300-400 number of myxospores. The myxospores were broadly pyriform in shape, measuring 8.27 × 4.41 µm, having a prominent pore at the anterior end. The polar capsule was pyriform in shape, measuring 4.15 × 4.10 µm, containing a polar filament coiled perpendicular to the longitudinal axis of myxospore body making 6-7 turns. At molecular level, the analysis of 18S rDNA sequence of T. theinensis n. sp. demonstrated maximum homogeneity of 99 % with T. filli (KR340464) as only 2 gaps were found due to the difference of the last 20 base pairs at the 3' end of T. theinensis n. sp. The current study emphasizes the need for caution when dealing with members of species complex.

Inflammatory Mediators in Xanthelasma Palpebrarum: Histopathologic and Immunohistochemical Study.

PubMed

Govorkova, Maria S; Milman, Tatyana; Ying, Gui-Shuang; Pan, Wei; Silkiss, Rona Z

To evaluate the expression of inflammatory mediators in xanthelasma palpebrarum. In this retrospective histopathologic case-control study, xanthelasma specimens obtained from the private practice and pathology archives of 1 author (R.Z.S.) were analyzed and compared with the blepharoplasty tissues from age- and sex-matched controls. Paraffin-embedded tissue sections were stained with hematoxylin-eosin and CD3, CD20, CD163, cyclooxygenase-1, inducible nitric oxide synthase, matrix metallopeptidase-9, and myeloperoxidase antibodies. Immunostaining was quantified by light microscopy and with a computerized image analysis system of scanned images. Hematoxylin-eosin-stained preparations of xanthelasma specimens demonstrated significantly more intense chronic lymphocytic infiltrate when compared with the control blepharoplasty tissues (p < 0.001). Immunohistochemical studies revealed more intense CD3+ T cell and CD163+ histiocytic infiltrate (11% vs. 5%; p = 0.02 and 28% vs. 5%; p = 0.003, respectively) and increased expression of cyclooxygenase-1 (44% vs. 20% expressing cells; p < 0.001 and 21% vs. 9% strongly expressing cells; p = 0.008) and inducible nitric oxide synthase (43% vs. 26% expressing cells; p = 0.03 and 42% vs. 25% strongly expressing cells; p = 0.02) in xanthelasma specimens compared with control tissues. The inflammatory milieu in xanthelasma appears to be analogous to descriptions of the early stages of cardiac atherosclerotic plaque formation. These findings may contribute to the understanding of xanthelasma pathogenesis and to the development of potential targeted therapies.

Effect of Au-dextran NPs as anti-tumor agent against EAC and solid tumor in mice by biochemical evaluations and histopathological investigations.

PubMed

Medhat, Dalia; Hussein, Jihan; El-Naggar, Mehrez E; Attia, Mohamed F; Anwar, Mona; Latif, Yasmine Abdel; Booles, Hoda F; Morsy, Safaa; Farrag, Abdel Razik; Khalil, Wagdy K B; El-Khayat, Zakaria

2017-07-01

Dextran-capped gold nanoparticles (Au-dextran NPs) were prepared exploiting the natural polysaccharide polymer as both reducing and stabilizing agent in the synthesis process, aiming at studying their antitumor effect on solid carcinoma and EAC-bearing mice. To this end, Au-dextran NPs were designed via simple eco-friendly chemical reaction and they were characterized revealing the monodispersed particles with narrow distributed size of around 49nm with high negative charge. In vivo experiments were performed on mice. Biochemical analysis of liver and kidney functions and oxidation stress ratio in addition to histopathological investigations of such tumor tissues were done demonstrating the potentiality of Au-dextran NPs as antitumor agent. The obtained results revealed that EAC and solid tumors caused significant increase in liver and kidney functions, liver oxidant parameters, alpha feto protein levels and diminished liver antioxidant accompanied by positive expression of tumor protein p53 of liver while the treatment with Au-dextran NPs for both types caused improvement in liver and kidney functions, increased liver antioxidant, increased the expression level of B-cell lymphoma 2 gene and subsequently suppressed the apoptotic pathway. As a result, the obtained data provides significant antitumor effects of the Au-dextran NPs in both Ehrlich ascites and solid tumor in mice models. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Clinical, histopathological and immunological characteristics of exfoliative cutaneous lupus erythematosus in 25 German short-haired pointers.

PubMed

Bryden, Sharon L; White, Stephen D; Dunston, Stanley M; Burrows, Amanda K; Olivry, Thierry

2005-08-01

Clinical, histopathological and immunological features of exfoliative cutaneous lupus erythematosus, an uncommon generalized exfoliative dermatitis occurring exclusively in German short-haired pointers, were characterized in 25 dogs. The disease affects young adult dogs and its familial incidence strongly suggests a hereditary origin. Lesions were characterized by scaling and alopecia affecting 100 (25/25) and 76% (19/25) of dogs, respectively. Follicular casts were present in 28% (7/25) of dogs. The muzzle, pinnae and dorsum were typically affected. Generalized skin lesions were described in 52% (13/25) of dogs. Systemic signs of pain and lameness affected several dogs. Anaemia and thrombocytopenia were detected in several dogs with a more severe clinical phenotype. The most common histopathological features were hyperkeratosis and a lymphocytic interface dermatitis. Direct immunostaining revealed IgG deposition in the epidermal and follicular basement membrane of 100 (19/19) and 41% (7/17) of dogs, respectively. Circulating antifollicular and antisebaceous gland IgG antibodies were demonstrated by indirect immunostaining in 57% (4/7) of dogs. This disease usually responds poorly to immunosuppressive therapy and it has a guarded prognosis. Where outcome was recorded, 85% (10/12) of dogs were euthanased due to either a failure to respond to, or complications associated with, immunomodulatory therapy. Two affected dogs are in remission and maintained on immunomodulatory dosages of prednisolone. This study demonstrates the existence of a cellular and humoral immune response directed against the epidermal basement membrane of dogs with exfoliative cutaneous lupus erythematosus. Additional studies are required to further characterize the immunological pathogenesis of this disease.

Comparative effectiveness of i-SCAN™ and high-definition white light characterizing small colonic polyps.

PubMed

Chan, Johanna L; Lin, Li; Feiler, Michael; Wolf, Andrew I; Cardona, Diana M; Gellad, Ziad F

2012-11-07

To evaluate accuracy of in vivo diagnosis of adenomatous vs non-adenomatous polyps using i-SCAN digital chromoendoscopy compared with high-definition white light. This is a single-center comparative effectiveness pilot study. Polyps (n = 103) from 75 average-risk adult outpatients undergoing screening or surveillance colonoscopy between December 1, 2010 and April 1, 2011 were evaluated by two participating endoscopists in an academic outpatient endoscopy center. Polyps were evaluated both with high-definition white light and with i-SCAN to make an in vivo prediction of adenomatous vs non-adenomatous pathology. We determined diagnostic characteristics of i-SCAN and high-definition white light, including sensitivity, specificity, and accuracy, with regards to identifying adenomatous vs non-adenomatous polyps. Histopathologic diagnosis was the gold standard comparison. One hundred and three small polyps, detected from forty-three patients, were included in the analysis. The average size of the polyps evaluated in the analysis was 3.7 mm (SD 1.3 mm, range 2 mm to 8 mm). Formal histopathology revealed that 54/103 (52.4%) were adenomas, 26/103 (25.2%) were hyperplastic, and 23/103 (22.3%) were other diagnoses include "lymphoid aggregates", "non-specific colitis," and "no pathologic diagnosis." Overall, the combined accuracy of endoscopists for predicting adenomas was identical between i-SCAN (71.8%, 95%CI: 62.1%-80.3%) and high-definition white light (71.8%, 95%CI: 62.1%-80.3%). However, the accuracy of each endoscopist differed substantially, where endoscopist A demonstrated 63.0% overall accuracy (95%CI: 50.9%-74.0%) as compared with endoscopist B demonstrating 93.3% overall accuracy (95%CI: 77.9%-99.2%), irrespective of imaging modality. Neither endoscopist demonstrated a significant learning effect with i-SCAN during the study. Though endoscopist A increased accuracy using i-SCAN from 59% (95%CI: 42.1%-74.4%) in the first half to 67.6% (95%CI: 49.5%-82.6%) in the second half, and endoscopist B decreased accuracy using i-SCAN from 100% (95%CI: 80.5%-100.0%) in the first half to 84.6% (95%CI: 54.6%-98.1%) in the second half, neither of these differences were statistically significant. i-SCAN and high-definition white light had similar efficacy predicting polyp histology. Endoscopist training likely plays a critical role in diagnostic test characteristics and deserves further study.

Debulking Surgery for Clear Cell Carcinoma of the Ovary - A Case Report and Literature Review.

PubMed

Bacalbasa, Nicolae; Balescu, Irina; Filipescu, Alexandru

2017-10-01

Ovarian clear cell carcinoma represents a distinct histopathological subtype of epithelial ovarian cancer, with poor outcomes, especially in cases diagnosed in advanced stages of disease. However, even in these cases, it seems that the most effective treatment remains debulking surgery to no residual disease. We present the case of a 56-year-old patient diagnosed with a large pelvic mass invading the rectosigmoidal colon, and ileal loop who was successfully submitted to cytoreductive surgery to no residual disease. The histopathological studies demonstrated the presence of a well-differentiated clear cell ovarian carcinoma of the ovary. At 1-year follow-up there is no evidence of residual disease. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Optic Nerve Assessment Using 7-Tesla Magnetic Resonance Imaging.

PubMed

Singh, Arun D; Platt, Sean M; Lystad, Lisa; Lowe, Mark; Oh, Sehong; Jones, Stephen E; Alzahrani, Yahya; Plesec, Thomas

2016-04-01

The purpose of this study was to correlate high-resolution magnetic resonance imaging (MRI) and histologic findings in a case of juxtapapillary choroidal melanoma with clinical evidence of optic nerve invasion. With institutional review board approval, an enucleated globe with choroidal melanoma and optic nerve invasion was imaged using a 7-tesla MRI followed by histopathologic evaluation. Optical coherence tomography, B-scan ultrasonography, and 1.5-tesla MRI of the orbit (1-mm sections) could not detect optic disc invasion. Ex vivo, 7-tesla MRI detected optic nerve invasion, which correlated with histopathologic features. Our case demonstrates the potential to document the existence of optic nerve invasion in the presence of an intraocular tumor, a feature that has a major bearing on decision making, particularly for consideration of enucleation.

Nodular Fasciitis of the Breast Previously Misdiagnosed as Breast Carcinoma

PubMed Central

Ozben, Volkan; Aydogan, Fatih; Karaca, Fatih Can; Ilvan, Sennur; Uras, Cihan

2009-01-01

Summary Background Nodular fasciitis of the breast is a rare benign pathology that can mimic breast cancer clinically, radiologically, and histopathologically. Case Report An 18-year-old female patient had first visited a physician in a different center with the complaint of a lump in her left breast. Breast examination had revealed a palpable mass located in the left upper outer quadrant. Ultrasonography had demonstrated a hypoechoic lesion. Excisional biopsy of the lump had been performed and histopathologic examination misdiagnosed this lump as a mesenchymal tumor. The patient was then referred to our clinic for further investigations. Pathologic revision was performed and the diagnosis of nodular fasciitis of the breast was established. Conclusion Awareness of this rare clinical entity, nodular fasciitis, in the breast eliminates the misdiagnosis of breast cancer. PMID:20877676

[A Case Report of Gastric Carcinoma with Lymphoid Stroma Differentially Diagnosed from Malignant Lymphoma].

PubMed

Yamada, Kazuto; Kosuga, Toshiyuki; Okamoto, Kazuma; Konishi, Hirotaka; Shiozaki, Atsushi; Fujiwara, Hitoshi; Morimura, Ryo; Murayama, Yasutoshi; Kuriu, Yoshiaki; Ikoma, Hisashi; Nakanishi, Masayoshi; Kuroda, Junya; Kishimoto, Mitsuo; Konishi, Eiichi; Otsuji, Eigo

2017-11-01

A 49-year-old man was referred to our hospital for close examination of a submucosal tumor with ulceration located in the upper gastric body. PET-CT showed FDG uptake both in the gastric tumor and an enlarged lymph node. Although routine biopsies and EUS-FNA of this tumor did not demonstrate any malignant findings, he underwent excisional biopsy of the enlarged lymph nodes to rule out malignant lymphoma. Histopathological examination revealed that the excised specimens were metastatic nodes of poorly differentiated carcinoma probably from the known gastric tumor. Subsequently, he underwent total gastrectomy with D2, and histopathological findings confirmed the final diagnosis of gastric carcinoma with lymphoid stroma(GCLS). We report a case of GCLS that was difficult to diagnose.

Pseudoephedrine may cause "pigmenting" fixed drug eruption.

PubMed

Ozkaya, Esen; Elinç-Aslan, Meryem Sevinç

2011-05-01

Fixed drug eruption (FDE) is a distinctive drug eruption characterized by recurrent well-defined lesions in the same location each time the responsible drug is taken. Two different clinical forms have been described: the common classic pigmenting form and the rare nonpigmenting form. Nonpigmenting FDE is mainly characterized by symmetrical large erythematous plaques and the dermal histopathologic reaction pattern. Pseudoephedrine is known as the major inducer of nonpigmenting FDE. Pigmenting FDE from pseudoephedrine has not been reported previously. Here, the first case of pseudoephedrine-induced pigmenting FDE is reported, showing the characteristic features of classic pigmenting FDE such as asymmetry, normal-sized lesions, and the epidermodermal histopathologic reaction pattern. Moreover, a positive occlusive patch-test reaction to pseudoephedrine could be demonstrated on postlesional FDE skin for the first time.

Alport's syndrome with focal segmental glomerulosclerosis lesion - Pattern to recognize.

PubMed

Alsahli, Afnan A; Alshahwan, Sara I; Alotaibi, Amal O; Alsaad, Khaled O; Aloudah, Nourah; Farooqui, Mahfooz; Al Sayyari, Abdullah A

2018-01-01

The association between Alport's syndrome (AS) and focal segmental glomerulosclerosis (FSGS) in the same patient is complex and rarely reported. We report a case of a 42-year-old male presenting with proteinuria, microscopic hematuria, elevated serum creatinine and hypertension with unremarkable physical examination apart from obesity. The renal biopsy showed well-established FSGS pattern of injury with mild interstitial fibrosis and tubular atrophy, while the electron microscopic examination demonstrated glomerular basement membranes (GBM) changes compatible with AS. AS can be complicated by segmental glomerular scarring, which can mimic primary FSGS, while familial FSGS can result from mutations in collagen IV network of the GBM. This overlap can complicate histopathological interpretation of renal biopsy, which should be accompanied by mutational analysis for accurate diagnosis and proper therapeutic intervention.

On the importance of mathematical methods for analysis of MALDI-imaging mass spectrometry data.

PubMed

Trede, Dennis; Kobarg, Jan Hendrik; Oetjen, Janina; Thiele, Herbert; Maass, Peter; Alexandrov, Theodore

2012-03-21

In the last decade, matrix-assisted laser desorption/ionization (MALDI) imaging mass spectrometry (IMS), also called as MALDI-imaging, has proven its potential in proteomics and was successfully applied to various types of biomedical problems, in particular to histopathological label-free analysis of tissue sections. In histopathology, MALDI-imaging is used as a general analytic tool revealing the functional proteomic structure of tissue sections, and as a discovery tool for detecting new biomarkers discriminating a region annotated by an experienced histologist, in particular, for cancer studies. A typical MALDI-imaging data set contains 10⁸ to 10⁹ intensity values occupying more than 1 GB. Analysis and interpretation of such huge amount of data is a mathematically, statistically and computationally challenging problem. In this paper we overview some computational methods for analysis of MALDI-imaging data sets. We discuss the importance of data preprocessing, which typically includes normalization, baseline removal and peak picking, and hightlight the importance of image denoising when visualizing IMS data.

On the Importance of Mathematical Methods for Analysis of MALDI-Imaging Mass Spectrometry Data.

PubMed

Trede, Dennis; Kobarg, Jan Hendrik; Oetjen, Janina; Thiele, Herbert; Maass, Peter; Alexandrov, Theodore

2012-03-01

In the last decade, matrix-assisted laser desorption/ionization (MALDI) imaging mass spectrometry (IMS), also called as MALDI-imaging, has proven its potential in proteomics and was successfully applied to various types of biomedical problems, in particular to histopathological label-free analysis of tissue sections. In histopathology, MALDI-imaging is used as a general analytic tool revealing the functional proteomic structure of tissue sections, and as a discovery tool for detecting new biomarkers discriminating a region annotated by an experienced histologist, in particular, for cancer studies. A typical MALDI-imaging data set contains 108 to 109 intensity values occupying more than 1 GB. Analysis and interpretation of such huge amount of data is a mathematically, statistically and computationally challenging problem. In this paper we overview some computational methods for analysis of MALDI-imaging data sets. We discuss the importance of data preprocessing, which typically includes normalization, baseline removal and peak picking, and hightlight the importance of image denoising when visualizing IMS data.

Histopathologic changes after bipolar resection of the prostate: depth of penetration of bipolar thermal injury.

PubMed

Maddox, Michael; Pareek, Gyan; Al Ekish, Shadi; Thavaseelan, Simone; Mehta, Akanksha; Mangray, Shamlal; Haleblian, George

2012-10-01

While the power needed to initiate bipolar vaporization is higher than conventional monopolar resection, the energy needed to maintain bipolar vaporization is significantly lower and may result in less thermal tissue injury. This may have implications for hemostasis, scarring, and perioperative morbidity. The objective of this study is to assess histopathologic changes in prostatic tissue after bipolar transurethral vaporization of the prostate. Male patients older than 40 years with a diagnosis of benign prostatic hyperplasia (BPH) who elected to undergo bipolar transurethral vaporization of the prostate were included in this study. Patients were excluded if they had a previous transurethral resection of the prostate (TURP) or prostate radiation therapy. An Olympus button vaporization electrode was used to vaporize prostate tissue. A loop electrode was then used to obtain a deep resection specimen. The vaporized and loop resection surfaces were inked and sent for pathologic analysis to determine the presence of gross histologic changes and the depth of penetration of the bipolar vaporization current. A total of 12 men underwent bipolar TURP at standard settings of 290 W cutting and 145 W coagulation current. Mean patient age was 70±10.2 years (range 56-88 years). Mean surgical time was 48.7±20.2 minutes (range 30-89 min). Mean depth of thermal injury was 2.4±0.84 mm (range 0.3-3.5 mm). Histopathologic evaluation demonstrated thermal injury in all specimens, but no gross char was encountered. In bipolar systems, resection takes place at much lower peak voltages and temperatures compared with monopolar systems. Theoretically, this leads to less collateral thermal damage and tissue char. Our tissue study illustrates that the button vaporization electrode achieves a much larger depth of penetration than previous studies of bipolar TURP. This may be because thermal injury represents a gradual continuum of histologic changes.

Molecular Histopathology Using Gold Nanorods and Optical Coherence Tomography

PubMed Central

Prabhulkar, Shradha; Matthews, Jared; Rawal, Siddarth; Awdeh, Richard M.

2013-01-01

Purpose. To examine the novel application of a commercially available optical coherence tomography (OCT) system toward molecular histopathology using gold nanorod (GNR) linked antibodies as a functionalized contrast agent to evaluate ocular surface squamous neoplasia (OSSN). Methods. GNRs were synthesized and covalently attached to anti–glucose transporter-1 (GLUT-1) antibodies via carbodiimide chemistry. Three specimens from each of three distinct categories of human conjunctival tissue were selected for analysis, including conjunctiva without epithelial atypia (controls); conjunctival intraepithelial neoplasia, carcinoma in situ (CIS); and conjunctival squamous cell carcinoma (SCC). Tissue sections were incubated initially with GNR tagged anti–GLUT-1 antibodies and then with a fluorescent-tagged secondary antibody. Immunofluorescence and OCT imaging of the tissue was performed and the results were correlated to the light microscopic findings on traditional hemotoxyin and eosin stained sections. Results. No binding of the functionalized GNRs was observed within the epithelium of three normal conjunctiva controls. While immunofluorescence disclosed variable binding of the functionalized GNRs to atypical epithelial cells in all six cases of OSSN, the enhancement of the OCT signal in three cases of CIS was insufficient to distinguish these specimens from normal controls. In two of three cases of SCC, binding of functionalized GNRs was sufficient to produce an increased scattering effect on OCT in areas correlating to atypical epithelial cells which stained intensely on immunofluorescence imaging. Binding of functionalized GNRs was sufficient to produce an increased scattering effect on OCT in areas correlating to regions of erythrocytes and hemorrhage which stained intensely on immunofluorescence imaging within all nine tested samples. Conclusions. We have demonstrated the use of OCT for molecular histopathology using functionalized gold nanorods in the setting of OSSN. Our results suggest a threshold concentration of functionalized GNRs within tissue is required to achieve a detectable enhancement in scattering of the OCT signal. PMID:23307958

Comparison of Allogeneic and Syngeneic Rat Glioma Models by Using MRI and Histopathologic Evaluation.

PubMed

Biasibetti, Elena; Valazza, Alberto; Capucchio, Maria T; Annovazzi, Laura; Battaglia, Luigi; Chirio, Daniela; Gallarate, Marina; Mellai, Marta; Muntoni, Elisabetta; Peira, Elena; Riganti, Chiara; Schiffer, Davide; Panciani, Pierpaolo; Lanotte, Michele

2017-03-01

Research in neurooncology traditionally requires appropriate in vivo animal models, on which therapeutic strategies are tested before human trials are designed and proceed. Several reproducible animal experimental models, in which human physiologic conditions can be mimicked, are available for studying glioblastoma multiforme. In an ideal rat model, the tumor is of glial origin, grows in predictable and reproducible patterns, closely resembles human gliomas histopathologically, and is weakly or nonimmunogenic. In the current study, we used MRI and histopathologic evaluation to compare the most widely used allogeneic rat glioma model, C6-Wistar, with the F98-Fischer syngeneic rat glioma model in terms of percentage tumor growth or regression and growth rate. In vivo MRI demonstrated considerable variation in tumor volume and frequency between the 2 rat models despite the same stereotactic implantation technique. Faster and more reproducible glioma growth occurred in the immunoresponsive environment of the F98-Fischer model, because the immune response is minimized toward syngeneic cells. The marked inability of the C6-Wistar allogeneic system to generate a reproducible model and the episodes of spontaneous tumor regression with this system may have been due to the increased humoral and cellular immune responses after tumor implantation.

Aberrant wound-healing response in mitomycin C-treated leaking blebs: a histopathologic study.

PubMed

Elner, Victor M; Newman-Casey, Paula Anne; Patil, A Jayaprakash; Flint, Andrew; Biswas, Jyotirmay; Moroi, Sayoko E; Pushparaj, Vaijayanthi; Edward, Deepak P

2009-08-01

To characterize histopathologic features of leaking mitomycin C-treated blebs and aberrant wound healing that may lead to persistent conjunctival thinning and leakage. Forty mitomycin C-treated filtering blebs excised for persistent leaks from 40 patients were examined histopathologically using hematoxylin-eosin, periodic acid-Schiff, Masson trichrome, and Alcian blue histochemical stains. Ninety percent of the leaking blebs contained epithelial-stromal domes with areas of acellular stroma covered by attenuated epithelium. Seventy-five percent of the blebs demonstrated varying degrees of fibrovascular repair growing from the bleb margin, either beneath or interdigitating with the acellular zone. A novel observation in 65% of specimens was Alcian blue-positive myxoid stroma at the interface between the fibrovascular proliferation and the epithelial-stromal dome. The association between the presence of fibrovascular proliferation and Alcian blue-staining myxoid stroma was significant by Fisher exact test (P = .002). A desirable filtration bleb requires a sufficient reparative fibrovascular response to maintain an epithelial-stromal barrier to prevent leakage. Fibroblasts must lay down a continuous collagen-rich fibrous layer, rather than merely myxoid stroma, beneath the conjunctival epithelium to promote bleb stability. Surgical techniques and postsurgical care should aim to attain this desired outcome.

Hepatoprotective action of various partitions of methanol extract of Bauhinia purpurea leaves against paracetamol-induced liver toxicity: involvement of the antioxidant mechanisms.

PubMed

Zakaria, Zainul Amiruddin; Yahya, Farhana; Mamat, Siti Syariah; Mahmood, Nur Diyana; Mohtarrudin, Nurhafizah; Taher, Muhammad; Hamid, Siti Selina Abdul; Teh, Lay Kek; Salleh, Mohd Zaki

2016-06-11

Methanol extract of Bauhinia purpurea L. (family Fabaceae) (MEBP) possesses high antioxidant and anti-inflammatory activities and recently reported to exert hepatoprotection against paracetamol (PCM)-induced liver injury in rats. In an attempt to identify the hepatoprotective bioactive compounds in MEBP, the extract was prepared in different partitions and subjected to the PCM-induced liver injury model in rats. Dried MEBP was partitioned successively to obtain petroleum ether (PEBP), ethylacetate (EABP) and aqueous (AQBP) partitions, respectively. All partitions were subjected to in vitro antioxidant (i.e. total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH)- and superoxide-radicals scavenging assay, and oxygen radical absorbance capacity (ORAC) assay) and anti-inflammatory (i.e. lipooxygenase (LOX) and xanthine oxidase (XO) assay) analysis. The partitions, prepared in the dose range of 50, 250 and 500 mg/kg, together with a vehicle (10 % DMSO) and standard drug (200 mg/kg silymarin) were administered orally for 7 consecutive days prior to subjection to the 3 mg/kg PCM-induced liver injury model in rats. Following the hepatic injury induction, blood samples and liver were collected for the respective biochemical parameter and histopathological studies. Body weight changes and liver weight were also recorded. The partitions were also subjected to the phytochemical screening and HPLC analysis. Of all partitions, EABP possessed high TPC value and demonstrated remarkable antioxidant activity when assessed using the DPPH- and superoxide-radical scavenging assay, as well as ORAC assay, which was followed by AQBP and PEBP. All partitions also showed low anti-inflammatory activity via the LOX and XO pathways. In the hepatoprotective study, the effectiveness of the partitions is in the order of EABP>AQBP>PEBP, which is supported by the microscopic analysis and histopathological scoring. In the biochemical analysis, EABP also exerted the most effective effect by reducing the serum level of alanine transaminase (ALT) and aspartate transaminase (AST) at all doses tested in comparison to the other partitions. Phytochemical screening and HPLC analysis suggested the presence of: flavonoids, condensed tannins and triterpenes in EABP; flavonoids, condensed tannins and saponins in PEBP and; only saponins in AQBP. EABP demonstrates the most effective hepatoprotection against PCM-induced liver injury in rats. This observation could be attributed to its remarkable antioxidant activity and the presence of flavonoids that might probably act synergistically with other biocompounds to cause the hepatoprotection.

First case of disseminated cryptococcosis in a Gorilla gorilla.

PubMed

Mischnik, Alexander; Stockklausner, Julia; Hohneder, Nicole; Jensen, Henrik E; Zimmermann, Stefan; Reuss, David E; Rickerts, Volker; Tintelnot, Kathrin; Stockklausner, Clemens

2014-11-01

In humans, Cryptococcus mainly infects individuals with HIV infection or other types of immunosuppression. Here, we report the first case of disseminated cryptococcosis in a simian immunodeficiency virus-negative 27-year-old female Gorilla gorilla presenting with lethargy, progressive weight loss and productive cough. The diagnosis was confirmed by positive lung biopsy culture, serum cryptococcal antigen, and cerebral histopathology demonstrating encapsulated yeasts. Molecular characterisation of lung culture isolate yielded Cryptococcus neoformans var. grubii. An immune-deficiency could not be demonstrated. © 2014 Blackwell Verlag GmbH.

Histopathological Parameters predicting Occult Nodal Metastases in Tongue Carcinoma Cases: An Indian Perspective.

PubMed

Jacob, Tina Elizabeth; Malathi, N; Rajan, Sharada T; Augustine, Dominic; Manish, N; Patil, Shankargouda

2016-01-01

It is a well-established fact that in squamous cell carcinoma cases, the presence of lymph node metastases decreased the 5-year survival rate by 50% and also caused the recurrence of the primary tumor with development of distant metastases. Till date, the predictive factors for occult cervical lymph nodes metastases in cases of tongue squamous cell carcinoma remain inconclusive. Therefore, it is imperative to identify patients who are at the greatest risk for occult cervical metastases. This study was thus performed with the aim to identify various histopathologic parameters of the primary tumor that predict occult nodal metastases. The clinicopathologic features of 56 cases of lateral tongue squamous cell carcinoma with cT1NoMo/cT2NoMo as the stage and without prior radiotherapy or chemotherapy were considered. The surgical excision of primary tumor was followed by elective neck dissection. The glossectomy specimen along with the neck nodes were fixed in formalin and 5 urn thick sections were obtained. The hematoxylin & eosin stained sections were then subjected to microscopic examination. The primary tumor characteristics that were analyzed include tumor grade, invading front, depth of tumor, lymphovascular invasion, perineural invasion and inflammatory response. The nodes were examined for possible metastases using hematoxylin & eosin followed by cytokeratin immunohistochemistry. A total of 12 cases were found with positive occult nodal metastases. On performing univariate analysis, the histopathologic parameters that were found to be statistically significant were lymphovascular invasion (p = 0.004) and perineural invasion (p = 0.003) along with a cut-off depth of infiltration more than 5 mm (p = 0.01). Histopathologic assessment of the primary tumor specimen therefore continues to provide information that is central to guide clinical management, particularly in cases of occult nodal metastases. Clinical significance The study highlights the importance of extensive histopathological screening, which holds the key for establishing occult metastases. Pathological upgrading of tumors is possible following histopathological studies similar to the present one. Presence of occult metastases justify neck dissection in these clinically N0 cases. In an Indian setting, histopathological evaluation assumes a bigger role than other expensive and advanced techniques.

Segmentation of epidermal tissue with histopathological damage in images of haematoxylin and eosin stained human skin

PubMed Central

2014-01-01

Background Digital image analysis has the potential to address issues surrounding traditional histological techniques including a lack of objectivity and high variability, through the application of quantitative analysis. A key initial step in image analysis is the identification of regions of interest. A widely applied methodology is that of segmentation. This paper proposes the application of image analysis techniques to segment skin tissue with varying degrees of histopathological damage. The segmentation of human tissue is challenging as a consequence of the complexity of the tissue structures and inconsistencies in tissue preparation, hence there is a need for a new robust method with the capability to handle the additional challenges materialising from histopathological damage. Methods A new algorithm has been developed which combines enhanced colour information, created following a transformation to the L*a*b* colourspace, with general image intensity information. A colour normalisation step is included to enhance the algorithm’s robustness to variations in the lighting and staining of the input images. The resulting optimised image is subjected to thresholding and the segmentation is fine-tuned using a combination of morphological processing and object classification rules. The segmentation algorithm was tested on 40 digital images of haematoxylin & eosin (H&E) stained skin biopsies. Accuracy, sensitivity and specificity of the algorithmic procedure were assessed through the comparison of the proposed methodology against manual methods. Results Experimental results show the proposed fully automated methodology segments the epidermis with a mean specificity of 97.7%, a mean sensitivity of 89.4% and a mean accuracy of 96.5%. When a simple user interaction step is included, the specificity increases to 98.0%, the sensitivity to 91.0% and the accuracy to 96.8%. The algorithm segments effectively for different severities of tissue damage. Conclusions Epidermal segmentation is a crucial first step in a range of applications including melanoma detection and the assessment of histopathological damage in skin. The proposed methodology is able to segment the epidermis with different levels of histological damage. The basic method framework could be applied to segmentation of other epithelial tissues. PMID:24521154

Red spinach (Amaranthus tricolor L.) ethanolic extract as prevention against atherosclerosis based on the level of Low-Density Lipoprotein and histopathological feature of aorta in male Sprague-Dawley rats

NASA Astrophysics Data System (ADS)

Pradana, Dimas Adhi; Pondawinata, Marizki; Widyarini, Sitarina

2017-03-01

This study aimed to determine the potential activity of standardized ethanolic extract of red spinach as prevention against atherosclerosis based on the level of Low-Density Lipoprotein (LDL) and histopathological feature of aorta in male Sprague-Dawley rats induced by high-fat, high-cholesterol diet. A total of 42 animals was divided into 6 groups: normal control group, negative control group, positive control group (0.9 mg/kgBW of simvastatin), first intervention group (200 mg/kgBW of red spinach extract), second intervention group (400 mg/kgBW of red spinach extract), and third intervention group (800 mg/kgBW of red spinach extract). From the first day up to the 66th day, all the groups, except the normal control group and negative control group, were administered simvastatin (positive control) and extract of amaranth (intervention). Then, from the eighth day until Day 66, induction of high-fat and high-cholesterol diet was given in two hours after the simvastatin and red spinach extract administration. The determination of LDL parameters was conducted on Day 0, Day 35, and Day 67. On the 67th day, the animals were dissected to examine the aortic histopathological parameters. The results showed that the ethanolic extract of red spinach with a dose of 200 mg/kgBW, 400 mg/kgBW, and 800 mg/kgBW statistically demonstrated a significant difference (p<0.05). The histopathological feature of the aorta in the treatment indicated the absence of fat in the blood vessel walls or even of foam cells supporting thereby the result of LDL level. This means there was a significant effect of ethanolic extract of red spinach on the prevention against atherosclerosis based on the level of Low-Density Lipoprotein and the histopathological feature of aorta in male Sprague-Dawley rats.

NMR-based metabonomic analysis of the hepatotoxicity induced by combined exposure to PCBs and TCDD in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu Chunfeng; Department of Pharmacology, Basic Medical College, Jiamusi University, Jiamusi 154007; Wang Yimei

2010-11-01

A metabonomic approach using {sup 1}H NMR spectroscopy was adopted to investigate the metabonomic pattern of rat urine after oral administration of environmental endocrine disruptors (EDs) polychlorinated biphenyls (PCBs) and 2,3,7,8-tetrachlorodibenzo- p-dioxin (TCDD) alone or in combination and to explore the possible hepatotoxic mechanisms of combined exposure to PCBs and TCDD. {sup 1}H NMR spectra of urines collected 24 h before and after exposure were analyzed via pattern recognition by using principal component analysis (PCA). Serum biochemistry and liver histopathology indicated significant hepatotoxicity in the rats of the combined group. The PCA scores plots of urinary {sup 1}H NMR datamore » showed that all the treatment groups could be easily distinguished from the control group, so could the PCBs or TCDD group and the combined group. The loadings plots of the PCA revealed remarkable increases in the levels of lactate, glucose, taurine, creatine, and 2-hydroxy-isovaleric acid and reductions in the levels of 2-oxoglutarate, citrate, succinate, hippurate, and trimethylamine-N-oxide in rat urine after exposure. These changes were more striking in the combined group. The changed metabolites may be considered possible biomarker for the hepatotoxicity. The present study demonstrates that combined exposure to PCBs and TCDD induced significant hepatotoxicity in rats, and mitochondrial dysfunction and fatty acid metabolism perturbations might contribute to the hepatotoxicity. There was good conformity between changes in the urine metabonomic pattern and those in serum biochemistry and liver histopathology. These results showed that the NMR-based metabonomic approach may provide a promising technique for the evaluation of the combined toxicity of EDs.« less

Experimental infection in Cavia porcellus by infected Amblyomma ovale nymphs with Rickettsia sp. (Atlantic rainforest strain).

PubMed

Brustolin, Joice Magali; da Silva Krawczak, Felipe; Alves, Marta Elena Machado; Weiller, Maria Amélia; de Souza, Camila Lopes; Rosa, Fábio Brum; Cadore, Gustavo Cauduro; Dos Anjos Lopes, Sônia Terezinha; Labruna, Marcelo Bahia; Vogel, Fernanda Silveira Flores; de Avila Botton, Sônia; Sangioni, Luís Antônio

2018-03-01

This study describes experimental infection of guinea pigs (Cavia porcellus) infested with naturally infected Amblyomma ovale nymphs with Rickettsia sp. (Atlantic rainforest strain), and the capacity of A. ovale nymphs to transmit this bacterium. Twenty-six guinea pigs were divided into the following groups: G1, 10 animals infested with uninfected A. ovale nymphs; G2, 10 animals infested with nymphs infected with Rickettsia sp. (Atlantic rainforest strain); and G3, 6 animals without tick infestation. Blood samples were taken 7, 14, 21, and 28 days post-infestation for serological and hematological tests. For histopathological analysis and rickettsial DNA detection, fragments of the spleen, lung, brain, and liver were harvested after euthanasia. The average feeding period for nymphs was 6.6 days for G1 and 6 days for G2. Hemolymph and PCR assays, performed to detect the causative agent in ticks, indicated that in G1, all ticks were negative, and in G2, all nymphs were positive by PCR and 80% (8/10) was positive by hemolymph tests. The only clinical change was skin scarring at the tick attachment site. Hematological parameters indicated leukopenia and total plasma protein (TPP) increased with decreased platelets in G1. In G2, leukocytosis, neutrophilia, monocytosis, an increase in platelets, and reduced TPP were observed. Only G2 guinea pigs were seroconverted (80%; 8/10). Histopathology tests indicated mild, diffuse hemosiderosis and mild, multifocal, follicular hyperplasia in the spleen. Molecular analysis did not detect Rickettsia sp. DNA in C. porcellus tissues. We demonstrated the capacity of A. ovale nymphs to transmit Rickettsia sp. (Atlantic rainforest strain) to guinea pigs.

Broadband hyperspectral coherent anti-Stokes Raman scattering microscopy for stain-free histological imaging with principal component analysis

NASA Astrophysics Data System (ADS)

Xu, Jingjiang; Guo, Baoshan; Wong, Kenneth K. Y.; Tsia, Kevin K.

