Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G
2015-06-01
The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Saubi, Narcís; Im, Eung-Jun; Fernández-Lloris, Raquel; Gil, Olga; Cardona, Pere-Joan; Gatell, Josep Maria; Hanke, Tomáš; Joseph, Joan
2011-01-01
We have evaluated the influence of age and immunization routes for induction of HIV-1- and M. tuberculosis-specific immune responses after neonatal (7 days old) and adult (7 weeks old) BALB/c mice immunization with BCG.HIVA222 prime and MVA.HIVA boost. The specific HIV-1 cellular immune responses were analyzed in spleen cells. The body weight of the newborn mice was weekly recorded. The frequencies of HIV-specific CD8+ T cells producing IFN-γ were higher in adult mice vaccinated intradermally and lower in adult and newborn mice vaccinated subcutaneously. In all cases the IFN-γ production was significantly higher when mice were primed with BCG.HIVA222 compared with BCGwt. When the HIV-specific CTL activity was assessed, the frequencies of specific killing were higher in newborn mice than in adults. The prime-boost vaccination regimen which includes BCG.HIVA222 and MVA.HIVA was safe when inoculated to newborn mice. The administration of BCG.HIVA222 to newborn mice is safe and immunogenic and increased the HIV-specific responses induced by MVA.HIVA vaccine. It might be a good model for infant HIV and Tuberculosis bivalent vaccine. PMID:21603216
Kill: boosting HIV-specific immune responses.
Trautmann, Lydie
2016-07-01
Increasing evidence suggests that purging the latent HIV reservoir in virally suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV-infected cells ('Shock and Kill' strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in-vivo and in-silico models to accelerate the design of new clinical trials. New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment.
Kill: Boosting HIV-specific immune responses
Trautmann, Lydie
2016-01-01
Purpose of review Increasing evidences suggest that purging the latent HIV reservoir in virally-suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV infected cells (“Shock and Kill” strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent findings Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in vivo and in silico models to accelerate the design of new clinical trials. Summary New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment. PMID:27054280
Engineering HIV-Specific Immunity with Chimeric Antigen Receptors.
Kitchen, Scott G; Zack, Jerome A
2016-12-01
HIV remains a highly important public health and clinical issue despite many recent advances in attempting to develop a cure, which has remained elusive for most people infected with HIV. HIV disease can be controlled with pharmacologic therapies; however, these treatments are expensive, may have severe side effects, and are not curative. Consequently, an improved means to control or eliminate HIV replication is needed. Cytotoxic T lymphocytes (CTLs) play a critical role in controlling viral replication and are an important part in the ability of the immune response to eradicate most viral infections. There are considerable efforts to enhance CTL responses in HIV-infected individuals in hopes of providing the immune response with armaments to more effectively control viral replication. In this review, we discuss some of these efforts and focus on the development of a gene therapy-based approach to engineer hematopoietic stem cells with an HIV-1-specific chimeric antigen receptor, which seeks to provide an inexhaustible source of HIV-1-specific immune cells that are MHC unrestricted and superior to natural antiviral T cell responses. These efforts provide the basis for further development of T cell functional enhancement to target and treat chronic HIV infection in hopes of eradicating the virus from the body.
Tung, Frank Y; Tung, Jack K; Pallikkuth, Suresh; Pahwa, Savita; Fischl, Margaret A
2016-04-27
HIV-1 specific cellular immunity plays an important role in controlling viral replication. In this first-in-human therapeutic vaccination study, a replication-defective HIV-1 vaccine (HIVAX) was tested in HIV-1 infected participants undergoing highly active antiretroviral therapy (HAART) to enhance anti-HIV immunity (Clinicaltrials.gov, identifier NCT01428596). A010 was a randomized, placebo-controlled trial to evaluate the safety and the immunogenicity of a replication defective HIV-1 vaccine (HIVAX) given as a subcutaneous injection to HIV-1 infected participants who were receiving HAART with HIV-1 viral load <50 copies/ml and CD4 cell count >500 cells/mm(3). HIV-1 specific immune responses were monitored by INF-γ enzyme linked immunospot (Elispot) and intracellular cytokine staining (ICS) assay after vaccination. Following the randomized placebo-controlled vaccination phase, subjects who received HIVAX vaccine and who met eligibility underwent a 12-week analytical antiretroviral treatment interruption (ATI). Viral load was monitored throughout the study. HIVAX was well tolerated in trial participants. Transient grade 1 to 2 (mild to moderate) injection site reactions occurred in 8 of 10 vaccinated participants. HIVAX was immunogenic in all vaccinated participants. The functionality of T cells was significantly enhanced after vaccination. Median viral load (3.45 log10 copies/ml, range of 96-12,830 copies/ml) at the end of the 12-week treatment interruption in HIVAX vaccinated group was significantly lower than the pre-treatment levels. Three vaccinated participants extended ATI for up to 2 years with stable CD4 cells and low viral loads. HIVAX vaccine is generally safe, elicits strong anti-HIV-1 immune responses, and may play an important role in controlling viral load during treatment interruption in HIV-1 infected participants. Copyright © 2016 Elsevier Ltd. All rights reserved.
HIV-1 evades innate immune recognition through specific cofactor recruitment
NASA Astrophysics Data System (ADS)
Rasaiyaah, Jane; Tan, Choon Ping; Fletcher, Adam J.; Price, Amanda J.; Blondeau, Caroline; Hilditch, Laura; Jacques, David A.; Selwood, David L.; James, Leo C.; Noursadeghi, Mahdad; Towers, Greg J.
2013-11-01
Human immunodeficiency virus (HIV)-1 is able to replicate in primary human macrophages without stimulating innate immunity despite reverse transcription of genomic RNA into double-stranded DNA, an activity that might be expected to trigger innate pattern recognition receptors. We reasoned that if correctly orchestrated HIV-1 uncoating and nuclear entry is important for evasion of innate sensors then manipulation of specific interactions between HIV-1 capsid and host factors that putatively regulate these processes should trigger pattern recognition receptors and stimulate type 1 interferon (IFN) secretion. Here we show that HIV-1 capsid mutants N74D and P90A, which are impaired for interaction with cofactors cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and cyclophilins (Nup358 and CypA), respectively, cannot replicate in primary human monocyte-derived macrophages because they trigger innate sensors leading to nuclear translocation of NF-κB and IRF3, the production of soluble type 1 IFN and induction of an antiviral state. Depletion of CPSF6 with short hairpin RNA expression allows wild-type virus to trigger innate sensors and IFN production. In each case, suppressed replication is rescued by IFN-receptor blockade, demonstrating a role for IFN in restriction. IFN production is dependent on viral reverse transcription but not integration, indicating that a viral reverse transcription product comprises the HIV-1 pathogen-associated molecular pattern. Finally, we show that we can pharmacologically induce wild-type HIV-1 infection to stimulate IFN secretion and an antiviral state using a non-immunosuppressive cyclosporine analogue. We conclude that HIV-1 has evolved to use CPSF6 and cyclophilins to cloak its replication, allowing evasion of innate immune sensors and induction of a cell-autonomous innate immune response in primary human macrophages.
Innate immunity against HIV-1 infection.
Altfeld, Marcus; Gale, Michael
2015-06-01
During acute HIV-1 infection, viral pathogen-associated molecular patterns are recognized by pathogen-recognition receptors (PRRs) of infected cells, which triggers a signaling cascade that initiates innate intracellular antiviral defenses aimed at restricting the replication and spread of the virus. This cell-intrinsic response propagates outward via the action of secreted factors such as cytokines and chemokines that activate innate immune cells and attract them to the site of infection and to local lymphatic tissue. Antiviral innate effector cells can subsequently contribute to the control of viremia and modulate the quality of the adaptive immune response to HIV-1. The concerted actions of PRR signaling, specific viral-restriction factors, innate immune cells, innate-adaptive immune crosstalk and viral evasion strategies determine the outcome of HIV-1 infection and immune responses.
Coplan, Paul M; Gupta, Swati B; Dubey, Sheri A; Pitisuttithum, Punnee; Nikas, Alex; Mbewe, Bernard; Vardas, Efthyia; Schechter, Mauro; Kallas, Esper G; Freed, Dan C; Fu, Tong-Ming; Mast, Christopher T; Puthavathana, Pilaipan; Kublin, James; Brown Collins, Kelly; Chisi, John; Pendame, Richard; Thaler, Scott J; Gray, Glenda; Mcintyre, James; Straus, Walter L; Condra, Jon H; Mehrotra, Devan V; Guess, Harry A; Emini, Emilio A; Shiver, John W
2005-05-01
The genetic diversity of human immunodeficiency virus type 1 (HIV-1) raises the question of whether vaccines that include a component to elicit antiviral T cell immunity based on a single viral genetic clade could provide cellular immune protection against divergent HIV-1 clades. Therefore, we quantified the cross-clade reactivity, among unvaccinated individuals, of anti-HIV-1 T cell responses to the infecting HIV-1 clade relative to other major circulating clades. Cellular immune responses to HIV-1 clades A, B, and C were compared by standardized interferon- gamma enzyme-linked immunospot assays among 250 unvaccinated individuals, infected with diverse HIV-1 clades, from Brazil, Malawi, South Africa, Thailand, and the United States. Cross-clade reactivity was evaluated by use of the ratio of responses to heterologous versus homologous (infecting) clades of HIV-1. Cellular immune responses were predominantly focused on viral Gag and Nef proteins. Cross-clade reactivity of cellular immune responses to HIV-1 clade A, B, and C proteins was substantial for Nef proteins (ratio, 0.97 [95% confidence interval, 0.89-1.05]) and lower for Gag proteins (ratio, 0.67 [95% confidence interval, 0.62-0.73]). The difference in cross-clade reactivity to Nef and Gag proteins was significant (P<.0001). Cross-clade reactivity of cellular immune responses can be substantial but varies by viral protein.
Pattacini, Laura; Baeten, Jared M.; Thomas, Katherine K.; Fluharty, Tayler R.; Murnane, Pamela M.; Donnell, Deborah; Bukusi, Elizabeth; Ronald, Allan; Mugo, Nelly; Lingappa, Jairam R.; Celum, Connie; McElrath, M. Juliana; Lund, Jennifer M.
2015-01-01
Objective Two distinct hypotheses have been proposed for T-cell involvement in protection from HIV-1 acquisition. First, HIV-1-specific memory T-cell responses generated upon HIV-1 exposure could mount an efficient response to HIV-1 and inhibit the establishment of an infection. Second, a lower level of immune activation could reduce the numbers of activated, HIV-1-susceptible CD4+ T-cells, thereby diminishing the likelihood of infection. Methods To test these hypotheses, we conducted a prospective study among high-risk heterosexual men and women, and tested peripheral blood samples from individuals who subsequently acquired HIV-1 during follow-up (cases) and from a subset of those who remained HIV-1 uninfected (controls). Results We found no difference in HIV-1-specific immune responses between cases and controls, but Treg frequency was higher in controls as compared to cases and was negatively associated with frequency of effector memory CD4+ T-cells. Conclusions Our findings support the hypothesis that low immune activation assists in protection from HIV-1 infection. PMID:26656786
Milani, Alireza; Bolhassani, Azam; Shahbazi, Sepideh; Motevalli, Fatemeh; Sadat, Seyed Mehdi; Soleymani, Sepehr
2017-11-01
Novel vaccine modalities have been designed to improve the efficiency of vaccines against HIV infections. In this way, the HIV-1 Nef protein has been known as an attractive antigenic candidate in therapeutic vaccine development. Moreover, the endogenous adjuvants such as heat shock proteins (HSPs) and high mobility group box 1 protein (HMGB1) have been suggested effectively to induce antigen-specific humoral and cellular immune responses. In this study, different Nef DNA and protein constructs were produced in eukaryotic and prokaryotic expression systems, and their immunostimulatory properties were evaluated using small heat shock protein 27 (Hsp27) and the HMGB1-derived peptide (Hp91) in a mouse model. Generally, our results indicated that the Hsp27-Nef fusion DNA or protein could significantly elicit higher humoral and cellular immune responses than Nef DNA or protein, respectively. Analysis of the immune responses demonstrated that the Hsp27-Nef fusion protein, and also the mixture of Nef and Hp91 significantly enhanced the Nef-specific T cell responses. Indeed, these regimens induced high levels of IgG2a and IFN-γ directed toward Th1 responses and also Granzyme B secretion as compared to other immunization strategies. The immunostimulatory properties of Freund's adjuvant were significantly less than Hsp27 and Hp91 peptide in various immunization strategies. These findings showed that the use of Hsp27 and Hp91 in protein strategy could improve HIV-1 Nef-specific B- and T-cell immune responses, and also represent a promising HIV-1 vaccine candidate in future. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
Complex Immune Correlates of Protection in HIV-1 Vaccine Efficacy Trials
Tomaras, Georgia D.; Plotkin, Stanley A.
2016-01-01
Summary Development of an efficacious HIV-1 vaccine is a major priority for improving human health worldwide. Vaccine mediated protection against human pathogens can be achieved through elicitation of protective innate, humoral, and cellular responses. Identification of specific immune responses responsible for pathogen protection enables vaccine development and provides insights into host defenses against pathogens and the immunological mechanisms that most effectively fight infection. Defining immunological correlates of transmission risk in preclinical and clinical HIV-1 vaccine trials has moved the HIV-1 vaccine development field forward and directed new candidate vaccine development. Immune correlate studies are providing novel hypotheses about immunological mechanisms that may be responsible for preventing HIV-1 acquisition. Recent results from HIV-1 immune correlates work has demonstrated that there are multiple types of immune responses that together, comprise an immune correlate—thus implicating polyfunctional immune control of HIV-1 transmission. An in depth understanding of these complex immunological mechanisms of protection against HIV-1 will accelerate the development of an efficacious HIV-1 vaccine. PMID:28133811
2018-01-01
ABSTRACT Vaccine-elicited humoral immune responses comprise an array of antibody forms and specificities, with only a fraction contributing to protective host immunity. Elucidation of antibody effector functions responsible for protective immunity against human immunodeficiency virus type 1 (HIV-1) acquisition is a major goal for the HIV-1 vaccine field. Immunoglobulin A (IgA) is an important part of the host defense against pathogens; however, little is known about the role of vaccine-elicited IgA and its capacity to mediate antiviral functions. To identify the antiviral functions of HIV-1-specific IgA elicited by vaccination, we cloned HIV-1 envelope-specific IgA monoclonal antibodies (MAbs) by memory B cell cultures from peripheral blood mononuclear cells from an RV144 vaccinee and produced two IgA clonal cell lines (HG129 and HG130) producing native, nonrecombinant IgA MAbs. The HG129 and HG130 MAbs mediated phagocytosis by monocytes, and HG129 blocked HIV-1 Env glycoprotein binding to galactosylceramide, an alternative HIV-1 receptor. These findings elucidate potential antiviral functions of vaccine-elicited HIV-1 envelope-specific IgA that may act to block HIV-1 acquisition at the portal of entry by preventing HIV-1 binding to galactosylceramide and mediating antibody Fc receptor-mediated virion phagocytosis. Furthermore, these findings highlight the complex and diverse interactions of vaccine-elicited IgA with pathogens that depend on IgA fine specificity and form (e.g., multimeric or monomeric) in the systemic circulation and mucosal compartments. IMPORTANCE Host-pathogen interactions in vivo involve numerous immune mechanisms that can lead to pathogen clearance. Understanding the nature of antiviral immune mechanisms can inform the design of efficacious HIV-1 vaccine strategies. Evidence suggests that both neutralizing and nonneutralizing antibodies can mediate some protection against HIV in animal models. Although numerous studies have characterized the
Ruane, D; Do, Y; Brane, L; Garg, A; Bozzacco, L; Kraus, T; Caskey, M; Salazar, A; Trumpheller, C; Mehandru, S
2016-09-01
Despite significant therapeutic advances for HIV-1 infected individuals, a preventative HIV-1 vaccine remains elusive. Studies focusing on early transmission events, including the observation that there is a profound loss of gastrointestinal (GI) CD4(+) T cells during acute HIV-1 infection, highlight the importance of inducing HIV-specific immunity within the gut. Here we report on the generation of cellular and humoral immune responses in the intestines by a mucosally administered, dendritic cell (DC) targeted vaccine. Our results show that nasally delivered α-CD205-p24 vaccine in combination with polyICLC, induced polyfunctional immune responses within naso-pulmonary lymphoid sites that disseminated widely to systemic and mucosal (GI tract and the vaginal epithelium) sites. Qualitatively, while α-CD205-p24 prime-boost immunization generated CD4(+) T-cell responses, heterologous prime-boost immunization with α-CD205-p24 and NYVAC gag-p24 generated high levels of HIV-specific CD4(+) and CD8(+) T cells within the GI tract. Finally, DC-targeting enhanced the amplitude and longevity of vaccine-induced immune responses in the GI tract. This is the first report of a nasally delivered, DC-targeted vaccine to generate HIV-specific immune responses in the GI tract and will potentially inform the design of preventative approaches against HIV-1 and other mucosal infections.
Maternal HIV-1 envelope–specific antibody responses and reduced risk of perinatal transmission
Permar, Sallie R.; Fong, Youyi; Vandergrift, Nathan; Fouda, Genevieve G.; Gilbert, Peter; Parks, Robert; Jaeger, Frederick H.; Pollara, Justin; Martelli, Amanda; Liebl, Brooke E.; Lloyd, Krissey; Yates, Nicole L.; Overman, R. Glenn; Shen, Xiaoying; Whitaker, Kaylan; Chen, Haiyan; Pritchett, Jamie; Solomon, Erika; Friberg, Emma; Marshall, Dawn J.; Whitesides, John F.; Gurley, Thaddeus C.; Von Holle, Tarra; Martinez, David R.; Cai, Fangping; Kumar, Amit; Xia, Shi-Mao; Lu, Xiaozhi; Louzao, Raul; Wilkes, Samantha; Datta, Saheli; Sarzotti-Kelsoe, Marcella; Liao, Hua-Xin; Ferrari, Guido; Alam, S. Munir; Montefiori, David C.; Denny, Thomas N.; Moody, M. Anthony; Tomaras, Georgia D.; Gao, Feng; Haynes, Barton F.
2015-01-01
Despite the wide availability of antiretroviral drugs, more than 250,000 infants are vertically infected with HIV-1 annually, emphasizing the need for additional interventions to eliminate pediatric HIV-1 infections. Here, we aimed to define humoral immune correlates of risk of mother-to-child transmission (MTCT) of HIV-1, including responses associated with protection in the RV144 vaccine trial. Eighty-three untreated, HIV-1–transmitting mothers and 165 propensity score–matched nontransmitting mothers were selected from the Women and Infants Transmission Study (WITS) of US nonbreastfeeding, HIV-1–infected mothers. In a multivariable logistic regression model, the magnitude of the maternal IgG responses specific for the third variable loop (V3) of the HIV-1 envelope was predictive of a reduced risk of MTCT. Neutralizing Ab responses against easy-to-neutralize (tier 1) HIV-1 strains also predicted a reduced risk of peripartum transmission in secondary analyses. Moreover, recombinant maternal V3–specific IgG mAbs mediated neutralization of autologous HIV-1 isolates. Thus, common V3-specific Ab responses in maternal plasma predicted a reduced risk of MTCT and mediated autologous virus neutralization, suggesting that boosting these maternal Ab responses may further reduce HIV-1 MTCT. PMID:26053661
Predominate HIV1-specific IgG activity in various mucosal compartments of HIV1-infected individuals.
Lü, F X
2000-10-01
Evaluating mucosal humoral immunity is important for understanding local immunity induced by HIV infection or vaccination and designing prophylactic strategies. To characterize the mucosal humoral immunity following HIV infection, the levels of immunoglobulins (Igs), antibodies (Abs), and HIV1-specific Ab activity were evaluated in cervicovaginal secretions (CVS), saliva, breast milk, and sera of HIV-infected individuals. HIV1-specific IgG activity was significantly higher than that of IgA in CVS, saliva, and breast milk. The highest HIV1-specific IgG activity was found in breast milk. The data suggest that anti-HIV1 Abs in CVS were most likely serum derived. However, HIV1-specific Abs in saliva and breast milk were mainly locally produced. The prevalence of HIV1-specific Abs in seropositive subjects was 97% for IgG and 95% for IgA in CVS, 100% for IgG and 80% for IgA in saliva, and 59% for IgG and 94% for IgA in breast milk. These data provide evidence for both a better understanding of the nature of humoral mucosal responses after HIV1 infection and the development of strategies to induce desirable functional mucosal immunity for preventing HIV transmission. Copyright 2000 Academic Press.
T-cell receptor transfer for boosting HIV-1-specific T-cell immunity in HIV-1-infected patients.
Mummert, Christiane; Hofmann, Christian; Hückelhoven, Angela G; Bergmann, Silke; Mueller-Schmucker, Sandra M; Harrer, Ellen G; Dörrie, Jan; Schaft, Niels; Harrer, Thomas
2016-09-10
Strategies to cure HIV-1 infection require the eradication of viral reservoirs. An innovative approach for boosting the cytotoxic T-lymphocyte response is the transfer of T-cell receptors (TCRs). Previously, we have shown that electroporation of TCR-encoding mRNA is able to reprogram CD8 T cells derived from healthy donors. So far, it is unknown whether the transfer of HIV-1-specific TCRs is capable to reprogram CD8 T cells of HIV-1-infected patients. To assess the efficiency of TCR-transfer by mRNA electroporation and the functionality of reprogramed T cells in HIV-1-infected patients, we performed an in-vitro analysis of TCR-transfer into T cells from HIV-1-infected patients in various stages of disease and from healthy controls. Peripheral blood mononuclear cells from 16 HIV-1-infected patients (nine HLA-A02-positive, seven HLA-A02-negative) and from five healthy controls were electroporated with mRNA-constructs encoding TCRs specific for the HLA-A02/HIV-1-gag p17 epitope SLYNTVATL (SL9). Functionality of the TCRs was measured by γIFN-ELISpot assays. SL9/TCR transfection into peripheral blood mononuclear cells from both HLA-A02-positive and HLA-A02-negative HIV-1-infected patients and from healthy blood donors reprogramed T cells for recognition of SL9-presenting HLA-A02-positive cells in γIFN-ELISpot assays. SL9/TCR-transfer into T cells from an immunodeficient AIDS patient could induce recognition of SL9-expressing target cells only after reversion of T-cell dysfunction by antiretroviral therapy. The transfer of HIV-1-p17-specific TCRs into T cells is functional both in HIV-1-infected patients as well as in healthy blood donors. TCR-transfer is a promising method to boost the immune system against HIV-1.
[Immune response induced by HIV DNA vaccine combined with recombinant adeno-associated virus].
Liu, Yan-zheng; Zhou, Ling; Wang, Qi; Ye, Shu-qing; Li, Hong-xia; Zeng, Yi
2004-09-01
HIV-1 DNA vaccine and recombinant adeno-associated virus (rAAV) expressing gagV3 gene of HIV-1 subtype B were constructed and BALB/c mice were immunized by vaccination regimen consisting of consecutive priming with DNA vaccine and boosting with rAAV vaccine; the CTL and antibody response were detected and compared with those induced by DNA vaccine or rAAV vaccine separately. HIV-1 subtype B gagV3 gene was inserted into the polyclonal site of plasmid pCI-neo, DNA vaccine pCI-gagV3 was thereby constructed; pCI-gagV3 was transfected into p815 cells, G-418-resistant cells were obtained through screening transfected cells with G418, the expression of HIV-1 antigen in G-418-resistant cells was detected by EIA; BALB/c mice were immunized with pCI-gagV3 and the immune response was tested; BALB/c mouse immunized with pCI-gagV3 and combined with rAAV expressing the same gagV3 genes were tested for antibody level in sera by EIA method and cytotoxicity response by LDH method. pCI-gagV3 could express HIV-1 gene in p815 cells; pCI-gagV3 could induce HIV-1 specific humoral and cell-mediated immune response in BALB/c mice. The HIV-1 specific antibody level was 1/20; when the ratio of effector cells: target cells was 50:1, the average specific cytotoxicity was 41.7%; there was no evident increase in the antibody level induced by pCI-gagV3 combined with rAAV, but there was increase in CTL response, the average specific cytotoxicity was 61.3% when effector cells: target cells ratio was 50:1. HIV-1 specific cytotoxicity in BALB/c mice can be increased by immunization of BALB/c mice with DNA vaccine combined with rAAV vaccine.
Liu, Fengliang; Fan, Xiuzhen; Auclair, Sarah; Ferguson, Monique; Sun, Jiaren; Soong, Lynn; Hou, Wei; Redfield, Robert R.; Birx, Deborah L.; Ratto-Kim, Silvia; Robb, Merlin L.; Kim, Jerome H.; Michael, Nelson L.; Hu, Haitao
2016-01-01
Loss of immune control over opportunistic infections can occur at different stages of HIV-1 (HIV) disease, among which mucosal candidiasis caused by the fungal pathogen Candida albicans (C. albicans) is one of the early and common manifestations in HIV-infected human subjects. The underlying immunological basis is not well defined. We have previously shown that compared to cytomegalovirus (CMV)-specific CD4 cells, C. albicans-specific CD4 T cells are highly permissive to HIV in vitro. Here, based on an antiretroviral treatment (ART) naïve HIV infection cohort (RV21), we investigated longitudinally the impact of HIV on C. albicans- and CMV-specific CD4 T-cell immunity in vivo. We found a sequential dysfunction and preferential depletion for C. albicans-specific CD4 T cell response during progressive HIV infection. Compared to Th1 (IFN-γ, MIP-1β) functional subsets, the Th17 functional subsets (IL-17, IL-22) of C. albicans-specific CD4 T cells were more permissive to HIV in vitro and impaired earlier in HIV-infected subjects. Infection history analysis showed that C. albicans-specific CD4 T cells were more susceptible to HIV in vivo, harboring modestly but significantly higher levels of HIV DNA, than CMV-specific CD4 T cells. Longitudinal analysis of HIV-infected individuals with ongoing CD4 depletion demonstrated that C. albicans-specific CD4 T-cell response was preferentially and progressively depleted. Taken together, these data suggest a potential mechanism for earlier loss of immune control over mucosal candidiasis in HIV-infected patients and provide new insights into pathogen-specific immune failure in AIDS pathogenesis. PMID:27280548
HIV-1 Antibody Neutralization Breadth Is Associated with Enhanced HIV-Specific CD4+ T Cell Responses
Soghoian, Damien Z.; Lindqvist, Madelene; Ghebremichael, Musie; Donaghey, Faith; Carrington, Mary; Seaman, Michael S.; Kaufmann, Daniel E.; Walker, Bruce D.
2015-01-01
ABSTRACT Antigen-specific CD4+ T helper cell responses have long been recognized to be a critical component of effective vaccine immunity. CD4+ T cells are necessary to generate and maintain humoral immune responses by providing help to antigen-specific B cells for the production of antibodies. In HIV infection, CD4+ T cells are thought to be necessary for the induction of Env-specific broadly neutralizing antibodies. However, few studies have investigated the role of HIV-specific CD4+ T cells in association with HIV neutralizing antibody activity in vaccination or natural infection settings. Here, we conducted a comprehensive analysis of HIV-specific CD4+ T cell responses in a cohort of 34 untreated HIV-infected controllers matched for viral load, with and without neutralizing antibody breadth to a panel of viral strains. Our results show that the breadth and magnitude of Gag-specific CD4+ T cell responses were significantly higher in individuals with neutralizing antibodies than in those without neutralizing antibodies. The breadth of Gag-specific CD4+ T cell responses was positively correlated with the breadth of neutralizing antibody activity. Furthermore, the breadth and magnitude of gp41-specific, but not gp120-specific, CD4+ T cell responses were significantly elevated in individuals with neutralizing antibodies. Together, these data suggest that robust Gag-specific CD4+ T cells and, to a lesser extent, gp41-specific CD4+ T cells may provide important intermolecular help to Env-specific B cells that promote the generation or maintenance of Env-specific neutralizing antibodies. IMPORTANCE One of the earliest discoveries related to CD4+ T cell function was their provision of help to B cells in the development of antibody responses. Yet little is known about the role of CD4+ T helper responses in the setting of HIV infection, and no studies to date have evaluated the impact of HIV-specific CD4+ T cells on the generation of antibodies that can neutralize
Innate immunity and HIV-1 infection.
Lehner, T; Wang, Y; Whittall, T; Seidl, T
2011-04-01
HIV-1 is predominantly transmitted through mucosal tissues, targeting CD4(+)CCR5(+) T cells, 50% of which are destroyed within 2 weeks of infection. Conventional vaccination strategies have so far failed to prevent HIV-1 infection. Neither antibodies nor cytotoxic lymphocytes are capable of mounting a sufficiently rapid immune response to prevent early destruction of these cells. However, innate immunity is an early-response system, largely independent of prior encounter with a pathogen. Innate immunity can be classified into cellular, extracellular, and intracellular components, each of which is exemplified in this review by γδ T cells, CC chemokines, and APOBEC3G, respectively. First, γδ T cells are found predominantly in mucosal tissues and produce cytokines, CC chemokines, and antiviral factors. Second, the CC chemokines CCL-3, CCL-4, and CCL-5 can be upregulated by immunization of macaques with SIVgp120 and gag p27, and these can bind and downmodulate CCR5, thereby inhibiting HIV-1 entry into the host cells. Third, APOBEC3G is generated and maintained following rectal mucosal immunization in rhesus macaques for over 17 weeks, and the innate anti-SIV factor is generated by CD4(+)CD95(+)CCR7(-) effector memory T cells. Thus, innate anti-HIV-1 or SIV immunity can be linked with immune memory, mediated by CD4(+) T cells generating APOBEC3G. The multiple innate functions may mount an early anti-HIV-1 response and either prevent viral transmission or contain the virus until an effective adaptive immune response develops.
Hou, Jue; Zhang, Qicheng; Liu, Zheng; Wang, Shuhui; Li, Dan; Liu, Chang; Liu, Ying; Shao, Yiming
2016-01-01
Previous research has shown that host Cyclophilin A (CyPA) can promote dendritic cell maturation and the subsequent innate immune response when incorporated into an HIV-1 Gag protein to circumvent the resistance of dendritic cells to HIV-1 infection. This led us to hypothesize that CyPA may improve HIV-1 Gag-specific vaccine immunogenicity via binding with Gag antigen. The adjuvant effect of CyPA was evaluated using a DNA vaccine with single or dual expression cassettes. Mouse studies indicated that CyPA specifically and markedly promoted HIV-1 Gag-specific cellular immunity but not an HIV-1 Env-specific cellular response. The Gag/CyPA dual expression cassettes stimulated a greater Gag-specific cellular immune response, than Gag immunization alone. Furthermore, CyPA induced a broad Gag-specific T cell response and strong cellular immunity that lasted up to 5 months. In addition, CyPA skewed to cellular rather than humoral immunity. To investigate the mechanisms of the adjuvant effect, site-directed mutagenesis in CyPA, including active site residues H54Q and F60A resulted in mutants that were co-expressed with Gag in dual cassettes. The immune response to this vaccine was analyzed in vivo. Interestingly, the wild type CyPA markedly increased Gag cellular immunity, but the H54Q and F60A mutants drastically reduced CyPA adjuvant activation. Therefore, we suggest that the adjuvant effect of CyPA was based on Gag-CyPA-specific interactions. Herein, we report that Cyclophilin A can augment HIV-1 Gag-specific cellular immunity as a genetic adjuvant in multiplex DNA immunization strategies, and that activity of this adjuvant is specific, broad, long-term, and based on Gag-CyPA interaction.
Immune pathogenesis of pediatric HIV-1 infection
TIEMESSEN, CAROLINE T.; KUHN, LOUISE
2008-01-01
Vertical exposure to HIV occurs at a time when functional capacity of the infant’s immune system is attenuated through immaturity. Immune response capability is rooted in host genetic makeup, and the broad and fine specificity of innate and adaptive immune responses, respectively, shape the outcomes of HIV encounter in some instances and imprint viral changes through selective immune pressure in others. Findings from recent studies have profound implications for understanding immune pathogenesis of pediatric HIV infection, and in particular highlight the importance of host genetics of both mother and child in determining whether an exposed child acquires HIV infection or not, and if infected, the rate of disease progression. This review focuses on the key host molecules, the CC chemokine CCL3 and HLA, which have taken center stage in these new developments. PMID:16522254
HIV-1 Therapy with Monoclonal Antibody 3BNC117 Elicits Host Immune Responses against HIV-1
Schoofs, Till; Klein, Florian; Braunschweig, Malte; Kreider, Edward F.; Feldmann, Anna; Nogueira, Lilian; Oliveira, Thiago; Lorenzi, Julio C. C.; Parrish, Erica H.; Learn, Gerald H.; West, Anthony P.; Bjorkman, Pamela J.; Schlesinger, Sarah J.; Seaman, Michael S.; Czartoski, Julie; McElrath, M. Juliana; Pfeifer, Nico; Hahn, Beatrice H.; Caskey, Marina; Nussenzweig, Michel C.
2016-01-01
3BNC117 is a broad and potent anti-HIV-1 neutralizing antibody that targets the CD4 binding site on the viral envelope spike. When administered passively, this antibody can prevent infection in animal models and suppress viremia in HIV-1-infected individuals. Here we report that HIV-1 immunotherapy with a single injection of 3BNC117 impacts host antibody responses in viremic subjects. In comparison to untreated controls that showed little change in their neutralizing activity over a six-month period, 3BNC117 infusion significantly improved neutralizing responses to heterologous tier 2 viruses in nearly all study participants. We conclude that 3BNC117-mediated immunotherapy enhances host humoral immunity to HIV-1. PMID:27199429
Nguyen, Marie; Pean, Polidy; Lopalco, Lucia; Nouhin, Janin; Phoung, Viseth; Ly, Nary; Vermisse, Pierre; Henin, Yvette; Barré-Sinoussi, Françoise; Burastero, Samuele E; Reynes, Jean-Marc; Carcelain, Guislaine; Pancino, Gianfranco
2006-08-01
To study biological factors related to protection against HIV-1 infection in Cambodia, we recruited 48 partners of HIV-1-infected patients who remained uninfected (exposed uninfected individuals, EUs) despite unprotected sexual intercourse for more than 1 year and 49 unexposed controls (UCs). HIV-1-specific antibodies (IgA anti-gp41 and IgG anti-CD4-gp120 complex), T-cell responses, and cellular factors that may be involved in protection (peripheral blood mononuclear cell [PBMC] resistance to HIV-1 infection and beta-chemokine production) were evaluated. Anti-HIV-1 antibodies were higher in EUs than those in UCs (P = 0.01 and P = 0.04 for anti-gp41 and anti-CD4-gp120, respectively). We observed a decreased susceptibility to a primary Cambodian isolate, HIV-1KH019, in EU PBMCs as compared with UC PBMCs (P = 0.03). A weak T-cell response to one pool of HIV-1 Gag peptides was found by ELISpot in 1 of 19 EUs. Whereas T-cell specific immunity was not associated to protection, our results suggest that HIV-specific humoral immunity and reduced cell susceptibility to infection may contribute to protection against HIV-1 infection in Cambodian EUs.
Tomescu, C; Abdulhaqq, S; Montaner, L J
2011-01-01
The description of highly exposed individuals who remain seronegative (HESN) despite repeated exposure to human immunodeficiency virus (HIV)-1 has heightened interest in identifying potential mechanisms of HIV-1 resistance. HIV-specific humoral and T cell-mediated responses have been identified routinely in HESN subjects, although it remains unknown if these responses are a definitive cause of protection or merely a marker for exposure. Approximately half of HESN lack any detectible HIV-specific adaptive immune responses, suggesting that other mechanisms of protection from HIV-1 infection also probably exist. In support of the innate immune response as a mechanism of resistance, increased natural killer (NK) cell activity has been correlated with protection from infection in several high-risk cohorts of HESN subjects, including intravenous drug users, HIV-1 discordant couples and perinatally exposed infants. Inheritance of protective NK KIR3DL1high and KIR3DS1 receptor alleles have also been observed to be over-represented in a high-risk cohort of HESN intravenous drug users and HESN partners of HIV-1-infected subjects. Other intrinsic mechanisms of innate immune protection correlated with resistance in HESN subjects include heightened dendritic cell responses and increased secretion of anti-viral factors such as β-chemokines, small anti-viral factors and defensins. This review will highlight the most current evidence in HESN subjects supporting the role of epithelial microenvironment and the innate immune system in sustaining resistance against HIV-1 infection. We will argue that as a front-line defence the innate immune response determines the threshold of infectivity that HIV-1 must overcome to establish a productive infection. PMID:21413945
Khattar, Sunil K; Palaniyandi, Senthilkumar; Samal, Sweety; LaBranche, Celia C; Montefiori, David C; Zhu, Xiaoping; Samal, Siba K
2015-01-01
The combination of multiple HIV antigens in a vaccine can broaden antiviral immune responses. In this study, we used NDV vaccine strain LaSota to generate rNDV (rLaSota/optGag) expressing human codon optimized p55 Gag protein of HIV-1. We examined the effect of co-immunization of rLaSota/optGag with rNDVs expressing different forms of Env protein gp160, gp120, gp140L [a version of gp140 that lacked cytoplasmic tail and contained complete membrane-proximal external region (MPER)] and gp140S (a version of gp140 that lacked cytoplasmic tail and distal half of MPER) on magnitude and breadth of humoral, mucosal and cellular immune responses in guinea pigs and mice. Our results showed that inclusion of rLaSota/optGag with rNDVs expressing different forms of Env HIV Gag did not affect the Env-specific humoral and mucosal immune responses in guinea pigs and that the potent immune responses generated against Env persisted for at least 13 weeks post immunization. The highest Env-specific humoral and mucosal immune responses were observed with gp140S+optGag group. The neutralizing antibody responses against HIV strains BaL.26 and MN.3 induced by gp140S+optGag and gp160+optGag were higher than those elicited by other groups. Inclusion of Gag with gp160, gp140S and gp140L enhanced the level of Env-specific IFN-γ-producing CD8+ T cells in mice. Inclusion of Gag with gp160 and gp140L also resulted in increased Env-specific CD4+ T cells. The level of Gag-specific CD8+ and CD4+ T cells was also enhanced in mice immunized with Gag along with gp140S and gp120. These results indicate lack of antigen interference in a vaccine containing rNDVs expressing Env and Gag proteins. PMID:25695657
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381
Ruiz-Riol, Marta; Llano, Anuska; Ibarrondo, Javier; Zamarreño, Jennifer; Yusim, Karina; Bach, Vanessa; Mothe, Beatriz; Perez-Alvarez, Susana; Fernandez, Marco A.; Requena, Gerard; Meulbroek, Michael; Pujol, Ferran; Leon, Agathe; Cobarsi, Patricia; Korber, Bette T.; Clotet, Bonaventura; Ganoza, Carmela; Sanchez, Jorge; Coll, Josep; Brander, Christian
2015-01-01
The characterization of host immune responses to human immunodeficiency virus (HIV) in HIV controllers and individuals with high exposure but seronegativity to HIV (HESN) is needed to guide the development of effective preventive and therapeutic vaccine candidates. However, several technical hurdles severely limit the definition of an effective virus-specific T-cell response. By using a toggle-peptide approach, which takes HIV sequence diversity into account, and a novel, boosted cytokine staining/flow cytometry strategy, we here describe new patterns of T-cell responses to HIV that would be missed by standard assays. Importantly, this approach also allows detection of broad and strong virus-specific T-cell responses in HESN individuals that are characterized by a T-helper type 1 cytokine–like effector profile and produce cytokines that have been associated with potential control of HIV infection, including interleukin 10, interleukin 13, and interleukin 22. These results establish a novel approach to improve the current understanding of HIV-specific T-cell immunity and identify cellular immune responses and individual cytokines as potential markers of relative HIV resistance. As such, the findings also help develop similar strategies for more-comprehensive assessments of host immune responses to other human infections and immune-mediated disorders. PMID:25249264
Mosaic HIV-1 vaccines expand the breadth and depth of cellular immune responses in rhesus monkeys.
Barouch, Dan H; O'Brien, Kara L; Simmons, Nathaniel L; King, Sharon L; Abbink, Peter; Maxfield, Lori F; Sun, Ying-Hua; La Porte, Annalena; Riggs, Ambryice M; Lynch, Diana M; Clark, Sarah L; Backus, Katherine; Perry, James R; Seaman, Michael S; Carville, Angela; Mansfield, Keith G; Szinger, James J; Fischer, Will; Muldoon, Mark; Korber, Bette
2010-03-01
The worldwide diversity of HIV-1 presents an unprecedented challenge for vaccine development. Antigens derived from natural HIV-1 sequences have elicited only a limited breadth of cellular immune responses in nonhuman primate studies and clinical trials to date. Polyvalent 'mosaic' antigens, in contrast, are designed to optimize cellular immunologic coverage of global HIV-1 sequence diversity. Here we show that mosaic HIV-1 Gag, Pol and Env antigens expressed by recombinant, replication-incompetent adenovirus serotype 26 vectors markedly augmented both the breadth and depth without compromising the magnitude of antigen-specific T lymphocyte responses as compared with consensus or natural sequence HIV-1 antigens in rhesus monkeys. Polyvalent mosaic antigens therefore represent a promising strategy to expand cellular immunologic vaccine coverage for genetically diverse pathogens such as HIV-1.
Bogers, Willy M.; Yates, Nicole L.; Ferrari, Guido; Dey, Antu K.; Williams, William T.; Jaeger, Frederick H.; Wiehe, Kevin; Sawant, Sheetal; Alam, S. Munir; LaBranche, Celia C.; Montefiori, David C.; Martin, Loic; Srivastava, Indresh; Heeney, Jonathan; Barnett, Susan W.
2017-01-01
ABSTRACT Evaluation of the epitope specificities, locations (systemic or mucosal), and effector functions of antibodies elicited by novel HIV-1 immunogens engineered to improve exposure of specific epitopes is critical for HIV-1 vaccine development. Utilizing an array of humoral assays, we evaluated the magnitudes, epitope specificities, avidities, and functions of systemic and mucosal immune responses elicited by a vaccine regimen containing Env cross-linked to a CD4-mimetic miniprotein (gp140-M64U1) in rhesus macaques. Cross-linking of gp140 Env to M64U1 resulted in earlier increases of both the magnitude and avidity of the IgG binding response than those with Env protein alone. Notably, IgG binding responses at an early time point correlated with antibody-dependent cellular cytotoxicity (ADCC) function at the peak immunity time point, which was higher for the cross-linked Env group than for the Env group. In addition, the cross-linked Env group developed higher IgG responses against a linear epitope in the gp120 C1 region of the HIV-1 envelope glycoprotein. These data demonstrate that structural modification of the HIV-1 envelope immunogen by cross-linking of gp140 with the CD4-mimetic M64U1 elicited an earlier increase of binding antibody responses and altered the specificity of the IgG responses, correlating with the rise of subsequent antibody-mediated antiviral functions. IMPORTANCE The development of an efficacious HIV-1 vaccine remains a global priority to prevent new cases of HIV-1 infection. Of the six HIV-1 efficacy trials to date, only one has demonstrated partial efficacy, and immune correlate analysis of that trial revealed a role for binding antibodies and antibody Fc-mediated effector functions. New HIV-1 envelope immunogens are being engineered to selectively expose the most vulnerable and conserved sites on the HIV-1 envelope, with the goal of eliciting antiviral antibodies. Evaluation of the humoral responses elicited by these novel immunogen
Khattar, Sunil K; Manoharan, Vinoth; Bhattarai, Bikash; LaBranche, Celia C; Montefiori, David C; Samal, Siba K
2015-07-21
Newcastle disease virus (NDV) avirulent strain LaSota was used to coexpress gp160 Env and p55 Gag from a single vector to enhance both Env-specific and Gag-specific immune responses. The optimal transcription position for both Env and Gag genes in the NDV genome was determined by generating recombinant NDV (rNDV)-Env-Gag (gp160 located between the P and M genes and Gag between the HN and L genes), rNDV-Gag-Env (Gag located between the P and M genes and gp160 between the HN and L genes), rNDV-Env/Gag (gp160 followed by Gag located between the P and M genes), and rNDV-Gag/Env (Gag followed by gp160 located between the P and M genes). All the recombinant viruses replicated at levels similar to those seen with parental NDV in embryonated chicken eggs and in chicken fibroblast cells. Both gp160 and Gag proteins were expressed at high levels in cell culture, with gp160 found to be incorporated into the envelope of NDV. The Gag and Env proteins expressed by all the recombinants except rNDV-Env-Gag self-assembled into human immunodeficiency virus type 1 (HIV-1) virus-like particles (VLPs). Immunization of guinea pigs by the intranasal route with these rNDVs produced long-lasting Env- and Gag-specific humoral immune responses. The Env-specific humoral and mucosal immune responses and Gag-specific humoral immune responses were higher in rNDV-Gag/Env and rNDV-Env/Gag than in the other recombinants. rNDV-Gag/Env and rNDV-Env/Gag were also more efficient in inducing cellular as well as protective immune responses to challenge with vaccinia viruses expressing HIV-1 Env and Gag in mice. These results suggest that vaccination with a single rNDV coexpressing Env and Gag represents a promising strategy to enhance immunogenicity and protective efficacy against HIV. A safe and effective vaccine that can induce both systemic and mucosal immune responses is needed to control HIV-1. In this study, we showed that coexpression of Env and Gag proteins of HIV-1 performed using a single
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
French, Martyn A.; Tjiam, M. Christian; Abudulai, Laila N.; Fernandez, Sonia
2017-01-01
Contemporary antiretroviral therapy (ART) is effective and tolerable for long periods of time but cannot eradicate human immunodeficiency virus type 1 (HIV-1) infection by either elimination of viral reservoirs or enhancement of HIV-1-specific immune responses. Boosting “protective” HIV-1-specific immune responses by active or passive immunization will therefore be necessary to control or eradicate HIV-1 infection and is currently the topic of intense investigation. Recently reported studies conducted in HIV patients and non-human primate (NHP) models of HIV-1 infection suggest that HIV-1-specific IgG antibody responses may contribute to the control of HIV-1 infection. However, production of IgG antibodies with virus neutralizing activity by vaccination remains problematic and while vaccine-induced natural killer cell-activating IgG antibodies have been shown to prevent the acquisition of HIV-1 infection, they may not be sufficient to control or eradicate established HIV-1 infection. It is, therefore, important to consider other functional characteristics of IgG antibody responses. IgG antibodies to viruses also mediate opsonophagocytic antibody responses against virions and capsids that enhance the function of phagocytic cells playing critical roles in antiviral immune responses, particularly conventional dendritic cells and plasmacytoid dendritic cells. Emerging evidence suggests that these antibody functions might contribute to the control of HIV-1 infection. In addition, IgG antibodies contribute to the intracellular degradation of viruses via binding to the cytosolic fragment crystallizable (Fc) receptor tripartite motif containing-21 (TRIM21). The functional activity of an IgG antibody response is influenced by the IgG subclass content, which affects binding to antigens and to Fcγ receptors on phagocytic cells and to TRIM21. The IgG subclass content and avidity of IgG antibodies is determined by germinal center (GC) reactions in follicles of lymphoid
Kawana-Tachikawa, Ai; Llibre, Josep M; Bravo, Isabel; Escrig, Roser; Mothe, Beatriz; Puig, Jordi; Puertas, Maria C; Martinez-Picado, Javier; Blanco, Julia; Manzardo, Christian; Miro, Jose M; Iwamoto, Aikichi; Pozniak, Anton L; Gatell, Jose M; Clotet, Bonaventura; Brander, Christian
2014-01-01
The effect of maraviroc on the maintenance and the function of HIV-1-specific T cell responses remains unknown. Subjects recently infected with HIV-1 were randomized to receive anti-retroviral treatment with or without maraviroc intensification for 48 weeks, and were monitored up to week 60. PBMC and in vitro-expanded T cells were tested for responses to the entire HIV proteome by ELISpot analyses. Intracellular cytokine staining assays were conducted to monitor the (poly)-functionality of HIV-1-specific T cells. Analyses were performed at baseline and week 24 after treatment start, and at week 60 (3 months after maraviroc discontinuation). Maraviroc intensification was associated with a slower decay of virus-specific T cell responses over time compared to the non-intensified regimen in both direct ex-vivo as well as in in-vitro expanded cells. The effector function profiles of virus-specific CD8⁺ T cells were indistinguishable between the two arms and did not change over time between the groups. Maraviroc did not negatively impact any of the measured parameters, but was rather associated with a prolonged maintenance of HIV-1-specific T cell responses. Maraviroc, in addition to its original effect as viral entry inhibitor, may provide an additional benefit on the maintenance of virus-specific T cells which may be especially important for future viral eradication strategies.
Townsley, Samantha; Mohamed, Zeinab; Guo, Wenjin; McKenna, Jennifer; Cleveland, Brad; LaBranche, Celia; Beaumont, David; Shen, Xiaoying; Yates, Nicole L.; Pinter, Abraham; Tomaras, Georgia D.; Ferrari, Guido; Montefiori, David C.
2016-01-01
ABSTRACT Poxvirus prime-protein boost used in the RV144 trial remains the only immunization strategy shown to elicit a modest level of protection against HIV-1 acquisition in humans. Although neutralizing antibodies (NAb) were generated, they were against sensitive viruses, not the more resistant “tier 2” isolates that dominate circulating strains. Instead, risk reduction correlated with antibodies recognizing epitopes in the V1/V2 region of HIV-1 envelope glycoprotein (Env). Here, we examined whether tier 2 virus NAb and V1/V2-specific non-NAb could be elicited by a poxvirus prime-gp120 boost strategy in a rabbit model. We studied two clade B Envs that differ in multiple parameters, including tissue origin, neutralization sensitivity, and presence of the N197 (N7) glycan that was previously shown to modulate the exposure of conserved epitopes on Env. We demonstrate that immunized rabbits generated cross-reactive neutralizing activities against >50% of the tier 2 global HIV-1 isolates tested. Some of these activities were directed against the CD4 binding site (CD4bs). These rabbits also generated antibodies that recognized protein scaffolds bearing V1/V2 sequences from diverse HIV-1 isolates and mediated antibody-dependent cellular cytotoxicity. However, there are subtle differences in the specificities and the response rates of V1/V2-specific antibodies between animals immunized with different Envs, with or without the N7 glycan. These findings demonstrate that antibody responses that have been correlated with protection against HIV-1 acquisition in humans can be elicited in a preclinical model by a poxvirus prime-gp120 boost strategy and that improvements may be achievable by optimizing the nature of the priming and boosting immunogens. IMPORTANCE The only vaccine approach shown to elicit any protective efficacy against HIV-1 acquisition is based on a poxvirus prime-protein boost regimen (RV144 Thai trial). Reduction of risk was associated with
Townsley, Samantha; Mohamed, Zeinab; Guo, Wenjin; McKenna, Jennifer; Cleveland, Brad; LaBranche, Celia; Beaumont, David; Shen, Xiaoying; Yates, Nicole L; Pinter, Abraham; Tomaras, Georgia D; Ferrari, Guido; Montefiori, David C; Hu, Shiu-Lok
2016-10-01
Poxvirus prime-protein boost used in the RV144 trial remains the only immunization strategy shown to elicit a modest level of protection against HIV-1 acquisition in humans. Although neutralizing antibodies (NAb) were generated, they were against sensitive viruses, not the more resistant "tier 2" isolates that dominate circulating strains. Instead, risk reduction correlated with antibodies recognizing epitopes in the V1/V2 region of HIV-1 envelope glycoprotein (Env). Here, we examined whether tier 2 virus NAb and V1/V2-specific non-NAb could be elicited by a poxvirus prime-gp120 boost strategy in a rabbit model. We studied two clade B Envs that differ in multiple parameters, including tissue origin, neutralization sensitivity, and presence of the N197 (N7) glycan that was previously shown to modulate the exposure of conserved epitopes on Env. We demonstrate that immunized rabbits generated cross-reactive neutralizing activities against >50% of the tier 2 global HIV-1 isolates tested. Some of these activities were directed against the CD4 binding site (CD4bs). These rabbits also generated antibodies that recognized protein scaffolds bearing V1/V2 sequences from diverse HIV-1 isolates and mediated antibody-dependent cellular cytotoxicity. However, there are subtle differences in the specificities and the response rates of V1/V2-specific antibodies between animals immunized with different Envs, with or without the N7 glycan. These findings demonstrate that antibody responses that have been correlated with protection against HIV-1 acquisition in humans can be elicited in a preclinical model by a poxvirus prime-gp120 boost strategy and that improvements may be achievable by optimizing the nature of the priming and boosting immunogens. The only vaccine approach shown to elicit any protective efficacy against HIV-1 acquisition is based on a poxvirus prime-protein boost regimen (RV144 Thai trial). Reduction of risk was associated with nonneutralizing antibodies targeting
HIV infection and specific mucosal immunity: workshop 4B.
Challacombe, S J; Fidel, P L; Tugizov, S; Tao, L; Wahl, S M
2011-04-01
Most HIV infections are transmitted across mucosal epithelium. An area of fundamental importance is understanding the role of innate and specific mucosal immunity in susceptibility or protection against HIV infection, as well as the effect of HIV infection on mucosal immunity, which leads to increased susceptibility to bacterial, fungal, and viral infections of oral and other mucosae. This workshop attempted to address 5 basic issues-namely, HIV acquisition across mucosal surfaces, innate and adaptive immunity in HIV resistance, antiviral activity of breast milk as a model mucosal fluid, neutralizing immunoglobulin A antibodies against HIV, and progress toward a mucosal vaccine against HIV. The workshop attendants agreed that progress had been made in each area covered, with much recent information. However, these advances revealed how little work had been performed on stratified squamous epithelium compared with columnar epithelium, and the attendants identified several important biological questions that had not been addressed. It is increasingly clear that innate immunity has an important biological role, although basic understanding of the mechanisms of normal homeostasis is still being investigated. Application of the emerging knowledge was lacking with regard to homeostatic mucosal immunity to HIV and its role in changing this homeostasis. With regard to breast milk, a series of studies have demonstrated the differences between transmitters and nontransmitters, although whether these findings could be generalized to other secretions such as saliva was less clear. Important progress toward an oral mucosal HIV vaccine has been made, demonstrating proof of principle for administering vaccine candidates into oral lymphoid tissues to trigger anti-HIV local and systemic immune responses. Similarly, experimental data emphasized the central role of neutralizing antibodies to prevent HIV infection via mucosal routes.
Bakari, Muhammad; Aboud, Said; Nilsson, Charlotta; Francis, Joel; Buma, Deus; Moshiro, Candida; Aris, Eric A.; Lyamuya, Eligius F.; Janabi, Mohamed; Godoy-Ramirez, Karina; Joachim, Agricola; Polonis, Victoria R.; Bråve, Andreas; Earl, Patricia; Robb, Merlin; Marovich, Mary; Wahren, Britta; Pallangyo, Kisali; Biberfeld, Gunnel; Mhalu, Fred; Sandström, Eric
2016-01-01
Background We conducted a phase I/II randomized placebo-controlled trial with the aim of exploring whether priming with a low intradermal dose of a multiclade, multigene HIV-1 DNA vaccine could improve the immunogenicity of the same vaccine given intramuscularly prior to boosting with a heterologous HIV-1 MVA among healthy adults in Dar es Salaam, Tanzania. Methods Sixty HIV-uninfected volunteers were randomized to receive DNA plasmid vaccine 1 mg intradermally (id), n = 20, or 3.8 mg intramuscularly (im), n = 20, or placebo, n = 20, using a needle-free injection device. DNA plasmids encoding HIV-1 genes gp160 subtype A, B, C; rev B; p17/p24 gag A, B and Rtmut B were given at weeks 0, 4 and 12. Recombinant MVA (108 pfu) expressing HIV-1 Env, Gag, Pol of CRF01_AE or placebo was administered im at month 9 and 21. Results The vaccines were well tolerated. Two weeks after the third HIV-DNA injection, 22/38 (58%) vaccinees had IFN-γ ELISpot responses to Gag. Two weeks after the first HIV-MVA boost all 35 (100%) vaccinees responded to Gag and 31 (89%) to Env. Two to four weeks after the second HIV-MVA boost, 28/29 (97%) vaccinees had IFN-γ ELISpot responses, 27 (93%) to Gag and 23 (79%) to Env. The id-primed recipients had significantly higher responses to Env than im recipients. Intracellular cytokine staining for Gag-specific IFN-γ/IL-2 production showed both CD8+ and CD4+ T cell responses. All vaccinees had HIV-specific lymphoproliferative responses. All vaccinees reacted in diagnostic HIV serological tests and 26/29 (90%) had antibodies against gp160 after the second HIV-MVA boost. Furthermore, while all of 29 vaccinee sera were negative for neutralizing antibodies against clade B, C and CRF01 AE pseudoviruses in the TZM-bl neutralization assay, in a PBMC assay, the response rate ranged from 31% to 83% positives, depending upon the clade B or CRF01_AE virus tested. This vaccine approach is safe and highly immunogenic. Low dose, id HIV-DNA priming elicited higher
Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana
2012-12-11
To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.
Laher, Faatima; Ranasinghe, Srinika; Porichis, Filippos; Mewalal, Nikoshia; Pretorius, Karyn; Ismail, Nasreen; Buus, Søren; Stryhn, Anette; Carrington, Mary; Walker, Bruce D; Ndung'u, Thumbi; Ndhlovu, Zaza M
2017-04-01
Immune control of viral infections is heavily dependent on helper CD4 + T cell function. However, the understanding of the contribution of HIV-specific CD4 + T cell responses to immune protection against HIV-1, particularly in clade C infection, remains incomplete. Recently, major histocompatibility complex (MHC) class II tetramers have emerged as a powerful tool for interrogating antigen-specific CD4 + T cells without relying on effector functions. Here, we defined the MHC class II alleles for immunodominant Gag CD4 + T cell epitopes in clade C virus infection, constructed MHC class II tetramers, and then used these to define the magnitude, function, and relation to the viral load of HIV-specific CD4 + T cell responses in a cohort of untreated HIV clade C-infected persons. We observed significantly higher frequencies of MHC class II tetramer-positive CD4 + T cells in HIV controllers than progressors ( P = 0.0001), and these expanded Gag-specific CD4 + T cells in HIV controllers showed higher levels of expression of the cytolytic proteins granzymes A and B. Importantly, targeting of the immunodominant Gag41 peptide in the context of HLA class II DRB1*1101 was associated with HIV control ( r = -0.5, P = 0.02). These data identify an association between HIV-specific CD4 + T cell targeting of immunodominant Gag epitopes and immune control, particularly the contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infection. Furthermore, these results highlight the advantage of the use of class II tetramers in evaluating HIV-specific CD4 + T cell responses in natural infections. IMPORTANCE Increasing evidence suggests that virus-specific CD4 + T cells contribute to the immune-mediated control of clade B HIV-1 infection, yet there remains a relative paucity of data regarding the role of HIV-specific CD4 + T cells in shaping adaptive immune responses in individuals infected with clade C, which is responsible for the majority of HIV
Laher, Faatima; Ranasinghe, Srinika; Porichis, Filippos; Mewalal, Nikoshia; Pretorius, Karyn; Ismail, Nasreen; Buus, Søren; Stryhn, Anette; Carrington, Mary; Walker, Bruce D.; Ndung'u, Thumbi
2017-01-01
ABSTRACT Immune control of viral infections is heavily dependent on helper CD4+ T cell function. However, the understanding of the contribution of HIV-specific CD4+ T cell responses to immune protection against HIV-1, particularly in clade C infection, remains incomplete. Recently, major histocompatibility complex (MHC) class II tetramers have emerged as a powerful tool for interrogating antigen-specific CD4+ T cells without relying on effector functions. Here, we defined the MHC class II alleles for immunodominant Gag CD4+ T cell epitopes in clade C virus infection, constructed MHC class II tetramers, and then used these to define the magnitude, function, and relation to the viral load of HIV-specific CD4+ T cell responses in a cohort of untreated HIV clade C-infected persons. We observed significantly higher frequencies of MHC class II tetramer-positive CD4+ T cells in HIV controllers than progressors (P = 0.0001), and these expanded Gag-specific CD4+ T cells in HIV controllers showed higher levels of expression of the cytolytic proteins granzymes A and B. Importantly, targeting of the immunodominant Gag41 peptide in the context of HLA class II DRB1*1101 was associated with HIV control (r = −0.5, P = 0.02). These data identify an association between HIV-specific CD4+ T cell targeting of immunodominant Gag epitopes and immune control, particularly the contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infection. Furthermore, these results highlight the advantage of the use of class II tetramers in evaluating HIV-specific CD4+ T cell responses in natural infections. IMPORTANCE Increasing evidence suggests that virus-specific CD4+ T cells contribute to the immune-mediated control of clade B HIV-1 infection, yet there remains a relative paucity of data regarding the role of HIV-specific CD4+ T cells in shaping adaptive immune responses in individuals infected with clade C, which is responsible for the majority of HIV
Targeted Immune Interventions for an HIV-1 Cure.
Perreau, Matthieu; Banga, Riddhima; Pantaleo, Giuseppe
2017-10-01
Combination antiretroviral therapy (cART) induces durable suppression of virus replication but is unable to eradicate HIV. Invariably, virus rebound follows treatment interruption and life-long cART is thus required. Advances have been made in our understanding of HIV latency, identification of HIV cell reservoirs, regulation of HIV-specific immune responses, as well as in the development of broad neutralizing antibodies and putative therapeutic vaccines. These have provided a scientific basis to explore alternative strategies that achieve durable suppression of viremia in the absence of cART, the so-called functional cure. Single intervention strategies have shown promise, albeit with limited efficacy. Consequently, a combination of interventions aiming to stimulate the immune response and prevent new rounds of viral infection and spreading may render the HIV functional cure a feasible goal. Copyright © 2017 Elsevier Ltd. All rights reserved.
O'Mara, Leigh A.; Gangadhara, Sailaja; McQuoid, Monica; Zhang, Xiugen; Zheng, Rui; Gill, Kiran; Verma, Meena; Yu, Tianwei; Johnson, Brent; Li, Bing; Derdeyn, Cynthia A.; Ibegbu, Chris; Altman, John D.; Hunter, Eric; Feinberg, Mark B.
2012-01-01
Modified vaccinia virus Ankara (MVA) is a safe, attenuated orthopoxvirus that is being developed as a vaccine vector but has demonstrated limited immunogenicity in several early-phase clinical trials. Our objective was to rationally improve the immunogenicity of MVA-based HIV/AIDS vaccines via the targeted deletion of specific poxvirus immune-modulatory genes. Vaccines expressing codon-optimized HIV subtype C consensus Env and Gag antigens were generated from MVA vector backbones that (i) harbor simultaneous deletions of four viral immune-modulatory genes, encoding an interleukin-18 (IL-18) binding protein, an IL-1β receptor, a dominant negative Toll/IL-1 signaling adapter, and CC-chemokine binding protein (MVAΔ4-HIV); (ii) harbor a deletion of an additional (fifth) viral gene, encoding uracil-DNA glycosylase (MVAΔ5-HIV); or (iii) represent the parental MVA backbone as a control (MVA-HIV). We performed head-to-head comparisons of the cellular and humoral immune responses that were elicited by these vectors during homologous prime-boost immunization regimens utilizing either high-dose (2 × 108 PFU) or low-dose (1 × 107 PFU) intramuscular immunization of rhesus macaques. At all time points, a majority of the HIV-specific T cell responses, elicited by all vectors, were directed against Env, rather than Gag, determinants, as previously observed with other vector systems. Both modified vectors elicited up to 6-fold-higher frequencies of HIV-specific CD8 and CD4 T cell responses and up to 25-fold-higher titers of Env (gp120)-specific binding (nonneutralizing) antibody responses that were relatively transient in nature. While the correlates of protection against HIV infection remain incompletely defined, our results indicate that the rational deletion of specific genes from MVA vectors can positively alter their cellular and humoral immunogenicity profiles in nonhuman primates. PMID:22973033
Innate immune reconstitution with suppression of HIV-1.
Scully, Eileen P; Lockhart, Ainsley; Garcia-Beltran, Wilfredo; Palmer, Christine D; Musante, Chelsey; Rosenberg, Eric; Allen, Todd M; Chang, J Judy; Bosch, Ronald J; Altfeld, Marcus
2016-03-17
Progressive HIV-1 infection leads to both profound immune suppression and pathologic inflammation in the majority of infected individuals. While adaptive immune dysfunction, as evidenced by CD4 + T cell depletion and exhaustion, has been extensively studied, less is known about the functional capacity of innate immune cell populations in the context of HIV-1 infection. Given the broad susceptibility to opportunistic infections and the dysregulated inflammation observed in progressive disease, we hypothesized that there would be significant changes in the innate cellular responses. Using a cohort of patients with multiple samplings before and after antiretroviral therapy (ART) initiation, we demonstrated increased responses to innate immune stimuli following viral suppression, as measured by the production of inflammatory cytokines. Plasma viral load itself had the strongest association with this change in innate functional capacity. We further identified epigenetic modifications in the TNFA promoter locus in monocytes that are associated with viremia, suggesting a molecular mechanism for the observed changes in innate immune function following initiation of ART. These data indicate that suppression of HIV-1 viremia is associated with changes in innate cellular function that may in part determine the restoration of protective immune responses.
Innate immune reconstitution with suppression of HIV-1
Scully, Eileen P.; Garcia-Beltran, Wilfredo; Palmer, Christine D.; Musante, Chelsey; Rosenberg, Eric; Allen, Todd M.; Bosch, Ronald J.
2016-01-01
Progressive HIV-1 infection leads to both profound immune suppression and pathologic inflammation in the majority of infected individuals. While adaptive immune dysfunction, as evidenced by CD4+ T cell depletion and exhaustion, has been extensively studied, less is known about the functional capacity of innate immune cell populations in the context of HIV-1 infection. Given the broad susceptibility to opportunistic infections and the dysregulated inflammation observed in progressive disease, we hypothesized that there would be significant changes in the innate cellular responses. Using a cohort of patients with multiple samplings before and after antiretroviral therapy (ART) initiation, we demonstrated increased responses to innate immune stimuli following viral suppression, as measured by the production of inflammatory cytokines. Plasma viral load itself had the strongest association with this change in innate functional capacity. We further identified epigenetic modifications in the TNFA promoter locus in monocytes that are associated with viremia, suggesting a molecular mechanism for the observed changes in innate immune function following initiation of ART. These data indicate that suppression of HIV-1 viremia is associated with changes in innate cellular function that may in part determine the restoration of protective immune responses. PMID:27158667
Abdulhaqq, S A; Zorrilla, C; Kang, G; Yin, X; Tamayo, V; Seaton, K E; Joseph, J; Garced, S; Tomaras, G D; Linn, K A; Foulkes, A S; Azzoni, L; VerMilyea, M; Coutifaris, C; Kossenkov, A V; Showe, L; Kraiselburd, E N; Li, Q; Montaner, L J
2016-07-01
Sex workers practicing in high HIV endemic areas have been extensively targeted to test anti-HIV prophylactic strategies. We hypothesize that in women with high levels of genital exposure to semen changes in cervico-vaginal mucosal and/or systemic immune activation will contribute to a decreased susceptibility to HIV-1 infection. To address this question, we assessed sexual activity and immune activation status (in peripheral blood), as well as cellular infiltrates and gene expression in ectocervical mucosa biopsies in female sex workers (FSWs; n=50), as compared with control women (CG; n=32). FSWs had low-to-absent HIV-1-specific immune responses with significantly lower CD38 expression on circulating CD4(+) or CD8(+) T-cells (both: P<0.001) together with lower cervical gene expression of genes associated with leukocyte homing and chemotaxis. FSWs also had increased levels of interferon-ɛ (IFNɛ) gene and protein expression in the cervical epithelium together with reduced expression of genes associated with HIV-1 integration and replication. A correlative relationship between semen exposure and elevated type-1 IFN expression in FSWs was also established. Overall, our data suggest that long-term condomless sex work can result in multiple changes within the cervico-vaginal compartment that would contribute to sustaining a lower susceptibility for HIV-1 infection in the absence of HIV-specific responses.
Pegu, Poonam; Helmus, Ruth; Gupta, Phalguni; Tarwater, Patrick; Caruso, Lori; Shen, Chengli; Ross, Ted; Chen, Yue
2011-12-01
The lower gastrointestinal tract is a major mucosal site of HIV entry and initial infection. Thus, the induction of strong cellular immune responses at this mucosal site will be an important feature of an effective HIV vaccine. We have used a novel prime-boost vaccination approach to induce immune responses at mucosal sites. Orally delivered recombinant Clostridium perfringens expressing HIV-1 gag (Cp-Gag) was evaluated for induction of HIV-1 Gag specific T cell responses in a prime-boost model with intranasal inoculation of HIV-1 virus like particles (VLP). HIV-1 specific cellular immune responses in both the effector (Lamina propria) and inductive sites (Peyer's patches) of the gastrointestinal (GI) tract were significantly higher in mice immunized using Cp-Gag and VLPs in a prime-boost approach compared to mice immunized with either Cp-Gag or VLPs alone. Such cellular immune response was found to be mediated by both CD8(+) and CD4(+) T cells. Such a strong mucosal immune response could be very useful in developing a mucosal vaccine against HIV-1.
Recent advances targeting innate immunity-mediated therapies against HIV-1 infection.
Shankar, Esaki Muthu; Velu, Vijayakumar; Vignesh, Ramachandran; Vijayaraghavalu, Sivakumar; Rukumani, Devi Velayuthan; Sabet, Negar Shafiei
2012-08-01
Early defence mechanisms of innate immunity respond rapidly to infection against HIV-1 in the genital mucosa. Additionally, innate immunity optimises effective adaptive immune responses against persistent HIV infection. Recent research has highlighted the intrinsic roles of apolipoprotein B mRNA-editing, enzyme-catalytic, polypeptide-like 3G, tripartite motif-containing protein 5, tetherin, sterile α-motif and histidine/aspartic acid domain-containing protein 1 in restricting HIV-1 replication. Likewise, certain endogenously secreted antimicrobial peptides, namely α/β/θ-defensins, lactoferrins, secretory leukocyte protease inhibitor, trappin-2/elafin and macrophage inflammatory protein-3α are reportedly protective. Whilst certain factors directly inhibit HIV, others can be permissive. Interferon-λ3 exerts an anti-HIV function by activating Janus kinase-signal transducer and activator of transcription-mediated innate responses. Morphine has been found to impair intracellular innate immunity, contributing to HIV establishment in macrophages. Interestingly, protegrin-1 could be used therapeutically to inhibit early HIV-1 establishment. Moreover, chloroquine inhibits plasmacytoid dendritic cell activation and improves effective T-cell responses. This minireview summarizes the recently identified targets for innate immunity-mediated therapies and outlines the challenges that lie ahead in improving treatment of HIV infection. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Chamcha, Venkateswarlu; Jones, Andrew; Quigley, Bernard R; Scott, June R; Amara, Rama Rao
2015-11-15
The induction of a potent humoral and cellular immune response in mucosal tissue is important for the development of an effective HIV vaccine. Most of the current HIV vaccines under development use the i.m. route for immunization, which is relatively poor in generating potent and long-lived mucosal immune responses. In this article, we explore the ability of an oral vaccination with a probiotic organism, Lactococcus lactis, to elicit HIV-specific immune responses in the mucosal and systemic compartments of BALB/c mice. We expressed the HIV-1 Gag-p24 on the tip of the T3 pilus of Streptococcus pyogenes as a fusion to the Cpa protein (LL-Gag). After four monthly LL-Gag oral immunizations, we observed strong Gag-specific IgG and IgA responses in serum, feces, and vaginal secretions. However, the Gag-specific CD8 T cell responses in the blood were at or below our detection limit. After an i.m. modified vaccinia Ankara/Gag boost, we observed robust Gag-specific CD8 T cell responses both in systemic and in mucosal tissues, including intraepithelial and lamina propria lymphocytes of the small intestine, Peyer's patches, and mesenteric lymph nodes. Consistent with strong immunogenicity, the LL-Gag induced activation of CD11c(+) CD11b(+) dendritic cells in the Peyer's patches after oral immunization. Our results demonstrate that oral immunization with L. lactis expressing an Ag on the tip of the group A Streptococcus pilus serves as an excellent vaccine platform to induce strong mucosal humoral and cellular immunity against HIV. Copyright © 2015 by The American Association of Immunologists, Inc.
Shollenberger, Lisa M; Bui, Cac T; Paterson, Yvonne; Nyhoff, Lindsay; Harn, Donald A
2013-11-19
In areas co-endemic for helminth parasites and HIV/AIDS, infants are often administered vaccines prior to infection with immune modulatory helminth parasites. Systemic Th2 biasing and immune suppression caused by helminth infection reduces cell-mediated responses to vaccines such as tetanus toxoid and BCG. Therefore, we asked if infection with helminthes post-vaccination, alters already established vaccine induced immune responses. In our model, mice are vaccinated against HIV-1 Gag using a Listeria vaccine vector (Lm-Gag) in a prime-boost manner, then infected with the human helminth parasite Schistosoma mansoni. This allows us to determine if established vaccine responses are maintained or altered after helminth infection. Our second objective asked if helminth infection post-vaccination alters the recipient's ability to respond to a second boost. Here we compared responses between uninfected mice, schistosome infected mice, and infected mice that were given an anthelminthic, which occurred coincident with the boost or four weeks prior, as well as comparing to un-boosted mice. We report that HIV-1 vaccine-specific responses generated by Listeria vector HIV-1 vaccines are maintained following subsequent chronic schistosome infection, providing further evidence that Listeria vector vaccines induce potent vaccine-specific responses that can withstand helminth infection. We also were able to demonstrate that administration of a second Listeria boost, which markedly enhanced the immune response, was minimally impacted by schistosome infection, or anthelminthic therapy. Surprisingly, we also observed enhanced antibody responses to HIV Gag in vaccinated mice subsequently infected with schistosomes. Copyright © 2013 Elsevier Ltd. All rights reserved.
Poteet, Ethan; Lewis, Phoebe; Li, Feng; Zhang, Sheng; Gu, Jianhua; Chen, Changyi; Ho, Sam On; Do, Thai; Chiang, SuMing; Fujii, Gary; Yao, Qizhi
2015-01-01
HIV virus-like particles (VLPs) present the HIV envelope protein in its native conformation, providing an ideal vaccine antigen. To enhance the immunogenicity of the VLP vaccine, we sought to improve upon two components; the route of administration and the additional adjuvant. Using HIV VLPs, we evaluated sub-cheek as a novel route of vaccine administration when combined with other conventional routes of immunization. Of five combinations of distinct prime and boost sequences, which included sub-cheek, intranasal, and intradermal routes of administration, intranasal prime and sub-cheek boost (IN+SC) resulted in the highest HIV-specific IgG titers among the groups tested. Using the IN+SC regimen we tested the adjuvant VesiVax Conjugatable Adjuvant Lipid Vesicles (CALV) + monophosphoryl lipid A (MPLA) at MPLA concentrations of 0, 7.5, 12.5, and 25 μg/dose in combination with our VLPs. Mice that received 12.5 or 25 μg/dose MPLA had the highest concentrations of Env-specific IgG2c (20.7 and 18.4 μg/ml respectively), which represents a Th1 type of immune response in C57BL/6 mice. This was in sharp contrast to mice which received 0 or 7.5 μg MPLA adjuvant (6.05 and 5.68 μg/ml of IgG2c respectively). In contrast to IgG2c, MPLA had minor effects on Env-specific IgG1; therefore, 12.5 and 25 μg/dose of MPLA induced the optimal IgG1/IgG2c ratio of 1.3. Additionally, the percentage of germinal center B cells increased significantly from 15.4% in the control group to 31.9% in the CALV + 25 μg MPLA group. These mice also had significantly more IL-2 and less IL-4 Env-specific CD8+ T cells than controls, correlating with an increased percentage of Env-specific central memory CD4+ and CD8+ T cells. Our study shows the strong potential of IN+SC as an efficacious route of administration and the effectiveness of VLPs combined with MPLA adjuvant to induce Env specific Th1-oriented HIV-specific immune responses. PMID:26312747
Berger, Christoph T; Greiff, Victor; Mehling, Matthias; Fritz, Stefanie; Meier, Marc A; Hoenger, Gideon; Conen, Anna; Recher, Mike; Battegay, Manuel; Reddy, Sai T; Hess, Christoph
2015-01-01
Vaccines dramatically reduce infection-related morbidity and mortality. Determining factors that modulate the host response is key to rational vaccine design and demands unsupervised analysis. To longitudinally resolve influenza-specific humoral immune response dynamics we constructed vaccine response profiles of influenza A- and B-specific IgM and IgG levels from 42 healthy and 31 HIV infected influenza-vaccinated individuals. Pre-vaccination antibody levels and levels at 3 predefined time points after vaccination were included in each profile. We performed hierarchical clustering on these profiles to study the extent to which HIV infection associated immune dysfunction, adaptive immune factors (pre-existing influenza-specific antibodies, T cell responses), an innate immune factor (Mannose Binding Lectin, MBL), demographic characteristics (gender, age), or the vaccine preparation (split vs. virosomal) impacted the immune response to influenza vaccination. Hierarchical clustering associated vaccine preparation and pre-existing IgG levels with the profiles of healthy individuals. In contrast to previous in vitro and animal data, MBL levels had no impact on the adaptive vaccine response. Importantly, while HIV infected subjects with low CD4 T cell counts showed a reduced magnitude of their vaccine response, their response profiles were indistinguishable from those of healthy controls, suggesting quantitative but not qualitative deficits. Unsupervised profile-based analysis ranks factors impacting the vaccine-response by relative importance, with substantial implications for comparing, designing and improving vaccine preparations and strategies. Profile similarity between HIV infected and HIV negative individuals suggests merely quantitative differences in the vaccine response in these individuals, offering a rationale for boosting strategies in the HIV infected population.
Mlotshwa, Mandla; Riou, Catherine; Chopera, Denis; de Assis Rosa, Debra; Ntale, Roman; Treunicht, Florette; Woodman, Zenda; Werner, Lise; van Loggerenberg, Francois; Mlisana, Koleka; Abdool Karim, Salim; Williamson, Carolyn; Gray, Clive M.
2010-01-01
Deciphering immune events during early stages of human immunodeficiency virus type 1 (HIV-1) infection is critical for understanding the course of disease. We characterized the hierarchy of HIV-1-specific T-cell gamma interferon (IFN-γ) enzyme-linked immunospot (ELISPOT) assay responses during acute subtype C infection in 53 individuals and associated temporal patterns of responses with disease progression in the first 12 months. There was a diverse pattern of T-cell recognition across the proteome, with the recognition of Nef being immunodominant as early as 3 weeks postinfection. Over the first 6 months, we found that there was a 23% chance of an increased response to Nef for every week postinfection (P = 0.0024), followed by a nonsignificant increase to Pol (4.6%) and Gag (3.2%). Responses to Env and regulatory proteins appeared to remain stable. Three temporal patterns of HIV-specific T-cell responses could be distinguished: persistent, lost, or new. The proportion of persistent T-cell responses was significantly lower (P = 0.0037) in individuals defined as rapid progressors than in those progressing slowly and who controlled viremia. Almost 90% of lost T-cell responses were coincidental with autologous viral epitope escape. Regression analysis between the time to fixed viral escape and lost T-cell responses (r = 0.61; P = 0.019) showed a mean delay of 14 weeks after viral escape. Collectively, T-cell epitope recognition is not a static event, and temporal patterns of IFN-γ-based responses exist. This is due partly to viral sequence variation but also to the recognition of invariant viral epitopes that leads to waves of persistent T-cell immunity, which appears to associate with slower disease progression in the first year of infection. PMID:20826686
Gómez-Mora, Elisabet; García, Elisabet; Urrea, Victor; Massanella, Marta; Puig, Jordi; Negredo, Eugenia; Clotet, Bonaventura; Blanco, Julià; Cabrera, Cecilia
2017-09-15
Poor CD4 + T-cell recovery after cART has been associated with skewed T-cell maturation, inflammation and immunosenescence; however, T-cell functionality in those individuals has not been fully characterized. In the present study, we assessed T-cell function by assessing cytokine production after polyclonal, CMV and HIV stimulations of T-cells from ART-suppressed HIV-infected individuals with CD4 + T-cell counts >350 cells/μL (immunoconcordants) or <350 cells/μL (immunodiscordants). A group of HIV-uninfected individuals were also included as controls. Since CMV co-infection significantly affected T-cell maturation and polyfunctionality, only CMV + individuals were analyzed. Despite their reduced and skewed CD4 + T-cell compartment, immunodiscordant individuals showed preserved polyclonal and HIV-specific responses. However, CMV response in immunodiscordant participants was significantly different from immunoconcordant or HIV-seronegative individuals. In immunodiscordant subjects, the magnitude of IFN-γ + CD8 + and IL-2 + CD4 + T-cells in response to CMV was higher and differently associated with the CD4 + T-cell maturation profile., showing an increased frequency of naïve, central memory and EMRA CMV-specific CD4 + T-cells. In conclusion, CD4 + and CD8 + T-cell polyfunctionality was not reduced in immunodiscordant individuals, although heightened CMV-specific immune responses, likely related to subclinical CMV reactivations, may be contributing to the skewed T-cell maturation and the higher risk of clinical progression observed in those individuals.
Tsai, Angela; Irrinki, Alivelu; Kaur, Jasmine; Cihlar, Tomas; Kukolj, George; Sloan, Derek D; Murry, Jeffrey P
2017-04-15
Antiretroviral therapy can suppress HIV replication to undetectable levels but does not eliminate latent HIV, thus necessitating lifelong therapy. Recent efforts to target this persistent reservoir have focused on inducing the expression of latent HIV so that infected cells may be recognized and eliminated by the immune system. Toll-like receptor (TLR) activation stimulates antiviral immunity and has been shown to induce HIV from latently infected cells. Activation of TLR7 leads to the production of several stimulatory cytokines, including type I interferons (IFNs). In this study, we show that the selective TLR7 agonist GS-9620 induced HIV in peripheral blood mononuclear cells (PBMCs) from HIV-infected individuals on suppressive antiretroviral therapy. GS-9620 increased extracellular HIV RNA 1.5- to 2-fold through a mechanism that required type I IFN signaling. GS-9620 also activated HIV-specific T cells and enhanced antibody-mediated clearance of HIV-infected cells. Activation by GS-9620 in combination with HIV peptide stimulation increased CD8 T cell degranulation, production of intracellular cytokines, and cytolytic activity. T cell activation was again dependent on type I IFNs produced by plasmacytoid dendritic cells. GS-9620 induced phagocytic cell maturation and improved effector-mediated killing of HIV-infected CD4 T cells by the HIV envelope-specific broadly neutralizing antibody PGT121. Collectively, these data show that GS-9620 can activate HIV production and improve the effector functions that target latently infected cells. GS-9620 may effectively complement orthogonal therapies designed to stimulate antiviral immunity, such as therapeutic vaccines or broadly neutralizing antibodies. Clinical studies are under way to determine if GS-9620 can target HIV reservoirs. IMPORTANCE Though antiretroviral therapies effectively suppress viral replication, they do not eliminate integrated proviral DNA. This stable intermediate of viral infection is persistently
Tsai, Angela; Irrinki, Alivelu; Kaur, Jasmine; Cihlar, Tomas; Kukolj, George
2017-01-01
ABSTRACT Antiretroviral therapy can suppress HIV replication to undetectable levels but does not eliminate latent HIV, thus necessitating lifelong therapy. Recent efforts to target this persistent reservoir have focused on inducing the expression of latent HIV so that infected cells may be recognized and eliminated by the immune system. Toll-like receptor (TLR) activation stimulates antiviral immunity and has been shown to induce HIV from latently infected cells. Activation of TLR7 leads to the production of several stimulatory cytokines, including type I interferons (IFNs). In this study, we show that the selective TLR7 agonist GS-9620 induced HIV in peripheral blood mononuclear cells (PBMCs) from HIV-infected individuals on suppressive antiretroviral therapy. GS-9620 increased extracellular HIV RNA 1.5- to 2-fold through a mechanism that required type I IFN signaling. GS-9620 also activated HIV-specific T cells and enhanced antibody-mediated clearance of HIV-infected cells. Activation by GS-9620 in combination with HIV peptide stimulation increased CD8 T cell degranulation, production of intracellular cytokines, and cytolytic activity. T cell activation was again dependent on type I IFNs produced by plasmacytoid dendritic cells. GS-9620 induced phagocytic cell maturation and improved effector-mediated killing of HIV-infected CD4 T cells by the HIV envelope-specific broadly neutralizing antibody PGT121. Collectively, these data show that GS-9620 can activate HIV production and improve the effector functions that target latently infected cells. GS-9620 may effectively complement orthogonal therapies designed to stimulate antiviral immunity, such as therapeutic vaccines or broadly neutralizing antibodies. Clinical studies are under way to determine if GS-9620 can target HIV reservoirs. IMPORTANCE Though antiretroviral therapies effectively suppress viral replication, they do not eliminate integrated proviral DNA. This stable intermediate of viral infection is
McGuire, Erin P; Fong, Youyi; Toote, Christopher; Cunningham, Coleen K; McFarland, Elizabeth J; Borkowsky, William; Barnett, Susan; Itell, Hannah L; Kumar, Amit; Gray, Glenda; McElrath, M Julianna; Tomaras, Georgia D; Permar, Sallie R; Fouda, Genevieve G
2018-01-01
In the RV144 vaccine trial, IgG responses against the HIV envelope variable loops 1 and 2 (V1V2) were associated with decreased HIV acquisition risk. We previously reported that infants immunized with an MF59-adjuvanted rgp120 vaccine developed higher-magnitude anti-V1V2 IgG responses than adult RV144 vaccinees. To determine whether the robust antibody response in infants is due to differences in vaccine regimens or to inherent differences between the adult and infant immune systems, we compared Env-specific IgG responses in adults and infants immunized with the same MF59- and alum-adjuvanted HIV envelope vaccines. At peak immunogenicity, the magnitudes of the gp120- and V1V2-specific IgG responses were comparable between adults and infants immunized with the alum/MNrgp120 vaccine (gp120 median fluorescence intensities [FIs] in infants = 7,118 and in adults = 11,510, P = 0.070; V1V2 median MFIs of 512 [infants] and 804 [adults], P = 0.50), whereas infants immunized with the MF59/SF-2 rgp120 vaccine had higher-magnitude antibody levels than adults (gp120 median FIs of 15,509 [infants] and 2,290 [adults], P < 0.001; V1V2 median FIs of 23,926 [infants] and 1,538 [adults]; P < 0.001). Six months after peak immunogenicity, infants maintained higher levels Env-specific IgG than adults. Anti-V1V2 IgG3 antibodies that were associated with decreased HIV-1 risk in RV144 vaccinees were present in 43% of MF59/rgp120-vaccinated infants but only in 12% of the vaccinated adults ( P = 0.0018). Finally, in contrast to the rare vaccine-elicited Env-specific IgA in infants, rgp120 vaccine-elicited Env-specific IgA was frequently detected in adults. Our results suggest that vaccine adjuvants differently modulate gp120-specific antibody responses in adults and infants and that infants can robustly respond to HIV Env immunization. IMPORTANCE More than 150,000 pediatric HIV infections occur yearly, despite the availability of antiretroviral prophylaxis. A pediatric HIV vaccine could
NASA Astrophysics Data System (ADS)
Lv, Cuifang; Huang, Lihong; Yuan, Zhaohui
2014-01-01
In this paper, an HIV-1 infection model with Beddington-DeAngelis incidence rate and CTL immune response is investigated. One main feature of this model is that an eclipse stage for the infected cells is included and a portion of these cells is reverted to uninfected cells. We derive the basic reproduction number R1 and the immune response reproduction number R2 for the HIV-1 infection model. By constructing Lyapunov functions, the global stabilities for the equilibria have been analyzed.
