Sample records for hoogsteen base pair

  1. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  2. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  3. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  4. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  5. Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

    PubMed

    Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

    2011-12-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

  6. An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing.

    PubMed

    Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A

    2011-03-07

    Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.

  7. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  8. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  9. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  10. Binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs in the Watson-Crick and Hoogsteen configurations.

    PubMed

    Morari, Cristian; Bogdan, Diana; Muntean, Cristina M

    2012-11-01

    The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.

  11. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    PubMed

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  12. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  13. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  14. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  15. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  16. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  17. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    PubMed

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  18. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  19. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  20. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    PubMed

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  1. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    PubMed

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  2. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    PubMed

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  3. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  4. Control of box C/D snoRNP assembly by N6-methylation of adenine.

    PubMed

    Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj

    2017-09-01

    N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

  6. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    PubMed

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A6:T7 basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2'-deoxyaristeromycin moiety, A6, as a result of substitution of the endocyclic 4'-oxygen in the natural sugar with a methylene group in A6. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in alpha, sigma and gamma torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.

  7. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    PubMed

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

    DOE PAGES

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; ...

    2015-03-31

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

  9. Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

    PubMed Central

    Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai

    2015-01-01

    One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995

  10. A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota.

    PubMed

    Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L

    2012-06-27

    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.

  11. A nucleotide analogue induced gain of function corrects the error-prone nature of human DNA polymerase iota

    PubMed Central

    Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L

    2012-01-01

    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140

  12. Thermodynamic characterization of a triple-helical three-way junction containing a Hoogsteen branch point.

    PubMed

    Hüsler, P L; Klump, H H

    1995-09-10

    We have designed a Hoogsteen (HG) triple-helical three-way junction (ternary complex) constructed from three 33-mer oligonucleotides based on the same subset of sequences used for the Watson-Crick (WC) triple-helical three-way junction, characterized previously (P. L. Hüsler and H. H. Klump (1994) Arch. Biochem. Biophys., 313, 29-38). The junction differs primarily in the assembly of the branch point and the ends of the arms. The three oligonucleotides can each fold into a WC hairpin, linked by a four-member cytosine loop, each containing a homo-pyrimidine 10-mer single-strand extension. On lowering the pH (between 6 and 4), the extensions mutually associate to one of the other hairpins via Hoogsteen (HG) hydrogen bonding. Collectively, this process results in the formation of the branch point and the triple-helical arms. The HG triple-helical three-way junction is characterized by gel electrophoresis, circular dichroism, uv melting, and differential scanning calorimetry. The junction undergoes thermal unfolding in two distinct temperature regions. In the temperature range 15 to 50 degrees C loss of HG base pairing results in the dissociation of the three-way junction. Between 55 and 95 degrees C the resulting hairpins undergo further successive unfolding. The overall calorimetric unfolding enthalpy and entropy changes associated with the loss of HG base pairing are approximately equal to the sum of the enthalpy and entropy changes associated with the dissociation of the HG base pairing in the isolated arms (170.6 kcal.mol-1; 540.1 cal.mol-1.K-1). It is apparent from these results that in the proximity of the branch point the structure is not perturb or strain. This result is contrary to the results obtained for the WC triple-helical three-way and for three-way junctions constructed from canonical double-helical DNA. Complete folding of the junction requires either high Na+ (600 mM) ion concentrations or 40-60 mM Mg2+.

  13. Structural basis for proficient incorporation of dTTP opposite O6-methylguanine by human DNA polymerase iota.

    PubMed

    Pence, Matthew G; Choi, Jeong-Yun; Egli, Martin; Guengerich, F Peter

    2010-12-24

    O(6)-methylguanine (O(6)-methylG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, even physiological ones (e.g. S-adenosylmethionine). The efficiency of a truncated, catalytic DNA polymerase ι core enzyme was determined for nucleoside triphosphate incorporation opposite O(6)-methylG, using steady-state kinetic analyses. The results presented here corroborate previous work from this laboratory using full-length pol ι, which showed that dTTP incorporation occurs with high efficiency opposite O(6)-methylG. Misincorporation of dTTP opposite O(6)-methylG occurred with ∼6-fold higher efficiency than incorporation of dCTP. Crystal structures of the truncated form of pol ι with O(6)-methylG as the template base and incoming dCTP or dTTP were solved and showed that O(6)-methylG is rotated into the syn conformation in the pol ι active site and that dTTP misincorporation by pol ι is the result of Hoogsteen base pairing with the adduct. Both dCTP and dTTP base paired with the Hoogsteen edge of O(6)-methylG. A single, short hydrogen bond formed between the N3 atom of dTTP and the N7 atom of O(6)-methylG. Protonation of the N3 atom of dCTP and bifurcation of the N3 hydrogen between the N7 and O(6) atoms of O(6)-methylG allow base pairing of the lesion with dCTP. We conclude that differences in the Hoogsteen hydrogen bonding between nucleotides is the main factor in the preferential selectivity of dTTP opposite O(6)-methylG by human pol ι, in contrast to the mispairing modes observed previously for O(6)-methylG in the structures of the model DNA polymerases Sulfolobus solfataricus Dpo4 and Bacillus stearothermophilus DNA polymerase I.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, X.; Patel, D.J.

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding themore » dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.« less

  15. Self-replication of chemical systems based on recognition within a double or a triple helix - A realistic hypothesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia

    1992-01-01

    A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.