2014-02-01

Routine procedures in standard histopathology involve laborious steps of tissue processing and staining for final examination. New techniques which can bypass these procedures and thus minimize the tissue handling error would be of great clinical value. Coherent anti-Stokes Raman scattering (CARS) microscopy is an attractive tool for label-free biochemical-specific characterization of biological specimen. However, a vast majority of prior works on CARS (or stimulated Raman scattering (SRS)) bioimaging restricted analyses on a narrowband or well-distinctive Raman spectral signatures. Although hyperspectral SRS/CARS imaging has recently emerged as a better solution to access wider-band spectral information in the image, studies mostly focused on a limited spectral range, e.g. CH-stretching vibration of lipids, or non-biological samples. Hyperspectral image information in the congested fingerprint spectrum generally remains untapped for biological samples. In this regard, we further explore ultrabroadband hyperspectral multiplex (HM-CARS) to perform chemoselective histological imaging with the goal of exploring its utility in stain-free clinical histopathology. Using the supercontinuum Stokes, our system can access the CARS spectral window as wide as >2000cm-1. In order to unravel the congested CARS spectra particularly in the fingerprint region, we first employ a spectral phase-retrieval algorithm based on Kramers-Kronig (KK) transform to minimize the non-resonant background in the CARS spectrum. We then apply principal component analysis (PCA) to identify and map the spatial distribution of different biochemical components in the tissues. We demonstrate chemoselective HM-CARS imaging of a colon tissue section which displays the key cellular structures that correspond well with standard stained-tissue observation.

The effects of Magnetic Resonance Imaging-guided High-Intensity Focused Ultrasound ablation on human cadaver breast tissue.

PubMed

Merckel, Laura G; Deckers, Roel; Baron, Paul; Bleys, Ronald L A W; van Diest, Paul J; Moonen, Chrit T W; Mali, Willem P Th M; van den Bosch, Maurice A A J; Bartels, Lambertus W

2013-10-05

Magnetic Resonance Imaging-guided High-Intensity Focused Ultrasound (MR-HIFU) is a promising technique for non-invasive breast tumor ablation. The purpose of this study was to investigate the effects of HIFU ablation and thermal exposure on ex vivo human breast tissue. HIFU ablations were performed in three unembalmed cadaveric breast specimens using a clinical MR-HIFU system. Sonications were performed in fibroglandular and adipose tissue. During HIFU ablation, time-resolved anatomical MR images were acquired to monitor macroscopic tissue changes. Furthermore, the breast tissue temperature was measured using a thermocouple to investigate heating and cooling under HIFU exposure. After HIFU ablation, breast tissue samples were excised and prepared for histopathological analysis. In addition, thermal exposure experiments were performed to distinguish between different levels of thermal damage using immunohistochemical staining. Irreversible macroscopic deformations up to 3.7 mm were observed upon HIFU ablation both in fibroglandular and in adipose tissue. No relationship was found between the sonication power or the maximum tissue temperature and the size of the deformations. Temperature measurements after HIFU ablation showed a slow decline in breast tissue temperature. Histopathological analysis of sonicated regions demonstrated ablated tissue and morphologically complete cell death. After thermal exposure, samples exposed to three different temperatures could readily be distinguished. In conclusion, the irreversible macroscopic tissue deformations in ex vivo human breast tissue observed during HIFU ablation suggest that it might be relevant to monitor tissue deformations during MR-HIFU treatments. Furthermore, the slow decrease in breast tissue temperature after HIFU ablation increases the risk of heat accumulation between successive sonications. Since cell death was inflicted after already 5 minutes at 75°C, MR-HIFU may find a place in non-invasive treatment of breast tumors. © 2013 Elsevier B.V. All rights reserved.

Prospective trial evaluating the sensitivity and specificity of 3,4-dihydroxy-6-[18F]-fluoro-L-phenylalanine (18F-DOPA) PET and MRI in patients with recurrent gliomas.

PubMed

Youland, Ryan S; Pafundi, Deanna H; Brinkmann, Debra H; Lowe, Val J; Morris, Jonathan M; Kemp, Bradley J; Hunt, Christopher H; Giannini, Caterina; Parney, Ian F; Laack, Nadia N

2018-05-01

Treatment-related changes can be difficult to differentiate from progressive glioma using MRI with contrast (CE). The purpose of this study is to compare the sensitivity and specificity of 18F-DOPA-PET and MRI in patients with recurrent glioma. Thirteen patients with MRI findings suspicious for recurrent glioma were prospectively enrolled and underwent 18F-DOPA-PET and MRI for neurosurgical planning. Stereotactic biopsies were obtained from regions of concordant and discordant PET and MRI CE, all within regions of T2/FLAIR signal hyperintensity. The sensitivity and specificity of 18F-DOPA-PET and CE were calculated based on histopathologic analysis. Receiver operating characteristic curve analysis revealed optimal tumor to normal (T/N) and SUVmax thresholds. In the 37 specimens obtained, 51% exhibited MRI contrast enhancement (M+) and 78% demonstrated 18F-DOPA-PET avidity (P+). Imaging characteristics included M-P- in 16%, M-P+ in 32%, M+P+ in 46% and M+P- in 5%. Histopathologic review of biopsies revealed grade II components in 16%, grade III in 43%, grade IV in 30% and no tumor in 11%. MRI CE sensitivity for recurrent tumor was 52% and specificity was 50%. PET sensitivity for tumor was 82% and specificity was 50%. A T/N threshold > 2.0 altered sensitivity to 76% and specificity to 100% and SUVmax > 1.36 improved sensitivity and specificity to 94 and 75%, respectively. 18F-DOPA-PET can provide increased sensitivity and specificity compared with MRI CE for visualizing the spatial distribution of recurrent gliomas. Future studies will incorporate 18F-DOPA-PET into re-irradiation target volume delineation for RT planning.

Multimodal Characterization of the Late Effects of Traumatic Brain Injury: A Methodological Overview of the Late Effects of Traumatic Brain Injury Project.

PubMed

Edlow, Brian L; Keene, C Dirk; Perl, Daniel P; Iacono, Diego; Folkerth, Rebecca D; Stewart, William; Mac Donald, Christine L; Augustinack, Jean; Diaz-Arrastia, Ramon; Estrada, Camilo; Flannery, Elissa; Gordon, Wayne A; Grabowski, Thomas J; Hansen, Kelly; Hoffman, Jeanne; Kroenke, Christopher; Larson, Eric B; Lee, Patricia; Mareyam, Azma; McNab, Jennifer A; McPhee, Jeanne; Moreau, Allison L; Renz, Anne; Richmire, KatieRose; Stevens, Allison; Tang, Cheuk Y; Tirrell, Lee S; Trittschuh, Emily H; van der Kouwe, Andre; Varjabedian, Ani; Wald, Lawrence L; Wu, Ona; Yendiki, Anastasia; Young, Liza; Zöllei, Lilla; Fischl, Bruce; Crane, Paul K; Dams-O'Connor, Kristen

2018-05-03

Epidemiological studies suggest that a single moderate-to-severe traumatic brain injury (TBI) is associated with an increased risk of neurodegenerative disease, including Alzheimer's disease (AD) and Parkinson's disease (PD). Histopathological studies describe complex neurodegenerative pathologies in individuals exposed to single moderate-to-severe TBI or repetitive mild TBI, including chronic traumatic encephalopathy (CTE). However, the clinicopathological links between TBI and post-traumatic neurodegenerative diseases such as AD, PD, and CTE remain poorly understood. Here, we describe the methodology of the Late Effects of TBI (LETBI) study, whose goals are to characterize chronic post-traumatic neuropathology and to identify in vivo biomarkers of post-traumatic neurodegeneration. LETBI participants undergo extensive clinical evaluation using National Institutes of Health TBI Common Data Elements, proteomic and genomic analysis, structural and functional magnetic resonance imaging (MRI), and prospective consent for brain donation. Selected brain specimens undergo ultra-high resolution ex vivo MRI and histopathological evaluation including whole-mount analysis. Co-registration of ex vivo and in vivo MRI data enables identification of ex vivo lesions that were present during life. In vivo signatures of postmortem pathology are then correlated with cognitive and behavioral data to characterize the clinical phenotype(s) associated with pathological brain lesions. We illustrate the study methods and demonstrate proof of concept for this approach by reporting results from the first LETBI participant, who despite the presence of multiple in vivo and ex vivo pathoanatomic lesions had normal cognition and was functionally independent until her mid-80s. The LETBI project represents a multidisciplinary effort to characterize post-traumatic neuropathology and identify in vivo signatures of postmortem pathology in a prospective study.

Identification of oligosaccharides from histopathological sections by MALDI imaging mass spectrometry.

PubMed

Yamada, Masanori; Yao, Ikuko; Hayasaka, Takahiro; Ushijima, Masaru; Matsuura, Masaaki; Takada, Hideho; Shikata, Nobuaki; Setou, Mitsutoshi; Kwon, A-Hon; Ito, Seiji

2012-02-01

Direct tissue analysis using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) provides the means for in situ molecular analysis of a wide variety of biomolecules. This technology--known as imaging mass spectrometry (IMS)--allows the measurement of biomolecules in their native biological environments without the need for target-specific reagents such as antibodies. In this study, we applied the IMS technique to formalin-fixed paraffin-embedded samples to identify a substance(s) responsible for the intestinal obstruction caused by an unidentified foreign body. In advance of IMS analysis, some pretreatments were applied. After the deparaffinization of sections, samples were subjected to enzyme digestion. The sections co-crystallized with matrix were desorbed and ionized by a laser pulse with scanning. A combination of α-amylase digestion and the 2,5-dihydroxybenzoic acid matrix gave the best mass spectrum. With the IMS Convolution software which we developed, we could automatically extract meaningful signals from the IMS datasets. The representative peak values were m/z 1,013, 1,175, 1,337, 1,499, 1,661, 1,823, and 1,985. Thus, it was revealed that the material was polymer with a 162-Da unit size, calculated from the even intervals. In comparison with the mass spectra of the histopathological specimen and authentic materials, the main component coincided with amylopectin rather than amylose. Tandem MS analysis proved that the main components were oligosaccharides. Finally, we confirmed the identification of amylopectin by staining with periodic acid-Schiff and iodine. These results for the first time show the advantages of MALDI-IMS in combination with enzyme digestion for the direct analysis of oligosaccharides as a major component of histopathological samples.

Semi-automated and automated glioma grading using dynamic susceptibility-weighted contrast-enhanced perfusion MRI relative cerebral blood volume measurements.

PubMed

Friedman, S N; Bambrough, P J; Kotsarini, C; Khandanpour, N; Hoggard, N

2012-12-01

Despite the established role of MRI in the diagnosis of brain tumours, histopathological assessment remains the clinically used technique, especially for the glioma group. Relative cerebral blood volume (rCBV) is a dynamic susceptibility-weighted contrast-enhanced perfusion MRI parameter that has been shown to correlate to tumour grade, but assessment requires a specialist and is time consuming. We developed analysis software to determine glioma gradings from perfusion rCBV scans in a manner that is quick, easy and does not require a specialist operator. MRI perfusion data from 47 patients with different histopathological grades of glioma were analysed with custom-designed software. Semi-automated analysis was performed with a specialist and non-specialist operator separately determining the maximum rCBV value corresponding to the tumour. Automated histogram analysis was performed by calculating the mean, standard deviation, median, mode, skewness and kurtosis of rCBV values. All values were compared with the histopathologically assessed tumour grade. A strong correlation between specialist and non-specialist observer measurements was found. Significantly different values were obtained between tumour grades using both semi-automated and automated techniques, consistent with previous results. The raw (unnormalised) data single-pixel maximum rCBV semi-automated analysis value had the strongest correlation with glioma grade. Standard deviation of the raw data had the strongest correlation of the automated analysis. Semi-automated calculation of raw maximum rCBV value was the best indicator of tumour grade and does not require a specialist operator. Both semi-automated and automated MRI perfusion techniques provide viable non-invasive alternatives to biopsy for glioma tumour grading.

A study of hearing function and histopathologic changes in the cochlea of the type 2 diabetes model Tsumura Suzuki obese diabetes mouse.

PubMed

Tsuda, Junko; Sugahara, Kazuma; Hori, Takeshi; Kanagawa, Eiju; Takaki, Eiichi; Fujimoto, Mitsuaki; Nakai, Akira; Yamashita, Hiroshi

2016-11-01

This study used Tsumura Suzuki Obese Diabetes (TSOD) mice as a spontaneous type 2 diabetes model and Tsumura Suzuki Non-obesity (TSNO) mice as controls to investigate factors involved in the onset of hearing impairment. Body weight, blood glucose levels, and auditory brainstem responses (ABRs) were measured. The cochleae were excised and evaluated histopathologically. The TSOD mice showed significant hyperglycemia at 2-7 months and severe obesity at 5-10 months; significantly elevated ABR thresholds at 8-10 months; and the capillary lumens in the cochlea stria vascularis were narrower in the TSOD mice than in the TSNO mice. At 17 months, India ink vascular staining of the TSOD mice's cochleae revealed decreased capillary density in the stria vascularis. The vascular area of capillaries in the stria vascularis and the vascular area were significantly smaller in TSOD mice. Histopathological analysis showed vessel wall thickening in the modiolus and narrowed capillaries in the stria vascularis, suggesting reduced blood flow to the inner ear. The diabetes mice model used in our study showed early age-associated hearing loss, and histopathology showed findings of vessel wall thickening in the modiolus, narrowing of capillaries in the stria vascularis, and chronically reduced blood flow in the cochlea.

Induction of osteoarthritis by injecting monosodium iodoacetate into the patellofemoral joint of an experimental rat model

PubMed Central

Matsuzaki, Taro; Kuroki, Hiroshi

2018-01-01

This study aimed to investigate the histopathological changes in the patellofemoral joint using a rat model of osteoarthritis that was induced using monosodium iodoacetate, and to establish a novel model of patellofemoral osteoarthritis in a rat model using histopathological analysis. Sixty male rats were used. Osteoarthritis was induced through a single intra-articular injection of monosodium iodoacetate in both knee joints. Animals were equally divided into two experimental groups based on the monosodium iodoacetate dose: 0.2 mg and 1.0 mg. Histopathological changes in the articular cartilage of the patellofemoral joint and the infrapatellar fat pad were examined at 3 days, 1 week, 2 weeks, 4 weeks, 8 weeks, and 12 weeks after the monosodium iodoacetate injection. In the 1.0-mg group, the representative histopathological findings of osteoarthritis were observed in the articular cartilage of the patellofemoral joint over time. Additionally, the Osteoarthritis Research Society International scores of the patellofemoral joint increased over time. The synovitis scores of the infrapatellar fat pad in both groups were highest at 3 days, and then the values decreased over time. The fibrosis score of the infrapatellar fat pad in the 1.0-mg group increased with time, whereas the fibrosis score in the 0.2-mg group remained low. Representative histopathological findings of osteoarthritis were observed in the articular cartilage of the patellofemoral joint in a rat model of osteoarthritis induced using monosodium iodoacetate. With appropriate selection, this model may be regarded as an ideal patellofemoral osteoarthritis model. PMID:29698461

Contact Endoscopy of mucosal lesions of oral cavity – Preliminary experience

PubMed Central

Mishra, Awadhesh Kumar; Nilakantan, Ajith; Sahai, Kavita; Datta, Rakesh; Malik, Ajay

2014-01-01

Background Contact Endoscopy is a non invasive tool to visualise alterations in cell architecture in vivo. In this study we investigated the diagnostic accuracy of Contact Endoscopy in detecting malignancy in oral mucosal lesions. Methods 76 patients with oral mucosal lesions requiring biopsy were included. Contact Endoscopy was performed by Otolaryngologist before biopsy and findings recorded. The lesion was then biopsied and sent for histopathological examination by Pathologist who was blinded to Contact Endoscopy findings. Findings of Contact Endoscopy were compared with histopathological findings taking the latter as the gold standard. Two biopsies were reported as ‘inconclusive’ on histopathological examination and hence excluded from the final analysis. Data of the remaining 74 patients is presented here. Results Clinically lesions were diagnosed as ulcero-proliferative lesions in 34 patients, Leukoplakia in 19, Erythroplakia in 9, Lichen planus in 5 and Submucous fibrosis in 7 patients. Histopathological examination revealed presence of malignancy in 97.06% of ulcero-proliferative mucosal lesions, 10.53% of leukoplakia and 33.33% of erythroplakia while corresponding figures on Contact Endoscopy were 94.12%, 5.26% and 11.11% respectively. No malignancy was detected in lichen planus and submucous fibrosis by either technique. When compared with histopathological examination, CE showed sensitivity of 84.21%, specificity of 94.44% and accuracy of 89.19%. No adverse effects on the patients were seen due to the procedure or stain. Conclusion Contact Endoscopy may be useful in determining cellular structure in vivo without biopsy to detect oral malignancy early. Further studies are suggested. PMID:25378780

Comparative Study of Clinical Staging of Oral Submucous Fibrosis with Qualitative Analysis of Collagen Fibers Under Polarized Microscopy.

PubMed

Modak, Neha; Tamgadge, Sandhya; Tamgadge, Avinash; Bhalerao, Sudhir

2015-01-01

Oral submucous fibrosis (OSMF) is a condition where excessive deposition of dense collagen fibers occurred in the connective tissue of oral mucosa. An alteration of collagen necessitates an in depth understanding of collagen in oral tissues as no breakthrough studies have been reported. T herefore the aim was to correlate the clinical, functional and histopathological staging and to analyze the polarization colors and thickness of the collagen fibers in different stages of OSMF using picrosirius red stain under polarizing microscopy so as to assess the severity of disease. The study was conducted in the department of Oral Pathology and Microbiology at Padm. Dr. D. Y Patil Dental and Hospital, Navi Mumbai, India (2012-13). A sample size was of a total 40 subjects, of which 30 patients had OSMF, and 10 were in control group. Clinical, functional and histopathological staging were done depending upon definite criteria. Collagen fibers were analyzed for polarizing colors and thickness. Further clinical, functional and histopathological stages as well as qualitative parameters of collagen fibers were compared. The correlation between clinical and functional staging was not significant ( P >0.05) whereas the comparison of the functional staging with histopathological staging was more reliable ( P <0.01) as an indication to the severity of the disease rather than clinical staging. One-way ANOVA analysis showed highly significant correlation between functional staging and polarization colors and thickness of collagen fibers ( P <0.001). The qualitative change in the collagen fibers of OSMF patients using polarized microscopy would help to assess its role in diagnostic evaluation, to determine the prognosis of the disease as well as to provide useful predictive treatment modalities to them.

Diastolic heart failure associated with hemangiosarcoma infiltrating left ventricular walls in a dog

PubMed Central

Osuga, Tatsuyuki; Nakamura, Kensuke; Morita, Tomoya; Kagawa, Yumiko; Ohta, Hiroshi; Takiguchi, Mitsuyoshi

2017-01-01

A 9-year-old Shetland sheepdog was diagnosed with cardiogenic pulmonary edema. Echocardiography revealed focally thickened left ventricular free wall and interventricular septum and left atrial dilation. Left ventricular systolic function was preserved. Doppler echocardiography of transmitral flow indicated restrictive left ventricular filling. Cardiac histopathology demonstrated hemangiosarcoma infiltrating the left ventricular walls. PMID:29089652

Diastolic heart failure associated with hemangiosarcoma infiltrating left ventricular walls in a dog.

PubMed

Osuga, Tatsuyuki; Nakamura, Kensuke; Morita, Tomoya; Kagawa, Yumiko; Ohta, Hiroshi; Takiguchi, Mitsuyoshi

2017-11-01

A 9-year-old Shetland sheepdog was diagnosed with cardiogenic pulmonary edema. Echocardiography revealed focally thickened left ventricular free wall and interventricular septum and left atrial dilation. Left ventricular systolic function was preserved. Doppler echocardiography of transmitral flow indicated restrictive left ventricular filling. Cardiac histopathology demonstrated hemangiosarcoma infiltrating the left ventricular walls.

Removal of the intestinal mucosa: photochemical approach in bladder augmentation

NASA Astrophysics Data System (ADS)

Haselhuhn, Gregory D.; Kropp, Kenneth A.; Keck, Rick W.; Selman, Steven H.

1995-03-01

Experiments were undertaken to determine whether 5-aminoleuvinic acid in combination with light could be used as an adjunct to intestinal bladder augmentation with the aim of removing intestinal mucosa with subsequent re-epithelialization of the treated segment with urothelium. Histopathologic studies of so-treated intestinal segments used in bladder augmentation demonstrate the feasibility of this approach.

Comparison of FibroTest-ActiTest with histopathology in demonstrating fibrosis and necroinflammatory activity in chronic hepatitis B and C.

PubMed

Uyar, Cemile; Akcam, Fusun Zeynep; Ciris, Metin; Kaya, Onur; Kockar, Cem; Isler, Mehmet

2010-01-01

FibroTest and ActiTest are noninvasive tests used in determining the level of fibrosis and the degree of necroinflammatory activity in the liver. In our study, we aimed to investigate whether these tests could be alternative to liver biopsy. Fifty patients were included in the study. Serum samples were obtained and liver needle biopsy was performed on the same day. Levels of fibrosis in FibroTest and levels of activity in ActiTest, both determined via serum biochemical markers, were compared with levels of fibrosis and activity in histopathological examination. For statistical analyses, Mc Nemar chi square test and Spearman's correlation tests were used. There was a significant positive correlation between fibrosis in biopsy and the level of fibrosis in FibroTest in patients with hepatitis B virus (HBV) (rho: 0.67, P < 0.0001). However, no significant correlation was determined between the activity in biopsy and the degree of activity in ActiTest (rho: 0.29, P < 0.05). No significant correlation was determined between both fibrosis and activity established in biopsy and the results of FibroTest and ActiTest in the group of patients with hepatitis C virus (HCV) (rho: 0.22, P < 0.05 and rho: 0.15, P < 0.05, respectively). Our results suggest that novel and safer noninvasive biochemical tests are needed as an alternative to histopathology in patients infected with HBV and HCV. Consequently, we believe that liver biopsy maintains its place as a gold standard in determining the histopathological condition of the liver.

Histopathological analysis of the cutaneous changes due to kangri use in kashmiri population: a hospital based study.

PubMed

Hassan, Iffat; Sajad, Peerzada; Reshi, Ruby

2013-05-01

Kangri cancer is peculiar to the valley of Kashmir as people of all age groups are accustomed to warm their bodies by the use of Kangri baskets. The clinical spectrum of skin cancer in the Kashmir valley is entirely different from the rest of the country, which could be attributed to the use of Kangri in this geographical region.[12]. Histopathological analysis of the cutaneous changes due to kangri use in Kashmiri population. This is a prospective hospital based study. All the patients attending the outpatient department of Dermatology, STD and Leprosy at SMHS Hospital, an associated hospital of govt. medical college in Srinagar and presented with suspicious lesions (i.e., erythema ab igne, papular or nodular skin growths) due to Kangri use were taken up for the study. A detailed history including the use of Kangri and a physical examination was done in each patient followed by a histopathological examination in case of suspicious lesions. The cutaneous changes which were observed during the study period of 8 months were erythema ab igne, bowen's disease and squamous cell carcinoma. Although this is a preliminary study we will be studying more of such changes caused due to Kangri use in the future.

Histopathological Analysis of the Cutaneous Changes Due to Kangri Use in Kashmiri Population: A Hospital Based Study

PubMed Central

Hassan, Iffat; Sajad, Peerzada; Reshi, Ruby

2013-01-01

Background: Kangri cancer is peculiar to the valley of Kashmir as people of all age groups are accustomed to warm their bodies by the use of Kangri baskets. The clinical spectrum of skin cancer in the Kashmir valley is entirely different from the rest of the country, which could be attributed to the use of Kangri in this geographical region.[12] Aims: Histopathological analysis of the cutaneous changes due to kangri use in Kashmiri population. Materials and Methods: This is a prospective hospital based study. All the patients attending the outpatient department of Dermatology, STD and Leprosy at SMHS Hospital, an associated hospital of govt. medical college in Srinagar and presented with suspicious lesions (i.e., erythema ab igne, papular or nodular skin growths) due to Kangri use were taken up for the study. A detailed history including the use of Kangri and a physical examination was done in each patient followed by a histopathological examination in case of suspicious lesions. Results: The cutaneous changes which were observed during the study period of 8 months were erythema ab igne, bowen's disease and squamous cell carcinoma. Conclusion: Although this is a preliminary study we will be studying more of such changes caused due to Kangri use in the future. PMID:23723467

Accumulation, biotransformation, histopathology and paralysis in the Pacific calico scallop Argopecten ventricosus by the paralyzing toxins of the dinoflagellate Gymnodinium catenatum.

PubMed

Escobedo-Lozano, Amada Y; Estrada, Norma; Ascencio, Felipe; Contreras, Gerardo; Alonso-Rodriguez, Rosalba

2012-05-01

The dinoflagellate Gymnodinium catenatum produces paralyzing shellfish poisons that are consumed and accumulated by bivalves. We performed short-term feeding experiments to examine ingestion, accumulation, biotransformation, histopathology, and paralysis in the juvenile Pacific calico scallop Argopecten ventricosus that consume this dinoflagellate. Depletion of algal cells was measured in closed systems. Histopathological preparations were microscopically analyzed. Paralysis was observed and the time of recovery recorded. Accumulation and possible biotransformation of toxins were measured by HPLC analysis. Feeding activity in treated scallops showed that scallops produced pseudofeces, ingestion rates decreased at 8 h; approximately 60% of the scallops were paralyzed and melanin production and hemocyte aggregation were observed in several tissues at 15 h. HPLC analysis showed that the only toxins present in the dinoflagellates and scallops were the N-sulfo-carbamoyl toxins (C1, C2); after hydrolysis, the carbamate toxins (epimers GTX2/3) were present. C1 and C2 toxins were most common in the mantle, followed by the digestive gland and stomach-complex, adductor muscle, kidney and rectum group, and finally, gills. Toxin profiles in scallop tissue were similar to the dinoflagellate; biotransformations were not present in the scallops in this short-term feeding experiment.

Accumulation, Biotransformation, Histopathology and Paralysis in the Pacific Calico Scallop Argopecten ventricosus by the Paralyzing Toxins of the Dinoflagellate Gymnodinium catenatum

PubMed Central

Escobedo-Lozano, Amada Y.; Estrada, Norma; Ascencio, Felipe; Contreras, Gerardo; Alonso-Rodriguez, Rosalba

2012-01-01

The dinoflagellate Gymnodinium catenatum produces paralyzing shellfish poisons that are consumed and accumulated by bivalves. We performed short-term feeding experiments to examine ingestion, accumulation, biotransformation, histopathology, and paralysis in the juvenile Pacific calico scallop Argopecten ventricosus that consume this dinoflagellate. Depletion of algal cells was measured in closed systems. Histopathological preparations were microscopically analyzed. Paralysis was observed and the time of recovery recorded. Accumulation and possible biotransformation of toxins were measured by HPLC analysis. Feeding activity in treated scallops showed that scallops produced pseudofeces, ingestion rates decreased at 8 h; approximately 60% of the scallops were paralyzed and melanin production and hemocyte aggregation were observed in several tissues at 15 h. HPLC analysis showed that the only toxins present in the dinoflagellates and scallops were the N-sulfo-carbamoyl toxins (C1, C2); after hydrolysis, the carbamate toxins (epimers GTX2/3) were present. C1 and C2 toxins were most common in the mantle, followed by the digestive gland and stomach-complex, adductor muscle, kidney and rectum group, and finally, gills. Toxin profiles in scallop tissue were similar to the dinoflagellate; biotransformations were not present in the scallops in this short-term feeding experiment. PMID:22822356

Spermatotoxic effects of α-chlorohydrin in rats

PubMed Central

Kim, Sung-Hwan; Lee, In-Chul; Lim, Jeong-Hyeon; Moon, Changjong; Bae, Chun-Sik; Kim, Sung-Ho; Shin, Dong-Ho; Kim, Hyoung-Chin

2012-01-01

This study was conducted to investigate the potential effects of α-chlorohydrin (ACH) on epididymal function and antioxidant system in male rats. The test chemical was administered to male rats by gavage at doses of 0, 3, 10, and 30 mg/kg/day for 7 days. Twenty-four male rats were randomly assigned to four experimental groups, with six rats in each group. Spermatotoxicity was assessed by measurement of reproductive organ weight, testicular sperm head count, epididymal sperm motility and morphology, histopathologic examination, and oxidative damage analysis in rats. At 30 mg/kg/day, an increase in the incidence of clinical signs, epididymis weight, and gross necropsy findings of the epididymis, a decrease in the sperm motility, and an increased incidence of histopathological changes of the epididymis were observed in a dose-dependent manner. At 10 mg/kg/day, an increased incidence of clinical signs and histopathological changes and decreased sperm motility were observed. In the oxidative damage analysis, an increase in the malondialdehyde concentration and a decrease in the glutathione content and glutathione peroxidase and catalase activities in the epididymal tissue were detected at ≥3 mg/kg/day. The results show that graded doses of ACH elicit depletion of the antioxidant defense system and that the spermatotoxicity of ACH may be due to the induction of oxidative stress. PMID:22474469

Applications of DNA-Based Liquid Biopsy for Central Nervous System Neoplasms.

PubMed

Wang, Joanna; Bettegowda, Chetan

2017-01-01

The management of central nervous system malignancies remains reliant on histopathological analysis and neuroimaging, despite their complex genetic profile. The intratumoral heterogeneity displayed by these tumors necessitates a more sophisticated method of tumor analysis and monitoring, with the ability to assess tumors over space and time. Circulating biomarkers, including circulating tumor cells, circulating tumor DNA, and extracellular vesicles, hold promise as a type of real-time liquid biopsy able to provide dynamic information not only regarding tumor burden to monitor disease progression and treatment response, but also regarding genetic profile to enable changes in management to match a constantly evolving tumor. In numerous cancer types, including glioma, they have demonstrated their clinical utility as a minimally invasive means for diagnosis, prognostication, and prediction. In addition, they can be used in the laboratory to probe mechanisms of acquired drug resistance and tumor invasion and dissemination. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Vulvar mucinous adenocarcinoma with neuroendocrine differentiation: A case report and review of the literature.

PubMed

van Rosmalen, M H J; Reijnen, C; Boll, D; Pijnenborg, J M A; van der Wurff, A A M; Piek, J M J

2016-03-01

There are limited cases in literature of patients with mucinous adenocarcinoma of the vulva with neuroendocrine differentiation have. With this new case, we aim to provide an overview of the existing literature and present a tool with relevant markers for the pathologist in the differential diagnosis. A 92-year-old multiparous, Caucasian woman presented with a 8 cm spherical tumor of the left major labium. Since the initial punch biopsy was not conclusive, a local resection was performed. Histopathological examination showed mucus production, large pools of mucin with trabeculae and cribriform glandular structures with strongly atypical columnar epithelium. Additional immunohistochemical analysis demonstrated expression of: CEA, CK7, EMA, and the neuroendocrine markers synaptophysin and chromogranin supporting the diagnosis. In this report, we present a new case of a mucinous adenocarcinoma of the vulva with neuroendocrine differentiation based immunohistochemical analysis. Due to the indolent tumor behavior, partial vulvectomy is the therapy of choice. Copyright © 2016 Elsevier GmbH. All rights reserved.

Customizing chemotherapy for colon cancer: the potential of gene expression profiling.

PubMed

Mariadason, John M; Arango, Diego; Augenlicht, Leonard H

2004-06-01

The value of gene expression profiling, or microarray analysis, for the classification and prognosis of multiple forms of cancer is now clearly established. For colon cancer, expression profiling can readily discriminate between normal and tumor tissue, and to some extent between tumors of different histopathological stage and prognosis. While a definitive in vivo study demonstrating the potential of this methodology for predicting response to chemotherapy is presently lacking, the ability of microarrays to distinguish other subtleties of colon cancer phenotype, as well as recent in vitro proof-of-principle experiments utilizing colon cancer cell lines, illustrate the potential of this methodology for predicting the probability of response to specific chemotherapeutic agents. This review discusses some of the recent advances in the use of microarray analysis for understanding and distinguishing colon cancer subtypes, and attempts to identify challenges that need to be overcome in order to achieve the goal of using gene expression profiling for customizing chemotherapy in colon cancer.

Immunity-Related Protein Expression and Pathological Lung Damage in Mice Poststimulation with Ambient Particulate Matter from Live Bird Markets.

PubMed

Meng, Kai; Wu, Bo; Gao, Jing; Cai, Yumei; Yao, Meiling; Wei, Liangmeng; Chai, Tongjie

2016-01-01

The objective of this study was to obtain insight into the adverse health effects of airborne particulate matter (PM) collected from live bird markets and to determine whether biological material in PM accounts for immune-related inflammatory response. Mice were exposed to a single or repeated dose of PM, after which the expression of toll-like receptors (TLRs), cytokines, and chemokines in the lungs of infected mice were examined by enzyme-linked immunosorbent assay and histopathological analysis. Results after single and repeated PM stimulation with [Formula: see text] indicated that TLR2 and TLR4 played a dominant role in the inflammatory responses of the lung. Further analysis demonstrated that the expression levels of IL-1β, TNF-α, IFN-γ, IL-8, IP-10, and MCP-1 increased significantly, which could eventually contribute to lung injury. Moreover, biological components in PM were critical in mediating immune-related inflammatory responses and should therefore not be overlooked.

Which is the best method of sterilization of tumour bone for reimplantation? a biomechanical and histopathological study

PubMed Central

2010-01-01

Introduction Sterilization and re-usage of tumour bone for reconstruction after tumour resection is now gaining popularity in the East. This recycle tumour bone needs to be sterilized in order to eradicate the tumour cells before re-implantation for limb salvage procedures. The effect of some of these treatments on the integrity and sterility of the bone after treatment has been published but there has yet been a direct comparison between the various methods of sterilization to determine the one method that gives the best tumour kill without compromising the bone's structural integrity. Method This study was performed to evaluate the effect of several sterilization methods on the mechanical behavior of human cortical bone graft and histopathology evaluation of tumour bone samples after being processed with 4 different methods of sterilization. Fresh human cortical tumour bone is harvested from the diaphyseal region of the tumour bone were sterilized by autoclave (n =10); boiling (n =10); pasteurization (n =10); and irradiation (n =10). There were also 10 control specimens that did not receive any form of sterilization treatment. The biomechanical test conducted were stress to failure, modulus and strain to failure, which were determined from axial compression testing. Statistical analysis (ANOVA) was performed on these results. Significance level (α) and power (β) were set to 0.05 and 0.90, respectively. Results ANOVA analysis of 'failure stress', 'modulus' and 'strain to failure' demonstrated significant differences (p < 0.05) between treated cortical bone and untreated specimens under mechanical loading. 'Stress to failure' was significantly reduced in boiled, autoclaved and irradiated cortical bone samples (p < 0.05). 'Modulus' detected significant differences in the boiled, autoclaved and pasteurization specimens compared to controls (p < 0.05). 'Strain to failure' was reduced by irradiation (p < 0.05) but not by the other three methods of treatments. Histopathology study revealed no viable tumour cell in any of four types of treatment group compared to the untreated control group. Conclusions Sterilization of cortical bone sample by pasteurization and to a lesser extent, irradiation does not significantly alter the mechanical properties when compared with untreated samples. Mechanical properties degrade with the use of high temperature for sterilization (boiling). All methods of sterilization gave rise to 100 percent tumour kill. PMID:20831801

Case-controlled clinical and histopathological study of conjunctivochalasis.

PubMed

Francis, I C; Chan, D G; Kim, P; Wilcsek, G; Filipic, M; Yong, J; Coroneo, M T

2005-03-01

Conjunctivochalasis, a secondary cause of the watery eye, is frequently seen in the older age group as an elevation of the bulbar conjunctiva lying along the lateral or central lower lid margin. A prospective, interventional, case-controlled clinical and histopathological study was conducted. The relevant features of 18 patients (29 eyes) who had their conjunctivochalasis resected as part of the surgical management of their watery eye syndrome were examined. In the control group, tissue was obtained from an age matched series of 24 normal subjects undergoing routine cataract surgery. 24 controls (24 specimens) and 18 patients (29 specimens) had conjunctival strip biopsies, taken from the usual lid margin level bulbar conjunctiva in line with the inferior limbus (controls), and the clinically apparent conjunctivochalasis (patients). These were submitted for histological study. 23 of 24 control sections demonstrated normal conjunctival variation. Four of 29 patient specimens demonstrated a chronic non-granulomatous conjunctivitis, while three eyes of the patient group (two patients) demonstrated features of elastosis. Of the four patients who had the inflammatory infiltrates, three had functional nasolacrimal duct obstructions (FNLDOs) and one had a primary acquired nasolacrimal duct obstruction (PANDO). Of the two patients who had elastosis, one had an FNLDO and the other had normal lacrimal drainage and was Jones 1 positive. Six of 18 patients--that is, seven of 29 specimens of conjunctivochalasis demonstrated signs of elastosis or of chronic non-granulomatous inflammation. Clinically, patients had a spectrum of aetiologies of their watery eye syndrome.

Oral focal epithelial hyperplasia: report of 3 cases with human papillomavirus DNA sequencing analysis.