Epigenetic alterations are associated with monocyte immune dysfunctions in HIV-1 infection.
Espíndola, Milena S; Soares, Luana S; Galvão-Lima, Leonardo J; Zambuzi, Fabiana A; Cacemiro, Maira C; Brauer, Verônica S; Marzocchi-Machado, Cleni M; de Souza Gomes, Matheus; Amaral, Laurence R; Martins-Filho, Olindo A; Bollela, Valdes R; Frantz, Fabiani G
2018-04-03
Monocytes are key cells in the immune dysregulation observed during human immunodeficiency virus (HIV) infection. The events that take place specifically in monocytes may contribute to the systemic immune dysfunction characterized by excessive immune activation in infected individuals, which directly correlates with pathogenesis and progression of the disease. Here, we investigated the immune dysfunction in monocytes from untreated and treated HIV + patients and associated these findings with epigenetic changes. Monocytes from HIV patients showed dysfunctional ability of phagocytosis and killing, and exhibited dysregulated cytokines and reactive oxygen species production after M. tuberculosis challenge in vitro. In addition, we showed that the expression of enzymes responsible for epigenetic changes was altered during HIV infection and was more prominent in patients that had high levels of soluble CD163 (sCD163), a newly identified plasmatic HIV progression biomarker. Among the enzymes, histone acetyltransferase 1 (HAT1) was the best epigenetic biomarker correlated with HIV - sCD163 high patients. In conclusion, we confirmed that HIV impairs effector functions of monocytes and these alterations are associated with epigenetic changes that once identified could be used as targets in therapies aiming the reduction of the systemic activation state found in HIV patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, Will; Korber, Bette
2009-01-01
Creation of a successful HIV vaccine will require the development of a strategy to generate cellular immunity with sufficient cross-clade breadth to deal with the extreme genetic diversity of the virus. Polyvalent mosaic immunogens derived from in silica recombination of natural strains of HIV are designed to induce cellular immune responses that maximally cover the sequence diversity of circulating virus isolates. Immunization of rhesus monkeys with plasmid DNA and recombinant vaccinia virus vaccine constructs expressing either consensus immunogens or polyvalent mosaic immunogens elicited a CD4+ T lymphocyte-biased response with comparably broad epitope-specific total T lymphocyte specificities. However, immunization with themore » mosaic immunogens induced HIV-specific CD8+ T lymphocyte responses with markedly greater depth and breadth. Therefore, the use of polyvalent mosaic immunogens is a promising strategy for a global vaccine for HIV.« less
Khattar, Sunil K.; Manoharan, Vinoth; Bhattarai, Bikash; LaBranche, Celia C.; Montefiori, David C.
2015-01-01
ABSTRACT Newcastle disease virus (NDV) avirulent strain LaSota was used to coexpress gp160 Env and p55 Gag from a single vector to enhance both Env-specific and Gag-specific immune responses. The optimal transcription position for both Env and Gag genes in the NDV genome was determined by generating recombinant NDV (rNDV)-Env-Gag (gp160 located between the P and M genes and Gag between the HN and L genes), rNDV-Gag-Env (Gag located between the P and M genes and gp160 between the HN and L genes), rNDV-Env/Gag (gp160 followed by Gag located between the P and M genes), and rNDV-Gag/Env (Gag followed by gp160 located between the P and M genes). All the recombinant viruses replicated at levels similar to those seen with parental NDV in embryonated chicken eggs and in chicken fibroblast cells. Both gp160 and Gag proteins were expressed at high levels in cell culture, with gp160 found to be incorporated into the envelope of NDV. The Gag and Env proteins expressed by all the recombinants except rNDV-Env-Gag self-assembled into human immunodeficiency virus type 1 (HIV-1) virus-like particles (VLPs). Immunization of guinea pigs by the intranasal route with these rNDVs produced long-lasting Env- and Gag-specific humoral immune responses. The Env-specific humoral and mucosal immune responses and Gag-specific humoral immune responses were higher in rNDV-Gag/Env and rNDV-Env/Gag than in the other recombinants. rNDV-Gag/Env and rNDV-Env/Gag were also more efficient in inducing cellular as well as protective immune responses to challenge with vaccinia viruses expressing HIV-1 Env and Gag in mice. These results suggest that vaccination with a single rNDV coexpressing Env and Gag represents a promising strategy to enhance immunogenicity and protective efficacy against HIV. PMID:26199332
Alsina, Laia; Noguera-Julian, Antoni; Fortuny, Clàudia
2013-05-07
Despite of highly active antiretroviral therapy, the response to vaccines in HIV-infected children is poor and short-lived, probably due to a defect in cellular immune responses. We compared the cellular immune response (assessed in terms of IFN-γ production) to tetanus toxoid and to cytomegalovirus in a series of 13 HIV-perinatally-infected children and adolescents with optimal immunovirological response to first line antiretroviral therapy, implemented during chronic infection. A stronger cellular response to cytomegalovirus (11 out of 13 patients) was observed, as compared to tetanus toxoid (1 out of 13; p=0.003). These results suggest that the repeated exposition to CMV, as opposed to the past exposition to TT, is able to maintain an effective antigen-specific immune response in stable HIV-infected pediatric patients and strengthen current recommendations on immunization practices in these children. Copyright © 2013. Published by Elsevier Ltd.
Wang, Yimeng; O'Dell, Sijy; Turner, Hannah L.; Chiang, Chi-I; Lei, Lin; Guenaga, Javier; Wilson, Richard; Martinez-Murillo, Paola; Doria-Rose, Nicole; Ward, Andrew B.; Mascola, John R.; Wyatt, Richard T.; Karlsson Hedestam, Gunilla B.
2017-01-01
ABSTRACT Elicitation of broadly neutralizing antibody (bNAb) responses is a major goal for the development of an HIV-1 vaccine. Current HIV-1 envelope glycoprotein (Env) vaccine candidates elicit predominantly tier 1 and/or autologous tier 2 virus neutralizing antibody (NAb) responses, as well as weak and/or sporadic cross-reactive tier 2 virus NAb responses with unknown specificity. To delineate the specificity of vaccine-elicited cross-reactive tier 2 virus NAb responses, we performed single memory B cell sorting from the peripheral blood of a rhesus macaque immunized with YU2gp140-F trimers in adjuvant, using JR-FL SOSIP.664, a native Env trimer mimetic, as a sorting probe to isolate monoclonal Abs (MAbs). We found striking genetic and functional convergence of the SOSIP-sorted Ig repertoire, with predominant VH4 or VH5 gene family usage and Env V3 specificity. Of these vaccine-elicited V3-specific MAbs, nearly 20% (6/33) displayed cross-reactive tier 2 virus neutralization, which recapitulated the serum neutralization capacity. Substantial similarities in binding specificity, neutralization breadth and potency, and sequence/structural homology were observed between selected macaque cross-reactive V3 NAbs elicited by vaccination and prototypic V3 NAbs derived from natural infections in humans, highlighting the convergence of this subset of primate V3-specific B cell repertories. Our study demonstrated that cross-reactive primary virus neutralizing B cell lineages could be elicited by vaccination as detected using a standardized panel of tier 2 viruses. Whether these lineages could be expanded to acquire increased breadth and potency of neutralization merits further investigation. IMPORTANCE Elicitation of antibody responses capable of neutralizing diverse HIV-1 primary virus isolates (designated broadly neutralizing antibodies [bNAbs]) remains a high priority for the vaccine field. bNAb responses were so far observed only in response to natural infection within
Stephenson, Kathryn E.; Neubauer, George H.; Reimer, Ulf; ...
2014-11-14
An effective vaccine against human immunodeficiency virus type 1 (HIV-1) will have to provide protection against a vast array of different HIV-1 strains. Current methods to measure HIV-1-specific binding antibodies following immunization typically focus on determining the magnitude of antibody responses, but the epitope diversity of antibody responses has remained largely unexplored. Here we describe the development of a global HIV-1 peptide microarray that contains 6564 peptides from across the HIV-1 proteome and covers the majority of HIV-1 sequences in the Los Alamos National Laboratory global HIV-1 sequence database. Using this microarray, we quantified the magnitude, breadth, and depth ofmore » IgG binding to linear HIV-1 sequences in HIV-1-infected humans and HIV-1-vaccinated humans, rhesus monkeys and guinea pigs. The microarray measured potentially important differences in antibody epitope diversity, particularly regarding the depth of epitope variants recognized at each binding site. Our data suggest that the global HIV-1 peptide microarray may be a useful tool for both preclinical and clinical HIV-1 research.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stephenson, Kathryn E.; Neubauer, George H.; Reimer, Ulf
An effective vaccine against human immunodeficiency virus type 1 (HIV-1) will have to provide protection against a vast array of different HIV-1 strains. Current methods to measure HIV-1-specific binding antibodies following immunization typically focus on determining the magnitude of antibody responses, but the epitope diversity of antibody responses has remained largely unexplored. Here we describe the development of a global HIV-1 peptide microarray that contains 6564 peptides from across the HIV-1 proteome and covers the majority of HIV-1 sequences in the Los Alamos National Laboratory global HIV-1 sequence database. Using this microarray, we quantified the magnitude, breadth, and depth ofmore » IgG binding to linear HIV-1 sequences in HIV-1-infected humans and HIV-1-vaccinated humans, rhesus monkeys and guinea pigs. The microarray measured potentially important differences in antibody epitope diversity, particularly regarding the depth of epitope variants recognized at each binding site. Our data suggest that the global HIV-1 peptide microarray may be a useful tool for both preclinical and clinical HIV-1 research.« less
Immune defence against HIV-1 infection in HIV-1-exposed seronegative persons.
Schmechel, S C; Russell, N; Hladik, F; Lang, J; Wilson, A; Ha, R; Desbien, A; McElrath, M J
2001-11-01
Rare individuals who are repeatedly exposed to HIV-1 through unprotected sexual contact fail to acquire HIV-1 infection. These persons represent a unique study population to evaluate mechanisms by which HIV-1 replication is either prevented or controlled. We followed longitudinally a group of healthy HIV-1 seronegative persons each reporting repeated high-risk sexual activities with their HIV-1-infected partner at enrollment. The volunteers were primarily (90%) male homosexuals, maintaining high risk activities with their known infected partner (45%) or multiple other partners (61%). We evaluated the quantity and specificity of HIV-1-specific T cells in 31 exposed seronegatives (ES) using a IFN-gamma ELISPOT assay to enumerate T cells recognizing epitopes within HIV-1 Env, Gag, Pol and Nef. PBMC from only three of the 31 volunteers demonstrated ex vivo HIV-1-specific IFN-gamma secretion, in contrast to nearly 30% exhibiting cytolytic responses in previous studies. These findings suggest that if T cell responses in ES are induced by HIV-1 exposure, the frequency is at low levels in most of them, and below the level of detection using the ELISPOT assay. Alternative approaches to improve the sensitivity of detection may include use of dendritic cells as antigen-presenting cells in the ex vivo assay and more careful definition of the risk behavior and extent of HIV-1 exposure in conjunction with the evaluation of T cell responses.
Fouda, Genevieve G.; Cunningham, Coleen K.; McFarland, Elizabeth J.; Borkowsky, William; Muresan, Petronella; Pollara, Justin; Song, Lin Ye; Liebl, Brooke E.; Whitaker, Kaylan; Shen, Xiaoying; Vandergrift, Nathan A.; Overman, R. Glenn; Yates, Nicole L.; Moody, M. Anthony; Fry, Carrie; Kim, Jerome H.; Michael, Nelson L.; Robb, Merlin; Pitisuttithum, Punnee; Kaewkungwal, Jaranit; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Liao, Hua-Xin; Haynes, Barton F.; Montefiori, David C.; Ferrari, Guido; Tomaras, Georgia D.; Permar, Sallie R.
2015-01-01
Background Infant responses to vaccines can be impeded by maternal antibodies and immune system immaturity. It is therefore unclear whether human immunodeficiency virus type 1 (HIV-1) vaccination would elicit similar responses in adults and infants. Method HIV-1 Env–specific antibody responses were evaluated in 2 completed pediatric vaccine trials. In the Pediatric AIDS Clinical Trials Group (PACTG) 230 protocol, infants were vaccinated with 4 doses of Chiron rgp120 with MF59 (n = 48), VaxGen rgp120 with aluminum hydroxide (alum; n = 49), or placebo (n = 19) between 0 and 20 weeks of age. In PACTG 326, infants received 4 doses of ALVAC-HIV-1/AIDSVAX B/B with alum (n = 9) or placebo (n = 13) between 0 and 12 weeks of age. Results By 52 weeks of age, the majority of maternally acquired antibodies had waned and vaccine Env-specific immunoglobulin G (IgG) responses in vaccinees were higher than in placebo recipients. Chiron vaccine recipients had higher and more-durable IgG responses than VaxGen vaccine recipients or ALVAC/AIDSVAX vaccinees, with vaccine-elicited IgG responses still detectable in 56% of recipients at 2 years of age. Remarkably, at peak immunogenicity, the concentration of anti-V1V2 IgG, a response associated with a reduced risk of HIV-1 acquisition in the RV144 adult vaccine trial, was 22-fold higher in Chiron vaccine recipients, compared with RV144 vaccinees. Conclusion As exemplified by the Chiron vaccine regimen, vaccination of infants against HIV-1 can induce robust, durable Env-specific IgG responses, including anti-V1V2 IgG. PMID:25170104
Lucas, Carolina Gonçalves de Oliveira; Rigato, Paula Ordonhez; Gonçalves, Jorge Luiz Santos; Sato, Maria Notomi; Maciel, Milton; Peçanha, Ligia Maria Torres; August, J. Thomas; de Azevedo Marques, Ernesto Torres; de Arruda, Luciana Barros
2014-01-01
We have previously demonstrated that a DNA vaccine encoding HIV-p55gag in association with the lysosomal associated membrane protein-1 (LAMP-1) elicited a greater Gag-specific immune response, in comparison to a DNA encoding the native gag. In vitro studies have also demonstrated that LAMP/Gag was highly expressed and was present in MHCII containing compartments in transfected cells. In this study, the mechanisms involved in these processes and the relative contributions of the increased expression and altered traffic for the enhanced immune response were addressed. Cells transfected with plasmid DNA constructs containing p55gag attached to truncated sequences of LAMP-1 showed that the increased expression of gag mRNA required p55gag in frame with at least 741 bp of the LAMP-1 luminal domain. LAMP luminal domain also showed to be essential for Gag traffic through lysosomes and, in this case, the whole sequence was required. Further analysis of the trafficking pathway of the intact LAMP/Gag chimera demonstrated that it was secreted, at least in part, associated with exosome-like vesicles. Immunization of mice with LAMP/gag chimeric plasmids demonstrated that high expression level alone can induce a substantial transient antibody response, but targeting of the antigen to the endolysosomal/secretory pathways was required for establishment of cellular and memory response. The intact LAMP/gag construct induced polyfunctional CD4+ T cell response, which presence at the time of immunization was required for CD8+ T cell priming. LAMP-mediated targeting to endolysosomal/secretory pathway is an important new mechanistic element in LAMP-mediated enhanced immunity with applications to the development of novel anti-HIV vaccines and to general vaccinology field. PMID:24932692
Selva, Kevin J; Kent, Stephen J; Parsons, Matthew S
2017-01-28
Mucosal exposure to HIV-1 infection generally occurs in the presence of semen. Immunomodulation by seminal plasma is well described in the reproductive biology literature. Little is known, however, about the impact of seminal plasma on innate and adaptive anti-HIV-1 cellular immunity. The study investigated the effects of seminal plasma on immune responses considered important for prophylactic HIV-1 vaccine development, namely innate and adaptive cellular immunity mediated by natural killer (NK) cells and T cells, respectively. The ability of seminal plasma to modulate direct, antibody-dependent and cytokine-stimulated NK cell activation was assessed utilizing intracellular cytokine staining. Direct and antibody-dependent cellular cytotoxicity was assessed using lactate dehydrogenase release assays. The effects of seminal plasma on T-cell activation upon stimulation with staphylococcus enterotoxin B or HIV-1 Gag peptides were assessed by intracellular cytokine staining. The impact of seminal plasma on redirected cytolysis mediated by T cells was measured using lactate dehydrogenase release assays. Both direct and antibody-dependent NK cell activation were dramatically impaired by the presence of either HIV-1-uninfected or HIV-1-infected seminal plasma in a dose-dependent manner. Additionally, seminal plasma suppressed both direct and antibody-dependent NK cell-mediated cytolysis, including anti-HIV-1 antibody-dependent cytolysis of gp120-pulsed CEM.NKr-CCR5 cells. Finally, seminal plasma attenuated both HIV-1 Gag-specific and staphylococcus enterotoxin B-induced CTL activation. Semen contains potent immunosuppressors of both NK cell and CD8 T-cell-mediated anti-HIV-1 immune responses. This could impede attempts to provide vaccine-induced immunity to HIV-1.
Excler, Jean-Louis; Robb, Merlin L; Kim, Jerome H
2014-01-01
The development of a safe and effective preventive HIV-1 vaccine remains a public health priority. Despite scientific difficulties and disappointing results, HIV-1 vaccine clinical development has, for the first time, established proof-of-concept efficacy against HIV-1 acquisition and identified vaccine-associated immune correlates of risk. The correlate of risk analysis showed that IgG antibodies against the gp120 V2 loop correlated with decreased risk of HIV infection, while Env-specific IgA directly correlated with increased risk. The development of vaccine strategies such as improved envelope proteins formulated with potent adjuvants and DNA and vectors expressing mosaics, or conserved sequences, capable of eliciting greater breadth and depth of potentially relevant immune responses including neutralizing and non-neutralizing antibodies, CD4+ and CD8+ cell-mediated immune responses, mucosal immune responses, and immunological memory, is now proceeding quickly. Additional human efficacy trials combined with other prevention modalities along with sustained funding and international collaboration remain key to bring an HIV-1 vaccine to licensure. PMID:24637946
Recent progress in immune-based interventions to prevent HIV-1 transmission to children.
Voronin, Yegor; Jani, Ilesh; Graham, Barney S; Cunningham, Coleen K; Mofenson, Lynne M; Musoke, Philippa M; Permar, Sallie R; Scarlatti, Gabriella
2017-12-01
Globally, 150,000 new paediatric human immunodeficiency virus type 1 (HIV-1) infections occurred in 2015. There remain complex challenges to the global elimination of paediatric HIV-1 infection. Thus, for the global community to achieve elimination of new paediatric HIV-1 infections, innovative approaches need to be explored. Immune-based approaches to prevention of mother-to-child transmission (MTCT) may help fill some of the remaining gaps and provide new opportunities to achieve an AIDS-free generation. Immune-based interventions to prevent MTCT of HIV-1 may include paediatric HIV vaccines and passive immunization approaches. Recent discoveries providing evidence of robust immune responses to HIV in infants open new and exciting prospects for paediatric HIV vaccines. Moreover, successful vaccination of infants has a different set of requirements than vaccination of adults and may be easier to achieve. Proof-of-concept has been established over the last two decades that passively administered HIV-1 Env-specific monoclonal antibody (mAbs) can prevent chimeric simian human immunodeficiency virus (SHIV) transmission to newborn nonhuman primates. There has been tremendous progress in isolating and characterizing broadly neutralizing antibodies to HIV, and clinical testing of these antibodies for treatment and prevention in both infants and adults is a major effort in the field. Immune-based interventions need to be actively explored as they can provide critically important tools to address persistent challenges in MTCT prevention. It is a pivotal time for the field with active discussions on the best strategy to further reduce HIV infection of infants and accomplish the World Health Organization Fast-Track 2030 goals to eliminate new paediatric HIV infections. © 2017 The Authors. Journal of the International AIDS Society published by John Wiley & sons Ltd on behalf of the International AIDS Society.
Abnormal B cell memory subsets dominate HIV-specific responses in infected individuals
Kardava, Lela; Moir, Susan; Shah, Naisha; Wang, Wei; Wilson, Richard; Buckner, Clarisa M.; Santich, Brian H.; Kim, Leo J.Y.; Spurlin, Emily E.; Nelson, Amy K.; Wheatley, Adam K.; Harvey, Christopher J.; McDermott, Adrian B.; Wucherpfennig, Kai W.; Chun, Tae-Wook; Tsang, John S.; Li, Yuxing; Fauci, Anthony S.
2014-01-01
Recently, several neutralizing anti-HIV antibodies have been isolated from memory B cells of HIV-infected individuals. Despite extensive evidence of B cell dysfunction in HIV disease, little is known about the cells from which these rare HIV-specific antibodies originate. Accordingly, we used HIV envelope gp140 and CD4 or coreceptor (CoR) binding site (bs) mutant probes to evaluate HIV-specific responses in peripheral blood B cells of HIV-infected individuals at various stages of infection. In contrast to non-HIV responses, HIV-specific responses against gp140 were enriched within abnormal B cells, namely activated and exhausted memory subsets, which are largely absent in the blood of uninfected individuals. Responses against the CoRbs, which is a poorly neutralizing epitope, arose early, whereas those against the well-characterized neutralizing epitope CD4bs were delayed and infrequent. Enrichment of the HIV-specific response within resting memory B cells, the predominant subset in uninfected individuals, did occur in certain infected individuals who maintained low levels of plasma viremia and immune activation with or without antiretroviral therapy. The distribution of HIV-specific responses among memory B cell subsets was corroborated by transcriptional analyses. Taken together, our findings provide valuable insight into virus-specific B cell responses in HIV infection and demonstrate that memory B cell abnormalities may contribute to the ineffectiveness of the antibody response in infected individuals. PMID:24892810
Fouda, Genevieve G; Cunningham, Coleen K; McFarland, Elizabeth J; Borkowsky, William; Muresan, Petronella; Pollara, Justin; Song, Lin Ye; Liebl, Brooke E; Whitaker, Kaylan; Shen, Xiaoying; Vandergrift, Nathan A; Overman, R Glenn; Yates, Nicole L; Moody, M Anthony; Fry, Carrie; Kim, Jerome H; Michael, Nelson L; Robb, Merlin; Pitisuttithum, Punnee; Kaewkungwal, Jaranit; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Liao, Hua-Xin; Haynes, Barton F; Montefiori, David C; Ferrari, Guido; Tomaras, Georgia D; Permar, Sallie R
2015-02-15
Infant responses to vaccines can be impeded by maternal antibodies and immune system immaturity. It is therefore unclear whether human immunodeficiency virus type 1 (HIV-1) vaccination would elicit similar responses in adults and infants. HIV-1 Env-specific antibody responses were evaluated in 2 completed pediatric vaccine trials. In the Pediatric AIDS Clinical Trials Group (PACTG) 230 protocol, infants were vaccinated with 4 doses of Chiron rgp120 with MF59 (n=48), VaxGen rgp120 with aluminum hydroxide (alum; n=49), or placebo (n=19) between 0 and 20 weeks of age. In PACTG 326, infants received 4 doses of ALVAC-HIV-1/AIDSVAX B/B with alum (n=9) or placebo (n=13) between 0 and 12 weeks of age. By 52 weeks of age, the majority of maternally acquired antibodies had waned and vaccine Env-specific immunoglobulin G (IgG) responses in vaccinees were higher than in placebo recipients. Chiron vaccine recipients had higher and more-durable IgG responses than VaxGen vaccine recipients or ALVAC/AIDSVAX vaccinees, with vaccine-elicited IgG responses still detectable in 56% of recipients at 2 years of age. Remarkably, at peak immunogenicity, the concentration of anti-V1V2 IgG, a response associated with a reduced risk of HIV-1 acquisition in the RV144 adult vaccine trial, was 22-fold higher in Chiron vaccine recipients, compared with RV144 vaccinees. As exemplified by the Chiron vaccine regimen, vaccination of infants against HIV-1 can induce robust, durable Env-specific IgG responses, including anti-V1V2 IgG. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Aichelburg, Maximilian C; Weseslindtner, Lukas; Mandorfer, Mattias; Strassl, Robert; Rieger, Armin; Reiberger, Thomas; Puchhammer-Stöckl, Elisabeth; Grabmeier-Pfistershammer, Katharina
2015-01-01
Among HIV-1-infected individuals, cytomegalovirus (CMV) reactivation and disease occur in the setting of advanced immunosuppression. The value of a standardized assessment of CMV-specific T-cell mediated immunity by the CMV QuantiFERON assay (CMV-QFT) has not yet been thoroughly investigated in HIV-1-infected subjects. Prospective, longitudinal study in 153 HIV-1-infected subjects with a CD4+ T cell count < 350/μL who simultaneously underwent CMV-QFT, CMV serology testing and CMV-DNA quantification. Factors associated with CMV-QFT were evaluated. Clinical screening for CMV manifestations was then performed every 3 months. Among the 141 CMV IgG-seropositive individuals the CMV-QFT assay yielded reactive results in 84% (118/141), negative results in 15% (21/141) and indeterminate (negative mitogen IFN-gamma response) results in 1% (2/141) of subjects. The mean actual CD4+ T cell count was significantly higher in CMV-QFT reactive subjects, when compared to CMV-QFT non-reactive individuals (183 ± 102 vs. 126 ± 104 cells/μL, P = 0.015). A significantly lower proportion of CMV-QFT reactive vs. non-reactive patients displayed CMV DNAemia > 100 copies/mL (23% (27/118) vs. 48% (11/23), P = 0.02). Furthermore, a statistically significant inverse association between mitogen IFN-gamma response and CMV-DNAemia > 1000 copies/mL was observed (P < 0.001). During the observational period, 5 CMV end-organ manifestations were observed. In three of the CMV cases the CMV-QFT yielded indeterminate results. While CMV-QFT reactivity indicates CMV-specific immunity, indeterminate results due to negative mitogen IFN-gamma response might reflect HIV-1-induced immunodeficiency. Thus, dependency upon CD4+ T cell count should be considered when interpreting CMV-QFT results.
Immune Interventions to Eliminate the HIV Reservoir.
Hsu, Denise C; Ananworanich, Jintanat
2017-10-26
Inducing HIV remission is a monumental challenge. A potential strategy is the "kick and kill" approach where latently infected cells are first activated to express viral proteins and then eliminated through cytopathic effects of HIV or immune-mediated killing. However, pre-existing immune responses to HIV cannot eradicate HIV infection due to the presence of escape variants, inadequate magnitude, and breadth of responses as well as immune exhaustion. The two major approaches to boost immune-mediated elimination of infected cells include enhancing cytotoxic T lymphocyte mediated killing and harnessing antibodies to eliminate HIV. Specific strategies include increasing the magnitude and breadth of T cell responses through therapeutic vaccinations, reversing the effects of T cell exhaustion using immune checkpoint inhibition, employing bispecific T cell targeting immunomodulatory proteins or dual-affinity re-targeting molecules to direct cytotoxic T lymphocytes to virus-expressing cells and broadly neutralizing antibody infusions. Methods to steer immune responses to tissue sites where latently infected cells are located need to be further explored. Ultimately, strategies to induce HIV remission must be tolerable, safe, and scalable in order to make a global impact.
Primary Human Immunodeficiency Virus Type 1 (HIV-1) Infection during HIV-1 Gag Vaccination▿
Balamurugan, Arumugam; Lewis, Martha J.; Kitchen, Christina M. R.; Robertson, Michael N.; Shiver, John W.; Daar, Eric S.; Pitt, Jacqueline; Ali, Ayub; Ng, Hwee L.; Currier, Judith S.; Yang, Otto O.
2008-01-01
Vaccination for human immunodeficiency virus type 1 (HIV-1) remains an elusive goal. Whether an unsuccessful vaccine might not only fail to provoke detectable immune responses but also could actually interfere with subsequent natural immunity upon HIV-1 infection is unknown. We performed detailed assessment of an HIV-1 gag DNA vaccine recipient (subject 00015) who was previously uninfected but sustained HIV-1 infection before completing a vaccination trial and another contemporaneously acutely infected individual (subject 00016) with the same strain of HIV-1. Subject 00015 received the vaccine at weeks 0, 4, and 8 and was found to have been acutely HIV-1 infected around the time of the third vaccination. Subject 00016 was a previously HIV-1-seronegative sexual contact who had symptoms of acute HIV-1 infection approximately 2 weeks earlier than subject 00015 and demonstrated subsequent seroconversion. Both individuals reached an unusually low level of chronic viremia (<1,000 copies/ml) without treatment. Subject 00015 had no detectable HIV-1-specific cytotoxic T-lymphocyte (CTL) responses until a borderline response was noted at the time of the third vaccination. The magnitude and breadth of Gag-specific CTL responses in subject 00015 were similar to those of subject 00016 during early chronic infection. Viral sequences from gag, pol, and nef confirmed the common source of HIV-1 between these individuals. The diversity and divergence of sequences in subjects 00015 and 00016 were similar, indicating similar immune pressure on these proteins (including Gag). As a whole, the data suggested that while the gag DNA vaccine did not prime detectable early CTL responses in subject 00015, vaccination did not appreciably impair his ability to contain viremia at levels similar to those in subject 00016. PMID:18199650
Nittayananta, W; Weinberg, A; Malamud, D; Moyes, D; Webster-Cyriaque, J; Ghosh, S
2016-04-01
The interplay between HIV-1 and epithelial cells represents a critical aspect in mucosal HIV-1 transmission. Epithelial cells lining the oral cavity cover subepithelial tissues, which contain virus-susceptible host cells including CD4(+) T lymphocytes, monocytes/macrophages, and dendritic cells. Oral epithelia are among the sites of first exposure to both cell-free and cell-associated virus HIV-1 through breast-feeding and oral-genital contact. However, oral mucosa is considered to be naturally resistant to HIV-1 transmission. Oral epithelial cells have been shown to play a crucial role in innate host defense. Nevertheless, it is not clear to what degree these local innate immune factors contribute to HIV-1 resistance of the oral mucosa. This review paper addressed the following issues that were discussed at the 7th World Workshop on Oral Health and Disease in AIDS held in Hyderabad, India, during November 6-9, 2014: (i) What is the fate of HIV-1 after interactions with oral epithelial cells?; (ii) What are the keratinocyte and other anti-HIV effector oral factors, and how do they contribute to mucosal protection?; (iii) How can HIV-1 interactions with oral epithelium affect activation and populations of local immune cells?; (iv) How can HIV-1 interactions alter functions of oral epithelial cells? © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Hu, Joyce K.; Crampton, Jordan C.; Cupo, Albert; Ketas, Thomas; van Gils, Marit J.; Sliepen, Kwinten; de Taeye, Steven W.; Sok, Devin; Ozorowski, Gabriel; Deresa, Isaiah; Stanfield, Robyn; Ward, Andrew B.; Burton, Dennis R.; Klasse, Per Johan; Sanders, Rogier W.; Moore, John P.
2015-01-01
ABSTRACT Generating neutralizing antibodies (nAbs) is a major goal of many current HIV-1 vaccine efforts. To be of practical value, these nAbs must be both potent and cross-reactive in order to be capable of preventing the transmission of the highly diverse and generally neutralization resistant (Tier-2) HIV-1 strains that are in circulation. The HIV-1 envelope glycoprotein (Env) spike is the only target for nAbs. To explore whether Tier-2 nAbs can be induced by Env proteins, we immunized conventional mice with soluble BG505 SOSIP.664 trimers that mimic the native Env spike. Here, we report that it is extremely difficult for murine B cells to recognize the Env epitopes necessary for inducing Tier-2 nAbs. Thus, while trimer-immunized mice raised Env-binding IgG Abs and had high-quality T follicular helper (Tfh) cell and germinal center (GC) responses, they did not make BG505.T332N nAbs. Epitope mapping studies showed that Ab responses in mice were specific to areas near the base of the soluble trimer. These areas are not well shielded by glycans and likely are occluded on virions, which is consistent with the lack of BG505.T332N nAbs. These data inform immunogen design and suggest that it is useful to obscure nonneutralizing epitopes presented on the base of soluble Env trimers and that the glycan shield of well-formed HIV Env trimers is virtually impenetrable for murine B cell receptors (BCRs). IMPORTANCE Human HIV vaccine efficacy trials have not generated meaningful neutralizing antibodies to circulating HIV strains. One possible hindrance has been the lack of immunogens that properly mimic the native conformation of the HIV envelope trimer protein. Here, we tested the first generation of soluble, native-like envelope trimer immunogens in a conventional mouse model. We attempted to generate neutralizing antibodies to neutralization-resistant circulating HIV strains. Various vaccine strategies failed to induce neutralizing antibodies to a neutralization
Wang, Xinhai; Kochetkova, Irina; Haddad, Asmahan; Hoyt, Teri; Hone, David M; Pascual, David W
2005-05-31
Receptor-mediated gene transfer using an M cell ligand has been shown to be an efficient method for mucosal DNA immunization. To investigate further into alternative M cell ligands, the plant lectin, Ulex europaeus agglutinin I (UEA-1), was tested. UEA-1 binds to human intestinal Caco-2 cells, and these cells can be transfected with poly-l-lysine (PL)-conjugated UEA-1 for expression of reporter cDNAs. When tested in vivo, mice nasally immunized with UEA-1-PL complexed to plasmid encoding HIV-1 envelope showed elevated systemic and mucosal antibody responses, and these were supported by tissue antibody-forming cells. Likewise, elevated envelope-specific CTLs were induced. Thus, UEA-1 mediated DNA delivery represents an alternative mucosal formulation for inducing humoral and cellular immunity against HIV-1.
Host Immune Responses That Promote Initial HIV Spread
2011-07-01
exposure to virus and peak viremia. The vaginal mucosa is the most common site of infection and vaccine strategies focus mainly on promoting...spread to the lymph node specifically in the acute phase, i.e., upon vaginal inoculation. The resulting mathematical model is based on mechanistic...for early immune response to SIV and HIV infection are generally assumed to be similar and are described as follows. Virus enters the vaginal lumen and
Ranasinghe, C; Trivedi, S; Stambas, J; Jackson, R J
2013-11-01
We have established that mucosal immunization can generate high-avidity human immunodeficiency virus (HIV)-specific CD8(+) T cells compared with systemic immunization, and interleukin (IL)-13 is detrimental to the functional avidity of these T cells. We have now constructed two unique recombinant HIV-1 vaccines that co-express soluble or membrane-bound forms of the IL-13 receptor α2 (IL-13Rα2), which can "transiently" block IL-13 activity at the vaccination site causing wild-type animals to behave similar to an IL-13 KO animal. Following intranasal/intramuscular prime-boost immunization, these IL-13Rα2-adjuvanted vaccines have shown to induce (i) enhanced HIV-specific CD8(+) T cells with higher functional avidity, with broader cytokine/chemokine profiles and greater protective immunity using a surrogate mucosal HIV-1 challenge, and also (ii) excellent multifunctional mucosal CD8(+) T-cell responses, in the lung, genito-rectal nodes (GN), and Peyer's patch (PP). Data revealed that intranasal delivery of these IL-13Rα2-adjuvanted HIV vaccines recruited large numbers of unique antigen-presenting cell subsets to the lung mucosae, ultimately promoting the induction of high-avidity CD8(+) T cells. We believe our novel IL-13R cytokine trap vaccine strategy offers great promise for not only HIV-1, but also as a platform technology against range of chronic infections that require strong sustained high-avidity mucosal/systemic immunity for protection.
HIV infection impairs Th1 and Th17 Mycobacterium tuberculosis-specific T cell responses
Murray, Lyle W; Satti, Iman; Meyerowitz, Jodi; Jones, Matthew; Willberg, Christian B; Ussher, James E; Goedhals, Dominique; Hurst, Jacob; Phillips, Rodney E; McShane, Helen
2018-01-01
Background HIV-infected individuals have a higher risk of developing active tuberculosis than HIV-uninfected individuals, but the mechanisms underpinning this are unclear. We hypothesized that depletion of specific components of Mycobacterium tuberculosis (M.tb)-specific CD4+ and CD8+ T cell responses contributed to this increased risk. Methods M.tb-specific T cell responses in 147 HIV-infected and 44 HIV-uninfected control subjects in a TB-endemic setting in Bloemfontein, South Africa were evaluated. Using a whole-blood flow cytometry assay, we measured expression of IFNγ, TNFα, IL-2 and IL-17 in CD4+ and CD8+ T cells in response to M.tb antigens (PPD, ESAT-6/CFP-10 (EC) and DosR regulon-encoded α-crystallin (Rv2031c)). Results Fewer HIV-infected individuals had detectable CD4+ and CD8+ T cell responses to PPD and Rv2031c than HIV-uninfected subjects. M.tb-specific T cells showed distinct patterns of cytokine expression comprising both Th1 (CD4 and CD8) and Th17 (CD4) cytokines, the latter at highest frequency for Rv2031c. Th17 antigen-specific responses to all antigens tested were specifically impaired in HIV-infected individuals. Conclusions HIV-associated impairment of CD4+ and CD8+ M.tb-specific T cell responses is antigen-specific, particularly impacting responses to PPD and Rv2031c. Preferential depletion of Th17 cytokine-expressing CD4+ T cells suggests this T cell subset may be key to TB susceptibility in HIV-infected individuals. PMID:29546381
Proof-of-Principle for Immune Control of Global HIV-1 Reactivation In Vivo
Smith, Nicola M. G.; Mlcochova, Petra; Watters, Sarah A.; Aasa-Chapman, Marlene M. I.; Rabin, Neil; Moore, Sally; Edwards, Simon G.; Garson, Jeremy A.; Grant, Paul R.; Ferns, R. Bridget; Kashuba, Angela; Mayor, Neema P.; Schellekens, Jennifer; Marsh, Steven G. E.; McMichael, Andrew J.; Perelson, Alan S.; Pillay, Deenan; Goonetilleke, Nilu; Gupta, Ravindra K.
2015-01-01
Background. Emerging data relating to human immunodeficiency virus type 1 (HIV-1) cure suggest that vaccination to stimulate the host immune response, particularly cytotoxic cells, may be critical to clearing of reactivated HIV-1–infected cells. However, evidence for this approach in humans is lacking, and parameters required for a vaccine are unknown because opportunities to study HIV-1 reactivation are rare. Methods. We present observations from a HIV-1 elite controller, not treated with combination antiretroviral therapy, who experienced viral reactivation following treatment for myeloma with melphalan and autologous stem cell transplantation. Mathematical modeling was performed using a standard viral dynamic model. Enzyme-linked immunospot, intracellular cytokine staining, and tetramer staining were performed on peripheral blood mononuclear cells; in vitro CD8 T-cell–mediated control of virion production by autologous CD4 T cells was quantified; and neutralizing antibody titers were measured. Results. Viral rebound was measured at 28 000 copies/mL on day 13 post-transplant before rapid decay to <50 copies/mL in 2 distinct phases with t1/2 of 0.71 days and 4.1 days. These kinetics were consistent with an expansion of cytotoxic effector cells and killing of productively infected CD4 T cells. Following transplantation, innate immune cells, including natural killer cells, recovered with virus rebound. However, most striking was the expansion of highly functional HIV-1–specific cytotoxic CD8 T cells, at numbers consistent with those applied in modeling, as virus control was regained. Conclusions. These observations provide evidence that the human immune response is capable of controlling coordinated global HIV-1 reactivation, remarkably with potency equivalent to combination antiretroviral therapy. These data will inform design of vaccines for use in HIV-1 curative interventions. PMID:25778749
PQBP1 Is a Proximal Sensor of the cGAS-Dependent Innate Response to HIV-1.
Yoh, Sunnie M; Schneider, Monika; Seifried, Janna; Soonthornvacharin, Stephen; Akleh, Rana E; Olivieri, Kevin C; De Jesus, Paul D; Ruan, Chunhai; de Castro, Elisa; Ruiz, Pedro A; Germanaud, David; des Portes, Vincent; García-Sastre, Adolfo; König, Renate; Chanda, Sumit K
2015-06-04
Dendritic cells (DCs) play a critical role in the immune response to viral infection through the facilitation of cell-intrinsic antiviral activity and the activation of adaptive immunity. HIV-1 infection of DCs triggers an IRF3-dependent innate immune response, which requires the activity of cyclic GAMP synthase (cGAS). We report the results of a targeted RNAi screen utilizing primary human monocyte-derived DCs (MDDCs) to identify immune regulators that directly interface with HIV-1-encoded features to initiate this innate response. Polyglutamine binding protein 1 (PQBP1) emerged as a strong candidate through this analysis. We found that PQBP1 directly binds to reverse-transcribed HIV-1 DNA and interacts with cGAS to initiate an IRF3-dependent innate response. MDDCs derived from Renpenning syndrome patients, who harbor mutations in the PQBP1 locus, possess a severely attenuated innate immune response to HIV-1 challenge, underscoring the role of PQBP1 as a proximal innate sensor of a HIV-1 infection. Copyright © 2015 Elsevier Inc. All rights reserved.
Aichelburg, Maximilian C.; Weseslindtner, Lukas; Mandorfer, Mattias; Strassl, Robert; Rieger, Armin; Reiberger, Thomas; Puchhammer-Stöckl, Elisabeth; Grabmeier-Pfistershammer, Katharina
2015-01-01
Background Among HIV-1–infected individuals, cytomegalovirus (CMV) reactivation and disease occur in the setting of advanced immunosuppression. The value of a standardized assessment of CMV-specific T-cell mediated immunity by the CMV QuantiFERON assay (CMV-QFT) has not yet been thoroughly investigated in HIV-1–infected subjects. Methods Prospective, longitudinal study in 153 HIV-1–infected subjects with a CD4+ T cell count < 350/μL who simultaneously underwent CMV-QFT, CMV serology testing and CMV-DNA quantification. Factors associated with CMV-QFT were evaluated. Clinical screening for CMV manifestations was then performed every 3 months. Results Among the 141 CMV IgG-seropositive individuals the CMV-QFT assay yielded reactive results in 84% (118/141), negative results in 15% (21/141) and indeterminate (negative mitogen IFN-gamma response) results in 1% (2/141) of subjects. The mean actual CD4+ T cell count was significantly higher in CMV-QFT reactive subjects, when compared to CMV-QFT non-reactive individuals (183 ± 102 vs. 126 ± 104 cells/μL, P = 0.015). A significantly lower proportion of CMV-QFT reactive vs. non-reactive patients displayed CMV DNAemia > 100 copies/mL (23% (27/118) vs. 48% (11/23), P = 0.02). Furthermore, a statistically significant inverse association between mitogen IFN-gamma response and CMV-DNAemia > 1000 copies/mL was observed (P < 0.001). During the observational period, 5 CMV end-organ manifestations were observed. In three of the CMV cases the CMV-QFT yielded indeterminate results. Conclusions While CMV-QFT reactivity indicates CMV-specific immunity, indeterminate results due to negative mitogen IFN-gamma response might reflect HIV-1-induced immunodeficiency. Thus, dependency upon CD4+ T cell count should be considered when interpreting CMV-QFT results. PMID:26322514
Immune Responses of HIV-1 Tat Transgenic Mice to Mycobacterium Tuberculosis W-Beijing SA161
Honda, Jennifer R; Shang, Shaobin; Shanley, Crystal A; Caraway, Megan L; Henao-Tamayo, Marcela; Chan, Edward D; Basaraba, Randall J; Orme, Ian M; Ordway, Diane J; Flores, Sonia C
2011-01-01
Background: Mycobacterium tuberculosis remains among the leading causes of death from an infectious agent in the world and exacerbates disease caused by the human immunodeficiency virus (HIV). HIV infected individuals are prone to lung infections by a variety of microbial pathogens, including M. tuberculosis. While the destruction of the adaptive immune response by HIV is well understood, the actual pathogenesis of tuberculosis in co-infected individuals remains unclear. Tat is an HIV protein essential for efficient viral gene transcription, is secreted from infected cells, and is known to influence a variety of host inflammatory responses. We hypothesize Tat contributes to pathophysiological changes in the lung microenvironment, resulting in impaired host immune responses to infection by M. tuberculosis. Results: Herein, we show transgenic mice that express Tat by lung alveolar cells are more susceptible than non-transgenic control littermates to a low-dose aerosol infection of M. tuberculosis W-Beijing SA161. Survival assays demonstrate accelerated mortality rates of the Tat transgenic mice compared to non-transgenics. Tat transgenic mice also showed poorly organized lung granulomata-like lesions. Analysis of the host immune response using quantitative RT-PCR, flow cytometry for surface markers, and intracellular cytokine staining showed increased expression of pro-inflammatory cytokines in the lungs, increased numbers of cells expressing ICAM1, increased numbers of CD4+CD25+Foxp3+ T regulatory cells, and IL-4 producing CD4+ T cells in the Tat transgenics compared to infected non-tg mice. Conclusions: Our data show quantitative differences in the inflammatory response to the SA161 clinical isolate of M. tuberculosis W-Beijing between Tat transgenic and non-transgenic mice, suggesting Tat contributes to the pathogenesis of tuberculosis. PMID:22046211
Souza, Thiago Moreno L; Santini-Oliveira, Marilia; Martorelli, Andressa; Luz, Paula M; Vasconcellos, Mauricio T L; Giacoia-Gripp, Carmem B W; Morgado, Mariza; Nunes, Estevão P; Lemos, Alberto S; Ferreira, Ana C G; Moreira, Ronaldo I; Veloso, Valdiléa G; Siqueira, Marilda; Grinsztejn, Beatriz; Camacho, Luiz A B
2016-03-01
HIV-infected individuals have a higher risk of serious illnesses following infection by infection with influenza. Although anti-influenza vaccination is recommended, immunosuppression may limit their response to active immunization. We followed-up a cohort of HIV-infected individuals vaccinated against influenza to assess the immunogenicity and sustainability of the immune response to vaccination. Individuals were vaccinated 2011 with inactivated triple influenza vaccine (TIV), and they had received in 2010 the monovalent anti-A(H1N1)pdm09 vaccine. The sustainability of the immune response to A(H1N1)pdm09 at 12 months after monovalent vaccination fell, both in individuals given two single or two double doses. For these individuals, A(H1N1)pdm09 component from TIV acted as a booster, raising around 40% the number of seroprotected individuals. Almost 70% of the HIV-infected individuals were already seroprotected to A/H3N2 at baseline. Again, TIV boosted over 90% the seroprotection to A/H3N2. Anti-A/H3N2 titers dropped by 20% at 6 months after vaccination. Pre-vaccination seroprotection rate to influenza B (victoria lineage) was the lowest among those tested, seroconversion rates were higher after vaccination. Seroconversion/protection after TIV vaccination did not differ significantly across categories of clinical and demographic variables. Anti-influenza responses in Brazilian HIV-infected individuals reflected both the previous history of virus circulation in Brazil and vaccination. © 2015 Wiley Periodicals, Inc.
HIV neuropathogenesis: a tight rope walk of innate immunity.
Yao, Honghong; Bethel-Brown, Crystal; Li, Cicy Zidong; Buch, Shilpa J
2010-12-01
During the course of HIV-1 disease, virus neuroinvasion occurs as an early event, within weeks following infection. Intriguingly, subsequent central nervous system (CNS) complications manifest only decades after the initial virus exposure. Although CNS is commonly regarded as an immune-privileged site, emerging evidence indicates that innate immunity elicited by the CNS glial cells is a critical determinant for the establishment of protective immunity. Sustained expression of these protective immune responses, however, can be a double-edged sword. As protective immune mediators, cytokines have the ability to function in networks and co-operate with other host/viral mediators to tip the balance from a protective to toxic state in the CNS. Herein, we present an overview of some of the essential elements of the cerebral innate immunity in HIV neuropathogenesis including the key immune cell types of the CNS with their respective soluble immune mediators: (1) cooperative interaction of IFN-γ with the host/virus factor (platelet-derived host factor (PDGF)/viral Tat) in the induction of neurotoxic chemokine CXCL10 by macrophages, (2) response of astrocytes to viral infection, and (3) protective role of PDGF and MCP-1 in neuronal survival against HIV Tat toxicity. These components of the cerebral innate immunity do not act separately from each other but form a functional immunity network. The ultimate outcome of HIV infection in the CNS will thus be dependent on the regulation of the net balance of cell-specific protective versus detrimental responses.
Immune activation and paediatric HIV-1 disease outcome.
Roider, Julia M; Muenchhoff, Maximilian; Goulder, Philip J R
2016-03-01
The paediatric HIV epidemic is changing. Over the past decade, new infections have substantially reduced, whereas access to antiretroviral therapy (ART) has increased. Overall this success means that numbers of children living with HIV are climbing. In addition, the problems observed in adult infection resulting from chronic inflammation triggered by persistent immune activation even following ART mediated suppression of viral replication are magnified in children infected from birth. Features of immune ontogeny favour low immune activation in early life, whereas specific aspects of paediatric HIV infection tend to increase it. A subset of ART-naïve nonprogressing children exists in whom normal CD4 cell counts are maintained in the setting of persistent high viremia and yet in the context of low immune activation. This sooty mangabey-like phenotype contrasts with nonprogressing adult infection which is characterized by the expression of protective HLA class I molecules and low viral load. The particular factors contributing to raised or lowered immune activation in paediatric infection, which ultimately influence disease outcome, are discussed. Novel strategies to circumvent the unwanted long-term consequences of HIV infection may be possible in children in whom natural immune ontogeny in early life militates against immune activation. Defining the mechanisms underlying low immune activation in natural HIV infection would have applications beyond paediatric HIV.
Sundling, Christopher; Schön, Karin; Mörner, Andreas; Forsell, Mattias N E; Wyatt, Richard T; Thorstensson, Rigmor; Karlsson Hedestam, Gunilla B; Lycke, Nils Y
2008-12-01
Strategies to induce potent and broad antibody responses against the human immunodeficiency virus type 1 (HIV-1) envelope glycoproteins (Env) at both systemic and mucosal sites represent a central goal for HIV-1 vaccine development. Here, we show that the non-toxic CTA1-DD adjuvant promoted mucosal and systemic humoral and cell-mediated immune responses following intranasal (i.n.) immunizations with trimeric or monomeric forms of HIV-1 Env in mice and in non-human primates. Env-specific IgG subclasses in the serum of immunized mice reflected a balanced Th1/Th2 type of response. Strikingly, i.n. immunizations with Env and the CTA1-DD adjuvant induced substantial levels of mucosal anti-Env IgA in bronchial alveolar lavage and also detectable levels in vaginal secretions. By contrast, parenteral immunizations of Env formulated in Ribi did not stimulate mucosal IgA responses, while the two adjuvants induced a similar distribution of Env-specific IgG-subclasses in serum. A single parenteral boost with Env in Ribi adjuvant into mice previously primed i.n. with Env and CTA1-DD, augmented the serum anti-Env IgG levels to similar magnitudes as those observed after three intraperitoneal immunizations with Env in Ribi. The augmenting potency of CTA1-DD was similar to that of LTK63 or CpG oligodeoxynucleotides (ODN). However, in contrast to CpG ODN, the effect of CTA1-DD and LTK63 appeared to be independent of MyD88 and toll-like receptor signalling. This is the first demonstration that CTA1-DD augments specific immune responses also in non-human primates, suggesting that this adjuvant could be explored further as a clinically safe mucosal vaccine adjuvant for humoral and cell-mediated immunity against HIV-1 Env.
Schindler, Tobias; Kagina, Benjamin M.; Zhang, Jitao David; Lukindo, Tedson; Mpina, Maxmillian; Bang, Peter; Kromann, Ingrid; Hoff, Søren T.; Andersen, Peter; Reither, Klaus; Churchyard, Gavin J.; Certa, Ulrich
2015-01-01
Tuberculosis (TB) remains a global health problem, with vaccination being a necessary strategy for disease containment and elimination. A TB vaccine should be safe and immunogenic as well as efficacious in all affected populations, including HIV-infected individuals. We investigated the induction and maintenance of vaccine-induced memory CD4+ T cells following vaccination with the subunit vaccine H1/IC31. H1/IC31 was inoculated twice on study days 0 and 56 among HIV-infected adults with CD4+ lymphocyte counts of >350 cells/mm3. Whole venous blood stimulation was conducted with the H1 protein, and memory CD4+ T cells were analyzed using intracellular cytokine staining and polychromatic flow cytometry. We identified high responders, intermediate responders, and nonresponders based on detection of interleukin-2 (IL-2), tumor necrosis factor alpha (TNF-α), and gamma interferon (IFN-γ) expressing central (TCM) and effector memory CD4+ T cells (TEM) 182 days after the first immunization. Amplicon-based transcript quantification using next-generation sequencing was performed to identify differentially expressed genes that correlated with vaccine-induced immune responses. Genes implicated in resolution of inflammation discriminated the responders from the nonresponders 3 days after the first inoculation. The volunteers with higher expression levels of genes involved in antiviral innate immunity at baseline showed impaired H1-specific TCM and TEM maintenance 6 months after vaccination. Our study showed that in HIV-infected volunteers, expression levels of genes involved in the antiviral innate immune response affected long-term maintenance of H1/IC31 vaccine-induced cellular immunity. (The clinical trial was registered in the Pan African Clinical Trials Registry [PACTR] with the identifier PACTR201105000289276.) PMID:25924764
Immunological tolerance as a barrier to protective HIV humoral immunity.
Schroeder, Kristin Ms; Agazio, Amanda; Torres, Raul M
2017-08-01
HIV-1 infection typically eludes antibody control by our immune system and is not yet prevented by a vaccine. While many viral features contribute to this immune evasion, broadly neutralizing antibodies (bnAbs) against HIV-1 are often autoreactive and it has been suggested that immunological tolerance may restrict a neutralizing antibody response. Indeed, recent Ig knockin mouse studies have shown that bnAb-expressing B cells are largely censored by central tolerance in the bone marrow. However, the contribution of peripheral tolerance in limiting the HIV antibody response by anergic and potentially protective B cells is poorly understood. Studies using mouse models to elucidate how anergic B cells are regulated and can be recruited into HIV-specific neutralizing antibody responses may provide insight into the development of a protective HIV-1 vaccine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hopkins, Richard; Bridgeman, Anne; Bourne, Charles; Mbewe-Mvula, Alice; Sadoff, Jerald C; Both, Gerald W; Joseph, Joan; Fulkerson, John; Hanke, Tomáš
2011-12-01
The desire to induce HIV-1-specific responses soon after birth to prevent breast milk transmission of HIV-1 led us to propose a vaccine regimen which primes HIV-1-specific T cells using a recombinant Mycobacterium bovis bacillus Calmette-Guérin (rBCG) vaccine. Because attenuated live bacterial vaccines are typically not sufficiently immunogenic as stand-alone vaccines, rBCG-primed T cells will likely require boost immunization(s). Here, we compared modified Danish (AERAS-401) and Pasteur lysine auxotroph (222) strains of BCG expressing the immunogen HIVA for their potency to prime HIV-1-specific responses in adult BALB/c mice and examined four heterologous boosting HIVA vaccines for their immunogenic synergy. We found that both BCG.HIVA(401) and BCG.HIVA(222) primed HIV-1-specific CD8(+) T-cell-mediated responses. The strongest boosts were delivered by human adenovirus-vectored HAdV5.HIVA and sheep atadenovirus-vectored OAdV7.HIVA vaccines, followed by poxvirus MVA.HIVA; the weakest was plasmid pTH.HIVA DNA. The prime-boost regimens induced T cells capable of efficient in vivo killing of sensitized target cells. We also observed that the BCG.HIVA(401) and BCG.HIVA(222) vaccines have broadly similar immunologic properties, but display a number of differences mainly detected through distinct profiles of soluble intercellular signaling molecules produced by immune splenocytes in response to both HIV-1- and BCG-specific stimuli. These results encourage further development of the rBCG prime-boost regimen. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gupta, Sachin; Clark, Emily S.; Termini, James M.; Boucher, Justin; Kanagavelu, Saravana; LeBranche, Celia C.; Abraham, Sakhi; Montefiori, David C.
2015-01-01
include the instability of the gp120 trimer, the inaccessibility of the conserved sequences, highly variable protein sequences, and the loss of HIV-1-specific antibody-producing cells during development. We have shown previously that tumor necrosis factor (TNF) superfamily ligands, including BAFF and APRIL, can be multitrimerized using the lung protein SP-D (surfactant protein D), enhancing immune responses. Here we show that DNA or DNA-protein vaccines encoding BAFF or APRIL multitrimers, IL-12p70, and membrane-bound HIV-1 Env gp140 induced tier 1 and tier 2 neutralizing antibodies in a mouse model. BAFF and APRIL enhanced the immune reaction, improved antibody binding, and increased the numbers of anti-HIV-1 antibody-secreting cells. Adaptation of this vaccine design may prove useful in designing preventive HIV-1 vaccines for humans. PMID:25631080
Claireaux, M; Galperin, M; Benati, D; Nouël, A; Mukhopadhyay, M; Klingler, J; de Truchis, P; Zucman, D; Hendou, S; Boufassa, F; Moog, C; Lambotte, O; Chakrabarti, L A
2018-05-08
Follicular helper T cells (Tfh) play an essential role in the affinity maturation of the antibody response by providing help to B cells. To determine whether this CD4 + T cell subset may contribute to the spontaneous control of HIV infection, we analyzed the phenotype and function of circulating Tfh (cTfh) in patients from the ANRS CO21 CODEX cohort who naturally controlled HIV-1 replication to undetectable levels and compared them to treated patients with similarly low viral loads. HIV-specific cTfh (Tet + ), detected by Gag-major histocompatibility complex class II (MHC-II) tetramer labeling in the CD45RA - CXCR5 + CD4 + T cell population, proved more frequent in the controller group ( P = 0.002). The frequency of PD-1 expression in Tet + cTfh was increased in both groups (median, >75%) compared to total cTfh (<30%), but the intensity of PD-1 expression per cell remained higher in the treated patient group ( P = 0.02), pointing to the persistence of abnormal immune activation in treated patients. The function of cTfh, analyzed by the capacity to promote IgG secretion in cocultures with autologous memory B cells, did not show major differences between groups in terms of total IgG production but proved significantly more efficient in the controller group when measuring HIV-specific IgG production. The frequency of Tet + cTfh correlated with HIV-specific IgG production ( R = 0.71 for Gag-specific and R = 0.79 for Env-specific IgG, respectively). Taken together, our findings indicate that key cTfh-B cell interactions are preserved in controlled HIV infection, resulting in potent memory B cell responses that may play an underappreciated role in HIV control. IMPORTANCE The rare patients who spontaneously control HIV replication in the absence of therapy provide a unique model to identify determinants of an effective anti-HIV immune response. HIV controllers show signs of particularly efficient antiviral T cell responses, while their humoral response was until recently
Dimethyl fumarate modulation of immune and antioxidant responses: application to HIV therapy
Gill, Alexander J.; Kolson, Dennis L.
2013-01-01
The persistence of chronic immune activation and oxidative stress in human immunodeficiency virus (HIV)-infected, antiretroviral drug-treated individuals are major obstacles to fully preventing HIV disease progression. The immune modulator and antioxidant dimethyl fumarate (DMF) is effective in treating immune-mediated diseases and it also has potential applications to limiting HIV disease progression. Among the relevant effects of DMF and its active metabolite monomethyl fumarate (MMF) are induction of a Th1 → Th2 lymphocyte shift, inhibition of pro-inflammatory cytokine signaling, inhibition of NF-κB nuclear translocation, inhibition of dendritic cell maturation, suppression of lymphocyte and endothelial cell adhesion molecule expression, and induction of the Nrf2-dependent antioxidant response element (ARE) and effector genes. Associated with these effects are reduced lymphocyte and monocyte infiltration into psoriatic skin lesions in humans and immune-mediated demyelinating brain lesions in rodents, which confirms potent systemic and central nervous system (CNS) effects. In addition, DMF and MMF limit HIV infection in macrophages in vitro, albeit by unknown mechanisms. Finally, DMF and MMF also suppress neurotoxin production from HIV-infected macrophages, which drives CNS neurodegeneration. Thus, DMF might protect against systemic and CNS complications in HIV infection through its effective suppression of immune activation, oxidative stress, HIV replication, and macrophage-associated neuronal injury. PMID:23971529
Ching, Natascha; Deville, Jaime G; Nielsen, Karin A; Ank, Bonnie; Wei, Lian S; Sim, Myung Shin; Wolinsky, Steven M; Bryson, Yvonne J
2007-01-01
Human immunodeficiency virus type 1 (HIV-1) infected children treated with highly active antiretroviral therapy (HAART) may develop a significant reduction of plasma viremia associated with an increase in CD4+ T-cell counts. Functional capacity of this reconstituted immune system in response to recall antigens is important to maintain protective immunity to vaccine-preventable diseases. We therefore determined cellular and humoral immune responses to tetanus toxoid (TT) booster in perinatally HIV-1-infected children and adolescents receiving HAART. Immune responses were prospectively evaluated pre- and post-tetanus booster using lymphocyte proliferation assay (LPA) stimulation index (SI > or = 3.0) and tetanus antibody (TAb > or = 0.15) in 15 patients. The median interval from primary tetanus immunization series was 6 years (range 2-12 years). We compared patients by their virological response to HAART (complete responders, CR, n=7; incomplete responders, ICR, n=8). There were no significant differences in median age 12.6 years (CR: 12.9; ICR: 10.6) or median CD4 T-cell pre-booster (CR: 35%/819; ICR: 26%/429) between groups. Tetanus LPA responses were observed in one patient prior to booster and in seven patients post-booster. In contrast, 38% of patients had protective TAb pre-booster, but 92% developed protective TAb post-booster. All of the CR and 5/6 ICR patients developed protective TAb. HIV-1-infected children and adolescents had modest LPA responses to tetanus following booster, similar to HIV-1-infected adults. However, the majority of patients developed protective TAb levels after booster and maintained the response. Shorter intervals may need to be considered for TT immunization boosters in HIV-1-infected pediatric patients, as only 38% had protective TAb at baseline.
Brumme, Chanson J.; Martin, Eric; Listgarten, Jennifer; Brockman, Mark A.; Le, Anh Q.; Chui, Celia K. S.; Cotton, Laura A.; Knapp, David J. H. F.; Riddler, Sharon A.; Haubrich, Richard; Nelson, George; Pfeifer, Nico; DeZiel, Charles E.; Heckerman, David; Apps, Richard; Carrington, Mary; Mallal, Simon; Harrigan, P. Richard; John, Mina
2012-01-01
HLA class I-associated polymorphisms identified at the population level mark viral sites under immune pressure by individual HLA alleles. As such, analysis of their distribution, frequency, location, statistical strength, sequence conservation, and other properties offers a unique perspective from which to identify correlates of protective cellular immunity. We analyzed HLA-associated HIV-1 subtype B polymorphisms in 1,888 treatment-naïve, chronically infected individuals using phylogenetically informed methods and identified characteristics of HLA-associated immune pressures that differentiate protective and nonprotective alleles. Over 2,100 HLA-associated HIV-1 polymorphisms were identified, approximately one-third of which occurred inside or within 3 residues of an optimally defined cytotoxic T-lymphocyte (CTL) epitope. Differential CTL escape patterns between closely related HLA alleles were common and increased with greater evolutionary distance between allele group members. Among 9-mer epitopes, mutations at HLA-specific anchor residues represented the most frequently detected escape type: these occurred nearly 2-fold more frequently than expected by chance and were computationally predicted to reduce peptide-HLA binding nearly 10-fold on average. Characteristics associated with protective HLA alleles (defined using hazard ratios for progression to AIDS from natural history cohorts) included the potential to mount broad immune selection pressures across all HIV-1 proteins except Nef, the tendency to drive multisite and/or anchor residue escape mutations within known CTL epitopes, and the ability to strongly select mutations in conserved regions within HIV's structural and functional proteins. Thus, the factors defining protective cellular immune responses may be more complex than simply targeting conserved viral regions. The results provide new information to guide vaccine design and immunogenicity studies. PMID:23055555
Arias, Mauricio A.; Loxley, Andrew; Eatmon, Christy; Van Roey, Griet; Fairhurst, David; Mitchnick, Mark; Dash, Philip; Cole, Tom; Wegmann, Frank; Sattentau, Quentin; Shattock, Robin
2011-01-01
Induction of humoral responses to HIV at mucosal compartments without inflammation is important for vaccine design. We developed charged wax nanoparticles that efficiently adsorb protein antigens and are internalized by DC in the absence of inflammation. HIV-gp140-adsorbed nanoparticles induced stronger in vitro T-cell proliferation responses than antigen alone. Such responses were greatly enhanced when antigen was co-adsorbed with TLR ligands. Immunogenicity studies in mice showed that intradermal vaccination with HIV-gp140 antigen-adsorbed nanoparticles induced high levels of specific IgG. Importantly, intranasal immunization with HIV-gp140-adsorbed nanoparticles greatly enhanced serum and vaginal IgG and IgA responses. Our results show that HIV-gp140-carrying wax nanoparticles can induce strong cellular/humoral immune responses without inflammation and may be of potential use as effective mucosal adjuvants for HIV vaccine candidates. PMID:21145913
Agarwal, Atima; Sankaran, Sumathi; Vajpayee, Madhu; Sreenivas, V; Seth, Pradeep; Dandekar, Satya
2014-01-01
Background Assays with specificity and cost effectiveness are needed for the measurement of HIV-1 burden to monitor disease progression or response to anti-retroviral therapy (ART) in HIV-1 subtype C infected patients. Objectives The objective of this study was to develop and validate an affordable; one step Real-Time RT-PCR assay with high specificity and sensitivity to measure plasma HIV-1 loads in HIV-1 subtype C infected patients. Results We developed an RT-PCR assay to detect and quantitate plasma HIV-1 levels in HIV-1 subtype C infected patients. An inverse correlation between plasma viral loads (PVL) and CD4+ T-cell numbers was detected at all CDC stages. Significant correlations were found between CD8+ T-cell activation and PVL, as well as with the clinical and immunological status of the patients. Conclusions The RT-PCR assay provides a sensitive method to measure PVL in HIV-1 subtype C infected patients. Viral loads correlated with immune activation and can be used to monitor HIV care in India. PMID:17962068
Leng, C Y; Low, H C; Chua, L L; Chong, M L; Sulaiman, H; Azwa, I; Roberts, J M; Kamarulzaman, A; Rajasuriar, R; Woo, Y L
2017-05-01
Human papillomavirus (HPV)-associated cancers disproportionately affect those infected with HIV despite effective combination antiretroviral therapy (cART). The primary aim of this study was to quantify HPV16 and HPV52 E6-specific interferon (IFN)-γ enzyme-linked immunospot (ELISPOT) T-cell responses, a correlate of protective immunity, in the first year following cART initiation and subsequently in those patients with suboptimal (sIR) and optimal (oIR) immune reconstitution. Ninety-four HIV-infected patients were recruited to the study; a longitudinal cohort of patients recruited just prior to commencing cART and followed up for 48 weeks (n = 27), and a cross-sectional cohort (n = 67) consisting of patients with sIR (CD4 T-cell count < 350 cells/μL) and oIR (CD4 T-cell count > 500 cells/μL) after a minimum of 2 years on cART. Controls (n = 29) consisted of HIV-negative individuals. IFN-γ ELISPOT responses against HPV16 and HPV52 E6 were correlated to clinical characteristics, anal and oral HPV carriage, T-cell maturational subsets, markers of activation, senescence and T-regulatory cells. HPV16 and HPV52 E6-specific T-cell responses were detected in only one of 27 patients (3.7%) during the initial phase of immune recovery. After at least 2 years of cART, those who achieved oIR had significantly higher E6-specific responses (9 of 34; 26.5%) compared with those with sIR (2 of 32; 6.3%) (P = 0.029). Apart from higher CD4 T-cell counts and lower CD4 T-cell activation, no other immunological correlates were associated with the detection of HPV16 and HPV52 E6-specific responses. HPV16 and HPV52 E6-specific IFN-γ T-cell responses, a correlate of protective immunity, were detected more frequently among HIV-infected patients who achieved optimal immune recovery on cART (26.5%) compared with those with suboptimal recovery (6.3%). © 2016 British HIV Association.
HIV-1 Envelope Resistance to Proteasomal Cleavage: Implications for Vaccine Induced Immune Responses
Steers, Nicholas J.; Ratto-Kim, Silvia; de Souza, Mark S.; Currier, Jeffrey R.; Kim, Jerome H.; Michael, Nelson L.; Alving, Carl R.; Rao, Mangala
2012-01-01
Background Antigen processing involves many proteolytic enzymes such as proteasomes and cathepsins. The processed antigen is then presented on the cell surface bound to either MHC class I or class II molecules and induces/interacts with antigen-specific CD8+ and CD4+ T-cells, respectively. Preliminary immunological data from the RV144 phase III trial indicated that the immune responses were biased towards the Env antigen with a dominant CD4+ T-cell response. Methods In this study, we examined the susceptibility of HIV-1 Env-A244 gp120 protein, one of the protein boost subunits of the RV144 Phase III vaccine trial, to proteasomes and cathepsins and identified the generated peptide epitope repertoire by mass spectrometry. The peptide fragments were tested for cytokine production in CD4+ T-cell lines derived from RV144 volunteers. Results Env-A244 was resistant to proteasomes, thus diminishing the possibility of the generation of class I epitopes by the classical MHC class I pathway. However, Env-A244 was efficiently cleaved by cathepsins generating peptide arrays identified by mass spectrometry that contained both MHC class I and class II epitopes as reported in the Los Alamos database. Each of the cathepsins generated distinct degradation patterns containing regions of light and dense epitope clusters. The sequence DKKQKVHALF that is part of the V2 loop of gp120 produced by cathepsins induced a polyfunctional cytokine response including the generation of IFN-γ from CD4+ T-cell lines-derived from RV144 vaccinees. This sequence is significant since antibodies to the V1/V2-loop region correlated inversely with HIV-1 infection in the RV144 trial. Conclusions Based on our results, the susceptibility of Env-A244 to cathepsins and not to proteasomes suggests a possible mechanism for the generation of Env-specific CD4+T cell and antibody responses in the RV144 vaccinees. PMID:22880042
Manocha, Monika; Pal, Pramod Chandra; Chitralekha, K T; Thomas, Beena Elizabeth; Tripathi, Vinita; Gupta, Siddhartha Dutta; Paranjape, Ramesh; Kulkarni, Smita; Rao, D Nageswara
2005-12-01
The predominant route of HIV infection is through the sexual transmission via M cells. Most of the peptide and protein vaccines show poor transport across the epithelial barrier and are commonly administered by parenteral route. In the present study four HIV peptides from envelope (gp 41-LZ (leucine zipper), gp 41-FD (fusion domain) and gp120-C2) and regulatory (Nef) region in poly lactic-co-glycolide (PLG) micro-particle delivery were evaluated in mice of outbred and with different genetic background to compare immune response versus MHC restriction. Out of the combinational and single routes of immunization attempted, the single route maintained the IgG, IgA and sIgA in sera and washes for longer duration as compared to combinational routes in which the response was declined. The study demonstrated that single intranasal immunization offered significantly higher immune response (p<0.05) over oral and rectal mucosal routes in terms of inducing systemic as well as mucosal response. Also, the specific activity measurement of IgA and IgG in sera and sIgA in washes were correlating to the antibody titers. However, the intramuscular route of immunization generated systemic response only. The entrapment of plant lectin UEA-1 a ligand specific for M cells in micro-particle further enhanced the immune response in all the mucosal routes. The IgG isotypes generated were of IgG1 and IgG2a/2b in sera for all the peptides. The T cell proliferation response study with and without UEA-1 lectin in micro-particles showed significantly high (p<0.05) stimulation index (SI) with intranasal immunization for all the peptides from cells collected from spleen (SP), peyer's patches (PP) and lamina propria (LP) with SI in the order LP cells>PP>or=SP. The cytokine measurement profile of IL-2, IFN-gamma and IL-6 and low levels of IL-4 in the cultural supernatants of SP, PP and LP showed mixed CD4(+) Th1 and Th2 immune response. The p24 assay showed high percent inhibition of HIV-IIIB virus
Arias, Mauricio A; Loxley, Andrew; Eatmon, Christy; Van Roey, Griet; Fairhurst, David; Mitchnick, Mark; Dash, Philip; Cole, Tom; Wegmann, Frank; Sattentau, Quentin; Shattock, Robin
2011-02-01
Induction of humoral responses to HIV at mucosal compartments without inflammation is important for vaccine design. We developed charged wax nanoparticles that efficiently adsorb protein antigens and are internalized by DC in the absence of inflammation. HIV-gp140-adsorbed nanoparticles induced stronger in vitro T-cell proliferation responses than antigen alone. Such responses were greatly enhanced when antigen was co-adsorbed with TLR ligands. Immunogenicity studies in mice showed that intradermal vaccination with HIV-gp140 antigen-adsorbed nanoparticles induced high levels of specific IgG. Importantly, intranasal immunization with HIV-gp140-adsorbed nanoparticles greatly enhanced serum and vaginal IgG and IgA responses. Our results show that HIV-gp140-carrying wax nanoparticles can induce strong cellular/humoral immune responses without inflammation and may be of potential use as effective mucosal adjuvants for HIV vaccine candidates. Copyright © 2010 Elsevier Ltd. All rights reserved.
Effect of deworming on Th2 immune response during HIV-helminths co-infection.
Mulu, Andargachew; Anagaw, Belay; Gelaw, Aschalew; Ota, Fuso; Kassu, Afework; Yifru, Sisay
2015-07-18
Helminths infections have been suggested to worsen the outcome of HIV infection by polarizing the immune response towards Th2. The purpose of this study is to determine the activity of Th2 immune response by measuring total serum IgE level during symptomatic and asymptomatic HIV infection with and without helminths co-infection and to define the role of deworming and/or ART on kinetics of serum IgE. This prospective comparative study was conducted among symptomatic HIV-1 infected adults, treatment naïve asymptomatic HIV positive individuals and HIV negative apparently healthy controls with and without helminths co-infection. Detection and quantification of helminths and determination of serum IgE level, CD4(+), and CD8(+) T cell count were done at baseline and 12 weeks after ART and/or deworming. HIV patients co-infected with helminths showed a high level of serum IgE compared to HIV patients without helminths co-infection (1,688 [IQR 721-2,473] versus 1,221 [IQR 618-2,289] IU/ml; P = 0.022). This difference was also markedly observed between symptomatic HIV infected patients after with and without helminths infection (1,690 [IQR 1,116-2,491] versus 1,252 [703-2,251] IU/ml; P = 0.047). A significant decline in serum IgE level was observed 12 weeks after deworming and ART of symptomatic HIV infected patients with (1,487 versus 992, P = 0.002) and without (1,233 versus 976 IU/ml, P = 0.093) helminths co-infection. However, there was no significant decrease in serum IgE level among asymptomatic HIV infected individuals (1,183 versus 1,097 IU/ml, P = 0.13) and apparently health controls (666 IU/ml versus 571, P = 0.09) without helminths co-infection 12 weeks after deworming. The significant decline of serum IgE level 12 weeks after deworming of both symptomatic and asymptomatic patients indicate a tendency to down-regulate the Th2 immune response and is additional supportive evidence that deworming positively impacts HIV/AIDS diseases progression
Immune-driven recombination and loss of control after HIV superinfection.
Streeck, Hendrik; Li, Bin; Poon, Art F Y; Schneidewind, Arne; Gladden, Adrianne D; Power, Karen A; Daskalakis, Demetre; Bazner, Suzane; Zuniga, Rosario; Brander, Christian; Rosenberg, Eric S; Frost, Simon D W; Altfeld, Marcus; Allen, Todd M
2008-08-04
After acute HIV infection, CD8(+) T cells are able to control viral replication to a set point. This control is often lost after superinfection, although the mechanism behind this remains unclear. In this study, we illustrate in an HLA-B27(+) subject that loss of viral control after HIV superinfection coincides with rapid recombination events within two narrow regions of Gag and Env. Screening for CD8(+) T cell responses revealed that each of these recombination sites (approximately 50 aa) encompassed distinct regions containing two immunodominant CD8 epitopes (B27-KK10 in Gag and Cw1-CL9 in Env). Viral escape and the subsequent development of variant-specific de novo CD8(+) T cell responses against both epitopes were illustrative of the significant immune selection pressures exerted by both responses. Comprehensive analysis of the kinetics of CD8 responses and viral evolution indicated that the recombination events quickly facilitated viral escape from both dominant WT- and variant-specific responses. These data suggest that the ability of a superinfecting strain of HIV to overcome preexisting immune control may be related to its ability to rapidly recombine in critical regions under immune selection pressure. These data also support a role for cellular immune pressures in driving the selection of new recombinant forms of HIV.
Maintenance of HIV-Specific Memory B-Cell Responses in Elite Controllers Despite Low Viral Burdens.
Buckner, Clarisa M; Kardava, Lela; Zhang, Xiaozhen; Gittens, Kathleen; Justement, J Shawn; Kovacs, Colin; McDermott, Adrian B; Li, Yuxing; Sajadi, Mohammad M; Chun, Tae-Wook; Fauci, Anthony S; Moir, Susan
2016-08-01
Human immunodeficiency virus (HIV)-specific B-cell responses in infected individuals are maintained by active HIV replication. Suppression of viremia by antiretroviral therapy (ART) leads to quantitative and qualitative changes that remain unclear. Accordingly, B-cell responses were investigated in elite controllers (ECs), who maintain undetectable HIV levels without ART, and in individuals whose viremia was suppressed by ART. Despite a higher HIV burden in the ART group, compared with the EC group, frequencies of HIV-specific B cells were higher in the EC group, compared with those in the ART group. However, the initiation of ART in several ECs was associated with reduced frequencies of HIV-specific B cells, suggesting that responses are at least in part sustained by HIV replication. Furthermore, B-cell responses to tetanus toxin but not influenza hemagglutinin in the ART group were lower than those in the EC group. Thus, the superior HIV-specific humoral response in ECs versus ART-treated individuals is likely due to a more intact humoral immune response in ECs and/or distinct responses to residual HIV replication. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.
van den Berg, C H S B; Ruys, T A; Nanlohy, N M; Geerlings, S E; van der Meer, J T; Mulder, J-W; Lange, J A; van Baarle, D
2009-04-01
The aim of this study was to study the development of HCV-specific T cell immunity during acute HCV infection in the presence of an existing HIV-1 infection in four HIV-1 infected men having sex with men. A comprehensive analysis of HCV-specific T cell responses was performed at two time points during acute HCV infection using a T cell expansion assay with overlapping peptide pools spanning the entire HCV genome Three patients with (near) normal CD4+ T cell counts (range 400-970 x 10(6)/L) either resolved (n=1) or temporary suppressed HCV RNA. In contrast, one patient with low CD4+ T cell counts (330 x 10(6)/L), had sustained high HCV RNA levels. All four patients had low HCV-specific CD8+ T cell responses, and similar magnitudes of CD4+ T cell responses. Interestingly, individuals with resolved infection or temporary suppression of HCV-RNA had HCV-specific CD4+ T cell responses predominantly against nonstructural (NS) proteins. While the individual with high HCV RNA plasma concentrations had CD4+ T cell responses predominantly directed against Core. Our data show that an acute HCV infection in an HIV-1 infected person can be suppressed in the presence of HCV-specific CD4+ T cell response targeting non-structural proteins. However further research is needed in a larger group of patients to evaluate the role of HIV-1 on HCV-specific T cell responses in relation to outcome of acute HCV infection.
Joachim, Agricola; Munseri, Patricia J; Nilsson, Charlotta; Bakari, Muhammad; Aboud, Said; Lyamuya, Eligius F; Tecleab, Teghesti; Liakina, Valentina; Scarlatti, Gabriella; Robb, Merlin L; Earl, Patricia L; Moss, Bernard; Wahren, Britta; Mhalu, Fred; Ferrari, Guido; Sandstrom, Eric; Biberfeld, Gunnel
2017-08-01
We explored the duration of immune responses and the effect of a late third HIV-modified vaccinia virus Ankara (MVA) boost in HIV-DNA primed and HIV-MVA boosted Tanzanian volunteers. Twenty volunteers who had previously received three HIV-DNA and two HIV-MVA immunizations were given a third HIV-MVA immunization 3 years after the second HIV-MVA boost. At the time of the third HIV-MVA, 90% of the vaccinees had antibodies to HIV-1 subtype C gp140 (median titer 200) and 85% to subtype B gp160 (median titer 100). The majority of vaccinees had detectable antibody-dependent cellular cytotoxicity (ADCC)-mediating antibodies, 70% against CRF01_AE virus-infected cells (median titer 239) and 84% against CRF01_AE gp120-coated cells (median titer 499). A high proportion (74%) of vaccinees had IFN-γ ELISpot responses, 63% to Gag and 42% to Env, 3 years after the second HIV-MVA boost. After the third HIV-MVA, there was an increase in Env-binding antibodies and ADCC-mediating antibodies relative to the response seen at the time of the third HIV-MVA vaccination, p < .0001 and p < .05, respectively. The frequency of IFN-γ ELISpot responses increased to 95% against Gag or Env and 90% to both Gag and Env, p = .064 and p = .002, respectively. In conclusion, the HIV-DNA prime/HIV-MVA boost regimen elicited potent antibody and cellular immune responses with remarkable durability, and a third HIV-MVA immunization significantly boosted both antibody and cellular immune responses relative to the levels detected at the time of the third HIV-MVA, but not to higher levels than after the second HIV-MVA.
Tenzer, Stefan; Crawford, Hayley; Pymm, Phillip; Gifford, Robert; Sreenu, Vattipally B; Weimershaus, Mirjana; de Oliveira, Tulio; Burgevin, Anne; Gerstoft, Jan; Akkad, Nadja; Lunn, Daniel; Fugger, Lars; Bell, John; Schild, Hansjörg; van Endert, Peter; Iversen, Astrid K N
2014-04-24
The recent HIV-1 vaccine failures highlight the need to better understand virus-host interactions. One key question is why CD8(+) T cell responses to two HIV-Gag regions are uniquely associated with delayed disease progression only in patients expressing a few rare HLA class I variants when these regions encode epitopes presented by ~30 more common HLA variants. By combining epitope processing and computational analyses of the two HIV subtypes responsible for ~60% of worldwide infections, we identified a hitherto unrecognized adaptation to the antigen-processing machinery through substitutions at subtype-specific motifs. Multiple HLA variants presenting epitopes situated next to a given subtype-specific motif drive selection at this subtype-specific position, and epitope abundances correlate inversely with the HLA frequency distribution in affected populations. This adaptation reflects the sum of intrapatient adaptations, is predictable, facilitates viral subtype diversification, and increases global HIV diversity. Because low epitope abundance is associated with infrequent and weak T cell responses, this most likely results in both population-level immune evasion and inadequate responses in most people vaccinated with natural HIV-1 sequence constructs. Our results suggest that artificial sequence modifications at subtype-specific positions in vitro could refocus and reverse the poor immunogenicity of HIV proteins. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Mendiratta, Sanjay; Vajpayee, Madhu; Mojumdar, Kamalika; Chauhan, Neeraj K; Sreenivas, Vishnubhatla
2011-02-01
Polyfunctional CD8+ T-cells have been described as most competent in controlling viral replication. We studied the impact of antigen persistence on the polyfunctional immune responses of CD8+ T-lymphocytes to HIV Gag and Nef peptides and polyclonal stimuli in 40 ART naïve HIV infected individuals and analyzed the alterations in T-cell functionality in early and late stages of infection. Significantly elevated level of global response and polyfunctional profile of CD8+ T-cells were observed to polyclonal stimulation, than HIV specific antigens in chronically infected individuals. However no key differences were observed in CD8+ T-cell functional profile in any of the 15 unique subsets for Gag and Nef specific antigens. The subjects in early stage of infection (defined as a gap of 6 months or less between seroconversion and enrolment and with no apparent clinical symptoms) had a higher degree of response functionality (4+ or 3+ different functions simultaneously) than in the late stage infection (defined as time duration since seroconversion greater than 6 months). The data suggest that persistence of antigen during chronic infection leads to functional impairment of HIV specific responses. Copyright © 2010 Elsevier Ltd. All rights reserved.
García-Arriaza, Juan; Perdiguero, Beatriz; Heeney, Jonathan L.; Seaman, Michael S.; Montefiori, David C.; Yates, Nicole L.; Tomaras, Georgia D.; Ferrari, Guido; Foulds, Kathryn E.; Roederer, Mario; Self, Steven G.; Borate, Bhavesh; Gottardo, Raphael; Phogat, Sanjay; Tartaglia, Jim; Barnett, Susan W.; Burke, Brian; Cristillo, Anthony D.; Weiss, Deborah E.; Lee, Carter; Kibler, Karen V.; Jacobs, Bertram L.; Wagner, Ralf; Ding, Song; Pantaleo, Giuseppe
2017-01-01
ABSTRACT The nonreplicating attenuated poxvirus vector NYVAC expressing clade C(CN54) HIV-1 Env(gp120) and Gag-Pol-Nef antigens (NYVAC-C) showed limited immunogenicity in phase I clinical trials. To enhance the capacity of the NYVAC vector to trigger broad humoral responses and a more balanced activation of CD4+ and CD8+ T cells, here we compared the HIV-1-specific immunogenicity elicited in nonhuman primates immunized with two replicating NYVAC vectors that have been modified by the insertion of the K1L and C7L vaccinia virus host range genes and express the clade C(ZM96) trimeric HIV-1 gp140 protein or a Gag(ZM96)-Pol-Nef(CN54) polyprotein as Gag-derived virus-like particles (termed NYVAC-C-KC). Additionally, one NYVAC-C-KC vector was generated by deleting the viral gene B19R, an inhibitor of the type I interferon response (NYVAC-C-KC-ΔB19R). An immunization protocol mimicking that of the RV144 phase III clinical trial was used. Two groups of macaques received two doses of the corresponding NYVAC-C-KC vectors (weeks 0 and 4) and booster doses with NYVAC-C-KC vectors plus the clade C HIV-1 gp120 protein (weeks 12 and 24). The two replicating NYVAC-C-KC vectors induced enhanced and similar HIV-1-specific CD4+ and CD8+ T cell responses, similar levels of binding IgG antibodies, low levels of IgA antibodies, and high levels of antibody-dependent cellular cytotoxicity responses and HIV-1-neutralizing antibodies. Small differences within the NYVAC-C-KC-ΔB19R group were seen in the magnitude of CD4+ and CD8+ T cells, the induction of some cytokines, and the neutralization of some HIV-1 isolates. Thus, replication-competent NYVAC-C-KC vectors acquired relevant immunological properties as vaccine candidates against HIV/AIDS, and the viral B19 molecule exerts some control of immune functions. IMPORTANCE It is of special importance to find a safe and effective HIV/AIDS vaccine that can induce strong and broad T cell and humoral immune responses correlating with HIV-1
Moussa, Sandrine; Jenabian, Mohammad-Ali; Gody, Jean Chrysostome; Léal, Josiane; Grésenguet, Gérard; Le Faou, Alain; Bélec, Laurent
2013-01-01
Background We evaluated whether B cell-derived immune defenses of the gastro-intestinal tract are activated to produce HIV-specific antibodies in children continuously exposed to HIV via breast-feeding. Methods Couples of HIV-1-infected mothers (n = 14) and their breastfed non HIV-infected (n = 8) and HIV-infected (n = 6) babies, and healthy HIV-negative mothers and breastfed babies (n = 10) as controls, were prospectively included at the Complexe Pédiatrique of Bangui, Central African Republic. Immunoglobulins (IgA, IgG and IgM) and anti-gp160 antibodies from mother’s milk and stools of breastfed children were quantified by ELISA. Immunoaffinity purified anti-gp160 antibodies were characterized functionally regarding their capacity to reduce attachment and/or infection of R5- and X4- tropic HIV-1 strains on human colorectal epithelial HT29 cells line or monocyte-derived-macrophages (MDM). Results The levels of total IgA and IgG were increased in milk of HIV-infected mothers and stools of HIV-exposed children, indicating the activation of B cell-derived mucosal immunity. Breast milk samples as well as stool samples from HIV-negative and HIV-infected babies exposed to HIV by breast-feeding, contained high levels of HIV-specific antibodies, mainly IgG antibodies, less frequently IgA antibodies, and rarely IgM antibodies. Relative ratios of excretion by reference to lactoferrin calculated for HIV-specific IgA, IgG and IgM in stools of HIV-exposed children were largely superior to 1, indicating active production of HIV-specific antibodies by the intestinal mucosa. Antibodies to gp160 purified from pooled stools of HIV-exposed breastfed children inhibited the attachment of HIV-1NDK on HT29 cells by 63% and on MDM by 77%, and the attachment of HIV-1JRCSF on MDM by 40%; and the infection of MDM by HIV-1JRCSF by 93%. Conclusions The intestinal mucosa of children exposed to HIV by breast-feeding produces HIV-specific antibodies harbouring in vitro major
Grosse, V; Schulte, A; Weber, K; Mendila, M; Jacobs, R; Schmidt, R E; Heiken, H
2000-08-01
Visualization of antigen-specific T cells has become an important tool in studying immune responses. The aim of this study was to analyze CMV-specific CD4+ T cells in healthy and HIV-infected individuals. Peripheral blood mononuclear cells (PBMC) were examined for antigen-induced intracellular cytokine responses. We found significant numbers of CMV-specific CD4+ T cells detectable in most CMV-IgG+ HIV-1 infected individuals, whereas CMV-specific CD4+ T cells could not be demonstrated in CMV-IgG- patients. Median frequency of CMV-specific CD4+ T cells were lower in HIV-infected subjects who had been treated with highly active antiretroviral therapy (HAART) for more than 1 year than in untreated HIV-infected individuals. In patients under therapy for less than 1 year median CMV-specific CD4+ T cell responder frequency was higher than in subjects treated for more than 1 year but lower than in untreated subjects. HIV suppression with HAART might lead to a progressive reduction of CMV-specific CD4+ T cells indicating an efficient elimination of an opportunistic pathogen.