  16. Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

    PubMed Central

    Pilch, D S; Brousseau, R; Shafer, R H

    1990-01-01

    We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

  17. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  18. Structural Basis for Proficient Incorporation of dTTP Opposite O[superscript 6]-Methylguanine by Human DNA Polymerase [iota

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pence, Matthew G.; Choi, Jeong-Yun; Egli, Martin

    2012-03-15

    O{sup 6}-Methylguanine (O{sup 6}-methylG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, even physiological ones (e.g. S-adenosylmethionine). The efficiency of a truncated, catalytic DNA polymerase L core enzyme was determined for nucleoside triphosphate incorporation opposite O{sup 6}-methylG, using steady-state kinetic analyses. The results presented here corroborate previous work from this laboratory using full-length pol L, which showed that dTTP incorporation occurs with high efficiency opposite O{sup 6}-methylG. Misincorporation of dTTP opposite O{sup 6}-methylG occurred with {approx}6-fold higher efficiency than incorporation of dCTP. Crystal structures of the truncated form of pol L with O{sup 6}-methylG asmore » the template base and incoming dCTP or dTTP were solved and showed that O{sup 6}-methylG is rotated into the syn conformation in the pol L active site and that dTTP misincorporation by pol L is the result of Hoogsteen base pairing with the adduct. Both dCTP and dTTP base paired with the Hoogsteen edge of O{sup 6}-methylG. A single, short hydrogen bond formed between the N3 atom of dTTP and the N7 atom of O{sup 6}-methylG. Protonation of the N3 atom of dCTP and bifurcation of the N3 hydrogen between the N7 and O{sup 6} atoms of O{sup 6}-methylG allow base pairing of the lesion with dCTP. We conclude that differences in the Hoogsteen hydrogen bonding between nucleotides is the main factor in the preferential selectivity of dTTP opposite O{sup 6}-methylG by human pol L, in contrast to the mispairing modes observed previously for O{sup 6}-methylG in the structures of the model DNA polymerases Sulfolobus solfataricus Dpo4 and Bacillus stearothermophilus DNA polymerase I.« less

  19. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

  20. Unique active site promotes error-free replication opposite an 8-oxo-guanine lesion by human DNA polymerase iota

    PubMed Central

    Kirouac, Kevin N.; Ling, Hong

    2011-01-01

    The 8-oxo-guanine (8-oxo-G) lesion is the most abundant and mutagenic oxidative DNA damage existing in the genome. Due to its dual coding nature, 8-oxo-G causes most DNA polymerases to misincorporate adenine. Human Y-family DNA polymerase iota (polι) preferentially incorporates the correct cytosine nucleotide opposite 8-oxo-G. This unique specificity may contribute to polι’s biological role in cellular protection against oxidative stress. However, the structural basis of this preferential cytosine incorporation is currently unknown. Here we present four crystal structures of polι in complex with DNA containing an 8-oxo-G lesion, paired with correct dCTP or incorrect dATP, dGTP, and dTTP nucleotides. An exceptionally narrow polι active site restricts the purine bases in a syn conformation, which prevents the dual coding properties of 8-oxo-G by inhibiting syn/anti conformational equilibrium. More importantly, the 8-oxo-G base in a syn conformation is not mutagenic in polι because its Hoogsteen edge does not form a stable base pair with dATP in the narrow active site. Instead, the syn 8-oxo-G template base forms the most stable replicating base pair with correct dCTP due to its small pyrimidine base size and enhanced hydrogen bonding with the Hoogsteen edge of 8-oxo-G. In combination with site directed mutagenesis, we show that Gln59 in the finger domain specifically interacts with the additional O8 atom of the lesion base, which influences nucleotide selection, enzymatic efficiency, and replication stalling at the lesion site. Our work provides the structural mechanism of high-fidelity 8-oxo-G replication by a human DNA polymerase. PMID:21300901

  1. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.

  2. Formation of a parallel-stranded DNA homoduplex by d(GGA) repeat oligonucleotides.

    PubMed Central

    Suda, T; Mishima, Y; Asakura, H; Kominami, R

    1995-01-01

    The GGA9-H molecules consisting of a double helical stretch followed by a single-stranded 3'-terminal overhang of nine GGA sequence repeats exhibited a gel mobility-shifted band in a concentration-dependent manner, suggestive of the intermolecular complex formation. The position of the shifted band in a gel was almost identical to that of the Y-shaped dimer marker of the same molecular weight that had the two double-helices at one side. This suggests that GGA9-H dimerizes in a parallel orientation without the formation of four-stranded hairpin structure. Since the GGA9-H homoduplex was stably formed at pH 4, 7 and 9, the formation does not require protonation or deprotonation of the N1 position of adenines. Neither does it require the N7 group of guanines responsible for Hoogsteen base pairing from the methylation interference and modification studies. Modification of the N7 group of guanines with dimethyl sulfate (DMS) did not inhibit the association and also the N7 group in the homoduplex was not protected from DMS. On the other hand, the GAA9-H having the G to A base substitution did not show such an association with either GGA9-H or GAA9-H. These results suggest that the homoduplex formation may be due to G.G base pairing through non-Hoogsteen hydrogen bonds. Images PMID:7479009