PubMed

Gültekin, S E; Tokman Yildirim, Benay; Sarisoy, S

2011-01-01

Focal epithelial hyperplasia (FEH), or Heck's disease, is a benign proliferative viral infection of the oral mucosa that is related to Human Papil-lomavirus (HPV), mainly subtypes 13 and 32. Although this condition is known to exist in numerous populations and ethnic groups, the reported cases among Caucasians are relatively rare. It presents as asymptomatic papules or nodules on the oral mucosa, gingiva, tongue, and lips. Histopathologically, it is characterized by parakeratosis, epithelial hyperplasia, focal acanthosis, fusion, and horizontal outgrowth of epithelial ridges and the cells named mitozoids. The purpose of this case report was to present 3 cases of focal epithelial hyperplasia in a pediatric age group. Histopathological and clinical features of cases are discussed and DNA sequencing analysis is reported in which HPV 13, HPV 32, and HPV 11 genomes are detected.

Placental Malaria in Colombia: Histopathologic Findings in Plasmodium vivax and P. falciparum Infections

PubMed Central

Carmona-Fonseca, Jaime; Arango, Eliana; Maestre, Amanda

2013-01-01

Studies on gestational malaria and placental malaria have been scarce in malaria-endemic areas of the Western Hemisphere. To describe the histopathology of placental malaria in Colombia, a longitudinal descriptive study was conducted. In this study, 179 placentas were studied by histologic analysis (112 with gestational malaria and 67 negative for malaria). Placental malaria was confirmed in 22.35%, 50.0% had previous infections, and 47.5% had acute infections. Typical malaria-associated changes were observed in 37%. The most common changes were villitis, intervillitis, deciduitis, increased fibrin deposition, increased syncytial knots, mononuclear (monocytes/macrophages and lymphocytes), polymorphonuclear cell infiltration, and trophozoites in fetal erythrocytes. No association was found between type of placental changes observed and histopathologic classification of placental malaria. The findings are consistent with those reported for placental malaria in other regions. Plasmodium vivax was the main parasite responsible for placental and gestational malaria, but its role in the pathogenesis of placental malaria was not conclusive. PMID:23546807

Histopathological and Digital Morphometrical Evaluation of Uterine Leiomyoma in Brazilian Women

PubMed Central

da Silva, Ana Paula Fernandes; Mello, Luciano de Albuquerque; dos Santos, Erlene Roberta Ribeiro; Paz, Silvania Tavares; Cavalcanti, Carmelita Lima Bezerra; de Melo-Junior, Mario Ribeiro

2016-01-01

The current study aims to evaluate histopathological and digital morphometrical aspects associated with uterine leiomyomas in one hundred and fifty (150) patients diagnosed with leiomyoma. Uterine tissues were subjected to the histopathological and digital morphometric analyses of the interstitial collagen distribution. The analysis of medical records indicates that most of the women diagnosed with uterine leiomyomas (68.7%) are between 37 and 48 years old. As for the anatomic location of the tumors, approximately 61.4% of the patients had intramural and subserosal lesions. In 50% of the studied cases, the patients developed uterine leiomyomatosis (with more than eight tumors). As for the morphometric study, the average size of the interstitial collagen distribution held approximately 28.53% of the capture area, whereas it was of 7.43% in the normal tissue adjacent to the tumor. Another important aspect observed in the current study was the high rate of young women subjected to total hysterectomy, a fact that resulted in early and definitive sterility. PMID:27293441

A histopathological study of bulbar conjunctival flaps occurring in 2 contact lens wearers.

PubMed

Markoulli, Maria; Francis, Ian C; Yong, Jim; Jalbert, Isabelle; Carnt, Nicole; Cole, Nerida; Papas, Eric

2011-09-01

To study the histopathology of paralimbal bulbar conjunctival flaps occurring secondary to soft contact lens wear. Slit-lamp biomicroscopy using sodium fluorescein, cobalt blue light, and a Wratten filter was used to observe the presence, location, and dimensions of bulbar conjunctival flaps presenting in a cohort of contact lens wearers. Two subjects who exhibited such flaps agreed to undergo conjunctival biopsy. Tissue samples, obtained from the region of the flap, and an adjacent unaffected area were processed by standard histopathological methods. In the first subject, analysis of the flap tissue showed even collagen distribution and overall normal histology. The flap of the second subject displayed a mild focal increase in collagen and mild degeneration of collagen, but no increase in elastic tissue. Conjunctival epithelium was normal in both cases. In these 2 subjects, conjunctival flap tissue either was normal or showed only minimal abnormality. There is insufficient evidence for significant pathological change on the time scale of this study.

Punctuated 88% Phenol Peeling for the Treatment of Facial Photoaging: A Clinical and Histopathological Study.

PubMed

de Mendonça, Maria Cristina C; Segheto, Natália N; Aarestrup, Fernando M; Aarestrup, Beatriz J V

2018-02-01

Phenol peeling is considered an important agent in the treatment of facial rejuvenation; however, its use has limitations due to its high potential for side effects. This article proposes a new peeling application technique for the treatment of photoaging, aiming to evaluate, clinically and histopathologically, the efficacy of a new way of applying 88% phenol, using a punctuated pattern. The procedure was performed in an outpatient setting, with female patients, on static wrinkles and high flaccidity areas of the face. Accompanying photographs and skin samples were taken for histopathological analysis before and after treatment. It was shown that 88% phenol applied topically using a punctuated technique is effective in skin rejuvenation. The authors thus suggest, based on this new proposal, that further studies be conducted with a larger group of patients to better elucidate the action mechanisms of 88% phenol. This new form of application considerably reduced patients' withdrawal from their regular activities, besides reducing the cost, compared with the conventional procedure.

Early axonal damage and progressive myelin pathology define the kinetics of CNS histopathology in a mouse model of multiple sclerosis.

PubMed

Recks, Mascha S; Stormanns, Eva R; Bader, Jonas; Arnhold, Stefan; Addicks, Klaus; Kuerten, Stefanie

2013-10-01

Studies of MS histopathology are largely dependent on suitable animal models. While light microscopic analysis gives an overview of tissue pathology, it falls short in evaluating detailed changes in nerve fiber morphology. The ultrastructural data presented here and obtained from studies of myelin oligodendrocyte glycoprotein (MOG):35-55-induced experimental autoimmune encephalomyelitis (EAE) in C57BL/6 mice delineate that axonal damage and myelin pathology follow different kinetics in the disease course. While myelin pathology accumulated with disease progression, axonal damage coincided with the initial clinical disease symptoms and remained stable over time. This pattern applied both to irreversible axolysis and early axonal pathology. Notably, these histopathological patterns were reflected by the normal-appearing white matter (NAWM), suggesting that the NAWM is also in an active neurodegenerative state. The data underline the need for neuroprotection in MS and suggest the MOG model as a highly valuable tool for the assessment of different therapeutic strategies. Copyright © 2013 Elsevier Inc. All rights reserved.

Deep learning as a tool for increased accuracy and efficiency of histopathological diagnosis

NASA Astrophysics Data System (ADS)

Litjens, Geert; Sánchez, Clara I.; Timofeeva, Nadya; Hermsen, Meyke; Nagtegaal, Iris; Kovacs, Iringo; Hulsbergen-van de Kaa, Christina; Bult, Peter; van Ginneken, Bram; van der Laak, Jeroen

2016-05-01

Pathologists face a substantial increase in workload and complexity of histopathologic cancer diagnosis due to the advent of personalized medicine. Therefore, diagnostic protocols have to focus equally on efficiency and accuracy. In this paper we introduce ‘deep learning’ as a technique to improve the objectivity and efficiency of histopathologic slide analysis. Through two examples, prostate cancer identification in biopsy specimens and breast cancer metastasis detection in sentinel lymph nodes, we show the potential of this new methodology to reduce the workload for pathologists, while at the same time increasing objectivity of diagnoses. We found that all slides containing prostate cancer and micro- and macro-metastases of breast cancer could be identified automatically while 30-40% of the slides containing benign and normal tissue could be excluded without the use of any additional immunohistochemical markers or human intervention. We conclude that ‘deep learning’ holds great promise to improve the efficacy of prostate cancer diagnosis and breast cancer staging.

Metastatic iridociliary adenocarcinoma in a labrador retriever.

PubMed

Zarfoss, M K; Dubielzig, R R

2007-09-01

An enucleated left eye from a 15-year-old female spayed Labrador Retriever was received by the Comparative Ocular Pathology Laboratory of Wisconsin (COPLOW) for histopathologic evaluation. Routine histologic preparation included staining with hematoxylin and eosin, and with alcian blue periodic acid-Schiff (PAS). At necropsy 9 months later, all grossly abnormal tissues (ipsilateral orbit and lung) were submitted to the COPLOW for histopathologic evaluation. Histopathologic evaluation of the globe revealed extensive invasion of the uvea and sclera by a pleomorphic cell population that formed disorganized cords and exhibited PAS-positive basement membrane material. Necropsy revealed a morphologically similar tumor in the ipsilateral orbit and lung. On immunohistochemical examination, the intraocular tumor stained diffusely immunopositive for vimentin, S-100, and neuron-specific enolase and multifocally, sparsely immunopositive for cytokeratin AE1/AE3. The orbital and thoracic tumors stained positively for vimentin but negatively for cytokeratin AE1/AE3. There are few reports of canine metastatic iridociliary adenocarcinoma in the literature; this is the first with immunohistochemical analysis.

Impact of novel histopathological factors on the outcomes of liver surgery for colorectal cancer metastases.

PubMed

Serrablo, A; Paliogiannis, P; Pulighe, F; Moro, S Saudi-Moro; Borrego-Estella, V; Attene, F; Scognamillo, F; Hörndler, C

2016-09-01

We evaluated the impacts of a series of novel histopathological factors on clinical-surgical outcomes and survival of patients who underwent surgery for colorectal cancer liver metastasis, with and without neoadjuvant chemotherapy. A prospective database including 150 consecutive patients who underwent 183 hepatic resections for metastatic colorectal cancer was evaluated. Among them, 74 (49.3%) received neoadjuvant chemotherapy before surgery. The histopathological factors studied were: a) microsatellitosis, b) type and pattern of tumour growth, c) nuclear grade and the number of mitoses/mm(2), d) perilesional pseudocapsule, e) intratumoural fibrosis, f) lesion cellularity, g) hypoxic-angiogenic perilesional growth pattern, and h) the tumour normal interface. Three or more metastatic lesions, R1 resection margins, and <50% tumour necrosis were prognostic factors for a worse OS, but only the former was confirmed to be an independent prognostic factor in the multivariate analysis. Furthermore, tumour fibrosis <40% and cellularity >10% were predictive of a worse neoadjuvant therapy response, but these findings were not confirmed in the multivariate analysis. Finally, tumour necrosis <50%, cellularity >10%, and TNI >0.5 mm were prognostic factors for a worse DFS and AS in the univariate but not in the multivariate analysis. Several factors seem to influence the outcomes of surgery for colorectal cancer liver metastasis, especially the number of the lesions, the margins of resection, the percentage of necrosis and fibrosis, as well as the cellularity and the TNI. Copyright © 2016 Elsevier Ltd. All rights reserved.

Development and validation of a protocol for optimizing the use of paraffin blocks in molecular epidemiological studies: The example from the HPV-AHEAD study.

PubMed

Mena, Marisa; Lloveras, Belen; Tous, Sara; Bogers, Johannes; Maffini, Fausto; Gangane, Nitin; Kumar, Rekha Vijay; Somanathan, Thara; Lucas, Eric; Anantharaman, Devasena; Gheit, Tarik; Castellsagué, Xavier; Pawlita, Michael; de Sanjosé, Silvia; Alemany, Laia; Tommasino, Massimo

2017-01-01

Worldwide use of formalin-fixed paraffin-embedded blocks (FFPE) is extensive in diagnosis and research. Yet, there is a lack of optimized/standardized protocols to process the blocks and verify the quality and presence of the targeted tissue. In the context of an international study on head and neck cancer (HNC)-HPV-AHEAD, a standardized protocol for optimizing the use of FFPEs in molecular epidemiology was developed and validated. First, a protocol for sectioning the FFPE was developed to prevent cross-contamination and distributed between participating centers. Before processing blocks, all sectioning centers underwent a quality control to guarantee a satisfactory training process. The first and last sections of the FFPEs were used for histopathological assessment. A consensus histopathology evaluation form was developed by an international panel of pathologists and evaluated for four indicators in a pilot analysis in order to validate it: 1) presence/type of tumor tissue, 2) identification of other tissue components that could affect the molecular diagnosis and 3) quality of the tissue. No HPV DNA was found in sections from empty FFPE generated in any histology laboratories of HPV-AHEAD consortium and all centers passed quality assurance for processing after quality control. The pilot analysis to validate the histopathology form included 355 HNC cases. The form was filled by six pathologists and each case was randomly assigned to two of them. Most samples (86%) were considered satisfactory. Presence of >50% of invasive carcinoma was observed in all sections of 66% of cases. Substantial necrosis (>50%) was present in <2% of samples. The concordance for the indicators targeted to validate the histopathology form was very high (kappa > 0.85) between first and last sections and fair to high between pathologists (kappa/pabak 0.21-0.72). The protocol allowed to correctly process without signs of contamination all FFPE of the study. The histopathology evaluation of the cases assured the presence of the targeted tissue, identified the presence of other tissues that could disturb the molecular diagnosis and allowed the assessment of tissue quality.

[Superficial invasive squamous carcinoma of the vulva].

PubMed

Rosmanich, A; Briones, H; Espinoza, A; Dabancens, A

1994-01-01

We present our experience at University of Chile Clinical Hospital, about superficial scamous vulvar carcinoma, during January, 1967 and april, 1992. We studied eight patients, mean age 57.1 years. Diagnostic was histopathologic in all cases. Three patients were submitted to simple total vulvectomy; other three were treated by total vulvectomy and bilateral inguinal lymphadenectomy (classic form of treatment). The other two cases, were submitted to simple in one case and partial vulvectomy in other, with lymphadenectomy by separate bilateral inguinal incisions. Histopathological study proved in situ scamous carcinoma near invasive focus at 50% of all cases. Follow up was between 2 and 25 years, mean 10.5 years. In one patient, carcinoma in situ relapsed at 2 years and 8 months after treatment, and then, at 8 years after primitive treatment. In other patient, and anal carcinoma was demonstrated 20 years after vulvectomy.

Optic Nerve Assessment Using 7-Tesla Magnetic Resonance Imaging

PubMed Central

Singh, Arun D.; Platt, Sean M.; Lystad, Lisa; Lowe, Mark; Oh, Sehong; Jones, Stephen E.; Alzahrani, Yahya; Plesec, Thomas

2016-01-01

Purpose The purpose of this study was to correlate high-resolution magnetic resonance imaging (MRI) and histologic findings in a case of juxtapapillary choroidal melanoma with clinical evidence of optic nerve invasion. Methods With institutional review board approval, an enucleated globe with choroidal melanoma and optic nerve invasion was imaged using a 7-tesla MRI followed by histopathologic evaluation. Results Optical coherence tomography, B-scan ultrasonography, and 1.5-tesla MRI of the orbit (1-mm sections) could not detect optic disc invasion. Ex vivo, 7-tesla MRI detected optic nerve invasion, which correlated with histopathologic features. Conclusions Our case demonstrates the potential to document the existence of optic nerve invasion in the presence of an intraocular tumor, a feature that has a major bearing on decision making, particularly for consideration of enucleation. PMID:27239461

Absence of histophatological response to cadmium in gill and digestive diverticula of the mussel, Mytilus edulis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giraud, A.S.; Webster, L.K.; Fabris, J.G.

1986-01-01

The blue mussel (Mytilus edulis) has been proposed for use as a sentinel organism to monitor the effects of marine pollution (Goldberg et al., 1978). Recently, there has been interest in quantifying histopathological changes in mussel tissues, as one indicator of pollution-induced stress. Cadmium is a common and toxic aquatic pollutant. Gill and digestive diverticula have been shown to be major sites of cadmium detoxification. In these same tissues, histopathological changes have been demonstrated after exposure to crude oil and to an oil dispersant. However, whether similar morphological changes are induced by heavy metals, such as cadmium, is not known.more » In this study, the authors have assessed the cellular effects of sublethal concentrations of cadmium on the gill and digestive diverticula of Mytilus.« less

Intraindividual Comparison of 18F-PSMA-1007 PET/CT, Multiparametric MRI, and Radical Prostatectomy Specimens in Patients with Primary Prostate Cancer: A Retrospective, Proof-of-Concept Study.

PubMed

Kesch, Claudia; Vinsensia, Maria; Radtke, Jan P; Schlemmer, Heinz P; Heller, Martina; Ellert, Elena; Holland-Letz, Tim; Duensing, Stefan; Grabe, Nils; Afshar-Oromieh, Ali; Wieczorek, Kathrin; Schäfer, Martin; Neels, Oliver C; Cardinale, Jens; Kratochwil, Clemens; Hohenfellner, Markus; Kopka, Klaus; Haberkorn, Uwe; Hadaschik, Boris A; Giesel, Frederik L

2017-11-01

68 Ga-prostate-specific membrane antigen (PSMA)-11 PET/CT represents an advanced method for the staging of primary prostate cancer (PCa) and diagnosis of recurrent or metastatic PCa. However, because of the narrow availability of 68 Ga the development of alternative tracers is of high interest. The objective of this study was to examine the value of the new PET tracer 18 F-PSMA-1007 for the staging of local disease by comparing it with multiparametric MRI (mpMRI) and radical prostatectomy (RP) histopathology. Methods: In 2016, 18 F-PSMA-1007 PET/CT was performed in 10 men with biopsy-confirmed high-risk PCa. Nine patients underwent mpMRI in the process of primary diagnosis. Consecutively, RP was performed in all 10 men. Agreement analysis was performed retrospectively. PSMA staining was added for representative sections in RP specimen slices. Localization and agreement analysis of 18 F-PSMA-1007 PET/CT, mpMRI, and RP specimens was performed by dividing the prostate into 38 sections as described in the prostate imaging reporting and data system (PI-RADS) (version 2). Sensitivity, specificity, positive predictive values, negative predictive values (NPVs), and accuracy were calculated for total and near-total agreement. Results: 18 F-PSMA-1007 PET/CT had an NPV of 68% and an accuracy of 75%, and mpMRI had an NPV of 88% and an accuracy of 73% for total agreement. Near-total agreement analysis resulted in an NPV of 91% and an accuracy of 93% for 18 F-PSMA-1007 PET/CT and 91% and 87% for mpMRI, respectively. Retrospective combination of mpMRI and PET/CT had an accuracy of 81% for total and 93% for near-total agreement. Conclusion: Comparison with RP histopathology demonstrates that 18 F-PSMA-1007 PET/CT is promising for accurate local staging of PCa. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

Neuroprotective effect of ebselen against intracerebroventricular streptozotocin-induced neuronal apoptosis and oxidative stress in rats.

PubMed

Unsal, Cuneyt; Oran, Mustafa; Albayrak, Yakup; Aktas, Cevat; Erboga, Mustafa; Topcu, Birol; Uygur, Ramazan; Tulubas, Feti; Yanartas, Omer; Ates, Ozkan; Ozen, Oguz Aslan

2016-04-01

The goal of this study was to examine the neuroprotective effect of ebselen against intracerebroventricular streptozotocin (ICV-STZ)-induced oxidative stress and neuronal apoptosis in rat brain. A total of 30 adult male Sprague-Dawley rats were randomly divided into 3 groups of 10 animals each: control, ICV-STZ, and ICV-STZ treated with ebselen. The ICV-STZ group rats were injected bilaterally with ICV-STZ (3 mg/kg) on days 1 and 3, and ebselen (10 mg/kg/day) was administered for 14 days starting from 1st day of ICV-STZ injection to day 14. Rats were killed at the end of the study and brain tissues were removed for biochemical and histopathological investigation. Our results demonstrated, for the first time, the neuroprotective effect of ebselen on Alzheimer's disease (AD) model in rats. Our present study, in ICV-STZ group, showed significant increase in tissue malondialdehyde levels and significant decrease in enzymatic antioxidants superoxide dismutase and glutathione peroxidase in the frontal cortex tissue. The histopathological studies in the brain of rats also supported that ebselen markedly reduced the ICV-STZ-induced histopathological changes and well preserved the normal histological architecture of the frontal cortex tissue. The number of apoptotic neurons was increased in frontal cortex tissue after ICV-STZ administration. Treatment of ebselen markedly reduced the number of degenerating apoptotic neurons. The study demonstrates the effectiveness of ebselen, as a powerful antioxidant, in preventing the oxidative damage and morphological changes caused by ICV-STZ in rats. Thus, ebselen may have a therapeutic value for the treatment of AD. © The Author(s) 2013.

Safety and efficacy of a novel Prunus domestica extract (Sitoprin, CR002) on testosterone-induced benign prostatic hyperplasia (BPH) in male Wistar rats.

PubMed

Swaroop, Anand; Bagchi, Manashi; Kumar, Pawan; Preuss, Harry G; Bagchi, Debasis

2015-01-01

The efficacy of a novel Prunus domestica bark extract (Sitoprin, CR002) was investigated on testosterone propionate (TP)-induced benign prostatic hyperplasia (BPH) in male Wistar rats. BPH was induced by daily subcutaneous administration of TP (3.0 mg/kg) over a period of 15 days (interim sacrifice group) and for an additional 21 days (terminal sacrifice group). We evaluated the dose-dependent efficacy (0, 50, 100 and 200 mg/kg body weight/day) of CR002 and a control group against BPH, and compared with a reference standard Prunus africana extract (CR001). Extensive clinical examinations were carried out on days 1, 7, 14, 21, 28 and 35 of treatment period to determine the onset, duration and severity of clinical signs. Clinical pathology, hematology, biochemistry and histopathology were performed on days 15 and 35, prior to necropsy. Animals were fasted overnight prior to blood collection. Prostate glands and tissues were examined. On day 36, histopathology of ventral prostrate of control rats demonstrates single layer of columnar mucin secreting epithelial cells along with a lumen occupied with eosinophilic secretion. In contrast, CR002 and CR001 groups (100 and 200 mg/kg/day) exhibited no hyperplasia and proliferation of epithelial cells. Prostate histopathology of these treated groups was comparable with control rats. The hyperplasia and hypertrophy of prostrate was reduced to single-layered cell indicating the efficacy of CR002 and CR001. Overall, results demonstrate that CR002 exhibits therapeutic efficacy/activity in TP-induced BPH in rats, which is comparable to CR001.

Histiocytoid Sweet's syndrome presenting with annular erythematous plaques*

PubMed Central

Marcarini, Renata; de Araujo, Raquel Nardelli; Nóbrega, Monisa Martins; Medeiros, Karina Bittencourt; Gripp, Alexandre Carlos; Maceira, Juan Manuel Piñeiro

2016-01-01

Histiocytoid Sweet's Syndrome is a rare inflammatory disease described in 2005 as a variant of the classical Sweet's Syndrome (SS). Histopathologically, the dermal inflammatory infiltrate is composed mainly of mononuclear cells that have a histiocytic appearance and represent immature myeloid cells. We describe a case of Histiocytoid Sweet's Syndrome in an 18-year-old man. Although this patient had clinical manifestations compatible with SS, the cutaneous lesions consisted of erythematous annular plaques, which are not typical for this entity and have not been described in histiocytic form so far. The histiocytic subtype was confirmed by histopathological analysis that showed positivity for myeloperoxidase in multiple cells with histiocytic appearance. PMID:28300927

A generic nuclei detection method for histopathological breast images

NASA Astrophysics Data System (ADS)

Kost, Henning; Homeyer, André; Bult, Peter; Balkenhol, Maschenka C. A.; van der Laak, Jeroen A. W. M.; Hahn, Horst K.

2016-03-01

The detection of cell nuclei plays a key role in various histopathological image analysis problems. Considering the high variability of its applications, we propose a novel generic and trainable detection approach. Adaption to specific nuclei detection tasks is done by providing training samples. A trainable deconvolution and classification algorithm is used to generate a probability map indicating the presence of a nucleus. The map is processed by an extended watershed segmentation step to identify the nuclei positions. We have tested our method on data sets with different stains and target nuclear types. We obtained F1-measures between 0.83 and 0.93.

Mitochondrial DNA diagnosis for taeniasis and cysticercosis.

PubMed

Yamasaki, Hiroshi; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Sato, Marcello Otake; Ito, Akira

2006-01-01

Molecular diagnosis for taeniasis and cysticercosis in humans on the basis of mitochondrial DNA analysis was reviewed. Development and application of three different methods, including restriction fragment length polymorphism analysis, base excision sequence scanning thymine-base analysis and multiplex PCR, were described. Moreover, molecular diagnosis of cysticerci found in specimens submitted for histopathology and the molecular detection of taeniasis using copro-DNA were discussed.

High-Throughput Histopathological Image Analysis via Robust Cell Segmentation and Hashing

PubMed Central

Zhang, Xiaofan; Xing, Fuyong; Su, Hai; Yang, Lin; Zhang, Shaoting

2015-01-01

Computer-aided diagnosis of histopathological images usually requires to examine all cells for accurate diagnosis. Traditional computational methods may have efficiency issues when performing cell-level analysis. In this paper, we propose a robust and scalable solution to enable such analysis in a real-time fashion. Specifically, a robust segmentation method is developed to delineate cells accurately using Gaussian-based hierarchical voting and repulsive balloon model. A large-scale image retrieval approach is also designed to examine and classify each cell of a testing image by comparing it with a massive database, e.g., half-million cells extracted from the training dataset. We evaluate this proposed framework on a challenging and important clinical use case, i.e., differentiation of two types of lung cancers (the adenocarcinoma and squamous carcinoma), using thousands of lung microscopic tissue images extracted from hundreds of patients. Our method has achieved promising accuracy and running time by searching among half-million cells. PMID:26599156

Clinicopathological Implications of Human Papilloma Virus (HPV) L1 Capsid Protein Immunoreactivity in HPV16-Positive Cervical Cytology

PubMed Central

Lee, Sung-Jong; Lee, Ah-Won; Kang, Chang-Suk; Park, Jong-Sup; Park, Dong-Choon; Ki, Eun-Young; Lee, Keun-Ho; Yoon, Joo-Hee; Hur, Soo-Young; Kim, Tae-Jung

2014-01-01

Background: The objective of this study was to investigate the expression of human papilloma virus (HPV) L1 capsid protein in abnormal cervical cytology with HPV16 infection and analyze its association with cervical histopathology in Korean women. Material and Methods: We performed immunocytochemistry for HPV L1 in 475 abnormal cervical cytology samples from patients with HPV16 infections using the Cytoactiv® HPV L1 screening set. We investigated the expression of HPV L1 in cervical cytology samples and compared it with the results of histopathological examination of surgical specimens. Results: Of a total of 475 cases, 188 (39.6%) were immunocytochemically positive and 287 (60.4%) negative for HPV L1. The immunocytochemical expression rates of HPV L1 in atypical squamous cells of unknown significance (ASCUS), low-grade squamous intraepithelial lesions (LSIL), high-grade squamous intraepithelial lesions (HSIL), and cancer were 21.8%, 59.7%, 19.1%, and 0.0%, respectively. LSIL exhibited the highest rate of HPV L1 positivity. Of a total of 475 cases, the multiple-type HPV infection rate, including HPV16, in HPV L1-negative cytology samples was 27.5%, which was significantly higher than that in HPV L1-positive cytology samples (p = 0.037). The absence of HPV L1 expression in ASCUS and LSIL was significantly associated with high-grade (≥cervical intraepithelial neoplasia [CIN] 2) than low-grade (≤CIN1) histopathology diagnoses (p < 0.05), but was not significantly different between HPV16 single and multiple-type HPV infections (p > 0.05). On the other hand, among 188 HPV L1-positive cases, 30.6% of multiple-type HPV infections showed high-grade histopathology diagnoses (≥CIN3), significantly higher than the percentage of HPV16 single infections (8.6%) (p = 0.0004) Conclusions: Our study demonstrates that the expression of HPV L1 is low in advanced dysplasia. Furthermore, the absence of HPV L1 in HPV16-positive low-grade cytology (i.e., ASCUS and LSIL) is strongly associated with high-grade histopathology diagnoses. The multiplicity of HPV infections may have an important role in high-grade histopathology diagnoses (≥CIN3) in HPV L1-positive cases. PMID:24396289

Advanced Effect of Moringa oleifera Bioconversion by Rhizopus oligosporus on the Treatment of Atopic Dermatitis: Preliminary Study

PubMed Central

Hur, Sang-sun; Choi, Suk-won; Lee, Dong-ryul; Park, Jong-hwan

2018-01-01

This study was conducted to determine if topical application of Moringa oleifera extracts and its bioconversion product fermented by Rhizopus oligosporus has therapeutic properties enhancement for treatment of atopic dermatitis. Rhizopus oligosporus (KCCM 11232P) was used to ferment Moringa leaves' extracts in this study. Comparison of organic acids and flavonols in Moringa simple extracts and their fermented product by HPLC analysis revealed that concentration of organic acids and flavonols of bioconversion product was lower than that of hot water extracts. The fermentation process is used as a nutrient for isolation of each component by microorganisms and growth of microorganisms. The results demonstrated that MF extracts effectively reduced clinical features based on macrography, scratching count, and severity scores, as well as model's serum IgE level, including histopathological analyses. PMID:29576799

Primary Orbital Chondromyxoid Fibroma: A Rare Case.

PubMed

Mullen, Martin G; Somogyi, Marie; Maxwell, Sean P; Prabhu, Vikram; Yoo, David K

A 56-year-old male with history of chronic sinusitis was found to have a 3 cm left orbital lesion on CT. Subsequent MRI demonstrated a multilobulated enhancing soft tissue lesion at the superotemporal region of the left orbit. Initial biopsy was reported as a low-grade sarcoma. On further evaluation, a consensus was made that the lesion was likely a benign mixed mesenchymal type tumor but should nonetheless be surgically removed. Left lateral orbitotomy was performed which revealed a tumor originating in the lateral orbital bone with segments eroding through the wall of the orbit. Intraoperative frozen sections revealed myoepitheliod tissue with locally aggressive features and the tumor was completely removed. The final histopathologic analysis of the tissue was consistent with a chondromyxoid fibroma. Chondomyxoid fibroma is a rare entity in the orbital bones and is more commonly seen in long bones.

A MULTISTAGE BIOLOGICALLY BASED MATHEMATICAL MODEL FOR MOUSE LIVER TUMORS INDUCED BY DICHLOROACETIC ACID (DCA) - EXPLORATION OF THE MODEL

EPA Science Inventory

A biologically based mathematical model for the induction of liver tumors in mice by dichloroacetic acid (DCA) has been developed from histopathologic analysis of the livers of exposed mice. This analysis suggests that following chronic exposure to DCA, carcinomas can arise dire...

Effects of endocrine disrupting chemicals from leather industry effluents on male reproductive system.

PubMed

Kumar, Vikas; Majumdar, Chandrajeetbalo; Roy, Partha

2008-09-01

The leather tanning industry is characterized by the production of different kinds of effluents, generated in each step of leather processing. These effluents have various chemical compounds which may cause toxicity and endocrine disruption and are thus known as endocrine disrupting chemicals (EDC). This study was aimed to examine the androgenic potential of leather industry effluents collected from northern region of India. Hershberger assay data showed a significant increase (p<0.05) in the weight and structure of sex accessory tissues of castrated rats. Reverse transcriptase polymerase chain reaction (RT-PCR) analysis demonstrated a significant change (p<0.05) in the expression patterns of the major steroidogenic enzymes in adrenal and testes namely, cytochrome P450scc, 3beta-hydroxysteroid dehydrogenase, 17beta-hydroxysteroid dehydorgenase in castrated and intact rats. This was further supported by increased enzymatic activities measured in vitro spectrophotometrically. Serum hormone profile demonstrated a dose dependent increase in testicular and adrenal testosterone productions in intact and castrated rats, respectively. This was further supported by decreased level of gonadotrophic hormones (LH and FSH) in treated groups of animals. Further, the effluent treatment resulted in the development of hyperplasia in seminiferous tubules of testes in treated rats as evident from histopathological studies and about two-fold increases in daily sperm production. On analysis of water samples using GC-MS, it was found to contain various aromatic compounds (nonylphenol, hexaclrobenzene and several azo dyes) some of which independently demonstrated similar effects as shown by water samples. Our data suggests that the effluents from leather industry have potential EDC demonstrating androgenic activities.

Isolated upper eyelid retraction: a sign of idiopathic inflammatory orbital disease.

PubMed

Shome, Debraj; Toshniwal, Svetlana; Jain, Vandana; Natarajan, Sundaram; Vemuganti, Geeta K

2008-01-01

A 41-year-old woman was examined for left upper eyelid retraction. Remaining ocular and systemic examination was unremarkable. Orbital CT demonstrated an ill-defined, extraconal, superior orbital soft-tissue mass involving the levator palpebrae superioris muscle. Incisional biopsy with histopathology demonstrated idiopathic orbital inflammation. The patient was started on a gradually tapering dose of oral steroids, for 6 weeks. On follow-up, the eyelid retraction had resolved. We report this case to demonstrate that idiopathic inflammatory orbital disease, localized to the superior orbit, may cause isolated upper eyelid retraction without associated proptosis. This condition resolves with medical therapy, leading to symmetrical palpebral apertures.

Pancreatic cancer ascites xenograft–an expeditious model mirroring advanced therapeutic resistant disease

PubMed Central

Schvimer, Michael; Atias, Dikla; Halperin, Sharon; Buzhor, Ella; Raitses-Gurevich, Maria; Cohen, Keren; Pri-Chen, Sara; Wilson, Julie; Denroche, Robert E.; Lungu, Ilinca; Bartlett, John M.S.; Mbabaali, Faridah; Yarden, Yosef; Nataraj, Nishanth Belugali; Gallinger, Steven; Berger, Raanan

2017-01-01

Pancreatic ductal adenocarcinoma has limited treatment options. There is an urgent need for developing appropriate pre-clinical models recapitulating metastatic disease, the most common clinical scenario at presentation. Ascites accumulation occurs in up to 20–30% of patients with pancreatic cancer; this milieu represents a highly cellular research resource of metastatic peritoneal spread. In this study, we utilized pancreatic ascites/pleural effusion cancer cells to establish patient derived xenografts. Ascites/pleural effusion-patient derived xenografts were established from twelve independent cases. Xenografts were serially passed in nude mice and tissue bio-specimen banking has been established. Histopathology of emergent tumors demonstrates poorly to moderately differentiated, glandular and mucin producing tumors, mirroring morphology of primary pancreatic cancer tumors. Whole genome sequencing of six patient derived xenografts samples demonstrates common mutations and structural variations similar to those reported in primary pancreatic cancer. Xenograft tumors were dissociated to single-cells and in-vitro drug sensitivity screen assays demonstrated chemo-resistance, correlating with patient clinical scenarios, thus serving as a platform for clinically relevant translational research. Therefore, establishment of this novel ascites/pleural effusion patient derived xenograft model, with extensive histopathology and genomic characterization, opens an opportunity for the study of advanced aggressive pancreatic cancer. Characterization of metastatic disease and mechanisms of resistance to therapeutics may lead to the development of novel drug combinations. PMID:28489577

High Peak Power Microwaves: A Health Hazard

DTIC Science & Technology

1993-12-01

activity and/or neural transmission"I4 1. For example, we I have reported electromagnetically induced effects, such as corneal endothelial lesions...increased permeability of the iris vasculature, altered retinal electrophysiologic activity (visual function), and histopathological changesr. The...level"]. The electromagnetic environment can also alter the drug’s action, as has been demonstrated with the anticholinesterase drug, physostigmineM

42 CFR 493.1219 - Condition: Histopathology.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Histopathology. 493.1219 Section 493....1219 Condition: Histopathology. If the laboratory provides services in the subspecialty of Histopathology, the laboratory must meet the requirements specified in §§ 493.1230 through 493.1256, § 493.1273...

42 CFR 493.1219 - Condition: Histopathology.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 5 2011-10-01 2011-10-01 false Condition: Histopathology. 493.1219 Section 493....1219 Condition: Histopathology. If the laboratory provides services in the subspecialty of Histopathology, the laboratory must meet the requirements specified in §§ 493.1230 through 493.1256, § 493.1273...

Cerebral Toxoplasmosis Masquerading Cns Lymphoma on FDG PET-CT in Post Renal Transplant Patient

PubMed Central

Mukherjee, Anirban; Bal, Chandrasekhar; Tripathi, Madhavi; Das, Chandan Jyoti; Shamim, Shamim Ahmed

2017-01-01

20 year old post renal transplant patient developed recurrent episodes of seizure. MRI revealed focal lesion in right parieto-occipital lobe with perilesional edema. FDG PET-CT revealed multiple hypermetabolic lesions in bilateral cerebral hemisphere. Subsequent biopsy from the lesion demonstrated bradyzoites of Toxoplasma gondii with inflammatory cells and thereby, a confirmatory diagnosis of cerebral toxoplasmosis was made. This case demonstrates the fact that increased FDG uptake in cerebral lesions in post transplant patient should be interpreted with caution and confirmed with histopathological correlation. PMID:28533649

Sensitivity and specificity for detecting basal cell carcinomas in Mohs excisions with confocal fluorescence mosaicing microscopy

NASA Astrophysics Data System (ADS)

Gareau, Daniel S.; Karen, Julie K.; Dusza, Stephen W.; Tudisco, Marie; Nehal, Kishwer S.; Rajadhyaksha, Milind

2009-05-01

Recent studies have demonstrated the ability of confocal fluorescence mosaicing microscopy to rapidly detect basal cell carcinomas (BCCs) directly in thick and fresh Mohs surgical excisions. Mosaics of confocal images display large areas of tissue with high resolution and magnification equivalent to 2×, which is the standard magnification when examining pathology. Comparison of mosaics to Mohs frozen histopathology was shown to be excellent for all types of BCCs. However, comparisons in the previous studies were visual and qualitative. In this work, we report the results of a semiquantitative preclinical study in which 45 confocal mosaics are blindly evaluated for the presence (or absence) of BCC tumor. The evaluations are made by two clinicians: a senior Mohs surgeon with prior expertise in interpreting confocal images, and a novice Mohs fellow with limited experience. The blinded evaluation is compared to the gold standard of frozen histopathology. BCCs are detected with an overall sensitivity of 96.6%, specificity of 89.2%, positive predictive value of 93.0%, and negative predictive value of 94.7%. The results demonstrate the potential clinical utility of confocal mosaicing microscopy toward rapid surgical pathology at the bedside to expedite and guide surgery.