Chege, Gerald K; Burgers, Wendy A; Müller, Tracey L; Gray, Clive M; Shephard, Enid G; Barnett, Susan W; Ferrari, Guido; Montefiori, David; Williamson, Carolyn; Williamson, Anna-Lise
2017-02-07
Successful future HIV vaccines are expected to generate an effective cellular and humoral response against the virus in both the peripheral blood and mucosal compartments. We previously reported the development of DNA-C and MVA-C vaccines based on HIV-1 subtype C and demonstrated their immunogenicity when given in a DNA prime-MVA boost combination in a nonhuman primate model. In the current study, rhesus macaques previously vaccinated with a DNA-C and MVA-C vaccine regimen were re-vaccinated 3.5years later with MVA-C followed by a protein vaccine based on HIV-1 subtype C envelope formulated with MF59 adjuvant (gp140Env/MF59), and finally a concurrent boost with both vaccines. A single MVA-C re-vaccination elicited T cell responses in all animals similar to previous peak responses, with 4/7 demonstrating responses >1000 SFU/10 6 PBMC. In contrast to an Env/MF59-only vaccine, concurrent boosting with MVA-C and Env/MF59 induced HIV-specific cellular responses in multiple mucosal associated lymph nodes in 6/7 animals, with high magnitude responses in some animals. Both vaccine regimens induced high titer Env-specific antibodies with ADCC activity, as well as neutralization of Tier 1 viruses and modest Tier 2 neutralization. These data demonstrate the feasibility of inducing HIV-specific immunity in the blood and mucosal sites of viral entry by means of DNA and poxvirus-vectored vaccines, in combination with a HIV envelope-based protein vaccine. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
The impact of pregnancy on the HIV-1-specific T cell function in infected pregnant women.
Hygino, Joana; Vieira, Morgana M; Kasahara, Taissa M; Xavier, Luciana F; Blanco, Bernardo; Guillermo, Landi V C; Filho, Renato G S; Saramago, Carmen S M; Lima-Silva, Agostinho A; Oliveira, Ariane L; Guimarães, Vander; Andrade, Arnaldo F B; Bento, Cleonice A M
2012-12-01
Evidences indicate that pregnancy can alter the Ag-specific T-cell responses. This work aims to evaluate the impact of pregnancy on the in vitro HIV-1-specific immune response. As compared with non-pregnant patients, lower T-cell proliferation and higher IL-10 production were observed in T-cell cultures from pregnant patients following addition of either mitogens or HIV-1 antigens. In our system, the main T lymphocyte subset involved in producing IL-10 was CD4(+)FoxP3(-). Depletion of CD4(+) cells elevated TNF-α and IFN-γ production. Interestingly, the in vitro HIV-1 replication was lower in cell cultures from pregnant patients, and it was inversely related to IL-10 production. In these cultures, the neutralization of IL-10 by anti-IL-10 mAb elevated TNF-α release and HIV-1 replication. In conclusion, our results reveal that pregnancy-related events should favor the expansion of HIV-1-specific IL-10-secreting CD4(+) T-cells in HIV-1-infected women, which should, in the scenario of pregnancy, help to reduce the risk of vertical HIV-1 transmission. Copyright © 2012 Elsevier Inc. All rights reserved.
Emmer, Kristel L; Wieczorek, Lindsay; Tuyishime, Steven; Molnar, Sebastian; Polonis, Victoria R; Ertl, Hildegund C J
2016-10-23
Over 2 million individuals are infected with HIV type 1 (HIV-1) each year, yet an effective vaccine remains elusive. The most successful HIV-1 vaccine to date demonstrated 31% efficacy. Immune correlate analyses associated HIV-1 envelope (Env)-specific antibodies with protection, thus providing a path toward a more effective vaccine. We sought to test the antibody response from novel prime-boost vaccination with a chimpanzee-derived adenovirus (AdC) vector expressing a subtype C Env glycoprotein (gp)140 combined with either a serologically distinct AdC vector expressing gp140 of a different subtype C isolate or an alum-adjuvanted, partially trimeric gp145 from yet another subtype C isolate. Three different prime-boost regimens were tested in mice: AdC prime-protein boost, protein prime-AdC boost, and AdC prime-AdC boost. Each regimen was tested at two different doses of AdC vector in a total of six experimental groups. Sera were collected at various time points and evaluated by ELISA for Env-specific antibody binding, isotype, and avidity. Antibody functionality was assessed by pseudovirus neutralization assay. Priming with AdC followed by a protein boost or sequential immunizations with two AdC vectors induced HIV-1 Env-specific binding antibodies, including those to the variable region 2, whereas priming with protein followed by an AdC boost was relatively ineffective. Antibodies that cross-neutralized tier 1 HIV-1 from different subtypes were elicited with vaccine regimens that included immunizations with protein. Our study warrants further investigation of AdC vector and gp145 protein prime-boost vaccines and their ability to protect against acquisition in animal challenge studies.
Khattar, Sunil K; DeVico, Anthony L; LaBranche, Celia C; Panda, Aruna; Montefiori, David C; Samal, Siba K
2016-02-01
Newcastle disease virus (NDV) expressing HIV-1 BaL gp160 was evaluated either alone or with monomeric BaL gp120 and BaL SOSIP gp140 protein in a prime-boost combination in guinea pigs to enhance envelope (Env)-specific humoral and mucosal immune responses. We showed that a regimen consisting of an NDV prime followed by a protein boost elicited stronger serum and mucosal Th-1-biased IgG responses and neutralizing antibody responses than NDV-only immunizations. Additionally, these responses were higher after the gp120 than after the SOSIP gp140 protein boost. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Belyakov, I M; Ahlers, J D
2011-01-01
Mucosal tissues are major sites of HIV entry and initial infection. Induction of a local mucosal cytotoxic T lymphocyte response is considered an important goal in developing an effective HIV vaccine. In addition, activation and recruitment of memory CD4(+) and CD8(+) T cells in systemic lymphoid circulation to mucosal effector sites might provide the firewall needed to prevent virus spread. Therefore a vaccine that generates CD4(+) and CD8(+) responses in both mucosal and systemic tissues might be required for protection against HIV. However, optimal routes and number of vaccinations required for the generation of long lasting CD4(+) and CD8(+) CTL effector and memory responses are not well understood especially for mucosal T cells. A number of studies looking at protective immune responses against diverse mucosal pathogens have shown that mucosal vaccination is necessary to induce a compartmentalized immune response including maximum levels of mucosal high-avidity CD8(+) CTL, antigen specific mucosal antibodies titers (especially sIgA), as well as induction of innate anti-viral factors in mucosa tissue. Immune responses are detectable at mucosal sites after systemic delivery of vaccine, and prime boost regimens can amplify the magnitude of immune responses in mucosal sites and in systemic lymphoid tissues. We believe that the most optimal mucosal and systemic HIV/SIV specific protective immune responses and innate factors might best be achieved by simultaneous mucosal and systemic prime and boost vaccinations. Similar principals of vaccination may be applied for vaccine development against cancer and highly invasive pathogens that lead to chronic infection.
Eudailey, Joshua A.; Dennis, Maria L.; Parker, Morgan E.; Phillips, Bonnie L.; Huffman, Tori N.; Bay, Camden P.; Hudgens, Michael G.; Wiseman, Roger W.; Pollara, Justin J.; Fouda, Genevieve G.; Ferrari, Guido; Pickup, David J.; Kozlowski, Pamela A.; Van Rompay, Koen K. A.; De Paris, Kristina
2018-01-01
ABSTRACT Mother-to-child transmission (MTCT) of human immunodeficiency virus type 1 (HIV-1) contributes to an estimated 150,000 new infections annually. Maternal vaccination has proven safe and effective at mitigating the impact of other neonatal pathogens and is one avenue toward generating the potentially protective immune responses necessary to inhibit HIV-1 infection of infants through breastfeeding. In the present study, we tested the efficacy of a maternal vaccine regimen consisting of a modified vaccinia virus Ankara (MVA) 1086.C gp120 prime-combined intramuscular-intranasal gp120 boost administered during pregnancy and postpartum to confer passive protection on infant rhesus macaques against weekly oral exposure to subtype C simian-human immunodeficiency virus 1157ipd3N4 (SHIV1157ipd3N4) starting 6 weeks after birth. Despite eliciting a robust systemic envelope (Env)-specific IgG response, as well as durable milk IgA responses, the maternal vaccine did not have a discernible impact on infant oral SHIV acquisition. This study revealed considerable variation in vaccine-elicited IgG placental transfer and a swift decline of both Env-specific antibodies (Abs) and functional Ab responses in the infants prior to the first challenge, illustrating the importance of pregnancy immunization timing to elicit optimal systemic Ab levels at birth. Interestingly, the strongest correlation to the number of challenges required to infect the infants was the percentage of activated CD4+ T cells in the infant peripheral blood at the time of the first challenge. These findings suggest that, in addition to maternal immunization, interventions that limit the activation of target cells that contribute to susceptibility to oral HIV-1 acquisition independently of vaccination may be required to reduce infant HIV-1 acquisition via breastfeeding. IMPORTANCE Without novel strategies to prevent mother-to-child HIV-1 transmission, more than 5% of HIV-1-exposed infants will continue to
Suarez, Guadalupe V; Angerami, Matías T; Vecchione, María B; Laufer, Natalia; Turk, Gabriela; Ruiz, Maria J; Mesch, Viviana; Fabre, Bibiana; Maidana, Patricia; Ameri, Diego; Cahn, Pedro; Sued, Omar; Salomón, Horacio; Bottasso, Oscar A; Quiroga, María F
2015-09-01
Tuberculosis (TB) is the leading cause of death among HIV-positive patients. The decreasing frequencies of terminal effector (TTE ) CD8(+) T cells may increase reactivation risk in persons latently infected with Mycobacterium tuberculosis (Mtb). We have previously shown that dehydroepiandrosterone (DHEA) increases the protective antitubercular immune responses in HIV-TB patients. Here, we aimed to study Mtb-specific cytotoxicity, IFN-γ secretion, memory status of CD8(+) T cells, and their modulation by DHEA during HIV-TB coinfection. CD8(+) T cells from HIV-TB patients showed a more differentiated phenotype with diminished naïve and higher effector memory and TTE T-cell frequencies compared to healthy donors both in total and Mtb-specific CD8(+) T cells. Notably, CD8(+) T cells from HIV-TB patients displayed higher Terminal Effector (TTE ) CD45RA(dim) proportions with lower CD45RA expression levels, suggesting a not fully differentiated phenotype. Also, PD-1 expression levels on CD8(+) T cells from HIV-TB patients increased although restricted to the CD27(+) population. Interestingly, DHEA plasma levels positively correlated with TTE in CD8(+) T cells and in vitro DHEA treatment enhanced Mtb-specific cytotoxic responses and terminal differentiation in CD8(+) T cells from HIV-TB patients. Our data suggest that HIV-TB coinfection promotes a deficient CD8(+) T-cell differentiation, whereas DHEA may contribute to improving antitubercular immunity by enhancing CD8(+) T-cell functions during HIV-TB coinfection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The innate immune response in HIV/AIDS septic shock patients: a comparative study.
Amancio, Rodrigo T; Japiassu, Andre M; Gomes, Rachel N; Mesquita, Emersom C; Assis, Edson F; Medeiros, Denise M; Grinsztejn, Beatriz; Bozza, Patrícia T; Castro-Faria Neto, Hugo C; Bozza, Fernando A
2013-01-01
In recent years, the incidence of sepsis has increased in critically ill HIV/AIDS patients, and the presence of severe sepsis emerged as a major determinant of outcomes in this population. The inflammatory response and deregulated cytokine production play key roles in the pathophysiology of sepsis; however, these mechanisms have not been fully characterized in HIV/AIDS septic patients. We conducted a prospective cohort study that included HIV/AIDS and non-HIV patients with septic shock. We measured clinical parameters and biomarkers (C-reactive protein and cytokine levels) on the first day of septic shock and compared these parameters between HIV/AIDS and non-HIV patients. We included 30 HIV/AIDS septic shock patients and 30 non-HIV septic shock patients. The HIV/AIDS patients presented low CD4 cell counts (72 [7-268] cells/mm(3)), and 17 (57%) patients were on HAART before hospital admission. Both groups were similar according to the acute severity scores and hospital mortality. The IL-6, IL-10 and G-CSF levels were associated with hospital mortality in the HIV/AIDS septic group; however, the CRP levels and the surrogates of innate immune activation (cytokines) were similar among HIV/AIDS and non-HIV septic patients. Age (odds ratio 1.05, CI 95% 1.02-1.09, p=0.002) and the IL-6 levels (odds ratio 1.00, CI 95% 1.00-1.01, p=0.05) were independent risk factors for hospital mortality. IL-6, IL-10 and G-CSF are biomarkers that can be used to predict prognosis and outcomes in HIV/AIDS septic patients. Although HIV/AIDS patients are immunocompromised, an innate immune response can be activated in these patients, which is similar to that in the non-HIV septic population. In addition, age and the IL-6 levels are independent risk factors for hospital mortality irrespective of HIV/AIDS disease.
Climent, Núria; Guerra, Susana; García, Felipe; Rovira, Cristina; Miralles, Laia; Gómez, Carmen Elena; Piqué, Núria; Gil, Cristina; Gatell, José María; Esteban, Mariano; Gallart, Teresa
2011-01-01
Currently, MVA virus vectors carrying HIV-1 genes are being developed as HIV-1/AIDS prophylactic/therapeutic vaccines. Nevertheless, little is known about the impact of these vectors on human dendritic cells (DC) and their capacity to present HIV-1 antigens to human HIV-specific T cells. This study aimed to characterize the interaction of MVA and MVA expressing the HIV-1 genes Env-Gag-Pol-Nef of clade B (referred to as MVA-B) in human monocyte-derived dendritic cells (MDDC) and the subsequent processes of HIV-1 antigen presentation and activation of memory HIV-1-specific T lymphocytes. For these purposes, we performed ex vivo assays with MDDC and autologous lymphocytes from asymptomatic HIV-infected patients. Infection of MDDC with MVA-B or MVA, at the optimal dose of 0.3 PFU/MDDC, induced by itself a moderate degree of maturation of MDDC, involving secretion of cytokines and chemokines (IL1-ra, IL-7, TNF-α, IL-6, IL-12, IL-15, IL-8, MCP-1, MIP-1α, MIP-1β, RANTES, IP-10, MIG, and IFN-α). MDDC infected with MVA or MVA-B and following a period of 48 h or 72 h of maturation were able to migrate toward CCL19 or CCL21 chemokine gradients. MVA-B infection induced apoptosis of the infected cells and the resulting apoptotic bodies were engulfed by the uninfected MDDC, which cross-presented HIV-1 antigens to autologous CD8+ T lymphocytes. MVA-B-infected MDDC co-cultured with autologous T lymphocytes induced a highly functional HIV-specific CD8+ T cell response including proliferation, secretion of IFN-γ, IL-2, TNF-α, MIP-1β, MIP-1α, RANTES and IL-6, and strong cytotoxic activity against autologous HIV-1-infected CD4+ T lymphocytes. These results evidence the adjuvant role of the vector itself (MVA) and support the clinical development of prophylactic and therapeutic anti-HIV vaccines based on MVA-B. PMID:21625608
HIV-I Nef inhibitors: a novel class of HIV-specific immune adjuvants in support of a cure.
Dekaban, Gregory A; Dikeakos, Jimmy D
2017-09-12
The success of many current vaccines relies on a formulation that incorporates an immune activating adjuvant. This will hold true for the design of a successful therapeutic HIV vaccine targeted at controlling reactivated virus following cessation of combined antiretroviral therapy (cART). The HIV accessory protein Nef functions by interfering with HIV antigen presentation through the major histocompatibility complex I (MHC-I) pathway thereby suppressing CD8 + cytotoxic T cell (CTL)-mediated killing of HIV infected cells. Thus, this important impediment to HIV vaccine success must be circumvented. This review covers our current knowledge of Nef inhibitors that may serve as immune adjuvants that will specifically restore and enhance CTL-mediated killing of reactivated HIV infected cells as part of an overall vaccine strategy to affect a cure for HIV infection.
HIV-1 Strategies of Immune Evasion
NASA Astrophysics Data System (ADS)
Castiglione, F.; Bernaschi, M.
We simulate the progression of the HIV-1 infection in untreated host organisms. The phenotype features of the virus are represented by the replication rate, the probability of activating the transcription, the mutation rate and the capacity to stimulate an immune response (the so-called immunogenicity). It is very difficult to study in-vivo or in-vitro how these characteristics of the virus influence the evolution of the disease. Therefore we resorted to simulations based on a computer model validated in previous studies. We observe, by means of computer experiments, that the virus continuously evolves under the selective pressure of an immune response whose effectiveness downgrades along with the disease progression. The results of the simulations show that immunogenicity is the most important factor in determining the rate of disease progression but, by itself, it is not sufficient to drive the disease to a conclusion in all cases.
Karnasuta, Chitraporn; Vasan, Sandhya; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Madnote, Sirinan; Savadsuk, Hathairat; Rittiroongrad, Surawach; Puangkaew, Jiraporn; Phogat, Sanjay; Tartaglia, James; Sinangil, Faruk; de Souza, Mark S.; Excler, Jean-Louis; Kim, Jerome H.; Robb, Merlin L.; Michael, Nelson L.; Ngauy, Viseth; O'Connell, Robert J.; Karasavvas, Nicos
2018-01-01
Sexual transmission is the principal driver of the human immunodeficiency virus (HIV) pandemic. Understanding HIV vaccine-induced immune responses at mucosal surfaces can generate hypotheses regarding mechanisms of protection, and may influence vaccine development. The RV144 (ClinicalTrials.gov NCT00223080) efficacy trial showed protection against HIV infections but mucosal samples were not collected, therefore, the contribution of mucosal antibodies to preventing HIV-1 acquisition is unknown. Here, we report the generation, magnitude and persistence of antibody responses to recombinant gp120 envelope and antigens including variable one and two loop scaffold antigens (gp70V1V2) previously shown to correlate with risk in RV144. We evaluated antibody responses to gp120 A244gD and gp70V1V2 92TH023 (both CRF01_AE) and Case A2 (subtype B) in cervico-vaginal mucus (CVM), seminal plasma (SP) and rectal secretions (RS) from HIV-uninfected RV144 vaccine recipients, who were randomized to receive two late boosts of ALVAC-HIV/AIDSVAX®B/E, AIDSVAX®B/E, or ALVAC-HIV alone at 0 and 6 months. Late vaccine boosting increased IgG geometric mean titers (GMT) to gp120 A244gD in AIDSVAX®B/E and ALVAC-HIV/AIDSVAX®B/E CVM (28 and 17 fold, respectively), followed by SP and RS. IgG to gp70V1V2 92TH023 increased in AIDSVAX®B/E and ALVAC-HIV/AIDSVAX®B/E CVM (11–17 fold) and SP (2 fold) two weeks post first boost. IgG to Case A2 was only detected in AIDSVAX®B/E and ALVAC-HIV/AIDSVAX®B/E CVM. Mucosal IgG to gp120 A244gD (CVM, SP, RS), gp70V1V2 92TH023 (CVM, SP), and Case A2 (CVM) correlated with plasma IgG levels (p<0.001). Although the magnitude of IgG responses declined after boosting, anti-gp120 A244gD IgG responses in CVM persisted for 12 months post final vaccination. Further studies in localization, persistence and magnitude of envelope specific antibodies (IgG and dimeric IgA) in anogenital secretions will help determine their role in preventing mucosal HIV acquisition. PMID
Gorse, Geoffrey J; Newman, Mark J; deCamp, Allan; Hay, Christine Mhorag; De Rosa, Stephen C; Noonan, Elizabeth; Livingston, Brian D; Fuchs, Jonathan D; Kalams, Spyros A; Cassis-Ghavami, Farah L
2012-05-01
We evaluated a DNA plasmid-vectored vaccine and a recombinant modified vaccinia virus Ankara vaccine (MVA-mBN32), each encoding cytotoxic and helper T-lymphocyte epitopes of human immunodeficiency virus type 1 (HIV-1) in a randomized, double-blinded, placebo-controlled trial in 36 HIV-1-uninfected adults using a heterologous prime-boost schedule. HIV-1-specific cellular immune responses, measured as interleukin-2 and/or gamma interferon production, were induced in 1 (4%) of 28 subjects after the first MVA-mBN32 immunization and in 3 (12%) of 25 subjects after the second MVA-mBN32 immunization. Among these responders, polyfunctional T-cell responses, including the production of tumor necrosis factor alpha and perforin, were detected. Vaccinia virus-specific antibodies were induced to the MVA vector in 27 (93%) of 29 and 26 (93%) of 28 subjects after the first and second immunizations with MVA-mBN32. These peptide-based vaccines were safe but were ineffective at inducing HIV-1-specific immune responses and induced much weaker responses than MVA vaccines expressing the entire open reading frames of HIV-1 proteins.
Measurements of Immune Responses for Establishing Correlates of Vaccine Protection Against HIV
Burgers, Wendy A.; Manrique, Amapola; McKinnon, Lyle R.; Reynolds, Matthew R.; Rolland, Morgane; Blish, Catherine; Chege, Gerald K.; Curran, Rhonda; Fischer, William; Herrera, Carolina; Sather, D. Noah
2012-01-01
Abstract Well-defined correlates of protective immunity are an essential component of rational vaccine development. Despite years of basic science and three HIV vaccine efficacy trials, correlates of immunological protection from HIV infection remain undefined. In December 2010, a meeting of scientists engaged in basic and translational work toward developing HIV-1 vaccines was convened. The goal of this meeting was to discuss current opportunities and optimal approaches for defining correlates of protection, both for ongoing and future HIV-1 vaccine candidates; specific efforts were made to engage young scientists. We discuss here the highlights from the meeting regarding the progress made and the way forward for a protective HIV-1 vaccine. PMID:21861777
Djawe, Kpandja; Daly, Kieran R; Levin, Linda; Zar, Heather J; Walzer, Peter D
2013-01-01
Humoral immune responses in human immunodeficiency virus (HIV)-infected and uninfected children with Pneumocystis pneumonia (PcP) are poorly understood. Consecutive children hospitalized with acute pneumonia, tachypnea, and hypoxia in South Africa were investigated for PcP, which was diagnosed by real-time polymerase chain reaction on lower respiratory tract specimens. Serum antibody responses to recombinant fragments of the carboxyl terminus of Pneumocystis jirovecii major surface glycoprotein (MsgC) were analyzed. 149 children were enrolled of whom 96 (64%) were HIV-infected. PcP occurred in 69 (72%) of HIV-infected and 14 (26%) of HIV-uninfected children. HIV-infected children with PcP had significantly decreased IgG antibodies to MsgC compared to HIV-infected patients without PcP, but had similar IgM antibodies. In contrast, HIV-uninfected children with PcP showed no change in IgG antibodies to MsgC, but had significantly increased IgM antibodies compared to HIV-uninfected children without PCP. Age was an independent predictor of high IgG antibodies, whereas PcP was a predictor of low IgG antibodies and high IgM antibodies. IgG and IgM antibody levels to the most closely related MsgC fragments were predictors of survival from PcP. Young HIV-infected children with PcP have significantly impaired humoral immune responses to MsgC, whereas HIV-uninfected children with PcP can develop active humoral immune responses. The children also exhibit a complex relationship between specific host factors and antibody levels to MsgC fragments that may be related to survival from PcP.
Mendiratta, Sanjay; Vajpayee, Madhu; Malhotra, Uma; Kaushik, Shweta; Dar, Lalit; Mojumdar, Kamalika; Chauhan, Neeraj Kumar; Sreenivas, Vishnubhatla
2009-02-01
Cytotoxic T lymphocyte (CTL) responses to Gag have been most frequently linked to control of viremia whereas CTL responses to Nef have direct relationship with viral load. IFN-gamma ELISpot assay was used to screen CTL responses at single peptide level directed at HIV-1 subtype C Gag and Nef proteins in 30 antiretroviral therapy naive HIV-1 infected Indian individuals. PBMCs from 73.3% and 90% of the study population showed response to Gag and Nef antigens, respectively. The magnitude of Gag-specific CTL responses was inversely correlated with plasma viral load (r = -0.45, P = 0.001), whereas magnitude of Nef-specific responses was directly correlated (r = 0.115). Thirteen immunodominant regions (6 in Gag, 7 in Nef) were identified in the current study. The identification of Gag and Nef-specific responses across HIV-1 infected Indian population and targeting epitopes from multiple immunodominant regions may provide useful insight into the designing of new immunotherapy and vaccines.
Lewis, David J. M.; Wang, Yufei; Huo, Zhiming; Giemza, Raphaela; Babaahmady, Kaboutar; Rahman, Durdana; Shattock, Robin J.; Singh, Mahavir
2014-01-01
ABSTRACT The international effort to prevent HIV-1 infection by vaccination has failed to develop an effective vaccine. The aim of this vaccine trial in women was to administer by the vaginal mucosal route a vaccine consisting of HIV-1 gp140 linked to the chaperone 70-kDa heat shock protein (HSP70). The primary objective was to determine the safety of the vaccine. The secondary objective was to examine HIV-1 infectivity ex vivo and innate and adaptive immunity to HIV-1. Protocol-defined female volunteers were recruited. HIV-1 CN54gp140 linked to HSP70 was administered by the vaginal route. Significant adverse reactions were not detected. HIV-1 was significantly inhibited ex vivo in postimmunization CD4+ T cells compared with preimmunization CD4+ T cells. The innate antiviral restrictive factor APOBEC3G was significantly upregulated, as were CC chemokines which induce downregulation of CCR5 in CD4+ T cells. Indeed, a significant inverse correlation between the proportion of CCR5+ T cells and the concentration of CCL-3 or CCL-5 was found. Importantly, the upregulation of APOBEC3G showed a significant inverse correlation, whereas CCR5 exhibited a trend to correlate with inhibition of HIV-1 infection (r = 0.51). Furthermore, specific CD4+ and CD8+ T cell proliferative responses were significantly increased and CD4+ T cells showed a trend to have an inverse correlation with the viral load (r = −0.60). However, HIVgp140-specific IgG or IgA antibodies were not detected. The results provide proof of concept that an innate mechanism consisting of CC chemokines, APOBEC3G, and adaptive immunity by CD4 and CD8 T cells might be involved in controlling HIV-1 infectivity following vaginal mucosal immunization in women. (This study has been registered at ClinicalTrials.gov under registration no. NCT01285141.) IMPORTANCE Vaginal immunization of women with a vaccine consisting of HIVgp140 linked to the 70-kDa heat shock protein (HSP70) elicited ex vivo significant inhibition of
Lewis, David J M; Wang, Yufei; Huo, Zhiming; Giemza, Raphaela; Babaahmady, Kaboutar; Rahman, Durdana; Shattock, Robin J; Singh, Mahavir; Lehner, Thomas
2014-10-01
The international effort to prevent HIV-1 infection by vaccination has failed to develop an effective vaccine. The aim of this vaccine trial in women was to administer by the vaginal mucosal route a vaccine consisting of HIV-1 gp140 linked to the chaperone 70-kDa heat shock protein (HSP70). The primary objective was to determine the safety of the vaccine. The secondary objective was to examine HIV-1 infectivity ex vivo and innate and adaptive immunity to HIV-1. Protocol-defined female volunteers were recruited. HIV-1 CN54gp140 linked to HSP70 was administered by the vaginal route. Significant adverse reactions were not detected. HIV-1 was significantly inhibited ex vivo in postimmunization CD4(+) T cells compared with preimmunization CD4(+) T cells. The innate antiviral restrictive factor APOBEC3G was significantly upregulated, as were CC chemokines which induce downregulation of CCR5 in CD4(+) T cells. Indeed, a significant inverse correlation between the proportion of CCR5(+) T cells and the concentration of CCL-3 or CCL-5 was found. Importantly, the upregulation of APOBEC3G showed a significant inverse correlation, whereas CCR5 exhibited a trend to correlate with inhibition of HIV-1 infection (r = 0.51). Furthermore, specific CD4(+) and CD8(+) T cell proliferative responses were significantly increased and CD4(+) T cells showed a trend to have an inverse correlation with the viral load (r = -0.60). However, HIVgp140-specific IgG or IgA antibodies were not detected. The results provide proof of concept that an innate mechanism consisting of CC chemokines, APOBEC3G, and adaptive immunity by CD4 and CD8 T cells might be involved in controlling HIV-1 infectivity following vaginal mucosal immunization in women. (This study has been registered at ClinicalTrials.gov under registration no. NCT01285141.) Importance: Vaginal immunization of women with a vaccine consisting of HIVgp140 linked to the 70-kDa heat shock protein (HSP70) elicited ex vivo significant inhibition
A Chimeric HIV-1 gp120 Fused with Vaccinia Virus 14K (A27) Protein as an HIV Immunogen
Vijayan, Aneesh; García-Arriaza, Juan; C. Raman, Suresh; Conesa, José Javier; Chichón, Francisco Javier; Santiago, César; Sorzano, Carlos Óscar S.; Carrascosa, José L.; Esteban, Mariano
2015-01-01
In the HIV vaccine field, there is a need to produce highly immunogenic forms of the Env protein with the capacity to trigger broad B and T-cell responses. Here, we report the generation and characterization of a chimeric HIV-1 gp120 protein (termed gp120-14K) by fusing gp120 from clade B with the vaccinia virus (VACV) 14K oligomeric protein (derived from A27L gene). Stable CHO cell lines expressing HIV-1 gp120-14K protein were generated and the protein purified was characterized by size exclusion chromatography, electron microscopy and binding to anti-Env antibodies. These approaches indicate that gp120-14K protein is oligomeric and reacts with a wide spectrum of HIV-1 neutralizing antibodies. Furthermore, in human monocyte-derived dendritic cells (moDCs), gp120-14K protein upregulates the levels of several proinflammatory cytokines and chemokines associated with Th1 innate immune responses (IL-1β, IFN-γ, IL-6, IL-8, IL-12, RANTES). Moreover, we showed in a murine model, that a heterologous prime/boost immunization protocol consisting of a DNA prime with a plasmid expressing gp120-14K protein followed by a boost with MVA-B [a recombinant modified vaccinia virus Ankara (MVA) expressing HIV-1 gp120, Gag, Pol and Nef antigens from clade B], generates stronger, more polyfunctional, and greater effector memory HIV-1-specific CD4+ and CD8+ T-cell immune responses, than immunization with DNA-gp120/MVA-B. The DNA/MVA protocol was superior to immunization with the combination of protein/MVA and the latter was superior to a prime/boost of MVA/MVA or protein/protein. In addition, these immunization protocols enhanced antibody responses against gp120 of the class IgG2a and IgG3, together favoring a Th1 humoral immune response. These results demonstrate that fusing HIV-1 gp120 with VACV 14K forms an oligomeric protein which is highly antigenic as it activates a Th1 innate immune response in human moDCs, and in vaccinated mice triggers polyfunctional HIV-1-specific adaptive
Freguja, Riccardo; Gianesin, Ketty; Zanchetta, Marisa; De Rossi, Anita
2012-07-01
Variability in the susceptibility to HIV-1 infection and disease progression depends on both virus and host determinants. Some exposed individuals remain HIV-1-uninfected and HIV-1-infected subjects develop disease at varying intervals with a small percentage remaining long-term non-progressors. As innate immunity is the earliest response to microbial entry and injury, host factors that impact innate immunity may play a role in viral infectivity and pathogenesis. In the pediatric population the interactions between the virus and the host may be of particular relevance due to the still developing adaptive immune system. Data indicate that genetic variants of defensins and Toll-Like Receptors (TLRs), key elements of innate immunity, play a role in mother-to-child transmission (MTCT) of HIV-1, and in the outcome of pediatric HIV-1 disease. Although the mechanisms by which these genetic variants influence HIV-1 interactions with the host are still largely unknown, defensins and TLRs, along with their link with regulatory T cells (Tregs), may play a critical role in the onset and persistence of immune activation, a hallmark of HIV-1 disease.
Giacomet, Vania; Masetti, Michela; Nannini, Pilar; Forlanini, Federica; Clerici, Mario; Zuccotti, Gian Vincenzo; Trabattoni, Daria
2018-01-01
HBV vaccine induces protective antibodies only in 23-56% of HIV-infected children. The aim of our study is to evaluate the immunologic effects of a booster dose of HBV vaccine in HIV-infected youth. 53 young HIV-infected patients in whom HBV vaccination did not elicit protective Ab titers were enrolled. All patients were on ART with optimal immunological and viral response. All patients received a booster dose of HBV vaccine (HBVAXPRO 10 μg i.m.). HBV-specific Ab titer, viral load and CD4+ T cells were measured at baseline (T0), T1, T6 and T12 months. In a subgroup of 16 patients HBV-specific cell mediated immune responses were evaluated at baseline, at T1 and T6. The booster dose induced seroconversion in 51% of patients at T1, 57% at T6, and49% at T12; seroconversion rate was significantly correlated with CD4+T cells at T0 and to the CD4 nadir. The booster dose induced HBV-specific cell mediated immunity at T6 mainly in Responders (Rs): Effector Memory CD8+T cells, HBV-specific TNFα-, IFNγ-, granzyme secreting CD8+ T cells and IL2-secreting CD4+ T cells were significantly increased in Rs compared to T0. In Non Responders (NRs), HBV-specific IL2-secreting CD4+ T cells, Central and Effector Memory CD8+ T cells were the only parameters modified at T6. Seroconversion induced by a booster dose of vaccine correlates with the development of T cell immunological memory in HIV-infected patients who did not respond to the standard immunization. Alternate immunization schedules need to be considered in NRs.
Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald
2015-01-01
HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN ('A'), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 ('P'), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides
Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald
2015-01-01
HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN (‘A’), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 (‘P’), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques
Tomescu, Costin; Liu, Qin; Ross, Brian N; Yin, Xiangfan; Lynn, Kenneth; Mounzer, Karam C; Kostman, Jay R; Montaner, Luis J
2014-01-01
HIV-1 infected viremic controllers maintain durable viral suppression below 2000 copies viral RNA/ml without anti-retroviral therapy (ART), and the immunological factor(s) associated with host control in presence of low but detectable viral replication are of considerable interest. Here, we utilized a multivariable analysis to identify which innate and adaptive immune parameters best correlated with viral control utilizing a cohort of viremic controllers (median 704 viral RNA/ml) and non-controllers (median 21,932 viral RNA/ml) that were matched for similar CD4+ T cell counts in the absence of ART. We observed that HIV-1 Gag-specific CD8+ T cell responses were preferentially targeted over Pol-specific responses in viremic controllers (p = 0.0137), while Pol-specific responses were positively associated with viral load (rho = 0.7753, p = 0.0001, n = 23). Viremic controllers exhibited significantly higher NK and plasmacytoid dendritic cells (pDC) frequency as well as retained expression of the NK CD16 receptor and strong target cell-induced NK cell IFN-gamma production compared to non-controllers (p<0.05). Despite differences in innate and adaptive immune function however, both viremic controllers (p<0.05) and non-controller subjects (p<0.001) exhibited significantly increased CD8+ T cell activation and spontaneous NK cell degranulation compared to uninfected donors. Overall, we identified that a combination of innate (pDC frequency) and adaptive (Pol-specific CD8+ T cell responses) immune parameters best predicted viral load (R2 = 0.5864, p = 0.0021, n = 17) by a multivariable analysis. Together, this data indicates that preferential Gag-specific over Pol-specific CD8+ T cell responses along with a retention of functional innate subsets best predict host control over viral replication in HIV-1 infected viremic controllers compared to chronically-infected non-controllers.
Montoya, Carlos J; Toro, Maria F; Aguirre, Carlos; Bustamante, Alberto; Hernandez, Mariluz; Arango, Liliana P; Echeverry, Marta; Arango, Ana E; Prada, Maria C; Alarcon, Herminia del P; Rojas, Mauricio
2007-06-01
Given that highly active antiretroviral therapy (HAART) has been demonstrated useful to restore immune competence in type-1 human immunodeficiency virus (HIV-1)-infected subjects, we evaluated the specific antibody response to influenza vaccine in a cohort of HIV-1-infected children on HAART so as to analyze the quality of this immune response in patients under antiretroviral therapy. Sixteen HIV-1-infected children and 10 HIV-1 seronegative controls were immunized with a commercially available trivalent inactivated influenza vaccine containing the strains A/H1N1, A/H3N2, and B. Serum hemagglutinin inhibition (HI) antibody titers were determined for the three viral strains at the time of vaccination and 1 month later. Immunization induced a significantly increased humoral response against the three influenza virus strains in controls, and only against A/H3N2 in HIV-1-infected children. The comparison of post-vaccination HI titers between HIV-1+ patients and HIV-1 negative controls showed significantly higher HI titers against the three strains in controls. In addition, post vaccination protective HI titers (defined as equal to or higher than 1:40) against the strains A/H3N2 and B were observed in a lower proportion of HIV-1+ children than in controls, while a similar proportion of individuals from each group achieved protective HI titers against the A/H1N1 strain. The CD4+ T cell count, CD4/CD8 T cells ratio, and serum viral load were not affected by influenza virus vaccination when pre- vs post-vaccination values were compared. These findings suggest that despite the fact that HAART is efficient in controlling HIV-1 replication and in increasing CD4+ T cell count in HIV-1-infected children, restoration of immune competence and response to cognate antigens remain incomplete, indicating that additional therapeutic strategies are required to achieve a full reconstitution of immune functions.
Humoral and Innate Antiviral Immunity as Tools to Clear Persistent HIV Infection.
Ferrari, Guido; Pollara, Justin; Tomaras, Georgia D; Haynes, Barton F
2017-03-15
Human immunodeficiency virus (HIV) type 1 uses the CD4 molecule as its principal receptor to infect T cells. HIV-1 integrates its viral genome into the host cell, leading to persistent infection wherein HIV-1 can remain transcriptionally silent in latently infected CD4+ T cells. On reactivation of replication-competent provirus, HIV-1 envelope glycoproteins (Env) are expressed and accumulate on the cell surface, allowing infected cells to be detected and targeted by endogenous immune responses or immune interventions. HIV-1 Env-specific antibodies have the potential to bind HIV-1 cell surface Env and promote elimination of infected CD4+ T cells by recruiting cytotoxic effector cells, such as natural killer cells, monocytes, and polymorphonuclear cells. Harnessing humoral and innate cellular responses has become one focus of research to develop innovative strategies to recruit and redirect cytotoxic effector cells to eliminate the HIV-1 latently infected CD4+ T-cell reservoir. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
HIV-1 Reservoir Association with Immune Activation.
Vallejo, Alejandro
2015-09-01
In this issue of EBioMedicine, Ruggiero and colleagues describe immune activation biomarkers associated with the size of the HIV reservoir in a carefully designed cross-sectional study. The cohort consists of a homogeneous sample of HIV-1-infected patients with long-term plasma HIV-1 RNA suppression under antiretroviral treatment (ART). It is crucial to explore the potential utility of biomarkers that are easier (less labor intensive, less expensive) to measure than integrated HIV DNA load, in order to quickly and accurately quantify cellular reservoirs of HIV.
Maelfait, Jonathan; Seiradake, Elena; Rehwinkel, Jan
2014-07-01
HIV-1 infects dendritic cells (DCs) without triggering an effective innate antiviral immune response. As a consequence, the induction of adaptive immune responses controlling virus spread is limited. In a recent issue of Immunity, Lahaye and colleagues show that intricate interactions of HIV capsid with the cellular cofactor cyclophilin A (CypA) control infection and innate immune activation in DCs. Manipulation of HIV-1 capsid to increase its affinity for CypA results in reduced virus infectivity and facilitates access of the cytosolic DNA sensor cGAS to reverse transcribed DNA. This in turn induces a strong host response. Here, we discuss these findings in the context of recent developments in innate immunity and consider the implications for disease control and vaccine design. © 2014 The Authors. Bioessays published by WILEY Periodicals, Inc.
Veit, Olivia; Domingo, Cristina; Niedrig, Matthias; Staehelin, Cornelia; Sonderegger, Beat; Héquet, Delphine; Stoeckle, Marcel; Calmy, Alexandra; Schiffer, Veronique; Bernasconi, Enos; Flury, Domenica; Hatz, Christoph; Zwahlen, Marcel; Furrer, Hansjakob
2018-03-19
In human immunodeficiency virus (HIV)-infected individuals, the immune response over time to yellow fever vaccination (YFV) and the necessity for booster vaccination are not well understood. We studied 247 participants of the Swiss HIV Cohort Study (SHCS) with a first YFV after HIV diagnosis and determined their immune responses at 1 year, 5 years, and 10 years postvaccination by yellow fever plaque reduction neutralization titers (PRNTs) in stored blood samples. A PRNT of 1:≥10 was regarded as reactive and protective. Predictors of vaccination response were analyzed with Poisson regression. At vaccination, 82% of the vaccinees were taking combination antiretroviral therapy (cART), 83% had suppressed HIV RNA levels (<400 copies/mL), and their median CD4 T-cell count was 536 cells/μL. PRNT was reactive in 46% (95% confidence interval [CI], 38%-53%) before, 95% (95% CI, 91%-98%) within 1 year, 86% (95% CI, 79%-92%) at 5 years, and 75% (95% CI, 62%-85%) at 10 years postvaccination. In those with suppressed plasma HIV RNA at YFV, the proportion with reactive PRNTs remained high: 99% (95% CI, 95%-99.8%) within 1 year, 99% (95% CI, 92%-100%) at 5 years, and 100% (95% CI, 86%-100%) at 10 years. HIV-infected patients' long-term immune response up to 10 years to YFV is primarily dependent on the control of HIV replication at the time of vaccination. For those on successful cART, immune response up to 10 years is comparable to that of non-HIV-infected adults. We recommend a single YFV booster after 10 years for patients vaccinated on successful cART, whereas those vaccinated with uncontrolled HIV RNA may need an early booster.
Djawe, Kpandja; Daly, Kieran R.; Walzer, Peter D.
2013-01-01
Background Humoral immune responses in human immunodeficiency virus (HIV)-infected and uninfected children with Pneumocystis pneumonia (PcP) are poorly understood. Methods Consecutive children hospitalized with acute pneumonia, tachypnea, and hypoxia in South Africa were investigated for PcP, which was diagnosed by real-time polymerase chain reaction on lower respiratory tract specimens. Serum antibody responses to recombinant fragments of the carboxyl terminus of Pneumocystis jirovecii major surface glycoprotein (MsgC) were analyzed. Results 149 children were enrolled of whom 96 (64%) were HIV-infected. PcP occurred in 69 (72%) of HIV-infected and 14 (26%) of HIV-uninfected children. HIV-infected children with PcP had significantly decreased IgG antibodies to MsgC compared to HIV-infected patients without PcP, but had similar IgM antibodies. In contrast, HIV-uninfected children with PcP showed no change in IgG antibodies to MsgC, but had significantly increased IgM antibodies compared to HIV-uninfected children without PCP. Age was an independent predictor of high IgG antibodies, whereas PcP was a predictor of low IgG antibodies and high IgM antibodies. IgG and IgM antibody levels to the most closely related MsgC fragments were predictors of survival from PcP. Conclusions Young HIV-infected children with PcP have significantly impaired humoral immune responses to MsgC, whereas HIV-uninfected children with PcP can develop active humoral immune responses. The children also exhibit a complex relationship between specific host factors and antibody levels to MsgC fragments that may be related to survival from PcP. PMID:24386119
Xu, Shuting; Ducroux, Aurélie; Ponnurangam, Aparna; Vieyres, Gabrielle; Franz, Sergej; Müsken, Mathias; Zillinger, Thomas; Malassa, Angelina; Ewald, Ellen; Hornung, Veit; Barchet, Winfried; Häussler, Susanne; Pietschmann, Thomas; Goffinet, Christine
2016-10-12
Upon sensing cytoplasmic retroviral DNA in infected cells, cyclic GMP-AMP (cGAMP) synthase (cGAS) produces the cyclic dinucleotide cGAMP, which activates STING to trigger a type I interferon (IFN) response. We find that membrane fusion-inducing contact between donor cells expressing the HIV envelope (Env) and primary macrophages endogenously expressing the HIV receptor CD4 and coreceptor enable intercellular transfer of cGAMP. This cGAMP exchange results in STING-dependent antiviral IFN responses in target macrophages and protection from HIV infection. Furthermore, under conditions allowing cell-to-cell transmission of HIV-1, infected primary T cells, but not cell-free virions, deliver cGAMP to autologous macrophages through HIV-1 Env and CD4/coreceptor-mediated membrane fusion sites and induce a STING-dependent, but cGAS-independent, IFN response in target cells. Collectively, these findings identify an infection-specific mode of horizontal transfer of cGAMP between primary immune cells that may boost antiviral responses, particularly in infected tissues in which cell-to-cell transmission of virions exceeds cell-free infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Innate Immune Recognition of HIV-1
Iwasaki, Akiko
2012-01-01
In contrast to the extraordinary body of knowledge gained over the past three decades on the virology, pathogenesis, and immunology of HIV-1 infection, innate sensors that detect HIV-1 had remained elusive until recently. By virtue of integration, retroviridae makes up a substantial portion of our genome. Thus, immune strategies that deal with endogenous retroviruses are, by necessity, those of self-preservation and not of virus elimination. Some of the principles of such strategies may also apply for defense against exogenous retroviruses including HIV-1. Here, I highlight several sensors that have recently been revealed to be capable of recognizing distinct features of HIV-1 infection, while taking into account the host-retrovirus relationship that converges on avoiding pathogenic inflammatory consequences. PMID:22999945
Choi, Eunsil; Michalski, Chad J; Choo, Seung Ho; Kim, Gyoung Nyoun; Banasikowska, Elizabeth; Lee, Sangkyun; Wu, Kunyu; An, Hwa-Yong; Mills, Anthony; Schneider, Stefan; Bredeek, U Fritz; Coulston, Daniel R; Ding, Shilei; Finzi, Andrés; Tian, Meijuan; Klein, Katja; Arts, Eric J; Mann, Jamie F S; Gao, Yong; Kang, C Yong
2016-11-28
Vaccination with inactivated (killed) whole-virus particles has been used to prevent a wide range of viral diseases. However, for an HIV vaccine this approach has been largely negated due to inherent safety concerns, despite the ability of killed whole-virus vaccines to generate a strong, predominantly antibody-mediated immune response in vivo. HIV-1 Clade B NL4-3 was genetically modified by deleting the nef and vpu genes and substituting the coding sequence for the Env signal peptide with that of honeybee melittin signal peptide to produce a less virulent and more replication efficient virus. This genetically modified virus (gmHIV-1 NL4-3 ) was inactivated and formulated as a killed whole-HIV vaccine, and then used for a Phase I human clinical trial (Trial Registration: Clinical Trials NCT01546818). The gmHIV-1 NL4-3 was propagated in the A3.01 human T cell line followed by virus purification and inactivation with aldrithiol-2 and γ-irradiation. Thirty-three HIV-1 positive volunteers receiving cART were recruited for this observer-blinded, placebo-controlled Phase I human clinical trial to assess the safety and immunogenicity. Genetically modified and killed whole-HIV-1 vaccine, SAV001, was well tolerated with no serious adverse events. HIV-1 NL4-3 -specific PCR showed neither evidence of vaccine virus replication in the vaccine virus-infected human T lymphocytes in vitro nor in the participating volunteers receiving SAV001 vaccine. Furthermore, SAV001 with adjuvant significantly increased the pre-existing antibody response to HIV-1 proteins. Antibodies in the plasma of vaccinees were also found to recognize HIV-1 envelope protein on the surface of infected cells as well as showing an enhancement of broadly neutralizing antibodies inhibiting tier I and II of HIV-1 B, D, and A subtypes. The killed whole-HIV vaccine, SAV001, is safe and triggers anti-HIV immune responses. It remains to be determined through an appropriate trial whether this immune response prevents
Mahiti, Macdonald; Brumme, Zabrina L; Jessen, Heiko; Brockman, Mark A; Ueno, Takamasa
2015-07-31
HLA class II-restricted CD4(+) T lymphocytes play an important role in controlling HIV-1 replication, especially in the acute/early infection stage. But, HIV-1 Nef counteracts this immune response by down-regulating HLA-DR and up-regulating the invariant chain associated with immature HLA-II (Ii). Although functional heterogeneity of various Nef activities, including down-regulation of HLA class I (HLA-I), is well documented, our understanding of Nef-mediated evasion of HLA-II-restricted immune responses during acute/early infection remains limited. Here, we examined the ability of Nef clones from 47 subjects with acute/early progressive infection and 46 subjects with chronic progressive infection to up-regulate Ii and down-regulate HLA-DR and HLA-I from the surface of HIV-infected cells. HLA-I down-regulation function was preserved among acute/early Nef clones, whereas both HLA-DR down-regulation and Ii up-regulation functions displayed relatively broad dynamic ranges. Nef's ability to down-regulate HLA-DR and up-regulate Ii correlated positively at this stage, suggesting they are functionally linked in vivo. Acute/early Nef clones also exhibited higher HLA-DR down-regulation and lower Ii up-regulation functions compared to chronic Nef clones. Taken together, our results support enhanced Nef-mediated HLA class II immune evasion activities in acute/early compared to chronic infection, highlighting the potential importance of these functions following transmission. Copyright © 2015 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Wille-Reece, Ulrike; Flynn, Barbara J.; Loré, Karin; Koup, Richard A.; Kedl, Ross M.; Mattapallil, Joseph J.; Weiss, Walter R.; Roederer, Mario; Seder, Robert A.
2005-10-01
Induction and maintenance of antibody and T cell responses will be critical for developing a successful vaccine against HIV. A rational approach for generating such responses is to design vaccines or adjuvants that have the capacity to activate specific antigen-presenting cells. In this regard, dendritic cells (DCs) are the most potent antigen-presenting cells for generating primary T cell responses. Here, we report that Toll-like receptor (TLR) agonists and ligands that activate DCs in vitro influence the magnitude and quality of the cellular immune response in nonhuman primates (NHPs) when administered with HIV Gag protein. NHPs immunized with HIV Gag protein and a TLR7/8 agonist or a TLR9 ligand [CpG oligodeoxynucleotides (CpG ODN)] had significantly increased Gag-specific T helper 1 and antibody responses, compared with animals immunized with HIV Gag protein alone. Importantly, conjugating the HIV Gag protein to the TLR7/8 agonist (Gag-TLR7/8 conjugate) dramatically enhanced the magnitude and altered the quality of the T helper 1 response, compared with animals immunized with HIV Gag protein and the TLR7/8 agonist or CpG ODN. Furthermore, immunization with the Gag-TLR7/8 conjugate vaccine elicited Gag-specific CD8+ T responses. Collectively, our results show that conjugating HIV Gag protein to a TLR7/8 agonist is an effective way to elicit broad-based adaptive immunity in NHPs. This type of vaccine formulation should have utility in preventive or therapeutic vaccines in which humoral and cellular immunity is required. vaccine | dendritic cell | cross-presentation | cellular immunity
da Silva, Tatiana Pereira; Giacoia-Gripp, Carmem Beatriz Wagner; Schmaltz, Carolina A; Sant'Anna, Flavia Marinho; Saad, Maria Helena; Matos, Juliana Arruda de; de Lima E Silva, Julio Castro Alves; Rolla, Valeria Cavalcanti; Morgado, Mariza Gonçalves
2017-09-06
Little is known regarding the restoration of the specific immune response after combined antiretroviral therapy (cART) and anti-tuberculosis (TB) therapy introduction among TB-HIV patients. In this study, we examined the immune response of TB-HIV patients to Mycobacterium tuberculosis (Mtb) antigens to evaluate the response dynamics to different antigens over time. Moreover, we also evaluated the influence of two different doses of efavirenz and the factors associated with immune reconstitution. This is a longitudinal study nested in a clinical trial, where cART was initiated during the baseline visit (D0), which occurred 30 ± 10 days after the introduction of anti-TB therapy. Follow-up visits were performed at 30, 60, 90 and 180 days after cART initiation. The production of IFN-γ upon in vitro stimulation with Mtb antigens purified protein derivative (PPD), ESAT-6 and 38 kDa/CFP-10 using ELISpot was examined at baseline and follow-up visits. Sixty-one patients, all ART-naïve, were selected and included in the immune reconstitution analysis; seven (11.5%) developed Immune Reconstitution Inflammatory Syndrome (IRIS). The Mtb specific immune response was higher for the PPD antigen followed by 38 kDa/CFP-10 and increased in the first 60 days after cART initiation. In multivariate analysis, the variables independently associated with increased IFN-γ production in response to PPD antigen were CD4 + T cell counts <200 cells/mm 3 at baseline, age, site of tuberculosis, 800 mg efavirenz dose and follow-up CD4 + T cell counts. Moreover, the factors associated with the production of IFN-γ in response to 38 kDa/CFP-10 were detectable HIV viral load (VL) and CD4 + T cell counts at follow-up visits of ≥200 cells/mm 3 . These findings highlight the differences in immune response according to the specificity of the Mtb antigen, which contributes to a better understanding of TB-HIV immunopathogenesis. IFN-γ production elicited by PPD and 38 kDa/CFP-10 antigens
Multifarious immunotherapeutic approaches to cure HIV-1 infection.
Imami, Nesrina; Herasimtschuk, Anna A
2015-01-01
Immunotherapy in the context of treated HIV-1 infection aims to improve immune responses to achieve better control of the virus. To date, multifaceted immunotherapeutic approaches have been shown to reduce immune activation and increase CD4 T-lymphocyte counts, further to the effects of antiretroviral therapy alone, in addition to improving HIV-1-specific T-cell responses. While sterilizing cure of HIV-1 would involve elimination of all replication-competent virus, a functional cure in which the host has long-lasting control of viral replication may be more feasible. In this commentary, we discuss novel strategies aimed at targeting the latent viral reservoir with cure of HIV-1 infection being the ultimate goal, an achievement that would have considerable impact on worldwide HIV-1 infection.
Zolla-Pazner, Susan; Edlefsen, Paul T.; Rolland, Morgane; Kong, Xiang-Peng; deCamp, Allan; Gottardo, Raphael; Williams, Constance; Tovanabutra, Sodsai; Sharpe-Cohen, Sandra; Mullins, James I.; deSouza, Mark S.; Karasavvas, Nicos; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Pitisuttihum, Punnee; Kaewkungwal, Jaranit; O'Connell, Robert J.; Robb, Merlin L.; Michael, Nelson L.; Kim, Jerome H.; Gilbert, Peter
2014-01-01
To evaluate the role of V3-specific IgG antibodies (Abs) in the RV144 clinical HIV vaccine trial, which reduced HIV-1 infection by 31.2%, the anti-V3 Ab response was assessed. Vaccinees' V3 Abs were highly cross-reactive with cyclic V3 peptides (cV3s) from diverse virus subtypes. Sieve analysis of CRF01_AE breakthrough viruses from 43 vaccine- and 66 placebo-recipients demonstrated an estimated vaccine efficacy of 85% against viruses with amino acids mismatching the vaccine at V3 site 317 (p = 0.004) and 52% against viruses matching the vaccine at V3 site 307 (p = 0.004). This analysis was supported by data showing that vaccinees' plasma Abs were less reactive with I307 when replaced with residues found more often in vaccinees' breakthrough viruses. Simultaneously, viruses with mutations at F317 were less infectious, possibly due to the contribution of F317 to optimal formation of the V3 hydrophobic core. These data suggest that RV144-induced V3-specific Abs imposed immune pressure on infecting viruses and inform efforts to design an HIV vaccine. PMID:25599085
Fanales-Belasio, Emanuele; Moretti, Sonia; Fiorelli, Valeria; Tripiciano, Antonella; Pavone Cossut, Maria R; Scoglio, Arianna; Collacchi, Barbara; Nappi, Filomena; Macchia, Iole; Bellino, Stefania; Francavilla, Vittorio; Caputo, Antonella; Barillari, Giovanni; Magnani, Mauro; Laguardia, Maria Elena; Cafaro, Aurelio; Titti, Fausto; Monini, Paolo; Ensoli, Fabrizio; Ensoli, Barbara
2009-03-01
Tat is an early regulatory protein that plays a major role in human HIV-1 replication and AIDS pathogenesis, and therefore, it represents a key target for the host immune response. In natural infection, however, Abs against Tat are produced only by a small fraction (approximately 20%) of asymptomatic individuals and are rarely seen in progressors, suggesting that Tat may possess properties diverting the adaptive immunity from generating humoral responses. Here we show that a Th1-type T cell response against Tat is predominant over a Th2-type B cell response in natural HIV-1 infection. This is likely due to the capability of Tat to selectively target and very efficiently enter CD1a-expressing monocyte-derived dendritic cells (MDDC), which represent a primary target for the recognition and response to virus Ag. Upon cellular uptake, Tat induces MDDC maturation and Th1-associated cytokines and beta-chemokines production and polarizes the immune response in vitro to the Th1 pattern through the transcriptional activation of TNF-alpha gene expression. This requires the full conservation of Tat transactivation activity since neither MDDC maturation nor TNF-alpha production are found with either an oxidized Tat, which does not enter MDDC, or with a Tat protein mutated in the cysteine-rich region (cys22 Tat), which enters MDDC as the wild-type Tat but is transactivation silent. Consistently with these data, inoculation of monkeys with the native wild-type Tat induced a predominant Th1 response, whereas cys22 Tat generated mostly Th2 responses, therefore providing evidence that Tat induces a predominant Th1 polarized adaptive immune response in the host.
Mouser, Emily E I M; Pollakis, Georgios; Paxton, William A
2012-05-01
In many regions of the world, a high prevalence of HIV-1, helminthic and Mycobacterium tuberculosis (Mtb) infections can be found. Here, we summarize the types of immune responses induced and/or modulated by these pathogens and the consequences for HIV-1 disease. Helminths predominantly induce strong T helper (Th) 2 cellular responses which are downregulated in chronic disease. The anatomical niche populated by helminths plays a key factor in the effect these parasites have on HIV-1 transmission and subsequent replication. Gut-associated helminths have been found to increase HIV-1 transmission via the lesions they provide. In spite of this, the many immune modulatory molecules secreted by the parasites may inhibit or slow HIV-1 infection. In contrast, Mtb is mainly restricted to the lung and the Mtb-specific Th cells induced are highly susceptible to HIV-1 infection and replication. Antigens from both pathogens have immunomodulatory activity that can skew cellular immune responses in specific directions. The effect of helminths and Mtb on modulating immune responses is varied and complex with both their location and phenotype potentially influencing HIV-1 disease. These pathogens have evolved a complex array of molecules which have the capacity to modulate immunity and preserve pathogen survival.
The Immune System of HIV-Exposed Uninfected Infants.
Abu-Raya, Bahaa; Kollmann, Tobias R; Marchant, Arnaud; MacGillivray, Duncan M
2016-01-01
Infants born to human immunodeficiency virus (HIV) infected women are HIV-exposed but the majority remains uninfected [i.e., HIV-exposed uninfected (HEU)]. HEU infants suffer greater morbidity and mortality from infections compared to HIV-unexposed (HU) peers. The reason(s) for these worse outcomes are uncertain, but could be related to an altered immune system state. This review comprehensively summarizes the current literature investigating the adaptive and innate immune system of HEU infants. HEU infants have altered cell-mediated immunity, including impaired T-cell maturation with documented hypo- as well as hyper-responsiveness to T-cell activation. And although prevaccination vaccine-specific antibody levels are often lower in HEU than HU, most HEU infants mount adequate humoral immune response following primary vaccination with diphtheria toxoid, haemophilus influenzae type b, whole cell pertussis, measles, hepatitis B, tetanus toxoid, and pneumococcal conjugate vaccines. However, HEU infants are often found to have lower absolute neutrophil counts as compared to HU infants. On the other hand, an increase of innate immune cytokine production and expression of co-stimulatory markers has been noted in HEU infants, but this increase appears to be restricted to the first few weeks of life. The immune system of HEU children beyond infancy remains largely unexplored.
Viegas, Edna Omar; Tembe, Nelson; Nilsson, Charlotta; Meggi, Bindiya; Maueia, Cremildo; Augusto, Orvalho; Stout, Richard; Scarlatti, Gabriella; Ferrari, Guido; Earl, Patricia L; Wahren, Britta; Andersson, Sören; Robb, Merlin L; Osman, Nafissa; Biberfeld, Gunnel; Jani, Ilesh; Sandström, Eric
2017-11-27
We assessed the safety and immunogenicity of HIV-DNA priming using Zetajet™, a needle-free device intradermally followed by intramuscular HIV-MVA boosts, in 24 healthy Mozambicans. Volunteers were randomized to receive three immunizations of 600 μg (n = 10; 2 × 0.1 ml) or 1,200 μg (n = 10; 2 × 0.2 ml) of HIV-DNA (3 mg/ml), followed by two boosts of 10 8 pfu HIV-MVA. Four subjects received placebo saline injections. Vaccines and injections were safe and well tolerated with no difference between the two priming groups. After three HIV-DNA immunizations, IFN-γ ELISpot responses to Gag were detected in 9/17 (53%) vaccinees, while none responded to Envelope (Env). After the first HIV-MVA, the overall response rate to Gag and/or Env increased to 14/15 (93%); 14/15 (93%) to Gag and 13/15 (87%) to Env. There were no significant differences between the immunization groups in frequency of response to Gag and Env or magnitude of Gag responses. Env responses were significantly higher in the higher dose group (median 420 vs. 157.5 SFC/million peripheral blood mononuclear cell, p = .014). HIV-specific antibodies to subtype C gp140 and subtype B gp160 were elicited in all vaccinees after the second HIV-MVA, without differences in titers between the groups. Neutralizing antibody responses were not detected. Two (13%) of 16 vaccinees, one in each of the priming groups, exhibited antibodies mediating antibody-dependent cellular cytotoxicity to CRF01_AE. In conclusion, HIV-DNA vaccine delivered intradermally in volumes of 0.1-0.2 ml using Zetajet was safe and well tolerated. Priming with the 1,200 μg dose of HIV-DNA generated higher magnitudes of ELISpot responses to Env.
Luzuriaga, Katherine; Tabak, Barbara; Garber, Manuel; Chen, Ya Hui; Ziemniak, Carrie; McManus, Margaret M.; Murray, Danielle; Strain, Matthew C.; Richman, Douglas D.; Chun, Tae-Wook; Cunningham, Coleen K.; Persaud, Deborah
2014-01-01
Background. Early initiation of combination antiretroviral therapy (cART) to human immunodeficiency virus type 1 (HIV-1)–infected infants controls HIV-1 replication and reduces mortality. Methods. Plasma viremia (lower limit of detection, <2 copies/mL), T-cell activation, HIV-1–specific immune responses, and the persistence of cells carrying replication-competent virus were quantified during long-term effective combination antiretroviral therapy (cART) in 4 perinatally HIV-1–infected youth who received treatment early (the ET group) and 4 who received treatment late (the LT group). Decay in peripheral blood mononuclear cell (PBMC) proviral DNA levels was also measured over time in the ET youth. Results. Plasma viremia was not detected in any ET youth but was detected in all LT youth (median, 8 copies/mL; P = .03). PBMC proviral load was significantly lower in ET youth (median, 7 copies per million PBMCs) than in LT youth (median, 181 copies; P = .03). Replication-competent virus was recovered from all LT youth but only 1 ET youth. Decay in proviral DNA was noted in all 4 ET youth in association with limited T-cell activation and with absent to minimal HIV-1–specific immune responses. Conclusions. Initiation of early effective cART during infancy significantly limits circulating levels of proviral and replication-competent HIV-1 and promotes continuous decay of viral reservoirs. Continued cART with reduction in HIV-1 reservoirs over time may facilitate HIV-1 eradication strategies. PMID:24850788
HIV-1 and hijacking of the host immune system: the current scenario.
Imran, Muhammad; Manzoor, Sobia; Saalim, Muhammad; Resham, Saleha; Ashraf, Javed; Javed, Aneela; Waqar, Ahmed Bilal
2016-10-01
Human immunodeficiency virus (HIV) infection is a major health burden across the world which leads to the development of acquired immune deficiency syndrome (AIDS). This review article discusses the prevalence of HIV, its major routes of transmission, natural immunity, and evasion from the host immune system. HIV is mostly prevalent in Sub-Saharan Africa and low income countries. It is mostly transmitted by sharing syringe needles, blood transfusion, and sexual routes. The host immune system is categorized into three main types; the innate, the adaptive, and the intrinsic immune system. Regarding the innate immune system against HIV, the key players are mucosal membrane, dendritic cells (DCs), complement system, interferon, and host Micro RNAs. The major components of the adaptive immune system exploited by HIV are T cells mainly CD4+ T cells and B cells. The intrinsic immune system confronted by HIV involves (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G) APOBEC3G, tripartite motif 5-α (TRIM5a), terherin, and (SAM-domain HD-domain containing protein) SAMHD1. HIV-1 efficiently interacts with the host immune system, exploits the host machinery, successfully replicates and transmits from one cell to another. Further research is required to explore evasion strategies of HIV to develop novel therapeutic approaches against HIV. © 2016 APMIS. Published by John Wiley & Sons Ltd.
Thiazolides Elicit Anti-Viral Innate Immunity and Reduce HIV Replication.
Trabattoni, Daria; Gnudi, Federica; Ibba, Salomè V; Saulle, Irma; Agostini, Simone; Masetti, Michela; Biasin, Mara; Rossignol, Jean-Francois; Clerici, Mario
2016-06-02
Nitazoxanide (Alinia(®), NTZ) and tizoxanide (TIZ), its active circulating metabolite, belong to a class of agents known as thiazolides (TZD) endowed with broad anti-infective activities. TIZ and RM-4848, the active metabolite of RM-5038, were shown to stimulate innate immunity in vitro. Because natural resistance to HIV-1 infection in HIV-exposed seronegative (HESN) individuals is suggested to be associated with strong innate immune responses, we verified whether TIZ and RM-4848 could reduce the in vitro infectiousness of HIV-1. Peripheral blood mononuclear cells (PBMCs) from 20 healthy donors were infected in vitro with HIV-1BaL in the presence/absence of TIZ or RM4848. HIV-1 p24 were measured at different timepoints. The immunomodulatory abilities of TZD were evaluated by the expression of type I IFN pathway genes and the production of cytokines and chemokines. TZD drastically inhibited in vitro HIV-1 replication (>87%). This was associated with the activation of innate immune responses and with the up-regulation of several interferon-stimulated genes (ISGs), including those involved in cholesterol pathway, particularly the cholesterol-25 hydroxylase (CH25H). TZD inhibition of HIV-1 replication in vitro could be due to their ability to stimulate potent and multifaceted antiviral immune responses. These data warrant the exploration of TZD as preventive/therapeutic agent in HIV infection.
Papasavvas, Emmanouil; Foulkes, Andrea; Yin, Xiangfan; Joseph, Jocelin; Ross, Brian; Azzoni, Livio; Kostman, Jay R; Mounzer, Karam; Shull, Jane; Montaner, Luis J
2015-07-01
The identification of immune correlates of HIV control is important for the design of immunotherapies that could support cure or antiretroviral therapy (ART) intensification-related strategies. ART interruptions may facilitate this task through exposure of an ART partially reconstituted immune system to endogenous virus. We investigated the relationship between set-point plasma HIV viral load (VL) during an ART interruption and innate/adaptive parameters before or after interruption. Dendritic cell (DC), natural killer (NK) cell and HIV Gag p55-specific T-cell functional responses were measured in paired cryopreserved peripheral blood mononuclear cells obtained at the beginning (on ART) and at set-point of an open-ended interruption from 31 ART-suppressed chronically HIV-1(+) patients. Spearman correlation and linear regression modeling were used. Frequencies of plasmacytoid DC (pDC), and HIV Gag p55-specific CD3(+) CD4(-) perforin(+) IFN-γ(+) cells at the beginning of interruption associated negatively with set-point plasma VL. Inclusion of both variables with interaction into a model resulted in the best fit (adjusted R(2) = 0·6874). Frequencies of pDC or HIV Gag p55-specific CD3(+) CD4(-) CSFE(lo) CD107a(+) cells at set-point associated negatively with set-point plasma VL. The dual contribution of pDC and anti-HIV T-cell responses to viral control, supported by our models, suggests that these variables may serve as immune correlates of viral control and could be integrated in cure or ART-intensification strategies. © 2015 John Wiley & Sons Ltd.
Current understanding of HIV-1 and T-cell adaptive immunity: progress to date.
Mohan, Teena; Bhatnagar, Santwana; Gupta, Dablu L; Rao, D N
2014-08-01
The cellular immune response to human immunodeficiency virus (HIV) has different components originating from both the adaptive and innate immune systems. HIV cleverly utilizes the host machinery to survive by its intricate nature of interaction with the host immune system. HIV evades the host immune system at innate ad adaptive, allows the pathogen to replicate and transmit from one host to another. Researchers have shown that HIV has multipronged effects especially on the adaptive immunity, with CD4(+) cells being the worst effect T-cell populations. Various analyses have revealed that, the exposure to HIV results in clonal expansion and excessive activation of the immune system. Also, an abnormal process of differentiation has been observed suggestive of an alteration and blocks in the maturation of various T-cell subsets. Additionally, HIV has shown to accelerate immunosenescence and exhaustion of the overtly activated T-cells. Apart from causing phenotypic changes, HIV has adverse effects on the functional aspect of the immune system, with evidences implicating it in the loss of the capacity of T-cells to secrete various antiviral cytokines and chemokines. However, there continues to be many aspects of the immune- pathogenesis of HIV that are still unknown and thus required further research in order to convert the malaise of HIV into a manageable epidemic. Copyright © 2014 Elsevier Ltd. All rights reserved.
Li, Jonathan Z.; Heisey, Andrea; Ahmed, Hayat; Wang, Hongying; Zheng, Lu; Carrington, Mary; Wrin, Terri; Schooley, Robert T.; Lederman, Michael M.; Kuritzkes, Daniel R.
2014-01-01
Objectives To evaluate the impact of therapeutic HIV vaccination on the HIV reservoir, and assess the relationship of the viral reservoir with HIV-specific immune status and viral rebound kinetics. Design Retrospective analysis of ACTG A5197, a randomized, placebo-controlled trial of a therapeutic rAd5 HIV-1 gag vaccine. Methods Participants received vaccine/placebo at weeks 0, 4, and 26 prior to a 16-week analytic treatment interruption (ATI) at week 38. Cell-associated HIV-1 RNA and DNA (CA-RNA and CA-DNA) and HIV-1 residual viremia (RV) were quantified at weeks 0, 8, and 38. HIV-specific CD4+/CD8+ activity were assessed by an intracellular cytokine staining assay. Results At study entry, CA-RNA and CA-DNA levels were correlated inversely with the numbers of HIV-specific CD4+ interferon-γ-producing cells (CA-RNA: r = −0.23, P=0.03 and CA-DNA: r = −0.28, P<0.01, N=93). Therapeutic HIV vaccination induced HIV-specific CD4+ activity, but did not significantly affect levels of CA-RNA or CA-DNA. Vaccine recipients with undetectable RV at week 8 had higher frequencies of HIV-specific CD4+ and CD8+ interferon-γ-producing cells (undetectable versus detectable RV: 277 versus 161 CD4+ cells/106 lymphocytes, P=0.03 and 1326 versus 669 CD8+ cells/106 lymphocytes, P=0.04). Pre-ATI CA-RNA and CA-DNA were associated with post-ATI plasma HIV set point (CA-RNA: r = 0.51, P<0.01 and CA-DNA: r = 0.47, P<0.01). Conclusions Vaccine-induced T-cell responses were associated with a modest transient effect on RV, but more potent immune responses and/or combination treatment with latency-reversing agents are needed to reduce the HIV reservoir. HIV reservoir measures may act as biomarkers of post-ATI viral rebound kinetics. PMID:25254301
Boosting of HIV-1 Neutralizing Antibody Responses by a Distally Related Retroviral Envelope Protein
Uchtenhagen, Hannes; Schiffner, Torben; Bowles, Emma; Heyndrickx, Leo; LaBranche, Celia; Applequist, Steven E.; Jansson, Marianne; De Silva, Thushan; Back, Jaap Willem; Achour, Adnane; Scarlatti, Gabriella; Fomsgaard, Anders; Montefiori, David; Stewart-Jones, Guillaume; Spetz, Anna-Lena
2014-01-01
Our knowledge of the binding sites for neutralizing antibodies (NAbs) that recognize a broad range of HIV-1 strains (bNAb) has substantially increased in recent years. However, gaps remain in our understanding of how to focus B-cell responses to vulnerable conserved sites within the HIV-1 envelope glycoprotein (Env). Here we report an immunization strategy composed of a trivalent HIV-1 (clade B envs) DNA prime, followed by a SIVmac239 gp140 Env protein boost that aimed to focus the immune response to structurally conserved parts of the HIV-1 and SIV Envs. Heterologous NAb titres, primarily to tier 1 HIV-1 isolates, elicited during the trivalent HIV-1 env prime, were significantly increased by the SIVmac239 gp140 protein boost in rabbits. Epitope mapping of antibody binding reactivity revealed preferential recognition of the C1, C2, V2, V3 and V5 regions. These results provide a proof of concept that a distally related retroviral SIV Env protein boost can increase pre-existing NAb responses against HIV-1. PMID:24829409
High-resolution definition of humoral immune response correlates of effective immunity against HIV.
Alter, Galit; Dowell, Karen G; Brown, Eric P; Suscovich, Todd J; Mikhailova, Anastassia; Mahan, Alison E; Walker, Bruce D; Nimmerjahn, Falk; Bailey-Kellogg, Chris; Ackerman, Margaret E
2018-03-26
Defining correlates of immunity by comprehensively interrogating the extensive biological diversity in naturally or experimentally protected subjects may provide insights critical for guiding the development of effective vaccines and antibody-based therapies. We report advances in a humoral immunoprofiling approach and its application to elucidate hallmarks of effective HIV-1 viral control. Systematic serological analysis for a cohort of HIV-infected subjects with varying viral control was conducted using both a high-resolution, high-throughput biophysical antibody profiling approach, providing unbiased dissection of the humoral response, along with functional antibody assays, characterizing antibody-directed effector functions such as complement fixation and phagocytosis that are central to protective immunity. Profiles of subjects with varying viral control were computationally analyzed and modeled in order to deconvolute relationships among IgG Fab properties, Fc characteristics, and effector functions and to identify humoral correlates of potent antiviral antibody-directed effector activity and effective viral suppression. The resulting models reveal multifaceted and coordinated contributions of polyclonal antibodies to diverse antiviral responses, and suggest key biophysical features predictive of viral control. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.
Envelope-specific antibodies and antibody-derived molecules for treating and curing HIV infection
Ferrari, Guido; Haynes, Barton F.; Koenig, Scott; Nordstrom, Jeffrey L.; Margolis, David M.; Tomaras, Georgia D.
2017-01-01
HIV-1 is a retrovirus that integrates into host chromatin and can remain transcriptionally quiescent in a pool of immune cells. This characteristic enables HIV-1 to evade both host immune responses and antiretroviral drugs, leading to persistent infection. Upon reactivation of proviral gene expression, HIV-1 envelope (HIV-1 Env) glycoproteins are expressed on the cell surface, transforming latently infected cells into targets for HIV-1 Env-specific monoclonal antibodies (mAbs), which can engage immune effector cells to kill productively infected CD4+ T cells and thus limit the spread of progeny virus. Recent innovations in antibody engineering have resulted in novel immunotherapeutics such as bispecific dual-affinity re-targeting (DART) molecules and other bi- and trispecific antibody designs that can recognize HIV-1 Env and recruit cytotoxic effector cells to kill CD4+ T cells latently infected with HIV‑1. Here, we review these immunotherapies, which are designed with the goal of curing HIV-1 infection. PMID:27725635
Iwajomo, Oluwadamilola H; Finn, Adam; Ogunniyi, Abiodun D; Williams, Neil A; Heyderman, Robert S
2013-01-01
Pneumococcal disease is associated with a particularly high morbidity and mortality amongst adults in HIV endemic countries. Our previous findings implicating a B-cell defect in HIV-infected children from the same population led us to comprehensively characterize B-cell subsets in minimally symptomatic HIV-infected Malawian adults and investigate the isotype-switched IgG memory B-cell immune response to the pneumococcus. We show that similar to vertically acquired HIV-infected Malawian children, horizontally acquired HIV infection in these adults is associated with IgM memory B-cell (CD19(+) CD27(+) IgM(+) IgD(+)) depletion, B-cell activation and impairment of specific IgG B-cell memory to a range of pneumococcal proteins. Our data suggest that HIV infection affects both T-cell independent and T-cell dependent B-cell maturation, potentially leading to impairment of humoral responses to extracellular pathogens such as the pneumococcus, and thus leaving this population susceptible to invasive disease.
Structure and immune recognition of trimeric pre-fusion HIV-1 Env
Pancera, Marie; Zhou, Tongqing; Druz, Aliaksandr; ...
2014-10-08
The human immunodeficiency virus type 1 (HIV-1) envelope (Env) spike, comprising three gp120 and three gp41 subunits, is a conformational machine that facilitates HIV-1 entry by rearranging from a mature unliganded state, through receptor-bound intermediates, to a post-fusion state. As the sole viral antigen on the HIV-1 virion surface, Env is both the target of neutralizing antibodies and a focus of vaccine efforts. Here we report the structure at 3.5 Å resolution for an HIV-1 Env trimer captured in a mature closed state by antibodies PGT122 and 35O22. This structure reveals the pre-fusion conformation of gp41, indicates rearrangements needed formore » fusion activation, and defines parameters of immune evasion and immune recognition. Pre-fusion gp41 encircles amino- and carboxy-terminal strands of gp120 with four helices that form a membrane-proximal collar, fastened by insertion of a fusion peptide-proximal methionine into a gp41-tryptophan clasp. Spike rearrangements required for entry involve opening the clasp and expelling the termini. In conclusion, N-linked glycosylation and sequence-variable regions cover the pre-fusion closed spike; we used chronic cohorts to map the prevalence and location of effective HIV-1-neutralizing responses, which were distinguished by their recognition of N-linked glycan and tolerance for epitope-sequence variation.« less
Structure and immune recognition of trimeric pre-fusion HIV-1 Env
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pancera, Marie; Zhou, Tongqing; Druz, Aliaksandr
The human immunodeficiency virus type 1 (HIV-1) envelope (Env) spike, comprising three gp120 and three gp41 subunits, is a conformational machine that facilitates HIV-1 entry by rearranging from a mature unliganded state, through receptor-bound intermediates, to a post-fusion state. As the sole viral antigen on the HIV-1 virion surface, Env is both the target of neutralizing antibodies and a focus of vaccine efforts. Here we report the structure at 3.5 Å resolution for an HIV-1 Env trimer captured in a mature closed state by antibodies PGT122 and 35O22. This structure reveals the pre-fusion conformation of gp41, indicates rearrangements needed formore » fusion activation, and defines parameters of immune evasion and immune recognition. Pre-fusion gp41 encircles amino- and carboxy-terminal strands of gp120 with four helices that form a membrane-proximal collar, fastened by insertion of a fusion peptide-proximal methionine into a gp41-tryptophan clasp. Spike rearrangements required for entry involve opening the clasp and expelling the termini. In conclusion, N-linked glycosylation and sequence-variable regions cover the pre-fusion closed spike; we used chronic cohorts to map the prevalence and location of effective HIV-1-neutralizing responses, which were distinguished by their recognition of N-linked glycan and tolerance for epitope-sequence variation.« less
Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.
VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H
1996-04-01
Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.
Goepfert, Paul A.; Elizaga, Marnie L.; Seaton, Kelly; Tomaras, Georgia D.; Montefiori, David C.; Sato, Alicia; Hural, John; DeRosa, Stephen C.; Kalams, Spyros A.; McElrath, M. Juliana; Keefer, Michael C.; Baden, Lindsey R.; Lama, Javier R.; Sanchez, Jorge; Mulligan, Mark J.; Buchbinder, Susan P.; Hammer, Scott M.; Koblin, Beryl A.; Pensiero, Michael; Butler, Chris; Moss, Bernard; Robinson, Harriet L.; Donastorg, Yeycy; Qin, Li; Lawrence, Dale; Cardinali, Massimo; Bae, Jin; Holt, Renée; Redinger, Huguette; Johannessen, Jan; Broder, Gail; Moody-White, Jerri; McKay, Butch; Calazans, Gabriela; Bentley, Carter; Kakinami, Lisa; Skibinski, Katie; Estep, Scharla; Tseng, Jenny; Swenson, Molly; Madenwald, Tamra; Overton, Edgar Turner; Edupuganti, Srilatha; Rouphael, Nadine; Whitaker, Jennifer; Hay, C Mhorag; Bunce, Catherine A; Gonzales, Pedro; Hurtado, Juan Carlos; Dolin, Raphael; Mayer, Ken; Walsh, Steven; Johnson, Jennifer
2014-01-01
Background. Clade B DNA and recombinant modified vaccinia Ankara (MVA) vaccines producing virus-like particles displaying trimeric membrane-bound envelope glycoprotein (Env) were tested in a phase 2a trial in human immunodeficiency virus (HIV)–uninfected adults for safety, immunogenicity, and 6-month durability of immune responses. Methods. A total of 299 individuals received 2 doses of JS7 DNA vaccine and 2 doses of MVA/HIV62B at 0, 2, 4, and 6 months, respectively (the DDMM regimen); 3 doses of MVA/HIV62B at 0, 2, and 6 months (the MMM regimen); or placebo injections. Results. At peak response, 93.2% of the DDMM group and 98.4% of the MMM group had binding antibodies for Env. These binding antibodies were more frequent and of higher magnitude for the transmembrane subunit (gp41) than the receptor-binding subunit (gp120) of Env. For both regimens, response rates were higher for CD4+ T cells (66.4% in the DDMM group and 43.1% in the MMM group) than for CD8+ T cells (21.8% in the DDMM group and 14.9% in the MMM group). Responding CD4+ and CD8+ T cells were biased toward Gag, and >70% produced 2 or 3 of the 4 cytokines evaluated (ie, interferon γ, interleukin 2, tumor necrosis factor α, and granzyme B). Six months after vaccination, the magnitudes of antibodies and T-cell responses had decreased by <3-fold. Conclusions. DDMM and MMM vaccinations with virus-like particle–expressing immunogens elicited durable antibody and T-cell responses. PMID:24403557
Breaching peripheral tolerance promotes the production of HIV-1–neutralizing antibodies
Schroeder, Kristin M.S.; Harper, Michael S.; Santiago, Mario L.
2017-01-01
A subset of characterized HIV-1 broadly neutralizing antibodies (bnAbs) are polyreactive with additional specificities for self-antigens and it has been proposed immunological tolerance may present a barrier to their participation in protective humoral immunity. We address this hypothesis by immunizing autoimmune-prone mice with HIV-1 Envelope (Env) and characterizing the primary antibody response for HIV-1 neutralization. We find autoimmune mice generate neutralizing antibody responses to tier 2 HIV-1 strains with alum treatment alone in the absence of Env. Importantly, experimentally breaching immunological tolerance in wild-type mice also leads to the production of tier 2 HIV-1–neutralizing antibodies, which increase in breadth and potency following Env immunization. In both genetically prone and experimentally induced mouse models of autoimmunity, increased serum levels of IgM anti-histone H2A autoantibodies significantly correlated with tier 2 HIV-1 neutralization, and anti-H2A antibody clones were found to neutralize HIV-1. These data demonstrate that breaching peripheral tolerance permits a cross-reactive HIV-1 autoantibody response able to neutralize HIV-1. PMID:28698284
Marlin, Romain; Nugeyre, Marie-Thérèse; Tchitchek, Nicolas; Parenti, Matteo; Hocini, Hakim; Benjelloun, Fahd; Cannou, Claude; Dereuddre-Bosquet, Nathalie; Levy, Yves; Barré-Sinoussi, Françoise; Scarlatti, Gabriella; Le Grand, Roger; Menu, Elisabeth
2017-09-01
The female reproductive tract (FRT) is one of the major mucosal invasion sites for HIV-1. This site has been neglected in previous HIV-1 vaccine studies. Immune responses in the FRT after systemic vaccination remain to be characterized. Using a modified vaccinia virus Ankara (MVA) as a vaccine model, we characterized specific immune responses in all compartments of the FRT of nonhuman primates after systemic vaccination. Memory T cells were preferentially found in the lower tract (vagina and cervix), whereas APCs and innate lymphoid cells were mainly located in the upper tract (uterus and fallopian tubes). This compartmentalization of immune cells in the FRT was supported by transcriptomic analyses and a correlation network. Polyfunctional MVA-specific CD8 + T cells were detected in the blood, lymph nodes, vagina, cervix, uterus, and fallopian tubes. Anti-MVA IgG and IgA were detected in cervicovaginal fluid after a second vaccine dose. Thus, systemic vaccination with an MVA vector elicits cellular and Ab responses in the FRT. Copyright © 2017 by The American Association of Immunologists, Inc.
Fouda, Genevieve G.; Yates, Nicole L.; Pollara, Justin; Shen, Xiaoying; Overman, Glenn R.; Mahlokozera, Tatenda; Wilks, Andrew B.; Kang, Helen H.; Salazar-Gonzalez, Jesus F.; Salazar, Maria G.; Kalilani, Linda; Meshnick, Steve R.; Hahn, Beatrice H.; Shaw, George M.; Lovingood, Rachel V.; Denny, Thomas N.; Haynes, Barton; Letvin, Norman L.; Ferrari, Guido; Montefiori, David C.; Tomaras, Georgia D.; Permar, Sallie R.