  3. Thermodynamic basis for engineering high-affinity, high-specificity binding-induced DNA clamp nanoswitches.

    PubMed

    Idili, Andrea; Plaxco, Kevin W; Vallée-Bélisle, Alexis; Ricci, Francesco

    2013-12-23

    Naturally occurring chemoreceptors almost invariably employ structure-switching mechanisms, an observation that has inspired the use of biomolecular switches in a wide range of artificial technologies in the areas of diagnostics, imaging, and synthetic biology. In one mechanism for generating such behavior, clamp-based switching, binding occurs via the clamplike embrace of two recognition elements onto a single target molecule. In addition to coupling recognition with a large conformational change, this mechanism offers a second advantage: it improves both affinity and specificity simultaneously. To explore the physics of such switches we have dissected here the thermodynamics of a clamp-switch that recognizes a target DNA sequence through both Watson-Crick base pairing and triplex-forming Hoogsteen interactions. When compared to the equivalent linear DNA probe (which relies solely on Watson-Crick interactions), the extra Hoogsteen interactions in the DNA clamp-switch increase the probe's affinity for its target by ∼0.29 ± 0.02 kcal/mol/base. The Hoogsteen interactions of the clamp-switch likewise provide an additional specificity check that increases the discrimination efficiency toward a single-base mismatch by 1.2 ± 0.2 kcal/mol. This, in turn, leads to a 10-fold improvement in the width of the "specificity window" of this probe relative to that of the equivalent linear probe. Given these attributes, clamp-switches should be of utility not only for sensing applications but also, in the specific field of DNA nanotechnology, for applications calling for a better control over the building of nanostructures and nanomachines.

  4. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  5. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    PubMed

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    PubMed Central

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  7. Influence of nucleotide modifications at the C2’ position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA

    PubMed Central

    Copp, William; Denisov, Alexey Y.; Xie, Jingwei; Noronha, Anne M.; Liczner, Christopher; Safaee, Nozhat

    2017-01-01

    Abstract Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2′-deoxyribose, 2′-O-methyl-ribose, 2′-deoxy-2′-fluoro-ribose, arabinose and 2′-deoxy-2′-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2’ modifications gave a variety of effects. Arabinose and 2′-deoxy-2′-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2′-O-methyl and 2′-deoxy-2′-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. PMID:28973475

  8. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

    PubMed

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

    2017-09-29

    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  10. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  11. Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.

    PubMed

    Lin, C H; Patel, D J

    1997-11-01

    Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.

  12. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Stable loop in the crystal structure of the intercalated four-stranded cytosine-rich metazoan telomere

    NASA Technical Reports Server (NTRS)

    Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.

    1995-01-01

    In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.

  14. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    PubMed

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  15. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    PubMed Central

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  16. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad

    PubMed Central

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-01-01

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. PMID:26400177

  17. Structure, stability and behaviour of nucleic acids in ionic liquids

    PubMed Central

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their conformational polymorphism. However, lack of a medium in which nucleic acid structures exhibit long-term stability has been a bottleneck. Ionic liquids (ILs) are potential solvents in the nanotechnology field. Hydrated ILs, such as choline dihydrogen phosphate (choline dhp) and deep eutectic solvent (DES) prepared from choline chloride and urea, are ‘green’ solvents that ensure long-term stability of biomolecules. An understanding of the behaviour of nucleic acids in hydrated ILs is necessary for developing DNA materials. We here review current knowledge about the structures and stabilities of nucleic acids in choline dhp and DES. Interestingly, in choline dhp, A–T base pairs are more stable than G–C base pairs, the reverse of the situation in buffered NaCl solution. Moreover, DNA triplex formation is markedly stabilized in hydrated ILs compared with aqueous solution. In choline dhp, the stability of Hoogsteen base pairs is comparable to that of Watson–Crick base pairs. Moreover, the parallel form of the G-quadruplex is stabilized in DES compared with aqueous solution. The behaviours of various DNA molecules in ILs detailed here should be useful for designing oligonucleotides for the development of nanomaterials and nanodevices. PMID:25013178

  18. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    PubMed

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Insights into Watson–Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A

    PubMed Central

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.

    2017-01-01

    Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571

  20. Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.

    PubMed

    Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân

    2015-12-02

    G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki

    N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the synmore » conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.« less

  2. Modified Amber Force Field Correctly Models the Conformational Preference for Tandem GA pairs in RNA

    PubMed Central

    2015-01-01

    Molecular mechanics with all-atom models was used to understand the conformational preference of tandem guanine-adenine (GA) noncanonical pairs in RNA. These tandem GA pairs play important roles in determining stability, flexibility, and structural dynamics of RNA tertiary structures. Previous solution structures showed that these tandem GA pairs adopt either imino (cis Watson–Crick/Watson–Crick A-G) or sheared (trans Hoogsteen/sugar edge A-G) conformations depending on the sequence and orientation of the adjacent closing base pairs. The solution structures (GCGGACGC)2 [Biochemistry, 1996, 35, 9677–9689] and (GCGGAUGC)2 [Biochemistry, 2007, 46, 1511–1522] demonstrate imino and sheared conformations for the two central GA pairs, respectively. These systems were studied using molecular dynamics and free energy change calculations for conformational changes, using umbrella sampling. For the structures to maintain their native conformations during molecular dynamics simulations, a modification to the standard Amber ff10 force field was required, which allowed the amino group of guanine to leave the plane of the base [J. Chem. Theory Comput., 2009, 5, 2088–2100] and form out-of-plane hydrogen bonds with a cross-strand cytosine or uracil. The requirement for this modification suggests the importance of out-of-plane hydrogen bonds in stabilizing the native structures. Free energy change calculations for each sequence demonstrated the correct conformational preference when the force field modification was used, but the extent of the preference is underestimated. PMID:24803859

  3. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    PubMed Central

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  4. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    PubMed

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  5. G-quadruplexes as sensing probes.