Coagulation necrosis induced by radiofrequency ablation in the liver: histopathologic and radiologic review of usual to extremely rare changes.

PubMed

Kim, Young-sun; Rhim, Hyunchul; Lim, Hyo Keun; Choi, Dongil; Lee, Min Woo; Park, Min Jung

2011-01-01

As the clinical role of radiofrequency ablation (RFA) of the liver grows, the importance of radiologic imaging after liver RFA to depict the diversity of post-RFA manifestations is also increasing. Because RFA induces coagulation necrosis of the hepatic parenchyma, cross-sectional imaging studies, in principle, demonstrate an area with a defect in contrast enhancement. However, for various reasons, such as the occurrence of a complication, the RFA zone may demonstrate different patterns or be accompanied by other abnormalities. In this investigation, a large number of imaging studies performed after more than 4000 procedures of liver RFA during the past 10-year period were reviewed, and various radiologic manifestations of the RFA zone were compiled. Herein, the basic principles of RFA, as well as the histopathologic features of coagulation necrosis of the liver, are catalogued to provide a more complete understanding of such changes. Through this review, the reader will become more familiar with the usual and unusual radiologic findings of coagulation necrosis induced by RFA in the liver. This increased familiarity will not only facilitate the daily practice of radiology but also deepen understanding of the therapeutic modality of RFA. © RSNA, 2011.

Species differences in developmental toxicity of epoxiconazole and its relevance to humans.

PubMed

Schneider, Steffen; Hofmann, Thomas; Stinchcombe, Stefan; Moreno, Maria Cecilia Rey; Fegert, Ivana; Strauss, Volker; Gröters, Sibylle; Fabian, Eric; Thiaener, Jutta; Fussell, Karma C; van Ravenzwaay, Bennard

2013-06-01

Epoxiconazole, a triazole-based fungicide, was tested in toxicokinetic, prenatal and pre-postnatal toxicity studies in guinea pigs, following oral (gavage) administration at several dose levels (high dose: 90 mg/kg body weight per day). Maternal toxicity was evidenced by slightly increased abortion rates and by histopathological changes in adrenal glands, suggesting maternal stress. No compound-related increase in the incidence of malformations or variations was observed in the prenatal study. In the pre-postnatal study, epoxiconazole did not adversely affect gestation length, parturition, or postnatal growth and development. Administration of epoxiconazole did not alter circulating estradiol levels. Histopathological examination of the placentas did not reveal compound-related effects. The results in guinea pigs are strikingly different to those observed in pregnant rats, in which maternal estrogen depletion, pathological alteration of placentas, increased gestation length, late fetal death, and dystocia were observed after administration of epoxiconazole. In the studies reported here, analysis of maternal plasma concentrations and metabolism after administration of radiolabeled epoxiconazole demonstrated that the different results in rats and guinea pigs were not due to different exposures of the animals. A comprehensive comparison of hormonal regulation of pregnancy and birth in murid rodents and primates indicates that the effects on pregnancy and parturition observed in rats are not applicable to humans. In contrast, the pregnant guinea pig shares many similarities to pregnant humans regarding hormonal regulation and is therefore considered to be a suitable species for extrapolation of related effects to humans. © 2013 Wiley Periodicals, Inc.

Variable importance in nonlinear kernels (VINK): classification of digitized histopathology.

PubMed

Ginsburg, Shoshana; Ali, Sahirzeeshan; Lee, George; Basavanhally, Ajay; Madabhushi, Anant

2013-01-01

Quantitative histomorphometry is the process of modeling appearance of disease morphology on digitized histopathology images via image-based features (e.g., texture, graphs). Due to the curse of dimensionality, building classifiers with large numbers of features requires feature selection (which may require a large training set) or dimensionality reduction (DR). DR methods map the original high-dimensional features in terms of eigenvectors and eigenvalues, which limits the potential for feature transparency or interpretability. Although methods exist for variable selection and ranking on embeddings obtained via linear DR schemes (e.g., principal components analysis (PCA)), similar methods do not yet exist for nonlinear DR (NLDR) methods. In this work we present a simple yet elegant method for approximating the mapping between the data in the original feature space and the transformed data in the kernel PCA (KPCA) embedding space; this mapping provides the basis for quantification of variable importance in nonlinear kernels (VINK). We show how VINK can be implemented in conjunction with the popular Isomap and Laplacian eigenmap algorithms. VINK is evaluated in the contexts of three different problems in digital pathology: (1) predicting five year PSA failure following radical prostatectomy, (2) predicting Oncotype DX recurrence risk scores for ER+ breast cancers, and (3) distinguishing good and poor outcome p16+ oropharyngeal tumors. We demonstrate that subsets of features identified by VINK provide similar or better classification or regression performance compared to the original high dimensional feature sets.

Protective effect of IGF-1 on experimental liver cirrhosis-induced common bile duct ligation.

PubMed

Cantürk, Nuh Zafer; Cantürk, Zeynep; Ozden, Meltem; Dalçik, Hakki; Yardimoglu, Melda; Tülübas, Feti

2003-01-01

The causes of malnutrition in liver cirrhosis are multifactorial. Levels of IGF-1 (insulin like growth factor-1) that is a crucial regulator of intermediary metabolism decreases. The aim of this study was to analyze the effect of IGF-1 supplementation during liver cirrhosis induced by common bile duct ligation. Rats were divided into five different groups: One sham and four experimental groups. Rats in three of four groups were treated with 2 micrograms/day IGF-1 with a different time of experiment in each group. Blood biochemical parameters, tissue malondialdehyde, glutathione levels and the activity of tissue antioxidant enzymes and conventional and immunohistochemical analysis of liver samples were studied for each group. Serum albumin, total protein, fibrinogen levels decreased and prothrombin time was prolonged in the bile duct ligated and transected experimental group but not in the IGF-I treated rats compared with the rats in sham group. Liver malondialdehyde levels significantly increased in control group but not in IGF-1 treated groups. The activities of antioxidant enzymes were decreased compared with the other groups. Histopathology findings of liver biopsy demonstrated intense degree fibrosis and overexpression of fibroblast growth factor and desmin in the control group but a lesser degree of those in the IGF-1 treated groups. IGF-1 treatment improves liver function and decreases oxidative liver damage and histopathological findings. Further studies are required to delineate the mechanisms of protective effects of IGF-1.

Predictors of seizure freedom after surgery for malformations of cortical development.

PubMed

Chang, Edward F; Wang, Doris D; Barkovich, A James; Tihan, Tarik; Auguste, Kurtis I; Sullivan, Joseph E; Garcia, Paul A; Barbaro, Nicholas M

2011-07-01

Malformations of cortical development (MCDs) are a major cause of medically refractory epilepsy. Our aim was to examine a surgical series of patients with cortical malformations to determine the prognostic factors associated with long-term seizure control. We conducted a retrospective review of 143 patients with MCD who underwent resective surgery for medically refractory epilepsy. Demographic, imaging, histopathologic, and surgical variables were analyzed for potential association with seizure freedom. Preoperative magnetic resonance imaging (MRI) was evaluated in a blind fashion and classified according to a new imaging/embryologic MCD classification system. Gray-white blurring on MRI, smaller lesions, complete resection of structural lesions, complete resection of abnormal electrocorticographic areas, and locally confined electrocorticographic abnormalities are favorable prognosticators of seizure freedom on univariate analysis. Imaging features consistent with abnormal proliferation (Barkovich class I) were associated with better outcome compared to those related to abnormal neuronal migration (class II) or abnormal cortical organization (class III). Multivariate logistic regression revealed complete resection of tissue manifesting electrocorticographic and/or MRI anatomic abnormalities as the main independent predictor of seizure freedom. Other histopathologic or demographic factors were not associated with seizure control. Long-term follow-up of patients demonstrated sustained overall rates of seizure control (72% at 2 years, 65% at 5 years, and 67% at 10 years). Surgery for MCDs can result in high rates of seizure freedom. Complete resection of electrocorticographic and anatomic abnormalities appears to be most predictive of long-term seizure control. Copyright © 2011 American Neurological Association.

A cellular spinal cord scaffold seeded with rat adipose-derived stem cells facilitates functional recovery via enhancing axon regeneration in spinal cord injured rats

PubMed Central

Yin, Hong; Jiang, Tao; Deng, Xi; Yu, Miao; Xing, Hui; Ren, Xianjun

2018-01-01

Spinal cord injury (SCI), usually resulting in severe sensory and motor deficits, is a major public health concern. Adipose-derived stem cells (ADSCs), one type of adult stem cell, are free from ethical restriction, easily isolated and enriched. Therefore, ADSCs may provide a feasible cell source for cell-based therapies in treatment of SCI. The present study successfully isolated rat ADSCs (rADSCs) from Sprague-Dawley male rats and co-cultured them with acellular spinal cord scaffolds (ASCs). Then, a rat spinal cord hemisection model was built and rats were randomly divided into 3 groups: SCI only, ASC only, and ASC + ADSCs. Furthermore, behavioral tests were conducted to evaluate functional recovery. Hematoxylin & Eosin staining and immunofluorence were carried out to assess histopathological remodeling. In addition, biotinylated dextran amines anterograde tracing was employed to visualize axon regeneration. The data demonstrated that harvested cells, which were positive for cell surface antigen cluster of differentiation (CD) 29, CD44 and CD90 and negative for CD4, detected by flow cytometry analysis, held the potential to differentiate into osteocytes and adipocytes. Rats that received transplantation of ASCs seeded with rADSCs benefited greatly in functional recovery through facilitation of histopathological rehabilitation, axon regeneration and reduction of reactive gliosis. rADSCs co-cultured with ASCs may survive and integrate into the host spinal cord on day 14 post-SCI. PMID:29257299

Oral proliferative verrucous leucoplakia: are there particular features for such an ambiguous entity? A systematic review.

PubMed

Pentenero, M; Meleti, M; Vescovi, P; Gandolfo, S

2014-05-01

Proliferative verrucous leucoplakia (PVL) is a distinct, particularly aggressive form of oral leucoplakia. Given the low prevalence of PVL, data are sparse and are mostly from case reports, case series and only a few case-control studies, meaning that the literature is able to provide only weak evidence. The present systematic literature review aims to collate the available evidence on the following issues: patient demographics, aetiology, lesion location(s), malignant potential, location and histopathological features of transformed lesions, disease-specific survival rates and treatment response. Electronic databases were searched for studies in the English language reporting original data from at least 10 patients with PVL on the target issues of the present review. The retrieved data were merged and a descriptive analysis performed. The 20 studies selected indicated that PVL does not seem to be correlated with the major risk factors for oral carcinoma (tobacco, alcohol and/or areca nut/betel leaf chewing). The disorder affects mainly adult/elderly women and has a very high malignant transformation rate, particular site distribution and particular location and histopathological features of transformed lesions. The present results may be limited by some articles being unintentionally excluded as they were not found during the electronic search, a lack of worldwide accepted diagnostic criteria for PVL, and overlapping data from multiple studies performed in a limited number of centres. Despite these potential drawbacks, the present results demonstrate that PVL does have particular features. © 2014 British Association of Dermatologists.

Indium Lung Disease

PubMed Central

Nakano, Makiko; Omae, Kazuyuki; Takeuchi, Koichiro; Chonan, Tatsuya; Xiao, Yong-long; Harley, Russell A.; Roggli, Victor L.; Hebisawa, Akira; Tallaksen, Robert J.; Trapnell, Bruce C.; Day, Gregory A.; Saito, Rena; Stanton, Marcia L.; Suarthana, Eva; Kreiss, Kathleen

2012-01-01

Background: Reports of pulmonary fibrosis, emphysema, and, more recently, pulmonary alveolar proteinosis (PAP) in indium workers suggested that workplace exposure to indium compounds caused several different lung diseases. Methods: To better understand the pathogenesis and natural history of indium lung disease, a detailed, systematic, multidisciplinary analysis of clinical, histopathologic, radiologic, and epidemiologic data for all reported cases and workplaces was undertaken. Results: Ten men (median age, 35 years) who produced, used, or reclaimed indium compounds were diagnosed with interstitial lung disease 4-13 years after first exposure (n = 7) or PAP 1-2 years after first exposure (n = 3). Common pulmonary histopathologic features in these patients included intraalveolar exudate typical of alveolar proteinosis (n = 9), cholesterol clefts and granulomas (n = 10), and fibrosis (n = 9). Two patients with interstitial lung disease had pneumothoraces. Lung disease progressed following cessation of exposure in most patients and was fatal in two. Radiographic data revealed that two patients with PAP subsequently developed fibrosis and one also developed emphysematous changes. Epidemiologic investigations demonstrated the potential for exposure to respirable particles and an excess of lung abnormalities among coworkers. Conclusions: Occupational exposure to indium compounds was associated with PAP, cholesterol ester crystals and granulomas, pulmonary fibrosis, emphysema, and pneumothoraces. The available evidence suggests exposure to indium compounds causes a novel lung disease that may begin with PAP and progress to include fibrosis and emphysema, and, in some cases, premature death. Prospective studies are needed to better define the natural history and prognosis of this emerging lung disease and identify effective prevention strategies. PMID:22207675

Histopathologic Findings in Autopsies with Emphasis on Interesting and Incidental Findings-A Pathologist's Perspective.

PubMed

Patel, Sapna; Rajalakshmi, B R; Manjunath, G V

2016-11-01

Autopsy aids to the knowledge of pathology by unveiling the rare lesions which are a source of learning from a pathologist's perspective Some of them are only diagnosed at autopsy as they do not cause any functional derangement. This study emphasizes the various incidental lesions which otherwise would have been unnoticed during a person's life. The aim of this study was to determine the spectrum of histopathological findings including neoplastic lesions related or unrelated to the cause of death. It was also aimed to highlight various incidental and interesting lesions in autopsies. A retrospective study of medicolegal autopsies for six years was undertaken in a tertiary care centre to determine the spectrum of histopathological findings including neoplastic lesions related or unrelated to the cause of death and to highlight various incidental and interesting lesions in autopsies. Statistical Analysis: Individual lesions were described in numbers and incidence in percentage. The study consisted of a series of 269 autopsy cases and histopathological findings were studied only in 202 cases. The commonest cause of death was pulmonary oedema. The most common incidental histopathological finding noted was atherosclerosis in 55 (27.2%) cases followed by fatty liver in 40 (19.8%) cases. Neoplastic lesions accounted for 2.47% of cases. This study has contributed a handful of findings to the pool of rare lesions in pathology. Some of these lesions encountered which served as feast to a pathologist are tumour to tumour metastasis, a case with coexistent triple lesions, Dubin Johnson syndrome, von Meyenburg complex, Multilocular Cystic Renal Cell Carcinoma (MCRCC), Autosomal Dominant Polycystic Kidney Disease (ADPKD), liver carcinod and an undiagnosed vaso-occlusive sickle cell crisis. Autopsy studies help in the detection of unexpected findings significant enough to have changed patient management had they been recognized before death.

In vivo features of melanocytic lesions: multimode hyperspectral dermoscopy, reflectance confocal microscopy, and histopathologic correlates (Conference Presentation)

NASA Astrophysics Data System (ADS)

Vasefi, Fartash; MacKinnon, Nicholas B.; Jain, Manu; Cordova, Miguel A.; Kose, Kivanc; Rajadhyaksha, Milind; Halpern, Allan C.; Farkas, Daniel L.

2017-02-01

Motivation and background: Melanoma, the fastest growing cancer worldwide, kills more than one person every hour in the United States. Determining the depth and distribution of dermal melanin and hemoglobin adds physio-morphologic information to the current diagnostic standard, cellular morphology, to further develop noninvasive methods to discriminate between melanoma and benign skin conditions. Purpose: To compare the performance of a multimode dermoscopy system (SkinSpect), which is designed to quantify and map in three dimensions, in vivo melanin and hemoglobin in skin, and to validate this with histopathology and three dimensional reflectance confocal microscopy (RCM) imaging. Methods: Sequentially capture SkinSpect and RCM images of suspect lesions and nearby normal skin and compare this with histopathology reports, RCM imaging allows noninvasive observation of nuclear, cellular and structural detail in 1-5 μm-thin optical sections in skin, and detection of pigmented skin lesions with sensitivity of 90-95% and specificity of 70-80%. The multimode imaging dermoscope combines polarization (cross and parallel), autofluorescence and hyperspectral imaging to noninvasively map the distribution of melanin, collagen and hemoglobin oxygenation in pigmented skin lesions. Results: We compared in vivo features of ten melanocytic lesions extracted by SkinSpect and RCM imaging, and correlated them to histopathologic results. We present results of two melanoma cases (in situ and invasive), and compare with in vivo features from eight benign lesions. Melanin distribution at different depths and hemodynamics, including abnormal vascularity, detected by both SkinSpect and RCM will be discussed. Conclusion: Diagnostic features such as dermal melanin and hemoglobin concentration provided in SkinSpect skin analysis for melanoma and normal pigmented lesions can be compared and validated using results from RCM and histopathology.

Assessing adverse effects of intra-articular botulinum toxin A in healthy Beagle dogs: A placebo-controlled, blinded, randomized trial

PubMed Central

Jokinen, Tarja S.; Syrjä, Pernilla; Junnila, Jouni; Hielm-Björkman, Anna; Laitinen-Vapaavuori, Outi

2018-01-01

Objective To investigate the clinical, cytological, and histopathological adverse effects of intra-articularly injected botulinum toxin A in dogs and to study whether the toxin spreads from the joint after the injection. Methods A longitudinal, placebo-controlled, randomized clinical trial was conducted with six healthy laboratory Beagle dogs. Stifle joints were randomized to receive either 30 IU of onabotulinum toxin A or placebo in a 1:1 ratio. Adverse effects and spread of the toxin were examined by evaluating dynamic and static weight-bearing of the injected limbs, by assessing painless range of motion and pain on palpation of joints, and by performing synovial fluid analysis, neurological examination, and electrophysiological recordings at different examination time-points in a 12-week period after the injections. The dogs were then euthanized and autopsy and histopathological examination of joint structures and adjacent muscles and nerves were performed. Results Intra-articular botulinum toxin A did not cause local weakness or injection site pain. Instead, static weight-bearing and painless range of motion of stifle joints decreased in the placebo limbs. No clinically significant abnormalities associated with intra-articular botulinum toxin A were detected in the neurological examinations. Electrophysiological recordings showed low compound muscle action potentials in two dogs in the botulinum toxin A-injected limb. No significant changes were detected in the synovial fluid. Autopsy and histopathological examination of the joint and adjacent muscles and nerves did not reveal histopathological adverse effects of the toxin. Conclusion Intra-articular botulinum toxin A does not produce significant clinical, cytological, or histopathological adverse effects in healthy dogs. Based on the electrophysiological recordings, the toxin may spread from the joint, but its clinical impact seems to be low. PMID:29320549

The Protective Effect of Curcumin on a Spinal Cord Ischemia-Reperfusion Injury Model.

PubMed

Akar, İlker; İnce, İlker; Arici, Akgül; Benli, İsmail; Aslan, Cemal; Şenol, Sefa; Demir, Osman; Altunkas, Fatih; Altındeger, Nuray; Akbas, Ali

2017-07-01

The purpose of this study is to investigate the neurological, biochemical, and histopathologic effects of both the acute and maintenance treatment of curcumin on an experimental spinal cord ischemia-reperfusion injury model in rats. The animals were randomly divided into 4 groups: (1) Sham, (2) ischemia-reperfusion (IR), (3) curcumin, and (4) solvent. Spinal cord ischemia was induced by clamping the aorta with minivascular clamps at a position just below the left renal artery and just proximal to the aortic bifurcation for 45 min. After 72 hr of reperfusion, neurological function was evaluated with a modified Tarlov score. In spinal cords, malondialdehyde (MDA), superoxide dismutase (SOD), glutathione peroxidase (GPx), and nitric oxide (NO) levels were detected biochemically. Immunohistochemical staining was performed by antibodies against interleukin-6 (IL-6) and myeloperoxidase. Histopathologic changes were examined with hematoxylin and eosin staining. Although MDA tissue levels were elevated significantly in the IR group compared with the sham group, SOD and GPx levels decreased. After the administration of curcumin, MDA levels in the spinal cord decreased, and SOD and GPx levels increased. Those changes were statistically significant. There was no significance at NO levels. Among all groups, there was no difference in IL-6 and myeloperoxidase immunostaining. Histopathological analysis showed that histopathological changes in the IR group were improved by curcumin treatment. In the curcumin group, neurological outcome scores were significantly better statistically when compared with the IR group. We believe that curcumin possesses antioxidant, antiproliferative, and anticarcinogenic properties and may be an effective drug for the prevention of spinal cord IR injury in light of the neurologic, biochemical, and histopathological data of this study and published scientific literature. Copyright © 2017 Elsevier Inc. All rights reserved.

Duodenal histopathology and laboratory deficiencies related to bone metabolism in coeliac disease.

PubMed

Posthumus, Lotte; Al-Toma, Abdul

2017-08-01

Coeliac disease (CD) is a chronic immune-mediated small intestine enteropathy precipitated by gluten in genetically predisposed individuals. Adult presentation is often atypical and malabsorption of vitamins and minerals is common, with a consequent disturbance of bone metabolism. We aim to evaluate laboratory deficiencies related to bone metabolism and the relationship between severity of histological damage and degree of bone mass loss at diagnosis of CD. A retrospective cross-sectional study of 176 adult coeliac patients was carried out. All patients fulfilled the histopathological criteria for CD. Biochemical data were analysed (calcium/phosphate/alkaline-phosphatase/vitamin D/parathormone). Duodenal histology was classified according to the Marsh classification. Bone mass density (BMD) at the lumbar and femoral regions measured by dual X-ray absorptiometry. A P-value of less than 0.05 was considered significant. No correlation was found between the presence of gastrointestinal symptoms and the Marsh histopathological stage (P>0.05). Vitamin D deficiency was most common (44.5%), whereas only 5.7% had hypocalcaemia. Calcium was lower (P<0.05) and parathormone was higher (P=0.01) in patients with Marsh III. These patients had lower lumbar T-score (P<0.05). Although low BMD occurred in all age groups, most osteoporotic patients were aged 45-49 years (81.8%). A multiple regression analysis showed that the Marsh histopathological stage could be a predictor of lower lumbar BMD (r=0.322, B=-1.146, P<0.05). Laboratory deficiencies and decreased BMD could be severe and unrelated to the presence of gastrointestinal symptoms. At diagnosis, the Marsh histopathological stage could predict the occurrence of low BMD, which carries a risk of developing into osteoporosis. In coeliac patients older than 30 years, evaluation of bone biomarkers and dual X-ray absorptiometry examination should be considered.

Assessing adverse effects of intra-articular botulinum toxin A in healthy Beagle dogs: A placebo-controlled, blinded, randomized trial.

PubMed

Heikkilä, Helka M; Jokinen, Tarja S; Syrjä, Pernilla; Junnila, Jouni; Hielm-Björkman, Anna; Laitinen-Vapaavuori, Outi

2018-01-01

To investigate the clinical, cytological, and histopathological adverse effects of intra-articularly injected botulinum toxin A in dogs and to study whether the toxin spreads from the joint after the injection. A longitudinal, placebo-controlled, randomized clinical trial was conducted with six healthy laboratory Beagle dogs. Stifle joints were randomized to receive either 30 IU of onabotulinum toxin A or placebo in a 1:1 ratio. Adverse effects and spread of the toxin were examined by evaluating dynamic and static weight-bearing of the injected limbs, by assessing painless range of motion and pain on palpation of joints, and by performing synovial fluid analysis, neurological examination, and electrophysiological recordings at different examination time-points in a 12-week period after the injections. The dogs were then euthanized and autopsy and histopathological examination of joint structures and adjacent muscles and nerves were performed. Intra-articular botulinum toxin A did not cause local weakness or injection site pain. Instead, static weight-bearing and painless range of motion of stifle joints decreased in the placebo limbs. No clinically significant abnormalities associated with intra-articular botulinum toxin A were detected in the neurological examinations. Electrophysiological recordings showed low compound muscle action potentials in two dogs in the botulinum toxin A-injected limb. No significant changes were detected in the synovial fluid. Autopsy and histopathological examination of the joint and adjacent muscles and nerves did not reveal histopathological adverse effects of the toxin. Intra-articular botulinum toxin A does not produce significant clinical, cytological, or histopathological adverse effects in healthy dogs. Based on the electrophysiological recordings, the toxin may spread from the joint, but its clinical impact seems to be low.

Evaluation of contralateral kidney, liver and lung after extracorporeal shock wave lithotripsy in rabbits.

PubMed

Senyucel, M F; Boybeyi, O; Ayva, S; Aslan, M K; Soyer, T; Demet, A I; Kısa, U; Basar, M; Cakmak, M A

2013-10-01

An experimental study was carried out to evaluate the effects of extracorporeal shock wave lithotripsy (ESWL) on contralateral kidney, liver and lung by histopathological and biochemical methods. Twelve New Zealand rabbits were allocated to two groups (n = 6). Tissues of control group (CG, n = 6) were harvested without any intervention. In ESWL group (EG), right kidneys were exposed to 3,000 shock waves at 14 kV energy using electro-hydraulic type ESWL device three times every other day. Both kidneys, liver, and right lobe of lung tissues in EG were harvested on seventh day. Kidneys were examined histopathologically for presence of glomerular and tubular injury, interstitial edema, congestion, inflammation and fibrosis. Livers were examined for hepatocyte vacuolization, congestion, portal inflammation and fibrosis. Lung tissues were examined for loss of normal structure, emphysema, interstitial congestion-edema, prominent alveolar septal vessels, interstitial inflammation, intra-alveolar hemorrhage, intraluminal hemorrhage, peribronchial edema, congestion, inflammation in bronchial wall and epithelial desquamation. Biochemical analysis of tissue samples was performed for oxidative injury markers. Histopathological evaluations revealed that tubular injury was found in both shocked and contralateral kidneys (p < 0.05). EG showed higher grades of portal fibrosis in liver and higher grades of peribronchial congestion in lung when compared to CG (p < 0.05). Biochemical evaluations of both kidneys showed that malondialdehyde levels were higher in EG than in CG (p < 0.05). ESWL causes histopathologic alterations both in shocked and contralateral kidneys. Extrarenal tissues such as liver and lung can be affected by shock waves histopathologically and oxidative injury of contralateral kidney may occur acutely after ESWL.

Aberrant Wound-Healing Response in Mitomycin C-Treated Leaking Blebs: A Histopathologic Study

PubMed Central

Elner, Victor M.; Newman-Casey, Paula Anne; Patil, A. Jayaprakash; Flint, Andrew; Biswas, Jyotirmay; Moroi, Sayoko E.; Pushparaj, Vaijayanthi; Edward, Deepak P.

2014-01-01

Objective To characterize histopathologic features of leaking mitomycin-C-treated blebs and aberrant wound healing that may lead to persistent conjunctival thinning and leakage. Methods Forty mitomycin C-treated filtering blebs excised for persistent leaks from 40 patients were examined histopathologically using hematoxylin-eosin, periodic acid-Schiff, Masson trichrome, and Alcian blue histochemical stains. Results Ninety percent of the leaking blebs contained epithelial-stromal domes with areas of acellular stroma covered by attenuated epithelium. Seventy-five percent of the blebs demonstrated varying degrees of fibrovascular repair growing from the bleb margin, either beneath or interdigitating with the acellular zone. A novel observation in 65% of specimens was Alcian blue-positive myxoid stroma at the interface between the fibrovascular proliferation and the epithelial-stromal dome. The association between the presence of fibrovascular proliferation and Alcian-blue staining myxoid stroma was significant by Fisher exact test (P=0.002). Conclusions A desirable filtration bleb requires a sufficient reparative fibrovascular response to maintain an epithelial-stromal barrier in order to prevent leakage. Fibroblasts must lay down a continuous collagen-rich fibrous layer, rather than merely myxoid stroma, beneath the conjunctival epithelium to promote bleb stability. Surgical techniques and postsurgical care should aim to attain this desired outcome. PMID:19667341

3D chick embryo chorioallantoic membrane model as an in vivo model to study morphological and histopathological features of feline fibrosarcomas.

PubMed

Zabielska-Koczywąs, Katarzyna; Wojtkowska, Agata; Dolka, Izabella; Małek, Anna; Walewska, Magdalena; Wojtalewicz, Anna; Żbikowski, Artur; Lechowski, Roman

2017-06-26

The chick embryo chorioallantoic membrane (CAM) model is well described in human medicine as a cost-effective, easy to perform preclinical oncological model for observing pro- and antiangiogenic response, tumor biology and metastasis. The main objective of this article was to present the modification of the CAM assay in order to evaluate tumor growth from two feline fibrosarcoma cell lines (FFS1, FFS3) and describe their morphological and histopathological features. The authors described morphological and histopathological features of two feline fibrosarcoma cell lines (FFS1 and FFS3) grown on the CAM. Tumors from the FFS1 cell line showed high malignancy (grade III), while tumors from the FFS3 cell line were grade II. Proliferation markers (Ki-67 and PCNA) were determined and the positive correlation between PCNA and tumor grade (r = 0.8247; p < 0.001) was demonstrated, as opposed to Ki-67. The results obtained indicate that PCNA may be helpful to evaluate the tumor grade, better than Ki-67, for feline fibrosarcomas. However, further investigations of proliferation marker, in bigger number of feline spontaneous fibrosarcomas and feline fibrosarcomas grown on the CAM from different cell lines, are needed to confirm these observations.

Eczematous Dermatitis Occurring on a Café-au-Lait Spot Long after Laser Radiation.

PubMed

Mihara, Motoyuki

2013-05-01

A 40-year-old woman presented with an itchy erythematosquamous change of a café-au-lait spot in her face. The onset of this change occurred just after her relocation. The café-au-lait spot had been irradiated by laser approximately 20 years ago. Clinically, there was a coin-sized erythema with a slight scale on the pigmented lesion in the left lateral orbital region. Histopathologically, the lesion demonstrated both spongiotic dermatitis and interface dermatitis together with lymphohistiocytic cell infiltration, in addition to moderate acanthosis and elongation of rete ridges with slight basal hyperpigmentation. From these clinical and histopathological findings, the lesion was diagnosed as eczematous dermatitis occurring on the café-au-lait spot after laser radiation. Another interesting histopathological finding was that some parts of a lobule of the sebaceous gland were occupied exclusively by degenerative atrophic sebocytes. From the viewpoint of pathogenesis, the eczematous dermatitis of this patient could have been an accompanying feature of a neurogenic inflammation occurring on the café-au-lait spot after laser radiation, and the atrophic change of a part of the sebaceous lobule might have been induced by a morphogenetic alteration of certain germinative cells of the sebaceous lobule due to laser radiation.

Comparison of Allogeneic and Syngeneic Rat Glioma Models by Using MRI and Histopathologic Evaluation

PubMed Central

Biasibetti, Elena; Valazza, Alberto; Capucchio, Maria T; Annovazzi, Laura; Battaglia, Luigi; Chirio, Daniela; Gallarate, Marina; Mellai, Marta; Muntoni, Elisabetta; Peira, Elena; Riganti, Chiara; Schiffer, Davide; Panciani, Pierpaolo; Lanotte, Michele

2017-01-01

Research in neurooncology traditionally requires appropriate in vivo animal models, on which therapeutic strategies are tested before human trials are designed and proceed. Several reproducible animal experimental models, in which human physiologic conditions can be mimicked, are available for studying glioblastoma multiforme. In an ideal rat model, the tumor is of glial origin, grows in predictable and reproducible patterns, closely resembles human gliomas histopathologically, and is weakly or nonimmunogenic. In the current study, we used MRI and histopathologic evaluation to compare the most widely used allogeneic rat glioma model, C6-Wistar, with the F98-Fischer syngeneic rat glioma model in terms of percentage tumor growth or regression and growth rate. In vivo MRI demonstrated considerable variation in tumor volume and frequency between the 2 rat models despite the same stereotactic implantation technique. Faster and more reproducible glioma growth occurred in the immunoresponsive environment of the F98-Fischer model, because the immune response is minimized toward syngeneic cells. The marked inability of the C6-Wistar allogeneic system to generate a reproducible model and the episodes of spontaneous tumor regression with this system may have been due to the increased humoral and cellular immune responses after tumor implantation. PMID:28381315

Tributyltin toxicity in abalone (Haliotis diversicolor supertexta) assessed by antioxidant enzyme activity, metabolic response, and histopathology.

PubMed

Zhou, Jin; Zhu, Xiao-shan; Cai, Zhong-hua

2010-11-15

A toxicity test was performed to investigate the possible harmful effects of tributyltin (TBT) on abalone (Haliotis diversicolor supertexta). Animals were exposed to TBT in a range of environmentally relevant concentrations (2, 10 and 50 ng/L) for 30 days under laboratory conditions. TBT-free conditions were used as control treatments. The activity of antioxidant enzymes superoxide dismutase (SOD) and peroxidase (POD), and malondialdehyde (MDA), along with levels of haemolymph metabolites, and hepatopancreas histopathology were analyzed. The results showed that TBT decreased SOD activity, and increased POD level and MDA production in a dose-dependent way, indicating that oxidative injury was induced by TBT. Haemolymph metabolite measurements showed that TBT increased alanine and glutamate levels, and decreased glucose content, which suggested perturbation of energy metabolism. Elevated levels of acetate and pyruvate in the haemolymph indicated partial alteration of lipid metabolism. A decrease in lactate and an increase in succinate, an intermediate of the tricarboxylic acid (TCA) cycle, indicated disturbance of amino acid metabolism. Hepatopancreas tissues also exhibited inflammatory responses characterized by histopathological changes such as cell swelling, granular degeneration, and inflammation. Taken together, these results demonstrated that TBT was a potential toxin with a variety of deleterious effects on abalone. Copyright © 2010 Elsevier B.V. All rights reserved.

The Combination of Trypan Blue and Brilliant Blue G-Assisted Vitrectomy for Macular Pucker: Histopathological Findings.

PubMed

Tognetto, Daniele; De Giacinto, Chiara; D'Aloisio, Rossella; Papagno, Claudia; Pastore, Marco; Zweyer, Marina

2018-01-01

To report on the combined use of trypan blue (TB) and brilliant blue G (BBG) for staining the epiretinal membrane (ERM) and internal limiting membrane (ILM) during vitrectomy and to describe the histopathological findings. 10 surgical specimens were removed from 10 eyes with macular pucker during vitrectomy using a commercially available combination of TB and BBG for ERM and ILM staining and peeling. Specimens were evaluated using light and transmission electron microscopy. In all cases the combination of TB and BBG was useful for identifying and delineating ERM and ILM. No complications related to the use of the dye were observed during or after surgery. Glial cells were present in all specimens. Hyalocytes were observed in 6 cases and myofibroblasts in 3 of them. In 7 cases native vitreous collagen fibrils were found on the ILM, while in 5 specimens newly formed collagen was present. No clinical evidence of toxicity was observed during the 3-month follow-up. The combined use of TB and BBG appeared to be very useful intraoperatively to improve the visualization of ERM and ILM, thus facilitating their complete removal. Anatomical and histopathological findings demonstrated the safety and the efficacy of this vital dye. © 2018 S. Karger AG, Basel.

Histopathologic changes in dental pulp of teeth with chronic periodontitis.

PubMed

Aguiar, Telma R; Tristao, Gilson C; Mandarino, Denize; Zarranz, Laila; Ferreira, Vinicius F; Barboza, Eliane P

2014-05-01

The aim of this study was to evaluate the histopathologic changes in dental pulp of teeth with chronic advanced periodontitis. In 22 patients, 30 teeth were selected for inclusion. Patients had received no periodontal treatment. No teeth had caries, abrasion, attrition, erosion, trauma, or restoration. Radiographically, all teeth showed bone-support destruction to the apex. Thermal and cavity tests were used to evaluate pulp vitality. After tooth extractions, crowns were separated from roots at the cementoenamel junction. Both the crowns and the roots were prepared for histopathologic analyses. Radicular pulp was analyzed considering both coronal and apical halves. In 100 percent of the cases, coronal pulp exhibited soft connective tissue. In the coronal half of radicular pulp, soft connective tissue was present in 60 percent of the cases, fibrosis in 30 percent, and fibrosis associated with dystrophic calcification in 10 percent. In the apical half of radicular pulp, 6.6 percent of the cases demonstrated fibrosis; 23 percent exhibited fibrosis associated with pulp atrophy and secondary dentin; and 63.3 percent showed fibrosis, pulp atrophy, secondary dentin, and diffuse calcification. Radicular pulp of teeth with chronic periodontitis presents characteristics compatible with pulp changes resulting from pulp aging. In such cases, endodontic treatment is not indicated to enhance periodontal treatment results.

[Advantages and limitations of chorionic villous sampling].