2011-01-01
Despite months of mucosal virus exposure, the majority of breastfed infants born to HIV-infected mothers do not become infected, raising the possibility that immune factors in milk inhibit mucosal transmission of HIV. HIV Envelope (Env)-specific antibodies are present in the milk of HIV-infected mothers, but little is known about their virus-specific functions. In this study, HIV Env-specific antibody binding, autologous and heterologous virus neutralization, and antibody-dependent cell cytotoxicity (ADCC) responses were measured in the milk and plasma of 41 HIV-infected lactating women. Although IgA is the predominant antibody isotype in milk, HIV Env-specific IgG responses were higher in magnitude than HIV Env-specific IgA responses in milk. The concentrations of anti-HIV gp120 IgG in milk and plasma were directly correlated (r = 0.75; P < 0.0001), yet the response in milk was 2 logarithm units lower than in plasma. Similarly, heterologous virus neutralization (r = 0.39; P = 0.010) and ADCC activity (r = 0.64; P < 0.0001) in milk were directly correlated with that in the systemic compartment but were 2 log units lower in magnitude. Autologous neutralization was rarely detected in milk. Milk heterologous virus neutralization titers correlated with HIV gp120 Env-binding IgG responses but not with IgA responses (r = 0.71 and P < 0.0001, and r = 0.17 and P = 0.30). Moreover, IgGs purified from milk and plasma had equal neutralizing potencies against a tier 1 virus (r = 0.65; P < 0.0001), whereas only 1 out of 35 tested non-IgG milk fractions had detectable neutralization. These results suggest that plasma-derived IgG antibodies mediate the majority of the low-level HIV neutralization and ADCC activity in breast milk. PMID:21734046
Physical Theory of the Competition that Allows HIV to Escape from the Immune System
NASA Astrophysics Data System (ADS)
Wang, Guanyu; Deem, Michael W.
2006-11-01
Competition within the immune system may degrade immune control of viral infections. We formalize the evolution that occurs in both HIV-1 and the immune system quasispecies. Inclusion of competition in the immune system leads to a novel balance between the immune response and HIV-1, in which the eventual outcome is HIV-1 escape rather than control. The analytical model reproduces the three stages of HIV-1 infection. We propose a vaccine regimen that may be able to reduce competition between T cells, potentially eliminating the third stage of HIV-1.
Santana, Vinicius C; Diniz, Mariana O; Cariri, Francisco A M O; Ventura, Armando M; Cunha-Neto, Edécio; Almeida, Rafael R; Campos, Marco A; Lima, Graciela K; Ferreira, Luís C S
2013-01-01
Millions of people worldwide are currently infected with human papillomavirus (HPV), herpes simplex virus (HSV) or human immunodeficiency virus (HIV). For this enormous contingent of people, the search for preventive and therapeutic immunological approaches represents a hope for the eradication of latent infection and/or virus-associated cancer. To date, attempts to develop vaccines against these viruses have been mainly based on a monovalent concept, in which one or more antigens of a virus are incorporated into a vaccine formulation. In the present report, we designed and tested an immunization strategy based on DNA vaccines that simultaneously encode antigens for HIV, HSV and HPV. With this purpose in mind, we tested two bicistronic DNA vaccines (pIRES I and pIRES II) that encode the HPV-16 oncoprotein E7 and the HIV protein p24 both genetically fused to the HSV-1 gD envelope protein. Mice i.m. immunized with the DNA vaccines mounted antigen-specific CD8⁺ T cell responses, including in vivo cytotoxic responses, against the three antigens. Under experimental conditions, the vaccines conferred protective immunity against challenges with a vaccinia virus expressing the HIV-derived protein Gag, an HSV-1 virus strain and implantation of tumor cells expressing the HPV-16 oncoproteins. Altogether, our results show that the concept of a trivalent HIV, HSV, and HPV vaccine capable to induce CD8⁺ T cell-dependent responses is feasible and may aid in the development of preventive and/or therapeutic approaches for the control of diseases associated with these viruses.
Boosting of HIV-1 neutralizing antibody responses by a distally related retroviral envelope protein.
Uchtenhagen, Hannes; Schiffner, Torben; Bowles, Emma; Heyndrickx, Leo; LaBranche, Celia; Applequist, Steven E; Jansson, Marianne; De Silva, Thushan; Back, Jaap Willem; Achour, Adnane; Scarlatti, Gabriella; Fomsgaard, Anders; Montefiori, David; Stewart-Jones, Guillaume; Spetz, Anna-Lena
2014-06-15
Our knowledge of the binding sites for neutralizing Abs (NAb) that recognize a broad range of HIV-1 strains (bNAb) has substantially increased in recent years. However, gaps remain in our understanding of how to focus B cell responses to vulnerable conserved sites within the HIV-1 envelope glycoprotein (Env). In this article, we report an immunization strategy composed of a trivalent HIV-1 (clade B envs) DNA prime, followed by a SIVmac239 gp140 Env protein boost that aimed to focus the immune response to structurally conserved parts of the HIV-1 and simian immunodeficiency virus (SIV) Envs. Heterologous NAb titers, primarily to tier 1 HIV-1 isolates, elicited during the trivalent HIV-1 env prime, were significantly increased by the SIVmac239 gp140 protein boost in rabbits. Epitope mapping of Ab-binding reactivity revealed preferential recognition of the C1, C2, V2, V3, and V5 regions. These results provide a proof of concept that a distally related retroviral SIV Env protein boost can increase pre-existing NAb responses against HIV-1. Copyright © 2014 by The American Association of Immunologists, Inc.
Li, Guangming; Cheng, Menglan; Nunoya, Jun-ichi; Cheng, Liang; Guo, Haitao; Yu, Haisheng; Liu, Yong-jun; Su, Lishan; Zhang, Liguo
2014-01-01
The role of plasmacytoid dendritic cells (pDC) in human immunodeficiency virus type 1 (HIV-1) infection and pathogenesis remains unclear. HIV-1 infection in the humanized mouse model leads to persistent HIV-1 infection and immunopathogenesis, including type I interferons (IFN-I) induction, immune-activation and depletion of human leukocytes, including CD4 T cells. We developed a monoclonal antibody that specifically depletes human pDC in all lymphoid organs in humanized mice. When pDC were depleted prior to HIV-1 infection, the induction of IFN-I and interferon-stimulated genes (ISGs) were abolished during acute HIV-1 infection with either a highly pathogenic CCR5/CXCR4-dual tropic HIV-1 or a standard CCR5-tropic HIV-1 isolate. Consistent with the anti-viral role of IFN-I, HIV-1 replication was significantly up-regulated in pDC-depleted mice. Interestingly, the cell death induced by the highly pathogenic HIV-1 isolate was severely reduced in pDC-depleted mice. During chronic HIV-1 infection, depletion of pDC also severely reduced the induction of IFN-I and ISGs, associated with elevated HIV-1 replication. Surprisingly, HIV-1 induced depletion of human immune cells including T cells in lymphoid organs, but not the blood, was reduced in spite of the increased viral replication. The increased cell number in lymphoid organs was associated with a reduced level of HIV-induced cell death in human leukocytes including CD4 T cells. We conclude that pDC play opposing roles in suppressing HIV-1 replication and in promoting HIV-1 induced immunopathogenesis. These findings suggest that pDC-depletion and IFN-I blockade will provide novel strategies for treating those HIV-1 immune non-responsive patients with persistent immune activation despite effective anti-retrovirus treatment. PMID:25077616
Pandemic HIV-1 Vpu overcomes intrinsic herd immunity mediated by tetherin.
Iwami, Shingo; Sato, Kei; Morita, Satoru; Inaba, Hisashi; Kobayashi, Tomoko; Takeuchi, Junko S; Kimura, Yuichi; Misawa, Naoko; Ren, Fengrong; Iwasa, Yoh; Aihara, Kazuyuki; Koyanagi, Yoshio
2015-07-17
Among the four groups of HIV-1 (M, N, O, and P), HIV-1M alone is pandemic and has rapidly expanded across the world. However, why HIV-1M has caused a devastating pandemic while the other groups remain contained is unclear. Interestingly, only HIV-1M Vpu, a viral protein, can robustly counteract human tetherin, which tethers budding virions. Therefore, we hypothesize that this property of HIV-1M Vpu facilitates human-to-human viral transmission. Adopting a multilayered experimental-mathematical approach, we demonstrate that HIV-1M Vpu confers a 2.38-fold increase in the prevalence of HIV-1 transmission. When Vpu activity is lost, protected human populations emerge (i.e., intrinsic herd immunity develops) through the anti-viral effect of tetherin. We also reveal that all Vpus of transmitted/founder HIV-1M viruses maintain anti-tetherin activity. These findings indicate that tetherin plays the role of a host restriction factor, providing 'intrinsic herd immunity', whereas Vpu has evolved in HIV-1M as a tetherin antagonist.
Immune Responses to HIV and SIV in Mucosal Tissues: “Location, Location, Location”
Shacklett, Barbara L.
2010-01-01
Purpose of review This review summarizes research literature regarding mucosal immunity to HIV and SIV, with an emphasis on work published within the past 18 months. Recent findings Notable recent studies have focused on the pivotal events occurring within mucosal tissues during acute HIV/SIV infection that serve to establish a balance between detrimental immune activation and beneficial adaptive responses. In cervicovaginal mucosa, an early inflammatory response leads to recruitment of susceptible target cells. At this acute stage, the in vivo ratio between CD8+ effector cells and infected CD4+ T-cells may be critical for limiting viral dissemination. Acute infection is also accompanied by loss of germinal center architecture and T/B cell apoptosis in Peyer’s patches of the gastrointestinal tract. During chronic infection, mucosal CD8+ T-cells may play a role in immune control, as suggested by studies of elite controllers. Summary Mucosal tissues serve as the major portal of entry for HIV, and house a majority of the body’s lymphocytes, including CD4+ T-cells that are targets for infection. Recent studies have focused renewed attention on events occurring immediately after transmission, and underscore the concept that the balance between inflammation and protective immunity is established by host responses in mucosal tissues. PMID:20543589
B cell responses to HIV infection
Moir, Susan; Fauci, Anthony S.
2016-01-01
Summary The induction of neutralizing antibodies directed against the human immunodeficiency virus (HIV) has received considerable attention in recent years, in part driven by renewed interest and opportunities for antibody-based strategies for prevention such as passive transfer of antibodies and the development of preventive vaccines, as well as immune-based therapeutic interventions. Advances in the ability to screen, isolate and characterize HIV-specific antibodies have led to the identification of a new generation of potent broadly neutralizing antibodies (bNAbs). The majority of these antibodies have been isolated from B cells of chronically HIV-infected individuals with detectable viremia. In this review, we provide insight into the phenotypic and functional attributes of human B cells, with a focus on HIV-specific memory B cells and plasmablasts/cells that are responsible for sustaining humoral immune responses against HIV. We discuss the abnormalities in B cells that occur in HIV infection both in the peripheral blood and lymphoid tissues, especially in the setting of persisting viremia. Finally, we consider the opportunities and drawbacks of intensively interrogating antibodies isolated from HIV-infected individuals to guide strategies aimed at developing effective antibody-based vaccine and therapeutic interventions for HIV. PMID:28133792
Goonetilleke, Nilu; Liu, Michael K. P.; Turnbull, Emma L.; Salazar-Gonzalez, Jesus F.; Hawkins, Natalie; Self, Steve; Watson, Sydeaka; Betts, Michael R.; Gay, Cynthia; McGhee, Kara; Pellegrino, Pierre; Williams, Ian; Tomaras, Georgia D.; Haynes, Barton F.; Gray, Clive M.; Borrow, Persephone; Roederer, Mario; McMichael, Andrew J.; Weinhold, Kent J.
2011-01-01
In the present study, we analyzed the functional profile of CD8+ T-cell responses directed against autologous transmitted/founder HIV-1 isolates during acute and early infection, and examined whether multifunctionality is required for selection of virus escape mutations. Seven anti-retroviral therapy-naïve subjects were studied in detail between 1 and 87 weeks following onset of symptoms of acute HIV-1 infection. Synthetic peptides representing the autologous transmitted/founder HIV-1 sequences were used in multiparameter flow cytometry assays to determine the functionality of HIV-1-specific CD8+ T memory cells. In all seven patients, the earliest T cell responses were predominantly oligofunctional, although the relative contribution of multifunctional cell responses increased significantly with time from infection. Interestingly, only the magnitude of the total and not of the poly-functional T-cell responses was significantly associated with the selection of escape mutants. However, the high contribution of MIP-1β-producing CD8+ T-cells to the total response suggests that mechanisms not limited to cytotoxicity could be exerting immune pressure during acute infection. Lastly, we show that epitope entropy, reflecting the capacity of the epitope to tolerate mutational change and defined as the diversity of epitope sequences at the population level, was also correlated with rate of emergence of escape mutants. PMID:21347345
Adenovirus vector-induced immune responses in nonhuman primates: responses to prime boost regimens1
Tatsis, Nia; Lasaro, Marcio O.; Lin, Shih-Wen; Xiang, Zhi Q.; Zhou, Dongming; DiMenna, Lauren; Li, Hua; Bian, Ang; Abdulla, Sarah; Li, Yan; Giles-Davis, Wynetta; Engram, Jessica; Ratcliffe, Sarah J.; Silvestri, Guido; Ertl, Hildegund C.; Betts, Michael R.
2009-01-01
In the phase IIb STEP trial an HIV-1 vaccine based on adenovirus (Ad) vectors of the human serotype 5 (AdHu5) not only failed to induce protection but also increased susceptibility to HIV-1 infection in individuals with pre-existing neutralizing antibodies against AdHu5. The mechanisms underlying the increased HIV-1 acquisition rates have not yet been elucidated. Furthermore, it remains unclear if the lack of the vaccine's efficacy reflects a failure of the concept of T cell-mediated protection against HIV-1 or a product failure of the vaccine. Here we compared two vaccine regimens based on sequential use of AdHu5 vectors or two different chimpanzee derived Ad (AdC) vectors in rhesus macaques that were AdHu5 seropositive or seronegative at the onset of vaccination. Our results show that heterologous booster immunizations with the AdC vectors induced higher T and B cell responses than repeated immunizations with the AdHu5 vector especially in AdHu5-pre-exposed macaques. PMID:19414814
New approaches to design HIV-1 T-cell vaccines.
Perrin, Hélène; Canderan, Glenda; Sékaly, Rafick-Pierre; Trautmann, Lydie
2010-09-01
Following the evidence that T-cell responses are crucial in the control of HIV-1 infection, vaccines targeting T-cell responses were tested in recent clinical trials. However, these vaccines showed a lack of efficacy. This review attempts to define the qualitative and quantitative features that are desirable for T-cell-induced responses by vaccines. We also describe strategies that could lead to achievement of this goal. Using the yellow fever vaccine as a benchmark of an efficient vaccine, recent studies identified factors of immune protection and more importantly innate immune pathways needed for the establishment of long-term protective adaptive immunity. To prevent or control HIV-1 infection, a vaccine must induce efficient and persistent antigen-specific T cells endowed with mucosal homing capacity. Such cells should have the capability to counteract HIV-1 diversity and its rapid spread from the initial site of infection. To achieve this goal, the activation of a diversified innate immune response is critical. New systems biology approaches will provide more precise correlates of immune protection that will pave the way for new approaches in T-cell-based vaccines.
The Immune Interaction between HIV-1 Infection and Mycobacterium tuberculosis.
Du Bruyn, Elsa; Wilkinson, Robert John
2016-12-01
The modulation of tuberculosis (TB)-induced immunopathology caused by human immunodeficiency virus (HIV)-1 coinfection remains incompletely understood but underlies the change seen in the natural history, presentation, and prognosis of TB in such patients. The deleterious combination of these two pathogens has been dubbed a "deadly syndemic," with each favoring the replication of the other and thereby contributing to accelerated disease morbidity and mortality. HIV-1 is the best-recognized risk factor for the development of active TB and accounts for 13% of cases globally. The advent of combination antiretroviral therapy (ART) has considerably mitigated this risk. Rapid roll-out of ART globally and the recent recommendation by the World Health Organization (WHO) to initiate ART for everyone living with HIV at any CD4 cell count should lead to further reductions in HIV-1-associated TB incidence because susceptibility to TB is inversely proportional to CD4 count. However, it is important to note that even after successful ART, patients with HIV-1 are still at increased risk for TB. Indeed, in settings of high TB incidence, the occurrence of TB often remains the first presentation of, and thereby the entry into, HIV care. As advantageous as ART-induced immune recovery is, it may also give rise to immunopathology, especially in the lower-CD4-count strata in the form of the immune reconstitution inflammatory syndrome. TB-immune reconstitution inflammatory syndrome will continue to impact the HIV-TB syndemic.
Stuehler, Claudia; Bernardini, Claudia; Elzi, Luigia; Stoeckle, Marcel; Zimmerli, Stefan; Furrer, Hansjakob; Günthard, Huldrych F.; Leibundgut-Landmann, Salomé; Battegay, Manuel; Khanna, Nina
2016-01-01
Objective: Candida esophagitis belongs to the most common AIDS-defining diseases; however, a comprehensive immune pathogenic concept is lacking. Design: We investigated the immune status of 37 HIV-1-infected patients from the Swiss HIV cohort study at diagnosis of Candida esophagitis, 1 year before, 1 year later and after 2 years of suppressed HIV RNA. We compared these patients with three groups: 37 HIV-1-infected patients without Candida esophagitis but similar CD4+ cell counts as the patients at diagnosis (advanced HIV group), 15 HIV-1-infected patients with CD4+ cell counts higher than 500 cells/μl, CD4+ cell nadirs higher than 350 cells/μl and suppressed HIV RNA under combination antiretroviral therapy (cART) (early cART group) and 20 healthy individuals. Methods: We investigated phenotype, cytokine production and proliferative capacity of different immune cells by flow cytometry and enzyme-linked immunosorbent spot. Results: We found that patients with Candida esophagitis had nearly abolished CD4+ cell proliferation in response to Candida albicans, significantly increased percentages of dysfunctional CD4+ cells, significantly decreased cytotoxic natural killer cell counts and peripheral innate lymphoid cell counts and significantly reduced IFN-γ and IL-17 production compared with the early cART group and healthy individuals. Most of these defects remained for more than 2 years despite viral suppression. The advanced HIV group without opportunistic infection showed partly improved immune recovery. Conclusion: Our data indicate that Candida esophagitis in HIV-1-infected patients is caused by an accumulation of multiple, partly Candida-specific immunological defects. Long-term immune recovery is impaired, illustrating that specific immunological gaps persist despite cART. These data also support the rationale for early cART initiation to prevent irreversible immune defects. PMID:27149086
Ly, Judy; Lagman, Minette; Saing, Tommy; Singh, Manpreet Kaur; Tudela, Enrique Vera; Morris, Devin; Anderson, Jessica; Daliva, John; Ochoa, Cesar; Patel, Nishita; Pearce, Daniel; Venketaraman, Vishwanath
2015-11-01
Cytokines are signaling biomolecules that serve as key regulators of our immune system. CD4(+) T-cells can be grouped into 2 major categories based on their cytokine profile: T-helper 1 (TH1) subset and T-helper 2 (TH2) subset. Protective immunity against HIV infection requires TH1-directed CD4 T-cell responses, mediated by cytokines, such as interleukin-1β (IL-1β), IL-12, interferon-γ (IFN-γ), and tumor necrosis factor-α (TNF-α). Cytokines released by the TH1 subset of CD4 T-cells are considered important for mediating effective immune responses against intracellular pathogens such as Mycobacterium tuberculosis (M. tb). Oxidative stress and redox imbalance that occur during HIV infection often lead to inappropriate immune responses. Glutathione (GSH) is an antioxidant present in nearly all cells and is recognized for its function in maintaining redox homeostasis. Our laboratory previously reported that individuals with HIV infection have lower levels of GSH. In this study, we report a link between lower levels of GSH and dysregulation of TH1- and TH2-associated cytokines in the plasma samples of HIV-positive subjects. Furthermore, we demonstrate that supplementing individuals with HIV infection for 13 weeks with liposomal GSH (lGSH) resulted in a significant increase in the levels of TH1 cytokines, IL-1β, IL-12, IFN-γ, and TNF-α. lGSH supplementation in individuals with HIV infection also resulted in a substantial decrease in the levels of free radicals and immunosuppressive cytokines, IL-10 and TGF-β, relative to those in a placebo-controlled cohort. Finally, we determined the effects of lGSH supplementation in improving the functions of immune cells to control M. tb infection by conducting in vitro assays using peripheral blood mononuclear cells collected from HIV-positive individuals at post-GSH supplementation. Our studies establish a correlation between low levels of GSH and increased susceptibility to M. tb infection through TH2-directed response
Donnelly, Louise; Curran, Rhonda M.; Tregoning, John S.; McKay, Paul F.; Cole, Tom; Morrow, Ryan J.; Kett, Vicky L.; Andrews, Gavin P.; Woolfson, A. David; Malcolm, R. Karl; Shattock, Robin J.
2011-01-01
Vaccine-mediated prevention of primary HIV-1 infection at the heterosexual mucosal portal of entry may be facilitated by highly optimised formulations or drug delivery devices for intravaginal (i.vag) immunization. Previously we described hydroxyethylcellulose (HEC)-based rheologically structured gel vehicles (RSVs) for vaginal immunization of an HIV-1 vaccine candidate, a soluble recombinant trimeric HIV-1 clade-C envelope glycoprotein designated CN54gp140. Here we investigated the efficacy of lyophilized solid dosage formulations (LSDFs) for prolonging antigen stability and as i.vag delivery modalities. LSDFs were designed and developed that upon i.vag administration they would reconstitute with the imbibing of vaginal fluid to mucoadhesive, site-retentive semi-solids. Mice were immunized with lyophilized equivalents of (i) RSVs, (ii) modified versions of the RSVs more suited to lyophilization (sodium carboxymethyl cellulose (NaCMC)-based gels) and (iii) Carbopol® gel, all containing CN54gp140. NaCMC-based LSDFs provided significantly enhanced antigen stability compared to aqueous-based RSVs. Rheological analysis indicated the NaCMC-based LSDFs would offer enhanced vaginal retention in woman compared to more conventional vaginal gel formulations. All LSDFs were well tolerated in the mouse model. Following i.vag administration, all LSDFs boosted systemic CN54gp140-specific antibody responses in sub-cutaneously primed mice. Induction of CN54gp140-specific antibody responses in the female genital tract was evident. Of all the LSDFs the fastest releasing which was lyophilized Carbopol® gel elicited immune responses comparable to buffer instillation of antigen suggesting that rather than slower sustained release, initial high burst release from the LSDFs may suffice. The boosting of specific immune responses upon i.vag administration indicates that LSDFs are viable mucosal vaccine delivery modalities promoting antigen stability and facilitating intimate exposure of
Mucosal immunity in HIV controllers: the right place at the right time.
Shacklett, Barbara L; Ferre, April L
2011-05-01
The phenomenon of long-term nonprogression in HIV infection has been recognized for some time, and the ability of rare individuals, designated 'elite controllers', to control HIV in the absence of therapy is the focus of numerous ongoing studies. This review focuses on studies of HIV-specific immune responses in mucosal tissues as a potential correlate of immune control, with an emphasis on recently published work. Genetic studies have implicated a role for elements localized to the major histocompatibility complex (MHC) on chromosome 6 in the immune control of HIV infection. In parallel, functional studies have strongly implicated MHC class I-restricted, CD8+ T-cell responses as a major contributor to elite control. In addition, the localization of HIV-specific CD8+ and CD4+ T cells with respect to the major sites of virus replication in the body may be critical in determining clinical outcome. Recent findings suggest that MHC class I-restricted, CD8+ T cells are a major component of immune control in 'elite controllers'. In addition, the presence of these effector cells at or near critical viral reservoirs, such as mucosal tissues, may be critical in determining their effectiveness at limiting viral replication and dissemination.
Kityo, Cissy; Bousheri, Stephanie; Akao, Juliette; Ssali, Francis; Byaruhanga, Rose; Ssewanyana, Isaac; Muloma, Prossy; Myalo, Sula; Magala, Rose; Lu, Yichen; Mugyenyi, Peter; Cao, Huyen
2011-01-01
Therapeutic immunizations in HIV infection may boost immunity during antiretroviral treatment. We report on the first therapeutic vaccine trial in Uganda, Africa. This open label Phase I trial was designed to assess the safety, tolerability and immunogenicity of a therapeutic HIV-1 vaccine candidate. Thirty HIV positive volunteers receiving a stable regimen of antiretroviral therapy with CD4 counts > 400 were recruited for the safety evaluation of LFn-p24C, a detoxified anthrax-derived polypeptide fused to the subtype C HIV gag protein p24. The vaccine was well tolerated and HIV RNA levels remained undetectable following three immunizations. CD4 counts in vaccine recipients were significantly higher compared to the control individuals after 12 months. HIV-specific responses were associated with higher gain in CD4 counts following LFn-p24C immunizations. Volunteers were subsequently asked to undergo a 30-day period of observed treatment interruption. 8/24 (30%) individuals showed no evidence of viral rebound during treatment interruption. All demonstrated prompt suppression of viral load following resumption of ART. Our data demonstrates the safety of LFn-p24C and suggests that adjunct therapeutic immunization may benefit select individuals in further boosting an immune response. PMID:21211581
Chapuis, Aude G; Casper, Corey; Kuntz, Steve; Zhu, Jia; Tjernlund, Annelie; Diem, Kurt; Turtle, Cameron J; Cigal, Melinda L; Velez, Roxanne; Riddell, Stanley; Corey, Lawrence; Greenberg, Philip D
2011-05-19
Most HIV+ individuals require lifelong highly active antiretroviral therapy (HAART) to suppress HIV replication, but fail to eliminate the virus in part because of residual replication in gut-associated lymphoid tissues (GALT). Naturally elicited HIV-specific CD8+ T cells generated in the acute and chronic infectious phases exhibit antiviral activity, but decrease in number after HAART. Therapeutic vaccines represent a potential strategy to expand cellular responses, although previous efforts have been largely unsuccessful, conceivably because of a lack of responding HIV-specific central-memory CD8+ T cells (Tcm). To determine whether patients receiving HAART possess CD8+ T cells with Tcm qualities that are amenable to augmentation, HIV-specific CD8+ T-cell clones were derived from HIV-reactive CD28+CD8+ T-cell lines isolated from 7 HIV+ HAART-treated patients, expanded ex vivo, and reinfused into their autologous host. Tracking of the cells in vivo revealed that clones could persist for ≥ 84 days, maintain expression and/or re-express CD28, up-regulate CD62L, secrete IL-2, proliferate on cognate Ag encounter and localize to the rectal mucosa. These results suggest some infused cells exhibited phenotypic and functional characteristics shared with Tcm in vivo, and imply that more effective therapeutic vaccination strategies targeting CD8+ Tcm in patients on HAART might provide hosts with expanded, long-lasting immune responses not only systemically but also in GALT.
B-cell development and pneumococcal immunity in vertically acquired HIV infection.
Eisen, Sarah; Hayden, Clare; Young, Carmel J; Gilson, Richard; Jungmann, Eva; Jacobsen, Marianne C; Poulsom, Hannah; Goldblatt, David; Klein, Nigel J; Baxendale, Helen E
2016-07-31
Many children with HIV infection now survive into adulthood. This study explored the impact of vertically acquired HIV in the era of antiretroviral therapy on the development of humoral immunity. Natural and vaccine-related immunity to pneumococcus and B-cell phenotype was characterized and compared in three groups of young adults: those with vertically-acquired infection, those with horizontally acquired infection and healthy controls. Serotype-specific pneumococcal (Pnc) immunoglobulin M and G concentrations before and up to 1 year post-Pnc polysaccharide (Pneumovax) immunization were determined, and opsonophagocytic activity was analysed. B-cell subpopulations and dynamic markers of B-cell signalling, turnover and susceptibility to apoptosis were evaluated by flow cytometry. HIV-infected patients showed impaired natural Pnc immunity and reduced humoral responses to immunization with Pneumovax; this was greatest in those viraemic at time of the study. Early-life viral control before the age of 10 years diminished these changes. Expanded populations of abnormally activated and immature B-cells were seen in both HIV-infected cohorts. Vertically infected patients were particularly vulnerable to reductions in marginal zone and switched memory populations. These aberrations were reduced in patients with early-life viral control. In children with HIV, damage to B-cell memory populations and impaired natural and vaccine immunity to pneumococcus is evident in early adult life. Sustained viral control from early childhood may help to limit this effect and optimize humoral immunity in adult life.
B-cell responses to HIV infection.
Moir, Susan; Fauci, Anthony S
2017-01-01
The induction of neutralizing antibodies directed against the human immunodeficiency virus (HIV) has received considerable attention in recent years, in part driven by renewed interest and opportunities for antibody-based strategies for prevention such as passive transfer of antibodies and the development of preventive vaccines, as well as immune-based therapeutic interventions. Advances in the ability to screen, isolate, and characterize HIV-specific antibodies have led to the identification of a new generation of potent broadly neutralizing antibodies (bNAbs). The majority of these antibodies have been isolated from B cells of chronically HIV-infected individuals with detectable viremia. In this review, we provide insight into the phenotypic and functional attributes of human B cells, with a focus on HIV-specific memory B cells and plasmablasts/cells that are responsible for sustaining humoral immune responses against HIV. We discuss the abnormalities in B cells that occur in HIV infection both in the peripheral blood and lymphoid tissues, especially in the setting of persisting viremia. Finally, we consider the opportunities and drawbacks of intensively interrogating antibodies isolated from HIV-infected individuals to guide strategies aimed at developing effective antibody-based vaccine and therapeutic interventions for HIV. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
A Physical Theory of the Competition that Allows HIV to Escape from the Immune System
NASA Astrophysics Data System (ADS)
Deem, Michael
2007-03-01
Competition within the immune system may degrade immune control of viral infections. We formalize the evolution that occurs in both HIV-1 and the immune system quasispecies [1]. Inclusion of competition in the immune system leads to a novel balance between the immune response and HIV-1, in which the eventual outcome is HIV-1 escape rather than control. The analytical model reproduces the three stages of HIV-1 infection. We propose a vaccine regimen that may be able to reduce competition between T cells, potentially eliminating the third stage of HIV-1. 1) G. Wang and M. W. Deem, Phys. Rev. Lett. 97 (2006) 188106.
NASA Astrophysics Data System (ADS)
Wang, Yan; Jiang, Daqing; Alsaedi, Ahmed; Hayat, Tasawar
2018-07-01
A stochastic HIV viral model with both logistic target cell growth and nonlinear immune response function is formulated to investigate the effect of white noise on each population. The existence of the global solution is verified. By employing a novel combination of Lyapunov functions, we obtain the existence of the unique stationary distribution for small white noises. We also derive the extinction of the virus for large white noises. Numerical simulations are performed to highlight the effect of white noises on model dynamic behaviour under the realistic parameters. It is found that the small intensities of white noises can keep the irregular blips of HIV virus and CTL immune response, while the larger ones force the virus infection and immune response to lose efficacy.
Intrasubtype B HIV-1 Superinfection Correlates with Delayed Neutralizing Antibody Response
Landais, Elise; Caballero, Gemma; Phung, Pham; Kosakovsky Pond, Sergei L.; Poignard, Pascal; Richman, Douglas D.; Little, Susan J.; Smith, Davey M.
2017-01-01
ABSTRACT Understanding whether the neutralizing antibody (NAb) response impacts HIV-1 superinfection and how superinfection subsequently modulates the NAb response can help clarify correlates of protection from HIV exposures and better delineate pathways of NAb development. We examined associations between the development of NAb and the occurrence of superinfection in a well-characterized, antiretroviral therapy (ART)-naive, primary infection cohort of men who have sex with men. Deep sequencing was applied to blood plasma samples from the cohort to detect cases of superinfection. We compared the NAb activity against autologous and heterologous viruses between 10 participants with intrasubtype B superinfection and 19 monoinfected controls, matched to duration of infection and risk behavior. Three to 6 months after primary infection, individuals who would later become superinfected had significantly weaker NAb activity against tier 1 subtype B viruses (P = 0.003 for SF-162 and P = 0.017 for NL4-3) and marginally against autologous virus (P = 0.054). Lower presuperinfection NAb responses correlated with weaker gp120 binding and lower plasma total IgG titers. Soon after superinfection, the NAb response remained lower, but between 2 and 3 years after primary infection, NAb levels strengthened and reached those of controls. Superinfecting viruses were typically not susceptible to neutralization by presuperinfection plasma. These observations suggest that recently infected individuals with a delayed NAb response against primary infecting and tier 1 subtype B viruses are more susceptible to superinfection. IMPORTANCE Our findings suggest that within the first year after HIV infection, a relatively weak neutralizing antibody response against primary and subtype-specific neutralization-sensitive viruses increases susceptibility to superinfection in the face of repeated exposures. As natural infection progresses, the immune response strengthens significantly in some
Intrasubtype B HIV-1 Superinfection Correlates with Delayed Neutralizing Antibody Response.
Wagner, Gabriel A; Landais, Elise; Caballero, Gemma; Phung, Pham; Kosakovsky Pond, Sergei L; Poignard, Pascal; Richman, Douglas D; Little, Susan J; Smith, Davey M
2017-09-01
Understanding whether the neutralizing antibody (NAb) response impacts HIV-1 superinfection and how superinfection subsequently modulates the NAb response can help clarify correlates of protection from HIV exposures and better delineate pathways of NAb development. We examined associations between the development of NAb and the occurrence of superinfection in a well-characterized, antiretroviral therapy (ART)-naive, primary infection cohort of men who have sex with men. Deep sequencing was applied to blood plasma samples from the cohort to detect cases of superinfection. We compared the NAb activity against autologous and heterologous viruses between 10 participants with intrasubtype B superinfection and 19 monoinfected controls, matched to duration of infection and risk behavior. Three to 6 months after primary infection, individuals who would later become superinfected had significantly weaker NAb activity against tier 1 subtype B viruses ( P = 0.003 for SF-162 and P = 0.017 for NL4-3) and marginally against autologous virus ( P = 0.054). Lower presuperinfection NAb responses correlated with weaker gp120 binding and lower plasma total IgG titers. Soon after superinfection, the NAb response remained lower, but between 2 and 3 years after primary infection, NAb levels strengthened and reached those of controls. Superinfecting viruses were typically not susceptible to neutralization by presuperinfection plasma. These observations suggest that recently infected individuals with a delayed NAb response against primary infecting and tier 1 subtype B viruses are more susceptible to superinfection. IMPORTANCE Our findings suggest that within the first year after HIV infection, a relatively weak neutralizing antibody response against primary and subtype-specific neutralization-sensitive viruses increases susceptibility to superinfection in the face of repeated exposures. As natural infection progresses, the immune response strengthens significantly in some superinfected
Agrati, Chiara; Castilletti, Concetta; Cimini, Eleonora; Lapa, Daniele; Quartu, Serena; Caglioti, Claudia; Lanini, Simone; Cattoli, Giovanni; Martini, Federico; Ippolito, Giuseppe; Capobianchi, Maria R
2014-01-01
Human cases of infection due to a novel swine-origin variant of influenza A virus subtype H3N2 (H3N2v) have recently been identified in the United States. Pre-existing humoral and cellular immunity has been recognized as one of the key factors in limiting the infection burden of an emerging influenza virus strain, contributing to restrict its circulation and to mitigate clinical presentation. Aim of this study was to assess humoral and cell-mediated cross immune responses to H3N2v in immuno-competent (healthy donors, n = 45) and immuno-compromised hosts (HIV-infected subjects, n = 46) never exposed to H3N2v influenza strain. Humoral response against i) H3N2v (A/H3N2/Ind/08/11), ii) animal vaccine H3N2 strain (A/H3N2/Min/11/10), and iii) pandemic H1N1 virus (A/H1N1/Cal/07/09) was analysed by hemagglutination inhibition assay; cell-mediated response against the same influenza strains was analysed by ELISpot assay. A large proportion of healthy and HIV subjects displayed cross-reacting humoral and cellular immune responses against two H3N2v strains, suggesting the presence of B- and T-cell clones able to recognize epitopes from emerging viral strains in both groups. Specifically, humoral response was lower in HIV subjects than in HD, and a specific age-related pattern of antibody response against different influenza strains was observed both in HD and in HIV. Cellular immune response was similar between HD and HIV groups and no relationship with age was reported. Finally, no correlation between humoral and cellular immune response was observed. Overall, a high prevalence of HD and HIV patients showing cross reactive immunity against two H3N2v strains was observed, with a slightly lower proportion in HIV persons. Other studies focused on HIV subjects at different stages of diseases are needed in order to define how cross immunity can be affected by advanced immunosuppression.
Mathematical modeling of escape of HIV from cytotoxic T lymphocyte responses
NASA Astrophysics Data System (ADS)
Ganusov, Vitaly V.; Neher, Richard A.; Perelson, Alan S.
2013-01-01
Human immunodeficiency virus (HIV-1 or simply HIV) induces a persistent infection, which in the absence of treatment leads to AIDS and death in almost all infected individuals. HIV infection elicits a vigorous immune response starting about 2-3 weeks postinfection that can lower the amount of virus in the body, but which cannot eradicate the virus. How HIV establishes a chronic infection in the face of a strong immune response remains poorly understood. It has been shown that HIV is able to rapidly change its proteins via mutation to evade recognition by virus-specific cytotoxic T lymphocytes (CTLs). Typically, an HIV-infected patient will generate 4-12 CTL responses specific for parts of viral proteins called epitopes. Such CTL responses lead to strong selective pressure to change the viral sequences encoding these epitopes so as to avoid CTL recognition. Indeed, the viral population ‘escapes’ from about half of the CTL responses by mutation in the first year. Here we review experimental data on HIV evolution in response to CTL pressure, mathematical models developed to explain this evolution, and highlight problems associated with the data and previous modeling efforts. We show that estimates of the strength of the epitope-specific CTL response depend on the method used to fit models to experimental data and on the assumptions made regarding how mutants are generated during infection. We illustrate that allowing CTL responses to decay over time may improve the model fit to experimental data and provides higher estimates of the killing efficacy of HIV-specific CTLs. We also propose a novel method for simultaneously estimating the killing efficacy of multiple CTL populations specific for different epitopes of HIV using stochastic simulations. Lastly, we show that current estimates of the efficacy at which HIV-specific CTLs clear virus-infected cells can be improved by more frequent sampling of viral sequences and by combining data on sequence evolution with
Nasi, Aikaterini; Amu, Sylvie; Göthlin, Mårten; Jansson, Marianne; Nagy, Noemi; Chiodi, Francesca; Réthi, Bence
2017-01-01
Dendritic cells (DCs) are potent antigen-presenting cells that might play contradictory roles during HIV-1 infection, contributing not only to antiviral immunity but also to viral dissemination and immune evasion. Although DCs are characterized by enormous functional diversity, it has not been analyzed how differentially programmed DCs interact with HIV-1. We have previously described the reprogramming of DC development by endogenously produced lactic acid that accumulated in a cell culture density-dependent manner and provided a long-lasting anti-inflammatory signal to the cells. By exploiting this mechanism, we generated immunostimulatory DCs characterized by the production of TH1 polarizing and inflammatory mediators or, alternatively, suppressed DCs that produce IL-10 upon activation, and we tested the interaction of these DC types with different HIV-1 strains. Cytokine patterns were monitored in HIV-1-exposed DC cultures. Our results showed that DCs receiving suppressive developmental program strongly upregulated their capacity to produce the TH1 polarizing cytokine IL-12 and the inflammatory chemokines CCL2 and CCL7 upon interaction with HIV-1 strains IIIB and SF162. On the contrary, HIV-1 abolished cytokine production in the more inflammatory DC types. Preincubation of the cells with the HIV-1 proteins gp120 and Nef could inhibit IL-12 production irrespectively of the tested DC types, whereas MyD88- and TRIF-dependent signals stimulated IL-12 production in the suppressed DC type only. Rewiring of DC cytokines did not require DC infections or ligation of the HIV-1 receptor CD209. A third HIV-1 strain, BaL, could not modulate DC cytokines in a similar manner indicating that individual HIV-1 strains can differ in their capacity to influence DCs. Our results demonstrated that HIV-1 could not induce definite and invariable modulatory programs in DCs. Instead, interaction with the virus triggered different responses in different DC types. Thus, the outcome of DC-HIV
Nasi, Aikaterini; Amu, Sylvie; Göthlin, Mårten; Jansson, Marianne; Nagy, Noemi; Chiodi, Francesca; Réthi, Bence
2017-01-01
Dendritic cells (DCs) are potent antigen-presenting cells that might play contradictory roles during HIV-1 infection, contributing not only to antiviral immunity but also to viral dissemination and immune evasion. Although DCs are characterized by enormous functional diversity, it has not been analyzed how differentially programmed DCs interact with HIV-1. We have previously described the reprogramming of DC development by endogenously produced lactic acid that accumulated in a cell culture density-dependent manner and provided a long-lasting anti-inflammatory signal to the cells. By exploiting this mechanism, we generated immunostimulatory DCs characterized by the production of TH1 polarizing and inflammatory mediators or, alternatively, suppressed DCs that produce IL-10 upon activation, and we tested the interaction of these DC types with different HIV-1 strains. Cytokine patterns were monitored in HIV-1-exposed DC cultures. Our results showed that DCs receiving suppressive developmental program strongly upregulated their capacity to produce the TH1 polarizing cytokine IL-12 and the inflammatory chemokines CCL2 and CCL7 upon interaction with HIV-1 strains IIIB and SF162. On the contrary, HIV-1 abolished cytokine production in the more inflammatory DC types. Preincubation of the cells with the HIV-1 proteins gp120 and Nef could inhibit IL-12 production irrespectively of the tested DC types, whereas MyD88- and TRIF-dependent signals stimulated IL-12 production in the suppressed DC type only. Rewiring of DC cytokines did not require DC infections or ligation of the HIV-1 receptor CD209. A third HIV-1 strain, BaL, could not modulate DC cytokines in a similar manner indicating that individual HIV-1 strains can differ in their capacity to influence DCs. Our results demonstrated that HIV-1 could not induce definite and invariable modulatory programs in DCs. Instead, interaction with the virus triggered different responses in different DC types. Thus, the outcome of DC-HIV
Salk's HIV immunogen: an immune-based therapy in human trials since 1988.
Jonas Salk, the developer of the first polio vaccine, has created a therapeutic vaccine for HIV which helps the immune system fight disease progression. Salk uses inactivated HIV-1 virus combined with Incomplete Freund's Adjuvant (IFA) in the vaccine preparation. The resulting HIV-1 immunogen was first studied in 1987, and since then, 235 seropositive individuals have received inoculations without serious adverse effects. Data from the first 25 subjects indicate that immunization with the HIV-1 immunogen results in improvement of cell-mediated response against the virus, a slower increase in the amount of virus present, and a reduced rate of clinical progression. Subsequent studies also show that higher doses of immunogen may produce stronger cell-mediated responses and high HIV-DTH (delayed-type hypersensitivity responsiveness immunogen) is associated with better outcome. Additional trials of HIV-1 immunogen are awaiting Food and Drug Administration approval.
Sasaki, S; Tsuji, T; Hamajima, K; Fukushima, J; Ishii, N; Kaneko, T; Xin, K Q; Mohri, H; Aoki, I; Okubo, T; Nishioka, K; Okuda, K
1997-01-01
To enhance immunity induced by DNA vaccination against human immunodeficiency virus type 1 (HIV-1), we evaluated the efficacy of monophosphoryl lipid A (MPL), an adjuvant of bacterial origin. BALB/c mice were intramuscularly injected with immunogenic DNA, encoding the env and rev genes of the HIV-1(IIIB) strain, formulated with MPL dissolved in different vehicles (MPL in stable emulsion and MPL in aqueous formulation). The sera from mice immunized with the two preparations of MPL revealed 2(6) to 2(9) times higher HIV-1-specific immunoglobulin G (IgG) titers than the sera from mice immunized without MPL. In virus neutralization tests for HIV-1(IIIB), by p24 assay and antifusion assay of infected MOLT-4 cells, MPL tends to elicit antibody more protective than antibody elicited without adjuvant. MPL also elicited stronger delayed-type hypersensitivity and cytotoxic-T-lymphocyte activity against HIV-1(IIIB) compared to DNA alone. HIV-1-specific IgG subclass analysis showed that MPL tends to facilitate IgG2a production, suggesting enhancement of a predominant T-helper-type-1 response, and this enhancement may help to facilitate protective-antibody induction. Furthermore, a chloramphenicol acetyltransferase (CAT) assay was employed to determine whether MPL affected the gene expression process. Interestingly, both MPL preparations reduced CAT activity in the muscle injected with CAT expression vector but increased anti-CAT antibody production. These results indicate that MPL acts as an effective adjuvant for immunogenic DNA injection despite reduced expression of encoding protein in muscle. We conclude that MPL has a strong adjuvant effect on DNA vaccination against HIV-1. PMID:9284115
Gerns Storey, Helen L; Richardson, Barbra A; Singa, Benson; Naulikha, Jackie; Prindle, Vivian C; Diaz-Ochoa, Vladimir E; Felgner, Phil L; Camerini, David; Horton, Helen; John-Stewart, Grace; Walson, Judd L
2014-01-01
The role of HIV-1-specific antibody responses in HIV disease progression is complex and would benefit from analysis techniques that examine clusterings of responses. Protein microarray platforms facilitate the simultaneous evaluation of numerous protein-specific antibody responses, though excessive data are cumbersome in analyses. Principal components analysis (PCA) reduces data dimensionality by generating fewer composite variables that maximally account for variance in a dataset. To identify clusters of antibody responses involved in disease control, we investigated the association of HIV-1-specific antibody responses by protein microarray, and assessed their association with disease progression using PCA in a nested cohort design. Associations observed among collections of antibody responses paralleled protein-specific responses. At baseline, greater antibody responses to the transmembrane glycoprotein (TM) and reverse transcriptase (RT) were associated with higher viral loads, while responses to the surface glycoprotein (SU), capsid (CA), matrix (MA), and integrase (IN) proteins were associated with lower viral loads. Over 12 months greater antibody responses were associated with smaller decreases in CD4 count (CA, MA, IN), and reduced likelihood of disease progression (CA, IN). PCA and protein microarray analyses highlighted a collection of HIV-specific antibody responses that together were associated with reduced disease progression, and may not have been identified by examining individual antibody responses. This technique may be useful to explore multifaceted host-disease interactions, such as HIV coinfections.
Mahlokozera, Tatenda; Kang, Helen H.; Goonetilleke, Nilu; Stacey, Andrea R.; Lovingood, Rachel V.; Denny, Thomas N.; Kalilani, Linda; Bunn, James E. G.; Meshnick, Steve R.; Borrow, Persephone; Letvin, Norman L.; Permar, Sallie R.
2011-01-01
Background The risk of postnatal HIV transmission is associated with the magnitude of the milk virus load. While HIV-specific cellular immune responses control systemic virus load and are detectable in milk, the contribution of these responses to the control of virus load in milk is unknown. Methods We assessed the magnitude of the immunodominant GagRY11 and subdominant EnvKY9-specific CD8+ T lymphocyte response in blood and milk of 10 A*3002+, HIV-infected Malawian women throughout the period of lactation and correlated this response to milk virus RNA load and markers of breast inflammation. Results The magnitude and kinetics of the HIV-specific CD8+ T lymphocyte responses were discordant in blood and milk of the right and left breast, indicating independent regulation of these responses in each breast. However, there was no correlation between the magnitude of the HIV-specific CD8+ T lymphocyte response and the milk virus RNA load. Further, there was no correlation between the magnitude of this response and markers of breast inflammation. Conclusions The magnitude of the HIV-specific CD8+ T lymphocyte response in milk does not appear to be solely determined by the milk virus RNA load and is likely only one of the factors contributing to maintenance of low virus load in milk. PMID:21886819
Karlsson, Ingrid; Borggren, Marie; Jensen, Sanne Skov; Heyndrickx, Leo; Stewart-Jones, Guillaume; Scarlatti, Gabriella; Fomsgaard, Anders
2017-11-17
The induction of both neutralizing antibodies and non-neutralizing antibodies with effector functions, for example, antibody-dependent cellular cytotoxicity (ADCC), is desired in the search for effective vaccines against HIV-1. In the pursuit of novel immunogens capable of inducing an efficient antibody response, rabbits were immunized with selected antigens using different prime-boost strategies. We immunized 35 different groups of rabbits with Env antigens from clinical HIV-1 subtypes A and B, including immunization with DNA alone, protein alone, and DNA prime with protein boost. The rabbit sera were screened for ADCC activity using a GranToxiLux-based assay with human peripheral blood mononuclear cells as effector cells and CEM.NKR CCR5 cells coated with HIV-1 envelope as target cells. The groups with the highest ADCC activity were further characterized for cross-reactivity between HIV-1 subtypes. The immunogen inducing the most potent and broadest ADCC response was a trimeric gp140. The ADCC activity was highest against the HIV-1 subtype corresponding to the immunogen. The ADCC activity did not necessarily reflect neutralizing activity in the pseudovirus-TZMbl assay, but there was an overall correlation between the two antiviral activities. We present a rabbit vaccination model and an assay suitable for screening HIV-1 vaccine candidates for the induction of ADCC-mediating antibodies in addition to neutralizing antibodies. The antigens and/or immunization strategies capable of inducing antibodies with ADCC activity did not necessarily induce neutralizing activity and vice versa. Nevertheless, we identified vaccine candidates that were able to concurrently induce both types of responses and that had ADCC activity that was cross-reactive between different subtypes. When searching for an effective vaccine candidate, it is important to evaluate the antibody response using a model and an assay measuring the desired function.
Complement-Opsonized HIV-1 Overcomes Restriction in Dendritic Cells.
Posch, Wilfried; Steger, Marion; Knackmuss, Ulla; Blatzer, Michael; Baldauf, Hanna-Mari; Doppler, Wolfgang; White, Tommy E; Hörtnagl, Paul; Diaz-Griffero, Felipe; Lass-Flörl, Cornelia; Hackl, Hubert; Moris, Arnaud; Keppler, Oliver T; Wilflingseder, Doris
2015-06-01
DCs express intrinsic cellular defense mechanisms to specifically inhibit HIV-1 replication. Thus, DCs are productively infected only at very low levels with HIV-1, and this non-permissiveness of DCs is suggested to go along with viral evasion. We now illustrate that complement-opsonized HIV-1 (HIV-C) efficiently bypasses SAMHD1 restriction and productively infects DCs including BDCA-1 DCs. Efficient DC infection by HIV-C was also observed using single-cycle HIV-C, and correlated with a remarkable elevated SAMHD1 T592 phosphorylation but not SAMHD1 degradation. If SAMHD1 phosphorylation was blocked using a CDK2-inhibitor HIV-C-induced DC infection was also significantly abrogated. Additionally, we found a higher maturation and co-stimulatory potential, aberrant type I interferon expression and signaling as well as a stronger induction of cellular immune responses in HIV-C-treated DCs. Collectively, our data highlight a novel protective mechanism mediated by complement opsonization of HIV to effectively promote DC immune functions, which might be in the future exploited to tackle HIV infection.
Innate immunity against HIV: a priority target for HIV prevention research.
Borrow, Persephone; Shattock, Robin J; Vyakarnam, Annapurna
2010-10-11
This review summarizes recent advances and current gaps in understanding of innate immunity to human immunodeficiency virus (HIV) infection, and identifies key scientific priorities to enable application of this knowledge to the development of novel prevention strategies (vaccines and microbicides). It builds on productive discussion and new data arising out of a workshop on innate immunity against HIV held at the European Commission in Brussels, together with recent observations from the literature.Increasing evidence suggests that innate responses are key determinants of the outcome of HIV infection, influencing critical events in the earliest stages of infection including the efficiency of mucosal HIV transmission, establishment of initial foci of infection and local virus replication/spread as well as virus dissemination, the ensuing acute burst of viral replication, and the persisting viral load established. They also impact on the subsequent level of ongoing viral replication and rate of disease progression. Modulation of innate immunity thus has the potential to constitute a powerful effector strategy to complement traditional approaches to HIV prophylaxis and therapy. Importantly, there is increasing evidence to suggest that many arms of the innate response play both protective and pathogenic roles in HIV infection. Consequently, understanding the contributions made by components of the host innate response to HIV acquisition/spread versus control is a critical pre-requisite for the employment of innate immunity in vaccine or microbicide design, so that appropriate responses can be targeted for up- or down-modulation. There is also an important need to understand the mechanisms via which innate responses are triggered and mediate their activity, and to define the structure-function relationships of individual innate factors, so that they can be selectively exploited or inhibited. Finally, strategies for achieving modulation of innate functions need to be
Paradoxical aging in HIV: immune senescence of B Cells is most prominent in young age.
Rinaldi, Stefano; Pallikkuth, Suresh; George, Varghese K; de Armas, Lesley R; Pahwa, Rajendra; Sanchez, Celeste M; Pallin, Maria Fernanda; Pan, Li; Cotugno, Nicola; Dickinson, Gordon; Rodriguez, Allan; Fischl, Margaret; Alcaide, Maria; Gonzalez, Louis; Palma, Paolo; Pahwa, Savita
2017-04-01
Combination antiretroviral therapies (cART)can lead to normal life expectancy in HIV-infected persons, and people aged >50 yrs represent the fastest growing HIV group. Although HIV and aging are independently associated with impaired humoral immunity, immune status in people aging with HIV is relatively unexplored. In this study influenza vaccination was used to probe age associated perturbations in the B cell compartment of HIV-negative "healthy controls" (HC) and virologically controlled HIV-infected participants on cART (HIV) (n=124), grouped by age as young (<40 yrs), middle-aged (40-59yrs) or old ( > 60 yrs). H1N1 antibody response at d21 post-vaccination correlated inversely with age in both HC and HIV. Immunophenotyping of cryopreserved PBMC demonstrated increased frequencies of double negative B cells and decreased plasmablasts in old compared to young HC. Remarkably, young HIV were different from young HC but similar to old HC in B cell phenotype, influenza specific spontaneous (d7) or memory (d21) antibody secreting cells. We conclude that B cell immune senescence is a prominent phenomenon in young HIV in comparison to young HC, but distinctions between old HIV and old HC are less evident though both groups manifest age-associated B cell dysfunction.
Paradoxical aging in HIV: immune senescence of B Cells is most prominent in young age
George, Varghese K.; de Armas, Lesley R.; Pahwa, Rajendra; Sanchez, Celeste M.; Pallin, Maria Fernanda; Pan, Li; Cotugno, Nicola; Dickinson, Gordon; Rodriguez, Allan; Fischl, Margaret; Alcaide, Maria; Gonzalez, Louis; Palma, Paolo; Pahwa, Savita
2017-01-01
Combination antiretroviral therapies (cART) can lead to normal life expectancy in HIV-infected persons, and people aged >50 yrs represent the fastest growing HIV group. Although HIV and aging are independently associated with impaired humoral immunity, immune status in people aging with HIV is relatively unexplored. In this study influenza vaccination was used to probe age associated perturbations in the B cell compartment of HIV-negative “healthy controls” (HC) and virologically controlled HIV-infected participants on cART (HIV) (n=124), grouped by age as young (<40 yrs), middle-aged (40-59yrs) or old (≥60 yrs). H1N1 antibody response at d21 post-vaccination correlated inversely with age in both HC and HIV. Immunophenotyping of cryopreserved PBMC demonstrated increased frequencies of double negative B cells and decreased plasmablasts in old compared to young HC. Remarkably, young HIV were different from young HC but similar to old HC in B cell phenotype, influenza specific spontaneous (d7) or memory (d21) antibody secreting cells. We conclude that B cell immune senescence is a prominent phenomenon in young HIV in comparison to young HC, but distinctions between old HIV and old HC are less evident though both groups manifest age-associated B cell dysfunction. PMID:28448963
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chavez, Leslie L; Perelson, Alan
2008-01-01
A window of opportunity for immune responses to extinguish HIV -1 exists from the moment of transmission through establishment of the latent pool of HIV -I-infected cells. A critical time to study the initial immune responses to the transmitted/founder virus is the eclipse phase of HIV-1 infection (time from transmission to the first appearance of plasma virus) but, to date, this period has been logistically difficult to analyze. Studies in non-human primates challenged with chimeric simianhuman immunodeficiency virus have shown that neutralizing antibodies, when present at the time of infection, can prevent virus infection.
Palmer, Clovis S; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M
2018-01-01
An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of "inflammaging", a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV + individuals.
Ballegaard, Vibe; Pedersen, Karin Kaereby; Pedersen, Maria; Brændstrup, Peter; Kirkby, Nikolai; Buus, Anette Stryhn; Ryder, Lars P; Gerstoft, Jan; Nielsen, Susanne Dam
2018-05-30
Mechanisms leading to neurocognitive impairment (NCI) in people living with HIV (PLWHIV) on stable antiretroviral therapy (cART) remain unknown. We investigated the association between CMV immunity, HIV-specific variables and NCI in PLWHIV on stable cART and with low comorbidity. 52 PLWHIV on stable cART and 31 HIV-uninfected controls matched on age, gender, education and comorbidity were tested with a neurocognitive test-battery and CMV-immunoglobulin G (CMV-IgG) levels were measured. In PLWHIV, CMV-specific (CMV-pp65 and CMV-gB) CD4+ and CD8+ T-cell responses were measured using intracellular-cytokine-staining and flowcytometry. NCI was defined as a global-deficit-scale score (GDS-score) ≥ 0.5. GDS-scores and domain-specific-scores defined severity of NCI. Logistic and linear multivariate regression analyses were used. NCI was detected in 30.8% of PLWHIV, and HIV was associated with an adjusted odds ratio (aOR) of 5.18 (95%CI: 1.15; 23.41, p=0.033) for NCI. In PLWHIV, higher CMV-specific CD4+ T-cell responses increased the probability of NCI with an aOR of 1.68 (95%CI: 1.10; 2.57) for CMV-pp65 or an aOR of 3.73 (95%CI: 1.61; 16.98) for CMV-gB, respectively. Similar associations were not found with CMV-IgG or CMV-specific CD8+ T-cells, but when assessing severity of NCI, higher CMV-IgG (per 100 U/ml) was associated with worse GDS-scores (β=0.08 (0.01-0.16), p=0.044), specifically in the domain of speed of information processing (β=0.20 (0.04-0.36, p=0.019). PLWHIV had increased risk of NCI. Excess risk may be associated with CMV-specific CD4+ T-cell responses and CMV-IgG. Larger longitudinal studies investigating the impact of CMV immunity on risk of NCI are warranted.
Long-term Durability of Immune Responses After Hepatitis A Vaccination Among HIV-Infected Adults
Wilkins, Kenneth; Lee, Andrew W.; Grosso, Anthony; Landrum, Michael L.; Weintrob, Amy; Ganesan, Anuradha; Maguire, Jason; Klopfer, Stephanie; Brandt, Carolyn; Bradley, William P.; Wallace, Mark R.; Agan, Brian K.
2011-01-01
Background. Vaccination provides long-term immunity to hepatitis A virus (HAV) among the general population, but there are no such data regarding vaccine durability among human immunodeficiency virus (HIV)–infected adults. Methods. We retrospectively studied HIV-infected adults who had received 2 doses of HAV vaccine. We analyzed blood specimens taken at 1 year, 3 years, and, when available, 6–10 years postvaccination. HAV immunoglobulin G (IgG) values of ≥10 mIU/mL were considered seropositive. Results. We evaluated specimens from 130 HIV-infected adults with a median age of 35 years and a median CD4 cell count of 461 cells/mm3 at or before time of vaccination. Of these, 49% had an HIV RNA load <1000 copies/mL. Initial vaccine responses were achieved in 89% of HIV-infected adults (95% confidence interval [CI], 83%–94%), compared with 100% (95% CI, 99%–100%) of historical HIV-uninfected adults. Among initial HIV-infected responders with available specimens, 90% (104 of 116; 95% CI, 83%–95%) remained seropositive at 3 years and 85% (63 of 74; 95% CI, 75%–92%) at 6–10 years. Geometric mean concentrations (GMCs) among HIV-infected adults were 154, 111, and 64 mIU/mL at 1, 3, and 6–10 years, respectively, compared with 1734, 687, and 684 mIU/mL among HIV-uninfected persons. Higher GMCs over time among HIV-infected adults were associated with lower log10 HIV RNA levels (β = −.12, P = .04). Conclusions. Most adults with well-controlled HIV infections had durable seropositive responses up to 6–10 years after HAV vaccination. Suppressed HIV RNA levels are associated with durable HAV responses. PMID:21606540
Role of immune activation in CD4+ T-cell depletion in HIV-1 infected Indian patients.
Vajpayee, M; Kaushik, S; Sreenivas, V; Mojumdar, K; Mendiratta, S; Chauhan, N K
2009-01-01
The correlation of immune activation with CD4(+) depletion and HIV-1 disease progression has been evidenced by several studies involving mainly clade B virus. However, this needs to be investigated in developing countries such as India predominately infected with clade C virus. In a cross-sectional study of 68 antiretroviral treatment naïve, HIV-1 infected Indian patients, we studied the association between CD4(+) T cells, plasma HIV-1 RNA levels, and immune activation markers using unadjusted and adjusted correlative analyses. Significant negative correlations of higher magnitude were observed between the CD4(+) T cell percentages and plasma HIV-1 RNA levels in the study population when adjusted for the effects of immune activation markers. However, the negative association of CD4(+) T cells with immune activation markers remained unaffected when controlled for the effects of plasma HIV-1 RNA levels. Our results support the important role of immune activation in CD4(+) T cell depletion and disease progression during untreated HIV-1 infection.
Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response
Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.
2016-01-01
Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed
Adaptive Evolution as a Predictor of Species-Specific Innate Immune Response.
Webb, Andrew E; Gerek, Z Nevin; Morgan, Claire C; Walsh, Thomas A; Loscher, Christine E; Edwards, Scott V; O'Connell, Mary J
2015-07-01
It has been proposed that positive selection may be associated with protein functional change. For example, human and macaque have different outcomes to HIV infection and it has been shown that residues under positive selection in the macaque TRIM5α receptor locate to the region known to influence species-specific response to HIV. In general, however, the relationship between sequence and function has proven difficult to fully elucidate, and it is the role of large-scale studies to help bridge this gap in our understanding by revealing major patterns in the data that correlate genotype with function or phenotype. In this study, we investigate the level of species-specific positive selection in innate immune genes from human and mouse. In total, we analyzed 456 innate immune genes using codon-based models of evolution, comparing human, mouse, and 19 other vertebrate species to identify putative species-specific positive selection. Then we used population genomic data from the recently completed Neanderthal genome project, the 1000 human genomes project, and the 17 laboratory mouse genomes project to determine whether the residues that were putatively positively selected are fixed or variable in these populations. We find evidence of species-specific positive selection on both the human and the mouse branches and we show that the classes of genes under positive selection cluster by function and by interaction. Data from this study provide us with targets to test the relationship between positive selection and protein function and ultimately to test the relationship between positive selection and discordant phenotypes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Effect of humoral immunity on HIV-1 dynamics with virus-to-target and infected-to-target infections
NASA Astrophysics Data System (ADS)
Elaiw, A. M.; Raezah, A. A.; Alofi, A. S.
2016-08-01
We consider an HIV-1 dynamics model by incorporating (i) two routes of infection via, respectively, binding of a virus to a receptor on the surface of a target cell to start genetic reactions (virus-to-target infection), and the direct transmission from infected cells to uninfected cells through the concept of virological synapse in vivo (infected-to-target infection); (ii) two types of distributed-time delays to describe the time between the virus or infected cell contacts an uninfected CD4+ T cell and the emission of new active viruses; (iii) humoral immune response, where the HIV-1 particles are attacked by the antibodies that are produced from the B lymphocytes. The existence and stability of all steady states are completely established by two bifurcation parameters, R 0 (the basic reproduction number) and R 1 (the viral reproduction number at the chronic-infection steady state without humoral immune response). By constructing Lyapunov functionals and using LaSalle's invariance principle, we have proven that, if R 0 ≤ 1 , then the infection-free steady state is globally asymptotically stable, if R 1 ≤ 1 < R 0 , then the chronic-infection steady state without humoral immune response is globally asymptotically stable, and if R 1 > 1 , then the chronic-infection steady state with humoral immune response is globally asymptotically stable. We have performed numerical simulations to confirm our theoretical results.
Type I Interferon Responses by HIV-1 Infection: Association with Disease Progression and Control.
Soper, Andrew; Kimura, Izumi; Nagaoka, Shumpei; Konno, Yoriyuki; Yamamoto, Keisuke; Koyanagi, Yoshio; Sato, Kei
2017-01-01
Human immunodeficiency virus type 1 (HIV-1) is the causative agent of acquired immunodeficiency syndrome and its infection leads to the onset of several disorders such as the depletion of peripheral CD4 + T cells and immune activation. HIV-1 is recognized by innate immune sensors that then trigger the production of type I interferons (IFN-Is). IFN-Is are well-known cytokines eliciting broad anti-viral effects by inducing the expression of anti-viral genes called interferon-stimulated genes (ISGs). Extensive in vitro studies using cell culture systems have elucidated that certain ISGs such as APOBEC3G, tetherin, SAM domain and HD domain-containing protein 1, MX dynamin-like GTPase 2, guanylate-binding protein 5, and schlafen 11 exert robust anti-HIV-1 activity, suggesting that IFN-I responses triggered by HIV-1 infection are detrimental for viral replication and spread. However, recent studies using animal models have demonstrated that at both the acute and chronic phase of infection, the role of IFN-Is produced by HIV or SIV infection in viral replication, spread, and pathogenesis, may not be that straightforward. In this review, we describe the pluses and minuses of HIV-1 infection stimulated IFN-I responses on viral replication and pathogenesis, and further discuss the possibility for therapeutic approaches.
Protection of chimpanzees from high-dose heterologous HIV-1 challenge by DNA vaccination.
Boyer, J D; Ugen, K E; Wang, B; Agadjanyan, M; Gilbert, L; Bagarazzi, M L; Chattergoon, M; Frost, P; Javadian, A; Williams, W V; Refaeli, Y; Ciccarelli, R B; McCallus, D; Coney, L; Weiner, D B
1997-05-01
Novel approaches for the generation of more effective vaccines for HIV-1 are of significant importance. In this report we analyze the immunogenicity and efficacy of an HIV-1 DNA vaccine encoding env, rev and gag/pol in a chimpanzee model system. The immunized animals developed specific cellular and humoral immune responses. Animals were challenged with a heterologous chimpanzee titered stock of HIV-1 SF2 virus and followed for 48 weeks after challenge. Polymerase chain reaction coupled with reverse transcription (RT-PCR) results indicated infection in the control animal, whereas those animals vaccinated with the DNA constructs were protected from the establishment of infection. These studies serve as an important benchmark for the use of DNA vaccine technology for the production of protective immune responses.
Patterns of HIV/SIV Prevention and Control by Passive Antibody Immunization.
Yamamoto, Hiroyuki; Matano, Tetsuro
2016-01-01
Neutralizing antibody (NAb) responses are promising immune effectors for control of human immunodeficiency virus (HIV) infection. Protective activity and mechanisms of immunodeficiency virus-specific NAbs have been increasingly scrutinized in animals infected with simian immunodeficiency virus (SIV), chimeric simian/human immunodeficiency virus (SHIV) and related viruses. Studies on such models have unraveled a previously underscored protective potential against in vivo immunodeficiency virus replication. Pre-challenge NAb titers feasibly provide sterile protection from SIV/SHIV infection by purging the earliest onset of viral replication and likely modulate innate immune cell responses. Sufficient sub-sterile NAb titers after established infection also confer dose-dependent reduction of viremia, and in certain earlier time frames augment adaptive immune cell responses and even provide rebound-free viral control. Here, we provide an overview of the obtained patterns of SIV/SHIV protection and viral control by various types of NAb passive immunizations and discuss how these notions may be extrapolated to NAb-based clinical control of HIV infection.
Assessing immune aging in HIV-infected patients
Appay, Victor; Sauce, Delphine
2017-01-01
ABSTRACT Many of the alterations that affect innate and adaptive immune cell compartments in HIV-infected patients are reminiscent of the process of immune aging, characteristic of old age. These alterations define the immunological age of individuals and are likely to participate to the decline of immune competence with HIV disease progression. It is therefore important to characterize these changes, which point toward the accumulation of highly differentiated immunocompetent cells, associated with overall telomere length shortening, as well as understanding their etiology, especially related to the impact of chronic immune activation. Particular attention should be given to the exhaustion of primary immune resources, including haematopoietic progenitors and naïve cells, which holds the key for effective hematopoiesis and immune response induction, respectively. The alteration of these compartments during HIV infection certainly represents the foundation of the immune parallel with aging. PMID:27310730
Cotugno, Nicola; De Armas, Lesley; Pallikkuth, Suresh; Rinaldi, Stefano; Issac, Biju; Cagigi, Alberto; Rossi, Paolo; Palma, Paolo; Pahwa, Savita
2017-01-01
Despite effective antiretroviral therapy (ART), HIV-infected individuals with apparently similar clinical and immunological characteristics can vary in responsiveness to vaccinations. However, molecular mechanisms responsible for such impairment, as well as biomarkers able to predict vaccine responsiveness in HIV-infected children, remain unknown. Following the hypothesis that a B cell qualitative impairment persists in HIV-infected children (HIV) despite effective ART and phenotypic B cell immune reconstitution, the aim of the current study was to investigate B cell gene expression of HIV compared to age-matched healthy controls (HCs) and to determine whether distinct gene expression patterns could predict the ability to respond to influenza vaccine. To do so, we analyzed prevaccination transcriptional levels of a 96-gene panel in equal numbers of sort-purified B cell subsets (SPBS) isolated from peripheral blood mononuclear cells using multiplexed RT-PCR. Immune responses to H1N1 antigen were determined by hemaglutination inhibition and memory B cell ELISpot assays following trivalent-inactivated influenza vaccination (TIV) for all study participants. Although there were no differences in terms of cell frequencies of SPBS between HIV and HC, the groups were distinguishable based upon gene expression analyses. Indeed, a 28-gene signature, characterized by higher expression of genes involved in the inflammatory response and immune activation was observed in activated memory B cells (CD27 + CD21 - ) from HIV when compared to HC despite long-term viral control (>24 months). Further analysis, taking into account H1N1 responses after TIV in HIV participants, revealed that a 25-gene signature in resting memory (RM) B cells (CD27 + CD21 + ) was able to distinguish vaccine responders from non-responders (NR). In fact, prevaccination RM B cells of responders showed a higher expression of gene sets involved in B cell adaptive immune responses ( APRIL, BTK, BLIMP1 ) and
Cotugno, Nicola; De Armas, Lesley; Pallikkuth, Suresh; Rinaldi, Stefano; Issac, Biju; Cagigi, Alberto; Rossi, Paolo; Palma, Paolo; Pahwa, Savita
2017-01-01
Despite effective antiretroviral therapy (ART), HIV-infected individuals with apparently similar clinical and immunological characteristics can vary in responsiveness to vaccinations. However, molecular mechanisms responsible for such impairment, as well as biomarkers able to predict vaccine responsiveness in HIV-infected children, remain unknown. Following the hypothesis that a B cell qualitative impairment persists in HIV-infected children (HIV) despite effective ART and phenotypic B cell immune reconstitution, the aim of the current study was to investigate B cell gene expression of HIV compared to age-matched healthy controls (HCs) and to determine whether distinct gene expression patterns could predict the ability to respond to influenza vaccine. To do so, we analyzed prevaccination transcriptional levels of a 96-gene panel in equal numbers of sort-purified B cell subsets (SPBS) isolated from peripheral blood mononuclear cells using multiplexed RT-PCR. Immune responses to H1N1 antigen were determined by hemaglutination inhibition and memory B cell ELISpot assays following trivalent-inactivated influenza vaccination (TIV) for all study participants. Although there were no differences in terms of cell frequencies of SPBS between HIV and HC, the groups were distinguishable based upon gene expression analyses. Indeed, a 28-gene signature, characterized by higher expression of genes involved in the inflammatory response and immune activation was observed in activated memory B cells (CD27+CD21−) from HIV when compared to HC despite long-term viral control (>24 months). Further analysis, taking into account H1N1 responses after TIV in HIV participants, revealed that a 25-gene signature in resting memory (RM) B cells (CD27+CD21+) was able to distinguish vaccine responders from non-responders (NR). In fact, prevaccination RM B cells of responders showed a higher expression of gene sets involved in B cell adaptive immune responses (APRIL, BTK, BLIMP1) and BCR
Nonhuman TRIM5 Variants Enhance Recognition of HIV-1-Infected Cells by CD8+ T Cells
Jimenez-Moyano, Esther; Ruiz, Alba; Kløverpris, Henrik N.; Rodriguez-Plata, Maria T.; Peña, Ruth; Blondeau, Caroline; Selwood, David L.; Izquierdo-Useros, Nuria; Moris, Arnaud; Clotet, Bonaventura; Goulder, Philip; Towers, Greg J.
2016-01-01
ABSTRACT Tripartite motif-containing protein 5 (TRIM5) restricts human immunodeficiency virus type 1 (HIV-1) in a species-specific manner by uncoating viral particles while activating early innate responses. Although the contribution of TRIM5 proteins to cellular immunity has not yet been studied, their interactions with the incoming viral capsid and the cellular proteasome led us to hypothesize a role for them. Here, we investigate whether the expression of two nonhuman TRIM5 orthologs, rhesus TRIM5α (RhT5) and TRIM-cyclophilin A (TCyp), both of which are potent restrictors of HIV-1, could enhance immune recognition of infected cells by CD8+ T cells. We illustrate how TRIM5 restriction improves CD8+ T-cell-mediated HIV-1 inhibition. Moreover, when TRIM5 activity was blocked by the nonimmunosuppressive analog of cyclosporine (CsA), sarcosine-3(4-methylbenzoate)–CsA (SmBz-CsA), we found a significant reduction in CD107a/MIP-1β expression in HIV-1-specific CD8+ T cells. This finding underscores the direct link between TRIM5 restriction and activation of CD8+ T-cell responses. Interestingly, cells expressing RhT5 induced stronger CD8+ T-cell responses through the specific recognition of the HIV-1 capsid by the immune system. The underlying mechanism of this process may involve TRIM5-specific capsid recruitment to cellular proteasomes and increase peptide availability for loading and presentation of HLA class I antigens. In summary, we identified a novel function for nonhuman TRIM5 variants in cellular immunity. We hypothesize that TRIM5 can couple innate viral sensing and CD8+ T-cell activation to increase species barriers against retrovirus infection. IMPORTANCE New therapeutics to tackle HIV-1 infection should aim to combine rapid innate viral sensing and cellular immune recognition. Such strategies could prevent seeding of the viral reservoir and the immune damage that occurs during acute infection. The nonhuman TRIM5 variants, rhesus TRIM5α (RhT5) and TRIM
Gallerano, Daniela; Ndlovu, Portia; Makupe, Ian; Focke-Tejkl, Margarete; Fauland, Kerstin; Wollmann, Eva; Puchhammer-Stöckl, Elisabeth; Keller, Walter; Sibanda, Elopy; Valenta, Rudolf
2015-01-01
A comprehensive set of recombinant proteins and peptides of the proteome of HIV-1 clade C was prepared and purified and used to measure IgG, IgG-subclass, IgA and IgM responses in HIV-infected patients from Sub-Saharan Africa, where clade C is predominant. As a comparison group, HIV-infected patients from Europe were tested. African and European patients showed an almost identical antibody reactivity profile in terms of epitope specificity and involvement of IgG, IgG subclass, IgA and IgM responses. A V3-peptide of gp120 was identified as major epitope recognized by IgG1>IgG2 = IgG4>IgG3, IgA>IgM antibodies and a C-terminal peptide represented another major peptide epitope for the four IgG subclasses. By contrast, gp41-derived-peptides were mainly recognized by IgG1 but not by the other IgG subclasses, IgA or IgM. Among the non-surface proteins, protease, reverse transcriptase+RNAseH, integrase, as well as the capsid and matrix proteins were the most frequently and strongly recognized antigens which showed broad IgG subclass and IgA reactivity. Specificities and magnitudes of antibody responses in African patients were stable during disease and antiretroviral treatment, and persisted despite severe T cell loss. Using a comprehensive panel of gp120, gp41 peptides and recombinant non-surface proteins of HIV-1 clade C we found an almost identical antibody recognition profile in African and European patients regarding epitopes and involved IgG-sublass, IgA- and IgM-responses. Immune recognition of gp120 peptides and non-surface proteins involved all four IgG subclasses and was indicative of a mixed Th1/Th2 immune response. The HIV-1 clade C proteome-based test allowed diagnosis and monitoring of antibody responses in the course of HIV-infections and assessment of isotype and subclass responses. PMID:25658330
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weinberg, Adriana; Jesser, Renee D.; Edelstein, Charles L.
2004-12-05
HIV-infected patients on highly active antiretroviral therapy (HAART) have persistently decreased cytomegalovirus (CMV)-specific proliferative responses [lymphocyte proliferation assay (LPA)] in spite of increases in CD4+ T cell counts. Here we demonstrate an association between apoptosis of unstimulated peripheral blood mononuclear cells (uPBMC) and decreased CMV-LPA. HAART recipients had more apoptosis of uPBMC than controls when measured by caspases 3, 8, and 9 activities and by annexin V binding. Patients with undetectable HIV replication maintained significantly higher apoptosis of CD4+ and CD14+ cells compared to controls. CMV-LPA decreased with higher apoptosis of uPBMC in patients only. This association was independent ofmore » CD4+ cell counts or HIV replication. Furthermore, rescuing PBMC from apoptosis with crmA, but not with TRAIL- or Fas-pathway blocking agents or with other caspase inhibitors, increased CMV-LPA in HAART recipients. This effect was not observed in uninfected controls, further indicating that the down regulatory effect of apoptosis on cell-mediated immunity (CMI) was specifically associated with the HIV-infected status.« less
Yue, Ling; Pfafferott, Katja J.; Baalwa, Joshua; ...
2015-01-08
Control of virus replication in HIV-1 infection is critical to delaying disease progression. While cellular immune responses are a key determinant of control, relatively little is known about the contribution of the infecting virus to this process. To gain insight into this interplay between virus and host in viral control, we conducted a detailed analysis of two heterosexual HIV-1 subtype A transmission pairs in which female recipients sharing three HLA class I alleles exhibited contrasting clinical outcomes: R880F controlled virus replication while R463F experienced high viral loads and rapid disease progression. Near full-length single genome amplification defined the infecting transmitted/foundermore » (T/F) virus proteome and subsequent sequence evolution over the first year of infection for both acutely infected recipients. T/F virus replicative capacities were compared in vitro, while the development of the earliest cellular immune response was defined using autologous virus sequence-based peptides. The R880F T/F virus replicated significantly slower in vitro than that transmitted to R463F. While neutralizing antibody responses were similar in both subjects, during acute infection R880F mounted a broad T cell response, the most dominant components of which targeted epitopes from which escape was limited. In contrast, the primary HIV-specific T cell response in R463F was focused on just two epitopes, one of which rapidly escaped. This comprehensive study highlights both the importance of the contribution of the lower replication capacity of the transmitted/founder virus and an associated induction of a broad primary HIV-specific T cell response, which was not undermined by rapid epitope escape, to long-term viral control in HIV-1 infection. It underscores the importance of the earliest CD8 T cell response targeting regions of the virus proteome that cannot mutate without a high fitness cost, further emphasizing the need for vaccines that elicit a breadth of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yue, Ling; Pfafferott, Katja J.; Baalwa, Joshua
Control of virus replication in HIV-1 infection is critical to delaying disease progression. While cellular immune responses are a key determinant of control, relatively little is known about the contribution of the infecting virus to this process. To gain insight into this interplay between virus and host in viral control, we conducted a detailed analysis of two heterosexual HIV-1 subtype A transmission pairs in which female recipients sharing three HLA class I alleles exhibited contrasting clinical outcomes: R880F controlled virus replication while R463F experienced high viral loads and rapid disease progression. Near full-length single genome amplification defined the infecting transmitted/foundermore » (T/F) virus proteome and subsequent sequence evolution over the first year of infection for both acutely infected recipients. T/F virus replicative capacities were compared in vitro, while the development of the earliest cellular immune response was defined using autologous virus sequence-based peptides. The R880F T/F virus replicated significantly slower in vitro than that transmitted to R463F. While neutralizing antibody responses were similar in both subjects, during acute infection R880F mounted a broad T cell response, the most dominant components of which targeted epitopes from which escape was limited. In contrast, the primary HIV-specific T cell response in R463F was focused on just two epitopes, one of which rapidly escaped. This comprehensive study highlights both the importance of the contribution of the lower replication capacity of the transmitted/founder virus and an associated induction of a broad primary HIV-specific T cell response, which was not undermined by rapid epitope escape, to long-term viral control in HIV-1 infection. It underscores the importance of the earliest CD8 T cell response targeting regions of the virus proteome that cannot mutate without a high fitness cost, further emphasizing the need for vaccines that elicit a breadth of
Lohman-Payne, Barb; Slyker, Jennifer; Rowland-Jones, Sarah L.
2010-01-01
Synopsis Despite more than two decades of research, an effective vaccine that can prevent HIV-1 infection in populations exposed to the virus remains elusive. In the pursuit of an HIV-1 vaccine, does prevention of exposure to maternal HIV-1 in utero, at birth or in early life through breast-milk require special consideration? In this article we will review what is known about the immune mechanisms of susceptibility and resistance to mother-to-child transmission (MTCT) of HIV-1 and will summarise studies that have used passive or active immunisation strategies to interrupt -MTCT of HIV-1. We will also describe potentially modifiable infectious co-factors that may enhance transmission and/or disease progression (especially in the developing world). Ultimately an effective prophylactic vaccine against HIV-1 infection will need to be deployed as part of the Extended Programme of Immunisation (EPI) recommended by the World Health Organisation (WHO) for use in developing countries, so it is important to understand how the infant immune system responds to HIV-1 antigens, both in natural infection and presented by candidate vaccines. PMID:21078451
Baden, Lindsey R; Walsh, Stephen R; Seaman, Michael S; Cohen, Yehuda Z; Johnson, Jennifer A; Licona, J Humberto; Filter, Rachel D; Kleinjan, Jane A; Gothing, Jon A; Jennings, Julia; Peter, Lauren; Nkolola, Joseph; Abbink, Peter; Borducchi, Erica N; Kirilova, Marinela; Stephenson, Kathryn E; Pegu, Poonam; Eller, Michael A; Trinh, Hung V; Rao, Mangala; Ake, Julie A; Sarnecki, Michal; Nijs, Steven; Callewaert, Katleen; Schuitemaker, Hanneke; Hendriks, Jenny; Pau, Maria G; Tomaka, Frank; Korber, Bette T; Alter, Galit; Dolin, Raphael; Earl, Patricia L; Moss, Bernard; Michael, Nelson L; Robb, Merlin L; Barouch, Dan H
2018-04-13
Mosaic immunogens are bioinformatically engineered HIV-1 sequences designed to elicit clade independent coverage against globally circulating HIV-1 strains. This Phase 1 double-blind, randomized, placebo-controlled trial enrolled healthy HIV uninfected adults who received two doses of a modified vaccinia Ankara (MVA) vectored HIV-1 bivalent mosaic immunogen vaccine or placebo on days 0 and 84. Two groups were enrolled: those who were HIV-1 vaccine naïve (N=15) and those who had received an HIV-1 vaccine four to six years earlier (Ad26.ENVA.01, N=10). We performed pre-specified blinded cellular and humoral immunogenicity analyses at days 0, 14, 28, 84, 98, 112, 168, 270, and 365. All 50 planned vaccinations were administered. Vaccination was safe and generally well tolerated. No vaccine-related serious adverse events occurred. Both cellular and humoral cross-clade immune responses were elicited after one or two vaccinations in all participants in the HIV-1 vaccine naïve group. Env-specific responses were induced after a single immunization in nearly all subjects who had previously received the prototype Ad26.ENVA.01 vaccine. No safety concerns were identified and multi-clade HIV-1 specific immune responses were elicited. http://www.clinicaltrials.gov/ Identifier: NCT02218125.
Expanded breadth of the T-cell response to mosaic HIV-1 envelope DNA vaccination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Korber, Bette; Fischer, William; Wallstrom, Timothy
2009-01-01
An effective AIDS vaccine must control highly diverse circulating strains of HIV-1. Among HIV -I gene products, the envelope (Env) protein contains variable as well as conserved regions. In this report, an informatic approach to the design of T-cell vaccines directed to HIV -I Env M group global sequences was tested. Synthetic Env antigens were designed to express mosaics that maximize the inclusion of common potential Tcell epitope (PTE) 9-mers and minimize the inclusion of rare epitopes likely to elicit strain-specific responses. DNA vaccines were evaluated using intracellular cytokine staining (ICS) in inbred mice with a standardized panel of highlymore » conserved 15-mer PTE peptides. I, 2 and 3 mosaic sets were developed that increased theoretical epitope coverage. The breadth and magnitude ofT-cell immunity stimulated by these vaccines were compared to natural strain Env's; additional comparisons were performed on mutant Env's, including gpl60 or gpl45 with or without V regions and gp41 deletions. Among them, the 2 or 3 mosaic Env sets elicited the optimal CD4 and CD8 responses. These responses were most evident in CD8 T cells; the 3 mosaic set elicited responses to an average of 8 peptide pools compared to 2 pools for a set of3 natural Env's. Synthetic mosaic HIV -I antigens can therefore induce T-cell responses with expanded breadth and may facilitate the development of effective T -cell-based HIV -1 vaccines.« less
Mucosal and systemic anti-HIV immunity controlled by A20 in mouse dendritic cells.
Hong, Bangxing; Song, Xiao-Tong; Rollins, Lisa; Berry, Lindsey; Huang, Xue F; Chen, Si-Yi
2011-02-01
Both mucosal and systemic immune responses are required for preventing or containing HIV transmission and chronic infection. However, currently described vaccination approaches are largely ineffective in inducing both mucosal and systemic responses. In this study, we found that the ubiquitin-editing enzyme A20--an inducible feedback inhibitor of the TNFR, RIG-I, and TLR signaling pathways that broadly controls the maturation, cytokine production, and immunostimulatory potency of DCs--restricted systemically immunized DCs to induce both robust mucosal and systemic HIV-specific cellular and humoral responses. Mechanistic studies revealed that A20 regulated DC production of retinoic acid and proinflammatory cytokines, inhibiting the expression of gut-homing receptors on T and B cells. Furthermore, A20-silenced, hyperactivated DCs exhibited an enhanced homing capacity to draining and gut-associated lymphoid tissues (GALTs) after systemic administration. Thus, this study provides insights into the role of A20 in innate immunity. This work may allow the development of an efficient HIV vaccination strategy that is capable of inducing both robust systemic and mucosal anti-HIV cellular and humoral responses.
Drewes, Julia L.; Szeto, Gregory L.; Engle, Elizabeth L.; Liao, Zhaohao; Shearer, Gene M.; Zink, M. Christine; Graham, David R.