    PubMed

    Ruttkay-Nedecky, Branislav; Kudr, Jiri; Nejdl, Lukas; Maskova, Darina; Kizek, Rene; Adam, Vojtech

    2013-11-28

    Guanine-rich sequences of DNA are able to create tetrastranded structures known as G-quadruplexes; they are formed by the stacking of planar G-quartets composed of four guanines paired by Hoogsteen hydrogen bonding. G-quadruplexes act as ligands for metal ions and aptamers for various molecules. Interestingly, the G-quadruplexes form a complex with anionic porphyrin hemin and exhibit peroxidase-like activity. This review focuses on overview of sensing techniques based on G-quadruplex complexes with anionic porphyrins for detection of various analytes, including metal ions such as K+, Ca2+, Ag+, Hg2+, Cu2+, Pb2+, Sr2+, organic molecules, nucleic acids, and proteins. Principles of G-quadruplex-based detection methods involve DNA conformational change caused by the presence of analyte which leads to a decrease or an increase in peroxidase activity, fluorescence, or electrochemical signal of the used probe. The advantages of various detection techniques are also discussed.

  6. Triple-helix molecular switch-based aptasensors and DNA sensors.

    PubMed

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Energetics, Ion and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

    PubMed

    Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A

    2018-06-22

    Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.

  8. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    NASA Astrophysics Data System (ADS)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  9. Solution structure of conserved AGNN tetraloops: insights into Rnt1p RNA processing

    PubMed Central

    Lebars, Isabelle; Lamontagne, Bruno; Yoshizawa, Satoko; Abou Elela, Sherif; Fourmy, Dominique

    2001-01-01

    Rnt1p, the yeast orthologue of RNase III, cleaves rRNAs, snRNAs and snoRNAs at a stem capped with conserved AGNN tetraloop. Here we show that 9 bp long stems ending with AGAA or AGUC tetraloops bind to Rnt1p and direct specific but sequence-independent RNA cleavage when provided with stems longer than 13 bp. The solution structures of these two tetraloops reveal a common fold for the terminal loop stabilized by non-canonical A–A or A–C pairs and extensive base stacking. The conserved nucleotides are stacked at the 5′ side of the loop, exposing their Watson–Crick and Hoogsteen faces for recognition by Rnt1p. These results indicate that yeast RNase III recognizes the fold of a conserved single-stranded tetraloop to direct specific dsRNA cleavage. PMID:11743001

  10. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    PubMed

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  11. Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

    PubMed

    Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

    2017-12-14

    The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

  12. Base modification strategies to modulate immune stimulation by an siRNA.

    PubMed

    Valenzuela, Rachel Anne P; Suter, Scott R; Ball-Jones, Alexi A; Ibarra-Soza, José M; Zheng, Yuxuan; Beal, Peter A

    2015-01-19

    Immune stimulation triggered by siRNAs is one of the major challenges in the development of safe RNAi-based therapeutics. Within an immunostimulatory siRNA sequence, this hurdle is commonly addressed by using ribose modifications (e.g., 2'-OMe or 2'-F), which results in decreased cytokine production. However, as immune stimulation by siRNAs is a sequence-dependent phenomenon, recognition of the nucleobases by the trigger receptor(s) is also likely. Here, we use the recently published crystal structures of Toll-like receptor 8 (TLR8) bound to small-molecule agonists to generate computational models for ribonucleotide binding by this immune receptor. Our modeling suggested that modification of either the Watson-Crick or Hoogsteen face of adenosine would disrupt nucleotide/TLR8 interactions. We employed chemical synthesis to alter either the Watson-Crick or Hoogsteen face of adenosine and evaluated the effect of these modifications in an siRNA guide strand by measuring the immunostimulatory and RNA interference properties. For the siRNA guide strand tested, we found that modifying the Watson-Crick face is generally more effective at blocking TNFα production in human peripheral blood mononuclear cells (PBMCs) than modification at the Hoogsteen edge. We also observed that modifications near the 5'-end were more effective at blocking cytokine production than those placed at the 3'-end. This work advances our understanding of how chemical modifications can be used to optimize siRNA performance. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Basis of Miscoding of the DNA Adduct N2,3-Ethenoguanine by Human Y-family DNA Polymerases*

    PubMed Central

    Zhao, Linlin; Pence, Matthew G.; Christov, Plamen P.; Wawrzak, Zdzislaw; Choi, Jeong-Yun; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter

    2012-01-01

    N2,3-Ethenoguanine (N2,3-ϵG) is one of the exocyclic DNA adducts produced by endogenous processes (e.g. lipid peroxidation) and exposure to bioactivated vinyl monomers such as vinyl chloride, which is a known human carcinogen. Existing studies exploring the miscoding potential of this lesion are quite indirect because of the lability of the glycosidic bond. We utilized a 2′-fluoro isostere approach to stabilize this lesion and synthesized oligonucleotides containing 2′-fluoro-N2,3-ϵ-2′-deoxyarabinoguanosine to investigate the miscoding potential of N2,3-ϵG by Y-family human DNA polymerases (pols). In primer extension assays, pol η and pol κ replicated through N2,3-ϵG, whereas pol ι and REV1 yielded only 1-base incorporation. Steady-state kinetics revealed that dCTP incorporation is preferred opposite N2,3-ϵG with relative efficiencies in the order of pol κ > REV1 > pol η ≈ pol ι, and dTTP misincorporation is the major miscoding event by all four Y-family human DNA pols. Pol ι had the highest dTTP misincorporation frequency (0.71) followed by pol η (0.63). REV1 misincorporated dTTP and dGTP with much lower frequencies. Crystal structures of pol ι with N2,3-ϵG paired to dCTP and dTTP revealed Hoogsteen-like base pairing mechanisms. Two hydrogen bonds were observed in the N2,3-ϵG:dCTP base pair, whereas only one appears to be present in the case of the N2,3-ϵG:dTTP pair. Base pairing mechanisms derived from the crystal structures explain the slightly favored dCTP insertion for pol ι in steady-state kinetic analysis. Taken together, these results provide a basis for the mutagenic potential of N2,3-ϵG. PMID:22910910

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson–Crick adenine–thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41more » to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39 –2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson–Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.« less

  15. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    PubMed Central

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Faucher, Frédérick; Robey-Bond, Susan M.; Wallace, Susan S.

    DNA is subject to a multitude of oxidative damages generated by oxidizing agents from metabolism and exogenous sources and by ionizing radiation. Guanine is particularly vulnerable to oxidation, and the most common oxidative product 8-oxoguanine (8-oxoG) is the most prevalent lesion observed in DNA molecules. 8-OxoG can form a normal Watson-Crick pair with cytosine (8-oxoG:C), but it can also form a stable Hoogsteen pair with adenine (8-oxoG:A), leading to a G:C {yields} T:A transversion after replication. Fortunately, 8-oxoG is recognized and excised by either of two DNA glycosylases of the base excision repair pathway: formamidopyrimidine-DNA glycosylase and 8-oxoguanine DNA glycosylasemore » (Ogg). While Clostridium acetobutylicum Ogg (CacOgg) DNA glycosylase can specifically recognize and remove 8-oxoG, it displays little preference for the base opposite the lesion, which is unusual for a member of the Ogg1 family. This work describes the crystal structures of CacOgg in its apo form and in complex with 8-oxo-2'-deoxyguanosine. A structural comparison between the apo form and the liganded form of the enzyme reveals a structural reorganization of the C-terminal domain upon binding of 8-oxoG, similar to that reported for human OGG1. A structural comparison of CacOgg with human OGG1, in complex with 8-oxoG containing DNA, provides a structural rationale for the lack of opposite base specificity displayed by CacOgg.« less

  17. Structural studies of p53 inactivation by DNA-contact mutations and its rescue by suppressor mutations via alternative protein–DNA interactions

    PubMed Central

    Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora

    2013-01-01

    A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845

  18. Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

    PubMed

    Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

    2009-04-01

    Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

  19. Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

    PubMed

    Makarova, A V; Kulbachinskiy, A V

    2012-06-01

    Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

  20. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    DOE PAGES

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; ...

    2014-11-17

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities,more » nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.« less

  1. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    NASA Astrophysics Data System (ADS)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  2. Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.

    PubMed

    Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B

    2015-05-14

    G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.

  3. Moving beyond Watson-Crick models of coarse grained DNA dynamics.

    PubMed

    Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

    2011-11-28

    DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Aiming; Rajashankar, Kanagalaghatta R.; Patel, Dinshaw J.

    Significant advances in our understanding of RNA architecture, folding and recognition have emerged from structure-function studies on riboswitches, non-coding RNAs whose sensing domains bind small ligands and whose adjacent expression platforms contain RNA elements involved in the control of gene regulation. We now report on the ligand-bound structure of the Thermotoga petrophila fluoride riboswitch, which adopts a higher-order RNA architecture stabilized by pseudoknot and long-range reversed Watson-Crick and Hoogsteen A {sm_bullet} U pair formation. The bound fluoride ion is encapsulated within the junctional architecture, anchored in place through direct coordination to three Mg{sup 2+} ions, which in turn are octahedrallymore » coordinated to water molecules and five inwardly pointing backbone phosphates. Our structure of the fluoride riboswitch in the bound state shows how RNA can form a binding pocket selective for fluoride, while discriminating against larger halide ions. The T. petrophila fluoride riboswitch probably functions in gene regulation through a transcription termination mechanism.« less

  5. Genetic Control of Replication through N1-methyladenine in Human Cells*

    PubMed Central

    Conde, Juan; Yoon, Jung-Hoon; Roy Choudhury, Jayati; Prakash, Louise; Prakash, Satya

    2015-01-01

    N1-methyl adenine (1-MeA) is formed in DNA by reaction with alkylating agents and naturally occurring methyl halides. The 1-MeA lesion impairs Watson-Crick base pairing and blocks normal DNA replication. Here we identify the translesion synthesis (TLS) DNA polymerases (Pols) required for replicating through 1-MeA in human cells and show that TLS through this lesion is mediated via three different pathways in which Pols ι and θ function in one pathway and Pols η and ζ, respectively, function in the other two pathways. Our biochemical studies indicate that in the Polι/Polθ pathway, Polι would carry out nucleotide insertion opposite 1-MeA from which Polθ would extend synthesis. In the Polη pathway, this Pol alone would function at both the nucleotide insertion and extension steps of TLS, and in the third pathway, Polζ would extend from the nucleotide inserted opposite 1-MeA by an as yet unidentified Pol. Whereas by pushing 1-MeA into the syn conformation and by forming Hoogsteen base pair with the T residue, Polι would carry out TLS opposite 1-MeA, the ability of Polη to replicate through 1-MeA suggests that despite its need for Watson-Crick hydrogen bonding, Polη can stabilize the adduct in its active site. Remarkably, even though Pols η and ι are quite error-prone at inserting nucleotides opposite 1-MeA, TLS opposite this lesion in human cells occurs in a highly error-free fashion. This suggests that the in vivo fidelity of TLS Pols is regulated by factors such as post-translational modifications, protein-protein interactions, and possibly others. PMID:26491020