PubMed

Carles, Dominique; Pelluard, Fanny; Mangione, Raphalle; Liquier, Alain; Horovitz, Jacques; Saura, Robert

2009-03-01

Chorionic villous sampling (CVS) has been available for more than twenty years. Together with amniocentesis, it helps the cytogenetician to determine the fetal karyotype for prenatal diagnosis. The choice between these two methods depends on the team and the indication. CVS can now provide sufficient material for both histopathologic and cytogenetic analyses. We evaluated the accuracy of microscopic examination of CVS for detecting primary ovular, uteroplacental vascular (preeclampsia) and inflammatory disorders. Four hundred CVS were examined in the pathology laboratory of Pellegrin Hospital, Bordeaux, France, from January 1995 to February 2008. The results were analyzed according to the indication, the karyotype, the results of placental examination, pregnancy outcome and, when available (following spontaneous or medical termination), fetoplacental findings. The sample was representative of patients requiring CVS for prenatal diagnosis, with respect to maternal age, the stage of pregnancy, and the indications. When used to screen for preeclamsia (prevalence 29.6% in the sample), the sensitivity and specificity of placental biopsy were respectively 56.8% and 87.2% (76.9% in case of intra-uterine growth retardation). When used to screen for chromosomal aberrations (prevalence 7.4%), the specificity was 14.3% and the sensitivity 93.2%. The prevalence of other disorders, and particularly chronic intervillitis, was too low for meaningful analysis. This study shows that histopathologic analysis of chorionic villous samples is useful for detecting the utero-placental vascular origin of intrauterine growth retardation in the absence of other clinical, biological or ultrasound signs, and that it is complementary to cytogenetic analysis. Being a simple and inexpensive examination, histopathologic analysis of CVS could be performed systematically in this indication. Its value and diagnostic signs in other settings need to be determined in larger series.

Germline MLH1 Mutations Are Frequently Identified in Lynch Syndrome Patients With Colorectal and Endometrial Carcinoma Demonstrating Isolated Loss of PMS2 Immunohistochemical Expression.

PubMed

Dudley, Beth; Brand, Randall E; Thull, Darcy; Bahary, Nathan; Nikiforova, Marina N; Pai, Reetesh K

2015-08-01

Current guidelines on germline mutation testing for patients suspected of having Lynch syndrome are not entirely clear in patients with tumors demonstrating isolated loss of PMS2 immunohistochemical expression. We analyzed the clinical and pathologic features of patients with tumors demonstrating isolated loss of PMS2 expression in an attempt to (1) determine the frequency of germline MLH1 and PMS2 mutations and (2) correlate mismatch-repair protein immunohistochemistry and tumor histology with germline mutation results. A total of 3213 consecutive colorectal carcinomas and 215 consecutive endometrial carcinomas were prospectively analyzed for DNA mismatch-repair protein expression by immunohistochemistry. In total, 32 tumors from 31 patients demonstrated isolated loss of PMS2 immunohistochemical expression, including 16 colorectal carcinomas and 16 endometrial carcinomas. Microsatellite instability (MSI) polymerase chain reaction was performed in 29 tumors from 28 patients with the following results: 28 tumors demonstrated high-level MSI, and 1 tumor demonstrated low-level MSI. Twenty of 31 (65%) patients in the study group had tumors demonstrating histopathology associated with high-level MSI. Seventeen patients underwent germline mutation analysis with the following results: 24% with MLH1 mutations, 35% with PMS2 mutations, 12% with PMS2 variants of undetermined significance, and 29% with no mutations in either MLH1 or PMS2. Three of the 4 patients with MLH1 germline mutations had a mutation that results in decreased stability and quantity of the MLH1 protein that compromises the MLH1-PMS2 protein complex, helping to explain the presence of immunogenic but functionally inactive MLH1 protein within the tumor. The high frequency of MLH1 germline mutations identified in our study has important implications for testing strategies in patients suspected of having Lynch syndrome and indicates that patients with tumors demonstrating isolated loss of PMS2 expression without a germline PMS2 mutation must have MLH1 mutation analysis performed.

Hepatoid adenocarcinoma of the lung without production of α-fetoprotein: A case report and review of the literature

PubMed Central

SUN, JI NING; ZHANG, BAO LONG; LI, LIN KUN; YU, HAI YAN; WANG, BIN

2016-01-01

Hepatoid adenocarcinoma of the lung (HAL) is a rare type of extrahepatic hepatoid adenocarcinoma. The majority of such cases that have been reported in the English literature have demonstrated elevated serum α-fetoprotein (AFP) and/or positive AFP expression on histopathological analysis, and have had poor prognoses. The current study reports an extremely rare case of HAL in the right upper lung without AFP production in a 59-year-old male patient. The patient underwent radical right upper lobectomy via video assisted thoracoscopic surgery. No signs of local recurrence or distant metastasis have been observed for 23 months after the surgery. The serum AFP level following surgery remained within the normal range. Although the diagnosis of HAL predominantly depends on pathological examination, a review of the literature demonstrates that HAL has certain characteristic features with regard to its clinical and computed tomography findings and prognoses, and clinicians should be aware that clinicians should be aware that monitoring serum AFP levels, as well as CT findings, remains important. PMID:27347123

Hepatoid adenocarcinoma of the lung without production of α-fetoprotein: A case report and review of the literature.

PubMed

Sun, Ji Ning; Zhang, Bao Long; Li, Lin Kun; Yu, Hai Yan; Wang, Bin

2016-07-01

Hepatoid adenocarcinoma of the lung (HAL) is a rare type of extrahepatic hepatoid adenocarcinoma. The majority of such cases that have been reported in the English literature have demonstrated elevated serum α-fetoprotein (AFP) and/or positive AFP expression on histopathological analysis, and have had poor prognoses. The current study reports an extremely rare case of HAL in the right upper lung without AFP production in a 59-year-old male patient. The patient underwent radical right upper lobectomy via video assisted thoracoscopic surgery. No signs of local recurrence or distant metastasis have been observed for 23 months after the surgery. The serum AFP level following surgery remained within the normal range. Although the diagnosis of HAL predominantly depends on pathological examination, a review of the literature demonstrates that HAL has certain characteristic features with regard to its clinical and computed tomography findings and prognoses, and clinicians should be aware that clinicians should be aware that monitoring serum AFP levels, as well as CT findings, remains important.

Antitumor activity of biflorin, an o-naphthoquinone isolated from Capraria biflora.

PubMed

Vasconcellos, Marne Carvalho de; Bezerra, Daniel Pereira; Fonseca, Aluísio Marques; Pereira, Márcio Roberto Pinho; Lemos, Telma Leda Gomes; Pessoa, Otília Deusdênia Loiola; Pessoa, Cláudia; Moraes, Manoel Odorico de; Alves, Ana Paula Negreiros Nunes; Costa-Lotufo, Letícia Veras

2007-08-01

Pharmacological studies with an aqueous extract obtained from leaves of Capraria biflora showed potent cytotoxic, analgesic, antimicrobial and anti-inflammatory activities. It has been demonstrated that biflorin possesses an in vitro cytotoxic activity against tumor cells. The in vivo antitumor activity of biflorin was evaluated on two mouse models, sarcoma 180 and Ehrlich carcinoma. Biflorin was active against both tumors with a very similar profile. In addition, biflorin was also able to increase the response elicited by 5-FU in mice inoculated with both tumors. The results showed a decrease in Ki67 staining in tumor cells from treated-animals when compared with non-treated groups, which suggests an inhibition of tumor proliferation rate. Histopathological analysis from kidneys and liver showed that biflorin possessed weak and reversible toxic effects. It was also demonstrated that biflorin acts as an immunoadjuvant agent, rising the production of ovalbumin-specific antibodies and inducing a discreet increase of the white pulp and nest of megakaryocytic in spleen of treated mice, which can be related to its antitumor properties.

Evaluation of Rosemont criteria for non-calcific chronic pancreatitis (NCCP) based on histopathology - A retrospective study.

PubMed

Trikudanathan, Guru; Munigala, Satish; Barlass, Usman; Malli, Ahmad; Han, Yusheng; Sekulic, Miroslav; Bellin, Melena; Chinnakotla, Srinath; Dunn, Ty; Pruett, Timothy; Beilman, Gregory; Peralta, Jose-Vega; Arain, Mustafa; Amateau, Stuart; Mallery, Shawn; Freeman, Martin L; Attam, Rajeev

Rosemont classification for chronic pancreatitis has not been evaluated specifically in non-calcific chronic pancreatitis (NCCP) patients and to this date, it has not been correlated with the gold standard namely histopathology. To assess the correlation of EUS Rosemont criteria for NCCP with histopathology from surgical specimens and evaluate the impact of age, sex, BMI, smoking and alcohol on Rosemont classification. Adult patients undergoing TPIAT for NCCP between July 2009 and January 2013 were identified from our institutional database. The presence or absence of standard and Rosemont (major and minor) criteria were determined by expert endosonographers using linear endosonography. Patients were categorized into normal, indeterminate and suggestive with CP based on Rosemont classification. Histology was obtained at time of TPIAT from the resected pancreas by wedge biopsy of head, body and tail. All histopathology were re-reviewed by a GI pathologist blinded to endosonographic features and clinical outcomes. Available pancreatic tissue was graded for severity of intralobular and perilobular pancreatic fibrosis by the Ammann classification system. 50 patients with NCCP (42 females, mean age± SD = 37.9 ± 10.8) underwent TPIAT with preoperative EUS during the study period. Univariate analysis of features such as age, sex, BMI, smoking and alcohol history showed no significant difference between patients identified as normal and those identified as indeterminate/suggestive (p > 0.05). Rosemont "Normal" was poor in excluding CP as 5/9 patients (55.5%) had CP on histopathology. 25/26 patients (96.2%) with features "suggestive" of CP had evidence of CP on histopathology. 12/15 patients (80.0%) with "indeterminate" features had CP on histopathology. Rosemont classification can be used independent of patient characteristics (age, sex and BMI) and environmental factors (smoking and alcohol exposure). In our cohort, Rosemont classification was strongly predictive of CP in patients with features "suggestive" of CP. However, "normal" Rosemont classification had poor correlation in this study. This is maybe due to lack of true comparator "normal" pancreas which cannot be obtained reasonably. The strength of agreement for diagnosis of CP was substantial between the standard and Rosemont criteria. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.

Intravoxel Incoherent Motion–derived Histogram Metrics for Assessment of Response after Combined Chemotherapy and Radiation Therapy in Rectal Cancer: Initial Experience and Comparison between Single-Section and Volumetric Analyses

PubMed Central

Vargas, Hebert Alberto; Lakhman, Yulia; Sudre, Romain; Do, Richard K. G.; Bibeau, Frederic; Azria, David; Assenat, Eric; Molinari, Nicolas; Pierredon, Marie-Ange; Rouanet, Philippe; Guiu, Boris

2016-01-01

Purpose To determine the diagnostic performance of intravoxel incoherent motion (IVIM) parameters and apparent diffusion coefficient (ADC) to assess response to combined chemotherapy and radiation therapy (CRT) in patients with rectal cancer by using histogram analysis derived from whole-tumor volumes and single-section regions of interest (ROIs). Materials and Methods The institutional review board approved this retrospective study of 31 patients with rectal cancer who underwent magnetic resonance (MR) imaging before and after CRT, including diffusion-weighted imaging with 34 b values prior to surgery. Patient consent was not required. ADC, perfusion-related diffusion fraction (f), slow diffusion coefficient (D), and fast diffusion coefficient (D*) were calculated on MR images acquired before and after CRT by using biexponential fitting. ADC and IVIM histogram metrics and median values were obtained by using whole-tumor volume and single-section ROI analyses. All ADC and IVIM parameters obtained before and after CRT were compared with histopathologic findings by using t tests with Holm-Sidak correction. Receiver operating characteristic curves were generated to evaluate the diagnostic performance of IVIM parameters derived from whole-tumor volume and single-section ROIs for prediction of histopathologic response. Results Extreme values aside, results of histogram analysis of ADC and IVIM were equivalent to median values for tumor response assessment (P > .06). Prior to CRT, none of the median ADC and IVIM diffusion metrics correlated with subsequent tumor response (P > .36). Median D and ADC values derived from either whole-volume or single-section analysis increased significantly after CRT (P ≤ .01) and were significantly higher in good versus poor responders (P ≤ .02). Median IVIM f and D* values did not significantly change after CRT and were not associated with tumor response to CRT (P > .36). Interobserver agreement was excellent for whole-tumor volume analysis (range, 0.91–0.95) but was only moderate for single-section ROI analysis (range, 0.50–0.63). Conclusion Median D and ADC values obtained after CRT were useful for discrimination between good and poor responders. Histogram metrics did not add to the median values for assessment of tumor response. Volumetric analysis demonstrated better interobserver reproducibility when compared with single-section ROI analysis. © RSNA, 2016 Online supplemental material is available for this article. PMID:26919562

Role of histopathology as an aid to prognosis in rhino-orbito-cerebral zygomycosis.

PubMed

Goel, Ashina; Kini, Usha; Shetty, Subhaschandra

2010-01-01

Rhino-orbito-cerebral zygomycosis is a rapidly progressive opportunistic fungal infection characterized by a set of clinical and radiological findings that help in prognostication. The present study is aimed to evaluate its histopathologic features as an aid to prognosis in order to guide the physician at the stage of tissue diagnosis to optimize surgery, chemotherapy and immunosuppression. The study comprises of a microscopic analysis of specific histopathologic variables on 33 cases of zygomycosis that were diagnosed and treated in a seven-year period. Fungal load in the tissue (graded as mild, moderate and marked), mean diameter of fungus, degree of neutrophilic and granulomatous response, tissue invasion and necrosis were graded and assessed for their prognostic significance. Seasonal variation, signs and symptoms, extent of involvement and laboratory parameters were also analyzed to examine the trend of occurrence of the disease and to associate these with patient's outcome, which was categorized as either survived or expired. The follow-up ranged from 1 month to 7 years. Of all the histological variables, angioinvasion was directly related to the mortality rate. Diameter of the fungal hyphae and its intraorbital or intracranial invasion also proved to be significant indicators of poor prognosis. (P = 0.04 and 0.0037, respectively) though angioinvasion was directly related to the mortality rate. Thus, histopathology could assist the clinician in assessing patient's progress and thus optimize the treatment in such patients.

Evaluation of the efficacy of photodynamic therapy for the treatment of actinic cheilitis.

PubMed

Chaves, Yuri N; Torezan, Luis Antonio; Lourenço, Silvia Vanessa; Neto, Cyro Festa

2017-01-01

Actinic cheilitis (AC) is a lip intraepithelial neoplasia, whose cells present alterations similar to those presented by invasive squamous cell carcinomas (SCCs). To conduct clinical and laboratory evaluation by histopathology and immunohistochemistry of the efficacy of actinic cheilitis treatment using photodynamic therapy (PDT) with methyl aminolevulinate (MAL) and noncoherent red light. Patients with actinic cheilitis detected by histopathological examination were submitted to two sessions of photodynamic therapy with a two-week interval between them. They were examined immediately after the sessions, four, six, and twelve weeks after beginning treatment when a new biopsy was carried out. Clinical histopathological and immunohistochemical parameters were evaluated before and after treatment. Of the 23 patients who underwent biopsy, 16 completed two photodynamic therapy sessions and the material of one patient was insufficient for immunohistochemistry. Complete clinical response was achieved in 62.5% (10 of 16 patients) and 37.5% still remained with clinical evidence of AC. In spite of this, no case of cure by histopathological analysis was found. There was no significant statistical change among the values of Ki-67, survivin, and p53 observed before and after treatment. Photodynamic therapy, as carried out in this trial, was not an efficacious therapeutic option for treating patients with actinic cheilitis included in this sample. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Expanding the spectrum of frontal fibrosing alopecia: a unifying concept.

PubMed

Chew, Ai-Lean; Bashir, Saqib J; Wain, E Mary; Fenton, David A; Stefanato, Catherine M

2010-10-01

In frontal fibrosing alopecia (FFA), scalp alopecia dominates the clinical picture. However, eyebrow loss and hair loss in other body sites may also occur; this has been documented clinically, but rarely histopathologically. We describe the clinicopathological findings of 13 cases of FFA, with histopathologic data from the scalp, eyebrow, and body hair. Thirteen patients with a diagnosis of FFA, seen between 2006 and 2008, were included. Scalp biopsies were performed in all patients for histology and direct immunofluorescence (DIF). Biopsy specimens for histology were taken from the eyebrow in 6 patients and from the upper limb in 5 patients. All 13 patients were female, 11 of whom were postmenopausal. The median age at onset of alopecia was 57 years. Clinical examination revealed a band of frontal hairline recession in all patients. Eyebrow loss was present clinically in all patients, with loss of body hair in 10 of 13. Histopathologic examination of the scalp, eyebrow, and upper limb skin biopsy specimens showed similar features, including a marked reduction in the number of hair follicles and a perifollicular lymphoid cell infiltrate with perifollicular fibrosis. Direct immunofluorescence was negative in all cases. Not all patients consented to biopsies of the eyebrows or upper limbs. Eyebrow and peripheral body hair loss is not uncommon in FFA-a finding that is likely underreported. We have demonstrated that alopecia of the upper limbs in FFA is indeed common and, histopathologically, shows features of lichen planopilaris and scarring, similar to findings in the scalp and eyebrows. Consequently, the process of lichen planopilaris with scarring alopecia is generalized rather than localized only to the frontal scalp and eyebrows.

Histopathological and biomechanical evaluation of bone healing properties of DBM and DBM-G90 in a rabbit model.

PubMed

Meimandi Parizi, Abdolhamid; Oryan, Ahmad; Haddadi, Shahram; Bigham Sadegh, Amin

2015-01-01

The present study was designed to investigate the effects of DBM and DBM-G90 on bone healing in a rabbit model. Thirty male white albino rabbits were used in this study. An incision was made in all rabbits under general anesthesia directly over the radius in order to expose it. A 10-mm segmental defect was created on the middle portion of each radius. The defects of 10 rabbits (Group I) were filled with DBM Block and Strip (Zimmer, Inc., Warsaw, IN, USA), the defects of 10 rabbits (Group II) were filled with DBM soaked in G90, and the defects of 10 rabbits (Group III/control) were left empty. The rabbits were euthanized at 60 days postoperatively for histopathological and biomechanical evaluation. At the histopathologic level, the defects of the animals in the DBM and DBM-G90 groups showed more advanced healing criteria than those of the control group. In biomechanical findings, there was a statistically significant difference between the injured bones and contralateral normal bones of the control group in terms of measured strength. There was not a statistically significant difference between the treated bones of the DBM and DBM-G90 groups with contralateral normal bones, nor was there a statistically significant difference between the treated bones of the DBM and DBM-G90 groups with the treated bones of the control group, in terms of other biomechanical tests. Based on the histopathological and biomechanical findings, the DBM and DBM-G90 groups demonstrated superior osteogenic potential; however, G90 shows no superiority over DBM on bone healing.

Acute toxicity, biochemical and histopathological responses of endosulfan in Chanos chanos.

PubMed

Kumar, Neeraj; Ambasankar, K; Krishnani, K K; Gupta, S K; Bhushan, Shashi; Minhas, P S

2016-09-01

This study investigated 96h median lethal concentration of endosulfan (99%, pure α: β ratio of 7:3) by conducting static non-renewable acute toxicity bio-assay in Chanos chanos juvenile with average weight (110±5.65g). Further, the effect of different definitive doses (18.5, 19.5, 20.5, 21.5 and 22.5µg/L) of endosulfan on metabolic, heamato-immunoligcal and histopathological response were probed. Anti-oxidative enzymes CAT, SOD and GST showed significant (p<0.01) increase of activity in the liver, gill and brain during exposure to endosulfan in a dose and time dependent manner. The brain AChE activity showed significant (p<0.01) inhibition from 18.5 to 22.5µg/L exposure of endosulfan than the control group. LDH and MDH activity gradually increased with consequent increasing dose of endosulfan exposure in the liver, gill and brain. Similarly, ALT, AST and G6PDH activities in both liver and gill increased with consequent increases in the dose of endosulfan exposure. Immunological profile such as blood glucose and serum cortisol level significantly enhanced while respiratory burst activity declined with consequent increasing doses of endosulfan exposure. Histopathological alteration in the gill demonstrated curling of secondary lamellae, thickening of primary epithelium, shorting of secondary lamellae, epithelial hyperplasia, fusion of secondary lamellae, aneurism, and collapsed secondary lamellae due to dose dependent exposure of endosulfan. Liver histology illustrated cloudy swelling and necrosis with pyknotic nuclei to the moderate dose of endosulfan, whereas higher dose of endosulfan (21.5µg/L) displayed severe necrosis of hepatic cells. Overall results clearly indicate that acute exposure of endosulfan led to pronounced deleterious alterations on biochemical, heamato-immunological, and histopathological responses of C. chanos juvenile. Copyright © 2016 Elsevier Inc. All rights reserved.

Biochemically and histopathologically comparative review of thiamine’s and thiamine pyrophosphate’s oxidative stress effects generated with methotrexate in rat liver

PubMed Central

Demiryilmaz, Ismail; Sener, Ebru; Cetin, Nihal; Altuner, Durdu; Suleyman, Bahadir; Albayrak, Fatih; Akcay, Fatih; Suleyman, Halis

2012-01-01

Summary Background Oxidative liver injury occurring with methotrexate restricts its use in the desired dose. Therefore, whether or not thiamine and thiamine pyrophosphate, whose antioxidant activity is known, have protective effects on oxidative liver injury generated with methotrexate was comparatively researched in rats using biochemical and histopathological approaches. Material/Methods Thiamine pyrophosphate+methotrexate, thiamine+methotrexate, and methotrexate were injected intraperitoneally in rats for 7 days. After this period, all animals’ livers were excised, killing them with high-dose anesthesia, and histopathologic and biochemical investigations were made. Result Biochemical results demonstrated a significant elevation in level of oxidant parameters such as MDA and MPO, and a reduction in antioxidant parameters such as GSH and SOD in the liver tissue of the methotrexate group. Also, the quantity of 8-OHdG/dG, a DNA injury product, was higher in the methotrexate group with high oxidant levels and low antioxidant levels, and the quantity of 8-OHdG/dG was in the thiamine pyrophosphate group with low oxidant levels and high antioxidant levels. In the thiamine and control groups, the 8-OHdG/dG rate was 1.48±0.35 pmol/L (P>0.05) and 0.55±0.1 pmol/L (P<0.0001). Thiamine pyrophosphate significantly decreased blood AST, ALT and LDH, but methotrexate and thiamine did not decrease the blood levels of AST, ALT and LDH. Histopathologically, although centrilobular necrosis, apoptotic bodies and inflammation were monitored in the methotrexate group, the findings in the thiamine pyrophosphate group were almost the same as in the control group. Conclusions Thiamine pyrophosphate was found to be effective in methotrexate hepatotoxicity, but thiamine was ineffective. PMID:23197226

Coexistence of tumid lupus erythematosus with systemic lupus erythematosus and discoid lupus erythematosus: a report of two cases of tumid lupus.

PubMed

Stead, Jennifer; Headley, Catherine; Ioffreda, Michael; Kovarik, Carrie; Werth, Victoria

2008-12-01

Tumid lupus erythematosus (LE) is a rare variant of chronic cutaneous LE that is characterized clinically by smooth, nonscarring, pink to violaceous papules or plaques without evidence of surface change. Histopathologic features include superficial and deep lymphocytic infiltration in a perivascular and periadnexal distribution, with dermal interstitial mucin deposition and focal or absent dermoepidermal junction involvement. These clinical and histopathologic features can be challenging to differentiate from other cutaneous diseases. This is particularly true because patients with tumid LE usually do not have other manifestations of systemic LE or cutaneous LE. We present 2 cases of tumid LE, one associated with concomitant systemic LE and the other occurring concurrently with discoid LE. Furthermore, we demonstrate the rare occurrence of a patient with tumid LE occurring below the waist at a photo-protected site.

Primary systemic amyloidosis, acquired cutis laxa and cutaneous mucinosis in a patient with multiple myeloma*

PubMed Central

Lavorato, Fernanda Guedes; Alves, Maria de Fátima Guimarães Scotelaro; Maceira, Juan Manuel Piñeiro; Unterstell, Natasha; Serpa, Laura Araújo; Azulay-Abulafia, Luna

2013-01-01

A 57-year-old woman presented with periorbital ecchymoses, laxity in skin folds, polyneuropathy and bilateral carpal tunnel syndrome. A skin biopsy of the axillary lesion demonstrated fragmentation of elastic fibers, but with a negative von Kossa stain, consistent with cutis laxa. The diagnosis of primary systemic amyloidosis was made by the presence of amyloid material in the eyelid using histopathological techniques, besides this, the patient was also diagnosed with purpura, polyneuropathy, bilateral carpal tunnel syndrome and monoclonal gammopathy. She was diagnosed as suffering from multiple myeloma based on the finding of 40% plasma cells in the bone marrow, component M in the urine and anemia. The patient developed blisters with a clear content, confirmed as mucinosis by the histopathological exam. The final diagnoses were: primary systemic amyloidosis, acquired cutis laxa and mucinosis, all related to multiple myeloma. PMID:24346874

Pleurotus eryngii Ameliorates Lipopolysaccharide-Induced Lung Inflammation in Mice

PubMed Central

Andoh, Tsugunobu; Ouchi, Kenji; Inatomi, Satoshi

2014-01-01

Pleurotus eryngii (P. eryngii) is consumed as a fresh cultivated mushroom worldwide and demonstrated to have multiple beneficial effects. We investigated the anti-inflammatory effect of P. eryngii in mice with acute lung injury (ALI). Intranasal instillation of lipopolysaccharide (LPS) (10 μg/site/mouse) induced marked lung inflammation (increase in the number of inflammatory cells, protein leakage, and production of nitric oxide in bronchoalveolar lavage fluid) as well as histopathological damage in the lung, 6 h after treatment. Mice administered heat-treated P. eryngii (0.3–1 g/kg, p.o. (HTPE)) 1 h before LPS challenge showed decreased pulmonary inflammation and ameliorated histopathological damage. These results suggest that HTPE has anti-inflammatory effects against ALI. Thus, P. eryngii itself may also have anti-inflammatory effects and could be a beneficial food for the prevention of ALI induced by bacterial infection. PMID:24799939

Autoradiographic and histopathological studies of boric acid-mediated BNCT in hepatic VX2 tumor-bearing rabbits: Specific boron retention and damage in tumor and tumor vessels.

PubMed

Yang, C H; Lin, Y T; Hung, Y H; Liao, J W; Peir, J J; Liu, H M; Lin, Y L; Liu, Y M; Chen, Y W; Chuang, K S; Chou, F I

2015-12-01

Hepatoma is a malignant tumor that responds poorly to conventional therapies. Boron neutron capture therapy (BNCT) may provide a better way for hepatoma therapy. In this research, (10)B-enriched boric acid (BA, 99% (10)B) was used as the boron drug. A multifocal hepatic VX2 tumor-bearing rabbit model was used to study the mechanisms of BA-mediated BNCT. Autoradiography demonstrated that BA was selectively targeted to tumors and tumor vessels. Histopathological examination revealed the radiation damage to tumor-bearing liver was concentrated in the tumor regions during BNCT treatment. The selective killing of tumor cells and the destruction of the blood vessels in tumor masses may be responsible for the success of BA-mediated BNCT for liver tumors. Copyright © 2015 Elsevier Ltd. All rights reserved.

Pleurotus eryngii Ameliorates Lipopolysaccharide-Induced Lung Inflammation in Mice.

PubMed

Kawai, Junya; Andoh, Tsugunobu; Ouchi, Kenji; Inatomi, Satoshi

2014-01-01

Pleurotus eryngii (P. eryngii) is consumed as a fresh cultivated mushroom worldwide and demonstrated to have multiple beneficial effects. We investigated the anti-inflammatory effect of P. eryngii in mice with acute lung injury (ALI). Intranasal instillation of lipopolysaccharide (LPS) (10  μ g/site/mouse) induced marked lung inflammation (increase in the number of inflammatory cells, protein leakage, and production of nitric oxide in bronchoalveolar lavage fluid) as well as histopathological damage in the lung, 6 h after treatment. Mice administered heat-treated P. eryngii (0.3-1 g/kg, p.o. (HTPE)) 1 h before LPS challenge showed decreased pulmonary inflammation and ameliorated histopathological damage. These results suggest that HTPE has anti-inflammatory effects against ALI. Thus, P. eryngii itself may also have anti-inflammatory effects and could be a beneficial food for the prevention of ALI induced by bacterial infection.

Transparency-enhancing technology allows three-dimensional assessment of gastrointestinal mucosa: A porcine model.

PubMed

Mizutani, Hiroya; Ono, Satoshi; Ushiku, Tetsuo; Kudo, Yotaro; Ikemura, Masako; Kageyama, Natsuko; Yamamichi, Nobutake; Fujishiro, Mitsuhiro; Someya, Takao; Fukayama, Masashi; Koike, Kazuhiko; Onodera, Hiroshi

2018-02-01

Although high-resolution three-dimensional imaging of endoscopically resected gastrointestinal specimens can help elucidating morphological features of gastrointestinal mucosa or tumor, there are no established methods to achieve this without breaking specimens apart. We evaluated the utility of transparency-enhancing technology for three-dimensional assessment of gastrointestinal mucosa in porcine models. Esophagus, stomach, and colon mucosa samples obtained from a sacrificed swine were formalin-fixed and paraffin-embedded, and subsequently deparaffinized for analysis. The samples were fluorescently stained, optically cleared using transparency-enhancing technology: ilLUmination of Cleared organs to IDentify target molecules method (LUCID), and visualized using laser scanning microscopy. After observation, all specimens were paraffin-embedded again and evaluated by conventional histopathological assessment to measure the impact of transparency-enhancing procedures. As a result, microscopic observation revealed horizontal section views of mucosa at deeper levels and enabled the three-dimensional image reconstruction of glandular and vascular structures. Besides, paraffin-embedded specimens after transparency-enhancing procedures were all assessed appropriately by conventional histopathological staining. These results suggest that transparency-enhancing technology may be feasible for clinical application and enable the three-dimensional structural analysis of endoscopic resected specimen non-destructively. Although there remain many limitations or problems to be solved, this promising technology might represent a novel histopathological method for evaluating gastrointestinal cancers. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Histopathological Breast Cancer Image Classification by Deep Neural Network Techniques Guided by Local Clustering.

PubMed

Nahid, Abdullah-Al; Mehrabi, Mohamad Ali; Kong, Yinan

2018-01-01

Breast Cancer is a serious threat and one of the largest causes of death of women throughout the world. The identification of cancer largely depends on digital biomedical photography analysis such as histopathological images by doctors and physicians. Analyzing histopathological images is a nontrivial task, and decisions from investigation of these kinds of images always require specialised knowledge. However, Computer Aided Diagnosis (CAD) techniques can help the doctor make more reliable decisions. The state-of-the-art Deep Neural Network (DNN) has been recently introduced for biomedical image analysis. Normally each image contains structural and statistical information. This paper classifies a set of biomedical breast cancer images (BreakHis dataset) using novel DNN techniques guided by structural and statistical information derived from the images. Specifically a Convolutional Neural Network (CNN), a Long-Short-Term-Memory (LSTM), and a combination of CNN and LSTM are proposed for breast cancer image classification. Softmax and Support Vector Machine (SVM) layers have been used for the decision-making stage after extracting features utilising the proposed novel DNN models. In this experiment the best Accuracy value of 91.00% is achieved on the 200x dataset, the best Precision value 96.00% is achieved on the 40x dataset, and the best F -Measure value is achieved on both the 40x and 100x datasets.

Histopathological comparative analysis of peri-implant soft tissue response after dental implant placement with flap and flapless surgical technique. Experimental study in pigs.

PubMed

Vlahovic, Zoran; Markovic, Aleksa; Golubovic, Mileta; Scepanovic, Miodrag; Kalanovic, Milena; Djinic, Ana

2015-11-01

The aim of this study was comparing the effect of flapless vs. flap technique of implant placement on inflammation degree of peri-implant soft tissue, through histopathological analysis. The experiment was conducted on five domestic pigs. Nine weeks after tooth extraction, implants were installed. Each animal received six implants in mandible. According to split-mouth design, randomly one side was used for flapless technique using mini-incision, while on the other side, flap was raised. After 7, 14, 21, 28, and 90 days, the experimental animals were sacrificed. Samples for histopathological analyzes were taken from the buccal side of peri-implant mucosa next to the neck of implants, from three levels. The degree of inflammatory response in the peri-implant soft tissue was estimated through ordinal scores from 0 to 3. In the flap group Score 3 indicating high degree of inflammation was present from day 7 to day 21, in contrast to flapless group where Score 3 was not recorded during the entire follow-up. Three months after implantation, there were no signs of inflammation neither around flap nor around flapless implants. Flapless surgical implantation technique using mini-incision decreases peri-implant soft tissue inflammatory reaction compared with flap surgery. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The neuroprotective role of boric acid on aluminum chloride-induced neurotoxicity.

PubMed

Colak, Suat; Geyikoglu, Fatime; Keles, Osman Nuri; Türkez, Hasan; Topal, Ahmet; Unal, Bünyami

2011-09-01

This study was designed to investigate the qualitative and quantitative changes in brain tissue following aluminum chloride (AlCl(3)) administration and to determine whether boric acid (BA) has a protective effect against brain damage induced by AlCl( 3). For this aim, Sprague-Dawley rats were randomly separated into eight groups: (1) control, (2) AlCl(3) (5 mg/kg/day), (3, 4 and 5) BA (3.25, 36 and 58.5 mg/kg/day), (6, 7 and 8) AlCl(3) (5 mg/kg/day) plus BA (3.25, 36 and 58.5 mg/kg/day). After the animals were killed, the total numbers of neuron in the brain of all groups were determined using an unbiased stereological analysis. In addition to the stereological analysis, all brains were examined histopathologically by using light and electron microscopy. The stereological and histopathological results indicated a high damage of the rat brain tissues in the AlCl(3) and AlCl(3) + high dose BA (36 and 58.5) treatment groups. However, protective effects on neuron were observed in the AlCl(3) + low dose BA (3.25) group when compared other AlCl(3) groups. Our stereological and histopathological findings show that low-dose BA, as a proteasome inhibitor, can decrease the adverse effects of AlCl(3) on the cerebral cortex.

Prostate cancer region prediction using MALDI mass spectra

NASA Astrophysics Data System (ADS)

Vadlamudi, Ayyappa; Chuang, Shao-Hui; Sun, Xiaoyan; Cazares, Lisa; Nyalwidhe, Julius; Troyer, Dean; Semmes, O. John; Li, Jiang; McKenzie, Frederic D.

2010-03-01

For the early detection of prostate cancer, the analysis of the Prostate-specific antigen (PSA) in serum is currently the most popular approach. However, previous studies show that 15% of men have prostate cancer even their PSA concentrations are low. MALDI Mass Spectrometry (MS) proves to be a better technology to discover molecular tools for early cancer detection. The molecular tools or peptides are termed as biomarkers. Using MALDI MS data from prostate tissue samples, prostate cancer biomarkers can be identified by searching for molecular or molecular combination that can differentiate cancer tissue regions from normal ones. Cancer tissue regions are usually identified by pathologists after examining H&E stained histological microscopy images. Unfortunately, histopathological examination is currently done on an adjacent slice because the H&E staining process will change tissue's protein structure and it will derogate MALDI analysis if the same tissue is used, while the MALDI imaging process will destroy the tissue slice so that it is no longer available for histopathological exam. For this reason, only the most confident cancer region resulting from the histopathological examination on an adjacent slice will be used to guide the biomarker identification. It is obvious that a better cancer boundary delimitation on the MALDI imaging slice would be beneficial. In this paper, we proposed methods to predict the true cancer boundary, using the MALDI MS data, from the most confident cancer region given by pathologists on an adjacent slice.

Laser induced autofluorescence for diagnosis of non-melanoma skin cancer

NASA Astrophysics Data System (ADS)

Drakaki, E.; Makropoulou, M.; Serafetinides, A. A.; Merlemis, N.; Kalatzis, I.; Sianoudis, I. A.; Batsi, O.; Christofidou, E.; Stratigos, A. J.; Katsambas, A. D.; Antoniou, Ch.

2015-01-01

Non melanoma skin cancer is one of the most frequent malignant tumors among humans. A non-invasive technique, with high sensitivity and high specificity, would be the most suitable method for basal cell carcinoma (BCC) or other malignancies diagnostics, instead of the well established biopsy and histopathology examination. In the last decades, a non-invasive, spectroscopic diagnostic method was introduced, the laser induced fluorescence (LIF), which could generate an image contrast between different states of skin tissue. The noninvasiveness consists in that this biophotonic method do not require tissue sample excision, what is necessary in histopathology characterization and biochemical analysis of the skin tissue samples, which is worldwide used as an evaluation gold standard. The object of this study is to establish the possibilities of a relatively portable system for laser induced skin autofluorescence to differentiate malignant from nonmalignant skin lesions. Unstained human skin samples, excised from humans undergoing biopsy examination, were irradiated with a Nd:YAG-3ω laser (λ=355 nm, 6 ns), used as an excitation source for the autofluorescence measurements. A portable fiber-based spectrometer was used to record fluorescence spectra of the sites of interest. The ex vivo results, obtained with this spectroscopic technique, were correlated with the histopathology results. After the analysis of the fluorescence spectra of almost 60 skin tissue areas, we developed an algorithm to distinguish different types of malignant lesions, including inflammatory areas. Optimization of the data analysis and potential use of LIF spectroscopy with 355 nm Nd:YAG laser excitation of tissue autofluorescence for clinical applications are discussed.

Histogram analysis parameters of dynamic contrast-enhanced magnetic resonance imaging can predict histopathological findings including proliferation potential, cellularity, and nucleic areas in head and neck squamous cell carcinoma.