2014-01-01
HIV immune pathogenesis is postulated to involve two major mechanisms: 1) chronic innate immune responses that drive T cell activation and apoptosis and 2) induction of immune regulators that suppress T cell function and proliferation. Both arms are elevated chronically in lymphoid tissues of non-natural hosts, which ultimately develop AIDS. However, these mechanisms are not elevated chronically in natural hosts of SIV infection that avert immune pathogenesis despite similarly high viral loads. In this study we investigated whether minocycline could modulate these pathogenic antiviral responses in non-natural hosts of HIV and SIV. We found that minocycline attenuated in vitro induction of type I interferon (IFN) and the IFN-stimulated genes indoleamine 2,3-dioxygenase (IDO1) and TNF-related apoptosis inducing ligand (TRAIL) in human plasmacytoid dendritic cells and PBMCs exposed to aldrithiol-2 inactivated HIV or infectious influenza virus. Activation-induced TRAIL and expression of cytotoxic T-lymphocyte antigen 4 (CTLA-4) in isolated CD4+ T cells were also reduced by minocycline. Translation of these in vitro findings to in vivo effects, however, were mixed as minocycline significantly reduced markers of activation and activation-induced cell death (CD25, Fas, caspase-3) but did not affect expression of IFNβ or the IFN-stimulated genes IDO1, FasL, or Mx in the spleens of chronically SIV-infected pigtailed macaques. TRAIL expression, reflecting the mixed effects of minocycline on activation and type I IFN stimuli, was reduced by half, but this change was not significant. These results show that minocycline administered after infection may protect against aspects of activation-induced cell death during HIV/SIV immune disease, but that in vitro effects of minocycline on type I IFN responses are not recapitulated in a rapid progressor model in vivo. PMID:24732038
Reeves, Daniel B; Peterson, Christopher W; Kiem, Hans-Peter; Schiffer, Joshua T
2017-07-01
Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the "Berlin patient" remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we studied the impact
Peterson, Christopher W.; Kiem, Hans-Peter
2017-01-01
ABSTRACT Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the “Berlin patient” remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we
Yao, X-D; Omange, R W; Henrick, B M; Lester, R T; Kimani, J; Ball, T B; Plummer, F A; Rosenthal, K L
2014-03-01
Cohort studies of female commercial sex workers (CSWs) in Kenya were among the first to identify highly HIV-1-exposed seronegative (HESN) individuals. As natural resistance is usually mediated by innate immune mechanisms, we focused on determining whether expression and function of innate signaling pathways were altered locally in the genital mucosa of HESN CSWs. Our results demonstrated that selected pattern-recognition receptors (PRRs) were significantly reduced in expression in cervical mononuclear cells (CMCs) from HESN compared with the new HIV-negative (HIV-N) and HIV-positive (HIV-P) groups. Although baseline levels of secreted cytokines were reduced in CMCs of HESN, they were highly stimulated following exposure to ssRNA40 in vitro. Importantly, cervical epithelial cells from HESN also expressed reduced levels of PRRs, but Toll-like receptor 3 (TLR3) and TLR7 as well as nuclear factor-κB and activator protein 1 were highly expressed and activated. Lastly, inflammatory cytokines interleukin (IL)-1β, IL-8, and RANTES (regulated and normal T cell expressed and secreted) were detected at lower levels in cervicovaginal lavage of HESN compared with the HIV-N and HIV-P groups. Overall, our study reveals a local microenvironment of HIV resistance in the genital mucosa consisting of a finely controlled balance of basal immune quiescence with a focused and potent innate anti-viral response critical to resistance to sexual transmission of HIV-1.
Dynamics of an HIV-1 infection model with cell mediated immunity
NASA Astrophysics Data System (ADS)
Yu, Pei; Huang, Jianing; Jiang, Jiao
2014-10-01
In this paper, we study the dynamics of an improved mathematical model on HIV-1 virus with cell mediated immunity. This new 5-dimensional model is based on the combination of a basic 3-dimensional HIV-1 model and a 4-dimensional immunity response model, which more realistically describes dynamics between the uninfected cells, infected cells, virus, the CTL response cells and CTL effector cells. Our 5-dimensional model may be reduced to the 4-dimensional model by applying a quasi-steady state assumption on the variable of virus. However, it is shown in this paper that virus is necessary to be involved in the modeling, and that a quasi-steady state assumption should be applied carefully, which may miss some important dynamical behavior of the system. Detailed bifurcation analysis is given to show that the system has three equilibrium solutions, namely the infection-free equilibrium, the infectious equilibrium without CTL, and the infectious equilibrium with CTL, and a series of bifurcations including two transcritical bifurcations and one or two possible Hopf bifurcations occur from these three equilibria as the basic reproduction number is varied. The mathematical methods applied in this paper include characteristic equations, Routh-Hurwitz condition, fluctuation lemma, Lyapunov function and computation of normal forms. Numerical simulation is also presented to demonstrate the applicability of the theoretical predictions.
Interferon-alpha, immune activation and immune dysfunction in treated HIV infection
Cha, Lilian; Berry, Cassandra M; Nolan, David; Castley, Allison; Fernandez, Sonia; French, Martyn A
2014-01-01
Type I interferons (IFNs) exert anti-viral effects through the induction of numerous IFN-stimulated genes and an immunomodulatory effect on innate and adaptive immune responses. This is beneficial in controlling virus infections but prolonged IFN-α activity in persistent virus infections, such as HIV infection, may contribute to immune activation and have a detrimental effect on the function of monocytes and T and B lymphocytes. Activation of monocytes, associated with increased IFN-α activity, contributes to atherosclerotic vascular disease, brain disease and other ‘age-related diseases' in HIV patients treated with long-term antiretroviral therapy (ART). In HIV patients receiving ART, the anti-viral effects of IFN-α therapy have the potential to contribute to eradication of HIV infection while IFN-α inhibitor therapy is under investigation for the treatment of immune activation. The management of HIV patients receiving ART will be improved by understanding more about the opposing effects of IFN-α on HIV infection and disease and by developing methods to assess IFN-α activity in clinical practice. PMID:25505958
Host-Specific Adaptation of HIV-1 Subtype B in the Japanese Population
Chikata, Takayuki; Carlson, Jonathan M.; Tamura, Yoshiko; Borghan, Mohamed Ali; Naruto, Takuya; Hashimoto, Masao; Murakoshi, Hayato; Le, Anh Q.; Mallal, Simon; John, Mina; Gatanaga, Hiroyuki; Oka, Shinichi; Brumme, Zabrina L.
2014-01-01
ABSTRACT The extent to which HIV-1 clade B strains exhibit population-specific adaptations to host HLA alleles remains incompletely known, in part due to incomplete characterization of HLA-associated HIV-1 polymorphisms (HLA-APs) in different global populations. Moreover, it remains unknown to what extent the same HLA alleles may drive significantly different escape pathways across populations. As the Japanese population exhibits distinctive HLA class I allele distributions, comparative analysis of HLA-APs between HIV-1 clade B-infected Japanese and non-Asian cohorts could shed light on these questions. However, HLA-APs remain incompletely mapped in Japan. In a cohort of 430 treatment-naive Japanese with chronic HIV-1 clade B infection, we identified 284 HLA-APs in Gag, Pol, and Nef using phylogenetically corrected methods. The number of HLA-associated substitutions in Pol, notably those restricted by HLA-B*52:01, was weakly inversely correlated with the plasma viral load (pVL), suggesting that the transmission and persistence of B*52:01-driven Pol mutations could modulate the pVL. Differential selection of HLA-APs between HLA subtype members, including those differing only with respect to substitutions outside the peptide-binding groove, was observed, meriting further investigation as to their mechanisms of selection. Notably, two-thirds of HLA-APs identified in Japan had not been reported in previous studies of predominantly Caucasian cohorts and were attributable to HLA alleles unique to, or enriched in, Japan. We also identified 71 cases where the same HLA allele drove significantly different escape pathways in Japan versus predominantly Caucasian cohorts. Our results underscore the distinct global evolution of HIV-1 clade B as a result of host population-specific cellular immune pressures. IMPORTANCE Cytotoxic T lymphocyte (CTL) escape mutations in HIV-1 are broadly predictable based on the HLA class I alleles expressed by the host. Because HLA allele
Host-specific adaptation of HIV-1 subtype B in the Japanese population.
Chikata, Takayuki; Carlson, Jonathan M; Tamura, Yoshiko; Borghan, Mohamed Ali; Naruto, Takuya; Hashimoto, Masao; Murakoshi, Hayato; Le, Anh Q; Mallal, Simon; John, Mina; Gatanaga, Hiroyuki; Oka, Shinichi; Brumme, Zabrina L; Takiguchi, Masafumi
2014-05-01
The extent to which HIV-1 clade B strains exhibit population-specific adaptations to host HLA alleles remains incompletely known, in part due to incomplete characterization of HLA-associated HIV-1 polymorphisms (HLA-APs) in different global populations. Moreover, it remains unknown to what extent the same HLA alleles may drive significantly different escape pathways across populations. As the Japanese population exhibits distinctive HLA class I allele distributions, comparative analysis of HLA-APs between HIV-1 clade B-infected Japanese and non-Asian cohorts could shed light on these questions. However, HLA-APs remain incompletely mapped in Japan. In a cohort of 430 treatment-naive Japanese with chronic HIV-1 clade B infection, we identified 284 HLA-APs in Gag, Pol, and Nef using phylogenetically corrected methods. The number of HLA-associated substitutions in Pol, notably those restricted by HLA-B*52:01, was weakly inversely correlated with the plasma viral load (pVL), suggesting that the transmission and persistence of B*52:01-driven Pol mutations could modulate the pVL. Differential selection of HLA-APs between HLA subtype members, including those differing only with respect to substitutions outside the peptide-binding groove, was observed, meriting further investigation as to their mechanisms of selection. Notably, two-thirds of HLA-APs identified in Japan had not been reported in previous studies of predominantly Caucasian cohorts and were attributable to HLA alleles unique to, or enriched in, Japan. We also identified 71 cases where the same HLA allele drove significantly different escape pathways in Japan versus predominantly Caucasian cohorts. Our results underscore the distinct global evolution of HIV-1 clade B as a result of host population-specific cellular immune pressures. Cytotoxic T lymphocyte (CTL) escape mutations in HIV-1 are broadly predictable based on the HLA class I alleles expressed by the host. Because HLA allele distributions differ among
Maeto, Cynthia; Rodríguez, Ana María; Holgado, María Pía; Falivene, Juliana; Gherardi, María Magdalena
2014-01-01
Induction of local antiviral immune responses at the mucosal portal surfaces where HIV-1 and other viral pathogens are usually first encountered remains a primary goal for most vaccines against mucosally acquired viral infections. Exploring mucosal immunization regimes in order to find optimal vector combinations and also appropriate mucosal adjuvants in the HIV vaccine development is decisive. In this study we analyzed the interaction of DNA-IL-12 and cholera toxin B subunit (CTB) after their mucosal administration in DNA prime/MVA boost intranasal regimes, defining the cooperation of both adjuvants to enhance immune responses against the HIV-1 Env antigen. Our results demonstrated that nasal mucosal DNA/MVA immunization schemes can be effectively improved by the co-delivery of DNA-IL-12 plus CTB inducing elevated HIV-specific CD8 responses in spleen and more importantly in genital tract and genito-rectal draining lymph nodes. Remarkably, these CTL responses were of superior quality showing higher avidity, polyfunctionality and a broader cytokine profile. After IL-12+CTB co-delivery, the cellular responses induced showed an enhanced breadth recognizing with higher efficiency Env peptides from different subtypes. Even more, an in vivo CTL cytolytic assay demonstrated the higher specific CD8 T-cell performance after the IL-12+CTB immunization showing in an indirect manner its potential protective capacity. Improvements observed were maintained during the memory phase where we found higher proportions of specific central memory and T memory stem-like cells T-cell subpopulations. Together, our data show that DNA-IL-12 plus CTB can be effectively employed acting as mucosal adjuvants during DNA prime/MVA boost intranasal vaccinations, enhancing magnitude and quality of HIV-specific systemic and mucosal immune responses.
Broadly neutralizing antibody specificities detected in the genital tract of HIV-1 infected women.
Mkhize, Nonhlanhla N; Durgiah, Raveshni; Ashley, Vicki; Archary, Derseree; Garrett, Nigel J; Karim, Quarraisha Abdool; Karim, Salim S Abdool; Moore, Penny L; Yates, Nicole; Passmore, Jo-Ann S; Tomaras, Georgia D; Morris, Lynn
2016-04-24
Broadly neutralizing antibodies (bNAbs) targeting conserved epitopes on the HIV envelope glycoprotein have been identified in blood from HIV-1 infected women. We investigated whether antibodies in the genital tract from these women share similar epitope specificities and functional profiles as those in blood. Immunoglobulin (Ig)G and IgA antibodies were isolated from cervicovaginal lavages or Softcups from 13 HIV-infected women in the CAPRISA cohort using Protein G and Peptide M, respectively. Binding antibodies to envelope antigens were quantified by ELISA and binding antibody multiplex assay. Neutralizing antibody titers and epitope targets were measured using the TZM-bl assay with Env-pseudotyped wild-type and mutated viruses. HIV-specific IgG, but not IgA, was detected in genital secretions and the ratio of total IgG to HIV-specific IgG was similar to plasma. HIV-specific IgG reacted with multiple envelope antigens, including V1V2, gp120, gp140 and gp41. Two women had high plasma titers of HIV-specific IgG3 which was also detected in their genital tract samples. IgG from the genital tract had neutralizing activity against both Tier 1 and Tier 2 primary HIV-isolates. Antibodies targeting well known glycan epitopes and the membrane proximal region of gp41 were detected in genital secretions, and matched specificities in plasma. Women with plasma bNAbs have overlapping specificities in their genital secretions, indicating that these predominantly IgG isotype antibodies may transudate from blood to the genital tract. These data provide evidence that induction of systemic HIV-specific bNAbs can lead to antiviral immunity at the portal of entry.
Vpr overcomes macrophage-specific restriction of HIV-1 Env expression and virion production
Mashiba, Michael; Collins, David R.; Terry, Valeri H.; Collins, Kathleen L.
2014-01-01
Summary The HIV-1 accessory protein Vpr enhances infection of primary macrophages through unknown mechanisms. Recent studies demonstrated that Vpr interactions with the cellular DCAF1-DDB1-CUL4 E3 ubiquitin ligase complex limit activation of innate immunity and interferon (IFN) induction. We describe a restriction mechanism that targets the HIV-1 envelope protein Env but is overcome by Vpr and its interaction with DCAF1. This restriction is active in the absence of Vpr in HIV-1-infected primary macrophages and macrophage-epithelial cell heterokaryons, but not epithelial cell lines. HIV-1-infected macrophages lacking Vpr express more IFN following infection, target Env for lysosomal degradation and produce fewer Env-containing virions. Conversely, Vpr expression reduces IFN induction, rescues Env expression and enhances virion release. Addition of IFN or silencing DCAF1 reduces the amount of cell-associated Env and virion production in wild-type HIV-1-infected primary macrophages. These findings provide insight into an IFN-stimulated macrophage-specific restriction pathway targeting HIV-1 Env that is counteracted by Vpr. PMID:25464830
Li, Li; Wang, Wei; Pan, Hong; Ma, Ge; Shi, Xinyi; Xie, Hui; Liu, Xiaoan; Ding, Qiang; Zhou, Wenbin; Wang, Shui
2017-01-31
Minimally invasive therapies, such as microwave ablation (MWA), are widely used for the treatment of solid tumors. Previous studies suggest that MWA is feasible for the treatment of small breast cancer, and thermal ablation may induce adaptive antitumor immunity. However, the induced immune responses are mostly weak, and the immunomodulation effects of MWA in breast cancer are unclear. Immunostimulant OK-432 can induce tumor-specific T-cell responses and may augment the immunity induced by MWA. We treated 4T1 breast cancer bearing BALB/c mice with MWA, OK-432, MWA plus OK-432, or left without treatment. Survival time was evaluated with the Kaplan-Meyer method comparing survival curves by log-rank test. On day 25 after ablation, surviving mice received tumor rechallenge, and the rechallenged tumor volumes were calculated every 5 days. Immunohistochemistry and flow cytometry were used to evaluate the T-cell immune responses in ablated tissues and spleens. The tumor-specific immunity was assessed by enzyme-linked immunospot assays. Besides, the cytokine patterns were identified from enzyme-linked immunosorbent assay. Microwave ablation plus OK-432 resulted in longer survival than single treatment and protect most surviving mice from tumor rechallenge. Both local and systemic T-cell responses were induced by MWA and were further enhanced by subsequent administration of OK-432. Moreover, the combination of MWA and OK-432 induced stronger tumor-specific immune responses than MWA alone. In addition, OK-432 and MWA synergistically promoted the production of Th1-type but not Th2-type cytokines, and polarized T-cell responses to Th1-dominant state. The T-cell immune responses were activated by MWA in breast cancer. Furthermore, the combination of MWA and OK-432 induced Th1-type response and elicited specific antitumor immunity.
Translating insights from persistent LCMV infection into anti-HIV immunity.
Wilson, Elizabeth B; Brooks, David G
2010-12-01
Human immunodeficiency virus (HIV) is a major global health concern with more than 30 million individuals currently infected worldwide. To date, attempts to stimulate protective immunity to viral components of HIV have been unsuccessful in preventing or clearing infection. Lymphocytic choriomeningitis virus (LCMV) is an established murine model of persistent viral infection that has been instrumental in illuminating several critical aspects of antiviral immunity. Although virologically the course of LCMV infection differs significantly from HIV, the immune responses and regulatory mechanisms elicited by these two viruses are markedly similar. In this review we discuss important recent findings in the LCMV model, highlighting the role of host-derived proteins in shaping immune responses to persistent infections, and explore the therapeutic potential of manipulating these pathways to enhance HIV vaccination strategies.
Natural Immunity to HIV: A Template for Vaccine Strategies.
Fourcade, Lyvia; Poudrier, Johanne; Roger, Michel
2018-04-23
Africa accounts for the majority of global human immunodeficiency virus (HIV) infections, most of which affect women through heterosexual intercourse. Currently, there is no cure for HIV and the development of vaccines and microbicides remains the best solution to eradicate the pandemic. We and others have identified HIV highly-exposed seronegative (HESN) individuals among African female commercial sex workers (CSWs). Analyses of genital samples from HESNs have demonstrated potent innate and anti-inflammatory conditions, HIV-specific CD4⁺ and CD8⁺ T-cells as well as immunoglobulins (Igs), and increased regulatory cell populations, all of which support a delicate balance between strength and control against HIV intrusion. Moreover, we have recently shown that frequencies of innate marginal zone (MZ) B-cells are decreased in the blood of HESNs when compared to HIV-uninfected non-CSW women, suggesting their recruitment to peripheral sites. This coincides with the fact that levels of B lymphocyte stimulator (BLyS/BAFF), known to shape the MZ pool and whose overexpression leads to MZ deregulation in HIV-infected progressors, are significantly lower in the blood of HESNs when compared to both HIV-infected CSWs and HIV-uninfected non-CSW women. Interestingly, MZ B-cells can bind HIV gp120 and produce specific IgG and IgA, and have a propensity for B regulatory potential, which could help both the fight against HIV and maintenance of low inflammatory conditions in HESNs. HESN individuals provide an exceptional opportunity to identify important clues for the development of protective devices, and efforts should aim at soliciting immune responses observed in the context of their natural immunity to HIV.
Freel, Stephanie A.; Picking, Ralph A.; Ferrari, Guido; Ding, Haitao; Ochsenbauer, Christina; Kappes, John C.; Kirchherr, Jennifer L.; Soderberg, Kelly A.; Weinhold, Kent J.; Cunningham, Coleen K.; Denny, Thomas N.; Crump, John A.; Cohen, Myron S.; McMichael, Andrew J.; Haynes, Barton F.
2012-01-01
CD8-mediated virus inhibition can be detected in HIV-1-positive subjects who naturally control virus replication. Characterizing the inhibitory function of CD8+ T cells during acute HIV-1 infection (AHI) can elucidate the nature of the CD8+ responses that can be rapidly elicited and that contribute to virus control. We examined the timing and HIV-1 antigen specificity of antiviral CD8+ T cells during AHI. Autologous and heterologous CD8+ T cell antiviral functions were assessed longitudinally during AHI in five donors from the CHAVI 001 cohort using a CD8+ T cell-mediated virus inhibition assay (CD8 VIA) and transmitted/founder (T/F) viruses. Potent CD8+ antiviral responses against heterologous T/F viruses appeared during AHI at the first time point sampled in each of the 5 donors (Fiebig stages 1/2 to 5). Inhibition of an autologous T/F virus was durable to 48 weeks; however, inhibition of heterologous responses declined concurrent with the resolution of viremia. HIV-1 viruses from 6 months postinfection were more resistant to CD8+-mediated virus inhibition than cognate T/F viruses, demonstrating that the virus escapes early from CD8+ T cell-mediated inhibition of virus replication. CD8+ T cell antigen-specific subsets mediated inhibition of T/F virus replication via soluble components, and these soluble responses were stimulated by peptide pools that include epitopes that were shown to drive HIV-1 escape during AHI. These data provide insights into the mechanisms of CD8-mediated virus inhibition and suggest that functional analyses will be important for determining whether similar antigen-specific virus inhibition can be induced by T cell-directed vaccine strategies. PMID:22514337
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-01-01
BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-12-01
Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.
Yong, Michelle K; Cameron, Paul U; Spelman, Tim; Elliott, Julian H; Fairley, Christopher K; Boyle, Jeffrey; Miyamasu, Misato; Lewin, Sharon R
2016-01-01
HIV infection is characterised by persistent immune dysfunction of both the adaptive and innate immune responses. The aim of this study was to evaluate these responses using a novel high throughput assay in healthy controls and HIV-infected individuals prior to and following anti-retroviral treatment (ART). Cross-sectional study. Whole blood was assessed using the QuantiFERON Monitor® (QFM) assay containing adaptive and innate immunostimulants. Interferon (IFN)-γ levels (IU/mL) were measured by enzyme-linked immunosorbent assay (ELISA). We recruited HIV-infected participants (n = 20 off ART and viremic; n = 59 on suppressive ART) and HIV-uninfected controls (n = 229). Median IFN-γ production was significantly higher in HIV-infected participants compared to controls (IFN-γ 512 vs 223 IU/ml, p<0.0001), but within the HIV-infected participants there was no difference between those on or off ART (median IFN-γ 512 vs 593 IU/ml p = 0.94). Amongst the HIV-infected participants, IFN-γ production was higher in individuals with CD4 count>350 compared to <350 cells/μL (IFN-γ IU/ml 561 vs 259 p = 0.02) and in males compared to females (IFN-γ 542 vs 77 IU/ml p = 0.04). There were no associations between IFN-γ production and age, plasma HIV RNA, nadir CD4 count or duration of HIV infection. Using a multivariable analysis, neither CD4 nor sex were independently predictive of IFN-γ production. Using a high throughput assay which assesses both adaptive and innate immune function, we showed elevated IFN-γ production in HIV-infected patients both on and off ART. Further research is warranted to determine if changes in QuantiFERON Monitor® are associated with clinical outcomes.
Surenaud, Mathieu; Lacabaratz, Christine; Zurawski, Gérard; Lévy, Yves; Lelièvre, Jean-Daniel
2017-10-01
Development of a safe, effective and globally affordable Human Immunodeficiency Virus strain 1 (HIV-1) vaccine offers the best hope for future control of the HIV-1 pandemic. However, with the exception of the recent RV144 trial, which elicited a modest level of protection against infection, no vaccine candidate has shown efficacy in preventing HIV-1 infection or in controlling virus replication in humans. There is also a great need for a successful immunotherapeutic vaccine since combination antiretroviral therapy (cART) does not eliminate the reservoir of HIV-infected cells. But to date, no vaccine candidate has proven to significantly alter the natural history of an individual with HIV-1 infection. Areas covered: For over 25 years, the ANRS (France Recherche Nord&Sud Sida-HIV hépatites) has been committed to an original program combining basic science and clinical research developing an epitope-based vaccine strategy to induce a multiepitopic cellular response against HIV-1. This review describes the evolution of concepts, based on strategies using HIV-1 lipopeptides towards the use of dendritic cell (DC) manipulation. Expert commentary: Understanding the crucial role of DCs in immune responses allowed moving from the non-specific administration of HIV-1 sequences with lipopeptides to DC-based vaccines. These DC-targeting strategies should improve HIV-1 vaccine efficacy.
Leitman, Ellen M; Thobakgale, Christina F; Adland, Emily; Ansari, M Azim; Raghwani, Jayna; Prendergast, Andrew J; Tudor-Williams, Gareth; Kiepiela, Photini; Hemelaar, Joris; Brener, Jacqui; Tsai, Ming-Han; Mori, Masahiko; Riddell, Lynn; Luzzi, Graz; Jooste, Pieter; Ndung'u, Thumbi; Walker, Bruce D; Pybus, Oliver G; Kellam, Paul; Naranbhai, Vivek; Matthews, Philippa C; Gall, Astrid; Goulder, Philip J R
2017-11-06
Recent studies have suggested greater HIV cure potential among infected children than adults. A major obstacle to HIV eradication in adults is that the viral reservoir is largely comprised of HIV-specific cytotoxic T lymphocyte (CTL) escape variants. We here evaluate the potential for CTL in HIV-infected slow-progressor children to play an effective role in "shock-and-kill" cure strategies. Two distinct subgroups of children were identified on the basis of viral load. Unexpectedly, in both groups, as in adults, HIV-specific CTL drove the selection of escape variants across a range of epitopes within the first weeks of infection. However, in HIV-infected children, but not adults, de novo autologous variant-specific CTL responses were generated, enabling the pediatric immune system to "corner" the virus. Thus, even when escape variants are selected in early infection, the capacity in children to generate variant-specific anti-HIV CTL responses maintains the potential for CTL to contribute to effective shock-and-kill cure strategies in pediatric HIV infection. © 2017 Leitman et al.
Population-Level Immune-Mediated Adaptation in HIV-1 Polymerase during the North American Epidemic
Kinloch, Natalie N.; MacMillan, Daniel R.; Le, Anh Q.; Cotton, Laura A.; Bangsberg, David R.; Buchbinder, Susan; Carrington, Mary; Fuchs, Jonathan; Harrigan, P. Richard; Koblin, Beryl; Kushel, Margot; Markowitz, Martin; Mayer, Kenneth; Milloy, M. J.; Schechter, Martin T.; Wagner, Theresa; Walker, Bruce D.; Carlson, Jonathan M.; Poon, Art F. Y.
2015-01-01
ABSTRACT Human leukocyte antigen (HLA) class I-associated polymorphisms in HIV-1 that persist upon transmission to HLA-mismatched hosts may spread in the population as the epidemic progresses. Transmission of HIV-1 sequences containing such adaptations may undermine cellular immune responses to the incoming virus in future hosts. Building upon previous work, we investigated the extent of HLA-associated polymorphism accumulation in HIV-1 polymerase (Pol) through comparative analysis of linked HIV-1/HLA class I genotypes sampled during historic (1979 to 1989; n = 338) and modern (2001 to 2011; n = 278) eras from across North America (Vancouver, BC, Canada; Boston, MA; New York, NY; and San Francisco, CA). Phylogenies inferred from historic and modern HIV-1 Pol sequences were star-like in shape, with an inferred most recent common ancestor (epidemic founder virus) sequence nearly identical to the modern North American subtype B consensus sequence. Nevertheless, modern HIV-1 Pol sequences exhibited roughly 2-fold-higher patristic (tip-to-tip) genetic distances than historic sequences, with HLA pressures likely driving ongoing diversification. Moreover, the frequencies of published HLA-associated polymorphisms in individuals lacking the selecting HLA class I allele was on average ∼2.5-fold higher in the modern than in the historic era, supporting their spread in circulation, though some remained stable in frequency during this time. Notably, polymorphisms restricted by protective HLA alleles appear to be spreading to a greater relative extent than others, though these increases are generally of modest absolute magnitude. However, despite evidence of polymorphism spread, North American hosts generally remain at relatively low risk of acquiring an HIV-1 polymerase sequence substantially preadapted to their HLA profiles, even in the present era. IMPORTANCE HLA class I-restricted cytotoxic T-lymphocyte (CTL) escape mutations in HIV-1 that persist upon transmission may
Taylor, Jared P; Cash, Melanie N; Santostefano, Katherine E; Nakanishi, Mahito; Terada, Naohiro; Wallet, Mark A
2018-02-13
The IFN-stimulated gene ubiquitin-specific proteinase 18 (USP18) encodes a protein that negatively regulates T1 IFN signaling via stearic inhibition of JAK1 recruitment to the IFN-α receptor 2 subunit (IFNAR2). Here, we demonstrate that USP18 expression is induced by HIV-1 in a T1 IFN-dependent manner. Experimental depletion of USP18 by clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing results in a significant restriction of HIV-1 replication in an induced pluripotent stem cell (iPSC)-derived macrophage model. In the absence of USP18, macrophages have increased responsiveness to stimulation with T1 IFNs with prolonged phosphorylation of STAT1 and STAT2 and increased expression of IFN-stimulated genes that are key for antiviral responses. Interestingly, HIV-1 requires some signaling through the T1 IFN receptor to replicate efficiently because a neutralizing antibody that inhibits T1 IFN activity reduces HIV-1 replication rate in monocyte-derived macrophages. USP18 induction by HIV-1 tunes the IFN response to optimal levels allowing for efficient transcription from the HIV-1 LTR promoter while minimizing the T1 IFN-induced antiviral response that would otherwise restrict viral replication and spread. Finally, iPSC and CRISPR/Cas9 gene targeting offer a powerful tool to study host factors that regulate innate immune responses. ©2018 Society for Leukocyte Biology.
Weinberg, Adriana; Muresan, Petronella; Richardson, Kelly; Fenton, Terence; Dominguez, Teresa; Bloom, Anthony; Watts, D Heather; Abzug, Mark J; Nachman, Sharon A; Levin, Myron J
2015-11-01
We investigated the Th1 protective and regulatory T and B cell (Treg and Breg) responses to pH1N1 monovalent influenza vaccine (IIV1) in HIV-infected pregnant women on combination antiretroviral therapy (cART). Peripheral blood mononuclear cells (PBMCs) from 52 study participants were cryopreserved before and after vaccination and analyzed by flow cytometry. pH1N1-specific Th1, Treg, and Breg responses were measured in PBMCs after in vitro stimulation with pH1N1 and control antigen. The cohort analysis did not detect changes in pH1N1-Th1, Treg, or Breg subsets postvaccination. However, individual analyses distinguished subjects who mounted vigorous Th1 responses postvaccination from others who did not. Postvaccination, high pH1N1-Th1 correlated with high pH1N1-Treg and Breg responses, suggesting that low influenza effector responses did not result from excessive vaccine-induced immune regulation. High postvaccination pH1N1-Th1 responses correlated with baseline high PHA- and pH1N1-IFN-γ ELISpot and circulating CD4(+)CD39(+)% and CD8(+)CD39(+)% Treg, with low CD8(+) cell numbers and CD19(+)FOXP3(+)% Breg, but not with CD4(+) cell numbers or HIV viral load. These data highlight the heterogeneity of T cell responses to vaccines in HIV-infected individuals on cART. Predictors of robust Th1 responses to IIV include CD8(+) cell numbers, T cell functionality, and circulating Breg and Treg.
Re, Maria Carla; Schiavone, Pasqua; Bon, Isabella; Vitone, Francesca; De Crignis, Elisa; Biagetti, Carlo; Gibellini, Davide
2010-11-01
To evaluate the evolution of antibody avidity and Western blot reactivity in recently infected HIV-1 subjects and to study the impact of highly active antiretroviral therapy (HAART) on avidity maturation of HIV-1-specific immunoglobulin G (IgG) in patients with recent HIV-1 infection. Thirty-six HIV-1 seroconverters were enrolled in this study and followed longitudinally over 24 months to evaluate if the administration of antiretroviral therapy during primary infection affects Western blot reactivity and the evolution of antibody avidity. The patients were divided into two groups; group A consisted of 19 HIV-1-untreated patients who did not receive any drug treatment during our follow-up period; group B consisted of 17 subjects who were treated early with an association of two nucleoside reverse transcriptase inhibitors (NRTI) and one non-nucleoside reverse transcriptase inhibitor (NNRTI) within 3 months after seroconversion. At diagnosis, Western blot analysis and avidity index (mean value) were exactly matched in untreated and treated patients; subsequently, however, a significantly lower reactivity to HIV-1 pol and gag proteins and a lower avidity index (mean values) were observed in HAART-treated patients up until the end of the follow-up period. The impaired production and maturation of the humoral immunological response in antiretroviral-treated patients might be related to a rapid suppression of HIV replication, driven by HAART. These results could have important implications in understanding the complex mechanism of the immune response during HIV infection. Copyright © 2010 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Cellular immune responses to HIV
NASA Astrophysics Data System (ADS)
McMichael, Andrew J.; Rowland-Jones, Sarah L.
2001-04-01
The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.
Gu, Linlin; Krendelchtchikova, Valentina; Krendelchtchikov, Alexandre; Farrow, Anitra L; Derdeyn, Cynthia A; Matthews, Qiana L
2016-01-01
Adenoviral (Ad) vectors in combination with the "Antigen Capsid-Incorporation" strategy have been applied in developing HIV-1 vaccines, due to the vectors׳ abilities in incorporating and inducing immunity of capsid-incorporated antigens. Variable loop 2 (V2)-specific antibodies were suggested in the RV144 trial to correlate with reduced HIV-1 acquisition, which highlights the importance of developing novel HIV-1 vaccines by targeting the V2 loop. Therefore, the V2 loop of HIV-1 has been incorporated into the Ad capsid protein. We generated adenovirus serotype 5 (Ad5) vectors displaying variable loop 2 (V2) of HIV-1 gp120, with the "Antigen Capsid-Incorporation" strategy. To assess the incorporation capabilities on hexon hypervariable region1 (HVR1) and protein IX (pIX), 20aa or full length (43aa) of V2 and V1V2 (67aa) were incorporated, respectively. Immunizations with the recombinant vectors significantly generated antibodies against both linear and discontinuous V2 epitopes. The immunizations generated durable humoral immunity against V2. This study will lead to more stringent development of various serotypes of adenovirus-vectored V2 vaccine candidates, based on breakthroughs regarding the immunogenicity of V2. Copyright © 2015. Published by Elsevier Inc.
Antibody-Dependent Cellular Cytotoxicity against Reactivated HIV-1-Infected Cells
Lee, Wen Shi; Richard, Jonathan; Lichtfuss, Marit; Smith, Amos B.; Park, Jongwoo; Courter, Joel R.; Melillo, Bruno N.; Sodroski, Joseph G.; Kaufmann, Daniel E.; Parsons, Matthew S.
2015-01-01
responses within HIV-1+ individuals can efficiently eliminate the reactivated cells. HIV-1-specific antibodies can potentially eliminate cells reactivated from latency via Fc effector functions by recruiting innate immune cells. Our study highlights the potential role that antibody-dependent cellular cytotoxicity might play in antilatency cure approaches. PMID:26656700
Singh, Maneesh; Singh, Pratibha; Gaudray, Gilles; Musumeci, Lucia; Thielen, Caroline; Vaira, Dolores; Vandergeeten, Claire; Delacroix, Laurence; Van Gulck, Ellen; Vanham, Guido; de Leval, Laurence; Rahmouni, Souad; Moutschen, Michel
2012-01-01
Cord blood hematopoietic progenitor cells (CB-HPCs) transplanted immunodeficient NOD/LtsZ-scidIL2Rγnull (NSG) and NOD/SCID/IL2Rγnull (NOG) mice need efficient human cell engraftment for long-term HIV-1 replication studies. Total body irradiation (TBI) is a classical myeloablation regimen used to improve engraftment levels of human cells in these humanized mice. Some recent reports suggest the use of busulfan as a myeloablation regimen to transplant HPCs in neonatal and adult NSG mice. In the present study, we further ameliorated the busulfan myeloablation regimen with fresh CB-CD34+cell transplantation in 3–4 week old NSG mice. In this CB-CD34+transplanted NSG mice engraftment efficiency of human CD45+cell is over 90% in peripheral blood. Optimal engraftment promoted early and increased CD3+T cell levels, with better lymphoid tissue development and prolonged human cell chimerism over 300 days. These humanized NSG mice have shown long-lasting viremia after HIV-1JRCSF and HIV-1Bal inoculation through intravenous and rectal routes. We also saw a gradual decline of the CD4+T cell count, widespread immune activation, up-regulation of inflammation marker and microbial translocation after HIV-1 infection. Humanized NSG mice reconstituted according to our new protocol produced, moderate cellular and humoral immune responses to HIV-1 postinfection. We believe that NSG mice reconstituted according to our easy to use protocol will provide a better in vivo model for HIV-1 replication and anti-HIV-1 therapy trials. PMID:22675567
García-Arriaza, Juan; Perdiguero, Beatriz; Heeney, Jonathan; Seaman, Michael; Montefiori, David C.; Labranche, Celia; Yates, Nicole L.; Shen, Xiaoying; Tomaras, Georgia D.; Ferrari, Guido; Foulds, Kathryn E.; McDermott, Adrian; Kao, Shing-Fen; Roederer, Mario; Hawkins, Natalie; Self, Steve; Yao, Jiansheng; Farrell, Patrick; Phogat, Sanjay; Tartaglia, Jim; Barnett, Susan W.; Burke, Brian; Cristillo, Anthony; Weiss, Deborah; Lee, Carter; Kibler, Karen; Jacobs, Bert; Asbach, Benedikt; Wagner, Ralf; Ding, Song; Pantaleo, Giuseppe
2015-01-01
ABSTRACT We compared the HIV-1-specific cellular and humoral immune responses elicited in rhesus macaques immunized with two poxvirus vectors (NYVAC and ALVAC) expressing the same HIV-1 antigens from clade C, Env gp140 as a trimeric cell-released protein and a Gag-Pol-Nef polyprotein as Gag-induced virus-like particles (VLPs) (referred to as NYVAC-C and ALVAC-C). The immunization protocol consisted of two doses of the corresponding poxvirus vector plus two doses of a combination of the poxvirus vector and a purified HIV-1 gp120 protein from clade C. This immunogenicity profile was also compared to that elicited by vaccine regimens consisting of two doses of the ALVAC vector expressing HIV-1 antigens from clades B/E (ALVAC-vCP1521) plus two doses of a combination of ALVAC-vCP1521 and HIV-1 gp120 protein from clades B/E (similar to the RV144 trial regimen) or clade C. The results showed that immunization of macaques with NYVAC-C stimulated at different times more potent HIV-1-specific CD4+ T-cell responses and induced a trend toward higher-magnitude HIV-1-specific CD8+ T-cell immune responses than did ALVAC-C. Furthermore, NYVAC-C induced a trend toward higher levels of binding IgG antibodies against clade C HIV-1 gp140, gp120, or murine leukemia virus (MuLV) gp70-scaffolded V1/V2 and toward best cross-clade-binding IgG responses against HIV-1 gp140 from clades A, B, and group M consensus, than did ALVAC-C. Of the linear binding IgG responses, most were directed against the V3 loop in all immunization groups. Additionally, NYVAC-C and ALVAC-C also induced similar levels of HIV-1-neutralizing antibodies and antibody-dependent cellular cytotoxicity (ADCC) responses. Interestingly, binding IgA antibody levels against HIV-1 gp120 or MuLV gp70-scaffolded V1/V2 were absent or very low in all immunization groups. Overall, these results provide a comprehensive survey of the immunogenicity of NYVAC versus ALVAC expressing HIV-1 antigens in nonhuman primates and indicate that
Morrison, Charles; Fichorova, Raina N; Mauck, Chris; Chen, Pai-Lien; Kwok, Cynthia; Chipato, Tsungai; Salata, Robert; Doncel, Gustavo F
2014-06-01
Hormonal contraception (HC), younger age, and pregnancy have been associated with increased HIV risk in some studies. We sought to elucidate the biological mechanisms for these associations. Case-control selection of specimens from a large, prospective, clinical study. We enrolled and followed 4531 HIV-negative women from Uganda and Zimbabwe using either the injectable depo-medroxyprogesterone acetate (DMPA), combined oral contraception, or no HC (NH). Innate immunity mediators were measured in cervical samples collected from women at their visit before HIV seroconversion (n = 199) and matched visits from women remaining HIV uninfected (n = 633). Generalized linear models were applied after Box-Cox power transformation. Higher RANTES and lower secretory leukocyte protease inhibitor (SLPI) levels were associated with HIV seroconversion. DMPA users had higher RANTES and lower BD-2 levels. Most inflammation-promoting and/or inflammation-inducible mediators were higher [interleukin (IL)-1β, IL-6, IL-8, MIP-3α, vascular endothelial growth factor, and SLPI], and the protective BD-2 and IL-1RA:IL-1β ratio were lower among combined oral contraception users. Pregnant women showed a similar cervical immunity status (higher IL-1β, IL-6, IL-8, vascular endothelial growth factor, SLPI, and IL-1RA; lower IL-1RA:IL-1β). Age <25 years was associated with lower SLPI, IL-8, MIP-3α but higher IL-1RA:IL-1β. Zimbabwean women (with higher HIV seroconversion rates) had overall higher pro-inflammatory and lower anti-inflammatory protein levels than Ugandan women. HC use, pregnancy, and young age alter cervical immunity in different ways known to increase risk of HIV, for example, through increased levels of pro-inflammatory cytokines or decreased levels of SLPI. Higher levels of RANTES may be one factor underlying a possible association between DMPA use and risk of HIV acquisition.
Chege, Gerald K; Burgers, Wendy A; Stutz, Helen; Meyers, Ann E; Chapman, Rosamund; Kiravu, Agano; Bunjun, Rubina; Shephard, Enid G; Jacobs, William R; Rybicki, Edward P; Williamson, Anna-Lise
2013-05-01
We previously reported that a recombinant pantothenate auxotroph of Mycobacterium bovis BCG expressing human immunodeficiency virus type 1 (HIV-1) subtype C Gag (rBCGpan-Gag) efficiently primes the mouse immune system for a boost with a recombinant modified vaccinia virus Ankara (rMVA) vaccine. In this study, we further evaluated the immunogenicity of rBCGpan-Gag in a nonhuman primate model. Two groups of chacma baboons were primed or mock primed twice with either rBCGpan-Gag or a control BCG. Both groups were boosted with HIV-1 Pr55(gag) virus-like particles (Gag VLPs). The magnitude and breadth of HIV-specific cellular responses were measured using a gamma interferon (IFN-γ) enzyme-linked immunosorbent spot (ELISPOT) assay, and the cytokine profiles and memory phenotypes of T cells were evaluated by polychromatic flow cytometry. Gag-specific responses were detected in all animals after the second inoculation with rBCGpan-Gag. Boosting with Gag VLPs significantly increased the magnitude and breadth of the responses in the baboons that were primed with rBCGpan-Gag. These responses targeted an average of 12 Gag peptides per animal, compared to an average of 3 peptides per animal for the mock-primed controls. Robust responses of Gag-specific polyfunctional T cells capable of simultaneously producing IFN-γ, tumor necrosis alpha (TNF-α), and interleukin-2 (IL-2) were detected in the rBCGpan-Gag-primed animals. Gag-specific memory T cells were skewed toward a central memory phenotype in both CD4(+) and CD8(+) T cell populations. These data show that the rBCGpan-Gag prime and Gag VLP boost vaccine regimen is highly immunogenic, inducing a broad and polyfunctional central memory T cell response. This report further indicates the feasibility of developing a BCG-based HIV vaccine that is safe for childhood HIV immunization.
Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai
2010-12-01
The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).
HIV-specific Th2 and Th17 responses predict HIV vaccine protection efficacy
Sauce, Delphine; Gorochov, Guy; Larsen, Martin
2016-01-01
Understanding the factors that delineate the efficacy of T-cell responses towards pathogens is crucial for our ability to develop potent therapies and vaccines against infectious diseases, such as HIV. Here we show that a recently developed analytical tool, the polyfunctionality index (PI), not only enables prediction of protection after vaccination against HIV, but also allows identification of the immunological pathways involved. Our data suggest that induction of a synergistic network of CD4+ T-cell subsets is implicated in HIV-protection. Accordingly, we provide evidence that vaccine-induced protection is associated with CD40L expressing Th2 cells and IL-2 secreting Th17 cells. In conclusion, we describe a novel approach that is widely applicable and readily interpretable in a biological and clinical context. This approach could greatly impact our fundamental understanding of T-cell immunity as well as the search for effective vaccines. PMID:27324186
Catano, Gabriel; Chykarenko, Zoya A; Mangano, Andrea; Anaya, J-M; He, Weijing; Smith, Alison; Bologna, Rosa; Sen, Luisa; Clark, Robert A; Lloyd, Andrew; Shostakovich-Koretskaya, Ludmila; Ahuja, Sunil K
2011-01-15
We used cutaneous delayed-type hypersensitivity responses, a powerful in vivo measure of cell-mediated immunity, to evaluate the relationships among cell-mediated immunity, AIDS, and polymorphisms in CCR5, the HIV-1 coreceptor. There was high concordance between CCR5 polymorphisms and haplotype pairs that influenced delayed-type hypersensitivity responses in healthy persons and HIV disease progression. In the cohorts examined, CCR5 genotypes containing -2459G/G (HHA/HHA, HHA/HHC, HHC/HHC) or -2459A/A (HHE/HHE) associated with salutary or detrimental delayed-type hypersensitivity and AIDS phenotypes, respectively. Accordingly, the CCR5-Δ32 allele, when paired with non-Δ32-bearing haplotypes that correlate with low (HHA, HHC) versus high (HHE) CCR5 transcriptional activity, associates with disease retardation or acceleration, respectively. Thus, the associations of CCR5-Δ32 heterozygosity partly reflect the effect of the non-▵32 haplotype in a background of CCR5 haploinsufficiency. The correlations of increased delayed-type hypersensitivity with -2459G/G-containing CCR5 genotypes, reduced CCR5 expression, decreased viral replication, and disease retardation suggest that CCR5 may influence HIV infection and AIDS, at least in part, through effects on cell-mediated immunity.
Kelschenbach, Jennifer L; Saini, Manisha; Hadas, Eran; Gu, Chao-Jiang; Chao, Wei; Bentsman, Galina; Hong, Jessie P; Hanke, Tomas; Sharer, Leroy R; Potash, Mary Jane; Volsky, David J
2012-06-01
Infection by some viruses induces immunity to reinfection, providing a means to identify protective epitopes. To investigate resistance to reinfection in an animal model of HIV disease and its control, we employed infection of mice with chimeric HIV, EcoHIV. When immunocompetent mice were infected by intraperitoneal (IP) injection of EcoHIV, they resisted subsequent secondary infection by IP injection, consistent with a systemic antiviral immune response. To investigate the potential role of these responses in restricting neurotropic HIV infection, we established a protocol for efficient EcoHIV expression in the brain following intracranial (IC) inoculation of virus. When mice were inoculated by IP injection and secondarily by IC injection, they also controlled EcoHIV replication in the brain. To investigate their role in EcoHIV antiviral responses, CD8+ T lymphocytes were isolated from spleens of EcoHIV infected and uninfected mice and adoptively transferred to isogenic recipients. Recipients of EcoHIV primed CD8+ cells resisted subsequent EcoHIV infection compared to recipients of cells from uninfected donors. CD8+ spleen cells from EcoHIV-infected mice also mounted modest but significant interferon-γ responses to two HIV Gag peptide pools. These findings suggest EcoHIV-infected mice may serve as a useful system to investigate the induction of anti-HIV protective immunity for eventual translation to human beings.
Natural Immunity to HIV: a delicate balance between strength and control.
Poudrier, Johanne; Thibodeau, Valérie; Roger, Michel
2012-01-01
Understanding how the mucosal immune system in the human female reproductive tract might prevent or facilitate HIV infection has important implications for the design of effective interventions. We and others have established cohorts of highly-exposed, HIV-seronegative individuals, such as HIV-uninfected commercial sex workers, who have remained HIV-negative after more than 5 years of active prostitution. Observations obtained in studies of such individuals, who represent a model of natural immunity to HIV, indicate that HIV resistance may be associated with the host's capacity to preserve systemic integrity by constraining immune activity and controlling inflammatory conditions at the mucosal point of entry. This likely necessitates the orchestration of balanced, first-line and adaptive immune responses.
Yates, Nicole L.; Liao, Hua-Xin; Fong, Youyi; deCamp, Allan; Vandergrift, Nathan A.; Williams, William T.; Alam, S. Munir; Ferrari, Guido; Yang, Zhi-yong; Seaton, Kelly E.; Berman, Phillip W.; Alpert, Michael D.; Evans, David T.; O’Connell, Robert J.; Francis, Donald; Sinangil, Faruk; Lee, Carter; Nitayaphan, Sorachai; Rerks-Ngarm, Supachai; Kaewkungwal, Jaranit; Pitisuttithum, Punnee; Tartaglia, James; Pinter, Abraham; Zolla-Pazner, Susan; Gilbert, Peter B.; Nabel, Gary J.; Michael, Nelson L.; Kim, Jerome H.; Montefiori, David C.; Haynes, Barton F.; Tomaras, Georgia D.
2014-01-01
HIV-1–specific immunoglobulin G (IgG) subclass antibodies bind to distinct cellular Fc receptors. Antibodies of the same epitope specificity but of a different subclass therefore can have different antibody effector functions. The study of IgG subclass profiles between different vaccine regimens used in clinical trials with divergent efficacy outcomes can provide information on the quality of the vaccine-induced B cell response. We show that HIV-1–specific IgG3 distinguished two HIV-1 vaccine efficacy studies (RV144 and VAX003 clinical trials) and correlated with decreased risk of HIV-1 infection in a blinded follow-up case-control study with the RV144 vaccine. HIV-1–specific IgG3 responses were not long-lived, which was consistent with the waning efficacy of the RV144 vaccine. These data suggest that specific vaccine-induced HIV-1 IgG3 should be tested in future studies of immune correlates in HIV-1 vaccine efficacy trials. PMID:24648342
Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.
Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T
1999-06-01
Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.
Xu, Weifeng; Santini, Paul A.; Sullivan, John S.; He, Bing; Shan, Meimei; Ball, Susan C.; Dyer, Wayne B.; Ketas, Thomas J.; Chadburn, Amy; Cohen-Gould, Leona; Knowles, Daniel M.; Chiu, April; Sanders, Rogier W.; Chen, Kang; Cerutti, Andrea
2009-01-01
Contact-dependent communication between immune cells generates protection, but also facilitates viral spread. We found that macrophages formed long-range actin-propelled conduits in response to negative factor (Nef), a human immunodeficiency virus type-1 (HIV-1) protein with immunosuppressive functions. Conduits attenuated immunoglobulin G2 (IgG2) and IgA class switching in systemic and intestinal lymphoid follicles by shuttling Nef from infected macrophages to B cells through a guanine exchange factor-dependent pathway involving the amino-terminal anchor, central core and carboxy-terminal flexible loop of Nef. By showing stronger virus-specific IgG2 and IgA responses in patients harboring Nef-deficient virions, our data suggest that HIV-1 exploits intercellular highways as a “Trojan horse” to deliver Nef to B cells and evade humoral immunity systemically and at mucosal sites of entry. PMID:19648924
Ontogeny of anti-human immunodeficiency virus (HIV) antibody production in HIV-1-infected infants.
Pollack, H; Zhan, M X; Ilmet-Moore, T; Ajuang-Simbiri, K; Krasinski, K; Borkowsky, W
1993-01-01
The early serologic response of infants to infection with human immunodeficiency virus type 1 (HIV-1) is normally obscured by the presence of transplacentally acquired maternal HIV antibody. By measuring HIV antibody produced in vitro by lymphocytes isolated from peripheral blood of infants and children of HIV-1-infected mothers, we have been able to study the natural acquisition of humoral immunity to perinatal HIV-1 infection. One hundred ninety-seven infants of HIV-1-infected women were studied prospectively and longitudinally from birth. In the neonatal period, infected infants produced only small amounts of HIV-specific IgG antibodies to a restricted number of antigens. The amount of immunoglobulin to HIV-1 and the number of HIV-1 antigens recognized increased with age. After 6 months of life 85% of infected infants made detectable antibody to two or more viral proteins. Antibody to gp160 appeared first and was the most frequently found at all ages, followed by antibody to the envelope proteins gp120 and gp41. The amount of HIV antibody produced correlated positively with the percentage of CD4+ T lymphocytes in peripheral blood. This assay provides a method of studying the immunogenicity of vaccines against HIV-1 in HIV-1-infected infants and of assessing the effect of early therapeutic interventions on the humoral response to HIV-1. PMID:8460144
NASA Technical Reports Server (NTRS)
Fitzgerald, Wendy; Sylwester, Andrew W.; Grivel, Jean-Charles; Lifson, Jeffrey D.; Margolis, Leonid B.
2004-01-01
Ex vivo human immunodeficiency virus type 1 (HIV-1) infection of human lymphoid tissue recapitulates some aspects of in vivo HIV-1 infection, including a severe depletion of CD4(+) T cells and suppression of humoral immune responses to recall antigens or to polyclonal stimuli. These effects are induced by infection with X4 HIV-1 variants, whereas infection with R5 variants results in only mild depletion of CD4(+) T cells and no suppression of immune responses. To study the mechanisms of suppression of immune responses in this ex vivo system, we used aldrithiol-2 (AT-2)-inactivated virions that have functional envelope glycoproteins but are not infectious and do not deplete CD4(+) T cells in human lymphoid tissues ex vivo. Nevertheless, AT-2-inactivated X4 (but not R5) HIV-1 virions, even with only a brief exposure, inhibit antibody responses in human lymphoid tissue ex vivo, similarly to infectious virus. This phenomenon is mediated by soluble immunosuppressive factor(s) secreted by tissue exposed to virus.
Sun, Yanqing; Qi, Li; Yang, Guangren; Gilbert, Peter B
2018-05-01
This article develops hypothesis testing procedures for the stratified mark-specific proportional hazards model with missing covariates where the baseline functions may vary with strata. The mark-specific proportional hazards model has been studied to evaluate mark-specific relative risks where the mark is the genetic distance of an infecting HIV sequence to an HIV sequence represented inside the vaccine. This research is motivated by analyzing the RV144 phase 3 HIV vaccine efficacy trial, to understand associations of immune response biomarkers on the mark-specific hazard of HIV infection, where the biomarkers are sampled via a two-phase sampling nested case-control design. We test whether the mark-specific relative risks are unity and how they change with the mark. The developed procedures enable assessment of whether risk of HIV infection with HIV variants close or far from the vaccine sequence are modified by immune responses induced by the HIV vaccine; this question is interesting because vaccine protection occurs through immune responses directed at specific HIV sequences. The test statistics are constructed based on augmented inverse probability weighted complete-case estimators. The asymptotic properties and finite-sample performances of the testing procedures are investigated, demonstrating double-robustness and effectiveness of the predictive auxiliaries to recover efficiency. The finite-sample performance of the proposed tests are examined through a comprehensive simulation study. The methods are applied to the RV144 trial. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Mucosal immunity in the female genital tract, HIV/AIDS.
Reis Machado, Juliana; da Silva, Marcos Vinícius; Cavellani, Camila Lourencini; dos Reis, Marlene Antônia; Monteiro, Maria Luiza Gonçalves dos Reis; Teixeira, Vicente de Paula Antunes; Miranda Corrêa, Rosana Rosa
2014-01-01
Mucosal immunity consists of innate and adaptive immune responses which can be influenced by systemic immunity. Despite having been the subject of intensive studies, it is not fully elucidated what exactly occurs after HIV contact with the female genital tract mucosa. The sexual route is the main route of HIV transmission, with an increased risk of infection in women compared to men. Several characteristics of the female genital tract make it suitable for inoculation, establishment of infection, and systemic spread of the virus, which causes local changes that may favor the development of infections by other pathogens, often called sexually transmitted diseases (STDs). The relationship of these STDs with HIV infection has been widely studied. Here we review the characteristics of mucosal immunity of the female genital tract, its alterations due to HIV/AIDS, and the characteristics of coinfections between HIV/AIDS and the most prevalent STDs.
Mucosal Immunity in the Female Genital Tract, HIV/AIDS
Reis Machado, Juliana; da Silva, Marcos Vinícius; Cavellani, Camila Lourencini; Antônia dos Reis, Marlene; Monteiro, Maria Luiza Gonçalves dos Reis; Teixeira, Vicente de Paula Antunes; Rosa Miranda Corrêa, Rosana
2014-01-01
Mucosal immunity consists of innate and adaptive immune responses which can be influenced by systemic immunity. Despite having been the subject of intensive studies, it is not fully elucidated what exactly occurs after HIV contact with the female genital tract mucosa. The sexual route is the main route of HIV transmission, with an increased risk of infection in women compared to men. Several characteristics of the female genital tract make it suitable for inoculation, establishment of infection, and systemic spread of the virus, which causes local changes that may favor the development of infections by other pathogens, often called sexually transmitted diseases (STDs). The relationship of these STDs with HIV infection has been widely studied. Here we review the characteristics of mucosal immunity of the female genital tract, its alterations due to HIV/AIDS, and the characteristics of coinfections between HIV/AIDS and the most prevalent STDs. PMID:25313360
The Effect of Chloroquine on Immune Activation and Interferon Signatures Associated with HIV-1.
Jacobson, Jeffrey M; Bosinger, Steven E; Kang, Minhee; Belaunzaran-Zamudio, Pablo; Matining, Roy M; Wilson, Cara C; Flexner, Charles; Clagett, Brian; Plants, Jill; Read, Sarah; Purdue, Lynette; Myers, Laurie; Boone, Linda; Tebas, Pablo; Kumar, Princy; Clifford, David; Douek, Daniel; Silvestri, Guido; Landay, Alan L; Lederman, Michael M
2016-07-01
Immune activation associated with HIV-1 infection contributes to morbidity and mortality. We studied whether chloroquine, through Toll-like receptor (TLR) antagonist properties, could reduce immune activation thought to be driven by TLR ligands, such as gut-derived bacterial elements and HIV-1 RNAs. AIDS Clinical Trials Group A5258 was a randomized, double-blind, placebo-controlled study in 33 HIV-1-infected participants off antiretroviral therapy (ART) and 37 participants on ART. Study participants in each cohort were randomized 1:1 to receive chloroquine 250 mg orally for the first 12 weeks then cross over to placebo for 12 weeks or placebo first and then chloroquine. Combining the periods of chloroquine use in both arms of the on-ART cohort yielded a modest reduction in the proportions of CD8 T cells co-expressing CD38 and DR (median decrease = 3.0%, p = .003). The effect on immune activation in the off-ART cohort was likely confounded by increased plasma HIV-1 RNA during chloroquine administration (median 0.29 log10 increase, p < .001). Transcriptional analyses in the off-ART cohort showed decreased expression of interferon-stimulated genes in 5 of 10 chloroquine-treated participants and modest decreases in CD38 and CCR5 RNAs in all chloroquine-treated participants. Chloroquine modestly reduced immune activation in ART-treated HIV-infected participants. Clinical Trials Registry Number: NCT00819390.
HIV-derived vectors for gene therapy targeting dendritic cells.
Rossetti, Maura; Cavarelli, Mariangela; Gregori, Silvia; Scarlatti, Gabriella
2013-01-01
Human immunodeficiency virus type 1 (HIV-1)-derived lentiviral vectors (LV) have the potential to mediate stable therapeutic gene transfer. However, similarly to other viral vectors, their benefit is compromised by the induction of an immune response toward transgene-expressing cells that closely mimics antiviral immunity. LV share with the parental HIV the ability to activate dendritic cells (DC), while lack the peculiar ability of subverting DC functions, which is responsible for HIV immune escape. Understanding the interaction between LV and DC, with plasmacytoid and myeloid DC playing fundamental and distinct roles, has paved the way to novel approaches aimed at regulating transgene-specific immune responses. Thanks to the ability to target either DC subsets LV might be a powerful tool to induce immunity (i.e., gene therapy of cancer), cell death (i.e., in HIV/AIDS infection), or tolerance (i.e., gene therapy strategies for monogenic diseases). In this chapter, similarities and differences between the LV-mediated and HIV-mediated induction of immune responses, with specific focus on their interactions with DC, are discussed.
Multi-Agent Simulations of the Immune Response to Hiv during the Acute Stage of Infection
NASA Astrophysics Data System (ADS)
Walshe, R.; Ruskin, H. J.; Callaghan, A.
Results of multi-agent based simulations of the immune response to HIV during the acute phase of infection are presented here. The model successfully recreates the viral dynamics associated with the acute phase of infection, i.e., a rapid rise in viral load followed by a sharp decline to what is often referred to as a "set point", a result of T-cell response and emergence of HIV neutralizing antibodies. The results indicate that sufficient T Killer cell response is the key factor in controlling viral growth during this phase with antibody levels of critical importance only in the absence of a sufficient T Killer response.
The preventive phase I trial with the HIV-1 Tat-based vaccine.
Ensoli, Barbara; Fiorelli, Valeria; Ensoli, Fabrizio; Lazzarin, Adriano; Visintini, Raffaele; Narciso, Pasquale; Di Carlo, Aldo; Tripiciano, Antonella; Longo, Olimpia; Bellino, Stefania; Francavilla, Vittorio; Paniccia, Giovanni; Arancio, Angela; Scoglio, Arianna; Collacchi, Barbara; Ruiz Alvarez, Maria Josè; Tambussi, Giuseppe; Tassan Din, Chiara; Palamara, Guido; Latini, Alessandra; Antinori, Andrea; D'Offizi, Gianpiero; Giuliani, Massimo; Giulianelli, Marina; Carta, Maria; Monini, Paolo; Magnani, Mauro; Garaci, Enrico
2009-12-11
The native HIV-1 Tat protein was chosen as vaccine candidate for phase I clinical trials based on its role in the natural infection and AIDS pathogenesis, on the association of Tat-specific immune response with the asymptomatic stage as well as on its sequence conservation among HIV clades. A randomized, double blind, placebo-controlled phase I study (ISS P-001) was conducted in healthy adult volunteers without identifiable risk of HIV infection. Tat was administered 5 times monthly, subcute in alum or intradermic alone at 7.5 microg, 15 microg or 30 microg, respectively (ClinicalTrials.gov identifier: NCT00529698). Vaccination with Tat resulted to be safe and well tolerated (primary endpoint) both locally and systemically. In addition, Tat induced both Th1 and Th2 type specific immune responses in all subjects (secondary endpoint) with a wide spectrum of functional antibodies that are rarely seen in natural infection, providing key information for further clinical development of the Tat vaccine candidate.
The kinetics and location of intra-host HIV evolution to evade cellular immunity are predictable
NASA Astrophysics Data System (ADS)
Barton, John; Goonetilleke, Nilu; Butler, Thomas; Walker, Bruce; McMichael, Andrew; Chakraborty, Arup
Human immunodeficiency virus (HIV) evolves within infected persons to escape targeting and clearance by the host immune system, thereby preventing effective immune control of infection. Knowledge of the timing and pathways of escape that result in loss of control of the virus could aid in the design of effective strategies to overcome the challenge of viral diversification and immune escape. We combined methods from statistical physics and evolutionary dynamics to predict the course of in vivo viral sequence evolution in response to T cell-mediated immune pressure in a cohort of 17 persons with acute HIV infection. Our predictions agree well with both the location of documented escape mutations and the clinically observed time to escape. We also find that that the mutational pathways to escape depend on the viral sequence background due to epistatic interactions. The ability to predict escape pathways, and the duration over which control is maintained by specific immune responses prior to escape, could be exploited for the rational design of immunotherapeutic strategies that may enable long-term control of HIV infection.
Preserving HIV-specific T cell responses: does timing of antiretroviral therapy help?
Macatangay, Bernard J C; Rinaldo, Charles R
2015-01-01
HIV-specific T cell responses are likely to have an important role in HIV cure strategies that aim for long-lasting viral control without antiretroviral therapy (ART). An important issue in enhancing virus-specific T cell responses is whether timing of ART can influence their magnitude and breadth. Early ART is associated with lower T cell activation, preservation of T cell numbers, smaller DNA and RNA reservoir size, and, in a single study (VISCONTI), control of plasma viremia after treatment interruption. The prevention of T cell destruction by early ART is associated with relatively low anti-HIV CD8⁺ T cell responses but stronger CD4⁺ T helper function. The relatively lower CD8⁺T cell response, which is presumably due to rapid lowering of HIV antigen burden after early ART, appears sufficient to control residual viral replication as well as viral rebound upon treatment interruption. Available evidence of starting ART during acute or early HIV infection has shown benefit in both virologic and immunologic parameters despite the lower HIV-specific CD8⁺ T cell responses observed. Encouraging as this is, more extensive data are necessary to evaluate its role in combination with immunotherapeutic and latency activation strategies that are being assessed in various HIV cure-related studies.
HIV-specific CD8+ T cells: serial killers condemned to die?
Petrovas, Constantinos; Mueller, Yvonne M; Katsikis, Peter D
2004-04-01
An increasing body of evidence supports a key role for cytotoxic CD8+ T cells (CTL) in controlling HIV infection. Although a vigorous HIV-specific CD8+ T cell response is raised during the primary infection, these cells ultimately fail to control virus and prevent disease progression. The failure of CTL to control HIV infection has been attributed to a number of strategies HIV employs to evade the immune system. Recently, intrinsic defects in the CTL themselves have been proposed to contribute to the failure of CTL to control HIV. HIV-specific CD8+ T cells differ in their effector/memory phenotype from other virus-specific CD8+ T cells indicating that their differentiation status differs. This altered differentiation may affect effector functions as well as homing properties of these cells. Other studies have indicated that activation of HIV-specific CTL may be impaired and this contributes to their dysfunction. The effector function of these CTL may also be affected. There are conflicting reports about their ability to kill, whereas IFNgamma production does not appear to be impaired in these cells. In this review we focus on recent work indicating that apoptosis may be an important mechanism through which HIV evades the CTL response. In particular, HIV-specific CD8+ T cells are highly susceptible to CD95/Fas-induced apoptosis. This leads to the hypothesis that virus-specific cytotoxic T cells can be eliminated upon binding CD95L/FasL on HIV-infected cells. Understanding the intrinsic defects of CTL in HIV infection could lead to new therapeutic strategies and optimized vaccination protocols that enhance the HIV-specific cytotoxic response.
Safety and immunogenicity of HIV-1 Tat toxoid in immunocompromised HIV-1-infected patients.
Gringeri, A; Santagostino, E; Muça-Perja, M; Mannucci, P M; Zagury, J F; Bizzini, B; Lachgar, A; Carcagno, M; Rappaport, J; Criscuolo, M; Blattner, W; Burny, A; Gallo, R C; Zagury, D
1998-01-01
To antagonize the deleterious effects of the HIV-1 toxin extracellular Tat on uninfected immune cells, we developed a new strategy of anti-HIV-1 vaccine using an inactivated but immunogenic Tat (Tat toxoid). Tat toxoid has been assayed for safety and immunogenicity in seropositive patients. The phase I vaccine clinical trial testing Tat toxoid preparation in Seppic Isa 51 oil adjuvant was performed on 14 HIV-1-infected asymptomatic although biologically immunocompromised individuals (500-200 CD4+ cells/mm3). Following as many as 8 injections, no clinical defects were observed. All patients exhibited an antibody (Ab) response to Tat, and some had cell-mediated immunity (CMI) as evaluated by skin test in vivo and T-cell proliferation in vitro. These results provide initial evidence of safety and potency of Tat toxoid vaccination in HIV-1-infected individuals.
Riou, Catherine; Strickland, Natalie; Soares, Andreia P.; Corleis, Bjorn; Kwon, Douglas; Wherry, E. John; Wilkinson, Robert J.; Burgers, Wendy A.
2016-01-01
HIV-infected persons are at greater risk of developing tuberculosis (TB) even before profound CD4 loss occurs, suggesting that HIV alters CD4+T cell functions capable of containing bacterial replication. An effective immune response to Mycobacterium tuberculosis likely relies on the development of a balanced CD4 response, where distinct CD4+T helper subsets act in synergy to control the infection. To define the diversity of Mtb-specific CD4+Th subsets and determine whether HIV infection impacts such responses, the expression of lineage-defining transcription factors T-bet, Gata3, RORγt and Foxp3 was measured in Mtb-specific CD4+T cells in HIV-uninfected (n=20) and HIV-infected individuals (n=20) with latent TB infection. Our results show that upon 5 day restimulation in vitro, Mtb-specific CD4+T cells from healthy individuals have the ability to exhibit a broad spectrum of T helper subsets, defined by specific patterns of transcription factor co-expression. These transcription factor profiles were skewed in HIV-infected individuals where the proportion of T-bethighFoxp3+ Mtb-specific CD4+T cells was significantly decreased (p=0.002) compared to HIV-uninfected individuals, a change that correlated inversely with HIV viral load (p=0.0007) and plasma TNF-α (p=0.027). Our data demonstrate an important balance in T helper subset diversity defined by lineage-defining transcription factor co-expression profiles that is disrupted by HIV infection and suggest a role for HIV in impairing TB immunity by altering the equilibrium of Mtb-specific CD4+T helper subsets. PMID:26927799
Dembo, Edson G.; Mwapasa, Victor; Montgomery, Jacqui; Craig, Alister G.; Porter, Kimberly A.; Meshnick, Steven R.; Molyneux, Malcolm E.; Rogerson, Stephen J.
2008-01-01
Human immunodeficiency virus (HIV) increases susceptibility to Plasmodium falciparum infection, and this has most clearly been demonstrated in pregnant women. Variant surface antigens on the surfaces of erythrocytes infected with P. falciparum are major targets of protective immunity. We studied the impact of HIV infection on pregnant women's humoral immunity to variant surface antigens expressed by placental and pediatric isolates of P. falciparum. By flow cytometry, sera from HIV-infected women more frequently lacked antibodies to these antigens than sera from HIV-uninfected women. This difference was similar in magnitude for pediatric isolates (unadjusted odds ratio [OR] = 6.36; 95% confidence interval [CI] = 1.14, 35.32; P < 0.05) and placental isolates (unadjusted OR = 6.47; 95% CI = 0.75, 55.64; P < 0.10). We divided women into high and low responders on the basis of their antibody levels. After adjustment for CD4 count, maternal age, and gravidity, we found that HIV-infected women more frequently had low responses to both pediatric isolates (OR = 5.34; 95% CI = 1.23, 23.16; P = 0.025) and placental isolates (OR = 4.14; 95% CI = 1.71, 10.02; P = 0.002). The relative quantity of antibodies to both pediatric isolates (P = 0.035) and placental isolates (P = 0.005) was lower in HIV-infected women than in HIV-uninfected women. HIV infection has a broad impact on variant-specific immunity, which may explain the susceptibility of infected individuals to clinical malaria episodes. PMID:18199738
Kwon, Douglas S.; Angin, Mathieu; Hongo, Tomoyuki; Law, Kenneth M.; Johnson, Jessica; Porichis, Filippos; Hart, Meghan G.; Pavlik, David F.; Tighe, Daniel P.; Kavanagh, Daniel G.; Streeck, Hendrik; Addo, Marylyn M.
2012-01-01
T cell dysfunction in the presence of ongoing antigen exposure is a cardinal feature of chronic viral infections with persistent high viremia, including HIV-1. Although interleukin-10 (IL-10) has been implicated as an important mediator of this T cell dysfunction, the regulation of IL-10 production in chronic HIV-1 infection remains poorly understood. We demonstrated that IL-10 is elevated in the plasma of individuals with chronic HIV-1 infection and that blockade of IL-10 signaling results in a restoration of HIV-1-specific CD4 T cell proliferation, gamma interferon (IFN-γ) secretion, and, to a lesser extent, IL-2 production. Whereas IL-10 blockade leads to restoration of IFN-γ secretion by HIV-1-specific CD4 T cells in all categories of subjects investigated, significant enhancement of IL-2 production and improved proliferation of CD4 T helper cells are restricted to viremic individuals. In peripheral blood mononuclear cells (PBMCs), this IL-10 is produced primarily by CD14+ monocytes, but its production is tightly controlled by regulatory T cells (Tregs), which produce little IL-10 directly. When Tregs are depleted from PBMCs of viremic individuals, the effect of the IL-10 signaling blockade is abolished and IL-10 production by monocytes decreases, while the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-α), increases. The regulation of IL-10 by Tregs appears to be mediated primarily by contact or paracrine-dependent mechanisms which involve IL-27. This work describes a novel mechanism by which regulatory T cells control IL-10 production and contribute to dysfunctional HIV-1-specific CD4 T cell help in chronic HIV-1 infection and provides a unique mechanistic insight into the role of regulatory T cells in immune exhaustion. PMID:22496237
Systemic Immune Activation Profiles of HIV-1 Subtype C-Infected Children and Their Mothers.
Makhubele, Tinyiko G; Steel, Helen C; Anderson, Ronald; van Dyk, Gisela; Theron, Annette J; Rossouw, Theresa M
2016-01-01
Little is known about immune activation profiles of children infected with HIV-1 subtype C. The current study compared levels of selected circulating biomarkers of immune activation in HIV-1 subtype C-infected untreated mothers and their children with those of healthy controls. Multiplex bead array, ELISA, and immunonephelometric procedures were used to measure soluble CD14 (sCD14), beta-2 microglobulin (β2M), CRP, MIG, IP-10, and transforming growth factor beta 1 (TGF-β1). Levels of all 6 biomarkers were significantly elevated in the HIV-infected mothers and, with the exception of MIG, in their children (P < 0.01-P < 0.0001). The effects of antiretroviral therapy (ART) and maternal smoking on these biomarkers were also assessed. With the exception of TGF-β1, which was unchanged in the children 12 months after therapy, initiation of ART was accompanied by decreases in the other biomarkers. Regression analysis revealed that although most biomarkers were apparently unaffected by smoking, exposure of children to maternal smoking was associated with a significant increase in IP-10. These findings demonstrate that biomarkers of immune activation are elevated in HIV-infected children pre-ART and decline, with the exception of TGF-β1, after therapy. Although preliminary, elevation of IP-10 in smoke-exposed infants is consistent with a higher level of immune activation in this group.
Narayan, Kristin M.; Agrawal, Nitish; Du, Sean X.; Muranaka, Janelle E.; Bauer, Katherine; Leaman, Daniel P.; Phung, Pham; Limoli, Kay; Chen, Helen; Boenig, Rebecca I.; Wrin, Terri; Zwick, Michael B.; Whalen, Robert G.
2013-01-01
Development of a vaccine for HIV-1 requires a detailed understanding of the neutralizing antibody responses that can be experimentally elicited to difficult-to-neutralize primary isolates. Rabbits were immunized with the gp120 subunit of HIV-1 JR-CSF envelope (Env) using a DNA-prime protein-boost regimen. We analyzed five sera that showed potent autologous neutralizing activity (IC50s at ∼103 to 104 serum dilution) against pseudoviruses containing Env from the primary isolate JR-CSF but not from the related isolate JR-FL. Pseudoviruses were created by exchanging each variable and constant domain of JR-CSF gp120 with that of JR-FL or with mutations in putative N-glycosylation sites. The sera contained different neutralizing activities dependent on C3 and V5, C3 and V4, or V4 regions located on the glycan-rich outer domain of gp120. All sera showed enhanced neutralizing activity toward an Env variant that lacked a glycosylation site in V4. The JR-CSF gp120 epitopes recognized by the sera are generally distinct from those of several well characterized mAbs (targeting conserved sites on Env) or other type-specific responses (targeting V1, V2, or V3 variable regions). The activity of one serum requires specific glycans that are also important for 2G12 neutralization and this serum blocked the binding of 2G12 to gp120. Our findings show that different fine specificities can achieve potent neutralization of HIV-1, yet this strong activity does not result in improved breadth. PMID:23326351
Molecular clock of HIV-1 envelope genes under early immune selection
Park, Sung Yong; Love, Tanzy M. T.; Perelson, Alan S.; ...
2016-06-01
Here, the molecular clock hypothesis that genes or proteins evolve at a constant rate is a key tool to reveal phylogenetic relationships among species. Using the molecular clock, we can trace an infection back to transmission using HIV-1 sequences from a single time point. Whether or not a strict molecular clock applies to HIV-1’s early evolution in the presence of immune selection has not yet been fully examined.
Molecular clock of HIV-1 envelope genes under early immune selection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Sung Yong; Love, Tanzy M. T.; Perelson, Alan S.
Here, the molecular clock hypothesis that genes or proteins evolve at a constant rate is a key tool to reveal phylogenetic relationships among species. Using the molecular clock, we can trace an infection back to transmission using HIV-1 sequences from a single time point. Whether or not a strict molecular clock applies to HIV-1’s early evolution in the presence of immune selection has not yet been fully examined.
Influence of a cocoa-enriched diet on specific immune response in ovalbumin-sensitized rats.
Pérez-Berezo, Teresa; Ramiro-Puig, Emma; Pérez-Cano, Francisco J; Castellote, Cristina; Permanyer, Joan; Franch, Angels; Castell, Margarida
2009-03-01
Previous studies in young rats have reported the impact of 3 weeks of high cocoa intake on healthy immune status. The present article describes the effects of a longer-term cocoa-enriched diet (9 weeks) on the specific immune response to ovalbumin (OVA) in adult Wistar rats. At 4 weeks after immunization, control rats produced anti-OVA antibodies, which, according their amount and isotype, were arranged as follows: IgG1 > IgG2a > IgM > IgG2b > IgG2c. Both cocoa diets studied (4% and 10%) down-modulated OVA-specific antibody levels of IgG1 (main subclass associated with the Th2 immune response in rats), IgG2a, IgG2c and IgM isotypes. Conversely, cocoa-fed rats presented equal or higher levels of anti-OVA IgG2b antibodies (subclass linked to the Th1 response). Spleen and lymph node cells from OVA-immunized control and cocoa-fed animals proliferated similarly under OVA stimulation. However, spleen cells from cocoa-fed animals showed decreased interleukin-4 secretion (main Th2 cytokine), and lymph node cells from the same rats displayed higher interferon-gamma secretion (main Th1 cytokine). These changes were accompanied by a reduction in the number of anti-OVA IgG-secreting cells in spleen. In conclusion, cocoa diets induced attenuation of antibody synthesis that may be attributable to specific down-regulation of the Th2 immune response.
González, Nuria; McKee, Krisha; Lynch, Rebecca M; Georgiev, Ivelin S; Jimenez, Laura; Grau, Eulalia; Yuste, Eloísa; Kwong, Peter D; Mascola, John R; Alcamí, José
2018-01-01
Only a small fraction of HIV-1-infected patients develop broadly neutralizing antibodies (bNAbs), a process generally associated to chronic antigen stimulation. It has been described that rare aviremic HIV-1-infected patients can generate bNAbs but this issue remains controversial. To address this matter we have assessed bNAb responses in a large cohort of long-term non-progressors (LTNPs) with low or undetectable viremia. Samples from the LTNP cohort of the Spanish AIDS Research Network (87 elite and 42 viremic controllers) and a control population of 176 viremic typical-progressors (TPs) were screened for bNAbs using Env-recombinant viruses. bNAb specificities were studied by ELISA using mutated gp120, neutralization assays with mutated viruses, and peptide competition. Epitope specificities were also elucidated from the serum pattern of neutralization against a panel of diverse HIV-1 isolates. Broadly neutralizing sera were found among 9.3% LTNPs, both elite (7%) and viremic controllers (14%). Within the broadly neutralizing sera, CD4 binding site antibodies were detected by ELISA in 4/12 LTNPs (33%), and 16/33 of TPs (48%). Anti-MPER antibodies were detected in 6/12 LTNPs (50%) and 14/33 TPs (42%) whereas glycan-dependent HIV-1 bNAbs were more frequent in LTNPs (11/12, 92%) as compared to TPs (12/33, 36%). A good concordance between standard serum mapping and neutralization-based mapping was observed. LTNPs, both viremic and elite controllers, showed broad humoral immune responses against HIV-1, including activity against many major epitopes involved in bNAbs-mediated protection.
Pan, Xiaoyan; Lin, Jian; Zeng, Xiaoyun; Li, Wenjuan; Wu, Wenjiao; Lu, Wan Zhen; Liu, Jing; Liu, Shuwen
2018-05-01
The persistent inflammation aggravated by a disordered immune response is considered to be the major cause of CD4 + T cell depletion in lymphoid tissue, which impels the progression of AIDS. Here, we report that heat shock factor 1 (HSF1) works as an innate repressor of HIV-induced inflammation. The activation of HSF1 was found to accompany inflammation during HIV infection. Further research uncovered that HSF1 activation inhibited HIV-induced inflammation. In addition, HSF1 overexpression suppressed the inflammatory response induced by HIV, while HSF1 deficiency exacerbated that inflammation. Mechanistically, HSF1 was found to compete with nuclear factor-κB (NF-κB) in the nucleus. Generally, our report highlights that HSF1 is an important host factor in regulating HIV-induced inflammation and may work as a potential target for curing AIDS. Copyright © 2018 Elsevier Inc. All rights reserved.
Influenza vaccination of HIV-1-positive and HIV-1-negative former intravenous drug users.
Amendola, A; Boschini, A; Colzani, D; Anselmi, G; Oltolina, A; Zucconi, R; Begnini, M; Besana, S; Tanzi, E; Zanetti, A R
2001-12-01
The immunogenicity of an anti-influenza vaccine was assessed in 409 former intravenous drug user volunteers and its effect on the levels of HIV-1 RNA, proviral DNA and on CD4+ lymphocyte counts in a subset HIV-1-positive subjects was measured. HIV-1-positive individuals (n = 72) were divided into three groups on the basis of their CD4+ lymphocyte counts, while the 337 HIV-1-negative participants were allocated into group four. Haemagglutination inhibiting (HI) responses varied from 45.8 to 70% in the HIV-1-positive subjects and were significantly higher in group four (80.7% responses to the H1N1 strain, 81.6% to the H3N2 strain, and 83% to the B strain). The percentage of subjects with HI protective antibody titres (> or = 1:40) increased significantly after vaccination, especially in HIV-1 uninfected subjects. Immunization caused no significant changes in CD4+ counts and in neither plasma HIV-1 RNA nor proviral DNA levels. Therefore, vaccination against influenza may benefit persons infected by HIV-1. Copyright 2001 Wiley-Liss, Inc.
Shen, Xiaoying; Basu, Rahul; Sawant, Sheetal; Beaumont, David; Kwa, Sue Fen; LaBranche, Celia; Seaton, Kelly E; Yates, Nicole L; Montefiori, David C; Ferrari, Guido; Wyatt, Linda S; Moss, Bernard; Alam, S Munir; Haynes, Barton F; Tomaras, Georgia D; Robinson, Harriet L
2017-12-15
An important goal of human immunodeficiency virus (HIV) vaccine design is identification of strategies that elicit effective antiviral humoral immunity. One novel approach comprises priming with DNA and boosting with modified vaccinia virus Ankara (MVA) expressing HIV-1 Env on virus-like particles. In this study, we evaluated whether the addition of a gp120 protein in alum or MVA-expressed secreted gp140 (MVAgp140) could improve immunogenicity of a DNA prime-MVA boost vaccine. Five rhesus macaques per group received two DNA primes at weeks 0 and 8 followed by three MVA boosts (with or without additional protein or MVAgp140) at weeks 18, 26, and 40. Both boost immunogens enhanced the breadth of HIV-1 gp120 and V1V2 responses, antibody-dependent cellular cytotoxicity (ADCC), and low-titer tier 1B and tier 2 neutralizing antibody responses. However, there were differences in antibody kinetics, linear epitope specificity, and CD4 T cell responses between the groups. The gp120 protein boost elicited earlier and higher peak responses, whereas the MVAgp140 boost resulted in improved antibody durability and comparable peak responses after the final immunization. Linear V3 specific IgG responses were particularly enhanced by the gp120 boost, whereas the MVAgp140 boost also enhanced responses to linear C5 and C2.2 epitopes. Interestingly, gp120, but not the MVAgp140 boost, increased peak CD4 + T cell responses. Thus, both gp120 and MVAgp140 can augment potential protection of a DNA/MVA vaccine by enhancing gp120 and V1/V2 antibody responses, whereas potential protection by gp120, but not MVAgp140 boosts, may be further impacted by increased CD4 + T cell responses. IMPORTANCE Prior immune correlate analyses with humans and nonhuman primates revealed the importance of antibody responses in preventing HIV-1 infection. A DNA prime-modified vaccinia virus Ankara (MVA) boost vaccine has proven to be potent in eliciting antibody responses. Here we explore the ability of boosts with
HIV infection deregulates innate immunity to malaria despite combination antiretroviral therapy.
Finney, Constance A M; Ayi, Kodjo; Wasmuth, James D; Sheth, Prameet M; Kaul, Rupert; Loutfy, Mona R; Kain, Kevin C; Serghides, Lena
2013-01-28
Malaria and HIV-1 adversely interact, with HIV-positive individuals suffering higher parasite burdens and worse clinical outcomes. However, the mechanisms underlying these disease interactions are unclear. We hypothesized that HIV coinfection impairs the innate immune response to malaria, and that combination antiretroviral therapy (cART) may restore this response. Our aim was to examine the innate inflammatory response of natural killer (NK), natural killer T (NKT), and γδ T-cells isolated from the peripheral blood of HIV-infected therapy-naive donors to malaria parasites, and determine the effect of cART on these responses. Freshly isolated peripheral blood mononuclear cells from 25 HIV-infected individuals pre-cART (month 0) and post-cART (months 3 and 6), and HIV-negative individuals at matched time-points, were cultured in the presence of Plasmodium falciparum parasitized erythrocytes. Supernatants and cells were collected to assess cytokine production and phenotypic changes. Compared to HIV-negative participants, NKT, NK, and γδ T-cell subsets from participants with chronic HIV infection showed marked differences, including decreased production of interferon γ (IFNγ) and tumor necrosis factor (TNF) in response to malaria parasites. IFNγ production was linked to interleukin-18 receptor (IL-18R) expression in all three cell types studied. Six months of cART provided partial cellular reconstitution but had no effect on IL-18R expression, or IFNγ and TNF production. These data suggest that HIV infection impairs the inflammatory response of innate effector cells to malaria, and that the response is not fully restored within 6 months of cART. This may contribute to higher parasite burdens and ineffective immune responses, and have implications for vaccination initiatives in coinfected individuals.
George, Varghese K; Pallikkuth, Suresh; Pahwa, Rajendra; de Armas, Lesley R; Rinaldi, Stefano; Pan, Li; Pahwa, Savita
2018-06-19
Antibody responses are often impaired in old age and in HIV-positive (HIV+) infection despite virologic control with antiretroviral therapy but innate immunologic determinants are not well understood. Monocytes and natural killer cells were examined for relationships to age, HIV infection and influenza vaccine responses. Virologically suppressed HIV+ (n = 139) and HIV-negative (HIV-) (n = 137) participants classified by age as young (18-39 years), middle-aged (40-59 years) and old (≥60 years) were evaluated preinfluenza and postinfluenza vaccination. Prevaccination frequencies of inflammatory monocytes were highest in old HIV+ and HIV-, with old HIV+ exhibiting higher frequency of integrin CD11b on inflammatory monocytes that was correlated with age, expression of C-C chemokine receptor-2 (CCR2) and plasma soluble tumor necrosis factor receptor-1 (sTNFR1), with inverse correlation with postvaccination influenza H1N1 antibody titers. Higher frequencies of CD11b inflammatory monocytes (CD11b, >48.4%) compared with low frequencies of CD11b inflammatory monocytes (<15.8%) was associated with higher prevaccination frequencies of total and inflammatory monocytes and higher CCR2 MFI, higher plasma sTNFR1 and CXCL-10 with higher lipopolysaccharide stimulated expression of TNFα and IL-6, concomitant with lower postvaccination influenza antibody titers. In HIV+ CD11b expressers, the depletion of inflammatory monocytes from peripheral blood mononuclear cells resulted in enhanced antigen-specific CD4 T-cell proliferation. Immature CD56 natural killer cells were lower in young HIV+ compared with young HIV- participants. Perturbations of innate immunity and inflammation signified by high CD11b on inflammatory monocytes are exacerbated with aging in HIV+ and negatively impact immune function involved in Ab response to influenza vaccination.
Cellular immunity for prevention and clearance of HIV infection.
Kalams, Spyros A
2003-05-01
Despite the major strides that have been made in HIV therapy with the advent of potent anti-retroviral drugs, these medications are quite expensive and are still not readily available for the vast majority of infected individuals worldwide. Even when available, the long-term toxicities associated with anti-retroviral medications and the frequent emergence of drug-resistance mutations can complicate therapy, making the formulation of effective vaccines imperative. This chapter will review the current state of understanding regarding cell-mediated immune responses that are associated with control of HIV replication. This knowledge has generated sound hypotheses regarding the prospects for augmenting cell-mediated immunity through immune-based therapies. With regard to prophylactic vaccines, it is presently unclear which vaccine-induced immune responses will protect against infection. While much progress has been made in formulating vaccine constructs designed to elicit cell-mediated immune responses, sterilizing immunity is unlikely to be achieved with the current vaccines. However, the ability to control viremia and prevent disease progression in animal infection models looks promising. The ability to measure immune responses has also advanced markedly over the past few years and will allow investigators to more accurately measure the immunogenicity of vaccine constructs, and correlate the magnitude and breadth of these responses with protection.