  6. Biophysical Characterization of the Strong Stabilization of the RNA Triplex poly(U)•poly(A)*poly(U) by 9-O-(ω-amino) Alkyl Ether Berberine Analogs

    PubMed Central

    Hossain, Maidul; Haq, Lucy; Suresh Kumar, Gopinatha

    2012-01-01

    Background Binding of two 9-O-(ω-amino) alkyl ether berberine analogs BC1 and BC2 to the RNA triplex poly(U)•poly(A)*poly(U) was studied by various biophysical techniques. Methodology/Principal Findings Berberine analogs bind to the RNA triplex non-cooperatively. The affinity of binding was remarkably high by about 5 and 15 times, respectively, for BC1 and BC2 compared to berberine. The site size for the binding was around 4.3 for all. Based on ferrocyanide quenching, fluorescence polarization, quantum yield values and viscosity results a strong intercalative binding of BC1 and BC2 to the RNA triplex has been demonstrated. BC1 and BC2 stabilized the Hoogsteen base paired third strand by about 18.1 and 20.5°C compared to a 17.5°C stabilization by berberine. The binding was entropy driven compared to the enthalpy driven binding of berbeine, most likely due to additional contacts within the grooves of the triplex and disruption of the water structure by the alkyl side chain. Conclusions/Significance Remarkably higher binding affinity and stabilization effect of the RNA triplex by the amino alkyl berberine analogs was achieved compared to berberine. The length of the alkyl side chain influence in the triplex stabilization phenomena. PMID:22666416

  7. Biological and Nano-Technological Applications of Artificial DNAs Made Exclusively of Nonnatural C-Nucleosides with Four Types of Nonnatural Bases

    DTIC Science & Technology

    2011-08-19

    A) CD, (B) UV, (C) Tm, and (D) titration experiments of d(iG*)8/d(C)8. d(T/A*/T)n WC WC
 d(T/A/T)n Watson – Crick (WC)
 Hoogsteen
 Symmetrical A...base Figure 7. Triplex formation of the natural T/A/T which has one Watson - Crick (WC)-type and one Hoogsteen-type hydrogen-bondings, and the...Final Report for AOARD Grant FA2386-10-1-4033 “Biological and Nano-technological Applications of Artificial DNAs Made Exclusively of Nonnatutal C

  8. Experimental and density functional theory (DFT) studies on the interactions of Ru(II) polypyridyl complexes with the RAN triplex poly(U)˙poly(A)*poly(U).

    PubMed

    Zhang, Hong; Liu, Xuewen; He, Xiaojun; Liu, Ying; Tan, Lifeng

    2014-11-01

    There is renewed interest in investigating triple helices because these novel structures have been implicated as a possible means of controlling cellular processes by endogenous or exogenous mechanisms. Due to the Hoogsteen base pairing, triple helices are, however, thermodynamically less stable than the corresponding duplexes. The poor stability of triple helices limits their practical applications under physiological conditions. In contrast to DNA triple helices, small molecules stabilizing RNA triple helices at present are less well established. Furthermore, most of these studies are limited to organic compounds and, to a far lesser extent, to metal complexes. In this work, two Ru(II) complexes, [Ru(bpy)2(btip)](2+) (Ru1) and [Ru(phen)2(btip)](2+) (Ru2), have been synthesized and characterized. The binding properties of the two metal complexes with the triple RNA poly(U)˙poly(A)*poly(U) were studied by various biophysical and density functional theory methods. The main results obtained here suggest that the slight binding difference in Ru1 and Ru2 may be attributed to the planarity of the intercalative ligand and the LUMO level of Ru(II) complexes. This study further advances our knowledge on the triplex RNA-binding by metal complexes, particularly Ru(II) complexes.

  9. Fluoride ion encapsulation by Mg2+ and phosphates in a fluoride riboswitch

    PubMed Central

    Ren, Aiming; Rajashankar, Kanagalaghatta R.; Patel, Dinshaw J.

    2012-01-01

    Significant advances in our understanding of RNA architecture, folding and recognition have emerged from structure-function studies on riboswicthes, non-coding RNAs whose sensing domains bind small ligands and whose adjacent expression platforms contain RNA elements involved in the control of gene regulation. We now report on the ligand-bound structure of the Thermotoga petrophila fluoride riboswitch, which adopts a higher-order RNA architecture stabilized by pseudoknot and long-range reversed Watson-Crick and Hoogsteen A•U pair formation. The bound fluoride ion is encapsulated within the junctional architecture, anchored in place through direct coordination to three Mg2+ ions, which in turn are octahedrally coordinated to waters and five inwardly-pointing backbone phosphates. Our structure of the fluoride riboswitch in the bound state defines how RNA can form a binding pocket selective for fluoride, while discriminating against larger halide ions. The T. petrophila fluoride riboswitch most likely functions in gene regulation through a transcription termination mechanism. PMID:22678284

  10. Molecular dynamics correctly models the unusual major conformation of the GAGU RNA internal loop and with NMR reveals an unusual minor conformation.