PubMed

Surov, Alexey; Meyer, Hans Jonas; Leifels, Leonard; Höhn, Anne-Kathrin; Richter, Cindy; Winter, Karsten

2018-04-20

Our purpose was to analyze possible associations between histogram analysis parameters of dynamic contrast-enhanced magnetic resonance imaging DCE MRI and histopathological findings like proliferation index, cell count and nucleic areas in head and neck squamous cell carcinoma (HNSCC). 30 patients (mean age 57.0 years) with primary HNSCC were included in the study. In every case, histogram analysis parameters of K trans , V e , and K ep were estimated using a mathlab based software. Tumor proliferation index, cell count, and nucleic areas were estimated on Ki 67 antigen stained specimens. Spearman's non-parametric rank sum correlation coefficients were calculated between DCE and different histopathological parameters. KI 67 correlated with K trans min ( p = -0.386, P = 0.043) and s K trans skewness ( p = 0.382, P = 0.045), V e min ( p = -0.473, P = 0.011), Ve entropy ( p = 0.424, P = 0.025), and K ep entropy ( p = 0.464, P = 0.013). Cell count correlated with K trans kurtosis ( p = 0.40, P = 0.034), V e entropy ( p = 0.475, P = 0.011). Total nucleic area correlated with V e max ( p = 0.386, P = 0.042) and V e entropy ( p = 0.411, P = 0.030). In G1/2 tumors, only K trans entropy correlated well with total ( P =0.78, P =0.013) and average nucleic areas ( p = 0.655, P = 0.006). In G3 tumors, KI 67 correlated with Ve min ( p = -0.552, P = 0.022) and V e entropy ( p = 0.524, P = 0.031). Ve max correlated with total nucleic area ( p = 0.483, P = 0.049). Kep max correlated with total area ( p = -0.51, P = 0.037), and K ep entropy with KI 67 ( p = 0.567, P = 0.018). We concluded that histogram-based parameters skewness, kurtosis and entropy of K trans , V e , and K ep can be used as markers for proliferation activity, cellularity and nucleic content in HNSCC. Tumor grading influences significantly associations between perfusion and histopathological parameters.

Disseminated cutaneous histoplasmosis in patients infected with human immunodeficiency virus.

PubMed

K Ramdial, Pratistadevi; Mosam, Anisa; Dlova, Ncoza C; B Satar, Nasreen; Aboobaker, Jamilla; Singh, Shivon M

2002-04-01

In the pre-AIDS era disseminated histoplasmosis was rare and the cutaneous manifestations thereof were reported infrequently. A range of unusual clinical manifestations of disseminated cutaneous histoplasmosis (DCH) in AIDS patients has been documented, but the cutaneous histopathological descriptions are short and incomplete. In addition, the histopathological spectrum of AIDS-associated DCH is poorly recognized. This is a prospective 32-month study of all HIV positive patients diagnosed with histoplasmosis in the Departments of Anatomical Pathology and Dermatology, Nelson R. Mandela School of Medicine and King Edward VIII Hospital, Durban, South Africa. Clinical distribution and morphology of the individual skin lesions and CD4+ lymphocyte counts in the peripheral blood were analysed in relation to the histopathological features of biopsied lesional tissue. Ultrastructural examination of tissue retrieved from the wax blocks of three cases that exhibited dermal karyorrhexis and collagen necrosis was undertaken. Fungal culture of lesional skin tissue was undertaken in all patients. Twenty-one biopsies of papules (7), nodules (4), plaques (5), erythema multiforme-like lesions (2), vasculitic lesions (2) and exfoliative dermatitis (1) from 14 patients were examined. Of four biopsies (CD4 range: 120-128 cells/mm3) one and three demonstrated necrotizing and non-necrotizing granulomatous inflammation with a paucity of intrahistiocytic microorganisms. Seven biopsies (CD4 range: 2-56 cells/mm3) demonstrated diffuse dermal and intravascular accumulation of histiocytes densely parasitized by Histoplasma capsulatum var. capsulatum. Vasculitis, karyorrhexis or collagen necrosis was not present. Ten biopsies (CD4 range: 2-72 cells/mm3) demonstrated diffuse dermal karyorrhexis, collagen necrosis and interstitial, extracellular H. capsulatum var. capsulatum. Histiocytic disintegration and nuclear fragmentation and release of intact microorganisms and intact and ruptured lysosomes were identified ultrastructurally. Leucocytoclastic vasculitis was present in two biopsies of vasculitic clinical morphology. Microbiological culture confirmed histoplasmosis in all cases. Three patients died before treatment was commenced. Two patients died within the first two days of induction of therapy. Nine patients demonstrated dramatic healing of the cutaneous lesions. Despite the clinicopathological spectrum of DCH and the attendant host immunocompromise, timely and appropriate treatment of DCH may be lifesaving and allows rapid healing of skin lesions. A high index of clinical suspicion and skin biopsies and culture are crucial for accurate diagnosis.

Lessons Learned from the On-Site Distillation of Used Solvents Generated by Health Care Facilities.

ERIC Educational Resources Information Center

Huang, Ching-San; Ciesla, John

1992-01-01

Discusses the sources of contaminants found in used solvents generated by the histopathological laboratories at health care facilities and the technical problems, corrective measures, and economic analysis associated with the on-site recycling and reusing of these solvents. An appendix contains an economic analysis for a used-solvent recycling…

Hepatic lipidosis associated with cobalt deficiency in Omani goats.

PubMed

Johnson, E H; Muirhead, D E; Annamalai, K; King, G J; Al-Busaidy, R; Hameed, M S

1999-06-01

Livers from 36 of 684 (5.3%) apparently healthy goats examined at an abattoir in the greater Muscat area of Oman exhibited gross pathological findings characterized by extremely pale, friable, fatty livers encompassing the entire organ. Histopathologically, diffuse hepatic lipidosis and occasional bile duct proliferation were observed. Periodic acid Schiff-positive, diastase-resistant pigment was observed in the macrophages lining the sinusoids. These histopathological lesions were consistent with those characteristic of ovine white liver disease. Cobalt analysis revealed that normal livers had six times more cobalt and a 3-fold less fat content than those measured in the fatty livers. This is the first report of an association between cobalt deficiency and hepatic lipidosis in Omani goats.

Clear cell adenocarcinoma of cervix in 1-year-old girl without in utero exposure to diethylstilbestrol: an uncommon tumour at an uncommon age and site.

PubMed

Arora, Aditi; Rastogi, Anurag; Neyaz, Azfar; Husain, Nuzhat

2017-03-16

Adenocarcinoma of cervix constitutes about 10-15% cases of carcinoma cervix. Clear cell variant is even a rarer variant of adenocarcinoma. It rarely occurs in the paediatric age group and a known risk factor is in utero exposure to diethylstilbestrol (DES). We report here a case of primary cervical tumour in a 1-year-old girl, which was initially suspected to be an embryonal rhabdomyosarcoma botryoides. Histopathology with immunohistochemical analysis revealed clear cell adenocarcinoma. There was no maternal history of DES intake during pregnancy. We discuss the histopathological characteristics and clinical course of this unusual tumour. 2017 BMJ Publishing Group Ltd.

Cutaneous angiosarcoma mimicking xanthoma: a challenging histopathologic diagnosis with important consequences.

PubMed

Llamas-Velasco, Mar; Kutzner, Heinz; Requena, Luis

2016-09-01

Cutaneous angiosarcoma may show protean histopathologic features. Rare or uncommon variants include epithelioid, clear cell, granular cell, verrucous, pseudolymphomatous and signet-ring cell types. Perhaps the rarest type consists of cutaneous angiosarcoma with xanthomization of neoplastic cells. We report an extraordinary case with almost all neoplastic cells exhibiting a xanthomatous appearance that was studied both histopathologically and immunohistochemically. We discuss the histopathologic differential diagnosis of foamy cell angiosarcoma with other neoplasms that may show similar histopathology. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Evaluation of T1/T2 ratios in a pilot study as a potential biomarker of biopsy: proven benign and malignant breast lesions in correlation with histopathological disease stage.

PubMed

Malikova, Marina A; Tkacz, Jaroslaw N; Slanetz, Priscilla J; Guo, Chao-Yu; Aakil, Adam; Jara, Hernan

2017-08-01

Early breast cancer detection is important for intervention and prognosis. Advances in treatment and outcome require diagnostic tools with highly positive predictive value. To study the potential role of quantitative MRI (qMRI) using T1/T2 ratios to differentiate benign from malignant breast lesions. A cross-sectional study of 69 women with 69 known or suspicious breast lesions were scanned with mixed-turbo spin echo pulse sequence. Patients were grouped according to histopathological assessment of disease stage: untreated malignant tumor, treated malignancy and benign disease. Elevated T1/T2 means were observed for biopsy-proven malignant lesions and for malignant lesions treated prior to qMRI with chemotherapy and/or radiation, as compared with benign lesions. The qMRI-obtained T1/T2 ratios correlated with histopathology. Analysis revealed correlation between elevated T1/T2 ratio and disease stage. This could provide valuable complementary information on tissue properties as an additional diagnostic tool.

Histopathological examination of nerve samples from pure neural leprosy patients: obtaining maximum information to improve diagnostic efficiency.

PubMed

Antunes, Sérgio Luiz Gomes; Chimelli, Leila; Jardim, Márcia Rodrigues; Vital, Robson Teixeira; Nery, José Augusto da Costa; Corte-Real, Suzana; Hacker, Mariana Andréa Vilas Boas; Sarno, Euzenir Nunes

2012-03-01

Nerve biopsy examination is an important auxiliary procedure for diagnosing pure neural leprosy (PNL). When acid-fast bacilli (AFB) are not detected in the nerve sample, the value of other nonspecific histological alterations should be considered along with pertinent clinical, electroneuromyographical and laboratory data (the detection of Mycobacterium leprae DNA with polymerase chain reaction and the detection of serum anti-phenolic glycolipid 1 antibodies) to support a possible or probable PNL diagnosis. Three hundred forty nerve samples [144 from PNL patients and 196 from patients with non-leprosy peripheral neuropathies (NLN)] were examined. Both AFB-negative and AFB-positive PNL samples had more frequent histopathological alterations (epithelioid granulomas, mononuclear infiltrates, fibrosis, perineurial and subperineurial oedema and decreased numbers of myelinated fibres) than the NLN group. Multivariate analysis revealed that independently, mononuclear infiltrate and perineurial fibrosis were more common in the PNL group and were able to correctly classify AFB-negative PNL samples. These results indicate that even in the absence of AFB, these histopathological nerve alterations may justify a PNL diagnosis when observed in conjunction with pertinent clinical, epidemiological and laboratory data.

The protective effect of infliximab on cisplatin-induced intestinal tissue toxicity.

PubMed

Aydin, I; Kalkan, Y; Ozer, E; Yucel, A F; Pergel, A; Cure, E; Cure, M C; Sahin, D A

2014-01-01

Cisplatin (CP) is a popular chemotherapeutic agent. However, high doses of CP may lead to severe side effects to the gastrointestinal system. The aim of this study was to investigate the protective effects of infliximab on small intestine injury induced by high doses of CP. The A total of 30 rats were equally divided into three groups, including sham (C), cisplatin (CP), and cisplatin + infliximab (CPI). The CP group was treated with 7 mg/kg intraperitoneal cisplatin, and a laparotomy was performed 5 days later. The CPI group received 7 mg/kg infliximab intraperitoneally, were administered 7 mg/kg cisplatin 4 days later, and a laparotomy was performed 5 days after receiving cisplatin. Histopathological and immunohistochemical analysis of small intestine tissue sections were performed, and superoxide dismutase, malondialdehyde, and TNF-α levels were measured. Histopathological evaluation revealed that the CP group had damage in the epithelium and connective tissue, but this damage was significantly improved in the CPI group (p < 0.05). In addition, these histopathological findings were confirmed by biochemical analyses. These results suggest that infliximab is protective against the adverse effects of CP.

Preoperative evaluation of patients with squamous cell carcinoma of the oral cavity: fluorine-18 fluorodeoxyglucose positron emission tomography/computed tomography and ultrasonography versus histopathology.

PubMed

Sugawara, Chieko; Takahashi, Akira; Kubo, Michiko; Otsuka, Hideki; Ishimaru, Naozumi; Miyamoto, Youji; Honda, Eiichi

2012-10-01

The purpose of this retrospective study was to compare fluorine-18 fluorodeoxyglucose positron emission tomography/computed tomography (PET/CT) and ultrasonography (US) in the staging of patients with squamous cell carcinoma of the oral cavity. We compared preoperative evaluations regarding lymph nodes using PET/CT, US, and both methods. The cutoff for the maximum standardized uptake value (SUV(max)) in PET/CT was set at 2.7 by a receiver operating characteristic analysis that was based on the histopathological diagnosis. US was used to examine internal structural changes on B-mode and hilar vascularity on power Doppler. The performance of PET/CT and US in combination was better than that of each modality separately. However, there were histopathological changes that could not be detected on PET/CT or US. PET/CT could not detect nodes with necrotic or cystic changes. US could not detect lymph nodes that did not have abnormal structures. PET/CT and US are complementary tools to evaluate preoperative patients. Copyright © 2012 Elsevier Inc. All rights reserved.

The Vital Role of Pathology in Improving Reproducibility and Translational Relevance of Aging Studies in Rodents

PubMed Central

Treuting, Piper M.; Snyder, Jessica M.; Ikeno, Yuji; Schofield, Paul N.; Ward, Jerrold M.; Sundberg, John P.

2016-01-01

Pathology is a discipline of medicine that adds great benefit to aging studies of mice by integrating in vivo, biochemical, and molecular data. It is not possible to diagnose systemic illness, co-morbidities, and proximate causes of death in aging studies without the morphologic context provided by histopathology. To date, many rodent aging studies do not utilize endpoints supported by systematic histopathology, which leaves studies incomplete, contradictory, and difficult to interpret. Similar to traditional toxicity studies, if the effect of a drug, dietary treatment, or altered gene expression on aging is to be studied, systematic pathology analysis must be included to determine the causes of age-related illness, moribundity, and death. In this Commentary we discuss the factors which should be considered in the design of aging studies in mice, with the inclusion of robust pathology practices modified after those developed by toxicologic and discovery research pathologists. Investigators in the field of aging must consider the use of histopathology in their rodent aging studies in this era of integrative and preclinical geriatric science (geroscience). PMID:26792843

The Vital Role of Pathology in Improving Reproducibility and Translational Relevance of Aging Studies in Rodents.

PubMed

Treuting, P M; Snyder, J M; Ikeno, Y; Schofield, P N; Ward, J M; Sundberg, J P

2016-03-01

Pathology is a discipline of medicine that adds great benefit to aging studies of rodents by integrating in vivo, biochemical, and molecular data. It is not possible to diagnose systemic illness, comorbidities, and proximate causes of death in aging studies without the morphologic context provided by histopathology. To date, many rodent aging studies do not utilize end points supported by systematic necropsy and histopathology, which leaves studies incomplete, contradictory, and difficult to interpret. As in traditional toxicity studies, if the effect of a drug, dietary treatment, or altered gene expression on aging is to be studied, systematic pathology analysis must be included to determine the causes of age-related illness, moribundity, and death. In this Commentary, the authors discuss the factors that should be considered in the design of aging studies in mice, with the inclusion of robust pathology practices modified after those developed by toxicologic and discovery research pathologists. Investigators in the field of aging must consider the use of histopathology in their rodent aging studies in this era of integrative and preclinical geriatric science (geroscience). © The Author(s) 2016.

Real-Time Optical Biopsy of Colon Polyps With Narrow Band Imaging in Community Practice Does Not Yet Meet Key Thresholds for Clinical Decisions

PubMed Central

LADABAUM, URI; FIORITTO, ANN; MITANI, AYA; DESAI, MANISHA; KIM, JANE P.; REX, DOUGLAS K.; IMPERIALE, THOMAS; GUNARATNAM, NARESH

2017-01-01

BACKGROUND & AIMS Accurate optical analysis of colorectal polyps (optical biopsy) could prevent unnecessary polypectomies or allow a “resect and discard” strategy with surveillance intervals determined based on the results of the optical biopsy; this could be less expensive than histopathologic analysis of polyps. We prospectively evaluated real-time optical biopsy analysis of polyps with narrow band imaging (NBI) by community-based gastroenterologists. METHODS We first analyzed a computerized module to train gastroenterologists (N = 13) in optical biopsy skills using photographs of polyps. Then we evaluated a practice-based learning program for these gastroenterologists (n = 12) that included real-time optical analysis of polyps in vivo, comparison of optical biopsy predictions to histopathologic analysis, and ongoing feedback on performance. RESULTS Twelve of 13 subjects identified adenomas with >90% accuracy at the end of the computer study, and 3 of 12 subjects did so with accuracy ≥90% in the in vivo study. Learning curves showed considerable variation among batches of polyps. For diminutive rectosigmoid polyps assessed with high confidence at the end of the study, adenomas were identified with mean (95% confidence interval [CI]) accuracy, sensitivity, specificity, and negative predictive values of 81% (73%–89%), 85% (74%–96%), 78% (66%–92%), and 91% (86%–97%), respectively. The adjusted odds ratio for high confidence as a predictor of accuracy was 1.8 (95% CI, 1.3–2.5). The agreement between surveillance recommendations informed by high-confidence NBI analysis of diminutive polyps and results from histopathologic analysis of all polyps was 80% (95% CI, 77%–82%). CONCLUSIONS In an evaluation of real-time optical biopsy analysis of polyps with NBI, only 25% of gastroenterologists assessed polyps with ≥90% accuracy. The negative predictive value for identification of adenomas, but not the surveillance interval agreement, met the American Society for Gastrointestinal Endoscopy–recommended thresholds for optical biopsy. Better results in community practice must be achieved before NBI-based optical biopsy methods can be used routinely to evaluate polyps; ClinicalTrials.gov number, NCT01638091. PMID:23041328

Molecular and histopathological detection of Hepatozoon canis in red foxes (Vulpes vulpes) from Portugal.

PubMed

Cardoso, Luís; Cortes, Helder C E; Eyal, Osnat; Reis, Antónia; Lopes, Ana Patrícia; Vila-Viçosa, Maria João; Rodrigues, Paula A; Baneth, Gad

2014-03-24

Hepatozoon canis is a protozoan tick-borne pathogen of dogs and wild canids. Hepatozoon spp. have been reported to infect foxes in different continents and recent studies have mostly used the polymerase chain reaction (PCR) for the detection and characterization of the infecting species. Surveying red foxes (Vulpes vulpes) may contribute to better understanding the epidemiology of canine vector-borne diseases, including hepatozoonosis caused by H. canis in domestic dogs. The present study investigated the prevalence of Hepatozoon spp. by means of histopathology and molecular analysis of different tissues in red foxes from different parts of Portugal. Blood and tissues including bone marrow, heart, hind leg muscle, jejunum, kidney, liver, lung, popliteal or axillary lymph nodes, spleen and/or tongue were collected from 91 red foxes from eight districts in northern, central and southern Portugal. Tissues were formalin-fixed, paraffin-embedded, cut and stained with hematoxylin and eosin. Polymerase chain reaction (PCR) amplified a ~650 bp fragment of the 18S rRNA gene of Hepatozoon spp. and the DNA products were sequenced. Hepatozoon canis was detected in 68 out of 90 foxes (75.6%) from all the sampled areas by PCR and sequencing. Histopathology revealed H. canis meronts similar in shape to those found in dogs in the bone marrow of 11 (23.4%) and in the spleen of two (4.3%) out of 47 foxes (p = 0.007). All the 11 foxes found positive by histopathology were also positive by PCR of bone marrow and/or blood. Positivity by PCR (83.0%) was significantly higher (p < 0.001) than by histopathological examination (23.4%) in paired bone marrow samples from the same 47 foxes. Sequences of the 18S rRNA gene of H. canis were 98-99% identical to those in GenBank. Hepatozoon canis was found to be highly prevalent in red fox populations from northern, central and southern Portugal. Detection of the parasite by histopathology was significantly less sensitive than by PCR. Red foxes are a presumptive reservoir of H. canis infection for domestic dogs.

Molecular and histopathological detection of Hepatozoon canis in red foxes (Vulpes vulpes) from Portugal

PubMed Central

2014-01-01

Background Hepatozoon canis is a protozoan tick-borne pathogen of dogs and wild canids. Hepatozoon spp. have been reported to infect foxes in different continents and recent studies have mostly used the polymerase chain reaction (PCR) for the detection and characterization of the infecting species. Surveying red foxes (Vulpes vulpes) may contribute to better understanding the epidemiology of canine vector-borne diseases, including hepatozoonosis caused by H. canis in domestic dogs. The present study investigated the prevalence of Hepatozoon spp. by means of histopathology and molecular analysis of different tissues in red foxes from different parts of Portugal. Methods Blood and tissues including bone marrow, heart, hind leg muscle, jejunum, kidney, liver, lung, popliteal or axillary lymph nodes, spleen and/or tongue were collected from 91 red foxes from eight districts in northern, central and southern Portugal. Tissues were formalin-fixed, paraffin-embedded, cut and stained with hematoxylin and eosin. Polymerase chain reaction (PCR) amplified a ~650 bp fragment of the 18S rRNA gene of Hepatozoon spp. and the DNA products were sequenced. Results Hepatozoon canis was detected in 68 out of 90 foxes (75.6%) from all the sampled areas by PCR and sequencing. Histopathology revealed H. canis meronts similar in shape to those found in dogs in the bone marrow of 11 (23.4%) and in the spleen of two (4.3%) out of 47 foxes (p = 0.007). All the 11 foxes found positive by histopathology were also positive by PCR of bone marrow and/or blood. Positivity by PCR (83.0%) was significantly higher (p < 0.001) than by histopathological examination (23.4%) in paired bone marrow samples from the same 47 foxes. Sequences of the 18S rRNA gene of H. canis were 98–99% identical to those in GenBank. Conclusions Hepatozoon canis was found to be highly prevalent in red fox populations from northern, central and southern Portugal. Detection of the parasite by histopathology was significantly less sensitive than by PCR. Red foxes are a presumptive reservoir of H. canis infection for domestic dogs. PMID:24655375

Unusually large complex odontoma in maxillary sinus associated with unerupted tooth. Report of case and review of literature.

PubMed

Singer, Steven R; Mupparapu, Muralidhar; Milles, Maano; Rinaggio, Joseph; Pisano, Dominic; Quaranta, Patrick

2007-01-01

An unusual case of a large complex odontoma with an associated impacted tooth is presented. Odontomas are hamartomatous growths of enamel, dentin, cementum and pulp tissue. Although they are usually tooth-sized or smaller, occasionally, the complex variant can exhibit considerable growth, as was seen in the case presented here. It occupied most of the maxillary sinus and displaced the floor of the orbit and the medial and posterior walls of the left maxillary sinus. Panoramic radiographs, as well as axial and coronal CT studies, showed the extent of the lesion in various dimensions. A differential diagnosis of various calcifying tumors was formulated on the basis of these findings. The lesion was surgically excised, and histologic analysis confirmed the radiographic impression. Although odontomas of this magnitude are rare, this case demonstrates the value of imaging, radiographic histopathologic diagnosis and surgical treatment planning prior to any definitive treatment.

Saccharomyces boulardii Administration Changes Gut Microbiota and Attenuates D-Galactosamine-Induced Liver Injury.

PubMed

Yu, Lei; Zhao, Xue-Ke; Cheng, Ming-Liang; Yang, Guo-Zhen; Wang, Bi; Liu, Hua-Juan; Hu, Ya-Xin; Zhu, Li-Li; Zhang, Shuai; Xiao, Zi-Wen; Liu, Yong-Mei; Zhang, Bao-Fang; Mu, Mao

2017-05-02

Growing evidence has shown that gut microbiome is a key factor involved in liver health. Therefore, gut microbiota modulation with probiotic bacteria, such as Saccharomyces boulardii, constitutes a promising therapy for hepatosis. In this study, we aimed to investigate the protective effects of S. boulardii on D-Galactosamine-induced liver injury in mice. Liver function test and histopathological analysis both suggested that the liver injury can be effectively attenuated by S. boulardii administration. In the meantime, S. boulardii induced dramatic changes in the gut microbial composition. At the phylum level, we found that S. boulardii significantly increased in the relative abundance of Bacteroidetes, and decreased the relative abundance of Firmicutes and Proteobacteria, which may explain the hepatic protective effects of S. boulardii. Taken together, our results demonstrated that S. boulardii administration could change the gut microbiota in mice and alleviate acute liver failure, indicating a potential protective and therapeutic role of S. boulardii.

Case report of cutaneous protothecosis caused by Prototheca wickerhamii designated as genotype 2 and current status of human protothecosis in Japan.

PubMed

Inoue, Maki; Miyashita, Azusa; Noguchi, Hiromitsu; Hirose, Noriyuki; Nishimura, Kazuko; Masuda, Michiaki; Ihn, Hironobu

2018-01-01

An 85-year-old Japanese woman presented with infiltrative erythema and ulceration on the extensor surface of her right forearm. Direct microscopic examination demonstrated spherical and morula-like sporangia, while histopathology revealed numerous microorganisms with a mulberry-like appearance in the dermis. Staining of the microorganisms also showed mulberry-like sporangia that resembled the spokes of a wheel. The isolated yeast-like microorganism had been identified as Prototheca wickerhamii genotype 2 in another independent study on the basis of its morphological, biochemical and genetic analysis. This case of protothecosis was recorded in Kyushu, Japan, and oral treatment with itraconazole 200 mg/day for 2 months was effective. Herein, we also summarize and analyze 39 cases of human protothecosis reported in Japan since the first record in 1983. © 2017 Japanese Dermatological Association.

Automated classification of multiphoton microscopy images of ovarian tissue using deep learning.

PubMed

Huttunen, Mikko J; Hassan, Abdurahman; McCloskey, Curtis W; Fasih, Sijyl; Upham, Jeremy; Vanderhyden, Barbara C; Boyd, Robert W; Murugkar, Sangeeta

2018-06-01

Histopathological image analysis of stained tissue slides is routinely used in tumor detection and classification. However, diagnosis requires a highly trained pathologist and can thus be time-consuming, labor-intensive, and potentially risk bias. Here, we demonstrate a potential complementary approach for diagnosis. We show that multiphoton microscopy images from unstained, reproductive tissues can be robustly classified using deep learning techniques. We fine-train four pretrained convolutional neural networks using over 200 murine tissue images based on combined second-harmonic generation and two-photon excitation fluorescence contrast, to classify the tissues either as healthy or associated with high-grade serous carcinoma with over 95% sensitivity and 97% specificity. Our approach shows promise for applications involving automated disease diagnosis. It could also be readily applied to other tissues, diseases, and related classification problems. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

Polarization-resolved second-harmonic generation imaging for liver fibrosis assessment without labeling

NASA Astrophysics Data System (ADS)

Lin, Jian; Pan, Shiying; Zheng, Wei; Huang, Zhiwei

2013-10-01

We apply the polarization-resolved second-harmonic generation (PR-SHG) microscopy to investigate the changes of collagen typings (type I vs type III) and collagen fibril orientations of liver tissue in bile-duct-ligation (BDL) rat models. The PR-SHG results show that the second-order susceptibility tensor ratios (χ31/χ15 and χ33/χ15) of collagen fibers increase with liver fibrotic progression after BDL surgery, reflecting an increase of the type III collagen component with the severity of liver fibrosis; and the square root of the collagen type III to type I ratio linearly correlates (R2 = 0.98) with histopathological scores. Furthermore, the collagen fibril orientations become more random with liver fibrosis transformation as compared to normal liver tissue. This work demonstrates that PR-SHG microscopy has the potential for label-free diagnosis and characterization of liver fibrosis based on quantitative analysis of collagen typings and fibril orientations.

A clinical report demonstrating the significance of distinguishing a nasopalatine duct cyst from a radicular cyst

PubMed Central

Aparna, Manikkath; Chakravarthy, Arumugam; Acharya, Shashi Rashmi; Radhakrishnan, Raghu

2014-01-01

Endodontic diagnosis is challenging and depends on the organisation of information from the patient history, clinical examination and analysis of the pulp, radiographic and histopathological assessment. A 35-year-old man was endodontically treated for radiolucency in relation to the roots of maxillary central incisors as it was a provisionally diagnosed case of radicular cyst. Since the palatal swelling persisted, the lesion was re-evaluated using relevant diagnostic aids and a diagnosis of nasopalatine duct cyst (NPDC) was made, which was missed during the initial assessment. An erroneous interpretation of cystic radiolucency in relation to maxillary central incisors can often lead to inappropriate treatment planning. This case highlights the relevant aspects in the diagnosis of NPDC when it is mistaken for a radicular cyst and emphasises the need for thorough clinical examination and relevant investigations for periapical radiolucencies of questionable origin before initiating endodontic therapy. PMID:24642171

Olfactory neuroblastoma in dogs and cats--a histological and immunohistochemical analysis.

PubMed

Brosinski, K; Janik, D; Polkinghorne, A; Von Bomhard, W; Schmahl, W

2012-01-01

Olfactory neuroblastoma (ONB) was identified in 13 dogs and nine cats. The tumours were subjected to microscopical examination and were graded using a human pathological grading system. In the canine and feline tumours there was more necrosis and higher mitotic activity (mitotic index and Ki67 labelling index) than reported in human ONB. Rosettes were a common feature of feline ONBs. A significant correlation was observed between the histological grade and the Ki67 labelling index. The histopathological diagnosis of ONB was confirmed immunohistochemically by demonstration of the neuronal marker neuron-specific enolase (NSE). Two other neuron-specific antibodies specific for microtubule-associated protein-2 (MAP-2) and neuronal nuclei antigen (NeuN) were evaluated. MAP-2 expression proved to have higher specificity than labelling for NSE. NeuN expression was less sensitive and of limited practical value. Copyright © 2011 Elsevier Ltd. All rights reserved.

Differentiation of early from advanced coronary atherosclerotic lesions: systematic comparison of CT, intravascular US, and optical frequency domain imaging with histopathologic examination in ex vivo human hearts.

PubMed

Maurovich-Horvat, Pál; Schlett, Christopher L; Alkadhi, Hatem; Nakano, Masataka; Stolzmann, Paul; Vorpahl, Marc; Scheffel, Hans; Tanaka, Atsushi; Warger, William C; Maehara, Akiko; Ma, Shixin; Kriegel, Matthias F; Kaple, Ryan K; Seifarth, Harald; Bamberg, Fabian; Mintz, Gary S; Tearney, Guillermo J; Virmani, Renu; Hoffmann, Udo

2012-11-01

To establish an ex vivo experimental setup for imaging coronary atherosclerosis with coronary computed tomographic (CT) angiography, intravascular ultrasonography (US), and optical frequency domain imaging (OFDI) and to investigate their ability to help differentiate early from advanced coronary plaques. All procedures were performed in accordance with local and federal regulations and the Declaration of Helsinki. Approval of the local Ethics Committee was obtained. Overall, 379 histologic cuts from nine coronary arteries from three donor hearts were acquired, coregistered among modalities, and assessed for the presence and composition of atherosclerotic plaque. To assess the discriminatory capacity of the different modalities in the detection of advanced lesions, c statistic analysis was used. Interobserver agreement was assessed with the Cohen κ statistic. Cross sections without plaque at coronary CT angiography and with fibrous plaque at OFDI almost never showed advanced lesions at histopathologic examination (odds ratio [OR]: 0.02 and 0.06, respectively; both P<.0001), while mixed plaque at coronary CT angiography, calcified plaque at intravascular US, and lipid-rich plaque at OFDI were associated with advanced lesions (OR: 2.49, P=.0003; OR: 2.60, P=.002; and OR: 31.2, P<.0001, respectively). OFDI had higher accuracy for discriminating early from advanced lesions than intravascular US and coronary CT angiography (area under the receiver operating characteristic curve: 0.858 [95% confidence interval {CI}: 0.802, 0.913], 0.631 [95% CI: 0.554, 0.709], and 0.679 [95% CI: 0.618, 0.740]; respectively, P<.0001). Interobserver agreement was excellent for OFDI and coronary CT angiography (κ=0.87 and 0.85, respectively) and was good for intravascular US (κ=0.66). Systematic and standardized comparison between invasive and noninvasive modalities for coronary plaque characterization in ex vivo specimens demonstrated that coronary CT angiography and intravascular US are reasonably associated with plaque composition and lesion grading according to histopathologic findings, while OFDI was strongly associated. These data may help to develop initial concepts of sequential imaging strategies to identify patients with advanced coronary plaques. © RSNA, 2012

The EpiOcular™ Eye Irritation Test is the Method of Choice for the In Vitro Eye Irritation Testing of Agrochemical Formulations: Correlation Analysis of EpiOcular Eye Irritation Test and BCOP Test Data According to the UN GHS, US EPA and Brazil ANVISA Classification Schemes.

PubMed

Kolle, Susanne N; Rey Moreno, Maria Cecilia; Mayer, Winfried; van Cott, Andrew; van Ravenzwaay, Bennard; Landsiedel, Robert

2015-07-01

The Bovine Corneal Opacity and Permeability (BCOP) test is commonly used for the identification of severe ocular irritants (GHS Category 1), but it is not recommended for the identification of ocular irritants (GHS Category 2). The incorporation of human reconstructed tissue model-based tests into a tiered test strategy to identify ocular non-irritants and replace the Draize rabbit eye irritation test has been suggested (OECD TG 405). The value of the EpiOcular™ Eye Irritation Test (EIT) for the prediction of ocular non-irritants (GHS No Category) has been demonstrated, and an OECD Test Guideline (TG) was drafted in 2014. The purpose of this study was to evaluate whether the BCOP test, in conjunction with corneal histopathology (as suggested for the evaluation of the depth of the injury( and/or the EpiOcular-EIT, could be used to predict the eye irritation potential of agrochemical formulations according to the UN GHS, US EPA and Brazil ANVISA classification schemes. We have assessed opacity, permeability and histopathology in the BCOP assay, and relative tissue viability in the EpiOcular-EIT, for 97 agrochemical formulations with available in vivo eye irritation data. By using the OECD TG 437 protocol for liquids, the BCOP test did not result in sufficient correct predictions of severe ocular irritants for any of the three classification schemes. The lack of sensitivity could be improved somewhat by the inclusion of corneal histopathology, but the relative viability in the EpiOcular-EIT clearly outperformed the BCOP test for all three classification schemes. The predictive capacity of the EpiOcular-EIT for ocular non-irritants (UN GHS No Category) for the 97 agrochemical formulations tested (91% sensitivity, 72% specificity and 82% accuracy for UN GHS classification) was comparable to that obtained in the formal validation exercise underlying the OECD draft TG. We therefore conclude that the EpiOcular-EIT is currently the best in vitro method for the prediction of the eye irritation potential of liquid agrochemical formulations. 2015 FRAME.

Histopathological and Immunohistochemical Evaluation of Pannus Tissue in Patients with Prosthetic Valve Dysfunction.

PubMed

Karakoyun, Süleyman; Ozan Gürsoy, Mustafa; Yesin, Mahmut; Kalçık, Macit; Astarcıoğlu, Mehmet Ali; Gündüz, Sabahattin; Emrah Oğuz, Ali; Çoban Kökten, Şermin; Nimet Karadayı, Ayşe; Tuncer, Altuğ; Köksal, Cengiz; Gökdeniz, Tayyar; Özkan, Mehmet

2016-01-01

Prosthetic valve dysfunction due to pannus formation is a rare but serious complication. Currently, limited data are available concerning the pathogenesis and immunohistochemical properties of pannus. The study aim was to investigate the morphological, histopathological and immunohistochemical characteristics of pannus formation in patients with prosthetic valve dysfunction. A total of 35 patients (10 males, 25 females; mean age 44 ± 16 years) who had undergone re-do valve surgery due to prosthetic valve obstruction was enrolled in the study. Immunohistochemical studies were aimed at evaluating the expression of alphasmooth muscle actin (α-SMA) and desmin in myofibroblasts and smooth muscle cells; epithelial membrane antigen (EMA) in epithelial cells; and CD34, Factor VIII and vascular endothelial growth factor (VEGF) in endothelial cells. Matrix metalloproteinases (MMPs) -2 and -9, and transforming growth factor-beta (TGF-β) were used to demonstrate cytokine release from macrophages, leukocytes, fibroblasts and myofibroblasts. Pannus appeared as a tough and thick tissue hyperplasia which began from outside the suture ring in the periannular region and extended to the inflow and outflow surfaces of the prosthetic valves. Histopathological analysis showed the pannus tissue to consist of chronic inflammatory cells (lymphocytes, plasma cells, macrophages and foreign body giant cells), spindle cells such as myofibroblasts, capillary blood vessels and endothelial cells laying down the lumens. Calcification was present in the pannus tissue of 19 explanted prostheses. Immunohistochemical studies revealed positive α-SMA expression in all patients, whereas 60.5% of patients were positive for desmin, 50% for EMA, 42.1% for VEGF, 39.5% for TBF-β, 42.1% for MMP-2, 86.8% for CD34, and 97.4% for Factor VIII. MMP-9 was negative in all patients. Pannus tissue appears to be formed as the result of a neointimal response in periannular regions of prosthetic valves that consist of periannular tissue migration, myofibroblast and extracellular matrix proliferation with vascular components. It is a chronic active process in which mediators such as TGF-β, VEGF and MMP-2 play roles in both matrix formation and degradation.

High-throughput quantum cascade laser (QCL) spectral histopathology: a practical approach towards clinical translation.