Mucosal Immunology of HIV Infection
Xu, Huanbin; Wang, Xiaolei; Veazey, Ronald S.
2013-01-01
Summary Recent advances in the immunology, pathogenesis, and prevention of human immunodeficiency virus (HIV) infection continue to reveal clues to the mechanisms involved in the progressive immunodeficiency attributed to infection but more importantly have shed light on the correlates of immunity to infection and disease progression. HIV selectively infects, eliminates, and/or dysregulates several key cells of the human immune system, thwarting multiple arms of the host immune response, and inflicting severe damage to mucosal barriers, resulting in tissue infiltration of ‘symbiotic’ intestinal bacteria and viruses that essentially become opportunistic infections promoting systemic immune activation. This leads to activation and recruitment or more target cells for perpetuating HIV infection, resulting in persistent, high level viral replication in lymphoid tissues, rapid evolution of resistant strains, and continued evasion of immune responses. However, vaccine studies and studies of spontaneous controllers are finally providing correlates of immunity from protection and disease progression, including virus-specific CD4+ T-cell responses, binding antibodies, innate immune responses, and generation of antibodies with potent antibody-dependent cell-mediated cytotoxicity activity. Emerging correlates of immunity indicate that prevention of HIV infection may be possible through effective vaccine strategies that protect and stimulate key regulatory cells and immune responses in susceptible hosts. Further, immune therapies specifically directed towards boosting specific aspects of the immune system may eventually lead to a cure for HIV-infected patients. PMID:23772612
Kunwar, Pratima; Hawkins, Natalie; Dinges, Warren L.; Liu, Yi; Gabriel, Erin E.; Swan, David A.; Stevens, Claire E.; Maenza, Janine; Collier, Ann C.; Mullins, James I.; Hertz, Tomer; Yu, Xuesong; Horton, Helen
2013-01-01
A successful HIV vaccine will likely induce both humoral and cell-mediated immunity, however, the enormous diversity of HIV has hampered the development of a vaccine that effectively elicits both arms of the adaptive immune response. To tackle the problem of viral diversity, T cell-based vaccine approaches have focused on two main strategies (i) increasing the breadth of vaccine-induced responses or (ii) increasing vaccine-induced responses targeting only conserved regions of the virus. The relative extent to which set-point viremia is impacted by epitope-conservation of CD8+ T cell responses elicited during early HIV-infection is unknown but has important implications for vaccine design. To address this question, we comprehensively mapped HIV-1 CD8+ T cell epitope-specificities in 23 ART-naïve individuals during early infection and computed their conservation score (CS) by three different methods (prevalence, entropy and conseq) on clade-B and group-M sequence alignments. The majority of CD8+ T cell responses were directed against variable epitopes (p<0.01). Interestingly, increasing breadth of CD8+ T cell responses specifically recognizing conserved epitopes was associated with lower set-point viremia (r = - 0.65, p = 0.009). Moreover, subjects possessing CD8+ T cells recognizing at least one conserved epitope had 1.4 log10 lower set-point viremia compared to those recognizing only variable epitopes (p = 0.021). The association between viral control and the breadth of conserved CD8+ T cell responses may be influenced by the method of CS definition and sequences used to determine conservation levels. Strikingly, targeting variable versus conserved epitopes was independent of HLA type (p = 0.215). The associations with viral control were independent of functional avidity of CD8+ T cell responses elicited during early infection. Taken together, these data suggest that the next-generation of T-cell based HIV-1 vaccines should focus on strategies that
Pauthner, Matthias; Havenar-Daughton, Colin; Sok, Devin; Nkolola, Joseph P; Bastidas, Raiza; Boopathy, Archana V; Carnathan, Diane G; Chandrashekar, Abishek; Cirelli, Kimberly M; Cottrell, Christopher A; Eroshkin, Alexey M; Guenaga, Javier; Kaushik, Kirti; Kulp, Daniel W; Liu, Jinyan; McCoy, Laura E; Oom, Aaron L; Ozorowski, Gabriel; Post, Kai W; Sharma, Shailendra K; Steichen, Jon M; de Taeye, Steven W; Tokatlian, Talar; Torrents de la Peña, Alba; Butera, Salvatore T; LaBranche, Celia C; Montefiori, David C; Silvestri, Guido; Wilson, Ian A; Irvine, Darrell J; Sanders, Rogier W; Schief, William R; Ward, Andrew B; Wyatt, Richard T; Barouch, Dan H; Crotty, Shane; Burton, Dennis R
2017-06-20
The development of stabilized recombinant HIV envelope trimers that mimic the virion surface molecule has increased enthusiasm for a neutralizing antibody (nAb)-based HIV vaccine. However, there is limited experience with recombinant trimers as immunogens in nonhuman primates, which are typically used as a model for humans. Here, we tested multiple immunogens and immunization strategies head-to-head to determine their impact on the quantity, quality, and kinetics of autologous tier 2 nAb development. A bilateral, adjuvanted, subcutaneous immunization protocol induced reproducible tier 2 nAb responses after only two immunizations 8 weeks apart, and these were further enhanced by a third immunization with BG505 SOSIP trimer. We identified immunogens that minimized non-neutralizing V3 responses and demonstrated that continuous immunogen delivery could enhance nAb responses. nAb responses were strongly associated with germinal center reactions, as assessed by lymph node fine needle aspiration. This study provides a framework for preclinical and clinical vaccine studies targeting nAb elicitation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Furci, Lucinda; Scarlatti, Gabriella; Burastero, Samuele; Tambussi, Giuseppe; Colognesi, Claudia; Quillent, Caroline; Longhi, Renato; Loverro, Patrizia; Borgonovo, Barbara; Gaffi, Davide; Carrow, Emily; Malnati, Mauro; Lusso, Paolo; Siccardi, Antonio G.; Lazzarin, Adriano; Beretta, Alberto
1997-01-01
Despite repeated exposure to HIV-1, certain individuals remain persistently uninfected. Such exposed uninfected (EU) people show evidence of HIV-1–specific T cell immunity and, in rare cases, selective resistance to infection by macrophage-tropic strains of HIV-1. The latter has been associated with a 32–base pair deletion in the C–C chemokine receptor gene CCR-5, the major coreceptor of macrophage-tropic strains of HIV-1. We have undertaken an analysis of the HIV-specific T cell responses in 12 EU individuals who were either homozygous for the wild-type CCR-5 allele or heterozygous for the deletion allele (CCR-5Δ32). We have found evidence of an oligoclonal T cell response mediated by helper T cells specific for a conserved region of the HIV-1 envelope. These cells produce very high levels of C–C chemokines when stimulated by the specific antigen and suppress selectively the replication of macrophage-tropic, but not T cell–tropic, strains of HIV-1. These chemokine-producing helper cells may be part of a protective immune response that could be potentially exploited for vaccine development. PMID:9236198
Panahi, Zeinab; Abdoli, Asghar; Mosayebi, Ghasem; Mahdavi, Mehdi; Bahrami, Fariborz
2018-03-01
To evaluate the combined effects of CpG oligodeoxynucleotides (CpG-ODNs) adjuvant and subcutaneous injection route on efficacy of a HIV-1-tat DNA vaccine candidate using BALB/c mice as an animal model. Evaluation of cellular and humoral immunity of mice injected subcutaneously with HIV-1-tat gene cloned into a pcDNA3.1 vector indicated that significant levels of IFN-γ cytokine secretion (900 pg/ml), lymphocyte proliferation (2.5 stimulation index) and IgG 2a (1.45 absorbance 450 nm) production could be achieved. These indicators of stimulated cellular immunity were elicited 2 weeks after the last injection (P < 0.05). Formulation of HIV-1-tat DNA vaccine candidate with CpG-ODNs as an adjuvant while administrated subcutaneously are a promising approach to induce effective cellular immunity responses against HIV-1 infection.
Jackson, Ronald J; Worley, Matthew; Trivedi, Shubhanshi; Ranasinghe, Charani
2014-09-29
We have established that the efficacy of a heterologous poxvirus vectored HIV vaccine, fowlpox virus (FPV)-HIV gag/pol prime followed by attenuated vaccinia virus (VV)-HIV gag/pol booster immunisation, is strongly influenced by the cytokine milieu at the priming vaccination site, with endogenous IL-13 detrimental to the quality of the HIV specific CD8+ T cell response induced. We have now developed a novel HIV vaccine that co-expresses a C-terminal deletion mutant of the mouse IL-4, deleted for the essential tyrosine (Y119) required for signalling. In our vaccine system, the mutant IL-4C118 can bind to IL-4 type I and II receptors with high affinity, and transiently prevent the signalling of both IL-4 and IL-13 at the vaccination site. When this IL-4C118 adjuvanted vaccine was used in an intranasal rFPV/intramuscular rVV prime-boost immunisation strategy, greatly enhanced mucosal/systemic HIV specific CD8+ T cells with higher functional avidity, expressing IFN-γ, TNF-α and IL-2 and greater protective efficacy were detected. Surprisingly, the IL-4C118 adjuvanted vaccines also induced robust long-lived HIV gag-specific serum antibody responses, specifically IgG1 and IgG2a. The p55-gag IgG2a responses induced were of a higher magnitude relative to the IL-13Rα2 adjuvant vaccine. More interestingly, our recently tested IL-13Rα2 adjuvanted vaccine which only inhibited IL-13 activity, even though induced excellent high avidity HIV-specific CD8+ T cells, had a detrimental impact on the induction of gag-specific IgG2a antibody immunity. Our observations suggest that (i) IL-4 cell-signalling in the absence of IL-13 retarded gag-specific antibody isotype class switching, or (ii) IL-13Rα2 signalling was involved in inducing good gag-specific B cell immunity. Thus, we believe our novel IL-4R antagonist adjuvant strategy offers great promise not only for HIV-1 vaccines, but also against a range of chronic infections where sustained high quality mucosal and systemic T and B
Bogers, Willy M.; Oostermeijer, Herman; Mooij, Petra; Koopman, Gerrit; Verschoor, Ernst J.; Davis, David; Ulmer, Jeffrey B.; Brito, Luis A.; Cu, Yen; Banerjee, Kaustuv; Otten, Gillis R.; Burke, Brian; Dey, Antu; Heeney, Jonathan L.; Shen, Xiaoying; Tomaras, Georgia D.; Labranche, Celia; Montefiori, David C.; Liao, Hua-Xin; Haynes, Barton; Geall, Andrew J.; Barnett, Susan W.
2015-01-01
Self-amplifying messenger RNA (mRNA) of positive-strand RNA viruses are effective vectors for in situ expression of vaccine antigens and have potential as a new vaccine technology platform well suited for global health applications. The SAM vaccine platform is based on a synthetic, self-amplifying mRNA delivered by a nonviral delivery system. The safety and immunogenicity of an HIV SAM vaccine encoding a clade C envelope glycoprotein formulated with a cationic nanoemulsion (CNE) delivery system was evaluated in rhesus macaques. The HIV SAM vaccine induced potent cellular immune responses that were greater in magnitude than those induced by self-amplifying mRNA packaged in a viral replicon particle (VRP) or by a recombinant HIV envelope protein formulated with MF59 adjuvant, anti-envelope binding (including anti-V1V2), and neutralizing antibody responses that exceeded those induced by the VRP vaccine. These studies provide the first evidence in nonhuman primates that HIV vaccination with a relatively low dose (50 µg) of formulated self-amplifying mRNA is safe and immunogenic. PMID:25234719
Schweighardt, Becky; Wrin, Terri; Meiklejohn, Duncan A.; Spotts, Gerald; Petropoulos, Christos J.; Nixon, Douglas F.; Hecht, Frederick M.
2010-01-01
We analyzed immune responses in chronically HIV-infected individuals who took part in a treatment interruption (TI) trial designed for patients who initiated anti-retroviral therapy within 6 months of seroconversion. In the two subjects that exhibited the best viral control, we detected CD8+ T cell responses against 1-2 Gag epitopes during the early weeks of TI and a subsequent increase in the number of epitopes recognized by the later time points. Each of these subjects developed mutations within the epitopes targeted by the highest magnitude responses. In the subject with the worst viral control, we detected responses against two Gag epitopes throughout the entire TI and no Gag mutations. The magnitude of these responses increased dramatically with time, greatly exceeding those detected in the virologic controllers. The highest levels of contemporaneous autologous neutralizing antibody activity were detected in the virologic controllers, and a subsequent escape mutation developed within the envelope gene of one controller that abrogated the response. These data suggest that immune escape mutations are a sign of viral control during TI, and that the absence of immune escape mutations in the presence of high-levels of viral replication indicates the lack of an effective host immune response. PMID:19910798
Engineering T Cells to Functionally Cure HIV-1 Infection.
Leibman, Rachel S; Riley, James L
2015-07-01
Despite the ability of antiretroviral therapy to minimize human immunodeficiency virus type 1 (HIV-1) replication and increase the duration and quality of patients' lives, the health consequences and financial burden associated with the lifelong treatment regimen render a permanent cure highly attractive. Although T cells play an important role in controlling virus replication, they are themselves targets of HIV-mediated destruction. Direct genetic manipulation of T cells for adoptive cellular therapies could facilitate a functional cure by generating HIV-1-resistant cells, redirecting HIV-1-specific immune responses, or a combination of the two strategies. In contrast to a vaccine approach, which relies on the production and priming of HIV-1-specific lymphocytes within a patient's own body, adoptive T-cell therapy provides an opportunity to customize the therapeutic T cells prior to administration. However, at present, it is unclear how to best engineer T cells so that sustained control over HIV-1 replication can be achieved in the absence of antiretrovirals. This review focuses on T-cell gene-engineering and gene-editing strategies that have been performed in efforts to inhibit HIV-1 replication and highlights the requirements for a successful gene therapy-mediated functional cure.
Rollenhagen, C; Asin, S N
2011-11-01
Knowledge about early innate immune responses at the mucosal surfaces of the female genital tract is important in understanding the pathogenesis of heterosexual transmission of human immunodeficiency virus type-1 (HIV-1). As estradiol decreases inflammatory responses, we postulated that an estradiol-deficient state such as post-menopause could enhance expression of inflammatory factors that stimulate HIV-1 replication. We compare HIV-1 integration, transcription, and viral p24 release levels among ectocervical tissues obtained from pre- and post-menopausal donors. We detected enhanced HIV-1 p24 release levels in post- compared with pre-menopausal tissues (P<0.0001), but saw no difference in HIV-1 integration. Overall, 100% of post-menopausal tissues exhibited levels of HIV-1 transcription above background compared with only 60% of pre-menopausal tissues. Increased HIV-1 transcription was associated with enhanced interleukin (IL)-1β, IL-6, monocyte chemotactic protein-1, growth-regulated oncogene-α, and interferon-γ-inducible protein-10 expression. Neutralization and nuclear factor-κB-targeting small-interfering RNA experiments both decreased HIV-1 transcription, suggesting that the early inflammatory response may facilitate HIV-1 replication in ex vivo ectocervical tissues from post-menopausal women.
Induction of innate immunity in control of mucosal transmission of HIV.
Wang, Yufei; Lehner, Thomas
2011-09-01
To present evidence of the role of innate mucosal immunity and to harness this arm of immunity in protection against HIV infection. Dendritic cells, monocytes, natural killer (NK) cells and γδ T cells are critical in innate immunity, which is mediated by Toll-like receptor (TLR) and recently identified stress pathways. Complement factors, cytokines and chemokines have diverse functions usually affecting HIV infection indirectly. A novel group of innate intracellular HIV restriction factors has been identified - APOBEC3G, TRIM5α and tetherin - all of which are upregulated by type I interferons and some by vaccination and TLR agonists. Whereas innate immunity conventionally lacks memory, recent evidence suggests that some of the cells and intracellular factors may express immunological memory-like features. Innate mucosal immunity may provide early effective control of HIV transmission and replication. Some vaccines can enhance innate immune factors, such as APOBEC3G and control HIV during the eclipse period, allowing full weight of neutralizing and/or cytotoxic T cells to develop and prevent mucosal HIV infection. The next generation of vaccines should be designed to target both innate and adaptive immune memory responses.
Fuchs, Jonathan D; Bart, Pierre-Alexandre; Frahm, Nicole; Morgan, Cecilia; Gilbert, Peter B; Kochar, Nidhi; DeRosa, Stephen C; Tomaras, Georgia D; Wagner, Theresa M; Baden, Lindsey R; Koblin, Beryl A; Rouphael, Nadine G; Kalams, Spyros A; Keefer, Michael C; Goepfert, Paul A; Sobieszczyk, Magdalena E; Mayer, Kenneth H; Swann, Edith; Liao, Hua-Xin; Haynes, Barton F; Graham, Barney S; McElrath, M Juliana
2015-05-01
Recombinant adenovirus serotype 5 (rAd5)-vectored HIV-1 vaccines have not prevented HIV-1 infection or disease and pre-existing Ad5 neutralizing antibodies may limit the clinical utility of Ad5 vectors globally. Using a rare Ad serotype vector, such as Ad35, may circumvent these issues, but there are few data on the safety and immunogenicity of rAd35 directly compared to rAd5 following human vaccination. HVTN 077 randomized 192 healthy, HIV-uninfected participants into one of four HIV-1 vaccine/placebo groups: rAd35/rAd5, DNA/rAd5, and DNA/rAd35 in Ad5-seronegative persons; and DNA/rAd35 in Ad5-seropositive persons. All vaccines encoded the HIV-1 EnvA antigen. Antibody and T-cell responses were measured 4 weeks post boost immunization. All vaccines were generally well tolerated and similarly immunogenic. As compared to rAd5, rAd35 was equally potent in boosting HIV-1-specific humoral and cellular immunity and responses were not significantly attenuated in those with baseline Ad5 seropositivity. Like DNA, rAd35 efficiently primed rAd5 boosting. All vaccine regimens tested elicited cross-clade antibody responses, including Env V1/V2-specific IgG responses. Vaccine antigen delivery by rAd35 is well-tolerated and immunogenic as a prime to rAd5 immunization and as a boost to prior DNA immunization with the homologous insert. Further development of rAd35-vectored prime-boost vaccine regimens is warranted.
Sieve analysis in HIV-1 vaccine efficacy trials.
Edlefsen, Paul T; Gilbert, Peter B; Rolland, Morgane
2013-09-01
The genetic characterization of HIV-1 breakthrough infections in vaccine and placebo recipients offers new ways to assess vaccine efficacy trials. Statistical and sequence analysis methods provide opportunities to mine the mechanisms behind the effect of an HIV vaccine. The release of results from two HIV-1 vaccine efficacy trials, Step/HVTN-502 (HIV Vaccine Trials Network-502) and RV144, led to numerous studies in the last 5 years, including efforts to sequence HIV-1 breakthrough infections and compare viral characteristics between the vaccine and placebo groups. Novel genetic and statistical analysis methods uncovered features that distinguished founder viruses isolated from vaccinees from those isolated from placebo recipients, and identified HIV-1 genetic targets of vaccine-induced immune responses. Studies of HIV-1 breakthrough infections in vaccine efficacy trials can provide an independent confirmation to correlates of risk studies, as they take advantage of vaccine/placebo comparisons, whereas correlates of risk analyses are limited to vaccine recipients. Through the identification of viral determinants impacted by vaccine-mediated host immune responses, sieve analyses can shed light on potential mechanisms of vaccine protection.
Dynamics of a Delayed HIV-1 Infection Model with Saturation Incidence Rate and CTL Immune Response
NASA Astrophysics Data System (ADS)
Guo, Ting; Liu, Haihong; Xu, Chenglin; Yan, Fang
2016-12-01
In this paper, we investigate the dynamics of a five-dimensional virus model incorporating saturation incidence rate, CTL immune response and three time delays which represent the latent period, virus production period and immune response delay, respectively. We begin this model by proving the positivity and boundedness of the solutions. Our model admits three possible equilibrium solutions, namely the infection-free equilibrium E0, the infectious equilibrium without immune response E1 and the infectious equilibrium with immune response E2. Moreover, by analyzing corresponding characteristic equations, the local stability of each of the feasible equilibria and the existence of Hopf bifurcation at the equilibrium point E2 are established, respectively. Further, by using fluctuation lemma and suitable Lyapunov functionals, it is shown that E0 is globally asymptotically stable when the basic reproductive numbers for viral infection R0 is less than unity. When the basic reproductive numbers for immune response R1 is less than unity and R0 is greater than unity, the equilibrium point E1 is globally asymptotically stable. Finally, some numerical simulations are carried out for illustrating the theoretical results.
Dilernia, Dario Alberto; Jones, Leandro; Rodriguez, Sabrina; Turk, Gabriela; Rubio, Andrea E.; Pampuro, Sandra; Gomez-Carrillo, Manuel; Bautista, Christian; Deluchi, Gabriel; Benetucci, Jorge; Lasala, María Beatriz; Lourtau, Leonardo; Losso, Marcelo Horacio; Perez, Héctor; Cahn, Pedro; Salomón, Horacio
2008-01-01
Background Cytotoxic T-Lymphocyte (CTL) response drives the evolution of HIV-1 at a host-level by selecting HLA-restricted escape mutations. Dissecting the dynamics of these escape mutations at a population-level would help to understand how HLA-mediated selection drives the evolution of HIV-1. Methodology/Principal Findings We undertook a study of the dynamics of HIV-1 CTL-escape mutations by analyzing through statistical approaches and phylogenetic methods the viral gene gag sequenced in plasma samples collected between the years 1987 and 2006 from 302 drug-naïve HIV-positive patients. By applying logistic regression models and after performing correction for multiple test, we identified 22 potential CTL-escape mutations (p-value<0.05; q-value<0.2); 10 of these associations were confirmed in samples biologically independent by a Bayesian Markov Chain Monte-Carlo method. Analyzing their prevalence back in time we found that escape mutations that are the consensus residue in samples collected after 2003 have actually significantly increased in time in one of either B or F subtype until becoming the most frequent residue, while dominating the other viral subtype. Their estimated prevalence in the viral subtype they did not dominate was lower than 30% for the majority of samples collected at the end of the 80's. In addition, when screening the entire viral region, we found that the 75% of positions significantly changing in time (p<0.05) were located within known CTL epitopes. Conclusions Across HIV Gag protein, the rise of polymorphisms from independent origin during the last twenty years of epidemic in our setting was related to an association with an HLA allele. The fact that these mutations accumulated in one of either B or F subtypes have also dominated the other subtype shows how this selection might be causing a convergence of viral subtypes to variants which are more likely to evade the immune response of the population where they circulate. PMID:18941505
Hajam, Irshad Ahmed; Lee, John Hwa
2017-06-01
Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.
B cell clonal lineage alterations upon recombinant HIV-1 envelope immunization of Rhesus macaques
USDA-ARS?s Scientific Manuscript database
Broadly neutralizing HIV-1 antibodies (bNAbs) isolated from infected subjects display protective potential in animal models. Their elicitation by immunization is thus highly desirable. The HIV-1 envelope glycoprotein (Env) is the sole viral target of bnAbs, but is also targeted by binding, non-neutr...
HIV-1 functional cure: will the dream come true?
Liu, Chao; Ma, Xiancai; Liu, Bingfeng; Chen, Cancan; Zhang, Hui
2015-11-20
The reservoir of human immunodeficiency virus type 1 (HIV-1), a long-lived pool of latently infected cells harboring replication-competent viruses, is the major obstacle to curing acquired immune deficiency syndrome (AIDS). Although the combination antiretroviral therapy (cART) can successfully suppress HIV-1 viremia and significantly delay the progression of the disease, it cannot eliminate the viral reservoir and the patient must continue to take anti-viral medicines for life. Currently, the appearance of the 'Berlin patient', the 'Boston patients', and the 'Mississippi baby' have inspired many therapeutic strategies for HIV-1 aimed at curing efforts. However, the specific eradication of viral latency and the recovery and optimization of the HIV-1-specific immune surveillance are major challenges to achieving such a cure. Here, we summarize recent studies addressing the mechanisms underlying the viral latency and define two categories of viral reservoir: 'shallow' and 'deep'. We also present the current strategies and recent advances in the development of a functional cure for HIV-1, focusing on full/partial replacement of the immune system, 'shock and kill', and 'permanent silencing' approaches.
Hulot, Sandrine L; Seaman, Michael S; Sen, Pritha; Autissier, Patrick A; Manuel, Edwin R; Letvin, Norman L
2009-10-01
An ideal human immunodeficiency virus type 1 (HIV-1) vaccine would elicit potent cellular and humoral immune responses that recognize diverse strains of the virus. In the present study, combined methodologies (flow cytometry, Vbeta repertoire analysis, and complementarity-determining region 3 sequencing) were used to determine the clonality of CD8(+) T lymphocytes taking part in the recognition of variant epitope peptides elicited in Mamu-A*01-positive rhesus monkeys immunized with vaccines encoding diverse HIV-1 envelopes (Envs). Monkeys immunized with clade B Envs generated CD8(+) T lymphocytes that cross-recognized both clade B- and clade C-p41A epitope peptides using a large degree of diversity in Vbeta gene usage. However, with two monkeys immunized with clade C Env, one monkey exhibited p41A-specific cytotoxic T-lymphocytes (CTL) with the capacity for cross-recognition of variant epitopes, while the other monkey did not. These studies demonstrate that the cross-reactive potential of variant p41A epitope peptide-specific CTL populations can differ between monkeys that share the same restricting major histocompatibility complex class I molecule and receive the same vaccine immunogens.
Williams, Wilton B; Liao, Hua-Xin; Moody, M Anthony; Kepler, Thomas B; Alam, S Munir; Gao, Feng; Wiehe, Kevin; Trama, Ashley M; Jones, Kathryn; Zhang, Ruijun; Song, Hongshuo; Marshall, Dawn J; Whitesides, John F; Sawatzki, Kaitlin; Hua, Axin; Liu, Pinghuang; Tay, Matthew Z; Seaton, Kelly E; Shen, Xiaoying; Foulger, Andrew; Lloyd, Krissey E; Parks, Robert; Pollara, Justin; Ferrari, Guido; Yu, Jae-Sung; Vandergrift, Nathan; Montefiori, David C; Sobieszczyk, Magdalena E; Hammer, Scott; Karuna, Shelly; Gilbert, Peter; Grove, Doug; Grunenberg, Nicole; McElrath, M Juliana; Mascola, John R; Koup, Richard A; Corey, Lawrence; Nabel, Gary J; Morgan, Cecilia; Churchyard, Gavin; Maenza, Janine; Keefer, Michael; Graham, Barney S; Baden, Lindsey R; Tomaras, Georgia D; Haynes, Barton F
2015-08-14
An HIV-1 DNA prime vaccine, with a recombinant adenovirus type 5 (rAd5) boost, failed to protect from HIV-1 acquisition. We studied the nature of the vaccine-induced antibody (Ab) response to HIV-1 envelope (Env). HIV-1-reactive plasma Ab titers were higher to Env gp41 than to gp120, and repertoire analysis demonstrated that 93% of HIV-1-reactive Abs from memory B cells responded to Env gp41. Vaccine-induced gp41-reactive monoclonal antibodies were non-neutralizing and frequently polyreactive with host and environmental antigens, including intestinal microbiota (IM). Next-generation sequencing of an immunoglobulin heavy chain variable region repertoire before vaccination revealed an Env-IM cross-reactive Ab that was clonally related to a subsequent vaccine-induced gp41-reactive Ab. Thus, HIV-1 Env DNA-rAd5 vaccine induced a dominant IM-polyreactive, non-neutralizing gp41-reactive Ab repertoire response that was associated with no vaccine efficacy. Copyright © 2015, American Association for the Advancement of Science.
Burke, D S
1993-01-01
A review of the history of 'vaccine therapy' for infectious diseases is presented. The concept originated when Auzias-Turenne introduced 'syphilitic vaccination' or 'syphilization' as a treatment for syphilis in Paris in the mid-1800s; his clinical studies probably influenced Pasteur's successful rabies postexposure vaccine trials. Robert Koch in Berlin in the 1890s observed that inoculation of tuberculin into patients with tuberculosis induced an inflammatory response in affected tissues, and advocated 'tuberculin therapy'. Sir Almroth Wright in London in the early 20th century devised methods to measure changes in serum 'opsonizing' activity in response to therapeutic inoculations with microbe-derived vaccines. Since the advent of antibiotics, active specific immunization with microbe-derived antigens (vaccine therapy) has been largely forgotten as a strategy for treatment of infectious diseases. Advances in antigen production and in molecular immunology now permit new tactics to probe, analyse and selectively alter in vivo human immune responses to infectious microbes. Our recent demonstration that vaccine therapy can boost natural immunity to HIV in infected patients should rekindle interest in this approach.
Pakker, N G; Kroon, E D; Roos, M T; Otto, S A; Hall, D; Wit, F W; Hamann, D; van der Ende, M E; Claessen, F A; Kauffmann, R H; Koopmans, P P; Kroon, F P; ten Napel, C H; Sprenger, H G; Weigel, H M; Montaner, J S; Lange, J M; Reiss, P; Schellekens, P T; Miedema, F
1999-02-04
Current antiretroviral treatment can induce significant and sustained virological and immunological responses in HIV-1-infected persons over at least the short- to mid-term. In this study, long-term immune reconstitution was investigated during highly active antiretroviral therapy. Patients enrolled in the INCAS study in The Netherlands were treated for 102 weeks (range 52-144 weeks) with nevirapine (NVP) + zidovudine (ZDV) (n = 9), didanosine (ddl) + ZDV (n = 10), or NVP + ddl + ZDV (n = 10). Memory and naïve CD4+ and CD8+ T cells were measured using CD45RA and CD27 monoclonal antibodies (mAb), T-cell function was assayed by CD3 + CD28 mAb stimulation, and plasma HIV-1 RNA load was measured by ultra-direct assay (cut-off < 20 copies/ml). Compared to both double combination regimens the triple combination regimen resulted in the most sustained increase in CD4+ T cells (change in CD4+, + 253 x 10(6) cells/l; standard error, 79 x 10(6) cells/l) and reduction of plasma HIV-1 RNA. In nine patients (31%) (ddl + ZDV, n = 2; NVP + ddl + ZDV, n = 7) plasma HIV-1 RNA levels remained below cut-off for at least 2 years. On average, these long-term virological responders demonstrated a significantly higher increase of naïve and memory CD4+ T cells (P = 0.01 and 0.02, respectively) as compared with patients with a virological failure, and showed improved T-cell function and normalization of the naïve; memory CD8+ T-cell ratio. However, individual virological success or failure did not predict the degree of immunological response. T-cell patterns were independent of baseline CD4+ T-cell count, T-cell function, HIV-1 RNA load or age. Low numbers of naïve CD4+ T cells at baseline resulted in modest long-term naïve T-cell recovery. Patients with prolonged undetectable plasma HIV-1 RNA levels during antiretroviral therapy do not invariably show immune restoration. Naïve T-cell recovery in the setting of complete viral suppression is a gradual process, similar to that reported
Mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens
Korber, Bette T [Los Alamos, NM; Fischer, William [Los Alamos, NM; Liao, Hua-Xin [Durham, NC; Haynes, Barton F [Durham, NC; Letvin, Norman [Boston, MA; Hahn,; Beatrice, H [Birmingham, AL
2011-05-31
The present invention relates to mosaic clade M HIV-1 Env polypeptides and to compositions comprising same. The polypeptides of the invention are suitable for use in inducing an immune response to HIV-1 in a human.
Mucosal immunology of HIV infection.
Xu, Huanbin; Wang, Xiaolei; Veazey, Ronald S
2013-07-01
Recent advances in the immunology, pathogenesis, and prevention of human immunodeficiency virus (HIV) infection continue to reveal clues to the mechanisms involved in the progressive immunodeficiency attributed to infection, but more importantly have shed light on the correlates of immunity to infection and disease progression. HIV selectively infects, eliminates, and/or dysregulates several key cells of the human immune system, thwarting multiple arms of the host immune response, and inflicting severe damage to mucosal barriers, resulting in tissue infiltration of 'symbiotic' intestinal bacteria and viruses that essentially become opportunistic infections promoting systemic immune activation. This leads to activation and recruitment or more target cells for perpetuating HIV infection, resulting in persistent, high-level viral replication in lymphoid tissues, rapid evolution of resistant strains, and continued evasion of immune responses. However, vaccine studies and studies of spontaneous controllers are finally providing correlates of immunity from protection and disease progression, including virus-specific CD4(+) T-cell responses, binding anti-bodies, innate immune responses, and generation of antibodies with potent antibody-dependent cell-mediated cytotoxicity activity. Emerging correlates of immunity indicate that prevention of HIV infection may be possible through effective vaccine strategies that protect and stimulate key regulatory cells and immune responses in susceptible hosts. Furthermore, immune therapies specifically directed toward boosting specific aspects of the immune system may eventually lead to a cure for HIV-infected patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Kløverpris, Henrik N.; McGregor, Reuben; McLaren, James E.; Ladell, Kristin; Stryhn, Anette; Koofhethile, Catherine; Brener, Jacqui; Chen, Fabian; Riddell, Lynn; Graziano, Luzzi; Klenerman, Paul; Leslie, Alasdair; Buus, Søren; Price, David A.; Goulder, Philip
2014-01-01
Objectives: Although CD8+ T cells play a critical role in the control of HIV-1 infection, their antiviral efficacy can be limited by antigenic variation and immune exhaustion. The latter phenomenon is characterized by the upregulation of multiple inhibitory receptors, such as programmed death-1 (PD-1), CD244 and lymphocyte activation gene-3 (LAG-3), which modulate the functional capabilities of CD8+ T cells. Design and methods: Here, we used an array of different human leukocyte antigen (HLA)-B∗15 : 03 and HLA-B∗42 : 01 tetramers to characterize inhibitory receptor expression as a function of differentiation on HIV-1-specific CD8+ T-cell populations (n = 128) spanning 11 different epitope targets. Results: Expression levels of PD-1, but not CD244 or LAG-3, varied substantially across epitope specificities both within and between individuals. Differential expression of PD-1 on T-cell receptor (TCR) clonotypes within individual HIV-1-specific CD8+ T-cell populations was also apparent, independent of clonal dominance hierarchies. Positive correlations were detected between PD-1 expression and plasma viral load, which were reinforced by stratification for epitope sequence stability and dictated by effector memory CD8+ T cells. Conclusion: Collectively, these data suggest that PD-1 expression on HIV-1-specific CD8+ T cells tracks antigen load at the level of epitope specificity and TCR clonotype usage. These findings are important because they provide evidence that PD-1 expression levels are influenced by peptide/HLA class I antigen exposure. PMID:24906112
Curtis, Donna J.; Muresan, Petronella; Nachman, Sharon; Fenton, Terence; Richardson, Kelly M.; Dominguez, Teresa; Flynn, Patricia M.; Spector, Stephen A.; Cunningham, Coleen K.; Bloom, Anthony; Weinberg, Adriana
2015-01-01
Objectives We investigated immune determinants of antibody responses and B-cell memory to pH1N1 vaccine in HIV-infected children. Methods Ninety subjects 4 to <25 years of age received two double doses of pH1N1 vaccine. Serum and cells were frozen at baseline, after each vaccination, and at 28 weeks post-immunization. Hemagglutination inhibition (HAI) titers, avidity indices (AI), B-cell subsets, and pH1N1 IgG and IgA antigen secreting cells (ASC) were measured at baseline and after each vaccination. Neutralizing antibodies and pH1N1-specific Th1, Th2 and Tfh cytokines were measured at baseline and post-dose 1. Results At entry, 26 (29%) subjects had pH1N1 protective HAI titers (≥1:40). pH1N1-specific HAI, neutralizing titers, AI, IgG ASC, IL-2 and IL-4 increased in response to vaccination (p<0.05), but IgA ASC, IL-5, IL-13, IL-21, IFNγ and B-cell subsets did not change. Subjects with baseline HAI ≥1:40 had significantly greater increases in IgG ASC and AI after immunization compared with those with HAI <1:40. Neutralizing titers and AI after vaccination increased with older age. High pH1N1 HAI responses were associated with increased IgG ASC, IFNγ, IL-2, microneutralizion titers, and AI. Microneutralization titers after vaccination increased with high IgG ASC and IL-2 responses. IgG ASC also increased with high IFNγ responses. CD4% and viral load did not predict the immune responses post-vaccination, but the B-cell distribution did. Notably, vaccine immunogenicity increased with high CD19+CD21+CD27+% resting memory, high CD19+CD10+CD27+% immature activated, low CD19+CD21-CD27-CD20-% tissue-like, low CD19+CD21-CD27-CD20-% transitional and low CD19+CD38+HLADR+% activated B-cell subsets. Conclusions HIV-infected children on HAART mount a broad B-cell memory response to pH1N1 vaccine, which was higher for subjects with baseline HAI≥1:40 and increased with age, presumably due to prior exposure to pH1N1 or to other influenza vaccination/infection. The response
T Follicular Helper Cells and B Cell Dysfunction in Aging and HIV-1 Infection
Pallikkuth, Suresh; de Armas, Lesley; Rinaldi, Stefano; Pahwa, Savita
2017-01-01
T follicular helper (Tfh) cells are a subset of CD4 T cells that provide critical signals to antigen-primed B cells in germinal centers to undergo proliferation, isotype switching, and somatic hypermutation to generate long-lived plasma cells and memory B cells during an immune response. The quantity and quality of Tfh cells therefore must be tightly controlled to prevent immune dysfunction in the form of autoimmunity and, on the other hand, immune deficiency. Both Tfh and B cell perturbations appear during HIV infection resulting in impaired antibody responses to vaccines such as seasonal trivalent influenza vaccine, also seen in biologic aging. Although many of the HIV-associated defects improve with antiretroviral therapy (ART), excess immune activation and antigen-specific B and T cell responses including Tfh function are still impaired in virologically controlled HIV-infected persons on ART. Interestingly, HIV infected individuals experience increased risk of age-associated pathologies. This review will discuss Tfh and B cell dysfunction in HIV infection and highlight the impact of chronic HIV infection and aging on Tfh–B cell interactions. PMID:29109730
T Follicular Helper Cells and B Cell Dysfunction in Aging and HIV-1 Infection.
Pallikkuth, Suresh; de Armas, Lesley; Rinaldi, Stefano; Pahwa, Savita
2017-01-01
T follicular helper (Tfh) cells are a subset of CD4 T cells that provide critical signals to antigen-primed B cells in germinal centers to undergo proliferation, isotype switching, and somatic hypermutation to generate long-lived plasma cells and memory B cells during an immune response. The quantity and quality of Tfh cells therefore must be tightly controlled to prevent immune dysfunction in the form of autoimmunity and, on the other hand, immune deficiency. Both Tfh and B cell perturbations appear during HIV infection resulting in impaired antibody responses to vaccines such as seasonal trivalent influenza vaccine, also seen in biologic aging. Although many of the HIV-associated defects improve with antiretroviral therapy (ART), excess immune activation and antigen-specific B and T cell responses including Tfh function are still impaired in virologically controlled HIV-infected persons on ART. Interestingly, HIV infected individuals experience increased risk of age-associated pathologies. This review will discuss Tfh and B cell dysfunction in HIV infection and highlight the impact of chronic HIV infection and aging on Tfh-B cell interactions.
Qendro, Veneta; Bugos, Grace A; Lundgren, Debbie H; Glynn, John; Han, May H; Han, David K
2017-03-01
In order to gain mechanistic insights into multiple sclerosis (MS) pathogenesis, we utilized a multi-dimensional approach to test the hypothesis that mutations in myelin proteins lead to immune activation and central nervous system autoimmunity in MS. Mass spectrometry-based proteomic analysis of human MS brain lesions revealed seven unique mutations of PLP1; a key myelin protein that is known to be destroyed in MS. Surprisingly, in-depth genomic analysis of two MS patients at the genomic DNA and mRNA confirmed mutated PLP1 in RNA, but not in the genomic DNA. Quantification of wild type and mutant PLP RNA levels by qPCR further validated the presence of mutant PLP RNA in the MS patients. To seek evidence linking mutations in abundant myelin proteins and immune-mediated destruction of myelin, specific immune response against mutant PLP1 in MS patients was examined. Thus, we have designed paired, wild type and mutant peptide microarrays, and examined antibody response to multiple mutated PLP1 in sera from MS patients. Consistent with the idea of different patients exhibiting unique mutation profiles, we found that 13 out of 20 MS patients showed antibody responses against specific but not against all the mutant-PLP1 peptides. Interestingly, we found mutant PLP-directed antibody response against specific mutant peptides in the sera of pre-MS controls. The results from integrative proteomic, genomic, and immune analyses reveal a possible mechanism of mutation-driven pathogenesis in human MS. The study also highlights the need for integrative genomic and proteomic analyses for uncovering pathogenic mechanisms of human diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Borges, Andrew Rosa; Wieczorek, Lindsay; Johnson, Benitra; Benesi, Alan J.; Brown, Bruce K.; Kensinger, Richard D.; Krebs, Fred C.; Wigdahl, Brian; Blumenthal, Robert; Puri, Anu; McCutchan, Francine E.; Birx, Deborah L.; Polonis, Victoria R.; Schengrund, Cara-Lynne
2010-01-01
Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3’-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC50s ranging from 0.1 – 7.4 µg/ml. Inhibition of Env-mediated membrane fusion by MVC was also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. PMID:20880566
Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K
2014-01-01
We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosa Borges, Andrew; Wieczorek, Lindsay; Johnson, Benitra
2010-12-05
Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3'-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC{sub 50}s ranging from 0.1 to 7.4 {mu}g/ml. Inhibition of Env-mediated membrane fusion by MVC wasmore » also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. -- Research Highlights: {yields}Multivalent carbohydrates (MVCs) inhibited infection of PBMCs by HIV-1. {yields}MVCs inhibited infection by T cell line-adapted viruses. {yields}MVCs inhibited infection by primary isolates of HIV-1. {yields}MVCs inhibited Env-mediated membrane fusion.« less
Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.
2014-01-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276
Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C
2015-03-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Holmström, Morten Orebo; Riley, Caroline Hasselbalch; Skov, Vibe; Svane, Inge Marie; Hasselbalch, Hans Carl; Andersen, Mads Hald
2018-01-01
The Chronic Myeloproliferative Neoplasms (MPN) are cancers characterized by hyperinflammation and immune deregulation. Concurrently, the expression of the immune check point programmed death ligand 1 (PD-L1) is induced by inflammation. In this study we report on the occurrence of spontaneous T cell responses against a PD-L1 derived epitope in patients with MPN. We show that 71% of patients display a significant immune response against PD-L1, and patients with advanced MPN have significantly fewer and weaker PD-L1 specific immune responses compared to patients with non-advanced MPN. The PD-L1 specific T cell responses are CD4 + T cell responses, and by gene expression analysis we show that expression of PD-L1 is enhanced in patients with MPN. This could imply that the tumor specific immune response in MPN could be enhanced by vaccination with PD-L1 derived epitopes by boosting the anti-regulatory immune response hereby allowing tumor specific T cell to exert anti-tumor immunity.
Bagley, Kenneth; Xu, Rong; Ota-Setlik, Ayuko; Egan, Michael; Schwartz, Jennifer; Fouts, Timothy
2015-01-01
DNA encoded adjuvants are well known for increasing the magnitude of cellular and/or humoral immune responses directed against vaccine antigens. DNA adjuvants can also tune immune responses directed against vaccine antigens to better protect against infection of the target organism. Two potent DNA adjuvants that have unique abilities to tune immune responses are the catalytic A1 domains of Cholera Toxin (CTA1) and Heat-Labile Enterotoxin (LTA1). Here, we have characterized the adjuvant activities of CTA1 and LTA1 using HIV and SIV genes as model antigens. Both of these adjuvants enhanced the magnitude of antigen-specific cellular immune responses on par with those induced by the well-characterized cytokine adjuvants IL-12 and GM-CSF. CTA1 and LTA1 preferentially enhanced cellular responses to the intracellular antigen SIVmac239-gag over those for the secreted HIVBaL-gp120 antigen. IL-12, GM-CSF and electroporation did the opposite suggesting differences in the mechanisms of actions of these diverse adjuvants. Combinations of CTA1 or LTA1 with IL-12 or GM-CSF generated additive and better balanced cellular responses to both of these antigens. Consistent with observations made with the holotoxin and the CTA1-DD adjuvant, CTA1 and LTA1 evoked mixed Th1/Th17 cellular immune responses. Together, these results show that CTA1 and LTA1 are potent DNA vaccine adjuvants that favor the intracellular antigen gag over the secreted antigen gp120 and evoke mixed Th1/Th17 responses against both of these antigens. The results also indicate that achieving a balanced immune response to multiple intracellular and extracellular antigens delivered via DNA vaccination may require combining adjuvants that have different and complementary mechanisms of action. PMID:26042527
Lewis, Brad; Whitney, Stephen; Hudacik, Lauren; Galmin, Lindsey; Huaman, Maria Cecilia; Cristillo, Anthony D.
2014-01-01
The late assembly domain of many viruses is critical for budding. Within these domains, encoded in viral structural proteins, are the conserved motifs PTAP, PPxY and YPxL. These sequences are the key determinants for association of viral proteins with intracellular molecules such as Tsg101, Nedd4 and AIP1/ALIX. While roles for Tsg101 and AIP1/ALIX in HIV-1 budding have been well established, less is known about the role of Nedd4. Recent studies, however, have identified a function for Nedd4-like protein in HIV-1 release. In this study, we investigated post-transcriptional changes of Nedd4 following SHIVSF162P3 infection of rhesus macaques, its role on HIV-1 p24 and gp120 levels in vitro and its potential as an immune modulator in HIV vaccination of BALB/c mice. Increased Nedd4 protein levels were noted in both CD4+ and CD8+ T cells following SHIVSF162P3-infection of naïve macaques. Transient co-transfection studies in 293 cells with HXB2 and Nedd4 demonstrated a Nedd4-mediated increase in p24 and gp120 levels. This increase was found to be dependent on the Ca2+/calmodulin-regulated phospholipid binding C2 domain and not ubiquitin ligase activity or HIV LTR activity. Co-transfection of Nedd4 with plasmid DNA expressing Gag or Env was further shown to augment both intracellular and extracellular Gag or Env proteins. To assess the potential of Nedd4 as an immune modulator, BALB/c mice were immunized intramuscularly with plasmid DNA encoding HIV gag, env and Nedd4. Nedd4 co-administration was found to increase serum anti-p24 but not anti-gp120 antibodies. Nedd4 co-injection was found to have no affect on Gag- or Env-specific IFNγ but had a trend of increased Gag-specific IL-6, IL-17A and TNFα that was not seen following Env stimulation. Based on our initial findings, Nedd4-mediated changes in HIV protein levels and its potential use in HIV-1 vaccine development warrants further investigation. PMID:24614057
Lewis, Brad; Whitney, Stephen; Hudacik, Lauren; Galmin, Lindsey; Huaman, Maria Cecilia; Cristillo, Anthony D
2014-01-01
The late assembly domain of many viruses is critical for budding. Within these domains, encoded in viral structural proteins, are the conserved motifs PTAP, PPxY and YPxL. These sequences are the key determinants for association of viral proteins with intracellular molecules such as Tsg101, Nedd4 and AIP1/ALIX. While roles for Tsg101 and AIP1/ALIX in HIV-1 budding have been well established, less is known about the role of Nedd4. Recent studies, however, have identified a function for Nedd4-like protein in HIV-1 release. In this study, we investigated post-transcriptional changes of Nedd4 following SHIVSF162P3 infection of rhesus macaques, its role on HIV-1 p24 and gp120 levels in vitro and its potential as an immune modulator in HIV vaccination of BALB/c mice. Increased Nedd4 protein levels were noted in both CD4+ and CD8+ T cells following SHIVSF162P3-infection of naïve macaques. Transient co-transfection studies in 293 cells with HXB2 and Nedd4 demonstrated a Nedd4-mediated increase in p24 and gp120 levels. This increase was found to be dependent on the Ca2+/calmodulin-regulated phospholipid binding C2 domain and not ubiquitin ligase activity or HIV LTR activity. Co-transfection of Nedd4 with plasmid DNA expressing Gag or Env was further shown to augment both intracellular and extracellular Gag or Env proteins. To assess the potential of Nedd4 as an immune modulator, BALB/c mice were immunized intramuscularly with plasmid DNA encoding HIV gag, env and Nedd4. Nedd4 co-administration was found to increase serum anti-p24 but not anti-gp120 antibodies. Nedd4 co-injection was found to have no affect on Gag- or Env-specific IFNγ but had a trend of increased Gag-specific IL-6, IL-17A and TNFα that was not seen following Env stimulation. Based on our initial findings, Nedd4-mediated changes in HIV protein levels and its potential use in HIV-1 vaccine development warrants further investigation.
Qualitative features of the HIV-specific CD8+ T-cell response associated with immunologic control.
Hersperger, Adam R; Migueles, Stephen A; Betts, Michael R; Connors, Mark
2011-05-01
Over the past 2 years, a clearer picture has emerged regarding the properties of HIV-specific CD8+ T cells associated with immunologic control of HIV replication. These properties represent a potential mechanism by which rare patients might control HIV replication in the absence of antiretroviral therapy. This review addresses the background and recent findings that have lead to our current understanding of these mechanism(s). Patients with immunologic control of HIV are not distinguished by targeted specificities, or greater numbers or breadth of their HIV-specific CD8+ T-cell response. For this reason, recent work has focused greater attention on qualitative features of this response. The qualitative features most closely associated with immunologic control of HIV are related to the granule-exocytosis-mediated elimination of HIV-infected CD4 T cells. The ability of HIV-specific CD8+ T cells to increase their contents of proteins known to mediate cytotoxicity, such as granzyme B and perforin, appears to be a critical means by which HIV-specific cytotoxic capacity is regulated. Investigation from multiple groups has now focused upon HIV-specific CD8+ T-cell granule-exocytosis-mediated cytotoxicity as a correlate of immunologic control of HIV. In the near future, a more detailed understanding of the qualities associated with immunologic control may provide critical insights regarding the necessary features of a response that should be stimulated by immunotherapies or T-cell-based vaccines.
Kumar, Swati; Morrison, James H; Dingli, David; Poeschla, Eric
2018-05-16
TREX1 has been reported to degrade cytosolic immune-stimulatory DNA, including viral DNA generated during HIV-1 infection, but the dynamic range of its capacity to suppress innate immune stimulation is unknown and its full role in the viral life cycle remains unclear. A main purpose of our study was to determine how the intracellular level of TREX1 affects HIV-1 activation and avoidance of innate immunity. Using stable over-expression and CRISPR-mediated gene disruption, we engineered a range of TREX1 levels in human THP-1 monocytes. Increasing the level of TREX1 dramatically suppressed HIV-1 induction of interferon-stimulated genes (ISGs). Productive infection and integrated proviruses were equal to increased. Knocking out TREX1 impaired viral infectivity, increased early viral cDNA and caused ten-fold or greater increases in HIV-1 ISG induction. Knockout of cyclic GMP-AMP synthase (cGAS) abrogated all ISG induction. Moreover, cGAS knockout produced no increase in single cycle infection, establishing that HIV-1 DNA-triggered signaling is not rapid enough to impair the initial ISG-triggering infection cycle. Disruption of the HIV-1 capsid by PF74 also induced ISGs and this was TREX1 level-dependent, required reverse transcriptase catalysis, and was eliminated by cGAS gene knockout. Thus, the intracellular level of TREX1 pivotally modulates innate immune induction by HIV-1. Partial HIV-1 genomes are the TREX1 target and are sensed by cGAS. The nearly complete lack of innate immune induction despite equal to increased viral integration observed when the TREX1 protein level is experimentally elevated indicates that integration-competent genomes are shielded from cytosolic sensor-effectors during uncoating and transit to the nucleus. IMPORTANCE Much remains unknown about how TREX1 influences HIV-1 replication, whether it targets full-length viral DNA versus partial intermediates, how intracellular TREX1 protein levels correlate with ISG induction, and whether TREX1
Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter
2012-04-01
Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.
Kanagavelu, Saravana; Termini, James M; Gupta, Sachin; Raffa, Francesca N; Fuller, Katherine A; Rivas, Yaelis; Philip, Sakhi; Kornbluth, Richard S; Stone, Geoffrey W
2014-01-01
Adenoviral vectored vaccines have shown considerable promise but could be improved by molecular adjuvants. Ligands in the TNF superfamily (TNFSF) are potential adjuvants for adenoviral vector (Ad5) vaccines based on their central role in adaptive immunity. Many TNFSF ligands require aggregation beyond the trimeric state (multi-trimerization) for optimal biological function. Here we describe Ad5 vaccines for HIV-1 Gag antigen (Ad5-Gag) adjuvanted with the TNFSF ligands 4-1BBL, BAFF, GITRL and CD27L constructed as soluble multi-trimeric proteins via fusion to Surfactant Protein D (SP-D) as a multimerization scaffold. Mice were vaccinated with Ad5-Gag combined with Ad5 expressing one of the SP-D-TNFSF constructs or single-chain IL-12p70 as adjuvant. To evaluate vaccine-induced protection, mice were challenged with vaccinia virus expressing Gag (vaccinia-Gag) which is known to target the female genital tract, a major route of sexually acquired HIV-1 infection. In this system, SP-D-4-1BBL or SP-D-BAFF led to significantly reduced vaccinia-Gag replication when compared to Ad5-Gag alone. In contrast, IL-12p70, SP-D-CD27L and SP-D-GITRL were not protective. Histological examination following vaccinia-Gag challenge showed a dramatic lymphocytic infiltration into the uterus and ovaries of SP-D-4-1BBL and SP-D-BAFF-treated animals. By day 5 post challenge, proinflammatory cytokines in the tissue were reduced, consistent with the enhanced control over viral replication. Splenocytes had no specific immune markers that correlated with protection induced by SP-D-4-1BBL and SP-D-BAFF versus other groups. IL-12p70, despite lack of anti-viral efficacy, increased the total numbers of splenic dextramer positive CD8+ T cells, effector memory T cells, and effector Gag-specific CD8+ T cells, suggesting that these markers are poor predictors of anti-viral immunity in this model. In conclusion, soluble multi-trimeric 4-1BBL and BAFF adjuvants led to strong protection from vaccinia
Immunotherapy with an HIV-DNA Vaccine in Children and Adults
Palma, Paolo; Gudmundsdotter, Lindvi; Finocchi, Andrea; Eriksson, Lars E.; Mora, Nadia; Santilli, Veronica; Aquilani, Angela; Manno, Emma C.; Zangari, Paola; Romiti, Maria Luisa; Montesano, Carla; Grifoni, Alba; Brave, Andreas; Ljungberg, Karl; Blomberg, Pontus; Bernardi, Stefania; Sandström, Eric; Hejdeman, Bo; Rossi, Paolo; Wahren, Britta
2014-01-01
Therapeutic HIV immunization is intended to induce new HIV-specific cellular immune responses and to reduce viral load, possibly permitting extended periods without antiretroviral drugs. A multigene, multi-subtype A, B, C HIV-DNA vaccine (HIVIS) has been used in clinical trials in both children and adults with the aim of improving and broadening the infected individuals’ immune responses. Despite the different country locations, different regimens and the necessary variations in assays performed, this is, to our knowledge, the first attempt to compare children’s and adults’ responses to a particular HIV vaccine. Ten vertically HIV-infected children aged 4–16 years were immunized during antiretroviral therapy (ART). Another ten children were blindly recruited as controls. Both groups continued their antiretroviral treatment during and after vaccinations. Twelve chronically HIV-infected adults were vaccinated, followed by repeated structured therapy interruptions (STI) of their antiretroviral treatment. The adult group included four controls, receiving placebo vaccinations. The HIV-DNA vaccine was generally well tolerated, and no serious adverse events were registered in any group. In the HIV-infected children, an increased specific immune response to Gag and RT proteins was detected by antigen-specific lymphoproliferation. Moreover, the frequency of HIV-specific CD8+ T-cell lymphocytes releasing perforin was significantly higher in the vaccinees than the controls. In the HIV-infected adults, increased CD8+ T-cell responses to Gag, RT and viral protease peptides were detected. No augmentation of HIV-specific lymphoproliferative responses were detected in adults after vaccination. In conclusion, the HIV-DNA vaccine can elicit new HIV-specific cellular immune responses, particularly to Gag antigens, in both HIV-infected children and adults. Vaccinated children mounted transient new HIV-specific immune responses, including both CD4+ T-cell lymphoproliferation
Achenbach, Chad J; Assoumou, Lambert; Deeks, Steven G; Wilkin, Timothy J; Berzins, Baiba; Casazza, Joseph P; Lambert-Niclot, Sidonie; Koup, Richard A; Costagliola, Dominique; Calvez, Vincent; Katlama, Christine; Autran, Brigitte; Murphy, Robert L
2015-03-01
Achievement of a cure for HIV infection might need reactivation of latent virus and improvement of HIV-specific immunity. As an initial step, in this trial we assessed the effect of antiretroviral therapy intensification and immune modulation with a DNA prime and recombinant adenovirus 5 (rAd5) boost vaccine. In this multicentre, randomised, open-label, non-comparative, phase 2 clinical trial, we enrolled eligible adults 18-70 years of age with chronic HIV-1 infection on suppressive antiretroviral therapy with current CD4 count of at least 350 cells per μL and HIV DNA between 10 and 1000 copies per 10(6) peripheral blood mononuclear cells. After an 8 week lead-in of antiretroviral intensification therapy (standard dose raltegravir and dose-adjusted maraviroc based on baseline antiretroviral therapy), patients were randomly assigned (1:1) to receive antiretroviral therapy intensification alone or intensification plus injections of HIV DNA prime vaccine (4 mg VRC-HIVDNA016-00-VP) at weeks 8, 12, and 16, followed by HIV rAd5 boost vaccine (10(10) particle units of VRC-HIVADV014-00-VP) at week 32. Randomisation was computer generated in permuted blocks of six and was stratified by study site. The primary endpoint was a 0·5 log10 or greater decrease in HIV DNA in peripheral blood mononuclear cells at week 56. This study is registered with ClinicalTrials.gov, number NCT00976404. Between Nov 29, 2010, and Oct 28, 2011, we enrolled 28 eligible patients from three academic HIV clinics in the USA. After the 8 week lead-in of antiretroviral intensification therapy, 14 patients were randomly assigned to continue antiretroviral therapy intensification alone and 14 to intensification plus vaccine. Enrolled participants had median CD4 count of 636 cells per μL, median HIV DNA 170 copies per 10(6) peripheral blood mononuclear cells, and duration of antiretroviral therapy of 13 years. The median amount of HIV DNA did not change significantly between baseline and week 56 in the
Weinberg, Adriana; Muresan, Petronella; Fenton, Terence; Richardson, Kelly; Dominguez, Teresa; Bloom, Anthony; Petzold, Elizabeth; Anthony, Patricia; Cunningham, Coleen K.; Spector, Stephen A.; Nachman, Sharon; Siberry, George K.; Handelsman, Edward; Flynn, Patricia M.
2013-01-01
HIV-infected individuals have poor responses to inactivated influenza vaccines. To evaluate the potential role of regulatory T (Treg) and B cells (Breg), we analyzed their correlation with humoral and cell-mediated immune (CMI) responses to pandemic influenza (pH1N1) monovalent vaccine in HIV-infected children and youth. Seventy-four HIV-infected, 4- to 25-y old participants in a 2-dose pH1N1 vaccine study had circulating and pH1N1-stimulated Treg and Breg measured by flow cytometry at baseline, post-dose 1 and post-dose 2. Concomitantly, CMI was measured by ELISPOT and flow cytometry; and antibodies by hemagglutination inhibition (HAI). At baseline, most of the participants had pH1N1-specific IFNγ ELISPOT responses, whose magnitude positively correlated with the baseline pH1N1, but not with seasonal H1N1 HAI titers. pH1N1-specific IFNγ ELISPOT responses did not change post-dose 1 and significantly decreased post-dose 2. In contrast, circulating CD4+CD25+% and CD4+FOXP3+% Treg increased after vaccination. The decrease in IFNγ ELISPOT results was marginally associated with higher pH1N1-specific CD19+FOXP3+ and CD4+TGFβ+% Breg and Treg, respectively. In contrast, increases in HAI titers post-dose 1 were associated with significantly higher circulating CD19+CD25+% post-dose 1, whereas increases in IFNγ ELISPOT results post-dose 1 were associated with higher circulating CD4+/C8+CD25+FOXP3+%. In conclusion, in HIV-infected children and youth, influenza-specific Treg and Breg may contribute to poor responses to vaccination. However, robust humoral and CMI responses to vaccination may result in increased circulating Treg and/or Breg, establishing a feed-back mechanism. PMID:23370281
On cell resistance and immune response time lag in a model for the HIV infection
NASA Astrophysics Data System (ADS)
Solovey, Guillermo; Peruani, Fernando; Ponce Dawson, Silvina; Maria Zorzenon dos Santos, Rita
2004-11-01
Recently, a cellular automata model has been introduced (Phys. Rev. Lett. 87 (2001) 168102) to describe the spread of the HIV infection among target cells in lymphoid tissues. The model reproduces qualitatively the entire course of the infection displaying, in particular, the two time scales that characterize its dynamics. In this work, we investigate the robustness of the model against changes in three of its parameters. Two of them are related to the resistance of the cells to get infected. The other one describes the time interval necessary to mount specific immune responses. We have observed that an increase of the cell resistance, at any stage of the infection, leads to a reduction of the latency period, i.e., of the time interval between the primary infection and the onset of AIDS. However, during the early stages of the infection, when the cell resistance increase is combined with an increase in the initial concentration of infected cells, the original behavior is recovered. Therefore we find a long and a short latency regime (eight and one year long, respectively) depending on the value of the cell resistance. We have obtained, on the other hand, that changes on the parameter that describes the immune system time lag affects the time interval during which the primary infection occurs. Using different extended versions of the model, we also discuss how the two-time scale dynamics is affected when we include inhomogeneities on the cells properties, as for instance, on the cell resistance or on the time interval to mount specific immune responses.
Sena, Angela A. S.; Glavan, Tiffany; Jiang, Guochun; Sankaran-Walters, Sumathi; Grishina, Irina; Dandekar, Satya; Goulart, Luiz R.
2016-01-01
HIV-1 disease progression is paradoxically characterized by systemic chronic immune activation and gut mucosal immune dysfunction, which is not fully defined. Annexin A1 (ANXA1), an inflammation modulator, is a potential link between systemic inflammation and gut immune dysfunction during the simian immunodeficiency virus (SIV) infection. Gene expression of ANXA1 and cytokines were assessed in therapy-naïve rhesus macaques during early and chronic stages of SIV infection and compared with SIV-negative controls. ANXA1 expression was suppressed in the gut but systemically increased during early infection. Conversely, ANXA1 expression increased in both compartments during chronic infection. ANXA1 expression in peripheral blood was positively correlated with HLA-DR+CD4+ and CD8+ T-cell frequencies, and negatively associated with the expression of pro-inflammatory cytokines and CCR5. In contrast, the gut mucosa presented an anergic cytokine profile in relation to ANXA1 expression. In vitro stimulations with ANXA1 peptide resulted in decreased inflammatory response in PBMC but increased activation of gut lymphocytes. Our findings suggest that ANXA1 signaling is dysfunctional in SIV infection, and may contribute to chronic inflammation in periphery and with immune dysfunction in the gut mucosa. Thus, ANXA1 signaling may be a novel therapeutic target for the resolution of immune dysfunction in HIV infection. PMID:27484833
Innate immunity in the control of HIV/AIDS: recent advances and open questions.
Ploquin, Mickaël J-Y; Jacquelin, Béatrice; Jochems, Simon P; Barré-Sinoussi, Françoise; Müller-Trutwin, Michaela C
2012-06-19
From the publication of the first AIDS issue onwards, major advances have been made in the field of innate immunity during HIV infection. Innate immunity can be defined as the first and unspecific lines of defense constitutively present and ready to be mobilized upon infection. Although a large body of literature adamantly highlights that innate immunity is a critical weapon of defense against HIV and its simian parents (simian immunodeficiency virus, SIV), innate immunity is still underexplored. Focusing on innate immunity may open new paths for the development of innovative therapeutics and vaccine strategies against HIV. Understanding innate immunity may shed light on the natural protection occurring in rare HIV-1-infected individuals who control their infection. This review focuses on innate mechanisms sensing HIV-1 entry and controlling HIV-1 infection, as well as promoting inflammation and shaping adaptive immunity.
Kahle, Erin M; Bolton, Michael; Hughes, James P; Donnell, Deborah; Celum, Connie; Lingappa, Jairam R; Ronald, Allan; Cohen, Craig R; de Bruyn, Guy; Fong, Youyi; Katabira, Elly; McElrath, M Juliana; Baeten, Jared M
2015-05-01
A heightened proinflammatory state has been hypothesized to enhance human immunodeficiency virus type 1 (HIV-1) transmission - both susceptibility of HIV-1-exposed persons and infectiousness of HIV-1-infected persons. Using prospective data from heterosexual African couples with HIV-1 serodiscordance, we conducted a nested case-control analysis to assess the relationship between cytokine concentrations and the risk of HIV-1 acquisition. Case couples (n = 120) were initially serodiscordant couples in which HIV-1 was transmitted to the seronegative partner during the study; control couples (n = 321) were serodiscordant couples in which HIV-1 was not transmitted to the seronegative partner. Differences in a panel of 30 cytokines were measured using plasma specimens from both HIV-1-susceptible and HIV-1-infected partners. Plasma was collected before seroconversion for cases. For both HIV-1-infected and HIV-1-susceptible partners, cases and controls had significantly different mean responses in cytokine panels (P < .001, by the Hotelling T(2) test), suggesting a broadly different pattern of immune activation for couples in which HIV-1 was transmitted, compared with couples without transmission. Individually, log10 mean concentrations of interleukin 10 (IL-10) and CXCL10 were significantly higher for both HIV-1-susceptible and HIV-1-infected case partners, compared with HIV-1-susceptible and HIV-1-infected control partners (P < .01 for all comparisons). In multivariate analysis, HIV-1 transmission was significantly associated with elevated CXCL10 concentrations in HIV-1-susceptible partners (P = .001) and with elevated IL-10 concentrations in HIV-1-infected partners (P = .02). Immune activation, as measured by levels of cytokine markers, particularly elevated levels of IL-10 and CXCL1, are associated with increased HIV-1 susceptibility and infectiousness. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All
Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host
NASA Astrophysics Data System (ADS)
Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael
1995-12-01
Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.
Carlson, Jonathan; Yan, Jiyu; Akinsiku, Olusimidele T.; Schaefer, Malinda; Sabbaj, Steffanie; Bet, Anne; Levy, David N.; Heath, Sonya; Tang, Jianming; Kaslow, Richard A.; Walker, Bruce D.; Ndung’u, Thumbi; Goulder, Philip J.; Heckerman, David; Hunter, Eric; Goepfert, Paul A.
2010-01-01
Retroviruses pack multiple genes into relatively small genomes by encoding several genes in the same genomic region with overlapping reading frames. Both sense and antisense HIV-1 transcripts contain open reading frames for known functional proteins as well as numerous alternative reading frames (ARFs). At least some ARFs have the potential to encode proteins of unknown function, and their antigenic properties can be considered as cryptic epitopes (CEs). To examine the extent of active immune response to virally encoded CEs, we analyzed human leukocyte antigen class I–associated polymorphisms in HIV-1 gag, pol, and nef genes from a large cohort of South Africans with chronic infection. In all, 391 CEs and 168 conventional epitopes were predicted, with the majority (307; 79%) of CEs derived from antisense transcripts. In further evaluation of CD8 T cell responses to a subset of the predicted CEs in patients with primary or chronic infection, both sense- and antisense-encoded CEs were immunogenic at both stages of infection. In addition, CEs often mutated during the first year of infection, which was consistent with immune selection for escape variants. These findings indicate that the HIV-1 genome might encode and deploy a large potential repertoire of unconventional epitopes to enhance vaccine-induced antiviral immunity. PMID:20065064
Day, Cheryl L; Abrahams, Deborah A; Harris, Levelle D; van Rooyen, Michele; Stone, Lynnett; de Kock, Marwou; Hanekom, Willem A
2017-09-15
Coinfection with HIV is the single greatest risk factor for reactivation of latent Mycobacterium tuberculosis infection (LTBI) and progression to active tuberculosis disease. HIV-associated dysregulation of adaptive immunity by depletion of CD4 Th cells most likely contributes to loss of immune control of LTBI in HIV-infected individuals, although the precise mechanisms whereby HIV infection impedes successful T cell-mediated control of M. tuberculosis have not been well defined. To further delineate mechanisms whereby HIV impairs protective immunity to M. tuberculosis , we evaluated the frequency, phenotype, and functional capacity of M. tuberculosis -specific CD4 T cells in HIV-infected and HIV-uninfected adults with LTBI. HIV infection was associated with a lower total frequency of cytokine-producing M. tuberculosis -specific CD4 T cells, and preferential depletion of a discrete subset of M. tuberculosis -specific IFN-γ + IL-2 - TNF-α + CD4 T cells. M. tuberculosis -specific CD4 T cells in HIV-infected individuals expressed significantly higher levels of Ki67, compared with HIV-uninfected individuals, thus indicating recent activation and turnover of these cells in vivo. The ex vivo proliferative capacity of M. tuberculosis -specific CD4 T cells was markedly impaired in HIV-infected individuals, compared with HIV-uninfected individuals. Moreover, HIV infection was associated with increased M. tuberculosis Ag-induced CD4 T cell death ex vivo, indicating a possible mechanism contributing to impaired proliferative capacity of M. tuberculosis -specific CD4 T cells in HIV-infected individuals. These data provide new insights into the parameters of M. tuberculosis -specific CD4 T cell immunity that are impaired in HIV-infected individuals with LTBI, which may contribute to their increased risk of developing active tuberculosis disease. Copyright © 2017 by The American Association of Immunologists, Inc.
Risk factors for incomplete immunization in children with HIV infection.
Bhattacharya, Sangeeta Das; Bhattacharyya, Subhasish; Chatterjee, Devlina; Niyogi, Swapan Kumar; Chauhan, Nageshwar; Sudar, A
2014-09-01
To document the immunization rates, factors associated with incomplete immunization, and missed opportunities for immunizations in children affected by HIV presenting for routine outpatient follow-up. A cross-sectional study of immunization status of children affected by HIV presenting for routine outpatient care was conducted. Two hundred and six HIV affected children were enrolled. The median age of children in this cohort was 6 y. One hundred ninety seven of 206 children were HIV infected, nine were HIV exposed, but indeterminate. Fifty (25 %) children had incomplete immunizations per the Universal Immunization Program (UIP) of India. Hundred percent of children had received OPV. Ninety three percent of children got their UIP vaccines from a government clinic. Children with incomplete immunization were older, median age of 8 compared to 5 (p = 0.003). Each year of maternal education increased the odds of having a child with complete UIP immunizations by 1.18 (p = 0.008)-children of mothers with 6 y of education compared to those with no education were seven times more likely to have complete UIP vaccine status. The average number of visits to the clinic by an individual child in a year was 4. This represents 200 missed opportunities for immunizations. HIV infected children are at risk for incomplete immunization coverage though they regularly access medical care. Including routine immunizations, particularly catch-up immunizations in programs for HIV infected children maybe an effective way of protecting these children from vaccine preventable disease.
Borsutzky, Stefan; Fiorelli, Valeria; Ebensen, Thomas; Tripiciano, Antonella; Rharbaoui, Faiza; Scoglio, Arianna; Link, Claudia; Nappi, Filomena; Morr, Michael; Buttó, Stefano; Cafaro, Aurelio; Mühlradt, Peter F; Ensoli, Barbara; Guzmán, Carlos A
2003-06-01
A major requirement for HIV/AIDS research is the development of a mucosal vaccine that stimulates humoral and cell-mediated immune responses at systemic and mucosal levels, thereby blocking virus replication at the entry port. Thus, a vaccine prototype based on biologically active HIV-1 Tat protein as antigen and the synthetic lipopeptide, macrophage-activating lipopeptide-2 (MALP-2), asa mucosal adjuvant was developed. Intranasal administration to mice stimulated systemic and mucosal anti-Tat antibody responses, and Tat-specific T cell responses, that were more efficient than those observed after i.p. immunization with Tat plus incomplete Freund's adjuvant. Major linear B cell epitopes mapped within aa 1-20 and 46-60, whereas T cell epitopes were identified within aa 36-50 and 56-70. These epitopes have also been described in vaccinated primates and in HIV-1-infected individuals with better prognosis. Analysis of the anti-Tat IgG isotypes in serum, and the cytokine profile of spleen cells indicated that a dominant Th1 helper response was stimulated by Tat plus MALP-2, as opposed to the Th2 response observed with Tat plus incomplete Freund's adjuvant. Tat-specific IFN-gamma-producing cells were significantly increased only in response to Tat plus MALP-2. These data suggest that Malp-2 may represent an optimal mucosal adjuvant for candidate HIV vaccines based on Tat alone or in combination with other HIV antigens.
Blocking type I interferon signaling enhances T cell recovery and reduces HIV-1 reservoirs.
Cheng, Liang; Ma, Jianping; Li, Jingyun; Li, Dan; Li, Guangming; Li, Feng; Zhang, Qing; Yu, Haisheng; Yasui, Fumihiko; Ye, Chaobaihui; Tsao, Li-Chung; Hu, Zhiyuan; Su, Lishan; Zhang, Liguo
2017-01-03
Despite the efficient suppression of HIV-1 replication that can be achieved with combined antiretroviral therapy (cART), low levels of type I interferon (IFN-I) signaling persist in some individuals. This sustained signaling may impede immune recovery and foster viral persistence. Here we report studies using a monoclonal antibody to block IFN-α/β receptor (IFNAR) signaling in humanized mice (hu-mice) that were persistently infected with HIV-1. We discovered that effective cART restored the number of human immune cells in HIV-1-infected hu-mice but did not rescue their immune hyperactivation and dysfunction. IFNAR blockade fully reversed HIV-1-induced immune hyperactivation and rescued anti-HIV-1 immune responses in T cells from HIV-1-infected hu-mice. Finally, we found that IFNAR blockade in the presence of cART reduced the size of HIV-1 reservoirs in lymphoid tissues and delayed HIV-1 rebound after cART cessation in the HIV-1-infected hu-mice. We conclude that low levels of IFN-I signaling contribute to HIV-1-associated immune dysfunction and foster HIV-1 persistence in cART-treated hosts. Our results suggest that blocking IFNAR may provide a potential strategy to enhance immune recovery and reduce HIV-1 reservoirs in individuals with sustained elevations in IFN-I signaling during suppressive cART.
Shao, Lingyun; Zhang, Xinyun; Gao, Yan; Xu, Yunya; Zhang, Shu; Yu, Shenglei; Weng, Xinhua; Shen, Hongbo; Chen, Zheng W; Jiang, Weimin; Zhang, Wenhong
2016-01-01
Detailed studies of correlation between HIV-M.tb co-infection and hierarchy declines of CD8+/CD4+ T-cell counts and IFN-γ responses have not been done. We conducted case-control studies to address this issue. 164 HIV-1-infected individuals comprised of HIV-1+ATB, HIV-1+LTB and HIV-1+TB- groups were evaluated. Immune phenotyping and complete blood count (CBC) were employed to measure CD4+ and CD8+ T-cell counts; T.SPOT.TB and intracellular cytokine staining (ICS) were utilized to detect ESAT6, CFP10 or PPD-specific IFN-γ responses. There were significant differences in median CD4+ T-cell counts between HIV-1+ATB (164/μL), HIV-1+LTB (447/μL) and HIV-1+TB- (329/μL) groups. Hierarchy low CD4+ T-cell counts (<200/μL, 200-500/μL, >500/μL) were correlated significantly with active TB but not M.tb co-infection. Interestingly, hierarchy low CD8+ T-cell counts were not only associated significantly with active TB but also with M.tb co-infection (P<0.001). Immunologically, HIV-1+ATB group showed significantly lower numbers of ESAT-6-/CFP-10-specific IFN-γ+ T cells than HIV-1+LTB group. Consistently, PPD-specific IFN-γ+CD4+/CD8+ T effector cells in HIV-1+ATB group were significantly lower than those in HIV-1+LTB group (P<0.001). Hierarchy low CD8+ T-cell counts and effector function in HIV-1-infected individuals are correlated with both M.tb co-infection and active TB. Hierarchy low CD4+ T-cell counts and Th1 effector function in HIV-1+ individuals are associated with increased frequencies of active TB, but not M.tb co-infection.
De Rosa, Stephen C.; Thomas, Evan P.; Bui, John; Huang, Yunda; deCamp, Allan; Morgan, Cecilia; Kalams, Spyros; Tomaras, Georgia D.; Akondy, Rama; Ahmed, Rafi; Lau, Chuen-Yen; Graham, Barney S.; Nabel, Gary J.; McElrath, M. Juliana
2011-01-01
Many candidate HIV vaccines are designed to primarily elicit T-cell responses. Although repeated immunization with the same vaccine boosts antibody responses, the benefit for T-cell responses is ill-defined. We compared two immunization regimens that include the same recombinant adenoviral serotype 5 (rAd5) boost. Repeated homologous rAd5 immunization fails to increase T-cell responses, but increases gp140 antibody responses ten-fold. DNA prime, as compared with rAd5 prime, directs long-term memory CD8+ T cells toward a terminally differentiated effector memory phenotype with cytotoxic potential. Based on the kinetics of activated cells measured directly ex vivo, the DNA vaccination primes for both CD4+ and CD8+ T cells, despite the lack of detection of the latter until after the boost. These results suggest that heterologous prime-boost combinations have distinct immunological advantages over homologous prime-boosts, and suggest that the effect of DNA on subsequent boosting may not be easily detectable directly after the DNA vaccination. PMID:21844392
Khattar, Sunil K; Samal, Sweety; Devico, Anthony L; Collins, Peter L; Samal, Siba K
2011-10-01
Human immunodeficiency virus type 1 (HIV-1) is transmitted mainly through mucosal sites. Optimum strategies to elicit both systemic and mucosal immunity are critical for the development of vaccines against HIV-1. We therefore sought to evaluate the induction of systemic and mucosal immune responses by the use of Newcastle disease virus (NDV) as a vaccine vector. We generated a recombinant NDV, designated rLaSota/gp160, expressing the gp160 envelope (Env) protein of HIV-1 from an added gene. The gp160 protein expressed by rLaSota/gp160 virus was detected on an infected cell surface and was incorporated into the NDV virion. Biochemical studies showed that gp160 present in infected cells and in the virion formed a higher-order oligomer that retained recognition by conformationally sensitive monoclonal antibodies. Expression of gp160 did not increase the virulence of recombinant NDV (rNDV) strain LaSota. Guinea pigs were administered rLaSota/gp160 via the intranasal (i.n.) or intramuscular (i.m.) route in different prime-boost combinations. Systemic and mucosal antibody responses specific to the HIV-1 envelope protein were assessed in serum and vaginal washes, respectively. Two or three immunizations via the i.n. or i.m. route induced a more potent systemic and mucosal immune response than a single immunization by either route. Priming by the i.n. route was more immunogenic than by the i.m. route, and the same was true for the boosts. Furthermore, immunization with rLaSota/gp160 by any route or combination of routes induced a Th1-type response, as reflected by the induction of stronger antigen-specific IgG2a than IgG1 antibody responses. Additionally, i.n. immunization elicited a stronger neutralizing serum antibody response to laboratory-adapted HIV-1 strain MN.3. These data illustrate that it is feasible to use NDV as a vaccine vector to elicit potent humoral and mucosal responses to the HIV-1 envelope protein.
Foldi, Julia; Kozhaya, Lina; McCarty, Bret; Mwamzuka, Mussa; Marshed, Fatma; Ilmet, Tiina; Kilberg, Max; Kravietz, Adam; Ahmed, Aabid; Borkowsky, William; Unutmaz, Derya; Khaitan, Alka
2017-09-15
During human immunodeficiency virus (HIV) disease, chronic immune activation leads to T-cell exhaustion. PD-1 identifies "exhausted" CD8 T cells with impaired HIV-specific effector functions, but its role on CD4 T cells and in HIV-infected children is poorly understood. In a Kenyan cohort of vertically HIV-infected children, we measured PD-1+ CD4 T-cell frequencies and phenotype by flow cytometry and their correlation with HIV disease progression and immune activation. Second, in vitro CD4 T-cell proliferative and cytokine responses to HIV-specific and -nonspecific stimuli were assessed with and without PD-1 blockade. HIV-infected children have increased frequencies of PD-1+ memory CD4 T cells that fail to normalize with antiretroviral treatment. These cells are comprised of central and effector memory subsets and correlate with HIV disease progression, measured by viral load, CD4 percentage, CD4:CD8 T-cell ratio, and immune activation. Last, PD-1+ CD4 T cells predict impaired proliferative potential yet preferentially secrete the Th1 and Th17 cytokines interferon-γ and interleukin 17A, and are unresponsive to in vitro PD-1 blockade. This study highlights differences in PD-1+ CD4 T-cell memory phenotype and response to blockade between HIV-infected children and adults, with implications for potential immune checkpoint therapies. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Cunningham-Rundles, Susanna; Ahrné, Siv; Johann-Liang, Rosemary; Abuav, Rachel; Dunn-Navarra, Ann-Margaret; Grassey, Claudia; Bengmark, Stig; Cervia, Joseph S.
2011-01-01
. Pilot studies have shown that probiotic bacteria given as a supplement have improved growth and protected against loss of CD4+ T cells. The recognition that normal bacterial flora prime neonatal immune response and that abnormal flora have a profound impact on metabolism has generated insight into potential mechanisms of gut dysfunction in many settings including HIV-1 infection. As discussed here, current and emerging studies support the concept that probiotic bacteria can provide specific benefit in HIV-1 infection. Probiotic bacteria have proven active against bacterial vaginosis in HIV-1 positive women and have enhanced growth in infants with congenital HIV-1 infection. Probiotic bacteria may stabilize CD4+ T cell numbers in HIV-1 infected children and are likely to have protective effects against inflammation and chronic immune activation of the gastrointestinal immune system. PMID:22292110
Xia, Shuang; Li, Xueqin; Shi, Yanbin; Liu, Jinxin; Zhang, Mengjie; Gu, Tenghui; Pan, Shinong; Song, Liucun; Xu, Jinsheng; Sun, Yan; Zhao, Qingxia; Lu, Zhiyan; Lu, Puxuan; Li, Hongjun
2016-02-01
The objective of this paper is to correlate the MRI distribution of cryptococcal meningoencephalitis in HIV-1 infection patients with CD4 T cell count and immune reconstitution effect.A large retrospective cohort study of HIV patients from multi-HIV centers in China was studied to demonstrate the MRI distribution of cryptococcal meningoencephalitis and its correlation with the different immune status.The consecutive clinical and neuroimaging data of 55 HIV-1-infected patients with cryptococcal meningoencephalitis collected at multi-HIV centers in China during the years of 2011 to 2014 was retrospectively analyzed. The enrolled patients were divided into 2 groups based on the distribution of lesions. One group of patients had their lesions at the central brain (group 1, n = 34) and the other group of patients had their lesions at the superficial brain (group 2, n = 21). We explored their MRI characterization of brain. In addition, we also compared their CD4 T cell counts and immune reconstitution effects between the 2 groups based on the imaging findings.No statistical difference was found in terms of age and gender between the 2 groups. The medians of CD4 T cell counts were 11.67 cells/mm (3.00-52.00 cells/mm) in group 1 and 42.00 cells/mm (10.00-252.00 cells/mm) in group 2. Statistical difference of CD4 T cell count was found between the 2 groups (P = 0.023). Thirteen patients in group 1 (13/34) and 12 patients in group 2 (12/21) received highly active antiretroviral treatment (HAART). Patients of group 2 received HAART therapy more frequently than patients of group 1 (P = 0.021).Central and superficial brain lesions detected by MR imaging in HIV-1-infected patients with cryptococcal meningoencephalitis are in correlation with the host immunity and HAART therapy.
Sieve analysis in HIV-1 vaccine efficacy trials
Edlefsen, Paul T.; Gilbert, Peter B.; Rolland, Morgane
2013-01-01
Purpose of review The genetic characterization of HIV-1 breakthrough infections in vaccine and placebo recipients offers new ways to assess vaccine efficacy trials. Statistical and sequence analysis methods provide opportunities to mine the mechanisms behind the effect of an HIV vaccine. Recent findings The release of results from two HIV-1 vaccine efficacy trials, Step/HVTN-502 and RV144, led to numerous studies in the last five years, including efforts to sequence HIV-1 breakthrough infections and compare viral characteristics between the vaccine and placebo groups. Novel genetic and statistical analysis methods uncovered features that distinguished founder viruses isolated from vaccinees from those isolated from placebo recipients, and identified HIV-1 genetic targets of vaccine-induced immune responses. Summary Studies of HIV-1 breakthrough infections in vaccine efficacy trials can provide an independent confirmation to correlates of risk studies, as they take advantage of vaccine/placebo comparisons while correlates of risk analyses are limited to vaccine recipients. Through the identification of viral determinants impacted by vaccine-mediated host immune responses, sieve analyses can shed light on potential mechanisms of vaccine protection. PMID:23719202
Generation and Characterization of a Defective HIV-1 Virus as an Immunogen for a Therapeutic Vaccine
García-Pérez, Javier; García, Felipe; Blanco, Julia; Escribà-García, Laura; Gatell, Jose Maria; Alcamí, Jose; Plana, Montserrat; Sánchez-Palomino, Sonsoles
2012-01-01
Background The generation of new immunogens able to elicit strong specific immune responses remains a major challenge in the attempts to obtain a prophylactic or therapeutic vaccine against HIV/AIDS. We designed and constructed a defective recombinant virus based on the HIV-1 genome generating infective but non-replicative virions able to elicit broad and strong cellular immune responses in HIV-1 seropositive individuals. Results Viral particles were generated through transient transfection in producer cells (293-T) of a full length HIV-1 DNA carrying a deletion of 892 base pairs (bp) in the pol gene encompassing the sequence that codes for the reverse transcriptase (NL4-3/ΔRT clone). The viral particles generated were able to enter target cells, but due to the absence of reverse transcriptase no replication was detected. The immunogenic capacity of these particles was assessed by ELISPOT to determine γ-interferon production in a cohort of 69 chronic asymptomatic HIV-1 seropositive individuals. Surprisingly, defective particles produced from NL4-3/ΔRT triggered stronger cellular responses than wild-type HIV-1 viruses inactivated with Aldrithiol-2 (AT-2) and in a larger proportion of individuals (55% versus 23% seropositive individuals tested). Electron microscopy showed that NL4-3/ΔRT virions display immature morphology. Interestingly, wild-type viruses treated with Amprenavir (APV) to induce defective core maturation also induced stronger responses than the same viral particles generated in the absence of protease inhibitors. Conclusions We propose that immature HIV-1 virions generated from NL4-3/ΔRT viral clones may represent new prototypes of immunogens with a safer profile and stronger capacity to induce cellular immune responses than wild-type inactivated viral particles. PMID:23144996
French, Martyn A.; Abudulai, Laila N.; Fernandez, Sonia
2013-01-01
The development of vaccines to treat and prevent human immunodeficiency virus (HIV) infection has been hampered by an incomplete understanding of “protective” immune responses against HIV. Natural control of HIV-1 infection is associated with T-cell responses against HIV-1 Gag proteins, particularly CD8+ T-cell responses restricted by “protective” HLA-B alleles, but other immune responses also contribute to immune control. These immune responses appear to include IgG antibodies to HIV-1 Gag proteins, interferon-α-dependant natural killer (NK) cell responses and plasmacytoid dendritic cell (pDC) responses. Here, it is proposed that isotype diversification of IgG antibodies against HIV-1 Gag proteins, to include IgG2, as well as IgG3 and IgG1 antibodies, will broaden the function of the antibody response and facilitate accessory cell responses against HIV-1 by NK cells and pDCs. We suggest that this should be investigated as a vaccination strategy for HIV-1 infection. PMID:26344116
French, Martyn A; Abudulai, Laila N; Fernandez, Sonia
2013-08-09
The development of vaccines to treat and prevent human immunodeficiency virus (HIV) infection has been hampered by an incomplete understanding of "protective" immune responses against HIV. Natural control of HIV-1 infection is associated with T-cell responses against HIV-1 Gag proteins, particularly CD8⁺ T-cell responses restricted by "protective" HLA-B alleles, but other immune responses also contribute to immune control. These immune responses appear to include IgG antibodies to HIV-1 Gag proteins, interferon-a-dependant natural killer (NK) cell responses and plasmacytoid dendritic cell (pDC) responses. Here, it is proposed that isotype diversification of IgG antibodies against HIV-1 Gag proteins, to include IgG2, as well as IgG3 and IgG1 antibodies, will broaden the function of the antibody response and facilitate accessory cell responses against HIV-1 by NK cells and pDCs. We suggest that this should be investigated as a vaccination strategy for HIV-1 infection.