    PubMed

    Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H

    2018-05-01

    The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    PubMed

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  12. Synthesis and Evolution of a Threose Nucleic Acid Aptamer Bearing 7-Deaza-7-Substituted Guanosine Residues.

    PubMed

    Mei, Hui; Liao, Jen-Yu; Jimenez, Randi M; Wang, Yajun; Bala, Saikat; McCloskey, Cailen; Switzer, Christopher; Chaput, John C

    2018-05-02

    In vitro selection experiments carried out on artificial genetic polymers require robust and faithful methods for copying genetic information back and forth between DNA and xeno-nucleic acids (XNA). Previously, we have shown that Kod-RI, an engineered polymerase developed to transcribe DNA templates into threose nucleic acid (TNA), can function with high fidelity in the absence of manganese ions. However, the transcriptional efficiency of this enzyme diminishes greatly when individual templates are replaced with libraries of DNA sequences, indicating that manganese ions are still required for in vitro selection. Unfortunately, the presence of manganese ions in the transcription mixture leads to the misincorporation of tGTP nucleotides opposite dG residues in the templating strand, which are detected as G-to-C transversions when the TNA is reverse transcribed back into DNA. Here we report the synthesis and fidelity of TNA replication using 7-deaza-7-modified guanosine base analogues in the DNA template and incoming TNA nucleoside triphosphate. Our findings reveal that tGTP misincorporation occurs via a Hoogsteen base pair in which the incoming tGTP residue adopts a syn conformation with respect to the sugar. Substitution of tGTP for 7-deaza-7-phenyl tGTP enabled the synthesis of TNA polymers with >99% overall fidelity. A TNA library containing the 7-deaza-7-phenyl guanine analogue was used to evolve a biologically stable TNA aptamer that binds to HIV reverse transcriptase with low nanomolar affinity.

  13. NMR structural studies of the ionizing radiation adduct 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) opposite deoxyadenosine in a DNA duplex. 8-oxo-7H-dG(syn)ter dot dA(anti) alignment at lesion site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kouchakdjian, M.; Patel, D.J.; Bodepudi, V.

    1991-02-05

    Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12){center dot}d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG{center dot}dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH{submore » 2}-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG{center dot}dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H{sub 2}O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8){center dot}d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn){center dot}dA(anti) pair between stable Watson-Crick dA6{center dot}dT19 and dT8{center dot}A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn){center dot}dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base.« less

  14. Amphiphiles for DNA Supramolecular Assemblies

    DTIC Science & Technology

    2005-11-15

    to drug or biomolecule delivery systems. In order to take advantage of forces that hold nucleic acid helices together, (Watson- Crick/Hoogsteen...supramolecular assemblies that highlight the underlying principles are evident in numerous biological (e.g., lipids) and synthetic (e.g., nanofibers ) systems.2...3). Additionally, they form hydrogels and organogels. The supramolecular systems obtained are promising in many aspects and could lead to new types

  15. pH-independent triple-helix formation with 6-oxocytidine as cytidine analogue.

    PubMed

    Parsch, U; Engels, J W

    2000-07-03

    The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap.

  16. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE PAGES

    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

    2016-02-04

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  17. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paugh, Steven W.; Coss, David R.; Bao, Ju

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  18. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

    PubMed Central

    Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

    2016-01-01

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  19. Self-organisation of an oligodeoxynucleotide containing the G- and C-rich stretches of the direct repeats of the human mitochondrial DNA.

    PubMed

    Nonin-Lecomte, Sylvie; Dardel, Frédéric; Lestienne, Patrick

    2005-08-01

    Stretches of cytosines and guanosines have been shown in vitro to adopt non-canonical structures known as i-motifs and G-quartets, respectively. When combined, such sequences are expected to either retain their structure or form duplexes or triple helices. All these structures may occur in vivo whenever the sequence criteria are met. Such stretches are present in the circular genome of human mitochondria, as two 10 nucleotide-long perfect tandem direct repeats (DR1 and DR2). The DR1 and DR2 repeats are G-rich on the heavy strand and C-rich on the light strand. Previous results suggested that during replication, transient formation of a parallel GGC triple helix between the neo-synthesised G-rich DR1 and the double-stranded homologous DR2 could be involved in a rearrangement process leading to genome instability. In order to get structural insights into the interaction between the two repeats, we have studied by nuclear magnetic resonance (NMR) the assembly properties of a 24-mer oligodeoxyribonucleotide in which the C- and G-rich segments of the DRs are covalently tethered by a TTTT linker. We show here that this 24-mer self-associates into a triplex-containing symmetrical tetramer. The core of the structure is composed of anti-parallel Watson-Crick (WC) base pairs. Two additional strands are hydrogen-bonded to the Hoogsteen side of the Gs, thus forming CGC(+) triple helices, with G-rich ends folding into G-quartets. These results suggest that such structures could occur when the two DRs are put to close proximity in a biological context.

  20. -CH2- lengthening of the internucleotide linkage in the ApA dimer can improve its conformational compatibility with its natural polynucleotide counterpart

    PubMed Central

    Hanu, J.; Barvík, I.; Ruszová-Chmelová, K.; ŠtÆpánek, J.; Turpin, P.-Y.; Bok, J.; Rosenberg, I.; Petrová-Endová, M.