PubMed

Pilling, Michael J; Henderson, Alex; Bird, Benjamin; Brown, Mick D; Clarke, Noel W; Gardner, Peter

2016-06-23

Infrared microscopy has become one of the key techniques in the biomedical research field for interrogating tissue. In partnership with multivariate analysis and machine learning techniques, it has become widely accepted as a method that can distinguish between normal and cancerous tissue with both high sensitivity and high specificity. While spectral histopathology (SHP) is highly promising for improved clinical diagnosis, several practical barriers currently exist, which need to be addressed before successful implementation in the clinic. Sample throughput and speed of acquisition are key barriers and have been driven by the high volume of samples awaiting histopathological examination. FTIR chemical imaging utilising FPA technology is currently state-of-the-art for infrared chemical imaging, and recent advances in its technology have dramatically reduced acquisition times. Despite this, infrared microscopy measurements on a tissue microarray (TMA), often encompassing several million spectra, takes several hours to acquire. The problem lies with the vast quantities of data that FTIR collects; each pixel in a chemical image is derived from a full infrared spectrum, itself composed of thousands of individual data points. Furthermore, data management is quickly becoming a barrier to clinical translation and poses the question of how to store these incessantly growing data sets. Recently, doubts have been raised as to whether the full spectral range is actually required for accurate disease diagnosis using SHP. These studies suggest that once spectral biomarkers have been predetermined it may be possible to diagnose disease based on a limited number of discrete spectral features. In this current study, we explore the possibility of utilising discrete frequency chemical imaging for acquiring high-throughput, high-resolution chemical images. Utilising a quantum cascade laser imaging microscope with discrete frequency collection at key diagnostic wavelengths, we demonstrate that we can diagnose prostate cancer with high sensitivity and specificity. Finally we extend the study to a large patient dataset utilising tissue microarrays, and show that high sensitivity and specificity can be achieved using high-throughput, rapid data collection, thereby paving the way for practical implementation in the clinic.

Molecular and Histopathological Changes in Mouse Intestinal Tissue after Proton Exposure

NASA Astrophysics Data System (ADS)

Purgason, Ashley; Zhang, Ye; Hamilton, Stanley; Wu, Honglu

Radiation in space, especially energetic protons emitted from solar particle events (SPEs), poses serious health risks to astronauts and is especially dangerous for long duration missions. Protons are the most abundant particles in space and to date there is little known about the details of the negative consequences crew members will face upon exposure to them. To elucidate some of the possible health effects induced by protons, BALB/C mice were subjected to 250 MeV of proton radiation at doses of 0 Gy, 0.1 Gy, 1 Gy, and 2 Gy. Three specimens per dose were studied. The gastrointestinal tract of each animal was dissected four hours post-irradiation and the isolated small intestinal tissue was fixed in formalin for histopathological examination or snap-frozen in liquid nitrogen for RNA isolation. Histopathologic observation of the tissue using standard HE staining methods to screen for morphologic changes showed a marked increase in apoptotic lesions for even the lowest dose of 0.1 Gy, and the dose response showed possible hyper sensitivities at low dose. Tissue of the gastrointestinal tract was also homogenized and RNA was isolated for cDNA synthesis and real-time PCR analysis for genes involved in apoptosis. Results of gene expression changes revealed consistent up or down regulation of a number of genes for all of the exposure doses that may play a role in proton-induced apoptosis (e.g. Hsp90ab1). In addition, several genes were found to have significant changes in the RNA level after only the low dose (0.1 Gy), but not the high dose (1 and 2 Gy), proton exposures (e.g. Bok and Casp1), whereas some genes had expression changes only after high dose proton exposures (e.g. Tsc22d3). These findings demonstrated that apoptosis may occur in gastrointestinal tracts after even low dose proton exposures, and the different gene expression patterns between low and high dose proton irradiated mice may offer insight into the molecular mechanisms of the possible hyper sensitivity at low proton doses.

Lyme carditis. Electrophysiologic and histopathologic study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reznick, J.W.; Braunstein, D.B.; Walsh, R.L.

1986-11-01

To further define the nature of Lyme carditis, electrophysiologic study and endomyocardial biopsy were performed in a patient with Lyme disease, whose principal cardiac manifestation was high-degree atrioventricular block. Intracardiac recording demonstrated supra-Hisian block and complete absence of an escape mechanism. Gallium 67 scanning demonstrated myocardial uptake, and right ventricular endomyocardial biopsy revealed active lymphocytic myocarditis. A structure compatible with a spirochetal organism was demonstrated in one biopsy specimen. It is concluded that Lyme disease can produce active myocarditis, as suggested by gallium 67 imaging and confirmed by endomyocardial biopsy. Furthermore, the presence of high-grade atrioventricular block in this diseasemore » requires aggressive management with temporary pacemaker and corticosteroid therapy.« less

Transcontinental communication and quantitative digital histopathology via the Internet; with special reference to prostate neoplasia

PubMed Central

Montironi, R; Thompson, D; Scarpelli, M; Bartels, H G; Hamilton, P W; Da Silva, V D; Sakr, W A; Weyn, B; Van Daele, A; Bartels, P H

2002-01-01

Objective: To describe practical experiences in the sharing of very large digital data bases of histopathological imagery via the Internet, by investigators working in Europe, North America, and South America. Materials: Experiences derived from medium power (sampling density 2.4 pixels/μm) and high power (6 pixels/μm) imagery of prostatic tissues, skin shave biopsies, breast lesions, endometrial sections, and colonic lesions. Most of the data included in this paper were from prostate. In particular, 1168 histological images of normal prostate, high grade prostatic intraepithelial neoplasia (PIN), and prostate cancer (PCa) were recorded, archived in an image format developed at the Optical Sciences Center (OSC), University of Arizona, and transmitted to Ancona, Italy, as JPEG (joint photographic experts group) files. Images were downloaded for review using the Internet application FTP (file transfer protocol). The images were then sent from Ancona to other laboratories for additional histopathological review and quantitative analyses. They were viewed using Adobe Photoshop, Paint Shop Pro, and Imaging for Windows. For karyometric analysis full resolution imagery was used, whereas histometric analyses were carried out on JPEG imagery also. Results: The three applications of the telecommunication system were remote histopathological assessment, remote data acquisition, and selection of material. Typical data volumes for each project ranged from 120 megabytes to one gigabyte, and transmission times were usually less than one hour. There were only negligible transmission errors, and no problem in efficient communication, although real time communication was an exception, because of the time zone differences. As far as the remote histopathological assessment of the prostate was concerned, agreement between the pathologist's electronic diagnosis and the diagnostic label applied to the images by the recording scientist was present in 96.6% of instances. When these images were forwarded to two pathologists, the level of concordance with the reviewing pathologist who originally downloaded the files from Tucson was as high as 97.2% and 98.0%. Initial results of studies made by researchers belonging to our group but located in others laboratories showed the feasibility of making quantitative analysis on the same images. Conclusions: These experiences show that diagnostic teleconsultation and quantitative image analyses via the Internet are not only feasible, but practical, and allow a close collaboration between researchers widely separated by geographical distance and analytical resources. PMID:12037030

Measurement of the perfusion fraction in brain tumors with intravoxel incoherent motion MR imaging: validation with histopathological vascular density in meningiomas.

PubMed

Togao, Osamu; Hiwatashi, Akio; Yamashita, Koji; Kikuchi, Kazufumi; Momosaka, Daichi; Yoshimoto, Koji; Kuga, Daisuke; Mizoguchi, Masahiro; Suzuki, Satoshi O; Iwaki, Toru; Van Cauteren, Marc; Iihara, Koji; Honda, Hiroshi

2018-05-01

To evaluate the quantification performance of the perfusion fraction (f) measured with intravoxel incoherent motion (IVIM) MR imaging in a comparison with the histological vascular density in meningiomas. 29 consecutive patients with meningioma (59.0 ± 16.8 years old, 8 males and 21 females) who underwent a subsequent surgical resection were examined with both IVIM imaging and a histopathological analysis. IVIM imaging was conducted using a single-shot SE-EPI sequence with 13 b-factors (0, 10, 20, 30, 50, 80, 100, 200, 300, 400, 600, 800, 1000 s mm - 2 ) at 3T. The perfusion fraction (f) was calculated by fitting the IVIM bi-exponential model. The 90-percentile f-value in the tumor region-of-interest (ROI) was defined as the maximum f-value (f-max). Histopathological vascular density (%Vessel) was measured on CD31-immunostainted histopathological specimens. The correlation and agreement between the f-values and %Vessel was assessed. The f-max (15.5 ± 5.5%) showed excellent agreement [intraclass correlation coefficient (ICC) = 0.754] and a significant correlation (r = 0.69, p < 0.0001) with the %Vessel (12.9 ± 9.4%) of the tumors. The Bland-Altman plot analysis showed excellent agreement between the f-max and %Vessel (bias, -2.6%; 95% limits of agreement, from -16.0 to 10.8%). The f-max was not significantly different among the histological subtypes of meningioma. An excellent agreement and a significant correlation were observed between the f-values and %Vessel. The f-value can be used as a noninvasive quantitative imaging measure to directly assess the vascular volume fraction in brain tumors. Advances in knowledge: The f-value measured by IVIM imaging showed a significant correlation and an excellent agreement with the histological vascular density in the meningiomas. The f-value can be used as a noninvasive and quantitative imaging measure to directly assess the volume fraction of capillaries in brain tumors.

Can Imaging Parameters Provide Information Regarding Histopathology in Head and Neck Squamous Cell Carcinoma? A Meta-Analysis.

PubMed

Surov, Alexey; Meyer, Hans Jonas; Wienke, Andreas

2018-04-01

Our purpose was to provide data regarding relationships between different imaging and histopathological parameters in HNSCC. MEDLINE library was screened for associations between different imaging parameters and histopathological features in HNSCC up to December 2017. Only papers containing correlation coefficients between different imaging parameters and histopathological findings were acquired for the analysis. Associations between 18 F-FDG positron emission tomography (PET) and KI 67 were reported in 8 studies (236 patients). The pooled correlation coefficient was 0.20 (95% CI = [-0.04; 0.44]). Furthermore, in 4 studies (64 patients), associations between 18 F-fluorothymidine PET and KI 67 were analyzed. The pooled correlation coefficient between SUV max and KI 67 was 0.28 (95% CI = [-0.06; 0.94]). In 2 studies (23 patients), relationships between KI 67 and dynamic contrast-enhanced magnetic resonance imaging were reported. The pooled correlation coefficient between K trans and KI 67 was -0.68 (95% CI = [-0.91; -0.44]). Two studies (31 patients) investigated correlation between apparent diffusion coefficient (ADC) and KI 67. The pooled correlation coefficient was -0.61 (95% CI = [-0.84; -0.38]). In 2 studies (117 patients), relationships between 18 F-FDG PET and p53 were analyzed. The pooled correlation coefficient was 0.0 (95% CI = [-0.87; 0.88]). There were 3 studies (48 patients) that investigated associations between ADC and tumor cell count in HNSCC. The pooled correlation coefficient was -0.53 (95% CI = [-0.74; -0.32]). Associations between 18 F-FDG PET and HIF-1α were investigated in 3 studies (72 patients). The pooled correlation coefficient was 0.44 (95% CI = [-0.20; 1.08]). ADC may predict cell count and proliferation activity, and SUV max may predict expression of HIF-1α in HNSCC. SUV max cannot be used as surrogate marker for expression of KI 67 and p53. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Synchronous Primary Cancers of the Endometrium and Ovary With the Same Histopathologic Type Versus Endometrial Cancer With Ovarian Metastasis: A Single Institution Review of 72 Cases.

PubMed

Bese, Tugan; Sal, Veysel; Kahramanoglu, Ilker; Tokgozoglu, Nedim; Demirkiran, Fuat; Turan, Hasan; Ilvan, Sennur; Arvas, Macit

2016-02-01

The purpose of this study was to evaluate the clinicopathological characteristics and survival outcomes of women with simultaneous endometrial and ovarian carcinomas having the same histopathologic type. A review of medical records from 1997 to 2015 identified 72 patients with simultaneous carcinomas of the endometrium and ovary with the same histopathologic type. Patients with synchronous primary cancers of endometrium and ovary (SCEOs) were compared with patients with primary endometrial cancer with ovarian metastasis (ECOM). Clinical and pathological data were obtained from the patients' medical records. Clinicopathological variables including categorical data were analyzed by χ(2) or Fisher exact test and continuous data by a Student t test. A Kaplan-Meier survival analysis was performed and compared by using the log-rank test. A univariate and multivariate analysis of 72 patients with SCEO with the same histopathologic type revealed that SCEO is an independent prognostic factor of 10-year overall survival. There were 31 patients in the SCEO group and 41 patients in the ECOM group. With a mean follow-up time of 68.2 months, the 10-year overall survival rates were 61.3% and 36.6% in SCEO and ECOM groups, respectively (P = 0.029). Age, menopausal status, stage of ovarian cancer, performing lymphadenectomy, grade of endometrial tumor, omental metastasis, and residual tumor were found to be significant risk factors for recurrence in the synchronous group. The differentiation between SCEO and ECOM is of great clinical importance while our results showed a better prognosis for patients with SCEO compared with patients with ECOM. More aggressive therapeutic approaches may be considered for patients with SCEO who are older, postmenopausal, and/or have advanced grade of endometrial tumor, omental metastasis, and residual tumor. Lymphadenectomy should be performed in every patient with SCEO.

Development and proof-of-concept of three-dimensional lung histology volumes

NASA Astrophysics Data System (ADS)

Mathew, Lindsay; Alabousi, Mostafa; Wheatley, Andrew; Aladl, Usaf; Slipetz, Deborah; Hogg, James C.; Fenster, Aaron; Parraga, Grace

2012-03-01

Most medical imaging is inherently three-dimensional (3D) but for validation of pathological findings, histopathology is commonly used and typically histopathology images are acquired as twodimensional slices with quantitative analysis performed in a single dimension. Histopathology is invasive, labour-intensive, and the analysis cannot be performed in real time, yet it remains the gold standard for the pathological diagnosis and validation of clinical or radiological diagnoses of disease. A major goal worldwide is to improve medical imaging resolution, sensitivity and specificity to better guide therapy and biopsy and to one day delay or replace biopsy. A key limitation however is the lack of tools to directly compare 3D macroscopic imaging acquired in patients with histopathology findings, typically provided in a single dimension (1D) or in two dimensions (2D). To directly address this, we developed methods for 2D histology slice visualization/registration to generate 3D volumes and quantified tissue components in the 3D volume for direct comparison to volumetric micro-CT and clinical CT. We used the elastase-instilled mouse emphysema lung model to evaluate our methods with murine lungs sectioned (5 μm thickness/10 μm gap) and digitized with 2μm in-plane resolution. 3D volumes were generated for wildtype and elastase mouse lung sections after semi-automated registration of all tissue slices. The 1D mean linear intercept (Lm) for wildtype (WT) (47.1 μm +/- 9.8 μm) and elastase mouse lung (64.5 μm +/- 14.0 μm) was significantly different (p<.001). We also generated 3D measurements based on tissue and airspace morphometry from the 3D volumes and all of these were significantly different (p<.0001) when comparing elastase and WT mouse lung. The ratio of the airspace-to-lung volume for the entire lung volume was also significantly and strongly correlated with Lm.

Enzymatic and histopathologic biomarkers as indicators of contaminant exposure and effect in Asian clam (Potamocorbula amurensis)

USGS Publications Warehouse

Teh, S.J.; Clark, S.L.; Brown, C.L.; Luoma, S.N.; Hinton, D.E.

1999-01-01

Enzymatic and histopathologic alterations of the digestive gland, gill, gonad, and kidney were studied in Asian clam (Potamocorbula amurensis) in April, 1997 from each of four United States Geological Survey (USGS) stations in the San Francisco Estuary. Stations were selected based on differing body burdens of metallic contaminants in clams (Stn 4.1>6.1>8.1>12.5) observed over 7 years. Because no pristine sites are known within the estuary and because no laboratory-reared stocks of P. amurensis were available, clams from station 12.5 served as reference animals. Histopathologic analysis revealed no lesions in clams collected from station 12.5. Mild digestive gland atrophy and moderate distal kidney tubular vacuolation were seen in clams collected from station 8.1. Mild digestive gland atrophy, moderate kidney tubular atrophy, and moderate gill inflammation were seen in clams collected from station 6.1. Lesions found only in clams from station 4.1 were: (1) severe inflammation and moderate atrophy of primary ducts and diverticula, and decreased numbers of heterophagosomes and heterolysosomes in diverticula of the digestive gland; (2) severe gill inflammation; (3) severe kidney tubular atrophy; (4) severe ovarian and testicular inflammation and necrosis (5) decreased numbers of mature ova; and (6) decreased number of glycogen storage cells in the ovary and testis. Localization of specific enzymes including adenosine triphosphatase (ATP), acid phosphatase (ACP), alkaline phosphatase (ALKP), gamma-glutamyl transpeptidase (GGT), and glucose-6-phosphate dehydrogenase (G6PDH) was performed and correlated, in serial sections with glycogen (PAS) and haematoxylin and eosin stains. Enzymatic analysis revealed: (1) increased digestive diverticula ATP in stations 6.1 and 4.1; (2) decreased digestive diverticula ACP in stations 6.1 and 4.1 and proximal kidney tubular ACP deficiency in station 4.1; (3) no ALKP differences among stations; (4) increased distal kidney tubular GGT at station 12.5 and decreased distal kidney tubular GGT at station 4.1; (5) decreased digestive diverticula G6PDH G6PDH in all stations except 12.5 and decreased proximal kidney tubular G6PDH in stations 8.1 and 6.1. It is possible that other anthropogenic and natural stressors may have affected the results in this study. However, the prevalence and increased severity of lesions in clams with highest metal body burden suggests a contaminant- associated etiology. Enzymatic and histopathologic biomarker alterations identified in this study were positively correlated with the metal body burden. Clams with the higher prevalence of diseases and enzyme alterations also showed a lower condition index and glycogen content in the month when histopathological assessment was performed. Further study will seek to develop enzymatic and histopathologic biomarkers for use in controlled laboratory conditions to help validate the field study.

Is seborrhoeic dermatitis associated with a diffuse, low-grade folliculitis and progressive cicatricial alopecia?

PubMed

Pitney, Lucy; Weedon, David; Pitney, Michael

2016-08-01

An association between adult scalp seborrhoeic dermatitis and cicatricial hair loss has not previously been convincingly established. This study seeks to demonstrate a unique relationship between a clinically identifiable chronic scalp dermatitis-folliculitis with the characteristic histological features of low-grade inflammatory fibrosing alopecia, resulting in a distinctive progressive cicatricial alopecia which we believe is prevalent and hitherto unrecognised, and befits the description of seborrhoeic folliculitis. The clinical, epidemiological and histopathological features of seborrhoeic folliculitis are demonstrated to establish its unique status among the disorders of adult diffuse cicatricial alopecia. © 2015 The Australasian College of Dermatologists.

Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Interrater Reliability of the Postoperative Epidural Fibrosis Classification: A Histopathologic Study in the Rat Model.

PubMed

Sae-Jung, Surachai; Jirarattanaphochai, Kitti; Sumananont, Chat; Wittayapairoj, Kriangkrai; Sukhonthamarn, Kamolsak

2015-08-01

Agreement study. To validate the interrater reliability of the histopathological classification of the post-laminectomy epidural fibrosis in an animal model. Epidural fibrosis is a common cause of failed back surgery syndrome. Many animal experiments have been developed to investigate the prevention of epidural fibrosis. One of the common outcome measurements is the epidural fibrous adherence grading, but the classification has not yet been validated. Five identical sets of histopathological digital files of L5-L6 laminectomized adult Sprague-Dawley rats, representing various degrees of postoperative epidural fibrous adherence were randomized and evaluated by five independent assessors masked to the study processes. Epidural fibrosis was rated as grade 0 (no fibrosis), grade 1 (thin fibrous band), grade 2 (continuous fibrous adherence for less than two-thirds of the laminectomy area), or grade 3 (large fibrotic tissue for more than two-thirds of the laminectomy area). A statistical analysis was performed. Four hundred slides were independently evaluated by each assessor. The percent agreement and intraclass correlation coefficient (ICC) between each pair of assessors varied from 73.5% to 81.3% and from 0.81 to 0.86, respectively. The overall ICC was 0.83 (95% confidence interval, 0.81-0.86). The postoperative epidural fibrosis classification showed almost perfect agreement among the assessors. This classification can be used in research involving the histopathology of postoperative epidural fibrosis; for example, for the development of preventions of postoperative epidural fibrosis or treatment in an animal model.

The Effects of Direct Oxygen Supply During Static Cold Preservation of Rat Livers: An Experimental Study.

PubMed

Zumrutdal, Emin; Karateke, Faruk; Eser, Pınar Eylem; Turan, Umit; Ozyazici, Sefa; Sozutek, Alper; Gulkaya, Mustafa; Kunt, Mevlut

2016-12-01

We aimed to determine the biochemical and histopathologic effects of direct oxygen supply to the preservation fluid of static cold storage system with a simple method on rat livers. Sixteen rats were randomly divided into 2 groups: the control group, which contained Ringer's lactate as preservation fluid; and the oxygen group, which contained oxygen and Ringer's lactate for preservation. Each liver was placed in a bag containing 50 mL Ringer's lactate and placed in ice-filled storage containers. One hundred percent oxygen supplies were given via a simple, inexpensive system created in our laboratory, to the livers in oxygen group. We obtained samples for histopathologic evaluation in the 12th hour. In addition, 3 mL of preservation fluid was subjected to biochemical analysis at 0, sixth, and twelfth hours. Aspartate aminotransferase, alanine aminotransferase, lactate dehydrogenase, and pH levels were measured from the preservation fluid. In oxygen-supplemented group, the acceleration speed of increase in alanine aminotransferase and lactate dehydrogenase levels at sixth hour and lactate dehydrogenase, alanine aminotransferase, and lactate dehydrogenase levels at 12th hour were statistically significantly reduced. In histopathologic examination, all parameters except ballooning were statistically significantly better in the oxygen-supplemented group. This simple system for oxygenation of liver tissues during static cold storage was shown to be effective with good results in biochemical and histopathologic assessments. Because this is a simple, inexpensive, and easily available method, larger studies are warranted to evaluate its effects (especially in humans).

A cross-omics toxicological evaluation of drinking water treated with different processes.

PubMed

Shi, Peng; Jia, Shuyu; Zhang, Xu-Xiang; Zhao, Fuzheng; Chen, Yajun; Zhou, Qing; Cheng, Shupei; Li, Ai-Min

2014-04-30

Cross-omics profiling and phenotypic analysis were conducted to comprehensively assess the toxicities of source of drinking water (SDW), effluent of conventional treatment (ECT) and effluent of advanced treatment (EAT) in a water treatment plant. SDW feeding increased body weight, and relative liver and kidney weights of mice. Hepatic histopathological damages and serum biochemical alterations were observed in the mice fed with SDW and ECT, but EAT feeding showed no obvious effects. Transcriptomic analysis demonstrated that exposure to water samples caused differential expression of hundreds of genes in livers. Cluster analysis of the differentially expressed genes which generated by both microarrays and digital gene expression showed similar grouping patterns. Proteomic and metabolomics analyses indicated that drinking SDW, ECT and EAT generated 59, 145 and 41 significantly altered proteins in livers and 8, 2 and 0 altered metabolites in serum, respectively. SDW was found to affect several metabolic pathways including metabolism of xenobiotics by cytochrome P450 and fatty acid metabolism. SDW and ECT might induce molecular toxicities to mice, but the advanced treatment process can reduce the potential health risk by effectively removing toxic chemicals in drinking water. Copyright © 2014 Elsevier B.V. All rights reserved.

Morphological and molecular analysis of the collagen fibers in inflammatory process

NASA Astrophysics Data System (ADS)

de Carvalho, Luis Felipe das Chagas e. Silva; Alves, Mônica Ghislaine Oliveira; Soares, Carlos Alexandre; Almeida, Janete Dias; da Silva Martinho, Herculano

2011-07-01

Collagen makes up one third of the total protein in humans, being formed by the connection of three polypeptide chains arranged in a triple helix. This protein has fundamental importance in the formation of extracellular matrix of connective tissue. This study aimed to analyze the structural changes of collagen, which are resulting from inflammatory processes in oral mucosa, and to make the comparative analysis between the histopathology and the Raman spectra. The samples of tissues with inflammatory fibrous hyperplasia (IFH) and normal mucosa (NM) were evaluated by Raman Spectroscopy, hematoxylin-eosin and Massons trichrome stain. The histological analysis in both stains showed differences in collagen fibers, which was presented as thin fibers and arranged in parallel direction in NM and as collagen fibers are thick, mature and not organized, showing that these types of stain show morphological changes of collagen in IFH. The Raman Spectroscopy discriminate the groups of NM and IFH based on vibrational modes of proline, hydroxiproline and CH3, CH2. The histological stains only shows information from morphological data, and can be complemented by Raman spectra. This technique could demonstrate that inflammatory process caused some changes in collagen structure which is related to aminoacids such as proline and hidroxyproline.

The antioxidant property of chitosan green tea polyphenols complex induces transglutaminase activation in wound healing.

PubMed

Qin, Yao; Guo, Xing Wei; Li, Lei; Wang, Hong Wei; Kim, Wook

2013-06-01

The present study examined, for the first time, the in vitro wound healing potential of chitosan green tea polyphenols (CGP) complex based on the activation of transglutaminase (TGM) genes in epidermal morphogenesis. Response surface methodology was applied to determine the optimal processing condition that gave maximum extraction of green tea polyphenols. The antioxidant activity, scavenging ability, and chelating ability were studied and expressed as average EC50 values of CGP and other treatments. In silico analysis and gene coexpression network was subjected to the TGM sequences analysis. The temporal expressions of TGMs were profiled by semi-quantitative reverse transcription (RT)-PCR technology within 10 days after wounding and 2 days postwounding. CGP showed the effectiveness of antioxidant properties, and the observations of histopathological photography showed advanced tissue granulation and epithelialization formation by CGP treatment. In silico and coexpression analysis confirmed the regulation via TGM gene family in dermatological tissues. RT-PCR demonstrated increased levels of TGM1-3 expression induced by CGP treatment. The efficacy of CGP in wound healing based on these results may be ascribed to its antioxidant properties and activation of the expression of TGMs, and is, thus, essential for the facilitated repair of skin injury.

[The clinical, serological and morphological analysis of 91 patients with cystic echinococcosis following surgery].

PubMed

Mıman, Ozlem; Atambay, Metin; Aydin, Nasuhi Engin; Daldal, Nilgün

2010-01-01

Cystic echinococcocis (CE) is a zoonotic infection caused by metacestod form of Echinococcus granulosus. In this study, 91 patients with CE were revealed according to their gender, age, symptoms, cyst localization and size, and also to their preoperative serologic analysis results. These patients were recruited in Pathology Department of Inonu University, School of Medicine, Turgut Ozal Medical Center between January 2002 and December 2005. They had already undergone surgery following the preliminary diagnosis of CE and were diagnosed definitively after histopathological analysis. Thirty-seven of them were female (41%) and the rest were male (n=54, 59%). Mean age was 36.24 ± 20.35 (range: 4-80 years). Lung and liver were the most common localizations for CE cysts (n=67, 73.63%). Fifty patients' preoperative serological analysis (IHA) were already available (55%) and 46 of them (92%) were positive. Since histopathological definitive diagnosis was CE, false negative result rate was assessed as 8%. Intraabdominal CE cyst localization was found related with bigger cyst size and multiple organ involvement. Symptom duration was correlated with cyst size (p < 0.05; r < sup > 2 < /sup > =0.09). IHA results were failed to be found related with clinical features of the cysts.

Super hydrophilic thin film nitinol demonstrates reduced platelet adhesion compared with commercially available endograft materials.

PubMed

Tulloch, Allan W; Chun, Youngjae; Levi, Daniel S; Mohanchandra, Kotekar P; Carman, Gregory P; Lawrence, Peter F; Rigberg, David A

2011-11-01

Thin film nitinol (TFN) is a novel material with which to cover stents for the treatment of a wide range of vascular disease processes. This study aimed to show that TFN, if treated to produce a super hydrophilic surface, significantly reduces platelet adhesion, potentially rendering covered stents more resistant to thrombosis compared to commercially available materials. TFN was fabricated using a sputter deposition process to produce a 5-μ thin film of uniform thickness. TFN then underwent a surface treatment process to create a super hydrophilic layer. Platelet adhesion studies compared surface treated TFN (S-TFN) to untreated TFN, polytetrafluoroethylene, Dacron, and bulk nitinol. In vivo swine studies examined the placement of an S-TFN covered stent in a 3.5 mm diameter external iliac artery. Angiography confirmed placement, and repeat angiography was performed at 2 wk followed by post mortem histopathology. S-TFN significantly reduced platelet adhesion without any evidence of aggregation compared with all materials studied (P < 0.05). Furthermore, in vivo swine studies demonstrated complete patency of the S-TFN covered stent at 2 wk. Post mortem histopathology showed rapid endothelialization of the S-TFN without excessive neointimal hyperplasia. These results demonstrate that S-TFN significantly reduces platelet adhesion and aggregation compared with commercially available endograft materials. Furthermore, the hydrophilic surface may confer thromboresistance in vivo, suggesting that S-TFN is a possible superior material for covering stents. Copyright © 2011 Elsevier Inc. All rights reserved.

Appearances of colorectal hepatic metastases at diffusion-weighted MRI compared with histopathology: initial observations.

PubMed

Scurr, E D; Collins, D J; Temple, L; Karanjia, N; Leach, M O; Koh, D-M

2012-03-01

To describe the appearances of colorectal liver metastases on diffusion-weighted MRI (DW-MRI) and to compare these appearances with histopathology. 43 patients with colorectal liver metastases were evaluated using breath-hold DW-MRI (b-values 0, 150 and 500 s mm(-2)). The b=500 s mm(-2) DW-MRI were reviewed consensually for lesion size and appearance by two readers. 18/43 patients underwent surgery allowing radiological-pathological comparison. Tissue sections were reviewed by a pathologist, who classified metastases histologically as cellular, fibrotic, necrotic or mixed. The frequency of DW-MRI findings and histological features were compared using the χ(2) test. 84 metastases were found in 43 patients. On b=500 s mm(-2) DW-MRI, metastases showed three high signal intensity patterns: rim (55/84), uniform (23/84) and variegate (6/84). Of the 55 metastases showing rim pattern, 54 were >1 cm in diameter (p<0.01, χ(2) test). 25/84 metastases were surgically resected. Of these, 11/22 metastases >1 cm in diameter showed rim pattern and demonstrated central necrosis at histopathology (p=0.04, χ(2) test). No definite relationship was found between uniform and variegate patterns with histology. Rim high signal intensity was the most common appearance of colorectal liver metastases >1 cm diameter on DW-MRI at b-values of 500 s mm(-2), a finding attributable to central necrosis.

The Acute Effect of Humic Acid on Iron Accumulation in Rats.

PubMed

Cagin, Yasir Furkan; Sahin, N; Polat, A; Erdogan, M A; Atayan, Y; Eyol, E; Bilgic, Y; Seckin, Y; Colak, C

2016-05-01

Free iron leads to the formation of pro-oxidant reactive oxygen species (ROS). Humic acids (HAs) enhance permeability of cellular wall and act as a chelator through electron transferring. This study was designed to test chelator effect of HA on iron as well as its anti-oxidant effect against the iron-induced hepatotoxicity and cardiotoxicity. The rats used were randomly divided into four groups (n = 8/group): group I (the control group); group II (the HA group), humic acid (562 mg/kg) was given over 10 days by oral gavage; group III (the iron group), iron III hydroxide polymaltose (250 mg/kg) was given over 10 days by intraperitoneal route; and group IV (the HA plus iron group), received the iron (similar to group II) plus humic acid (similar to those in groups II and III) group. Blood and two tissue samples both from liver and heart were obtained for biochemical and histopathological evaluations. Iron deposition, the iron-induced hepatotoxicity, and cardiotoxicity were demonstrated by histopathological and biochemical manner. However, no significant differences were observed in the serum biochemical values and the histopathological results among the iron and the HA plus iron groups in the liver tissue but not in the heart tissue. The protective effects of humic acid against iron-induced cardiotoxicity were shown but not against hepatotoxicity in our study.

Intraperitoneal curcumin decreased lung, renal and heart injury in abdominal aorta ischemia/reperfusion model in rat.

PubMed

Aydin, Mehmet Salih; Caliskan, Ahmet; Kocarslan, Aydemir; Kocarslan, Sezen; Yildiz, Ali; Günay, Samil; Savik, Emin; Hazar, Abdussemet; Yalcin, Funda

2014-01-01

Previous studies have demonstrated that curcumin (CUR) has protective effects against ischemia reperfusion injury to various organs. We aimed to determine whether CUR has favorable effects on tissues and oxidative stress in abdominal aorta ischemia-reperfusion injury. Thirty rats were divided into three groups as sham, control and treatment (CUR) group. Control and CUR groups underwent abdominal aorta ischemia for 60 min followed by a 120 min period of reperfusion. In the CUR group, CUR was given 5 min before reperfusion at a dose of 200 mg/kg via an intraperitoneal route. Total antioxidant capacity (TAC), total oxidative status (TOS), and oxidative stress index (OSI) in blood serum were measured, and lung, renal and heart tissue histopathology were evaluated with light microscopy. TOS and OSI activity in blood samples were statistically decreased in sham and CUR groups compared to the control group (p < 0.001 for TOS and OSI). Renal, lung, heart injury scores of sham and CUR groups were statistically decreased compared to control group (p < 0.001 for all comparisons). Histopathological examination revealed less severe lesions in CUR group than in the control group. CUR administered intraperitoneally was effective in reducing oxidative stress and histopathologic injury in an acute abdominal aorta I/R rat model. Copyright © 2014 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.

Protective Effect of Platelet Rich Plasma on Experimental Ischemia/Reperfusion Injury in Rat Ovary.

PubMed

Bakacak, Murat; Bostanci, Mehmet Suhha; İnanc, Fatma; Yaylali, Asli; Serin, Salih; Attar, Rukset; Yildirim, Gazi; Yildirim, Ozge Kizilkale

2016-01-01

Ovarian torsion is a common cause of local ischemic damage, reduced follicular activity and infertility. Platelet-rich plasma (PRP) contains growth factors with demonstrated cytoprotective properties; so we evaluated PRP efficacy in a rat ischemia/reperfusion (I/R) model. Sixty adult female Sprague-Dawley albino rats were randomly assigned to 6 groups of 8 animals each: Sham, Ischemia, I/R, Sham + PRP, I + PRP and I/R + PRP; and the remaining 12 used to prepare PRP. Ischemia groups were subjected to bilateral adnexal torsion for 3 h, while I/R and I/R + PRP groups received subsequent detorsion for 3 h. Intraperitoneal PRP was administered 30 min prior to ischemia (Ischemia + PRP) or reperfusion (I/R + PRP). Total oxidant status (TOS), oxidative stress index (OSI) and total ovarian histopathological scores were higher in Ischemia and I/R groups than in the Sham group (p < 0.05). PRP decreased mean TOS, OSI and histopathological scores in I + PRP and I/R + PRP groups compared to the corresponding Ischemia and I/R groups (p < 0.001). There was a strong correlation between total histopathological score and OSI (r = 0.877, p < 0.001). Peritoneal vascular endothelial growth factor was significantly higher in PRP-treated groups than corresponding untreated groups (p < 0.05). PRP is effective for the prevention of ischemia and reperfusion damage in rat ovary. © 2015 S. Karger AG, Basel.

Cat-scratch uveitis confirmed by histological, serological, and molecular diagnoses.

PubMed

Font, Ramon L; Del Valle, Maria; Mitchell, Bradley M; Boniuk, Milton

2011-04-01

To report a case of a cat-scratch uveitis caused by Bartonella henselae, which was confirmed by histology, serology, and polymerase chain reaction (PCR) methodology. An iris nodule was biopsied from a 4-year-old child who was scratched by a kitten on the side of his face and developed redness of the eye associated with cervical lymphadenopathy. Sections of the iridectomy specimen were stained with hematoxylin-eosin, periodic acid-Schiff, and Warthin-Starry technique for histopathologic evaluation. Additionally, serologic tests and molecular diagnosis using B. henselae-specific PCR were performed. Histopathologically, sections of the iridectomy specimen showed a zonal granulomatous inflammation with a central iris necrotic abscess surrounded by a mantle of epithelioid histiocytes and more peripherally by lymphocytes and plasma cells. The Warthin-Starry stain disclosed scattered short bacilli within the necrotic abscess morphologically compatible with B. henselae. Report of serologic tests for B. henselae disclosed a negative immunoglobulin G antibody (negative: less than 12) and a positive immunoglobulin M antibody of 18 (positive: greater than 15). Other serologic studies including Toxocara, histoplasmin, blastomycin, coccidioidin, aspergillin, and Chlamydia were all negative. PCR was positive for B. henselae DNA. Our case showed a unilateral chronic granulomatous iritis with the histopathologic features compatible with CSD caused by B. henselae bacillus as demonstrated in the iris biopsy and confirmed by serology and PCR technique. This case is an example of a relatively rare uveal manifestation of CSD.

Ganoderma Lucidum Protects Rat Brain Tissue Against Trauma-Induced Oxidative Stress.