Martinez, David R; Vandergrift, Nathan; Douglas, Ayooluwa O; McGuire, Erin; Bainbridge, John; Nicely, Nathan I; Montefiori, David C; Tomaras, Georgia D; Fouda, Genevieve G; Permar, Sallie R
2017-05-01
The development of an effective maternal HIV-1 vaccine that could synergize with antiretroviral therapy (ART) to eliminate pediatric HIV-1 infection will require the characterization of maternal immune responses capable of blocking transmission of autologous HIV to the infant. We previously determined that maternal plasma antibody binding to linear epitopes within the variable loop 3 (V3) region of HIV envelope (Env) and neutralizing responses against easy-to-neutralize tier 1 viruses were associated with reduced risk of peripartum HIV infection in the historic U.S. Woman and Infant Transmission Study (WITS) cohort. Here, we defined the fine specificity and function of the potentially protective maternal V3-specific IgG antibodies associated with reduced peripartum HIV transmission risk in this cohort. The V3-specific IgG binding that predicted low risk of mother-to-child-transmission (MTCT) was dependent on the C-terminal flank of the V3 crown and particularly on amino acid position 317, a residue that has also been associated with breakthrough transmission in the RV144 vaccine trial. Remarkably, the fine specificity of potentially protective maternal plasma V3-specific tier 1 virus-neutralizing responses was dependent on the same region in the V3 loop. Our findings suggest that MTCT risk is associated with neutralizing maternal IgG that targets amino acid residues in the C-terminal region of the V3 loop crown, suggesting the importance of the region in immunogen design for maternal vaccines to prevent MTCT. IMPORTANCE Efforts to curb HIV-1 transmission in pediatric populations by antiretroviral therapy (ART) have been highly successful in both developed and developing countries. However, more than 150,000 infants continue to be infected each year, likely due to a combination of late maternal HIV diagnosis, lack of ART access or adherence, and drug-resistant viral strains. Defining the fine specificity of maternal humoral responses that partially protect against
Ruiz-Riol, M; Berdnik, D; Llano, A; Mothe, B; Gálvez, C; Pérez-Álvarez, S; Oriol-Tordera, B; Olvera, A; Silva-Arrieta, S; Meulbroek, M; Pujol, F; Coll, J; Martinez-Picado, J; Ganoza, C; Sanchez, J; Gómez, G; Wyss-Coray, T; Brander, C
2017-08-15
Intact and broad immune cell effector functions and specific individual cytokines have been linked to HIV disease outcome, but their relative contribution to HIV control remains unclear. We asked whether the proteome of secreted cytokines and signaling factors in peripheral blood can be used to discover specific pathways critical for host viral control. A custom glass-based microarray, able to measure >600 plasma proteins involved in cell-to-cell communication, was used to measure plasma protein profiles in 96 HIV-infected, treatment-naive individuals with high (>50,000) or low (<10,000 HIV RNA copies/ml) viral loads. Univariate and regression model analysis demonstrate that plasma levels of soluble interleukin-27 (IL-27) are significantly elevated in individuals with high plasma viremia ( P < 0.0001) and are positively correlated with proviral HIV-DNA copy numbers in peripheral blood mononuclear cells (PBMC) (Rho = 0.4011; P = 0.0027). Moreover, soluble IL-27 plasma levels are negatively associated with the breadth and magnitude of the total virus-specific T-cell responses and directly with plasma levels of molecules involved in Wnt/β-catenin signaling. In addition to IL-27, gene expression levels of the specific IL-27 receptor ( IL27RA ) in PBMC correlated directly with both plasma viral load (Rho = 0.3531; P = 0.0218) and the proviral copy number in the peripheral blood as an indirect measure of partial viral reservoir (Rho = 0.4580; P = 0.0030). These results were validated in unrelated cohorts of early infected subjects as well as subjects before and after initiation of antiretroviral treatment, and they identify IL-27 and its specific receptor as a critical immune axis for the antiviral immune response and as robust correlates of viral load and proviral reservoir size in PBMC. IMPORTANCE The detailed knowledge of immune mechanisms that contribute to HIV control is a prerequisite for the design of effective treatment strategies to achieve HIV cure. Cells
NASA Astrophysics Data System (ADS)
Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.
1999-04-01
Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.
Eda, Yasuyuki; Takizawa, Mari; Murakami, Toshio; Maeda, Hiroaki; Kimachi, Kazuhiko; Yonemura, Hiroshi; Koyanagi, Satoshi; Shiosaki, Kouichi; Higuchi, Hirofumi; Makizumi, Keiichi; Nakashima, Toshihiro; Osatomi, Kiyoshi; Tokiyoshi, Sachio; Matsushita, Shuzo; Yamamoto, Naoki; Honda, Mitsuo
2006-06-01
An antibody response capable of neutralizing not only homologous but also heterologous forms of the CXCR4-tropic human immunodeficiency virus type 1 (HIV-1) MNp and CCR5-tropic primary isolate HIV-1 JR-CSF was achieved through sequential immunization with a combination of synthetic peptides representing HIV-1 Env V3 sequences from field and laboratory HIV-1 clade B isolates. In contrast, repeated immunization with a single V3 peptide generated antibodies that neutralized only type-specific laboratory-adapted homologous viruses. To determine whether the cross-neutralization response could be attributed to a cross-reactive antibody in the immunized animals, we isolated a monoclonal antibody, C25, which neutralized the heterologous primary viruses of HIV-1 clade B. Furthermore, we generated a humanized monoclonal antibody, KD-247, by transferring the genes of the complementary determining region of C25 into genes of the human V region of the antibody. KD-247 bound with high affinity to the "PGR" motif within the HIV-1 Env V3 tip region, and, among the established reference antibodies, it most effectively neutralized primary HIV-1 field isolates possessing the matching neutralization sequence motif, suggesting its promise for clinical applications involving passive immunizations. These results demonstrate that sequential immunization with B-cell epitope peptides may contribute to a humoral immune-based HIV vaccine strategy. Indeed, they help lay the groundwork for the development of HIV-1 vaccine strategies that use sequential immunization with biologically relevant peptides to overcome difficulties associated with otherwise poorly immunogenic epitopes.
Eda, Yasuyuki; Takizawa, Mari; Murakami, Toshio; Maeda, Hiroaki; Kimachi, Kazuhiko; Yonemura, Hiroshi; Koyanagi, Satoshi; Shiosaki, Kouichi; Higuchi, Hirofumi; Makizumi, Keiichi; Nakashima, Toshihiro; Osatomi, Kiyoshi; Tokiyoshi, Sachio; Matsushita, Shuzo; Yamamoto, Naoki; Honda, Mitsuo
2006-01-01
An antibody response capable of neutralizing not only homologous but also heterologous forms of the CXCR4-tropic human immunodeficiency virus type 1 (HIV-1) MNp and CCR5-tropic primary isolate HIV-1 JR-CSF was achieved through sequential immunization with a combination of synthetic peptides representing HIV-1 Env V3 sequences from field and laboratory HIV-1 clade B isolates. In contrast, repeated immunization with a single V3 peptide generated antibodies that neutralized only type-specific laboratory-adapted homologous viruses. To determine whether the cross-neutralization response could be attributed to a cross-reactive antibody in the immunized animals, we isolated a monoclonal antibody, C25, which neutralized the heterologous primary viruses of HIV-1 clade B. Furthermore, we generated a humanized monoclonal antibody, KD-247, by transferring the genes of the complementary determining region of C25 into genes of the human V region of the antibody. KD-247 bound with high affinity to the “PGR” motif within the HIV-1 Env V3 tip region, and, among the established reference antibodies, it most effectively neutralized primary HIV-1 field isolates possessing the matching neutralization sequence motif, suggesting its promise for clinical applications involving passive immunizations. These results demonstrate that sequential immunization with B-cell epitope peptides may contribute to a humoral immune-based HIV vaccine strategy. Indeed, they help lay the groundwork for the development of HIV-1 vaccine strategies that use sequential immunization with biologically relevant peptides to overcome difficulties associated with otherwise poorly immunogenic epitopes. PMID:16699036
DOE Office of Scientific and Technical Information (OSTI.GOV)
Venkatachari, Narasimhan J.; Majumder, Biswanath; Ayyavoo, Velpandi
2007-02-20
Human immunodeficiency virus type 1 (HIV-1) viral proteins disrupt the normal host cellular immune pathways thus exploiting the cellular machinery for replication, survival and to escape host immune attack. Here we evaluated the direct effects of HIV-1 Vpr-mediated immune modulation of infected T cells. Vpr specifically downregulated the expression of CD28 and increased the expression of CTLA-4, whereas no significant difference in the expression of CD25 and HLA-DR was observed. Interferon gamma (IFN-{gamma}) production in T cells was evaluated as a measure of the downstream effector functions. Results indicate that Vpr significantly inhibited IFN-{gamma} production and this may, in part,more » due to Vpr's ability to inhibit the nuclear translocation of NF-{kappa}B, and its transcriptional regulation. Together these results support that HIV-1 Vpr selectively dysregulates the immune functions at multiple levels and exerts its inhibitory effects in the presence of other viral proteins.« less
Nguyen, Philip V; Kafka, Jessica K; Ferreira, Victor H; Roth, Kristy; Kaushic, Charu
2014-01-01
The male and female reproductive tracts are complex microenvironments that have diverse functional demands. The immune system in the reproductive tract has the demanding task of providing a protective environment for a fetal allograft while simultaneously conferring protection against potential pathogens. As such, it has evolved a unique set of adaptations, primarily under the influence of sex hormones, which make it distinct from other mucosal sites. Here, we discuss the various components of the immune system that are present in both the male and female reproductive tracts, including innate soluble factors and cells and humoral and cell-mediated adaptive immunity under homeostatic conditions. We review the evidence showing unique phenotypic and functional characteristics of immune cells and responses in the male and female reproductive tracts that exhibit compartmentalization from systemic immunity and discuss how these features are influenced by sex hormones. We also examine the interactions among the reproductive tract, sex hormones and immune responses following HIV-1 infection. An improved understanding of the unique characteristics of the male and female reproductive tracts will provide insights into improving clinical treatments of the immunological causes of infertility and the design of prophylactic interventions for the prevention of sexually transmitted infections. PMID:24976268
Ensoli, Barbara; Bellino, Stefania; Tripiciano, Antonella; Longo, Olimpia; Francavilla, Vittorio; Marcotullio, Simone; Cafaro, Aurelio; Picconi, Orietta; Paniccia, Giovanni; Scoglio, Arianna; Arancio, Angela; Ariola, Cristina; Ruiz Alvarez, Maria J.; Campagna, Massimo; Scaramuzzi, Donato; Iori, Cristina; Esposito, Roberto; Mussini, Cristina; Ghinelli, Florio; Sighinolfi, Laura; Palamara, Guido; Latini, Alessandra; Angarano, Gioacchino; Ladisa, Nicoletta; Soscia, Fabrizio; Mercurio, Vito S.; Lazzarin, Adriano; Tambussi, Giuseppe; Visintini, Raffaele; Mazzotta, Francesco; Di Pietro, Massimo; Galli, Massimo; Rusconi, Stefano; Carosi, Giampiero; Torti, Carlo; Di Perri, Giovanni; Bonora, Stefano; Ensoli, Fabrizio; Garaci, Enrico
2010-01-01
Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4+ T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks) on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002). Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002), served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4+ and CD8+ cellular activation (CD38 and HLA-DR) together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4+ T cells and B cells with reduction of CD8+ T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4+ and CD8+ T cells were accompanied by increases of CD4+ and CD8+ T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite, absent or partial in the
Ensoli, Barbara; Bellino, Stefania; Tripiciano, Antonella; Longo, Olimpia; Francavilla, Vittorio; Marcotullio, Simone; Cafaro, Aurelio; Picconi, Orietta; Paniccia, Giovanni; Scoglio, Arianna; Arancio, Angela; Ariola, Cristina; Ruiz Alvarez, Maria J; Campagna, Massimo; Scaramuzzi, Donato; Iori, Cristina; Esposito, Roberto; Mussini, Cristina; Ghinelli, Florio; Sighinolfi, Laura; Palamara, Guido; Latini, Alessandra; Angarano, Gioacchino; Ladisa, Nicoletta; Soscia, Fabrizio; Mercurio, Vito S; Lazzarin, Adriano; Tambussi, Giuseppe; Visintini, Raffaele; Mazzotta, Francesco; Di Pietro, Massimo; Galli, Massimo; Rusconi, Stefano; Carosi, Giampiero; Torti, Carlo; Di Perri, Giovanni; Bonora, Stefano; Ensoli, Fabrizio; Garaci, Enrico
2010-11-11
Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4(+) T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks) on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002). Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002), served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4(+) and CD8(+) cellular activation (CD38 and HLA-DR) together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4(+) T cells and B cells with reduction of CD8(+) T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4(+) and CD8(+) T cells were accompanied by increases of CD4(+) and CD8(+) T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite, absent
2009-01-01
Background The optimal stage for initiating antiretroviral therapies in HIV-1 bearing patients is still a matter of debate. Methods We present computer simulations of HIV-1 infection aimed at identifying the pro et contra of immediate as compared to deferred Highly Active Antiretroviral Therapy (HAART). Results Our simulations highlight that a prompt specific CD8+ cytotoxic T lymphocytes response is detected when therapy is delayed. Compared to very early initiation of HAART, in deferred treated patients CD8+ T cells manage to mediate the decline of viremia in a shorter time and, at interruption of therapy, the virus experiences a stronger immune pressure. We also observe, however, that the immunological effects of the therapy fade with time in both therapeutic regimens. Thus, within one year from discontinuation, viral burden recovers to the value at which it would level off in the absence of therapy. In summary, simulations show that immediate therapy does not prolong the disease-free period and does not confer a survival benefit when compared to treatment started during the chronic infection phase. Conclusion Our conclusion is that, since there is no therapy to date that guarantees life-long protection, deferral of therapy should be preferred in order to minimize the risk of adverse effects, the occurrence of drug resistances and the costs of treatment. PMID:19840392
Lakhashe, Samir K.; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B.; DiPasquale, Janet M.; Hemashettar, Girish; Yoon, John K.; Rasmussen, Robert A.; Yang, Feng; Lee, Sandra J.; Montefiori, David C.; Novembre, Francis J.; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R.; Robert-Guroff, Marjorie; Johnson, Welkin E.; Lieberman, Judy; Ruprecht, Ruth M.
2011-01-01
We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus >90%; these RM also had strong SIV Gag-specific proliferation of CD8+ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4+ T cells; the latter have been implicated as preferential virus targets in-vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. PMID:21693155
Lakhashe, Samir K; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B; Dipasquale, Janet M; Hemashettar, Girish; Yoon, John K; Rasmussen, Robert A; Yang, Feng; Lee, Sandra J; Montefiori, David C; Novembre, Francis J; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R; Robert-Guroff, Marjorie; Johnson, Welkin E; Lieberman, Judy; Ruprecht, Ruth M
2011-08-05
We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus > 90%; these RM also had strong SIV Gag-specific proliferation of CD8⁺ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4⁺ T cells; the latter have been implicated as preferential virus targets in vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. Copyright © 2011 Elsevier Ltd. All rights reserved.
Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua
2016-10-01
This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wu, Beiqing; Huang, Yunlong; Braun, Alexander L; Tong, Zenghan; Zhao, Runze; Li, Yuju; Liu, Fang; Zheng, Jialin C
2015-11-06
HIV-1-infected and/or immune-activated microglia and macrophages are pivotal in the pathogenesis of HIV-1-associated neurocognitive disorders (HAND). Glutaminase, a metabolic enzyme that facilitates glutamate generation, is upregulated and may play a pathogenic role in HAND. Our previous studies have demonstrated that glutaminase is released to the extracellular fluid during HIV-1 infection and neuroinflammation. However, key molecular mechanisms that regulate glutaminase release remain unknown. Recent advances in understanding intercellular trafficking have identified microvesicles (MVs) as a novel means of shedding cellular contents. We posit that during HIV-1 infection and immune activation, microvesicles may mediate glutaminase release, generating excessive and neurotoxic levels of glutamate. MVs isolated through differential centrifugation from cell-free supernatants of monocyte-derived macrophages (MDM) and BV2 microglia cell lines were first confirmed in electron microscopy and immunoblotting. As expected, we found elevated number of MVs, glutaminase immunoreactivities, as well as glutaminase enzyme activity in the supernatants of HIV-1 infected MDM and lipopolysaccharide (LPS)-activated microglia when compared with controls. The elevated glutaminase was blocked by GW4869, a neutral sphingomyelinase inhibitor known to inhibit MVs release, suggesting a critical role of MVs in mediating glutaminase release. More importantly, MVs from HIV-1-infected MDM and LPS-activated microglia induced significant neuronal injury in rat cortical neuron cultures. The MV neurotoxicity was blocked by a glutaminase inhibitor or GW4869, suggesting that the neurotoxic potential of HIV-1-infected MDM and LPS-activated microglia is dependent on the glutaminase-containing MVs. These findings support MVs as a potential pathway/mechanism of excessive glutamate generation and neurotoxicity in HAND and therefore MVs may serve as a novel therapeutic target.
Belderok, Sanne-Meike; Sonder, Gerard J B; van Rossum, Marion; van Dijk-Hummelman, Annette; Hartwig, Nico; Scherpbier, Henriette; Geelen, Sibyl; Speksnijder, Arjen G C L; Baaten, Gijs; van den Hoek, Anneke
2013-08-28
A phase IV interventional study with a combined hepatitis A and B vaccine was conducted in HIV-infected children and children receiving immunosuppressive medication for treatment of rheumatic diseases to evaluate immune responses. Both groups (1-16 years of age) received combined (inactivated) HAV and (rDNA) HBV vaccine Ambirix(®) at months 0 and 6. Serum samples were taken at four time points and tested for anti-HAV and anti-HBs antibodies. Anti-HAV concentrations ≥20 mIU/mL or anti-HBs concentrations ≥10 mIU/mL were considered protective. Seropositivity percentages were calculated and geometric mean concentrations (GMCs) were compared by nonparametric Mann-Whitney U-test or Kruskal-Wallis one-way-analysis-of-variance. Of 80 HIV-infected children who completed the study, 67 were HAV-susceptible and 68 HBV-susceptible at enrolment. Of 80 children with rheumatic diseases who completed the study, 65 were HAV-susceptible and 74 HBV-susceptible at enrolment. Immune responses to HAV after first dose of vaccine in both study groups were low: 71% and 55% respectively, whereas immune responses after the second dose were 99% and 100% respectively. Immune response to HBV after first dose of vaccine in both groups was also low: 27% and 17% respectively. Immune responses after the second dose were 97% and 93%, respectively. A larger proportion of children on combination antiretroviral therapy (cART) and of children with viral load <50 copies/mL responded to HBV, and also showed a significantly higher GMC. Although immune response after full series of combined HAV and HBV vaccine in both groups was excellent and comparable to healthy children, a substantial proportion of both groups was not protected for HAV after first dose of vaccine. This protection gap is especially important for HAV in travel health and postexposure prophylactic treatment: both groups of children should be serologically tested for anti-HAV prior to travel to ensure protection if there is no time to
Almeida, Rafael Ribeiro; Rosa, Daniela Santoro; Ribeiro, Susan Pereira; Santana, Vinicius Canato; Kallás, Esper Georges; Sidney, John; Sette, Alessandro; Kalil, Jorge; Cunha-Neto, Edecio
2012-01-01
T-cell based vaccine approaches have emerged to counteract HIV-1/AIDS. Broad, polyfunctional and cytotoxic CD4+ T-cell responses have been associated with control of HIV-1 replication, which supports the inclusion of CD4+ T-cell epitopes in vaccines. A successful HIV-1 vaccine should also be designed to overcome viral genetic diversity and be able to confer immunity in a high proportion of immunized individuals from a diverse HLA-bearing population. In this study, we rationally designed a multiepitopic DNA vaccine in order to elicit broad and cross-clade CD4+ T-cell responses against highly conserved and promiscuous peptides from the HIV-1 M-group consensus sequence. We identified 27 conserved, multiple HLA-DR-binding peptides in the HIV-1 M-group consensus sequences of Gag, Pol, Nef, Vif, Vpr, Rev and Vpu using the TEPITOPE algorithm. The peptides bound in vitro to an average of 12 out of the 17 tested HLA-DR molecules and also to several molecules such as HLA-DP, -DQ and murine IAb and IAd. Sixteen out of the 27 peptides were recognized by PBMC from patients infected with different HIV-1 variants and 72% of such patients recognized at least 1 peptide. Immunization with a DNA vaccine (HIVBr27) encoding the identified peptides elicited IFN-γ secretion against 11 out of the 27 peptides in BALB/c mice; CD4+ and CD8+ T-cell proliferation was observed against 8 and 6 peptides, respectively. HIVBr27 immunization elicited cross-clade T-cell responses against several HIV-1 peptide variants. Polyfunctional CD4+ and CD8+ T cells, able to simultaneously proliferate and produce IFN-γ and TNF-α, were also observed. This vaccine concept may cope with HIV-1 genetic diversity as well as provide increased population coverage, which are desirable features for an efficacious strategy against HIV-1/AIDS. PMID:23028895
Chun, Rene F; Liu, Nancy Q; Lee, T; Schall, Joan I; Denburg, Michelle R; Rutstein, Richard M; Adams, John S; Zemel, Babette S; Stallings, Virginia A; Hewison, Martin
2015-04-01
Human monocytes activated by toll-like receptor 2/1 ligand (TLR2/1L) show enhanced expression of the vitamin D receptor (VDR) and the vitamin D-activating enzyme 1α-hydroxylase (CYP27B1). The resulting intracrine conversion of precursor 25-hydroxyvitamin D3 (25OHD) to active 1,25-dihydroxyvitamin D (1,25(OH)2D) can stimulate expression of antibacterial cathelicidin (CAMP). To determine whether this response is functional in HIV-infected subjects (HIV+ ), serum from HIV+ subjects pre- and post-vitamin D supplementation was utilized in monocyte cultures with or without TLR2/1L. Expression of CYP27B1 and VDR was enhanced following treatment with TLR2/1L, although this effect was lower in HIV+ vs HIV- serum (p<0.05). CAMP was also lower in TLR2/1L-treated monocytes cultured in HIV+ serum (p<0.01). In a dose study, supplementation of HIV+ subjects with 4000IU or 7000IU vitamin D/day increased serum 25OHD from 17.3±8.0 and 20.6±6.2ng/ml (43nM and 51nM) at baseline to 41.1±12.0 and 51.9±23.1ng/ml (103nM and 130nM) after 12 weeks (both p<0.001). Greater percent change from baseline 25OHD was significantly associated with enhanced TLR2/1L-induced monocyte CAMP adjusted for baseline expression (p=0.009). In a randomized placebo-controlled trial, 7000IU vitamin D/day increased serum 25OHD from 18.0±8.6 to 32.7±13.8ng/ml (45nM and 82nM) after 12 weeks. Expression of CAMP increased significantly from baseline after 52 weeks of vitamin D-supplementation. At this time point, TLR2/1L-induced CAMP was positively associated with percent change from baseline in 25OHD (p=0.029 overall and 0.002 within vitamin D-supplemented only). These data indicate that vitamin D supplementation in HIV-infected subjects can promote improved antibacterial immunity, but also suggest that longer periods of supplementation are required to achieve this. Copyright © 2014 Elsevier Ltd. All rights reserved.
Chun, Rene F.; Liu, Nancy Q.; Lee, T; Schall, Joan I.; Denburg, Michelle R.; Rutstein, Richard M.; Adams, John S.; Zemel, Babette S.; Stallings, Virginia A.; Hewison, Martin
2014-01-01
Human monocytes activated by toll-like receptor 2/1 ligand (TLR2/1L) show enhanced expression of the vitamin D receptor (VDR) and the vitamin D-activating enzyme 1α-hydroxylase (CYP27B1). The resulting intracrine conversion of precursor 25-hydroxyvitamin D3 (25OHD) to active 1,25-dihydroxyvitamin D (1,25(OH)2D) can stimulate expression of antibacterial cathelicidin (CAMP). To determine whether this response is functional in HIV-infected subjects (HIV+), serum from HIV+ subjects pre- and post-vitamin D supplementation was utilized in monocyte cultures with or without TLR2/1L. Expression of CYP27B1 and VDR was enhanced following treatment with TLR2/1L, although this effect was lower in HIV+ vs HIV- serum (p<0.05). CAMP was also lower in TLR2/1L-treated monocytes cultured in HIV+ serum (p<0.01). In a dose study, supplementation of HIV+ subjects with 4,000IU or 7,000IU vitamin D/day increased serum 25OHD from 17.3±8.0 and 20.6±6.2 ng/ml (43 nM and 51 nM) at baseline to 41.1±12.0 and 51.9±23.1 ng/ml (103 nM and 130 nM) after 12 wks (both p<0.001). Greater percent change from baseline 25OHD was significantly associated with enhanced TLR2/1L-induced monocyte CAMP adjusted for baseline expression (p = 0.009). In a randomized placebo-controlled trial, 7,000IU vitamin D/day increased serum 25OHD from 18.0±8.6 to 32.7±13.8 ng/ml (45 nM and 82 nM) after 12 wks. Expression of CAMP increased significantly from baseline after 52 wks of vitamin D-supplementation. At this time point, TLR2/1L-induced CAMP was positively associated with percent change from baseline in 25OHD (p = 0.029 overall and 0.002 within vitamin D-supplemented only). These data indicate that vitamin D supplementation in HIV-infected subjects can promote improved antibacterial immunity, but also suggest that longer periods of supplementation are required to achieve this. PMID:25092518
Oral innate immunity in HIV infection in HAART era
Nittayananta, Wipawee; Tao, Renchuan; Jiang, Lanlan; Peng, Yuanyuan; Huang, Yuxiao
2015-01-01
Oral innate immunity, an important component in host defense and immune surveillance in the oral cavity, plays a crucial role in the regulation of oral health. As part of the innate immune system, epithelial cells lining oral mucosal surfaces provide not only a physical barrier but also produce different antimicrobial peptides, including human β-defensins (hBDs), secretory leukocyte protease inhibitor (SLPI), and various cytokines. These innate immune mediators help in maintaining oral homeostasis. When they are impaired either by local or systemic causes, various oral infections and malignancies may be developed. Human immunodeficiency virus (HIV) infection and other co-infections appear to have both direct and indirect effects on systemic and local innate immunity leading to the development of oral opportunistic infections and malignancies. Highly active antiretroviral therapy (HAART), the standard treatment of HIV infection contributed to a global reduction of HIV-associated oral lesions. However, prolonged treatment by HAART may lead to adverse effects on the oral innate immunity resulting in the relapse of oral lesions. This review article focused on the roles of oral innate immunity in HIV infection in HAART era. The following five key questions were addressed: 1) What are the roles of oral innate immunity in health and disease?, 2) What are the effects of HIV infection on oral innate immunity?, 3) What are the roles of oral innate immunity against other co-infections?, 4) What are the effects of HAART on oral innate immunity?, and 5) Is oral innate immunity enhanced by HAART? PMID:25639844
Antiretroviral Treatment Effect on Immune Activation Reduces Cerebrospinal Fluid HIV-1 Infection
Sinclair, Elizabeth; Ronquillo, Rollie; Lollo, Nicole; Deeks, Steven G.; Hunt, Peter; Yiannoutsos, Constantin T.; Spudich, Serena; Price, Richard W.
2012-01-01
Objective To define the effect of antiretroviral therapy (ART) on activation of T cells in cerebrospinal fluid (CSF) and blood, and interactions of this activation with CSF HIV-1 RNA concentrations. Design Cross-sectional analysis of 14 HIV-negative subjects and 123 neuroasymptomatic HIV-1–infected subjects divided into 3 groups: not on ART (termed “offs”), on ART with plasma HIV-1 RNA >500 copies/mL (“failures”), and on ART with plasma HIV-1 RNA ≤500 copies/mL (“successes”). T-cell activation was measured by coexpression of CD38 and human leukocyte antigen DR (HLA-DR). Other measurements included CSF neopterin and white blood cell (WBC) counts. Results CD8 T-cell activation in CSF and blood was highly correlated across all subjects and was highest in the offs, lower in the failures, and lower still in the successes. While CD8 activation was reduced in failures compared to offs across the range of plasma HIV-1, it maintained a coincident relation to CSF HIV-1 in both viremic groups. In addition to correlation with CSF HIV-1 concentrations, CD8 activation in blood and CSF correlated with CSF WBCs and CSF neopterin. Multivariate analysis confirmed the association of blood CD8 T-cell activation, along with plasma HIV-1 RNA and CSF neopterin, with CSF HIV-1 RNA levels. Conclusions The similarity of CD8 T-cell activation in blood and CSF suggests these cells move from blood to CSF with only minor changes in CD38/HLA-DR expression. Differences in the relation of CD8 activation to HIV-1 concentrations in the blood and CSF in the 2 viremic groups suggest that changes in immune activation not only modulate CSF HIV-1 replication but also contribute to CSF treatment effects. The magnitude of systemic HIV-1 infection and intrathecal macrophage activation are also important determinants of CSF HIV-1 RNA levels. PMID:18362693
Alexander, Jeff; Mendy, Jason; Vang, Lo; Avanzini, Jenny B.; Garduno, Fermin; Manayani, Darly J.; Ishioka, Glenn; Farness, Peggy; Ping, Li-Hua; Swanstrom, Ronald; Parks, Robert; Liao, Hua-Xin; Haynes, Barton F.; Montefiori, David C.; LaBranche, Celia; Smith, Jonathan; Gurwith, Marc; Mayall, Tim
2013-01-01
Background There is a well-acknowledged need for an effective AIDS vaccine that protects against HIV-1 infection or limits in vivo viral replication. The objective of these studies is to develop a replication-competent, vaccine vector based on the adenovirus serotype 4 (Ad4) virus expressing HIV-1 envelope (Env) 1086 clade C glycoprotein. Ad4 recombinant vectors expressing Env gp160 (Ad4Env160), Env gp140 (Ad4Env140), and Env gp120 (Ad4Env120) were evaluated. Methods The recombinant Ad4 vectors were generated with a full deletion of the E3 region of Ad4 to accommodate the env gene sequences. The vaccine candidates were assessed in vitro following infection of A549 cells for Env-specific protein expression and for posttranslational transport to the cell surface as monitored by the binding of broadly neutralizing antibodies (bNAbs). The capacity of the Ad4Env vaccines to induce humoral immunity was evaluated in rabbits for Env gp140 and V1V2-specific binding antibodies, and HIV-1 pseudovirus neutralization. Mice immunized with the Ad4Env160 vaccine were assessed for IFNγ T cell responses specific for overlapping Env peptide sets. Results Robust Env protein expression was confirmed by western blot analysis and recognition of cell surface Env gp160 by multiple bNAbs. Ad4Env vaccines induced humoral immune responses in rabbits that recognized Env 1086 gp140 and V1V2 polypeptide sequences derived from 1086 clade C, A244 clade AE, and gp70 V1V2 CASE A2 clade B fusion protein. The immune sera efficiently neutralized tier 1 clade C pseudovirus MW965.26 and neutralized the homologous and heterologous tier 2 pseudoviruses to a lesser extent. Env-specific T cell responses were also induced in mice following Ad4Env160 vector immunization. Conclusions The Ad4Env vaccine vectors express high levels of Env glycoprotein and induce both Env-specific humoral and cellular immunity thus supporting further development of this new Ad4 HIV-1 Env vaccine platform in Phase 1 clinical
Adenovirus vector-induced immune responses in nonhuman primates: responses to prime boost regimens.
Tatsis, Nia; Lasaro, Marcio O; Lin, Shih-Wen; Haut, Larissa H; Xiang, Zhi Q; Zhou, Dongming; Dimenna, Lauren; Li, Hua; Bian, Ang; Abdulla, Sarah; Li, Yan; Giles-Davis, Wynetta; Engram, Jessica; Ratcliffe, Sarah J; Silvestri, Guido; Ertl, Hildegund C; Betts, Michael R
2009-05-15
In the phase IIb STEP trial an HIV-1 vaccine based on adenovirus (Ad) vectors of the human serotype 5 (AdHu5) not only failed to induce protection but also increased susceptibility to HIV-1 infection in individuals with preexisting neutralizing Abs against AdHu5. The mechanisms underlying the increased HIV-1 acquisition rates have not yet been elucidated. Furthermore, it remains unclear if the lack of the vaccine's efficacy reflects a failure of the concept of T cell-mediated protection against HIV-1 or a product failure of the vaccine. Here, we compared two vaccine regimens based on sequential use of AdHu5 vectors or two different chimpanzee-derived Ad vectors in rhesus macaques that were AdHu5 seropositive or seronegative at the onset of vaccination. Our results show that heterologous booster immunizations with the chimpanzee-derived Ad vectors induced higher T and B cell responses than did repeated immunizations with the AdHu5 vector, especially in AdHu5-preexposed macaques.
2018-01-01
ABSTRACT Induction of broadly cross-reactive antiviral humoral responses with the capacity to target globally diverse circulating strains is a key goal for HIV-1 immunogen design. A major gap in the field is the identification of diverse HIV-1 envelope antigens to evaluate vaccine regimens for binding antibody breadth. In this study, we define unique antigen panels to map HIV-1 vaccine-elicited antibody breadth and durability. Diverse HIV-1 envelope glycoproteins were selected based on genetic and geographic diversity to cover the global epidemic, with a focus on sexually acquired transmitted/founder viruses with a tier 2 neutralization phenotype. Unique antigenicity was determined by nonredundancy (Spearman correlation), and antigens were clustered using partitioning around medoids (PAM) to identify antigen diversity. Cross-validation demonstrated that the PAM method was better than selection by reactivity and random selection. Analysis of vaccine-elicited V1V2 binding antibody in longitudinal samples from the RV144 clinical trial revealed the striking heterogeneity among individual vaccinees in maintaining durable responses. These data support the idea that a major goal for vaccine development is to improve antibody levels, breadth, and durability at the population level. Elucidating the level and durability of vaccine-elicited binding antibody breadth needed for protection is critical for the development of a globally efficacious HIV vaccine. IMPORTANCE The path toward an efficacious HIV-1 vaccine will require characterization of vaccine-induced immunity that can recognize and target the highly genetically diverse virus envelope glycoproteins. Antibodies that target the envelope glycoproteins, including diverse sequences within the first and second hypervariable regions (V1V2) of gp120, were identified as correlates of risk for the one partially efficacious HIV-1 vaccine. To build upon this discovery, we experimentally and computationally evaluated humoral
Dysregulated humoral immunity to nontyphoidal Salmonella in HIV-infected African adults
MacLennan, Calman A.; Gilchrist, James J.; Gordon, Melita A.; Cunningham, Adam F.; Cobbold, Mark; Goodall, Margaret; Kingsley, Robert A.; van Oosterhout, Joep J. G.; Msefula, Chisomo L.; Mandala, Wilson L.; Leyton, Denisse L.; Marshall, Jennifer L.; Gondwe, Esther N.; Bobat, Saeeda; López-Macías, Constantino; Doffinger, Rainer; Henderson, Ian R.; Zijlstra, Eduard E.; Dougan, Gordon; Drayson, Mark T.; MacLennan, Ian C. M.; Molyneux, Malcolm E.
2013-01-01
Nontyphoidal Salmonellae are a major cause of life-threatening bacteremia among HIV-infected individuals. Although cell-mediated immunity controls intracellular infection, antibody protects against Salmonella bacteremia. We report that high titer antibodies specific for Salmonella lipopolysaccharide (LPS) associate with absent Salmonella-killing in HIV-infected African adults. Killing was restored by genetically shortening LPS from target Salmonella, or removing LPS-specific antibodies from serum. Complement-mediated killing of Salmonella by healthy serum is shown to be induced specifically by antibodies against outer membrane proteins. This killing is lost when excess antibody against Salmonella LPS is added. Thus our study indicates impaired immunity against nontyphoidal Salmonella bacteremia in HIV infection results from excess inhibitory antibodies against Salmonella LPS, whilst serum killing of Salmonella is induced by antibodies against outer membrane proteins. PMID:20413503
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shimizu, Yuya; Miyazaki, Yasuyuki; Ibuki, Kentaro
2005-12-20
TNF-{alpha} has been implicated in the pathogenesis of, and the immune response against, HIV-1 infection. To clarify the roles of TNF-{alpha} against HIV-1-related virus infection in an SHIV-macaque model, we genetically engineered an SHIV to express the TNF-{alpha} gene (SHIV-TNF) and characterized the virus's properties in vivo. After the acute viremic stage, the plasma viral loads declined earlier in the SHIV-TNF-inoculated monkeys than in the parental SHIV (SHIV-NI)-inoculated monkeys. SHIV-TNF induced cell death in the lymph nodes without depletion of circulating CD4{sup +} T cells. SHIV-TNF provided some immunity in monkeys by increasing the production of the chemokine RANTES andmore » by inducing an antigen-specific proliferation of lymphocytes. The monkeys immunized with SHIV-TNF were partly protected against a pathogenic SHIV (SHIV-C2/1) challenge. These findings suggest that TNF-{alpha} contributes to the induction of an effective immune response against HIV-1 rather than to the progression of disease at the early stage of infection.« less
Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter
2012-01-01
Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID
Zhou, Dongyan; Zhang, Xin; Li, Weihua; Xu, Xiaoning; Goonetilleke, Nilu; Yang, Hongbing; Dong, Tao; Yan, Huiping
2013-01-01
Cellular immune responses play a critical role in the control of human immunodeficiency virus type 1 (HIV-1), but less is known about the impact of transmission routes on immune defenses against HIV-1. Here, we report that subjects infected with HIV-1 through contaminated blood showed stronger HIV-specific T cell responses than those infected through mucosa, both in breadth (6.9±2.5 vs. 2.3±0.5, p=0.0293) and in magnitude [1270.0±544.9 vs. 409.5±121.3 SFU per million peripheral blood mononuclear cells (PBMCs), p=0.0223], by using a matrix of 404 overlapping peptides spanning all expressed HIV-1 proteins in an interferon (IFN)-γ enzyme-linked immunospot (ELISpot) assay. Our observation indicates that different mechanisms might be involved in the priming/generating of anti-HIV-specific T cell responses through different transmission routes.
Mena, Guillermo; García-Basteiro, Alberto L; Llupià, Anna; Díez, Consolación; Costa, Josep; Gatell, Josep-María; García, Felipe; Bayas, José-María
2013-08-12
HIV seropositivity is considered a risk factor for complications in hepatitis A virus (HAV) infection. HAV vaccination schedules are widely implemented in HIV-infected patients, but the immune response remains impaired. We analysed the response to vaccination (antiHAV titres ≥20IU/l) in 282 HIV-infected patients included in a standard (1440 Elisa Units (EU) at 0, 6 months) or rapidly accelerated schedule (720 EU at 0, 7, 21 days and 6 months) between 1997 and 2009. Factors associated with the response to vaccination were analysed using logistic regression. The overall response rate was 73.4%. Male sex (OR: 0.16, 95% CI 0.05-0.51) and hepatitis C virus co-infection (OR: 0.30, 95% CI 0.14-0.74) were associated with a lower probability of response. Protective antibody response was associated with a higher CD4/CD8 ratio (OR: 3.69, 95% CI 1.3-10.5) and having received two doses of standard schedule (compared with patients receiving only one dose of the same schedule) (OR: 2.51, 95% CI 1.22-5.15). Three doses of the rapidly accelerated schedule were not more effective than a single dose of 1440 EU (OR: 1.32, 95% CI 0.48-3.63). The low responses observed in patients receiving a single dose suggest the need to emphasize adhesion to vaccination protocols to avoid failure. The CD4/CD8 ratio may be considered as an immune status marker which could help to better choose the moment of vaccination. Our findings underscore the importance of identifying strategies that optimize the timing and effectiveness of hepatitis A vaccination in HIV-infected patients and of the need for further studies on individual factors such as sex and hepatitis C co-infection that may affect the response to vaccination. Likewise, the sub-optimal effectiveness of three doses of 720 EU in the rapidly accelerated schedule, if confirmed in future studies, might lead to a revision of the current schedule recommended for HIV-infected travellers. Copyright © 2013 Elsevier Ltd. All rights reserved.
Toda, Tsuguto; Yoshino, Shin
2016-01-01
Nanomaterials present in cosmetics and food additives are used for industrial applications. However, their safety profile is unclear. Amorphous silica nanoparticles (nSPs) are a widely used nanomaterial and have been shown to induce inflammatory cytokines following intratracheal administration in mice. The current study investigated the adjuvant effect of nSP30 (nSP with a diameter of 33 nm) on T helper (Th)1, Th2, and Th17 immune responses as well as immunoglobulin (Ig) levels in mice. BALB/c mice were intraperitoneally administered ovalbumin (OVA) with or without varying doses and varying sizes of nSPs. The adjuvant effect of nSPs was investigated by measuring OVA-specific IgG antibodies in sera, OVA-specific proliferative responses of splenocytes, and the production of Th1, Th2, and Th17 cytokines. Aluminum hydroxide was used as a positive adjuvant control. Anti-OVA IgG production, splenocyte proliferative responses, and secretion of IFN-γ, IL-2, IL-4, IL-5, and IL-17 were increased significantly in mice receiving a combined injection of nSP30 (30 or 300 µg) with OVA compared with OVA alone or a combined injection with nSP30 (3 µg). The responses were nSP30 dose-dependent. When different sized nSPs were used (with 30, 100, and 1000 nm diameters), the responses to OVA were enhanced and were size-dependent. The smaller sized nSP particles had a greater adjuvant effect. nSPs appear to exert a size-dependent adjuvant effect for Th1, Th2, and Th17 immune responses. Understanding the mechanisms of nSP adjuvanticity might lead to the development of novel vaccine adjuvants and therapies for allergic diseases caused by environmental factors. PMID:27343242
Reevaluation of immune activation in the era of cART and an aging HIV-infected population
de Armas, Lesley R.; Pallikkuth, Suresh; George, Varghese; Rinaldi, Stefano; Pahwa, Rajendra; Arheart, Kristopher L.
2017-01-01
Biological aging is associated with immune activation (IA) and declining immunity due to systemic inflammation. It is widely accepted that HIV infection causes persistent IA and premature immune senescence despite effective antiretroviral therapy and virologic suppression; however, the effects of combined HIV infection and aging are not well defined. Here, we assessed the relationship between markers of IA and inflammation during biological aging in HIV-infected and -uninfected populations. Antibody response to seasonal influenza vaccination was implemented as a measure of immune competence and relationships between IA, inflammation, and antibody responses were explored using statistical modeling appropriate for integrating high-dimensional data sets. Our results show that markers of IA, such as coexpression of HLA antigen D related (HLA-DR) and CD38 on CD4+ T cells, exhibit strong associations with HIV infection but not with biological age. Certain variables that showed a strong relationship with aging, such as declining naive and CD38+ CD4 and CD8+ T cells, did so regardless of HIV infection. Interestingly, the variable of biological age was not identified in a predictive model as significantly impacting vaccine responses in either group, while distinct IA and inflammatory variables were closely associated with vaccine response in HIV-infected and -uninfected populations. These findings shed light on the most relevant and persistent immune defects during virological suppression with antiretroviral therapy. PMID:29046481
Reevaluation of immune activation in the era of cART and an aging HIV-infected population.
de Armas, Lesley R; Pallikkuth, Suresh; George, Varghese; Rinaldi, Stefano; Pahwa, Rajendra; Arheart, Kristopher L; Pahwa, Savita
2017-10-19
Biological aging is associated with immune activation (IA) and declining immunity due to systemic inflammation. It is widely accepted that HIV infection causes persistent IA and premature immune senescence despite effective antiretroviral therapy and virologic suppression; however, the effects of combined HIV infection and aging are not well defined. Here, we assessed the relationship between markers of IA and inflammation during biological aging in HIV-infected and -uninfected populations. Antibody response to seasonal influenza vaccination was implemented as a measure of immune competence and relationships between IA, inflammation, and antibody responses were explored using statistical modeling appropriate for integrating high-dimensional data sets. Our results show that markers of IA, such as coexpression of HLA antigen D related (HLA-DR) and CD38 on CD4+ T cells, exhibit strong associations with HIV infection but not with biological age. Certain variables that showed a strong relationship with aging, such as declining naive and CD38+ CD4 and CD8+ T cells, did so regardless of HIV infection. Interestingly, the variable of biological age was not identified in a predictive model as significantly impacting vaccine responses in either group, while distinct IA and inflammatory variables were closely associated with vaccine response in HIV-infected and -uninfected populations. These findings shed light on the most relevant and persistent immune defects during virological suppression with antiretroviral therapy.
Royal, Walter; Can, Adem; Gould, Todd D.; Guo, Ming; Huse, Jared; Jackson, Myles; Davis, Harry; Bryant, Joseph
2018-01-01
Cognitive impairment in HIV-1 infection is associated with the induction of chronic proinflammatory responses in the brains of infected individuals. The risk of HIV-related cognitive impairment is increased by cigarette smoking, which induces brain inflammation in rodent models. To better understand the role of smoking and the associated immune response on behavioral and motor function in HIV infection, wild-type F344 and HIV-1 transgenic (HIV1Tg) rats were exposed to either smoke from nicotine-containing (regular) cigarettes, smoke from nicotine-free cigarettes, or to nicotine alone. The animals were then tested using the rotarod test (RRT), the novel object recognition test (NORT), and the open field test (OFT). Subsequently, brain frontal cortex from the rats was analyzed for levels of TNF-α, IL-1, and IL-6. On the RRT, impairment was noted for F344 rats exposed to either nicotine-free cigarette smoke or nicotine alone and for F344 and HIV1Tg rats exposed to regular cigarette smoke. Effects from the exposures on the OFT were seen only for HIV1Tg rats, for which function was worse following exposure to regular cigarette smoke as compared to exposure to nicotine alone. Expression levels for all three cytokines were overall higher for HIV1Tg than for F344 rats. For HIV1Tg rats, TNF-α, IL-1, and IL-6 gene expression levels for all exposure groups were higher than for control rats. All F344 rat exposure groups also showed significantly increased TNF-α expression levels. However, for F344 rats, IL-1 expression levels were higher only for rats exposed to nicotine-free and nicotine-containing CS, and no increase in IL-6 gene expression was noted with any of the exposures as compared to controls. These studies, therefore, demonstrate that F344 and HIV1Tg rats show differential behavioral and immune effects from these exposures. These effects may potentially reflect differences in the responsiveness of the various brain regions in the two animal species as well as the
Factors that deregulate the protective immune response in tuberculosis.
Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana
2009-01-01
Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.
Buggert, Marcus; Nguyen, Son; Salgado-Montes de Oca, Gonzalo; Bengsch, Bertram; Darko, Samuel; Ransier, Amy; Roberts, Emily R; Del Alcazar, Daniel; Brody, Irene Bukh; Vella, Laura A; Beura, Lalit; Wijeyesinghe, Sathi; Herati, Ramin S; Del Rio Estrada, Perla M; Ablanedo-Terrazas, Yuria; Kuri-Cervantes, Leticia; Sada Japp, Alberto; Manne, Sasikanth; Vartanian, Shant; Huffman, Austin; Sandberg, Johan K; Gostick, Emma; Nadolski, Gregory; Silvestri, Guido; Canaday, David H; Price, David A; Petrovas, Constantinos; Su, Laura F; Vahedi, Golnaz; Dori, Yoav; Frank, Ian; Itkin, Maxim G; Wherry, E John; Deeks, Steven G; Naji, Ali; Reyes-Terán, Gustavo; Masopust, David; Douek, Daniel C; Betts, Michael R
2018-06-01
Current paradigms of CD8 + T cell-mediated protection in HIV infection center almost exclusively on studies of peripheral blood, which is thought to provide a window into immune activity at the predominant sites of viral replication in lymphoid tissues (LTs). Through extensive comparison of blood, thoracic duct lymph (TDL), and LTs in different species, we show that many LT memory CD8 + T cells bear phenotypic, transcriptional, and epigenetic signatures of resident memory T cells (T RMs ). Unlike their circulating counterparts in blood or TDL, most of the total and follicular HIV-specific CD8 + T cells in LTs also resemble T RMs Moreover, high frequencies of HIV-specific CD8 + T RMs with skewed clonotypic profiles relative to matched blood samples are present in LTs of individuals who spontaneously control HIV replication in the absence of antiretroviral therapy (elite controllers). Single-cell RNA sequencing analysis confirmed that HIV-specific T RMs are enriched for effector-related immune genes and signatures compared with HIV-specific non-T RMs in elite controllers. Together, these data indicate that previous studies in blood have largely failed to capture the major component of HIV-specific CD8 + T cell responses resident within LTs. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
Hessell, Ann J; Malherbe, Delphine C; Pissani, Franco; McBurney, Sean; Krebs, Shelly J; Gomes, Michelle; Pandey, Shilpi; Sutton, William F; Burwitz, Benjamin J; Gray, Matthew; Robins, Harlan; Park, Byung S; Sacha, Jonah B; LaBranche, Celia C; Fuller, Deborah H; Montefiori, David C; Stamatatos, Leonidas; Sather, D Noah; Haigwood, Nancy L
2016-04-01
Advancement in immunogen selection and vaccine design that will rapidly elicit a protective Ab response is considered critical for HIV vaccine protective efficacy. Vaccine-elicited Ab responses must therefore have the capacity to prevent infection by neutralization-resistant phenotypes of transmitted/founder (T/F) viruses that establish infection in humans. Most vaccine candidates to date have been ineffective at generating Abs that neutralize T/F or early variants. In this study, we report that coimmunizing rhesus macaques with HIV-1 gp160 DNA and gp140 trimeric protein selected from native envelope gene sequences (envs) induced neutralizing Abs against Tier 2 autologous viruses expressing cognate envelope (Env). The Env immunogens were selected from envs emerging during the earliest stages of neutralization breadth developing within the first 2 years of infection in two clade B-infected human subjects. Moreover, the IgG responses in macaques emulated the targeting to specific regions of Env known to be associated with autologous and heterologous neutralizing Abs developed within the human subjects. Furthermore, we measured increasing affinity of macaque polyclonal IgG responses over the course of the immunization regimen that correlated with Tier 1 neutralization. In addition, we report firm correlations between Tier 2 autologous neutralization and Tier 1 heterologous neutralization, as well as overall TZM-bl breadth scores. Additionally, the activation of Env-specific follicular helper CD4 T cells in lymphocytes isolated from inguinal lymph nodes of vaccinated macaques correlated with Tier 2 autologous neutralization. These results demonstrate the potential for native Env derived from subjects at the time of neutralization broadening as effective HIV vaccine elements. Copyright © 2016 by The American Association of Immunologists, Inc.
SIRT1 and HIF1α signaling in metabolism and immune responses.
Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei
2018-04-01
SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
Takeoka, Tomohira; Nagase, Hirotsugu; Kurose, Koji; Ohue, Yoshihiro; Yamasaki, Makoto; Takiguchi, Shuji; Sato, Eiichi; Isobe, Midori; Kanazawa, Takayuki; Matsumoto, Mitsunobu; Iwahori, Kota; Kawashima, Atsunari; Morimoto-Okazawa, Akiko; Nishikawa, Hiroyoshi; Oka, Mikio; Pan, Linda; Venhaus, Ralph; Nakayama, Eiichi; Mori, Masaki; Doki, Yuichiro; Wada, Hisashi
2017-03-23
We conducted a clinical trial of a cancer vaccine using NY-ESO-1 protein with polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) and/or OK-432 against solid tumors. A total of 15 patients were sequentially enrolled in 4 cohorts. Patients in cohort 1 received NY-ESO-1 protein; cohort 2a received NY-ESO-1 protein+OK-432; cohort 2b received NY-ESO-1 protein+poly-ICLC; cohort 3 received NY-ESO-1 protein+OK-432+poly-ICLC with Montanide ISA-51. The endpoints of this trial were safety, NY-ESO-1 immune responses, and clinical response. Vaccine-related adverse events observed were fever and injection-site reaction (grade 1). Two patients showed stable disease after vaccination. NY-ESO-1 antibodies were observed in 4 patients at the baseline (sero-positive) and augmented in all patients after vaccination. Eleven patients showed a conversion of negative antibody responses at baseline to positive after vaccination (seroconversion). The seroconversions were observed in all 11 sero-negative patients by the fourth immunization; in particular, it was observed by the second immunization in patients with poly-ICLC, and these induced antibody responses were stronger than those in patients immunized without poly-ICLC. The number of NY-ESO-1-specific interferon (IFN)γ-producing T cells was increased in patients immunized with poly-ICLC and/or OK-432, and furthermore, the increase of IFNγ-producing CD8 T cells in patients immunized with poly-ICLC was significantly higher than that in patients without poly-ICLC. Nonspecific activations of T-cell or antigen presenting cells were not observed. Our present study showed that poly-ICLC is a promising adjuvant for cancer vaccines.
Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H
2015-04-21
The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.
Vermaak, Anine; Theron, Gerhard B; Schubert, Pawel T; Kidd, Martin; Rabie, Ursula; Adjiba, Benedict M; Wright, Colleen A
2012-12-01
To provide baseline information regarding a possible association between specific histopathologic features of the placentas of HIV-positive women and the degree of immune suppression. A prospective single-blinded laboratory-based pilot study was conducted at Tygerberg Hospital, South Africa. The macroscopic and microscopic features of placentas from HIV-positive (n=91) and HIV-negative women (n=89) were compared and recorded using a standard template. Investigators were blinded to the participants' HIV status and CD4-positive cell count. Placentas from the HIV-positive group were characterized by decreased weight and increased number of marginal infarcts relative to the HIV-negative group. The most important microscopic finding was the increased presence of villitis of unknown etiology (VUE) among the group of untreated HIV-positive women with CD4 cell counts of 200 cells/mm(3) or below. Both macroscopic and microscopic differences relating to the degree of immune suppression were identified, which seemingly contradicts previous reports. Larger studies are warranted to define the function of antiretroviral therapy and VUE in the mechanism of mother-to-fetus transmission of HIV. Furthermore, the potential role of VUE in the pathophysiology of the compromised immune response observed among HIV-exposed but uninfected infants should be investigated. Copyright © 2012 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.
Henrick, Bethany M; Yao, Xiao-Dan; Nasser, Laila; Roozrogousheh, Ava; Rosenthal, Kenneth L
2017-01-01
The majority of infants' breastfeeding from their HIV-infected mothers do not acquire HIV-1 infection despite exposure to cell-free virus and cell-associated virus in HIV-infected breast milk. Paradoxically, exclusive breastfeeding regardless of the HIV status of the mother has led to a significant decrease in mother-to-child transmission (MTCT) compared with non-exclusive breastfeeding. Although it remains unclear how these HIV-exposed infants remain uninfected despite repeated and prolonged exposure to HIV-1, the low rate of transmission is suggestive of a multitude of protective, short-lived bioactive innate immune factors in breast milk. Indeed, recent studies of soluble factors in breast milk shed new light on mechanisms of neonatal HIV-1 protection. This review highlights the role and significance of innate immune factors in HIV-1 susceptibility and infection. Prevention of MTCT of HIV-1 is likely due to multiple factors, including innate immune factors such as lactoferrin and elafin among many others. In pursuing this field, our lab was the first to show that soluble toll-like receptor 2 (sTLR2) directly inhibits HIV infection, integration, and inflammation. More recently, we demonstrated that sTLR2 directly binds to selective HIV-1 proteins, including p17, gp41, and p24, leading to significantly reduced NFκB activation, interleukin-8 production, CCR5 expression, and HIV infection in a dose-dependent manner. Thus, a clearer understanding of soluble milk-derived innate factors with known antiviral functions may provide new therapeutic insights to reduce vertical HIV-1 transmission and will have important implications for protection against HIV-1 infection at other mucosal sites. Furthermore, innate bioactive factors identified in human milk may serve not only in protecting infants against infections and inflammation but also the elderly; thus, opening the door for novel innate immune therapeutics to protect newborns, infants, adults, and the elderly.
Sun, Peifang; Crum-Cianflone, Nancy F; Defang, Gabriel; Williams, Maya; Ganesan, Anuradha; Agan, Brian K; Lalani, Tahaniyat; Whitman, Timothy; Brandt, Carolyn; Burgess, Timothy H
2017-10-27
This study was to compare B and T memory cells elicited by a single dose monovalent 2009 influenza A (H1N1) vaccine (strain A/California/7/2009 H1N1) in HIV + and HIV - groups, and to analyze the impact of the prior seasonal vaccines to the immunogenicity of this vaccine. Blood samples were collected before vaccination (day 0) and at days 28 and 180. Participants were categorized into HIV - /LAIV, HIV - /TIV and HIV + /TIV subgroups according to the trivalent live-attenuated or inactivated (LAIV or TIV) seasonal influenza vaccines they received previously. The IgG + memory B cells (B Mem ) and IFNγ + T cells were measured against antigens including the H1N1 vaccine, the hemagglutinin (HA) and neuraminidase (NA) proteins or peptide pools of the pandemic and the seasonal H1N1 strains, respectively. Overall B Mem responses increased significantly at day 28 but returned to baseline by day 180 in all three subgroups. The average frequency of the H1N1-specific B Mem at day 28 for the HIV - /LAIV, HIV - /TIV and HIV + /TIV groups was 2.14%, 1.26% and 1.67%, respectively, and the average fold change was 14.39, 3.81 and 3.93, respectively. The differences of B Mem between HIV - /LAIV and the two TIV subgroups were significant. For the IFNγ response, the overall spot counts ranged widely between 0 and 958/10 6 PBMCs. The group average spot counts to H1N1 vaccine was 89, 102, and 30 at day 28 for HIV - /LAIV, HIV - /TIV and HIV + /TIV subgroups, respectively. The average increase of IFNγ response at day 28 vs day 0 in all three subgroups did not reach 2-fold. Participants with a prior LAIV seasonal vaccine, as compared to a TIV seasonal vaccine, responded significantly better to the monovalent H1N1 vaccine. Excluding LAIV participants, no difference was seen between the HIV + and HIV - subject groups in terms of B Mem . The B Mem response declined at 6months. Copyright © 2017. Published by Elsevier Ltd.
Panagiotakis, Simeon H; Soufla, Giannoula; Baritaki, Stavroula; Sourvinos, George; Passam, Andreas; Zagoreos, Ioannis; Stavrianeas, Nikolaos; Spandidos, Demetrios A
2007-01-01
The purpose of this study was to assess the qualitative single and multiple herpes virus DNAemia in the peripheral blood leukocytes (PBLs) of HIV-1-positive patients and its impact on the response to highly active antiretroviral therapy (HAART) and immune reconstitution. All (163) HIV-1-positive patients attending "Syngros AIDS Referral Center" from November 2000 to February 2001 were recruited. CMV, HSV-1, HSV-2, EBV, and HHV-8 DNA were detected in PBLs by polymerase chain reaction (PCR). Patients' follow-up comprised regular measurements of CD4(+) T cell count and HIV-1 viral load (VL) for an average period of 21 months. Immune reconstitution was defined as an increase in the CD4 T cell count by above 200 cells/micro l, while response to HAART was defined as a decrease in HIV-1 VL to undetectable levels. Single and multiple herpetic DNAemia in PBLs was found to be significantly higher in HIV-1-positive patients compared to healthy controls (p < 0.02) for all the viruses detected apart from HSV-2, which was not detected in the PBLs of either population. Concurrent CMV and EBV DNAemia significantly correlates with a delay in the response to HAART (p = 0.033) in treatment-naive patients. Untreated patients with a CD4(+) T cell count <200 cells/micro l, and with either CMV or EBV DNAemia, presented a delayed increase in the CD4 count after initiation of HAART (p = 0.035 and p = 0.037 respectively), while multiple herpetic DNAemia in the above patients was borderline associated with immune reconstitution (p = 0.068). Conclusively, CMV and EBV DNAemia may be poor prognostic factors for the response to HAART in treatment-naive HIV-1 patients.
HMGB1, an alarmin promoting HIV dissemination and latency in dendritic cells
Gougeon, M-L; Melki, M-T; Saïdi, H
2012-01-01
Dendritic cells (DCs) initiate immune responses by transporting antigens and migrating to lymphoid tissues to initiate T-cell responses. DCs are located in the mucosal surfaces that are involved in human immunodeficiency virus (HIV) transmission and they are probably among the earliest targets of HIV-1 infection. DCs have an important role in viral transmission and dissemination, and HIV-1 has evolved different strategies to evade DC antiviral activity. High mobility group box 1 (HMGB1) is a DNA-binding nuclear protein that can act as an alarmin, a danger signal to alert the innate immune system for the initiation of host defense. It is the prototypic damage-associated molecular pattern molecule, and it can be secreted by innate cells, including DCs and natural killer (NK) cells. The fate of DCs is dependent on a cognate interaction with NK cells, which involves HMGB1 expressed at NK–DC synapse. HMGB1 is essential for DC maturation, migration to lymphoid tissues and functional type-1 polarization of naïve T cells. This review highlights the latest advances in our understanding of the impact of HIV on the interactions between HMGB1 and DCs, focusing on the mechanisms of HMGB1-dependent viral dissemination and persistence in DCs, and discussing the consequences on antiviral innate immunity, immune activation and HIV pathogenesis. PMID:22033335
Surace, Laura; Lysenko, Veronika; Fontana, Andrea Orlando; Cecconi, Virginia; Janssen, Hans; Bicvic, Antonela; Okoniewski, Michal; Pruschy, Martin; Dummer, Reinhard; Neefjes, Jacques; Knuth, Alexander; Gupta, Anurag; van den Broek, Maries
2015-04-21
Radiotherapy induces DNA damage and cell death, but recent data suggest that concomitant immune stimulation is an integral part of the therapeutic action of ionizing radiation. It is poorly understood how radiotherapy supports tumor-specific immunity. Here we report that radiotherapy induced tumor cell death and transiently activated complement both in murine and human tumors. The local production of pro-inflammatory anaphylatoxins C3a and C5a was crucial to the tumor response to radiotherapy and concomitant stimulation of tumor-specific immunity. Dexamethasone, a drug frequently given during radiotherapy, limited complement activation and the anti-tumor effects of the immune system. Overall, our findings indicate that anaphylatoxins are key players in radiotherapy-induced tumor-specific immunity and the ensuing clinical responses. Copyright © 2015 Elsevier Inc. All rights reserved.
Giardia-specific cellular immune responses in post-giardiasis chronic fatigue syndrome.
Hanevik, Kurt; Kristoffersen, Einar; Mørch, Kristine; Rye, Kristin Paulsen; Sørnes, Steinar; Svärd, Staffan; Bruserud, Øystein; Langeland, Nina
2017-01-28
The role of pathogen specific cellular immune responses against the eliciting pathogen in development of post-infectious chronic fatigue syndrome (PI-CFS) is not known and such studies are difficult to perform. The aim of this study was to evaluate specific anti-Giardia cellular immunity in cases that developed CFS after Giardia infection compared to cases that recovered well. Patients reporting chronic fatigue in a questionnaire study three years after a Giardia outbreak were clinically evaluated five years after the outbreak and grouped according to Fukuda criteria for CFS and idiopathic chronic fatigue. Giardia specific immune responses were evaluated in 39 of these patients by proliferation assay, T cell activation and cytokine release analysis. 20 Giardia exposed non-fatigued individuals and 10 healthy unexposed individuals were recruited as controls. Patients were clinically classified into CFS (n = 15), idiopathic chronic fatigue (n = 5), fatigue from other causes (n = 9) and recovered from fatigue (n = 10). There were statistically significant antigen specific differences between these Giardia exposed groups and unexposed controls. However, we did not find differences between the Giardia exposed fatigue classification groups with regard to CD4 T cell activation, proliferation or cytokine levels in 6 days cultured PBMCs. Interestingly, sCD40L was increased in patients with PI-CFS and other persons with fatigue after Giardia infection compared to the non-fatigued group, and correlated well with fatigue levels at the time of sampling. Our data show antigen specific cellular immune responses in the groups previously exposed to Giardia and increased sCD40L in fatigued patients.
Sejian, Veerasamy; Srivastava, Rajendra Swaroop
2010-12-01
The purpose of the investigation was to observe the pineal-adrenal-immune system relationships and their influence on non-specific immune response in female goats under short-term thermal stress. Six female goats had been exposed to 40°C and 60% relative humidity in the psychrometric chamber for 17 days. Blood samples were obtained on days 0 and 10 to establish control and thermal stress effects, respectively. Chemical adrenalectomy was achieved by injecting metyrapone (100 mg/kg body weight) followed by exogenous melatonin treatment (0.1 mg/kg body weight) from 11th to 17th day of experiment. Thermal stress significantly (P≤0.05) altered the physiological responses. Metyrapone and melatonin treatment significantly (P≤0.05) reduced the thermal-stress-induced increase in plasma concentrations of cortisol and corticosterone while significantly (P≤0.05) increased the plasma melatonin on days 11 and 17. Furthermore, these treatments significantly (P<0.05) increased the phagocytic activity of neutrophils as compared to both control and thermal exposure values from 11-17 days of experiment. The data generated from this study help us to understand the functional relationship between pineal, adrenal, and immune system, and how this relationship modifies the non-specific immune response for the well being of goats during thermal stress.
Chang, Christina C; Crane, Megan; Zhou, JingLing; Mina, Michael; Post, Jeffrey J; Cameron, Barbara A; Lloyd, Andrew R; Jaworowski, Anthony; French, Martyn A; Lewin, Sharon R
2013-01-01
Summary Despite significant reductions in morbidity and mortality secondary to availability of effective combination antiretroviral therapy (cART), human immunodeficiency virus (HIV) infection still accounts for 1.5 million deaths annually. The majority of deaths occur in sub-Saharan Africa where rates of opportunistic co-infections are disproportionately high. In this review, we discuss the immunopathogenesis of five common infections that cause significant morbidity in HIV-infected patients globally. These include co-infection with Mycobacterium tuberculosis, Cryptococcus neoformans, hepatitis B virus (HBV), hepatitis C virus (HCV), and Plasmodium falciparum. Specifically, we review the natural history of each co-infection in the setting of HIV, the specific immune defects induced by HIV, the effects of cART on the immune response to the co-infection, the pathogenesis of immune restoration disease (IRD) associated with each infection, and advances in the areas of prevention of each co-infection via vaccination. Finally, we discuss the opportunities and gaps for future research. PMID:23772618
Fouts, Timothy R; Bagley, Kenneth; Prado, Ilia J; Bobb, Kathryn L; Schwartz, Jennifer A; Xu, Rong; Zagursky, Robert J; Egan, Michael A; Eldridge, John H; LaBranche, Celia C; Montefiori, David C; Le Buanec, Hélène; Zagury, Daniel; Pal, Ranajit; Pavlakis, George N; Felber, Barbara K; Franchini, Genoveffa; Gordon, Shari; Vaccari, Monica; Lewis, George K; DeVico, Anthony L; Gallo, Robert C
2015-03-03
A guiding principle for HIV vaccine design has been that cellular and humoral immunity work together to provide the strongest degree of efficacy. However, three efficacy trials of Ad5-vectored HIV vaccines showed no protection. Transmission was increased in two of the trials, suggesting that this vaccine strategy elicited CD4+ T-cell responses that provide more targets for infection, attenuating protection or increasing transmission. The degree to which this problem extends to other HIV vaccine candidates is not known. Here, we show that a gp120-CD4 chimeric subunit protein vaccine (full-length single chain) elicits heterologous protection against simian-human immunodeficiency virus (SHIV) or simian immunodeficiency virus (SIV) acquisition in three independent rhesus macaque repeated low-dose rectal challenge studies with SHIV162P3 or SIVmac251. Protection against acquisition was observed with multiple formulations and challenges. In each study, protection correlated with antibody-dependent cellular cytotoxicity specific for CD4-induced epitopes, provided that the concurrent antivaccine T-cell responses were minimal. Protection was lost in instances when T-cell responses were high or when the requisite antibody titers had declined. Our studies suggest that balance between a protective antibody response and antigen-specific T-cell activation is the critical element to vaccine-mediated protection against HIV. Achieving and sustaining such a balance, while enhancing antibody durability, is the major challenge for HIV vaccine development, regardless of the immunogen or vaccine formulation.
Fouts, Timothy R.; Bagley, Kenneth; Prado, Ilia J.; Bobb, Kathryn L.; Schwartz, Jennifer A.; Xu, Rong; Zagursky, Robert J.; Egan, Michael A.; Eldridge, John H.; LaBranche, Celia C.; Montefiori, David C.; Le Buanec, Hélène; Zagury, Daniel; Pal, Ranajit; Pavlakis, George N.; Felber, Barbara K.; Franchini, Genoveffa; Gordon, Shari; Vaccari, Monica; Lewis, George K.; DeVico, Anthony L.; Gallo, Robert C.
2015-01-01
A guiding principle for HIV vaccine design has been that cellular and humoral immunity work together to provide the strongest degree of efficacy. However, three efficacy trials of Ad5-vectored HIV vaccines showed no protection. Transmission was increased in two of the trials, suggesting that this vaccine strategy elicited CD4+ T-cell responses that provide more targets for infection, attenuating protection or increasing transmission. The degree to which this problem extends to other HIV vaccine candidates is not known. Here, we show that a gp120-CD4 chimeric subunit protein vaccine (full-length single chain) elicits heterologous protection against simian-human immunodeficiency virus (SHIV) or simian immunodeficiency virus (SIV) acquisition in three independent rhesus macaque repeated low-dose rectal challenge studies with SHIV162P3 or SIVmac251. Protection against acquisition was observed with multiple formulations and challenges. In each study, protection correlated with antibody-dependent cellular cytotoxicity specific for CD4-induced epitopes, provided that the concurrent antivaccine T-cell responses were minimal. Protection was lost in instances when T-cell responses were high or when the requisite antibody titers had declined. Our studies suggest that balance between a protective antibody response and antigen-specific T-cell activation is the critical element to vaccine-mediated protection against HIV. Achieving and sustaining such a balance, while enhancing antibody durability, is the major challenge for HIV vaccine development, regardless of the immunogen or vaccine formulation. PMID:25681373
Mechanisms for Cell-to-Cell Transmission of HIV-1
Bracq, Lucie; Xie, Maorong; Benichou, Serge; Bouchet, Jérôme
2018-01-01
While HIV-1 infection of target cells with cell-free viral particles has been largely documented, intercellular transmission through direct cell-to-cell contact may be a predominant mode of propagation in host. To spread, HIV-1 infects cells of the immune system and takes advantage of their specific particularities and functions. Subversion of intercellular communication allows to improve HIV-1 replication through a multiplicity of intercellular structures and membrane protrusions, like tunneling nanotubes, filopodia, or lamellipodia-like structures involved in the formation of the virological synapse. Other features of immune cells, like the immunological synapse or the phagocytosis of infected cells are hijacked by HIV-1 and used as gateways to infect target cells. Finally, HIV-1 reuses its fusogenic capacity to provoke fusion between infected donor cells and target cells, and to form infected syncytia with high capacity of viral production and improved capacities of motility or survival. All these modes of cell-to-cell transfer are now considered as viral mechanisms to escape immune system and antiretroviral therapies, and could be involved in the establishment of persistent virus reservoirs in different host tissues. PMID:29515578
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Donglai; Wang, Chu; Hora, Bhavna
Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less
Liu, Donglai; Wang, Chu; Hora, Bhavna; ...
2017-10-10
Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less
Costa, Natalia Moriya Xavierda; Albuquerque, Maly de; Lins, Janaína Bacelar Acioli; Alvares-Junior, João Teixeira; Stefani, Mariane Martins de Araújo
2011-10-01
Among HIV-1-infected patients, CD4+ T cell counts are well-established markers of cell-mediated immunity. Delayed-type hypersensitivity (DTH) skin tests can be used to evaluate in vivo cell-mediated immunity to common antigens. DTH responses to tuberculin purified protein derivative (PPD), sporotrichin, trichophytin, candidin and streptokinase/streptodornase antigens were assessed. Thirty-six HIV-1-infected children/adolescents and 56 age- and sex-matched HIV-1/HIV-2-seronegative participants were tested. All participants had a BCG scar. Fisher's exact test was used to evaluate significant differences between groups (p<0.05). The main characteristics of the HIV-1 patients were as follows: median age 8.1 years; 20/36 were males; 35 were vertical transmission cases; 34 were AIDS cases under antiretroviral therapy; median viral load = 3.04 log10 copies/ml; median CD4+ T cell count = 701 cells/μl. A total of 25% (9/36) and 87.5% (49/56) of HIV-1-infected and healthy participants, respectively, displayed DTH reactivity to at least one antigen (p<0.001). Among HIV-1-infected participants, reactivity to candidin predominated (8/36, 22.2%), while PPD positivity prevailed among healthy participants (40/56, 71.4%). PPD reactivity in the HIV-1-positive group was 8.3% (p<0.01). The median PPD induration was 2.5mm (range: 2-5mm) in the HIV-1 group and 6.0 mm among healthy participants (range: 3-15 mm). There was no correlation between PPD positivity and age. No correlation between CD4+ T cell counts and DTH reactivity was observed among HIV-1-infected patients. DTH skin test responses, including PPD reactivity, were significantly lower among HIV-1-infected participants compared to healthy controls, which likely reflects advanced disease and T cell depletion.
Yu, Mingke; Vajdy, Michael
2011-01-01
Non-replicating protein- or DNA-based antigens generally require immune-enhancing adjuvants and delivery systems. It has been particularly difficult to raise antibodies against gp120 of HIV-1, which constitutes an important approach in HIV vaccine design. While almost all effort in adjuvant research has focused on mimicking the pathogens and the danger signals they engender in the host, relatively little effort has been spent on nutritive approaches. In this study, a new nutritive immune-enhancing delivery system (NIDS) composed of vitamin A, a polyphenol-flavonoid catechin hydrate, and mustard oil was tested for its adjuvant effect in immune responses against the gp120 protein of HIV-1CN54. Following a combination of two mucosal and two systemic vaccinations of mice, we found significant enhancement of both local and systemic antibodies as well as cytokine responses. These data have important implications for vaccine and adjuvant design against HIV-1 and other pathogens. PMID:21272602
Batraville, Laurie-Anne; Richard, Jonathan; Veillette, Maxime; Labbé, Annie-Claude; Alary, Michel; Guédou, Fernand; Kaufmann, Daniel E; Poudrier, Johanne; Finzi, Andrés; Roger, Michel
2014-11-01
Characterization of the immune correlates of protection against HIV infection is crucial for the development of preventive strategies. This study examined HIV-1 envelope (Env) glycoproteins, specifically immunoglobulin G (IgG), in systemic and mucosal compartments of female Beninese commercial sex workers (CSWs). Samples of 23 HIV-1-positive and 20 highly exposed HIV-1-seronegative (HESN) CSWs were studied. HIV-1 Env-specific IgG detection in sera and cervicovaginal lavages (CVLs) from the study population was done by cell-based ELISA. The HIV neutralizing activity was evaluated with a neutralization assay. The HIV-1-specific antibody-dependent cellular cytotoxicity (ADCC) response of the cohort was measured with a FACS-based assay evaluating the ADCC-mediated elimination of gp120-coated target cells. No anti-HIV-1 Env-specific IgG neutralizing or ADCC activities were detected in samples from HESN CSWs. Samples from HIV-1-infected CSWs presented ADCC activity in both sera and CVLs. Anti-Env IgG from sera and CVLs from HIV-1-infected CSWs preferentially recognized Env in its CD4-bound conformation. HIV-1-infected CSWs have ADCC-mediating IgG that preferentially recognizes Env in its CD4-bound conformation at the mucosal site.
HIV-1 Tat-based vaccines: from basic science to clinical trials.
Fanales-Belasio, Emanuele; Cafaro, Aurelio; Cara, Andrea; Negri, Donatella R M; Fiorelli, Valeria; Butto, Stefano; Moretti, Sonia; Maggiorella, Maria Teresa; Baroncelli, Silvia; Michelini, Zuleika; Tripiciano, Antonella; Sernicola, Leonardo; Scoglio, Arianna; Borsetti, Alessandra; Ridolfi, Barbara; Bona, Roberta; Ten Haaft, Peter; Macchia, Iole; Leone, Pasqualina; Pavone-Cossut, Maria Rosaria; Nappi, Filomena; Vardas, Eftyhia; Magnani, Mauro; Laguardia, Elena; Caputo, Antonella; Titti, Fausto; Ensoli, Barbara
2002-09-01
Vaccination against human immunodeficiency virus (HIV)-1 infection requires candidate antigen(s) (Ag) capable of inducing an effective, broad, and long-lasting immune response against HIV-1 despite mutation events leading to differences in virus clades. The HIV-1 Tat protein is more conserved than envelope proteins, is essential in the virus life cycle and is expressed very early upon virus entry. In addition, both humoral and cellular responses to Tat have been reported to correlate with a delayed progression to disease in both humans and monkeys. This suggested that Tat is an optimal target for vaccine development aimed at controlling virus replication and blocking disease onset. Here are reviewed the results of our studies including the effects of the Tat protein on monocyte-derived dendritic cells (MDDCs) that are key antigen-presenting cells (APCs), and the results from vaccination trials with both the Tat protein or tat DNA in monkeys. We provide evidence that the HIV-1 Tat protein is very efficiently taken up by MDDCs and promotes T helper (Th)-1 type immune responses against itself as well as other Ag. In addition, a Tat-based vaccine elicits an immune response capable of controlling primary infection of monkeys with the pathogenic SHIV89.6P at its early stages allowing the containment of virus spread. Based on these results and on data of Tat conservation and immune cross-recognition in field isolates from different clades, phase I clinical trials are being initiated in Italy for both preventive and therapeutic vaccination.
Particle-based vaccines for HIV-1 infection.
Young, Kelly R; Ross, Ted M
2003-06-01
The use of live-attenuated viruses as vaccines has been successful for the control of viral infections. However, the development of an effective vaccine against the human immunodeficiency virus (HIV) has proven to be a challenge. HIV infects cells of the immune system and results in a severe immunodeficiency. In addition, the ability of the virus to adapt to immune pressure and the ability to reside in an integrated form in host cells present hurdles for vaccinologists to overcome. A particle-based vaccine strategy has promise for eliciting high titer, long-lived, immune responses to a diverse number of viral epitopes from different HIV antigens. Live-attenuated viruses are effective at generating both cellular and humoral immunity, however, a live-attenuated vaccine for HIV is problematic. The possibility of a live-attenuated vaccine to revert to a pathogenic form or recombine with a wild-type or defective virus in an infected individual is a drawback to this approach. Therefore, these vaccines are currently only being tested in non-human primate models. Live-attenuated vaccines are effective in stimulating immunity, however challenged animals rarely clear viral infection and the degree of attenuation directly correlates with the protection of animals from disease. Another particle-based vaccine approach for HIV involves the use of virus-like particles (VLPs). VLPs mimic the viral particle without causing an immunodeficiency disease. HIV-like particles (HIV-LP) are defined as self-assembling, non-replicating, nonpathogenic, genomeless particles that are similar in size and conformation to intact virions. A variety of VLPs for both HIV and SIV are currently in pre-clinical and clinical trials. This review focuses on the current knowledge regarding the immunogenicity and safety of particle-based vaccine strategies for HIV-1.
Wiehe, Kevin; Easterhoff, David; Luo, Kan; ...
2014-11-29
In HIV-1, the ability to mount antibody responses to conserved, neutralizing epitopes is critical for protection. Here we have studied the light chain usage of human and rhesus macaque antibodies targeted to a dominant region of the HIV-1 envelope second variable (V2) region involving lysine (K) 169, the site of immune pressure in the RV144 vaccine efficacy trial. We found that humans and rhesus macaques used orthologous lambda variable gene segments encoding a glutamic acid-aspartic acid (ED) motif for K169 recognition. Structure determination of an unmutated ancestor antibody demonstrated that the V2 binding site was preconfigured for ED motif-mediated recognitionmore » prior to maturation. Thus, light chain usage for recognition of the site of immune pressure in the RV144 trial is highly conserved across species. In conclusion, these data indicate that the HIV-1 K169-recognizing ED motif has persisted over the diversification between rhesus macaques and humans, suggesting an evolutionary advantage of this antibody recognition mode.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiehe, Kevin; Easterhoff, David; Luo, Kan
In HIV-1, the ability to mount antibody responses to conserved, neutralizing epitopes is critical for protection. Here we have studied the light chain usage of human and rhesus macaque antibodies targeted to a dominant region of the HIV-1 envelope second variable (V2) region involving lysine (K) 169, the site of immune pressure in the RV144 vaccine efficacy trial. We found that humans and rhesus macaques used orthologous lambda variable gene segments encoding a glutamic acid-aspartic acid (ED) motif for K169 recognition. Structure determination of an unmutated ancestor antibody demonstrated that the V2 binding site was preconfigured for ED motif-mediated recognitionmore » prior to maturation. Thus, light chain usage for recognition of the site of immune pressure in the RV144 trial is highly conserved across species. In conclusion, these data indicate that the HIV-1 K169-recognizing ED motif has persisted over the diversification between rhesus macaques and humans, suggesting an evolutionary advantage of this antibody recognition mode.« less
HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin
Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago
2014-01-01
AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN
Alice, Alejandro F; Kramer, Gwen; Bambina, Shelly; Baird, Jason R; Bahjat, Keith S; Gough, Michael J; Crittenden, Marka R
2018-01-01
Although prophylactic vaccines provide protective humoral immunity against infectious agents, vaccines that elicit potent CD8 T cell responses are valuable tools to shape and drive cellular immunity against cancer and intracellular infection. In particular, IFN-γ-polarized cytotoxic CD8 T cell immunity is considered optimal for protective immunity against intracellular Ags. Suppressor of cytokine signaling (SOCS)1 is a cross-functional negative regulator of TLR and cytokine receptor signaling via degradation of the receptor-signaling complex. We hypothesized that loss of SOCS1 in dendritic cells (DCs) would improve T cell responses by accentuating IFN-γ-directed immune responses. We tested this hypothesis using a recombinant Listeria monocytogenes vaccine platform that targets CD11c + DCs in mice in which SOCS1 is selectively deleted in all CD11c + cells. Unexpectedly, in mice lacking SOCS1 expression in CD11c + cells, we observed a decrease in CD8 + T cell response to the L. monocytogenes vaccine. NK cell responses were also decreased in mice lacking SOCS1 expression in CD11c + cells but did not explain the defect in CD8 + T cell immunity. We found that DCs lacking SOCS1 expression were functional in driving Ag-specific CD8 + T cell expansion in vitro but that this process was defective following infection in vivo. Instead, monocyte-derived innate TNF-α and inducible NO synthase-producing DCs dominated the antibacterial response. Thus, loss of SOCS1 in CD11c + cells skewed the balance of immune response to infection by increasing innate responses while decreasing Ag-specific adaptive responses to infectious Ags. Copyright © 2017 by The American Association of Immunologists, Inc.
Simi, S; Peter, Valsa S; Peter, M C Subhash
2017-09-15
Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
Henrick, Bethany M.; Yao, Xiao-Dan; Nasser, Laila; Roozrogousheh, Ava; Rosenthal, Kenneth L.
2017-01-01
The majority of infants’ breastfeeding from their HIV-infected mothers do not acquire HIV-1 infection despite exposure to cell-free virus and cell-associated virus in HIV-infected breast milk. Paradoxically, exclusive breastfeeding regardless of the HIV status of the mother has led to a significant decrease in mother-to-child transmission (MTCT) compared with non-exclusive breastfeeding. Although it remains unclear how these HIV-exposed infants remain uninfected despite repeated and prolonged exposure to HIV-1, the low rate of transmission is suggestive of a multitude of protective, short-lived bioactive innate immune factors in breast milk. Indeed, recent studies of soluble factors in breast milk shed new light on mechanisms of neonatal HIV-1 protection. This review highlights the role and significance of innate immune factors in HIV-1 susceptibility and infection. Prevention of MTCT of HIV-1 is likely due to multiple factors, including innate immune factors such as lactoferrin and elafin among many others. In pursuing this field, our lab was the first to show that soluble toll-like receptor 2 (sTLR2) directly inhibits HIV infection, integration, and inflammation. More recently, we demonstrated that sTLR2 directly binds to selective HIV-1 proteins, including p17, gp41, and p24, leading to significantly reduced NFκB activation, interleukin-8 production, CCR5 expression, and HIV infection in a dose-dependent manner. Thus, a clearer understanding of soluble milk-derived innate factors with known antiviral functions may provide new therapeutic insights to reduce vertical HIV-1 transmission and will have important implications for protection against HIV-1 infection at other mucosal sites. Furthermore, innate bioactive factors identified in human milk may serve not only in protecting infants against infections and inflammation but also the elderly; thus, opening the door for novel innate immune therapeutics to protect newborns, infants, adults, and the elderly. PMID
Fulcher, Jennifer A; Romas, Laura; Hoffman, Jennifer C; Elliott, Julie; Saunders, Terry; Burgener, Adam D; Anton, Peter A; Yang, Otto O
2017-08-01
Risk of HIV acquisition varies, and some individuals are highly HIV-1-exposed, yet, persistently seronegative (HESN). The immunologic mechanisms contributing to this phenomenon are an area of intense interest. As immune activation and inflammation facilitate disease progression in HIV-1-infected persons and gastrointestinal-associated lymphoid tissue is a highly susceptible site for transmission, we hypothesized that reduced gut mucosal immune reactivity may contribute to reduced HIV-1 susceptibility in HESN men with a history of numerous rectal sexual exposures. To test this, we used ex vivo mucosal explants from freshly acquired colorectal biopsies from healthy control and HESN subjects who were stimulated with specific innate immune ligands and inactivated whole pathogens. Immune reactivity was then assessed via cytokine arrays and proteomic analysis. Mucosal immune cell compositions were quantified via immunohistochemistry. We found that explants from HESN subjects produced less proinflammatory cytokines compared with controls following innate immune stimulation; while noninflammatory cytokines were similar between groups. Proteomic analysis identified several immune response proteins to be differentially expressed between HIV-1-stimulated HESN and control explants. Immunohistochemical examination of colorectal mucosa showed similar amounts of T cells, macrophages, and dendritic cells between groups. The results of this pilot study suggest that mucosal innate immune reactivity is dampened in HESN versus control groups, despite presence of similar densities of immune cells in the colorectal mucosa. This observed modulation of the rectal mucosal immune response may contribute to lower risk of mucosal HIV-1 transmission in these individuals.
Dalod, Marc; Dupuis, Marion; Deschemin, Jean-Christophe; Sicard, Didier; Salmon, Dominique; Delfraissy, Jean-Francois; Venet, Alain; Sinet, Martine; Guillet, Jean-Gerard
1999-01-01
The ex vivo antiviral CD8+ repertoires of 34 human immunodeficiency virus (HIV)-seropositive patients with various CD4+ T-cell counts and virus loads were analyzed by gamma interferon enzyme-linked immunospot assay, using peptides derived from HIV type 1 and Epstein-Barr virus (EBV). Most patients recognized many HIV peptides, with markedly high frequencies, in association with all the HLA class I molecules tested. We found no correlation between the intensity of anti-HIV CD8+ responses and the CD4+ counts or virus load. In contrast, the polyclonality of anti-HIV CD8+ responses was positively correlated with the CD4+ counts. The anti-EBV responses were significantly less intense than the anti-HIV responses and were positively correlated with the CD4+ counts. Longitudinal follow-up of several patients revealed the remarkable stability of the anti-HIV and anti-EBV CD8+ responses in two patients with stable CD4+ counts, while both antiviral responses decreased in two patients with obvious progression toward disease. Last, highly active antiretroviral therapy induced marked decreases in the number of anti-HIV CD8+ T cells, while the anti-EBV responses increased. These findings emphasize the magnitude of the ex vivo HIV-specific CD8+ responses at all stages of HIV infection and suggest that the CD8+ hyperlymphocytosis commonly observed in HIV infection is driven mainly by virus replication, through intense, continuous activation of HIV-specific CD8+ T cells until ultimate progression toward disease. Nevertheless, highly polyclonal anti-HIV CD8+ responses may be associated with a better clinical status. Our data also suggest that a decrease of anti-EBV CD8+ responses may occur with depletion of CD4+ T cells, but this could be restored by highly active antiretroviral treatment. PMID:10438796
Churchill, Melissa J.; Cowley, Daniel J.; Wesselingh, Steve L.; Gorry, Paul R.; Gray, Lachlan R.
2014-01-01
Human immunodeficiency virus type-1 (HIV-1) invades the central nervous system (CNS) during acute infection which can result in HIV-associated neurocognitive disorders (HAND) in up to 50% of patients, even in the presence of combination antiretroviral therapy (cART). Within the CNS, productive HIV-1 infection occurs in the perivascular macrophages and microglia. Astrocytes also become infected, although their infection is restricted and does not give rise to new viral particles. The major barrier to the elimination of HIV-1 is the establishment of viral reservoirs in different anatomical sites throughout the body and viral persistence during long-term treatment with cART. While the predominant viral reservoir is believed to be resting CD4+ T-cells in the blood, other anatomical compartments including the CNS, gut-associated lymphoid tissue, bone marrow, and genital tract can also harbor persistently infected cellular reservoirs of HIV-1. Viral latency is predominantly responsible for HIV-1 persistence, and is most likely governed at the transcriptional level. Current clinical trials are testing transcriptional activators, in the background of cART, in an attempt to purge these viral reservoirs and reverse viral latency. These strategies aim to activate viral transcription in cells constituting the viral reservoir, so they can be recognized and cleared by the immune system, while new rounds of infection are blocked by co-administration of cART. The CNS has several unique characteristics that may result in differences in viral transcription and in the way latency is established. These include CNS-specific cell types, different transcription factors, altered immune surveillance, and reduced antiretroviral drug bioavailability. A comprehensive understanding of viral transcription and latency in the CNS is required in order to determine treatment outcomes when using transcriptional activators within the CNS. PMID:25060300
Klasse, P. J.; Ozorowski, Gabriel; Cupo, Albert; Pugach, Pavel; Ringe, Rajesh P.; Golabek, Michael; van Gils, Marit J.; Guttman, Miklos; Lee, Kelly K.; Wilson, Ian A.; Butera, Salvatore T.; Ward, Andrew B.; Montefiori, David C.; Sanders, Rogier W.; Moore, John P.
2016-01-01
We have investigated the immunogenicity in rabbits of native-like, soluble, recombinant SOSIP.664 trimers based on the env genes of four isolates of human immunodeficiency virus type 1 (HIV-1); specifically BG505 (clade A), B41 (clade B), CZA97 (clade C) and DU422 (clade C). The various trimers were delivered either simultaneously (as a mixture of clade A + B trimers) or sequentially over a 73-week period. Autologous, Tier-2 neutralizing antibody (NAb) responses were generated to the clade A and clade B trimers in the bivalent mixture. When delivered as boosting immunogens to rabbits immunized with the clade A and/or clade B trimers, the clade C trimers also generated autologous Tier-2 NAb responses, the CZA97 trimers doing so more strongly and consistently than the DU422 trimers. The clade C trimers also cross-boosted the pre-existing NAb responses to clade A and B trimers. We observed heterologous Tier-2 NAb responses albeit inconsistently, and with limited overall breath. However, cross-neutralization of the clade A BG505.T332N virus was consistently observed in rabbits immunized only with clade B trimers and then boosted with clade C trimers. The autologous NAbs induced by the BG505, B41 and CZA97 trimers predominantly recognized specific holes in the glycan shields of the cognate virus. The shared location of some of these holes may account for the observed cross-boosting effects and the heterologous neutralization of the BG505.T332N virus. These findings will guide the design of further experiments to determine whether and how multiple Env trimers can together induce more broadly neutralizing antibody responses. PMID:27627672
Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua
2016-07-01
This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gouvêa, Aída de Fátima Thomé Barbosa; Pinto, Maria Isabel de Moraes; Miyamoto, Maristela; Machado, Daisy Maria; Pessoa, Silvana Duarte; do Carmo, Fabiana Bononi; Beltrão, Suênia Cordeiro de Vasconcelos; Succi, Regina Célia de Menezes
2015-01-01
OBJECTIVE: To assess possible factors associated with the loss of antibodies to hepatitis A 7 years after the primary immunization in children of HIV-infected mothers and the response to revaccination in patients seronegative for hepatitis A. METHODS: Quantification of HAV antibodies by electrochemiluminescence was performed in 39 adolescents followed up at the Pediatric Aids Clinic of Federal University of São Paulo (Unifesp): 29 HIV-infected (HIV group) (median age: 12.8 years) and 10 HIV-exposed but non-infected (ENI group) (median age: 13.4 years). All of them received two doses of HAV vaccine (Havrix(r)) in 2002. RESULTS: The median age at primary immunization (PI) was 5.4 years for HIV group and 6.5 years for ENI group. All children, from both groups, had antibodies to HAV >20 mIU/mL after PI. Seven years later, the ENI group showed a median concentration of antibodies = 253.5 mIU/mL, while the HIV group = 113.0 mIU/mL (Mann-Whitney test, p=0.085). All ENI group and 23/29 (79.3%) from HIV group mantained HAV antibodies 7 years after PI. The levels of hepatitis A antibodies in the primary vaccination were the only factor independently associated with maintaining these antibodies for 7 years. The group that lost HAV seropositivity was revaccinated and 83.3% (5/6) responded with antibodies >20 mUI/mL. CONCLUSIONS: The antibodies levels acquired in the primary vaccination in the HIV group were the main factor associated with antibodies loss after HAV immunization. PMID:25918013
Winckelmann, Anni; Morcilla, Vincent; Shao, Wei; Schleimann, Mariane H; Højen, Jesper F; Schlub, Timothy E; Denton, Paul W; Østergaard, Lars; Søgaard, Ole S; Tolstrup, Martin; Palmer, Sarah
2018-05-11
Therapeutic HIV-1 immunization followed by latency reversal has been suggested as a strategy to eradicate HIV-1. Here we investigate the phylogenetic composition of the HIV-1 regions targeted by the therapeutic HIV-1 peptide vaccine Vacc-4x in participants in a clinical trial. Seventeen participants on suppressive antiretroviral therapy were vaccinated with six doses of Vacc-4x followed by three doses of romidepsin. Seven study participants were selected for sequencing analysis. All participants underwent an analytical treatment interruption. Single-genome/proviral sequencing of the p24-RT region was performed to genetically characterize proviral DNA, cell-associated (CA) RNA and outgrowth viruses during therapy as well as plasma HIV-1 RNA during an analytical treatment interruption. There were no changes in CA HIV-1 RNA (P = 0.83) and DNA (P = 0.09) diversity over the course of the study and no difference between CA HIV-1 RNA and DNA diversity (P = 0.32). Only one participant showed signs of potential vaccine-related selection in the rebounding plasma virus. In five of seven participants, we identified HLA-specific CTL epitopes containing non-silent mutations in 100% of the sequences. We detected no evidence of selective immune pressure reflected in proviral diversity or by occurrence of specific mutation in the vaccine-targeted epitopes. Pre-existing CTL epitope mutations may affect the potency of this therapeutic vaccine. This highlights the challenges of developing effective HIV-1 therapeutic vaccines.This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0.
HIV vaccine trial exploits a dual and central role for innate immunity.
Fuller, Deborah Heydenburg; Richert-Spuhler, Laura E; Klatt, Nichole R
2014-10-01
Limited understanding of correlates of protection from HIV transmission hinders development of an efficacious vaccine. D. J. M. Lewis and colleagues (J. Virol. 88:11648-11657, 2014, doi:10.1128/JVI.01621-14) now report that vaginal immunization with an HIVgp140 vaccine linked to the 70-kDa heat shock protein downregulated the human immunodeficiency virus (HIV) coreceptor CCR5 (chemokine [C-C motif] receptor 5) and increased expression of the HIV resistance factor APOBEC3G (apolipoprotein B mRNA-editing, enzyme-catalytic, polypeptide-like 3G), in women. These effects correlated with HIV suppression ex vivo. Thus, vaccine-induced innate responses not only facilitate adaptive immunity-they may prove to be critical for preventing HIV transmission. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Evolutionary genomics and HIV restriction factors.
Pyndiah, Nitisha; Telenti, Amalio; Rausell, Antonio
2015-03-01
To provide updated insights into innate antiviral immunity and highlight prototypical evolutionary features of well characterized HIV restriction factors. Recently, a new HIV restriction factor, Myxovirus resistance 2, has been discovered and the region/residue responsible for its activity identified using an evolutionary approach. Furthermore, IFI16, an innate immunity protein known to sense several viruses, has been shown to contribute to the defense to HIV-1 by causing cell death upon sensing HIV-1 DNA. Restriction factors against HIV show characteristic signatures of positive selection. Different patterns of accelerated sequence evolution can distinguish antiviral strategies--offense or defence--as well as the level of specificity of the antiviral properties. Sequence analysis of primate orthologs of restriction factors serves to localize functional domains and sites responsible for antiviral action. We use recent discoveries to illustrate how evolutionary genomic analyses help identify new antiviral genes and their mechanisms of action.
The role of polymorphonuclear neutrophils during HIV-1 infection.
Yaseen, Mahmoud Mohammad; Abuharfeil, Nizar Mohammad; Yaseen, Mohammad Mahmoud; Shabsoug, Barakat Mohammad
2018-01-01
It is well-recognized that human immunodeficiency virus type-1 (HIV-1) mainly targets CD4 + T cells and macrophages. Nonetheless, during the past three decades, a huge number of studies have reported that HIV-1 can directly or indirectly target other cellular components of the immune system including CD8 + T cells, B cells, dendritic cells, natural killer cells, and polymorphonuclear neutrophils (PMNs), among others. PMNs are the most abundant leukocytes in the human circulation, and are known to play principal roles in the elimination of invading pathogens, regulating different immune responses, healing of injured tissues, and maintaining mucosal homeostasis. Until recently, little was known about the impact of HIV-1 infection on PMNs as well as the impact of PMNs on HIV-1 disease progression. This is because early studies focused on neutropenia and recurrent microbial infections, particularly, during advanced disease. However, recent studies have extended the investigation area to cover new aspects of the interactions between HIV-1 and PMNs. This review aims to summarize these advances and address the impact of HIV-1 infection on PMNs as well as the impact of PMNs on HIV-1 disease progression to better understand the pathophysiology of HIV-1 infection.
2014-01-01
Background The MPER region of the HIV-1 envelope glycoprotein gp41 is targeted by broadly neutralizing antibodies. However, the localization of this epitope in a hydrophobic environment seems to hamper the elicitation of these antibodies in HIV infected individuals. We have quantified and characterized anti-MPER antibodies by ELISA and by flow cytometry using a collection of mini gp41-derived proteins expressed on the surface of 293T cells. Longitudinal plasma samples from 35 HIV-1 infected individuals were assayed for MPER recognition and MPER-dependent neutralizing capacity using HIV-2 viruses engrafted with HIV-1 MPER sequences. Results Miniproteins devoid of the cysteine loop of gp41 exposed the MPER on 293T cell membrane. Anti-MPER antibodies were identified in most individuals and were stable when analyzed in longitudinal samples. The magnitude of the responses was strongly correlated with the global response to the HIV-1 envelope glycoprotein, suggesting no specific limitation for anti-MPER antibodies. Peptide mapping showed poor recognition of the C-terminal MPER moiety and a wide presence of antibodies against the 2F5 epitope. However, antibody titers failed to correlate with 2F5-blocking activity and, more importantly, with the specific neutralization of HIV-2 chimeric viruses bearing the HIV-1 MPER sequence; suggesting a strong functional heterogeneity in anti-MPER humoral responses. Conclusions Anti-MPER antibodies can be detected in the vast majority of HIV-1 infected individuals and are generated in the context of the global anti-Env response. However, the neutralizing capacity is heterogeneous suggesting that eliciting neutralizing anti-MPER antibodies by immunization might require refinement of immunogens to skip nonneutralizing responses. PMID:24909946
DOE Office of Scientific and Technical Information (OSTI.GOV)
Honda, M.; Robinson, H.; Wang, R.
Prime-boost immunization with gene-based vectors has been developed to generate more effective vaccines for AIDS, malaria, and tuberculosis. Although these vectors elicit potent T cell responses, the mechanisms by which they stimulate immunity are not well understood. In this study, we show that immunization by a single gene product, HIV-1 envelope, with alternative vector combinations elicits CD8{sup +} cells with different fine specificities and kinetics of mobilization. Vaccine-induced CD8{sup +} T cells recognized overlapping third V region loop peptides. Unexpectedly, two anchor variants bound H-2D{sup d} better than the native sequences, and clones with distinct specificities were elicited by alternativemore » vectors. X-ray crystallography revealed major differences in solvent exposure of MHC-bound peptide epitopes, suggesting that processed HIV-1 envelope gave rise to MHC-I/peptide conformations recognized by distinct CD8{sup +} T cell populations. These findings suggest that different gene-based vectors generate peptides with alternative conformations within MHC-I that elicit distinct T cell responses after vaccination.« less
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
HIV-associated chronic immune activation
Paiardini, Mirko; Müller-Trutwin, Michaela
2013-01-01
Summary Systemic chronic immune activation is considered today as the driving force of CD4+ T-cell depletion and acquired immunodeficiency syndrome (AIDS). A residual chronic immune activation persists even in HIV-infected patients in which viral replication is successfully inhibited by antiretroviral therapy, with the extent of this residual immune activation being associated with CD4+ T-cell loss. Unfortunately, the causal link between chronic immune activation and CD4+ T-cell loss has not been formally established. This article provides first a brief historical overview on how the perception of the causative role of immune activation has changed over the years and lists the different kinds of immune activation that have been observed to be characteristic for human immunodeficiency virus (HIV) infection. The mechanisms proposed to explain the chronic immune activation are multiple and are enumerated here, as well as the mechanisms proposed on how chronic immune activation could lead to AIDS. In addition, we summarize the lessons learned from natural hosts that know how to ‘show AIDS the door’, and discuss how these studies informed the design of novel immune modulatory interventions that are currently being tested. Finally, we review the current approaches aimed at targeting chronic immune activation and evoke future perspectives. PMID:23772616
Fang, Y; Zhang, T; Lidell, L; Xu, X; Lycke, N; Xiang, Z
2013-11-01
We have previously reported that CTA1-DD/IgG immune complexes augment antibody responses in a mast cell-dependent manner following intranasal (IN) immunizations. However, from a safety perspective, mast cell activation could preclude clinical use. Therefore, we have extended these studies and demonstrate that CTA1-DD/IgG immune complexes administered IN did not trigger an anaphylactic reaction. Importantly, CTA1-DD/IgE immune complexes did not activate mast cells. Interestingly, only connective tissue, but not mucosal, mast cells could be activated by CTA1-DD/IgG immune complexes. This effect was mediated by FcγRIIIA, only expressed on connective tissue mast cells, and found in the nasal submucosa. FcγRIIIA-deficient mice had compromised responses to immunization adjuvanted by CTA1-DD/IgG. Proof-of-concept studies revealed that IN immunized mice with human papillomavirus (HPV) type 16 L1 virus-like particles (VLP) and CTA1-DD/IgG immune complexes demonstrated strong and sustained specific antibody titers in serum and vaginal secretions. From a mast cell perspective, CTA1-DD/IgG immune complexes appear to be safe and effective mucosal adjuvants.
Singh, Maneesh; Singh, Pratibha; Vaira, Dolores; Amand, Mathieu; Rahmouni, Souad; Moutschen, Michel
2014-01-01
More than a quarter of a century of research has established chronic immune activation and dysfunctional T cells as central features of chronic HIV infection and subsequent immunodeficiency. Consequently, the search for a new immunomodulatory therapy that could reduce immune activation and improve T-cell function has been increased. However, the lack of small animal models for in vivo HIV study has hampered progress. In the current study, we have investigated a model of cord blood haematopoietic progenitor cells (CB-HPCs) -transplanted humanized NOD/LtsZ-scidIL-2Rγnull mice in which progression of HIV infection is associated with widespread chronic immune activation and inflammation. Indeed, HIV infection in humanized NSG mice caused up-regulation of several T-cell immune activation markers such as CD38, HLA-DR, CD69 and co-receptor CCR5. T-cell exhaustion markers PD-1 and CTLA-4 were found to be significantly up-regulated on T cells. Moreover, increased plasmatic levels of lipopolysaccharide, sCD14 and interleukin-10 were also observed in infected mice. Treatment with minocycline resulted in a significant decrease of expression of cellular and plasma immune activation markers, inhibition of HIV replication and improved T-cell counts in HIV-infected humanized NSG mice. The study demonstrates that minocycline could be an effective, low-cost adjunctive treatment to regulate chronic immune activation and replication of HIV. PMID:24409837
Lee, Jin-A; Kim, Yun-Mi; Kim, Tae-Hoon; Lee, Sang-Ho; Lee, Cho-A; Cho, Cheong-Weon; Jeon, Jong-Woon; Park, Jin-Kyu; Kim, Sang-Ki; Jung, Bock-Gie; Lee, Bong-Joo
2016-10-01
Nasal delivery is a convenient and acceptable route for drug administration, and has been shown to elicit a much more potent local and systemic response compared with other drug delivery routes. We previously demonstrated that rectal administration of poly(lactide-co-glycolide)-encapsulated honeybee venom (P-HBV) could enhance systemic Th 1-specific immune responses. We therefore synthesized chitosan-coated P-HBV (CP-HBV) and then evaluated the immune-boosting efficacy of nasally administered CP-HBV on systemic and local intestinal immunity compared with non-chitosan-coated P-HBV. The nasally delivered CP-HBV effectively enhanced Th 1-specific responses, eliciting a significant increase in the CD3(+)CD4(+)CD8(-) Th cell population, lymphocyte proliferation capacity, and expression of Th 1 cytokines (IFN-γ, IL-12, and IL-2) in peripheral blood mononuclear cells. Furthermore, these immune-boosting effects persisted up to 21days post CP-HBV administration. Nasal administration of CP-HBV also led to an increase of not only the CD4(+) Th 1 and IFN-γ secreting CD4(+) Th 1 cell population but also Th 1-specific cytokines and transcription factors, including IL-12, IFN-γ, STAT4, and T-bet, in isolated mononuclear cells from the spleen and ileum. Copyright © 2016 Elsevier B.V. All rights reserved.
Emerging concepts on the role of innate immunity in the prevention and control of HIV infection.
Ackerman, Margaret E; Dugast, Anne-Sophie; Alter, Galit
2012-01-01
While neutralizing antibodies can provide sterilizing protection from HIV infection via their variable domains, the antibody constant domain provides a functional link between innate and adaptive immunity and offers a means to harness the potent antiviral properties of a wide spectrum of innate immune effector cells. There has been a growing appreciation of the role of these effector mechanisms across fields from cancer immunotherapy to autoimmunity and infectious disease, as well as speculation that this mechanism may be responsible for the protection observed in the RV144 HIV vaccine trial. This review summarizes these extraneutralizing humoral immune activities, progress in defining the importance of these effector mechanisms during progression in HIV infection, and the potential impact that such vaccine-induced immune responses may have on protection from infection.
Induction of Type 1 Immune Responses to SIV by IFN-Gamma
1997-06-01
of rhesus macaques vaccinated with recombinant vaccinia viruses ( rVVs). Five animals were vaccinated with 107 pfu of vHuy/SIVgen, a Wyeth rVV...predominance of SIVAnef viruses . There is strong evidence to support the critical role of the cell-mediated arm of the immune system in the control of HIV...manufacturers, and imnmunofluorescence was measured with a dual- laser flow cytometer (FACSCAN, Becton Dickinson). -9- Induction of Type I Inmune Responses
Alcohol and HIV Effects on the Immune System.
Bagby, Gregory J; Amedee, Angela M; Siggins, Robert W; Molina, Patricia E; Nelson, Steve; Veazey, Ronald S
2015-01-01
HIV disease and alcohol independently influence the human immune system, so it stands to reason that, together, their influence may be additive. Here, we review the evidence that alcohol can exacerbate HIV's influence on the immune system, thereby affecting disease progression and transmission. We focus particularly on alcohol's effect on the mucosal immune system in the tissues of the gastrointestinal tract, the genital tract and the lungs, all of which play a role in transmission and progression of HIV disease.
Clinical Control of HIV-1 by Cytotoxic T Cells Specific for Multiple Conserved Epitopes.
Murakoshi, Hayato; Akahoshi, Tomohiro; Koyanagi, Madoka; Chikata, Takayuki; Naruto, Takuya; Maruyama, Rie; Tamura, Yoshiko; Ishizuka, Naoki; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi
2015-05-01
Identification and characterization of CD8(+) T cells effectively controlling HIV-1 variants are necessary for the development of AIDS vaccines and for studies of AIDS pathogenesis, although such CD8(+) T cells have been only partially identified. In this study, we sought to identify CD8(+) T cells controlling HIV-1 variants in 401 Japanese individuals chronically infected with HIV-1 subtype B, in which protective alleles HLA-B*57 and HLA-B*27 are very rare, by using comprehensive and exhaustive methods. We identified 13 epitope-specific CD8(+) T cells controlling HIV-1 in Japanese individuals, though 9 of these epitopes were not previously reported. The breadths of the T cell responses to the 13 epitopes were inversely associated with plasma viral load (P = 2.2 × 10(-11)) and positively associated with CD4 count (P = 1.2 × 10(-11)), indicating strong synergistic effects of these T cells on HIV-1 control in vivo. Nine of these epitopes were conserved among HIV-1 subtype B-infected individuals, whereas three out of four nonconserved epitopes were cross-recognized by the specific T cells. These findings indicate that these 12 epitopes are strong candidates for antigens for an AIDS vaccine. The present study highlighted a strategy to identify CD8(+) T cells controlling HIV-1 and demonstrated effective control of HIV-1 by those specific for 12 conserved or cross-reactive epitopes. HLA-B*27-restricted and HLA-B*57-restricted cytotoxic T lymphocytes (CTLs) play a key role in controlling HIV-1 in Caucasians and Africans, whereas it is unclear which CTLs control HIV-1 in Asian countries, where HLA-B*57 and HLA-B*27 are very rare. A recent study showed that HLA-B*67:01 and HLA-B*52:01-C*12:02 haplotypes were protective alleles in Japanese individuals, but it is unknown whether CTLs restricted by these alleles control HIV-1. In this study, we identified 13 CTLs controlling HIV-1 in Japan by using comprehensive and exhaustive methods. They included 5 HLA-B*52:01-restricted
Clinical Control of HIV-1 by Cytotoxic T Cells Specific for Multiple Conserved Epitopes
Murakoshi, Hayato; Akahoshi, Tomohiro; Koyanagi, Madoka; Chikata, Takayuki; Naruto, Takuya; Maruyama, Rie; Tamura, Yoshiko; Ishizuka, Naoki; Gatanaga, Hiroyuki; Oka, Shinichi
2015-01-01
ABSTRACT Identification and characterization of CD8+ T cells effectively controlling HIV-1 variants are necessary for the development of AIDS vaccines and for studies of AIDS pathogenesis, although such CD8+ T cells have been only partially identified. In this study, we sought to identify CD8+ T cells controlling HIV-1 variants in 401 Japanese individuals chronically infected with HIV-1 subtype B, in which protective alleles HLA-B*57 and HLA-B*27 are very rare, by using comprehensive and exhaustive methods. We identified 13 epitope-specific CD8+ T cells controlling HIV-1 in Japanese individuals, though 9 of these epitopes were not previously reported. The breadths of the T cell responses to the 13 epitopes were inversely associated with plasma viral load (P = 2.2 × 10−11) and positively associated with CD4 count (P = 1.2 × 10−11), indicating strong synergistic effects of these T cells on HIV-1 control in vivo. Nine of these epitopes were conserved among HIV-1 subtype B-infected individuals, whereas three out of four nonconserved epitopes were cross-recognized by the specific T cells. These findings indicate that these 12 epitopes are strong candidates for antigens for an AIDS vaccine. The present study highlighted a strategy to identify CD8+ T cells controlling HIV-1 and demonstrated effective control of HIV-1 by those specific for 12 conserved or cross-reactive epitopes. IMPORTANCE HLA-B*27-restricted and HLA-B*57-restricted cytotoxic T lymphocytes (CTLs) play a key role in controlling HIV-1 in Caucasians and Africans, whereas it is unclear which CTLs control HIV-1 in Asian countries, where HLA-B*57 and HLA-B*27 are very rare. A recent study showed that HLA-B*67:01 and HLA-B*52:01-C*12:02 haplotypes were protective alleles in Japanese individuals, but it is unknown whether CTLs restricted by these alleles control HIV-1. In this study, we identified 13 CTLs controlling HIV-1 in Japan by using comprehensive and exhaustive methods. They included 5 HLA-B*52
Dissecting polyclonal vaccine-induced humoral immunity against HIV using Systems Serology
Chung, Amy W.; Kumar, Manu P.; Arnold, Kelly B.; Yu, Wen Han; Schoen, Matthew K.; Dunphy, Laura J.; Suscovich, Todd J.; Frahm, Nicole; Linde, Caitlyn; Mahan, Alison E.; Hoffner, Michelle; Streeck, Hendrik; Ackerman, Margaret E.; McElrath, M. Juliana; Schuitemaker, Hanneke; Pau, Maria G.; Baden, Lindsey R.; Kim, Jerome H.; Michael, Nelson L.; Barouch, Dan H.; Lauffenburger, Douglas A.; Alter, Galit
2017-01-01
While antibody titers and neutralization are considered the gold standard for the selection of successful vaccines, these parameters are often inadequate predictors of protective immunity. As antibodies mediate an array of extra-neutralizing Fc-functions, when neutralization fails to predict protection, investigating Fc-mediated activity may help identify immunological correlates and mechanism(s) of humoral protection. Here, we used an integrative approach termed Systems Serology to analyze relationships among humoral responses elicited in four HIV vaccine-trials. Each vaccine regimen induced a unique humoral “Fc-fingerprint”. Moreover, analysis of case:control data from the first moderately protective HIV vaccine trial, RV144, pointed to mechanistic insights into immune complex composition that may underlie protective immunity to HIV. Thus, multi-dimensional relational comparisons of vaccine humoral fingerprints offer a unique approach for the evaluation and design of novel vaccines against pathogens for which correlates of protection remain elusive. PMID:26544943
Buchbinder, Susan P.; Mehrotra, Devan V.; Duerr, Ann; Fitzgerald, Daniel W.; Mogg, Robin; Li, David; Gilbert, Peter B.; Lama, Javier R.; Marmor, Michael; Rio, Carlos del; McElrath, M. Juliana; Casimiro, Danilo R.; Gottesdiener, Keith M.; Chodakewitz, Jeffrey A.; Corey, Lawrence; Robertson, Michael N.
2009-01-01
Background Observational data and non-human primate challenge studies suggest that cell-mediated immune (CMI) responses may provide control of HIV replication. The Step Study is the first direct assessment of the efficacy of a CMI vaccine to protect against HIV infection or alter early plasma HIV levels in humans. Method HIV-seronegative participants (3000) were randomized (1:1) to receive 3 injections of MRKAd5 HIV-1 gag/pol/nef vaccine or placebo. Randomization was pre-stratified by gender, baseline adenovirus type 5 (Ad5) titer, and study site. Participants were tested ~every 6 months for HIV acquisition; early plasma HIV RNA was measured ~3 months post-HIV diagnosis. Findings The vaccine elicited IFN-γ ELISPOT responses in 75% of vaccinees. In a pre-specified interim analysis among participants with baseline Ad5 ≤200, 24 of 741 vaccinees became HIV infected, versus 21 of 762 placebo recipients. All but one infection occurred in men. The early geometric mean plasma HIV RNA was comparable in infected vaccine and placebo recipients. In exploratory multivariate analyses, HIV incidence was higher in vaccinees versus placebo recipients among Ad5 seropositive men (5.1% versus 2.2% per year, respectively) and uncircumcised men (5.2% versus 1.4% per year, respectively). HIV incidence was similar in vaccinees versus placebo recipients among Ad5 seronegative men and circumcised men. Interpretation This CMI vaccine did not prevent HIV infection or lower early viral level. Mechanisms for failure of the vaccine to protect and for the increased HIV infection rates in subgroups of vaccinees are being explored. Additional follow-up will determine if elevated HIV incidence in vaccinee subgroups persists. PMID:19012954
Sex-specific consequences of an induced immune response on reproduction in a moth.
Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T
2015-12-16
Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.
Specific immune response genes of new inbred strains of guinea pigs.
Chiba, J; Egashira, Y
1978-01-01
Distribution of specific immune-response (Ir) genes controlling responsiveness to synthetic polypeptide antigens, homopolymer of poly-L-lysine (PLL), copolymer of L-glutamic acid and L-alanine (GA) and copolymer of L-glutamic acid and L-tyrosine (GT), and limiting doses of 2,4-dinitrophenyl guinea pig serum albumin (DNP-GPA) was surveyed in new inbred strains of guinea pigs, JY 1, JY 2, JY 9 and JY 10, established in this Institute. The PLL gene was not found in any of the guinea pigs. The GA gene was found in JY 1 and JY 2 guinea pigs and the GT gene in all the guinea pigs. The gene controlling responsiveness to low doses (1 microgram) of DNP-GPA was found in JY 1, JY 9 and JY 10 guinea pigs. The associated (Ia) antigens was discussed.
Canonical and Non-Canonical Autophagy in HIV-1 Replication Cycle
Leymarie, Olivier; Lepont, Leslie; Berlioz-Torrent, Clarisse
2017-01-01
Autophagy is a lysosomal-dependent degradative process essential for maintaining cellular homeostasis, and is a key player in innate and adaptive immune responses to intracellular pathogens such as human immunodeficiency virus type 1 (HIV-1). In HIV-1 target cells, autophagy mechanisms can (i) selectively direct viral proteins and viruses for degradation; (ii) participate in the processing and presentation of viral-derived antigens through major histocompatibility complexes; and (iii) contribute to interferon production in response to HIV-1 infection. As a consequence, HIV-1 has evolved different strategies to finely regulate the autophagy pathway to favor its replication and dissemination. HIV-1 notably encodes accessory genes encoding Tat, Nef and Vpu proteins, which are able to perturb and hijack canonical and non-canonical autophagy mechanisms. This review outlines the current knowledge on the complex interplay between autophagy and HIV-1 replication cycle, providing an overview of the autophagy-mediated molecular processes deployed both by infected cells to combat the virus and by HIV-1 to evade antiviral response. PMID:28946621
Pfeifer, Caroline; Bunders, Madeleine J
2016-03-01
With the rapid roll-out of combination antiretroviral therapy to prevent mother-to-child transmission of HIV, there is an annual increase in the number of uninfected infants born to HIV-infected women. Although the introduction of combination antiretroviral therapy has vastly improved pregnancy outcome and the health of infants born to HIV-infected women, concerns remain regarding the impact the maternal HIV infection on the pregnancy outcome and the health of HIV-exposed uninfected infants. Maternal HIV infection is associated with negative pregnancy outcomes such as low birth weight. In addition, an increased susceptibility to infections is reported in HIV-exposed uninfected infants compared with infants born to uninfected women. Studies have shown that HIV-exposure affects the maternal/fetal unit, with increase of proinflammatory cytokine produced by placental cells, as well as altered infant immune responses. These changes could provide the underlying conditions for negative pregnancy outcomes and facilitate mother-to-child transmission of HIV in the infant. Further studies are required to understand the underlying mechanisms and investigate whether these altered infant immune responses persist and have clinical consequences beyond childhood. HIV infection in pregnant women is associated with altered immune responses in HIV-infected women and their offspring with clinical consequences for pregnancy outcome and the HIV-exposed uninfected infant. Further studies are required to address the origin and long-term consequences of prenatal HIV-exposure and subsequent immune activation for infant health.
Wines, Bruce D; Billings, Hugh; Mclean, Milla R; Kent, Stephen J; Hogarth, P Mark
2017-01-01
There is now intense interest in the role of HIV-specific antibodies and the engagement of FcγR functions in the control and prevention of HIV infection. The analyses of the RV144 vaccine trial, natural progression cohorts, and macaque models all point to a role for Fc-dependent effector functions, such as cytotoxicity (ADCC) or phagocytosis (ADCP), in the control of HIV. However, reliable assays that can be reproducibly used across different laboratories to measure Fcdependent functions, such as antibody dependent cellular cytotoxicity (ADCC) are limited. This brief review highlights the importance of Fc properties for immunity to HIV, particularly via FcγR diversity and function. We discuss assays used to study FcR mediated functions of HIV-specific Ab, including our recently developed novel cell-free ELISA using homo-dimeric FcγR ectodomains to detect functionally relevant viral antigen-specific antibodies. The binding of these dimeric FcγR ectodomains, to closely spaced pairs of IgG Fc, mimics the engagement and cross-linking of Fc receptors by IgG opsonized virions or infected cells as the essential prerequisite to the induction of Ab-dependent effector functions. The dimeric FcγR ELISA reliably correlates with ADCC in patient responses to influenza. The assay is amenable to high throughput and could be standardized across laboratories. We propose the assay has broader implications for the evaluation of the quality of antibody responses in viral infections and for the rapid evaluation of responses in vaccine development campaigns for HIV and other viral infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Wines, Bruce D.; Billings, Hugh; Mclean, Milla R.; Kent, Stephen J.; Hogarth, P. Mark
2017-01-01
Background: There is now intense interest in the role of HIV-specific antibodies and the engagement of FcγR functions in the control and prevention of HIV infection. The analyses of the RV144 vaccine trial, natural progression cohorts, and macaque models all point to a role for Fc-dependent effector functions, such as cytotoxicity (ADCC) or phagocytosis (ADCP), in the control of HIV. However, reliable assays that can be reproducibly used across different laboratories to measure Fc-dependent functions, such as antibody dependent cellular cytotoxicity (ADCC) are limited. Method: This brief review highlights the importance of Fc properties for immunity to HIV, particular-ly via FcγR diversity and function. We discuss assays used to study FcR mediated functions of HIV-specific Ab, including our recently developed novel cell-free ELISA using homo-dimeric FcγR ecto-domains to detect functionally relevant viral antigen-specific antibodies. Results: The binding of these dimeric FcγR ectodomains, to closely spaced pairs of IgG Fc, mimics the engagement and cross-linking of Fc receptors by IgG opsonized virions or infected cells as the es-sential prerequisite to the induction of Ab-dependent effector functions. The dimeric FcγR ELISA reli-ably correlates with ADCC in patient responses to influenza. The assay is amenable to high throughput and could be standardized across laboratories. Conclusion: We propose the assay has broader implications for the evaluation of the quality of anti-body responses in viral infections and for the rapid evaluation of responses in vaccine development campaigns for HIV and other viral infections. PMID:28322167
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B
2014-01-01
Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
M Honda; R Wang; W Kong
Prime-boost immunization with gene-based vectors has been developed to generate more effective vaccines for AIDS, malaria, and tuberculosis. Although these vectors elicit potent T cell responses, the mechanisms by which they stimulate immunity are not well understood. In this study, we show that immunization by a single gene product, HIV-1 envelope, with alternative vector combinations elicits CD8{sup +} cells with different fine specificities and kinetics of mobilization. Vaccine-induced CD8{sup +} T cells recognized overlapping third V region loop peptides. Unexpectedly, two anchor variants bound H-2D{sup d} better than the native sequences, and clones with distinct specificities were elicited by alternativemore » vectors. X-ray crystallography revealed major differences in solvent exposure of MHC-bound peptide epitopes, suggesting that processed HIV-1 envelope gave rise to MHC-I/peptide conformations recognized by distinct CD8{sup +} T cell populations. These findings suggest that different gene-based vectors generate peptides with alternative conformations within MHC-I that elicit distinct T cell responses after vaccination.« less
Mukherjee, P; Pathangey, L B; Bradley, J B; Tinder, T L; Basu, G D; Akporiaye, E T; Gendler, S J
2007-02-19
A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan-helper-peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-gamma-producing CD4(+) helper and CD8(+) cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced.
Chen, Shuai; Liu, Shuping; Zhang, Fengmei; Ren, Wenkai; Li, Nengzhang; Yin, Jie; Duan, Jielin; Peng, Yuanyi; Liu, Gang; Yin, Yulong; Wu, Guoyao
2014-10-01
Little is known about effects of dietary glutamine supplementation on specific and general defense responses in a vaccine-immunized animal model. Thus, this study determined roles for dietary glutamine supplementation in specific and general defense responses in mice immunized with inactivated Pasteurella multocida vaccine. The measured variables included: (1) the production of pathogen-specific antibodies; (2) mRNA levels for pro-inflammatory cytokines, toll-like receptors and anti-oxidative factors; and (3) the distribution of P. multocida in tissues and the expression of its major virulence factors in vivo. Dietary supplementation with 0.5 % glutamine had a better protective role than 1 or 2 % glutamine against P. multocida infection in vaccine-immunized mice, at least partly resulting from its effects in modulation of general defense responses. Dietary glutamine supplementation had little effects on the production of P. multocida-specific antibodies. Compared to the non-supplemented group, dietary supplementation with 0.5 % glutamine had no effect on bacterial burden in vivo but decreased the expression of major virulence factors in the spleen. Collectively, supplementing 0.5 % glutamine to a conventional diet provides benefits in vaccine-immunized mice by enhancing general defense responses and decreasing expression of specific virulence factors.
Loss of memory B cells impairs maintenance of long-term serologic memory during HIV-1 infection.
Titanji, Kehmia; De Milito, Angelo; Cagigi, Alberto; Thorstensson, Rigmor; Grützmeier, Sven; Atlas, Ann; Hejdeman, Bo; Kroon, Frank P; Lopalco, Lucia; Nilsson, Anna; Chiodi, Francesca
2006-09-01
Circulating memory B cells are severely reduced in the peripheral blood of HIV-1-infected patients. We investigated whether dysfunctional serologic memory to non-HIV antigens is related to disease progression by evaluating the frequency of memory B cells, plasma IgG, plasma levels of antibodies to measles, and Streptococcus pneumoniae, and enumerating measles-specific antibody-secreting cells in patients with primary, chronic, and long-term nonprogressive HIV-1 infection. We also evaluated the in vitro production of IgM and IgG antibodies against measles and S pneumoniae antigens following polyclonal activation of peripheral blood mononuclear cells (PBMCs) from patients. The percentage of memory B cells correlated with CD4+ T-cell counts in patients, thus representing a marker of disease progression. While patients with primary and chronic infection had severe defects in serologic memory, long-term nonprogressors had memory B-cell frequency and levels of antigen-specific antibodies comparable with controls. We also evaluated the effect of antiretroviral therapy on these serologic memory defects and found that antiretroviral therapy did not restore serologic memory in primary or in chronic infection. We suggest that HIV infection impairs maintenance of long-term serologic immunity to HIV-1-unrelated antigens and this defect is initiated early in infection. This may have important consequences for the response of HIV-infected patients to immunizations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caivano, Antonella; Doria-Rose, Nicole A.; Dept. of Molecular and Cell Biology, University of Washington, Seattle, WA 98124-6108
2010-11-25
We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibodies was biased towards IgG1, and the E2-primed CD4+ T cells did not secrete IFN{gamma}. Using transgenic mouse model systems, we demonstrated that CD8+ T cells primed with E2 particles were able to exert lytic activitymore » and produce IFN{gamma}. These results show that the E2 scaffold represents a powerful vaccine delivery system for whole antigenic proteins or polyepitope engineered proteins, evoking antibody production and antigen specific CTL activity even in the absence of IFN{gamma}-producing CD4+ T cells.« less
Stochastic modeling for dynamics of HIV-1 infection using cellular automata: A review.
Precharattana, Monamorn
2016-02-01
Recently, the description of immune response by discrete models has emerged to play an important role to study the problems in the area of human immunodeficiency virus type 1 (HIV-1) infection, leading to AIDS. As infection of target immune cells by HIV-1 mainly takes place in the lymphoid tissue, cellular automata (CA) models thus represent a significant step in understanding when the infected population is dispersed. Motivated by these, the studies of the dynamics of HIV-1 infection using CA in memory have been presented to recognize how CA have been developed for HIV-1 dynamics, which issues have been studied already and which issues still are objectives in future studies.
Uncommon Pathways of Immune Escape Attenuate HIV-1 Integrase Replication Capacity
Chopera, Denis R.; Olvera, Alex; Brumme, Chanson J.; Sela, Jennifer; Markle, Tristan J.; Martin, Eric; Carlson, Jonathan M.; Le, Anh Q.; McGovern, Rachel; Cheung, Peter K.; Kelleher, Anthony D.; Jessen, Heiko; Markowitz, Martin; Rosenberg, Eric; Frahm, Nicole; Sanchez, Jorge; Mallal, Simon; John, Mina; Harrigan, P. Richard; Heckerman, David; Brander, Christian; Walker, Bruce D.; Brumme, Zabrina L.
2012-01-01
An attenuation of the HIV-1 replication capacity (RC) has been observed for immune-mediated escape mutations in Gag restricted by protective HLA alleles. However, the extent to which escape mutations affect other viral proteins during natural infection is not well understood. We generated recombinant viruses encoding plasma HIV-1 RNA integrase sequences from antiretroviral-naïve individuals with early (n = 88) and chronic (n = 304) infections and measured the in vitro RC of each. In contrast to data from previous studies of Gag, we observed little evidence that host HLA allele expression was associated with integrase RC. A modest negative correlation was observed between the number of HLA-B-associated integrase polymorphisms and RC in chronic infection (R = −0.2; P = 0.003); however, this effect was not driven by mutations restricted by protective HLA alleles. Notably, the integrase variants S119R, G163E, and I220L, which represent uncommon polymorphisms associated with HLA-C*05, -A*33, and -B*52, respectively, correlated with lower RC (all q < 0.2). We identified a novel C*05-restricted epitope (HTDNGSNF114–121) that likely contributes to the selection of the S119R variant, the polymorphism most significantly associated with lower RC in patient sequences. An NL4-3 mutant encoding the S119R polymorphism displayed a ∼35%-reduced function that was rescued by a single compensatory mutation of A91E. Together, these data indicate that substantial HLA-driven attenuation of integrase is not a general phenomenon during HIV-1 adaptation to host immunity. However, uncommon polymorphisms selected by HLA alleles that are not conventionally regarded to be protective may be associated with impaired protein function. Vulnerable epitopes in integrase might therefore be considered for future vaccine strategies. PMID:22496233
Uncommon pathways of immune escape attenuate HIV-1 integrase replication capacity.
Brockman, Mark A; Chopera, Denis R; Olvera, Alex; Brumme, Chanson J; Sela, Jennifer; Markle, Tristan J; Martin, Eric; Carlson, Jonathan M; Le, Anh Q; McGovern, Rachel; Cheung, Peter K; Kelleher, Anthony D; Jessen, Heiko; Markowitz, Martin; Rosenberg, Eric; Frahm, Nicole; Sanchez, Jorge; Mallal, Simon; John, Mina; Harrigan, P Richard; Heckerman, David; Brander, Christian; Walker, Bruce D; Brumme, Zabrina L
2012-06-01
An attenuation of the HIV-1 replication capacity (RC) has been observed for immune-mediated escape mutations in Gag restricted by protective HLA alleles. However, the extent to which escape mutations affect other viral proteins during natural infection is not well understood. We generated recombinant viruses encoding plasma HIV-1 RNA integrase sequences from antiretroviral-naïve individuals with early (n = 88) and chronic (n = 304) infections and measured the in vitro RC of each. In contrast to data from previous studies of Gag, we observed little evidence that host HLA allele expression was associated with integrase RC. A modest negative correlation was observed between the number of HLA-B-associated integrase polymorphisms and RC in chronic infection (R = -0.2; P = 0.003); however, this effect was not driven by mutations restricted by protective HLA alleles. Notably, the integrase variants S119R, G163E, and I220L, which represent uncommon polymorphisms associated with HLA-C*05, -A*33, and -B*52, respectively, correlated with lower RC (all q < 0.2). We identified a novel C*05-restricted epitope (HTDNGSNF(114-121)) that likely contributes to the selection of the S119R variant, the polymorphism most significantly associated with lower RC in patient sequences. An NL4-3 mutant encoding the S119R polymorphism displayed a ~35%-reduced function that was rescued by a single compensatory mutation of A91E. Together, these data indicate that substantial HLA-driven attenuation of integrase is not a general phenomenon during HIV-1 adaptation to host immunity. However, uncommon polymorphisms selected by HLA alleles that are not conventionally regarded to be protective may be associated with impaired protein function. Vulnerable epitopes in integrase might therefore be considered for future vaccine strategies.
Munseri, Patricia J; Kroidl, Arne; Nilsson, Charlotta; Joachim, Agricola; Geldmacher, Christof; Mann, Philipp; Moshiro, Candida; Aboud, Said; Lyamuya, Eligius; Maboko, Leonard; Missanga, Marco; Kaluwa, Bahati; Mfinanga, Sayoki; Podola, Lilly; Bauer, Asli; Godoy-Ramirez, Karina; Marovich, Mary; Moss, Bernard; Hoelscher, Michael; Gotch, Frances; Stöhr, Wolfgang; Stout, Richard; McCormack, Sheena; Wahren, Britta; Mhalu, Fred; Robb, Merlin L; Biberfeld, Gunnel; Sandström, Eric; Bakari, Muhammad
2015-01-01
Intradermal priming with HIV-1 DNA plasmids followed by HIV-1MVA boosting induces strong and broad cellular and humoral immune responses. In our previous HIVIS-03 trial, we used 5 injections with 2 pools of HIV-DNA at separate sites for each priming immunization. The present study explores whether HIV-DNA priming can be simplified by reducing the number of DNA injections and administration of combined versus separated plasmid pools. In this phase IIa, randomized trial, priming was performed using 5 injections of HIV-DNA, 1000 μg total dose, (3 Env and 2 Gag encoding plasmids) compared to two "simplified" regimens of 2 injections of HIV-DNA, 600 μg total dose, of Env- and Gag-encoding plasmid pools with each pool either administered separately or combined. HIV-DNA immunizations were given intradermally at weeks 0, 4, and 12. Boosting was performed intramuscularly with 108 pfu HIV-MVA at weeks 30 and 46. 129 healthy Tanzanian participants were enrolled. There were no differences in adverse events between the groups. The proportion of IFN-γ ELISpot responders to Gag and/or Env peptides after the second HIV-MVA boost did not differ significantly between the groups primed with 2 injections of combined HIV-DNA pools, 2 injections with separated pools, and 5 injections with separated pools (90%, 97% and 97%). There were no significant differences in the magnitude of Gag and/or Env IFN-γ ELISpot responses, in CD4+ and CD8+ T cell responses measured as IFN-γ/IL-2 production by intracellular cytokine staining (ICS) or in response rates and median titers for binding antibodies to Env gp160 between study groups. A simplified intradermal vaccination regimen with 2 injections of a total of 600 μg with combined HIV-DNA plasmids primed cellular responses as efficiently as the standard regimen of 5 injections of a total of 1000 μg with separated plasmid pools after boosting twice with HIV-MVA. World Health Organization International Clinical Trials Registry Platform PACTR
Antigen specific suppression of humoral immunity by anergic Ars/A1 B cells1
Aviszus, Katja; MacLeod, Megan K.L.; Kirchenbaum, Greg A.; Detanico, Thiago O.; Heiser, Ryan A.; St. Clair, James B.; Guo, Wenzhong; Wysocki, Lawrence J.
2012-01-01
Autoreactive anergic B lymphocytes are considered to be dangerous because of their potential for activation and recruitment into autoimmune responses. Yet they persist for days and constitute ~5% of the B cell pool. We assessed their functional potential in the Ars/A1 transgene model, where anergic B cells express a dual-reactive antigen receptor that binds, in addition to a self-antigen, the hapten p-azophenylarsonate (Ars). When Ars/A1 B cells were transferred into adoptive recipients that were immunized with foreign proteins covalently conjugated with Ars, endogenous IgG immune responses to both were selectively and severely diminished, and the development of T helper cells was impaired. Approximately 95% inhibition of the anti-Ars response was attained with ~4000 transferred Ars/A1 B cells through redundant mechanisms, one of which depended upon their expression of MHC II but not upon secretion of IL-10 or IgM. This antigen-specific suppressive activity implicates the autoreactive anergic B cell as an enforcer of immunological tolerance to self-antigens. PMID:23008448
Mooij, Petra; Balla-Jhagjhoorsingh, Sunita S; Koopman, Gerrit; Beenhakker, Niels; van Haaften, Patricia; Baak, Ilona; Nieuwenhuis, Ivonne G; Kondova, Ivanela; Wagner, Ralf; Wolf, Hans; Gómez, Carmen E; Nájera, José L; Jiménez, Victoria; Esteban, Mariano; Heeney, Jonathan L
2008-03-01
Poxvirus vectors have proven to be highly effective for boosting immune responses in diverse vaccine settings. Recent reports reveal marked differences in the gene expression of human dendritic cells infected with two leading poxvirus-based human immunodeficiency virus (HIV) vaccine candidates, New York vaccinia virus (NYVAC) and modified vaccinia virus Ankara (MVA). To understand how complex genomic changes in these two vaccine vectors translate into antigen-specific systemic immune responses, we undertook a head-to-head vaccine immunogenicity and efficacy study in the pathogenic HIV type 1 (HIV-1) model of AIDS in Indian rhesus macaques. Differences in the immune responses in outbred animals were not distinguished by enzyme-linked immunospot assays, but differences were distinguished by multiparameter fluorescence-activated cell sorter analysis, revealing a difference between the number of animals with both CD4(+) and CD8(+) T-cell responses to vaccine inserts (MVA) and those that elicit a dominant CD4(+) T-cell response (NYVAC). Remarkably, vector-induced differences in CD4(+)/CD8(+) T-cell immune responses persisted for more than a year after challenge and even accompanied antigenic modulation throughout the control of chronic infection. Importantly, strong preexposure HIV-1/simian immunodeficiency virus-specific CD4(+) T-cell responses did not prove deleterious with respect to accelerated disease progression. In contrast, in this setting, animals with strong vaccine-induced polyfunctional CD4(+) T-cell responses showed efficacies similar to those with stronger CD8(+) T-cell responses.
Graham, Barney S.; McElrath, M. Juliana; Keefer, Michael C.; Rybczyk, Kyle; Berger, David; Weinhold, Kent J.; Ottinger, Janet; Ferarri, Guido; Montefiori, David C.; Stablein, Don; Smith, Carol; Eldridge, John; Duerr, Ann; Fast, Pat; Haynes, Barton F.
2010-01-01
Background A peptide vaccine was produced containing B and T cell epitopes from the V3 and C4 Envelope domains of 4 subtype B HIV-1 isolates (MN, RF, CanO, & Ev91). The peptide mixture was formulated as an emulsion in incomplete Freund's adjuvant (IFA). Methods Low-risk, healthy adult subjects were enrolled in a randomized, placebo-controlled dose-escalation study, and selected using criteria specifying that 50% in each study group would be HLA-B7+. Immunizations were scheduled at 0, 1, and 6 months using a total peptide dose of 1 or 4 mg. Adaptive immune responses in16 vaccine recipients and two placebo recipients after the 2nd immunization were evaluated using neutralization assays of sera, as well as ELISpot and ICS assays of cryopreserved PBMCs to assess CD4 and CD8 T-cell responses. In addition, 51Cr release assays were performed on fresh PBMCs following 14-day stimulation with individual vaccine peptide antigens. Results 24 subjects were enrolled; 18 completed 2 injections. The study was prematurely terminated because 4 vaccinees developed prolonged pain and sterile abscess formation at the injection site-2 after dose 1, and 2 after dose 2. Two other subjects experienced severe systemic reactions consisting of headache, chills, nausea, and myalgia. Both reactions occurred after the second 4 mg dose. The immunogenicity assessments showed that 6/8 vaccinees at each dose level had detectable MN-specific neutralizing (NT) activity, and 2/7 HLA-B7+ vaccinees had classical CD8 CTL activity detected. However, using both ELISpot and ICS, 8/16 vaccinees (5/7 HLA-B7+) and 0/2 controls had detectable vaccine-specific CD8 T-cell responses. Subjects with moderate or severe systemic or local reactions tended to have more frequent T cell responses and higher antibody responses than those with mild or no reactions. Conclusions The severity of local responses related to the formulation of these four peptides in IFA is clinically unacceptable for continued development. Both
Harro, Clayton D; Robertson, Michael N; Lally, Michelle A; O'Neill, Lori D; Edupuganti, Srilatha; Goepfert, Paul A; Mulligan, Mark J; Priddy, Frances H; Dubey, Sheri A; Kierstead, Lisa S; Sun, Xiao; Casimiro, Danilo R; DiNubile, Mark J; Shiver, John W; Leavitt, Randi Y; Mehrotra, Devan V
2009-01-01
Vaccines inducing pathogen-specific cell-mediated immunity are being developed using attenuated adenoviral (Ad) vectors. We report the results of two independent Phase I trials of similar replication-deficient Ad5 vaccines containing a near-consensus HIV-1 clade B gag transgene. Healthy HIV-uninfected adults were enrolled in two separate, multicenter, dose-escalating, blinded, placebo-controlled studies to assess the safety and immunogenicity of a three-dose homologous regimen of Ad5 and MRKAd5 HIV-1 gag vaccines given on day 1, week 4, and week 26. Adverse events were collected for 29 days following each intradeltoid injection. The primary immunogenicity endpoint was the proportion of subjects with a positive unfractionated Gag-specific IFN-gamma ELISPOT response measured 4 weeks after the last dose (week 30). Analyses were performed after combining data for each dose group from both protocols, stratifying by baseline Ad5 titers. Overall, 252 subjects were randomized to receive either vaccine or placebo, including 229 subjects (91%) who completed the study through week 30. Tolerability and immunogenicity did not appear to differ between the Ad5 and MRKAd5 vaccines. The frequency of injection-site reactions was dose dependent. Systemic adverse events were also dose dependent and more frequent in subjects with baseline Ad5 titers <200 versus > or =200, especially after the first dose. The percent of ELISPOT responders and the ELISPOT geometric means overall were significantly higher for all four vaccine doses studied compared to placebo, and were generally higher in vaccine recipients with baseline Ad5 titers <200 versus > or = 200. Ad5 titers increased after vaccination in a dose-dependent fashion. Both Ad5-vectored HIV-1 vaccines were generally well tolerated and induced cell-mediated immune responses against HIV Gag-peptides in the majority of healthy adults with baseline Ad5 titers <200. Preexistent and/or vaccine-induced immunity to the Ad5 vector may dampen
Robertson, Michael N.; Lally, Michelle A.; O'Neill, Lori D.; Edupuganti, Srilatha; Goepfert, Paul A.; Mulligan, Mark J.; Priddy, Frances H.; Dubey, Sheri A.; Kierstead, Lisa S.; Sun, Xiao; Casimiro, Danilo R.; DiNubile, Mark J.; Shiver, John W.; Leavitt, Randi Y.; Mehrotra, Devan V.
2009-01-01
Abstract Vaccines inducing pathogen-specific cell-mediated immunity are being developed using attenuated adenoviral (Ad) vectors. We report the results of two independent Phase I trials of similar replication-deficient Ad5 vaccines containing a near-consensus HIV-1 clade B gag transgene. Healthy HIV-uninfected adults were enrolled in two separate, multicenter, dose-escalating, blinded, placebo-controlled studies to assess the safety and immunogenicity of a three-dose homologous regimen of Ad5 and MRKAd5 HIV-1 gag vaccines given on day 1, week 4, and week 26. Adverse events were collected for 29 days following each intradeltoid injection. The primary immunogenicity endpoint was the proportion of subjects with a positive unfractionated Gag-specific IFN-γ ELISPOT response measured 4 weeks after the last dose (week 30). Analyses were performed after combining data for each dose group from both protocols, stratifying by baseline Ad5 titers. Overall, 252 subjects were randomized to receive either vaccine or placebo, including 229 subjects (91%) who completed the study through week 30. Tolerability and immunogenicity did not appear to differ between the Ad5 and MRKAd5 vaccines. The frequency of injection-site reactions was dose dependent. Systemic adverse events were also dose dependent and more frequent in subjects with baseline Ad5 titers <200 versus ≥200, especially after the first dose. The percent of ELISPOT responders and the ELISPOT geometric means overall were significantly higher for all four vaccine doses studied compared to placebo, and were generally higher in vaccine recipients with baseline Ad5 titers <200 versus ≥200. Ad5 titers increased after vaccination in a dose-dependent fashion. Both Ad5-vectored HIV-1 vaccines were generally well tolerated and induced cell-mediated immune responses against HIV Gag-peptides in the majority of healthy adults with baseline Ad5 titers <200. Preexistent and/or vaccine-induced immunity to the Ad5 vector may dampen the
Weak anti-HIV CD8+ T-cell effector activity in HIV primary infection
Dalod, Marc; Dupuis, Marion; Deschemin, Jean-Christophe; Goujard, Cécile; Deveau, Christiane; Meyer, Laurence; Ngo, Nicole; Rouzioux, Christine; Guillet, Jean-Gérard; Delfraissy, Jean-François; Sinet, Martine; Venet, Alain
1999-01-01
HIV-specific CD8+ T cells play a major role in the control of virus during HIV primary infection (PI) but do not completely prevent viral replication. We used IFN-γ enzyme-linked immunospot assay and intracellular staining to characterize the ex vivo CD8+ T-cell responses to a large variety of HIV epitopic peptides in 24 subjects with early HIV PI. We observed HIV-specific responses in 71% of subjects. Gag and Nef peptides were more frequently recognized than Env and Pol peptides. The number of peptides recognized was low (median 2, range 0–6). In contrast, a much broader response was observed in 30 asymptomatic subjects with chronic infection: all were responders with a median of 5 peptides recognized (range 1–13). The frequency of HIV-specific CD8+ T cells among PBMC for a given peptide was of the same order of magnitude in both groups. The proportion of HIV-specific CD8+CD28– terminally differentiated T cells was much lower in PI than at the chronic stage of infection. The weakness of the immune response during HIV PI could partially account for the failure to control HIV. These findings have potential importance for defining immunotherapeutic strategies and establishing the goals for effective vaccination. J. Clin. Invest. 104:1431–1439 (1999). PMID:10562305
Oral innate immunity in HIV infection in HAART era.
Nittayananta, Wipawee; Tao, Renchuan; Jiang, Lanlan; Peng, Yuanyuan; Huang, Yuxiao
2016-01-01
Oral innate immunity, an important component in host defense and immune surveillance in the oral cavity, plays a crucial role in the regulation of oral health. As part of the innate immune system, epithelial cells lining oral mucosal surfaces not only provide a physical barrier but also produce different antimicrobial peptides, including human β-defensins (hBDs), secretory leukocyte protease inhibitor (SLPI), and various cytokines. These innate immune mediators help in maintaining oral homeostasis. When they are impaired either by local or systemic causes, various oral infections and malignancies may be developed. Human immunodeficiency virus (HIV) infection and other co-infections appear to have both direct and indirect effects on systemic and local innate immunity leading to the development of oral opportunistic infections and malignancies. Highly active antiretroviral therapy (HAART), the standard treatment of HIV infection, contributed to a global reduction of HIV-associated oral lesions. However, prolonged use of HAART may lead to adverse effects on the oral innate immunity resulting in the relapse of oral lesions. This review article focused on the roles of oral innate immunity in HIV infection in HAART era. The following five key questions were addressed: (i) What are the roles of oral innate immunity in health and disease?, (ii) What are the effects of HIV infection on oral innate immunity?, (iii) What are the roles of oral innate immunity against other co-infections?, (iv) What are the effects of HAART on oral innate immunity?, and (v) Is oral innate immunity enhanced by HAART? © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan
2017-08-03
One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.
Baden, Lindsey R; Karita, Etienne; Mutua, Gaudensia; Bekker, Linda-Gail; Gray, Glenda; Page-Shipp, Liesl; Walsh, Stephen R; Nyombayire, Julien; Anzala, Omu; Roux, Surita; Laher, Fatima; Innes, Craig; Seaman, Michael S; Cohen, Yehuda Z; Peter, Lauren; Frahm, Nicole; McElrath, M Juliana; Hayes, Peter; Swann, Edith; Grunenberg, Nicole; Grazia-Pau, Maria; Weijtens, Mo; Sadoff, Jerry; Dally, Len; Lombardo, Angela; Gilmour, Jill; Cox, Josephine; Dolin, Raphael; Fast, Patricia; Barouch, Dan H; Laufer, Dagna S
2016-03-01
A prophylactic HIV-1 vaccine is a global health priority. To assess a novel vaccine platform as a prophylactic HIV-1 regimen. Randomized, double-blind, placebo-controlled trial. Both participants and study personnel were blinded to treatment allocation. (ClinicalTrials.gov: NCT01215149). United States, East Africa, and South Africa. Healthy adults without HIV infection. 2 HIV-1 vaccines (adenovirus serotype 26 with an HIV-1 envelope A insert [Ad26.EnvA] and adenovirus serotype 35 with an HIV-1 envelope A insert [Ad35.Env], both administered at a dose of 5 × 1010 viral particles) in homologous and heterologous combinations. Safety and immunogenicity and the effect of baseline vector immunity. 217 participants received at least 1 vaccination, and 210 (>96%) completed follow-up. No vaccine-associated serious adverse events occurred. All regimens were generally well-tolerated. All regimens elicited humoral and cellular immune responses in nearly all participants. Preexisting Ad26- or Ad35-neutralizing antibody titers had no effect on vaccine safety and little effect on immunogenicity. In both homologous and heterologous regimens, the second vaccination significantly increased EnvA antibody titers (approximately 20-fold from the median enzyme-linked immunosorbent assay titers of 30-300 to 3000). The heterologous regimen of Ad26-Ad35 elicited significantly higher EnvA antibody titers than Ad35-Ad26. T-cell responses were modest and lower in East Africa than in South Africa and the United States. Because the 2 envelope inserts were not identical, the boosting responses were complex to interpret. Durability of the immune responses elicited beyond 1 year is unknown. Both vaccines elicited significant immune responses in all populations. Baseline vector immunity did not significantly affect responses. Second vaccinations in all regimens significantly boosted EnvA antibody titers, although vaccine order in the heterologous regimen had a modest effect on the immune response
Mukherjee, P.; Pathangey, L.B.; Bradley, J.B.; Tinder, T.L.; Basu, G.D.; Akporiaye, E.T.; Gendler, S.J.
2007-01-01
A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan helper peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-γ-producing CD4+ helper and CD8+ cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced. PMID:17166639
Innate immunity in resistance to HIV infection.
Biasin, Mara; Clerici, Mario; Piacentini, Luca
2010-11-01
Resistance to human immunodeficiency virus (HIV) infection in subjects who do not seroconvert despite multiple exposures to the virus and to the progression to AIDS in HIV‐infected individuals depends on multiple factors involving both the innate and the adaptive immune system. The contribution of natural immunity in preventing HIV infection has so far received little attention, but many recently published articles suggest a key role for Toll‐like receptors, natural killer cells, interleukin‐22, acute‐phase amyloid A protein, and APOBEC3G in conferring resistance to HIV infection. The study of these factors will shed light on HIV pathogenesis and contribute to the development of new therapeutic approaches to this elusive disease.
Gelinck, Luc B S; Jol-van der Zijde, Cornelia M; Jansen-Hoogendijk, Anja M; Brinkman, Daniëlle M C; van Dissel, Jaap T; van Tol, Maarten J D; Kroon, Frank P
2009-11-27
Rabies vaccine was used as a T-cell-dependent neoantigen to investigate several aspects of the primary and booster immune response in vivo in HIV-infected individuals receiving antiretroviral treatment. Study participants received rabies vaccination twice, within a 3-month interval. Serum samples were taken before and 1, 2 and 4 weeks after both vaccinations and 1 and 5 years after the primary vaccination. Antirabies antibodies [immunoglobulin G (IgG), IgG subclasses, immunoglobulin A (IgA) and immunoglobulin M (IgM)] were determined; antibody avidity was measured after both vaccinations. T-cell subsets were characterized by flow cytometry. Eighteen healthy controls and 30 HIV-infected adults, treated with HAART for almost 4 years, with a median CD4(+) T-cell count of 537 cells/microl, were immunized. The postvaccination concentrations of antirabies IgG and IgM were significantly lower in HIV-infected individuals as compared with controls. Three T-cell-dependent processes, a true booster response, a class switch from IgM to IgG and avidity maturation were present in both healthy controls and HIV-infected individuals. Higher age was associated with lower postvaccination antirabies IgG and IgM titers. Five years after the primary vaccination, 63% of the HIV-infected individuals still had antibody titers above the protection threshold. Immune restoration in HIV-infected individuals treated with HAART, resulting in a CD4(+) T-cell count greater than 500 cells/microl, is incomplete. However, the majority of HIV-infected individuals are capable of mounting a long-lasting immune response, including several pivotal T-cell-dependent processes, upon vaccination with a neoantigen such as the rabies vaccine.
Virus-Like Particle, Liposome, and Polymeric Particle-Based Vaccines against HIV-1
Gao, Yong; Wijewardhana, Chanuka; Mann, Jamie F. S.
2018-01-01
It is acknowledged that vaccines remain the best hope for eliminating the HIV-1 epidemic. However, the failure to produce effective vaccine immunogens and the inability of conventional delivery strategies to elicit the desired immune responses remains a central theme and has ultimately led to a significant roadblock in HIV vaccine development. Consequently, significant efforts have been applied to generate novel vaccine antigens and delivery agents, which mimic viral structures for optimal immune induction. Here, we review the latest developments that have occurred in the nanoparticle vaccine field, with special emphasis on strategies that are being utilized to attain highly immunogenic, systemic, and mucosal anti-HIV humoral and cellular immune responses. This includes the design of novel immunogens, the central role of antigen-presenting cells, delivery routes, and biodistribution of nanoparticles to lymph nodes. In particular, we will focus on virus-like-particle formulations and their preclinical uses within the HIV prophylactic vaccine setting. PMID:29541072
Lindh, Ingrid; Bråve, Andreas; Hallengärd, David; Hadad, Ronza; Kalbina, Irina; Strid, Åke; Andersson, Sören
2014-04-25
During early infection with human immunodeficiency virus type 1 (HIV-1), there is a rapid depletion of CD4(+) T-cells in the gut-associated lymphoid tissue (GALT) in the gastrointestinal tract. Therefore, immediate protection at these surfaces is of high priority for the development of an HIV-1 vaccine. Thus, transgenic plants expressing HIV-1 antigens, which are exposed to immune competent cells in the GALT during oral administration, can be interesting as potential vaccine candidates. In the present study, we used two HIV-1 p24 antigen-expressing transgenic plant systems, Arabidopsis thaliana and Daucus carota, in oral immunization experiments. Both transgenic plant systems showed a priming effect in mice and induced humoral immune responses, which could be detected as anti-p24-specific IgG in sera after an intramuscular p24 protein boost. Dose-dependent antigen analyses using transgenic A. thaliana indicated that low p24 antigen doses were superior to high p24 antigen doses. Copyright © 2014. Published by Elsevier Ltd.
An Automated HIV-1 Env-Pseudotyped Virus Production for Global HIV Vaccine Trials
Fuss, Martina; Mazzotta, Angela S.; Sarzotti-Kelsoe, Marcella; Ozaki, Daniel A.; Montefiori, David C.; von Briesen, Hagen; Zimmermann, Heiko; Meyerhans, Andreas
2012-01-01
Background Infections with HIV still represent a major human health problem worldwide and a vaccine is the only long-term option to fight efficiently against this virus. Standardized assessments of HIV-specific immune responses in vaccine trials are essential for prioritizing vaccine candidates in preclinical and clinical stages of development. With respect to neutralizing antibodies, assays with HIV-1 Env-pseudotyped viruses are a high priority. To cover the increasing demands of HIV pseudoviruses, a complete cell culture and transfection automation system has been developed. Methodology/Principal Findings The automation system for HIV pseudovirus production comprises a modified Tecan-based Cellerity system. It covers an area of 5×3 meters and includes a robot platform, a cell counting machine, a CO2 incubator for cell cultivation and a media refrigerator. The processes for cell handling, transfection and pseudovirus production have been implemented according to manual standard operating procedures and are controlled and scheduled autonomously by the system. The system is housed in a biosafety level II cabinet that guarantees protection of personnel, environment and the product. HIV pseudovirus stocks in a scale from 140 ml to 1000 ml have been produced on the automated system. Parallel manual production of HIV pseudoviruses and comparisons (bridging assays) confirmed that the automated produced pseudoviruses were of equivalent quality as those produced manually. In addition, the automated method was fully validated according to Good Clinical Laboratory Practice (GCLP) guidelines, including the validation parameters accuracy, precision, robustness and specificity. Conclusions An automated HIV pseudovirus production system has been successfully established. It allows the high quality production of HIV pseudoviruses under GCLP conditions. In its present form, the installed module enables the production of 1000 ml of virus-containing cell culture supernatant per
Gouvêa, Aída de Fátima Thomé Barbosa; Pinto, Maria Isabel de Moraes; Miyamoto, Maristela; Machado, Daisy Maria; Pessoa, Silvana Duarte; Carmo, Fabiana Bononi do; Beltrão, Suênia Cordeiro de Vasconcelos; Succi, Regina Célia de Menezes
2015-01-01
To assess possible factors associated with the loss of antibodies to hepatitis A 7 years after the primary immunization in children of HIV-infected mothers and the response to revaccination in patients seronegative for hepatitis A. Quantification of HAV antibodies by electrochemiluminescence was performed in 39 adolescents followed up at the Pediatric Aids Clinic of Federal University of São Paulo (Unifesp): 29 HIV-infected (HIVgroup) (median age: 12.8 years) and 10 HIV-exposed but non-infected (ENI group) (median age: 13.4 years). All of them received two doses of HAV vaccine (Havrix(®)) in 2002. The median age at primary immunization (PI) was 5.4 years for HIV group and 6.5 years for ENI group. All children, from both groups, had antibodies to HAV >20 mIU/mL after PI. Seven years later, the ENI group showed a median concentration of antibodies = 253.5 mIU/mL, while the HIV group = 113.0 mIU/mL (Mann-Whitney test, p=0.085). All ENI group and 23/29 (79.3%) from HIV group mantained HAV antibodies 7 years after PI. The levels of hepatitis A antibodies in the primary vaccination were the only factor independently associated with maintaining these antibodies for 7 years. The group that lost HAV seropositivity was revaccinated and 83.3% (5/6) responded with antibodies >20 mUI/mL. The antibodies levels acquired in the primary vaccination in the HIV group were the main factor associated with antibodies loss after HAV immunization. Copyright © 2015 Associação de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.
Diversion of HIV-1 Vaccine-induced Immunity by gp41-Microbiota Cross-reactive Antibodies
Williams, Wilton B; Liao, Hua-Xin; Moody, M. Anthony; Kepler, Thomas B.; Alam, S Munir; Gao, Feng; Wiehe, Kevin; Trama, Ashley M.; Jones, Kathryn; Zhang, Ruijun; Song, Hongshuo; Marshall, Dawn J; Whitesides, John F; Sawatzki, Kaitlin; Hua, Axin; Liu, Pinghuang; Tay, Matthew Z; Seaton, Kelly; Shen, Xiaoying; Foulger, Andrew; Lloyd, Krissey E.; Parks, Robert; Pollara, Justin; Ferrari, Guido; Yu, Jae-Sung; Vandergrift, Nathan; Montefiori, David C.; Sobieszczyk, Magdalena E; Hammer, Scott; Karuna, Shelly; Gilbert, Peter; Grove, Doug; Grunenberg, Nicole; McElrath, Julie; Mascola, John R.; Koup, Richard A; Corey, Lawrence; Nabel, Gary J.; Morgan, Cecilia; Churchyard, Gavin; Maenza, Janine; Keefer, Michael; Graham, Barney S.; Baden, Lindsey R.; Tomaras, Georgia D.; Haynes, Barton F.
2015-01-01
A HIV-1 DNA prime-recombinant Adenovirus Type 5 (rAd5) boost vaccine failed to protect from HIV-1 acquisition. We studied the nature of the vaccine-induced antibody (Ab) response to HIV-1 envelope (Env). HIV-1-reactive plasma Ab titers were higher to Env gp41 than gp120, and repertoire analysis demonstrated that 93% of HIV-1-reactive Abs from memory B cells was to Env gp41. Vaccine-induced gp41-reactive monoclonal antibodies (mAbs) were non-neutralizing, and frequently polyreactive with host and environmental antigens including intestinal microbiota (IM). Next generation sequencing of an IGHV repertoire prior to vaccination revealed an Env-IM cross-reactive Ab that was clonally-related to a subsequent vaccine-induced gp41-reactive Ab. Thus, HIV-1 Env DNA-rAd5 vaccine induced a dominant IM-polyreactive, non-neutralizing gp41-reactive Ab repertoire response that was associated with no vaccine efficacy. PMID:26229114
Choudhury, Shahana A; Matin, Fazle
2013-12-01
Little is known regarding waning immunity to tetanus toxoid (TT) in HIV-infected children and the need for booster doses before the recommended interval of 5-10 years. Anti-tetanus antibodies were assessed by ELISA in 24 HIV-infected and 24 control children. A protective level (>0.1 IU/ml) of TT antibodies was observed in 62% of HIV-infected children and in 100% of controls. HIV-infected children with five doses had a significantly (p=0.01) lower prevalence of protective immunity compared to controls. Follow-up anti-TT antibody levels in nine HIV-infected children declined from 1.27 to 0.26 IU/ml, but levels did not decline in the seven controls; five of the seven (71%) children with a non-protective level of antibodies responded with a level>0.16 IU/ml following one booster dose of the vaccine. HIV-infected children may need TT boosters before the recommended 5-10 years. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
von Bredow, Benjamin; Arias, Juan F.; Heyer, Lisa N.; Moldt, Brian; Le, Khoa; Robinson, James E.; Burton, Dennis R.
2016-01-01
ABSTRACT Although antibodies to the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein have been studied extensively for their ability to block viral infectivity, little data are currently available on nonneutralizing functions of these antibodies, such as their ability to eliminate virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC). HIV-1 Env-specific antibodies of diverse specificities, including potent broadly neutralizing and nonneutralizing antibodies, were therefore tested for ADCC against cells infected with a lab-adapted HIV-1 isolate (HIV-1NL4-3), a primary HIV-1 isolate (HIV-1JR-FL), and a simian-human immunodeficiency virus (SHIV) adapted for pathogenic infection of rhesus macaques (SHIVAD8-EO). In accordance with the sensitivity of these viruses to neutralization, HIV-1NL4-3-infected cells were considerably more sensitive to ADCC, both in terms of the number of antibodies and magnitude of responses, than cells infected with HIV-1JR-FL or SHIVAD8-EO. ADCC activity generally correlated with antibody binding to Env on the surfaces of virus-infected cells and with viral neutralization; however, neutralization was not always predictive of ADCC, as instances of ADCC in the absence of detectable neutralization, and vice versa, were observed. These results reveal incomplete overlap in the specificities of antibodies that mediate these antiviral activities and provide insights into the relationship between ADCC and neutralization important for the development of antibody-based vaccines and therapies for combating HIV-1 infection. IMPORTANCE This study provides fundamental insights into the relationship between antibody-dependent cell-mediated cytotoxicity (ADCC) and virus neutralization that may help to guide the development of antibody-based vaccines and immunotherapies for the prevention and treatment of HIV-1 infection. PMID:27122574
von Bredow, Benjamin; Arias, Juan F; Heyer, Lisa N; Moldt, Brian; Le, Khoa; Robinson, James E; Zolla-Pazner, Susan; Burton, Dennis R; Evans, David T
2016-07-01
Although antibodies to the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein have been studied extensively for their ability to block viral infectivity, little data are currently available on nonneutralizing functions of these antibodies, such as their ability to eliminate virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC). HIV-1 Env-specific antibodies of diverse specificities, including potent broadly neutralizing and nonneutralizing antibodies, were therefore tested for ADCC against cells infected with a lab-adapted HIV-1 isolate (HIV-1NL4-3), a primary HIV-1 isolate (HIV-1JR-FL), and a simian-human immunodeficiency virus (SHIV) adapted for pathogenic infection of rhesus macaques (SHIVAD8-EO). In accordance with the sensitivity of these viruses to neutralization, HIV-1NL4-3-infected cells were considerably more sensitive to ADCC, both in terms of the number of antibodies and magnitude of responses, than cells infected with HIV-1JR-FL or SHIVAD8-EO ADCC activity generally correlated with antibody binding to Env on the surfaces of virus-infected cells and with viral neutralization; however, neutralization was not always predictive of ADCC, as instances of ADCC in the absence of detectable neutralization, and vice versa, were observed. These results reveal incomplete overlap in the specificities of antibodies that mediate these antiviral activities and provide insights into the relationship between ADCC and neutralization important for the development of antibody-based vaccines and therapies for combating HIV-1 infection. This study provides fundamental insights into the relationship between antibody-dependent cell-mediated cytotoxicity (ADCC) and virus neutralization that may help to guide the development of antibody-based vaccines and immunotherapies for the prevention and treatment of HIV-1 infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Pariani, Elena; Boschini, Antonio; Amendola, Antonella; Poletti, Raffaella; Anselmi, Giovanni; Begnini, Marco; Ranghiero, Alberto; Cecconi, Gianluca; Zanetti, Alessandro R
2011-11-15
2009 A(H1N1) pandemic influenza vaccination was recommended as a priority to essential workers and high-risk individuals, including HIV-infected patients and people living in communities. HIV-infected and HIV-uninfected former drug-users (18-60 years old) living in a rehabilitation community (San Patrignano, Italy) received one dose of a MF59-adjuvanted 2009 pandemic influenza vaccine and one dose of a 2009-2010 seasonal trivalent inactivated influenza vaccine (containing A/Brisbane/59/2007(H1N1), A/Brisbane/10/2007(H3N2), B/Brisbane/60/2008) simultaneously. Antibodies against each vaccine antigen were determined at the time of vaccination and one and six months post-vaccination by hemagglutination-inhibition test. 49 HIV-infected and 60 HIV-uninfected subjects completed the study. Most (98%) HIV-infected participants were on antiretroviral treatment, the median CD4+ cell count was 350 (IQR 300)cells/μl and viremia was suppressed in 91.8% of cases. One month post-vaccination, no significant changes in immune-virological parameters were observed. One month post-vaccination, the immune responses to both pandemic and seasonal vaccine met the EMA-CPMP criteria for immunogenicity of influenza vaccines in both HIV-infected and HIV-uninfected subjects. No difference in vaccine responses was observed between the two groups. Six months after vaccination, the percentages of vaccinees with antibody titres ≥1:40 and antibody geometric mean titres significantly decreased in both groups. However, they were significantly lower in HIV-infected than in HIV-uninfected vaccinees. In subjects who had been primed to seasonal influenza the year before (through either vaccination or natural infection), levels of antibodies against 2009 A(H1N1) were higher than those measured in unprimed subjects, both one month and six months post-vaccination. The co-administration of a single dose of 2009 pandemic MF59-adjuvanted influenza vaccine with a seasonal vaccine provided a protective immune
Mosoian, Arevik; Zhang, Lumin; Hong, Feng; Cunyat, Francesc; Rahman, Adeeb; Bhalla, Riti; Panchal, Ankur; Saiman, Yedidya; Fiel, M Isabel; Florman, Sander; Roayaie, Sasan; Schwartz, Myron; Branch, Andrea; Stevenson, Mario; Bansal, Meena B
2017-05-01
End-stage liver disease is a common cause of non-AIDS-related mortality in HIV + patients, despite effective anti-retroviral therapies (ARTs). HIV-1 infection causes gut CD4 depletion and is thought to contribute to increased gut permeability, bacterial translocation, and immune activation. Microbial products drain from the gut into the liver via the portal vein where Kupffer cells (KCs), the resident liver macrophage, clear translocated microbial products. As bacterial translocation is implicated in fibrogenesis in HIV patients through unclear mechanisms, we tested the hypothesis that HIV infection of KCs alters their response to LPS in a TLR4-dependent manner. We showed that HIV-1 productively infected KCs, enhanced cell-surface TLR4 and CD14 expression, and increased IL-6 and TNF-α expression, which was blocked by a small molecule TLR4 inhibitor. Our study demonstrated that HIV infection sensitizes KCs to the proinflammatory effects of LPS in a TLR4-dependent manner. These findings suggest that HIV-1-infected KCs and their dysregulated innate immune response to LPS may play a role in hepatic inflammation and fibrosis and represent a novel target for therapy. © Society for Leukocyte Biology.
Blakney, Anna K; Tchakoute, Christophe Toukam; Hesseling, Anneke C; Kidzeru, Elvis B; Jones, Christine E; Passmore, Jo-Ann S; Sodora, Donald L; Gray, Clive M; Jaspan, Heather B
2015-09-11
Bacille Calmette-Guerin (BCG) is effective in preventing disseminated tuberculosis (TB) in children but may also have non-specific benefits, and is thought to improve immunity to unrelated antigens through trained innate immunity. In HIV-infected infants, there is a risk of BCG-associated adverse events. We aimed to explore whether delaying BCG vaccination by 8 weeks, in utero or perinatal HIV infection is excluded, affected T-cell responses to B. pertussis (BP) and tetanus toxoid (TT), in HIV-exposed, uninfected infants. Infants were randomized to receive BCG vaccination at birth or 8 weeks of age. At 8 and 14 weeks, T cell proliferation and intracellular cytokine (IL-2, IL-13, IL-17, and IFN-γ) expression was analyzed in response to BP, TT and Staphylococcal enterotoxin B (SEB) antigens. Delaying BCG vaccination did not alter T-cell proliferation to BP or TT antigens. Infants immunized with BCG at birth had higher CD4+ T cell proliferation to SEB at 14 weeks of age (p=0.018). Birth-vaccinated infants had increased CD8+ IL-2 expression in response to BP, but not TT or SEB, at 8 weeks. Infants vaccinated with BCG at 8 weeks had significantly lower IL-13 expression by BP-specific CD4+ and CD8+ T cells at 14 weeks (p=0.032 and p=0.0035, respectively). There were no observed differences in multifunctional cytokine response to TT, BP or SEB between infants vaccinated with BCG at birth versus 8 weeks of age. Delaying BCG vaccination until 8 weeks of age results in robust T-cellular responses to BP and TT in HIV-exposed infants. NCT02062580. Copyright © 2015 Elsevier Ltd. All rights reserved.
Agouron and immune response to commercialize remune immune-based treatment.
James, J S
1998-06-19
Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.
Are Evolution and the Intracellular Innate Immune System Key Determinants in HIV Transmission?
Sumner, Rebecca P.; Thorne, Lucy G.; Fink, Doug L.; Khan, Hataf; Milne, Richard S.; Towers, Greg J.
2017-01-01
HIV-1 is the single most important sexually transmitted disease in humans from a global health perspective. Among human lentiviruses, HIV-1 M group has uniquely achieved pandemic levels of human-to-human transmission. The requirement to transmit between hosts likely provides the strongest selective forces on a virus, as without transmission, there can be no new infections within a host population. Our perspective is that evolution of all of the virus–host interactions, which are inherited and perpetuated from host-to-host, must be consistent with transmission. For example, CXCR4 use, which often evolves late in infection, does not favor transmission and is therefore lost when a virus transmits to a new host. Thus, transmission inevitably influences all aspects of virus biology, including interactions with the innate immune system, and dictates the biological niche in which the virus exists in the host. A viable viral niche typically does not select features that disfavor transmission. The innate immune response represents a significant selective pressure during the transmission process. In fact, all viruses must antagonize and/or evade the mechanisms of the host innate and adaptive immune systems that they encounter. We believe that viewing host–virus interactions from a transmission perspective helps us understand the mechanistic details of antiviral immunity and viral escape. This is particularly true for the innate immune system, which typically acts from the very earliest stages of the host–virus interaction, and must be bypassed to achieve successful infection. With this in mind, here we review the innate sensing of HIV, the consequent downstream signaling cascades and the viral restriction that results. The centrality of these mechanisms to host defense is illustrated by the array of countermeasures that HIV deploys to escape them, despite the coding constraint of a 10 kb genome. We consider evasion strategies in detail, in particular the role of the
Geldhof, Marc F; Van Breedam, Wander; De Jong, Ellen; Lopez Rodriguez, Alfonso; Karniychuk, Uladzimir U; Vanhee, Merijn; Van Doorsselaere, Jan; Maes, Dominiek; Nauwynck, Hans J
2013-12-27
The porcine reproductive and respiratory syndrome virus (PRRSV) causes reproductive failure in sows and respiratory disease in pigs of all ages. Despite the frequent use of vaccines to maintain PRRSV immunity in sows, little is known on how the currently used vaccines affect the immunity against currently circulating and genetically divergent PRRSV variants in PRRSV-immune sows, i.e. sows that have a pre-existing PRRSV-specific immunity due to previous infection with or vaccination against the virus. Therefore, this study aimed to assess the capacity of commercially available attenuated/inactivated PRRSV vaccines and autogenous inactivated PRRSV vaccines - prepared according to a previously optimized in-house protocol - to boost the antibody immunity against currently circulating PRRSV variants in PRRSV-immune sows. PRRSV isolates were obtained from 3 different swine herds experiencing PRRSV-related problems, despite regular vaccination of gilts and sows against the virus. In a first part of the study, the PRRSV-specific antibody response upon booster vaccination with commercial PRRSV vaccines and inactivated farm-specific PRRSV vaccines was evaluated in PRRSV-immune, non-pregnant replacement sows from the 3 herds. A boost in virus-neutralizing antibodies against the farm-specific isolate was observed in all sow groups vaccinated with the corresponding farm-specific inactivated vaccines. Use of the commercial attenuated EU type vaccine boosted neutralizing antibodies against the farm-specific isolate in sows derived from 2 farms, while use of the commercial attenuated NA type vaccine did not boost farm-specific virus-neutralizing antibodies in any of the sow groups. Interestingly, the commercial inactivated EU type vaccine boosted farm-specific virus-neutralizing antibodies in sows from 1 farm. In the second part of the study, a field trial was performed at one of the farms to evaluate the booster effect of an inactivated farm-specific vaccine and a commercial