PubMed

Özevren, Hüseyin; İrtegün, Sevgi; Deveci, Engin; Aşır, Fırat; Pektanç, Gülsüm; Deveci, Şenay

2017-10-01

Traumatic brain injury causes tissue damage, breakdown of cerebral blood flow and metabolic regulation. This study aims to investigate the protective influence of antioxidant Ganoderma lucidum ( G. lucidum ) polysaccharides (GLPs) on brain injury in brain-traumatized rats. Sprague-Dawley conducted a head-traumatized method on rats by dropping off 300 g weight from 1 m height. Groups were categorized as control, G. lucidum , trauma, trauma+ G. lucidum (20 mL/kg per day via gastric gavage). Brain tissues were dissected from anesthetized rats 7 days after injury. For biochemical analysis, malondialdehyde, glutathione and myeloperoxidase values were measured. In histopathological examination, neuronal damage in brain cortex and changes in blood brain barrier were observed. In the analysis of immunohistochemical and western blot, p38 mitogen-activated protein kinase, vascular endothelial growth factor and cluster of differentiation 68 expression levels were shown. These analyzes demonstrated the beneficial effects of GLPs on brain injury. We propose that GLPs treatment after brain injury could be an alternative treatment to decraseing inflammation and edema, preventing neuronal and glial cells degeneration if given in appropriate dosage and in particular time intervals.

Necrotizing hepatitis in a domestic pigeon (Columba livia).

PubMed

Himmel, L; O'Connor, M; Premanandan, C

2014-11-01

An adult male domestic pigeon (Columba livia) was presented for necropsy following natural death after a period of chronic weight loss and severe intestinal ascariasis. Histopathologic examination of the liver found moderate to marked, multifocal necrotizing hepatitis with large, basophilic intranuclear inclusion bodies. Transmission electron microscopy of affected hepatocytes demonstrated numerous intra- and perinuclear icosahedral virions arranged in a lattice structure, consistent with adenoviral infection. © The Author(s) 2014.

Neuroprotective effects of agmatine in experimental peripheral nerve injury in rats: a prospective randomized and placebo-controlled trial.

PubMed

Sezer, Aykut; Guclu, Bulent; Kazanci, Burak; Cakir, Murteza; Coban, Mustafa Kemal

2014-01-01

The purpose of this study was to demonstrate the activity of agmatine, an inducible nitric oxide synthase (iNOS) inhibitor and selective N-methyl-D-aspartate receptor (NMDAR) antagonist, on reducing tissue damage in distal part of traumatic nerve in an experimental rat peripheral nerve injury model. Sciatic nerves of 30 Sprague Dawley male rats were used. Rats were divided into 5 groups; group 1 (n=6), control group; group 2 (n=6), axonotmesis + placebo group; group 3 (n=6), axonotmesis + 50 mg/kg agmatine treatment group; group 4 (n=6), neurotmesis + placebo group; group 5 (n=6), neurotmesis + 50 mg/kg agmatine treatment group. Axonolysis, axon degeneration, edema, hemorrhage, and inflammation were evaluated in histopathologic examinations of all the groups. When group 2 was compared with group 3 in histopathologic sections, axonolysis was less in group 3 (p=0.007), as was axon degeneration (p=0.022) and edema (p=0.018). When group 4 was compared with group 5, axonolysis was less in group 5 (p=0.009), as was axon degeneration (p=0.006) and edema (p=0.021). This study demonstrated agmatine to have antioxidant and antineurotoxic effects in an experimental rat peripheral nerve injury model.

Three Molecular Subtypes of Gastric Adenocarcinoma Have Distinct Histochemical Features Reflecting Epstein-Barr Virus Infection Status and Neuroendocrine Differentiation.

PubMed

Speck, Olga; Tang, Weihua; Morgan, Douglas R; Kuan, Pei Fen; Meyers, Michael O; Dominguez, Ricardo L; Martinez, Enrique; Gulley, Margaret L

2015-10-01

Current histopathologic classification schemes for gastric adenocarcinoma have limited clinical utility and are difficult to apply due to tumor heterogeneity. Elucidation of molecular subtypes of gastric cancer may contribute to our understanding of gastric cancer biology and to the development of new molecular markers that may lead to improved diagnosis, therapy, or prognosis. We previously demonstrated that Epstein-Barr virus (EBV)-infected gastric cancers have a distinct human gene expression profile compared with uninfected cancers. We now examine the histopathologic features characterizing infected (n=14) and uninfected (n=89) cancers; the latter of which are now further divided into 2 major molecular subtypes based on expression patterns of 93 RNAs. One uninfected gastric cancer subtype was distinguished by upregulation of 3 genes with neuroendocrine (NE) function (CHGA, GAST, and REG4 encoding chromogranin, gastrin, and the secreted peptide REG4 involved in epithelial cell regeneration), implicating hormonal factors in the pathogenesis of a major class of gastric adenocarcinomas. Evidence of NE differentiation (molecular, immunohistochemical, or morphologic) was mutually exclusive of EBV infection. EBV-infected tumors tended to have solid-type morphology with lymphoid stroma. This study reveals novel molecular subtypes of gastric cancer and their associated morphologies that demonstrate divergent NE features.

Role of phenolics from Spondias pinnata bark in amelioration of iron overload induced hepatic damage in Swiss albino mice.

PubMed

Chaudhuri, Dipankar; Ghate, Nikhil Baban; Panja, Sourav; Mandal, Nripendranath

2016-07-26

Crude Spondias pinnata bark extract was previously assessed for its antioxidant, anticancer and iron chelating potentials. The isolated compounds gallic acid (GA) and methyl gallate (MG) were evaluated for their curative potential against iron overload-induced liver fibrosis and hepatocellular damage. In vitro iron chelation property and in vivo ameliorating potential from iron overload induced liver toxicity of GA and MG was assessed by different biochemical assays and histopathological studies. MG and GA demonstrated excellent reducing power activities but iron chelation potential of MG is better than GA. Oral MG treatment in mice displayed excellent efficacy (better than GA) to significantly restore the levels of liver antioxidants, serum markers and cellular reactive oxygen species in a dose-dependent fashion. Apart from these, MG exceptionally prevented lipid peroxidation and protein oxidation whereas GA demonstrated better activity to reduce collagen content, thereby strengthening its position as an efficient drug against hepatic damage/fibrosis, which was further supported by histopathological studies. Alongside, MG efficiently eliminated the cause of liver damage, i.e., excess iron, by chelating free iron and reducing the ferritin-bound iron. The present study confirmed the curative effect of GA and MG against iron overload hepatic damage via their potent antioxidant and iron-chelating potential.

Transforming growth factor-β1 expression in endangered age-0 shortnose suckers (Chasmistes brevirostris) from Upper Klamath Lake, OR relative to histopathology, meristic, spatial, and temporal data.

PubMed

Ottinger, Christopher A; Densmore, Christine L; Robertson, Laura S; Iwanowicz, Deborah D; VanderKooi, Scott P

2016-02-01

During July-September of 2008, 2009, and 2010 endangered age-0 juvenile shortnose suckers were sampled from Upper Klamath Lake, OR in a health evaluation that included the measurement of transforming growth factor - beta (TGF-β) expression in spleen in combination with a histopathology assessment. This analysis was performed to determine if the expression of this immuno-regulator could be used as a component of a larger health evaluation intended to identify potential risk-factors that may help to explain why very few of these fish survive to age-1. Potential associations between TGF-β1 expression, histopathological findings, meristic data as well as temporal and spatial data were evaluated using analysis-of-variance. In this analysis, the absence or presence of opercula deformity and hepatic cell necrosis were identified as significant factors in accounting for the variance in TGF-β1 expression observed in age-0 shortnose suckers (n = 122, squared multiple R = 0.989). Location of sample collection and the absence or presence of anchor worms (Lernaea spp.) were identified as significant cofactors. The actual mechanisms involved with these relationships have yet to be determined. The strength, however, of our findings support the concept of using TGF-β1 expression as part of a broader fish health assessment and suggests the potential for using additional immunologic measures in future studies. Specifically, our results indicate that the measure of TGF-β1 expression in age-0 shortnose sucker health assessments can facilitate the process of identifying disease risks that are associated with the documented lack of recruitment into the adult population. Published by Elsevier Ltd.

Acute toxicity of functionalized single wall carbon nanotubes: A biochemical, histopathologic and proteomics approach.

PubMed

Ahmadi, Homa; Ramezani, Mohammad; Yazdian-Robati, Rezvan; Behnam, Behzad; Razavi Azarkhiavi, Kamal; Hashem Nia, Azadeh; Mokhtarzadeh, Ahad; Matbou Riahi, Maryam; Razavi, Bibi Marjan; Abnous, Khalil

2017-09-25

Recently carbon nanotubes (CNTs) showed promising potentials in different biomedical applications but their safe use in humans and probable toxicities are still challenging. The aim of this study was to determine the acute toxicity of functionalized single walled carbon nanotubes (SWCNTs). In this project, PEGylated and Tween functionalized SWCNTs were prepared. BALB/c mice were randomly divided into nine groups, including PEGylated SWCNTs (75,150μg/mouse) and PEG, Tween80 suspended SWCNTs, Tween 80 and a control group (intact mice). One or 7 days after intravenous injection, the mice were killed and serum and livers were collected. The oxidative stress markers, biochemical and histopathological changes were studied. Subsequently, proteomics approach was used to investigate the alterations of protein expression profiles in the liver. Results showed that there were not any significant differences in malondealdehyde (MDA), glutathione (GSH) levels and biochemical enzymes (ALT and AST) between groups, while the histopathological observations of livers showed some injuries. The results of proteomics analysis revealed indolethylamine N-Methyltransferase (INMT), glycine N-Methyltransferase (GNMT), selenium binding protein (Selenbp), thioredoxin peroxidase (TPx), TNF receptor associated protein 1(Trap1), peroxiredoxin-6 (Prdx6), electron transport flavoprotein (Etf-α), regucalcin (Rgn) and ATP5b proteins were differentially expressed in functionalized SWCNTs groups. Western blot analyses confirmed that the changes in Prdx6 were consistent with 2-DE gel analysis. In summary, acute toxicological study on two functionalized SWCNTs did not show any significant toxicity at selected doses. Proteomics analysis also showed that following exposure to functionalized SWCNTs, the expression of some proteins with antioxidant activity and detoxifying properties were increased in liver tissue. Copyright © 2017 Elsevier B.V. All rights reserved.

A population-based analysis of germline BAP1 mutations in melanoma.

PubMed

O'Shea, Sally J; Robles-Espinoza, Carla Daniela; McLellan, Lauren; Harrigan, Jeanine; Jacq, Xavier; Hewinson, James; Iyer, Vivek; Merchant, Will; Elliott, Faye; Harland, Mark; Bishop, D Timothy; Newton-Bishop, Julia A; Adams, David J

2017-02-15

Germline mutation of the BRCA1 associated protein-1 (BAP1) gene has been linked to uveal melanoma, mesothelioma, meningioma, renal cell carcinoma and basal cell carcinoma. Germline variants have also been found in familial cutaneous melanoma pedigrees, but their contribution to sporadic melanoma has not been fully assessed. We sequenced BAP1 in 1,977 melanoma cases and 754 controls and used deubiquitinase assays, a pedigree analysis, and a histopathological review to assess the consequences of the mutations found. Sequencing revealed 30 BAP1 variants in total, of which 27 were rare (ExAc allele frequency <0.002). Of the 27 rare variants, 22 were present in cases (18 missense, one splice acceptor, one frameshift and two near splice regions) and five in controls (all missense). A missense change (S98R) in a case that completely abolished BAP1 deubiquitinase activity was identified. Analysis of cancers in the pedigree of the proband carrying the S98R variant and in two other pedigrees carrying clear loss-of-function alleles showed the presence of BAP1-associated cancers such as renal cell carcinoma, mesothelioma and meningioma, but not uveal melanoma. Two of these three probands carrying BAP1 loss-of-function variants also had melanomas with histopathological features suggestive of a germline BAP1 mutation. The remaining cases with germline mutations, which were predominantly missense mutations, were associated with less typical pedigrees and tumours lacking a characteristic BAP1-associated histopathological appearances, but may still represent less penetrant variants. Germline BAP1 alleles defined as loss-of-function or predicted to be deleterious/damaging are rare in cutaneous melanoma. © The Author 2017. Published by Oxford University Press.

A population-based analysis of germline BAP1 mutations in melanoma

PubMed Central

O’Shea, Sally J.; Robles-Espinoza, Carla Daniela; Harrigan, Jeanine; Jacq, Xavier; Hewinson, James; Iyer, Vivek; Merchant, Will; Elliott, Faye; Harland, Mark; Bishop, D. Timothy; Newton-Bishop, Julia A.

2017-01-01

Abstract Germline mutation of the BRCA1 associated protein-1 (BAP1) gene has been linked to uveal melanoma, mesothelioma, meningioma, renal cell carcinoma and basal cell carcinoma. Germline variants have also been found in familial cutaneous melanoma pedigrees, but their contribution to sporadic melanoma has not been fully assessed. We sequenced BAP1 in 1,977 melanoma cases and 754 controls and used deubiquitinase assays, a pedigree analysis, and a histopathological review to assess the consequences of the mutations found. Sequencing revealed 30 BAP1 variants in total, of which 27 were rare (ExAc allele frequency <0.002). Of the 27 rare variants, 22 were present in cases (18 missense, one splice acceptor, one frameshift and two near splice regions) and five in controls (all missense). A missense change (S98R) in a case that completely abolished BAP1 deubiquitinase activity was identified. Analysis of cancers in the pedigree of the proband carrying the S98R variant and in two other pedigrees carrying clear loss-of-function alleles showed the presence of BAP1-associated cancers such as renal cell carcinoma, mesothelioma and meningioma, but not uveal melanoma. Two of these three probands carrying BAP1 loss-of-function variants also had melanomas with histopathological features suggestive of a germline BAP1 mutation. The remaining cases with germline mutations, which were predominantly missense mutations, were associated with less typical pedigrees and tumours lacking a characteristic BAP1-associated histopathological appearances, but may still represent less penetrant variants. Germline BAP1 alleles defined as loss-of-function or predicted to be deleterious/damaging are rare in cutaneous melanoma. PMID:28062663

Transforming growth factor-β1 expression in endangered age-0 shortnose suckers (Chasmistes brevirostris) from Upper Klamath Lake, OR relative to histopathology, meristic, spatial, and temporal data

USGS Publications Warehouse

Ottinger, Christopher A.; Densmore, Christine L.; Robertson, Laura S.; Iwanowicz, Deborah; Vanderkooi, Scott P.

2016-01-01

During July – September of 2008, 2009, and 2010 endangered age-0 juvenile shortnose suckers were sampled from Upper Klamath Lake, OR in a health evaluation that included the measurement of transforming growth factor – beta (TGF-β) expression in spleen in combination with a histopathology assessment. This analysis was performed to determine if the expression of this immuno-regulator could be used as a component of a larger health evaluation intended to identify potential risk-factors that may help to explain why very few of these fish survive to age-1. Potential associations between TGF-β1 expression, histopathological findings, meristic data as well as temporal and spatial data were evaluated using analysis-of-variance. In this analysis, the absence or presence of opercula deformity and hepatic cell necrosis were identified as significant factors in accounting for the variance in TGF-β1 expression observed in age-0 shortnose suckers (n = 122, squared multiple R = 0.989). Location of sample collection and the absence or presence of anchor worms (Lernaea spp.) were identified as significant cofactors. The actual mechanisms involved with these relationships have yet to be determined. The strength, however, of our findings support the concept of using TGF-β1 expression as part of a broader fish health assessment and suggests the potential for using additional immunologic measures in future studies. Specifically, our results indicate that the measure of TGF-β1 expression in age-0 shortnose sucker health assessments can facilitate the process of identifying disease risks that are associated with the documented lack of recruitment into the adult population.

The importance of histopathological and clinical variables in predicting the evolution of colon cancer.

PubMed

Diculescu, Mircea; Iacob, Răzvan; Iacob, Speranţa; Croitoru, Adina; Becheanu, Gabriel; Popeneciu, Valentin

2002-09-01

It has been a consensus that prognostic factors should always be taken into account before planning treatment in colorectal cancer. A 5 year prospective study was conducted, in order to assess the importance of several histopathological and clinical prognostic variables in the prediction of evolution in colon cancer. Some of the factors included in the analysis are still subject to dispute by different authors. 46 of 53 screened patients qualified to enter the study and underwent a potentially curative resection of the tumor, followed, when necessary, by adjuvant chemotherapy. Univariate and multivariate analyses were carried out in order to identify independent prognostic indicators. The endpoint of the study was considered the recurrence of the tumor or the detection of metastases. 65.2% of the patients had a good evolution during the follow up period. Multivariate survival analysis performed by Cox proportional hazard model identified 3 independent prognostic factors: Dukes stage (p = 0.00002), the grade of differentiation (p = 0.0009) and the weight loss index, representing the weight loss of the patient divided by the number of months when it was actually lost (p = 0.02). Age under 40 years, sex, microscopic aspect of the tumor, tumor location, anemia degree were not identified by our analysis as having prognostic importance. Histopathological factors continue to be the most valuable source of information regarding the possible evolution of patients with colorectal cancer. Individual clinical symptoms or biological parameters such as erytrocyte sedimentation rate or hemoglobin level are of little or no prognostic value. More research is required relating to the impact of a performance status index (which could include also weight loss index) as another reliable prognostic variable.

FDG-PET/CT Imaging Predicts Histopathologic Treatment Responses after Neoadjuvant Therapy in Adult Primary Bone Sarcomas

DOE PAGES

Benz, Matthias R.; Czernin, Johannes; Tap, William D.; ...

2010-01-01

Purpose . Tmore » he aim of this study was to prospectively evaluate whether FDG-PET allows an accurate assessment of histopathologic response to neoadjuvant treatment in adult patients with primary bone sarcomas. Methods . Twelve consecutive patients with resectable, primary high grade bone sarcomas were enrolled prospectively. FDG-PET/CT imaging was performed prior to the initiation and after completion of neoadjuvant treatment. Imaging findings were correlated with histopathologic response. Results . Histopathologic responders showed significantly more pronounced decreases in tumor FDG-SUVmax from baseline to late follow up than non-responders ( 64 ± 19 % versus 29 ± 30 %, resp.; P = .03 ). Using a 60% decrease in tumor FDG-uptake as a threshold for metabolic response correctly classified 3 of 4 histopathologic responders and 7 of 8 histopathologic non-responders as metabolic responders and non-responders, respectively (sensitivity, 75%; specificity, 88%). Conclusion . These results suggest that changes in FDG-SUVmax at the end of neoadjuvant treatment can identify histopathologic responders and non-responders in adult primary bone sarcoma patients.« less

Intravascular lymphoma involving the central and peripheral nervous systems in a dog.

PubMed

Bush, William W; Throop, Juliene L; McManus, Patricia M; Kapatkin, Amy S; Vite, Charles H; Van Winkle, Tom J

2003-01-01

A 5-year-old, castrated male mixed-breed dog was presented for paraparesis, ataxia, hyperesthesia, and thrombocytopenia of 5 months' duration and recurrent seizures during the preceding 2 weeks. Multifocal neurological, ophthalmological, pulmonary, and cardiac diseases were identified. Magnetic resonance imaging and cerebrospinal fluid analysis supported a tentative diagnosis of neoplastic or inflammatory disease. A computed tomography-guided biopsy provided both cytopathological and histopathological evidence of intravascular lymphoma. The disease progressed despite chemotherapy with prednisone, L-asparginase, and vincristine. Postmortem histopathological examinations suggested intravascular lymphoma in the central and peripheral nervous systems as well as in multiple other organ systems. This is the first description of an antemortem diagnosis and treatment of intravascular lymphoma involving the central nervous system of a dog.

Pyogenic granuloma near the midline of the oral cavity: A series of case reports

PubMed Central

Adusumilli, Srikanth; Yalamanchili, Pallavi Samatha; Manthena, Sathish

2014-01-01

Pyogenic granuloma (PyG) is a common cause of swelling in the oral cavity during pregnancy and also as an exaggerated response to any minor trauma. The condition is frequently associated with periodontal pain and discomfort, in some cases interfering with mastication and creating esthetic problems. Six patients reported to the Department of Periodontics with gingival overgrowth in the lower anteriors. After recording the details of the patients’ oral hygiene status, all the patients were provided initial therapy with scaling and were prescribed analgesics for the reduction of pain and discomfort. After 1 week, surgical excision of the overgrowth was performed and sent for histopathological analysis. The histopathological report is suggestive of PyG. PMID:24872636

Study of Histopathological and Molecular Changes of Rat Kidney under Simulated Weightlessness and Resistance Training Protective Effect

PubMed Central

Li, Zhili; Tian, Jijing; Abdelalim, Saed; Du, Fang; She, Ruiping; Wang, Desheng; Tan, Cheng; Wang, Huijuan; Chen, Wenjuan; Lv, Dongqiang; Chang, Lingling

2011-01-01

To explore the effects of long-term weightlessness on the renal tissue, we used the two months tail suspension model to simulate microgravity and investigated the simulated microgravity on the renal morphological damages and related molecular mechanisms. The microscopic examination of tissue structure and ultrastructure was carried out for histopathological changes of renal tissue morphology. The immunohistochemistry, real-time PCR and Western blot were performed to explore the molecular mechanisms associated the observations. Hematoxylin and eosin (HE) staining showed severe pathological kidney lesions including glomerular atrophy, degeneration and necrosis of renal tubular epithelial cells in two months tail-suspended rats. Ultrastructural studies of the renal tubular epithelial cells demonstrated that basal laminas of renal tubules were rough and incrassate with mitochondria swelling and vacuolation. Cell apoptosis in kidney monitored by the expression of Bax/Bcl-2 and caspase-3 accompanied these pathological damages caused by long-term microgravity. Analysis of the HSP70 protein expression illustrated that overexpression of HSP70 might play a crucial role in inducing those pathological damages. Glucose regulated protein 78 (GRP78), one of the endoplasmic reticulum (ER) chaperones, was up-regulated significantly in the kidney of tail suspension rat, which implied that ER-stress was associated with apoptosis. Furthermore, CHOP and caspase-12 pathways were activated in ER-stress induced apoptosis. Resistance training not only reduced kidney cell apoptosis and expression of HSP70 protein, it also can attenuate the kidney impairment imposed by weightlessness. The appropriate optimization might be needed for the long term application for space exploration. PMID:21625440

Raman spectroscopy reveals biophysical markers in skin cancer surgical margins

NASA Astrophysics Data System (ADS)

Feng, Xu; Moy, Austin J.; Nguyen, Hieu T. M.; Zhang, Yao; Fox, Matthew C.; Sebastian, Katherine R.; Reichenberg, Jason S.; Markey, Mia K.; Tunnell, James W.

2018-02-01

The recurrence rate of nonmelanoma skin cancer is highly related to the residual tumor after surgery. Although tissueconserving surgery, such as Mohs surgery, is a standard method for the treatment of nonmelanoma skin cancer, they are limited by lengthy and costly frozen-section histopathology. Raman spectroscopy (RS) is proving to be an objective, sensitive, and non-destructive tool for detecting skin cancer. Previous studies demonstrated the high sensitivity of RS in detecting tumor margins of basal cell carcinoma (BCC). However, those studies rely on statistical classification models and do not elucidate the skin biophysical composition. As a result, we aim to discover the biophysical differences between BCC and primary normal skin structures (including epidermis, dermis, hair follicle, sebaceous gland and fat). We obtained freshly resected ex vivo skin samples from fresh resection specimens from 14 patients undergoing Mohs surgery. Raman images were acquired from regions containing one or more structures using a custom built 830nm confocal Raman microscope. The spectra were grouped using K-means clustering analysis and annotated as either BCC or each of the five normal structures by comparing with the histopathology image of the serial section. The spectral data were then fit by a previously established biophysical model with eight primary skin constituents. Our results show that BCC has significant differences in the fit coefficients of nucleus, collagen, triolein, keratin and elastin compared with normal structures. Our study reveals RS has the potential to detect biophysical changes in resection margins, and supports the development of diagnostic algorithms for future intraoperative implementation of RS during Mohs surgery.

Cut-point for Ki-67 proliferation index as a prognostic marker for glioblastoma.

PubMed

Wong, Eugene; Nahar, Najmun; Hau, Eric; Varikatt, Winny; Gebski, Val; Ng, Thomas; Jayamohan, Jayasingham; Sundaresan, Puma

2018-01-16

Ki-67 proliferation index (Ki-67 index) is used to quantify cell proliferation during histopathological assessment of various tumors including glioblastoma (GB). We aimed to assess correlation between Ki-67 index and overall survival in patients with GB and determine a cut-point for Ki-67 index that predicts for poorer survival. Records of adult patients diagnosed with GB on histopathological specimens at a tertiary cancer center in Sydney between 1 January 2002 and 30 July 2012 were retrieved. Specimens of these patients were examined for quantification of Ki-67 staining by two independent pathologists. Patient, disease, treatment, and survival data were collected from hospital and cancer care service records. Statistical analysis was performed using proportional hazards models, Kaplan-Meier curves, and the minimum P-value approach. Of the eligible 71 patients, 58% were males with median age of 58 (range 18-87). Seventy-three percent of patients were of ECOG performance status 0-1. There was a statistically significant correlation between Ki-67 index and overall survival. In patients with Ki-67 > 22% (n = 36), 5-year survival was approximately 30% compared to 5% in those with Ki-67 ≤ 22% (n = 35; log-rank P-value = 0.04; hazard ratio (HR) = 0.53; 95% confidence intervals (CI), 0.29-0.97). This study demonstrates a positive correlation between Ki-67 index and overall survival in patients with GB. Percentage staining of Ki-67 < 22% appears to predict for poorer survival in GB. © 2018 John Wiley & Sons Australia, Ltd.

Heterogeneous Pulmonary Phenotypes Associated With Mutations in the Thyroid Transcription Factor Gene NKX2-1

PubMed Central

Deterding, Robin R.; Wert, Susan E.; White, Frances V.; Dishop, Megan K.; Alfano, Danielle N.; Halbower, Ann C.; Planer, Benjamin; Stephan, Mark J.; Uchida, Derek A.; Williames, Lee D.; Rosenfeld, Jill A.; Lebel, Robert Roger; Young, Lisa R.; Cole, F. Sessions; Nogee, Lawrence M.

2013-01-01

Background: Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Methods: Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. Results: We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Conclusions: Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease. PMID:23430038

Averrhoa bilimbi fruits attenuate hyperglycemia-mediated oxidative stress in streptozotocin-induced diabetic rats.

PubMed

Kurup, Surya B; Mini, S

2017-04-01

Hyperglycemia-mediated oxidative stress plays a major role in the development of diabetic complications. Averrhoa bilimbi Linn. (Oxalidaceae) is a medicinal plant with fruits reported to possess antidiabetic activity. This study evaluated the beneficial effects of the ethyl acetate fraction of A. bilimbi fruit (ABAEE) on the antioxidant/oxidant status in diabetes mellitus. Diabetic rats were treated orally with the ethyl acetate fraction of A. bilimbi fruits at a dose of 25 mg/kg body weight for 60 days. Serum glucose, glycated hemoglobin, plasma insulin, hepatic toxicity markers, antioxidant enzymes, lipid peroxidation products, and liver histopathology were assayed checked after 60 days of extract treatment. Diabetic rats administered ABAEE showed a significant decline in serum glucose, glycated hemoglobin, and also significantly increases the level of plasma insulin, as well as a notable attenuation in thiobarbituric acid-reactive substances, conjugated dienes, and hydroperoxides. ABAEE also modulated hepatic antioxidant potential by significantly increasing the activities of catalase, glutathione peroxidase, glutathione reductase, superoxide dismutase, and reducing glutathione content. The results associated with ABAEE were more significant than those observed following treatment with the standard drug metformin. Histopathological observations showed that ABAEE effectively rescued hepatocytes from oxidative damage without affecting cellular function and structural integrity. High-performance liquid chromatography analysis of ABAEE indicated the presence of phenolic compound, quercetin, indicating that the antidiabetic effect of the extract might be related to quercetin. These results demonstrated the potential beneficial effect of ABAEE on streptozotocin-induced diabetes in rats. Copyright © 2016. Published by Elsevier B.V.

Heterogeneous pulmonary phenotypes associated with mutations in the thyroid transcription factor gene NKX2-1.

PubMed

Hamvas, Aaron; Deterding, Robin R; Wert, Susan E; White, Frances V; Dishop, Megan K; Alfano, Danielle N; Halbower, Ann C; Planer, Benjamin; Stephan, Mark J; Uchida, Derek A; Williames, Lee D; Rosenfeld, Jill A; Lebel, Robert Roger; Young, Lisa R; Cole, F Sessions; Nogee, Lawrence M

2013-09-01

Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease.

Temperature modulation with an esophageal heat transfer device - a pediatric swine model study.

PubMed

Kulstad, Erik B; Naiman, Melissa; Shanley, Patrick; Garrett, Frank; Haryu, Todd; Waller, Donald; Azarafrooz, Farshid; Courtney, Daniel Mark

2015-01-01

An increasing number of conditions appear to benefit from control and modulation of temperature, but available techniques to control temperature often have limitations, particularly in smaller patients with high surface to mass ratios. We aimed to evaluate a new method of temperature modulation with an esophageal heat transfer device in a pediatric swine model, hypothesizing that clinically significant modulation in temperature (both increases and decreases of more than 1°C) would be possible. Three female Yorkshire swine averaging 23 kg were anesthetized with inhalational isoflurane prior to placement of the esophageal device, which was powered by a commercially available heat exchanger. Swine temperature was measured rectally and cooling and warming were performed by selecting the appropriate external heat exchanger mode. Temperature was recorded over time in order to calculate rates of temperature change. Histopathology of esophageal tissue was performed after study completion. Average swine baseline temperature was 38.3°C. Swine #1 exhibited a cooling rate of 3.5°C/hr; however, passive cooling may have contributed to this rate. External warming blankets maintained thermal equilibrium in swine #2 and #3, demonstrating maximum temperature decrease of 1.7°C/hr. Warming rates averaged 0.29°C/hr. Histopathologic analysis of esophageal tissue showed no adverse effects. An esophageal heat transfer device successfully modulated the temperature in a pediatric swine model. This approach to temperature modulation may offer a useful new modality to control temperature in conditions warranting temperature management (such as maintenance of normothermia, induction of hypothermia, fever control, or malignant hyperthermia).

Rare Forms of Castleman Disease Mimicking Malignancy: Mesenteric and Pancreatic Involvement.

PubMed

Ozsoy, Mustafa; Ozsoy, Zehra; Sahin, Suleyman; Arıkan, Yuksel

2018-03-12

Castleman disease is a lymphoproliferative disorder with unknown etiology and pathogenesis. While the disease may involve all parts of the body, the mediastinum appears to be the most common part of involvement. In this study, we present two cases of Castleman disease with different localizations that mimicked malignancy. A 62-year-old female patient presented with jaundice. Laboratory analysis indicated aspartate aminotransferase: 250 U/L, total bilirubin: 4 mg/dl, and carbohydrate antigen (CA) 19-9: 900 U/ml. Computerized tomography (CT) of the abdomen showed a mass originating from the pancreas head which resulted in a biliary tract obstruction. A positron emission tomography-computed tomography (PET/CT) showed that the only site of involvement was the pancreas head. A decision was made to perform pancreaticoduodenectomy. During intra-abdominal exploration, lymphadenopathies were identified in the surroundings of the retropancreatic portal vein and the hepatic artery. Histopathological investigation of the dissected lymph nodes demonstrated findings consistent with granulomatous plasma-cell-rich Castleman disease. A 55-year-old female patient presented with abdominal pain, nausea, and vomiting. Computerized tomography of the abdomen showed an abdominal mass of 7 cm, originating from the mesenterium, with high-contrast uptake in the mesenterium in the lower abdominal quadrant. The mesenteric mass was resected along with segmentary small intestine resection. Histopathological investigation of the mass showed a giant granulomatous structure that consisted of plasma cells consistent with Castleman disease. Castleman disease should be kept in mind during differential diagnosis of locally advanced lymph nodes observed during preoperative investigations and intraoperative exploration.

Hepatoprotective effect of methyl ferulic acid against carbon tetrachloride-induced acute liver injury in rats

PubMed Central

Yang, Chengfang; Li, Li; Ma, Zuheng; Zhong, Yujuan; Pang, Wenxiao; Xiong, Meili; Fang, Shuping; Li, Yongwen

2018-01-01

The present study aimed to investigate the hepatoprotective effects of methyl ferulic acid (MFA) against oxidative stress and apoptosis in acute liver injury induced by carbon tetrachloride (CCl4) in rats, as well as the underlying mechanisms. Sprague Dawley rats were treated with CCl4 after oral administration of MFA (25, 50, and 100 mg/kg) or dimethyl diphenyl bicarboxylate (200 mg/kg) for 7 days. The hepatoprotective effects of MFA were determined by analyzing serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities as well as changes of oxidant parameters. Histopathological analysis was performed to determine the degree of hepatic injury. The mechanisms were investigated by detecting the levels of NADPH oxidase (NOX) trans-membrane subunit NOX4, its ligand p22phox, as well as caspase3, cleaved caspase3, B-cell lymphoma (Bcl)-2, Bcl-2-associated X protein (Bax), tumor necrosis factor (TNF)-α, interleukin (IL)-1, reactive oxygen species (ROS), thiobarbituric acid-reactive substances (TBARS), total anti-oxidant capacity (TAC), phosphorylated J-Jun N-terminal kinase (p-JNK) and p-p38 mitogen-activated protein kinase (MAPK) using semi-quantitative polymerase chain reaction, western blot analysis and colorimetric assays. MFA treatment significantly decreased serum enzymatic activities of ALT and AST. MFA markedly increased activities of liver superoxide dismutase, catalase and glutathione peroxidase, and reduced the malondialdehyde concentration. Histopathological examination demonstrated that MFA reduced lipid degeneration, cytoplasmic vacuolization, necrosis and inflammatory cell infiltration in the liversof CCl4-treated rats. MFA treatment markedly inhibited the expression of inflammatory factors TNF-α and IL-1β. Mechanistic study revealed that MFA decreased the TAC and the levels of ROS and TBARS. Furthermore, MFA treatment led to a reduction of the mRNA and protein expression of NOX4 and p22phox, as well as the protein levels of caspase3, cleaved caspase-3 and Bax, and an upregulation of p-JNK, p-p38 MAPK and Bcl-2 proteins in the liver. The present study demonstrated that MFA has hepatoprotective effects against CCl4-induced acute liver damage. MFA has anti-oxidant, anti-inflammatory and anti-apoptotic activities and was able to modulate the NOX4/p22phox/ROS-JNK/p38 MAPK signaling pathway. PMID:29467841

Cationic drug pharmacokinetics in diseased livers determined by fibrosis index, hepatic protein content, microsomal activity, and nature of drug.

PubMed

Hung, Daniel Y; Chang, Ping; Cheung, Kee; McWhinney, Brett; Masci, Paul P; Weiss, Michael; Roberts, Michael S

2002-06-01

The disposition kinetics of six cationic drugs in perfused diseased and normal rat livers were determined by multiple indicator dilution and related to the drug physicochemical properties and liver histopathology. A carbon tetrachloride (CCl(4))-induced acute hepatocellular injury model had a higher fibrosis index (FI), determined by computer-assisted image analysis, than did an alcohol-induced chronic hepatocellular injury model. The alcohol-treated group had the highest hepatic alpha(1)-acid glycoprotein, microsomal protein (MP), and cytochrome P450 (P450) concentrations. Various pharmacokinetic parameters could be related to the octanol-water partition coefficient (log P(app)) of the drug as a surrogate for plasma membrane partition coefficient and affinity for MP or P450, the dependence being lower in the CCl(4)-treated group and higher in the alcohol-treated group relative to controls. Stepwise regression analysis showed that hepatic extraction ratio, permeability-surface area product, tissue-binding constant, intrinsic clearance, partition ratio of influx (k(in)) and efflux rate constant (k(out)), and k(in)/k(out) were related to physicochemical properties of drug (log P(app) or pK(a)) and liver histopathology (FI, MP, or P450). In addition, hepatocyte organelle ion trapping of cationic drugs was evident in all groups. It is concluded that fibrosis-inducing hepatic disease effects on cationic drug disposition in the liver may be predicted from drug properties and liver histopathology.

Histopathological study of cardiac lesions in methamphetamine poisoning-related deaths.

PubMed

Akhgari, Maryam; Mobaraki, Homeira; Etemadi-Aleagha, Afshar

2017-02-17

Methamphetamine abuse is a worldwide health concern. Methamphetamine causes health hazards in many vital organs. It can cause damage to cardiac tissue via catecholamines release. Methamphetamine related deaths are becoming one of the most important problems in Iran. The purpose of the present study was to determine cardiac pathology in methamphetamine poisoning-related deaths. The study included 100 cases of methamphetamine poisoning-related deaths and 100 cases as control group. Toxicology analysis of liver, gastric content, bile, urine, blood and vitreous humor were conducted to detect drugs, poisons and alcohols using thin layer chromatography, gas chromatography/mass spectrometry, and high performance liquid chromatography. Positive toxicology analysis results except for amphetamine and methamphetamine were excluded from the study in order to omit interfering factors. The most striking features of cardiac damage were observed by light microscopy. Methamphetamine and amphetamine were detected in either urine or gastric content samples. In all of the cases methamphetamine toxicity was determined to be a direct cause of death by forensic medicine practitioner. Cardiovascular pathology was noted in 68% of studied cases. The most common histopathologic features were myocardial fiber hypertrophy, mild, moderate to severe atherosclerosis and focal degeneration/necrosis. The results of the present study indicate that cardiotoxicity is one of the major contributing factors in methamphetamine poisoning related deaths. Overall, the current study highlights the fact that cardiotoxic effects of methamphetamine can explain increasing reports of heart failure and consequently death in young abusers. Not applicable. Histopathological study of cardiac lesions in methamphetamine poisoning-related deaths.