    2001-01-01

    The complete family of ApA phosphonate analogues with the internucleotide linkage elongated by insertion of a -CH2- group was prepared and the hybridisation and structural properties of its members in interaction with polyuridylic acid were investigated using an original 2D Raman approach. Except for the conformationally restricted ACHpA(2′3′endo-5′) modification, all of the isopolar, non-isosteric analogues form triplex-like complexes with poly(rU) at room temperature, in which two polymer strands are bound by Watson–Crick and Hoogsteen bonds to a central pseudostrand consisting of a ‘chain’ of A-dimers. For all of these dimers, the overall conformation of the triplexes was found to be similar according to their extracted Raman spectra. A simple semi-empirical model was introduced to explain the observed dependency of the efficiency of triplex formation on the adenine concentration. Apparently, for most of the modifications studied, the creation of a stable complex at room temperature requires the formation of a central pseudostrand, consisting of several adenine dimers. Molecular dynamics calculations were finally performed to interpret the differences in ‘cooperative’ behaviour between the different dimers studied. The results indicate that the exceptional properties of the ApCH2A(3′-5′) dimer could be caused by the 3D conformational compatibility of this modified linkage with the second (Hoogsteen) poly(rU) strand. PMID:11812852

  1. Implication of the solvent effect, metal ions and topology in the electronic structure and hydrogen bonding of human telomeric G-quadruplex DNA.

    PubMed

    Poudel, Lokendra; Steinmetz, Nicole F; French, Roger H; Parsegian, V Adrian; Podgornik, Rudolf; Ching, Wai-Yim

    2016-08-03

    We present a first-principles density functional study elucidating the effects of solvent, metal ions and topology on the electronic structure and hydrogen bonding of 12 well-designed three dimensional G-quadruplex (G4-DNA) models in different environments. Our study shows that the parallel strand structures are more stable in dry environments and aqueous solutions containing K(+) ions within the tetrad of guanine but conversely, that the anti-parallel structure is more stable in solutions containing the Na(+) ions within the tetrad of guanine. The presence of metal ions within the tetrad of the guanine channel always enhances the stability of the G4-DNA models. The parallel strand structures have larger HOMO-LUMO gaps than antiparallel structures, which are in the range of 0.98 eV to 3.11 eV. Partial charge calculations show that sugar and alkali ions are positively charged whereas nucleobases, PO4 groups and water molecules are all negatively charged. Partial charges on each functional group with different signs and magnitudes contribute differently to the electrostatic interactions involving G4-DNA and favor the parallel structure. A comparative study between specific pairs of different G4-DNA models shows that the Hoogsteen OH and NH hydrogen bonds in the guanine tetrad are significantly influenced by the presence of metal ions and water molecules, collectively affecting the structure and the stability of G4-DNA.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Topping, R.J.; Stone, M.P.; Brush, C.K.

    The {sup 1}H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25{degree}C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25{degree}C, the various conformational state in the mixture are in rapid exchange on the NMR time scale.more » Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5{degree}C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C{sup +}:G base pairs.« less

  3. New Approaches Towards Recognition of Nucleic Acid Triple Helices

    PubMed Central

    Arya, Dev P.

    2012-01-01

    We show that groove recognition of nucleic acid triple helices can be achieved with aminosugars. Among these aminosugars, neomycin is the most effective aminoglycoside (groove binder) for stabilizing a DNA triple helix. It stabilizes both the T·A·T triplex and mixed-base DNA triplexes better than known DNA minor groove binders (which usually destabilize the triplex) and polyamines. Neomycin selectively stabilizes the triplex (T·A·T and mixed base) without any effect on the DNA duplex. The selectivity of neomycin likely originates from its potential and shape complementarity to the triplex Watson–Hoogsteen groove, making it the first molecule that selectively recognizes a triplex groove over a duplex groove. The groove recognition of aminoglycosides is not limited to DNA triplexes, but also extends to RNA and hybrid triple helical structures. Intercalator–neomycin conjugates are shown to simultaneously probe the base stacking and groove surface in the DNA triplex. Calorimetric and spectrosocopic studies allow the quantification of the effect of surface area of the intercalating moiety on binding to the triplex. These studies outline a novel approach to the recognition of DNA triplexes that incorporates the use of non-competing binding sites. These principles of dual recognition should be applicable to the design of ligands that can bind any given nucleic acid target with nanomolar affinities and with high selectivity. PMID:21073199

  4. Orientation Preferences of Backbone Secondary Amide Functional Groups in Peptide Nucleic Acid Complexes: Quantum Chemical Calculations Reveal an Intrinsic Preference of Cationic D-Amino Acid-Based Chiral PNA Analogues for the P-form

    PubMed Central

    Topham, Christopher M.; Smith, Jeremy C.

    2007-01-01

    Geometric descriptions of nonideal interresidue hydrogen bonding and backbone-base water bridging in the minor groove are established in terms of polyamide backbone carbonyl group orientation from analyses of residue junction conformers in experimentally determined peptide nucleic acid (PNA) complexes. Two types of interresidue hydrogen bonding are identified in PNA conformers in heteroduplexes with nucleic acids that adopt A-like basepair stacking. Quantum chemical calculations on the binding of a water molecule to an O2 base atom in glycine-based PNA thymine dimers indicate that junctions modeled with P-form backbone conformations are lower in energy than a dimer comprising the predominant conformation observed in A-like helices. It is further shown in model systems that PNA analogs based on D-lysine are better able to preorganize in a conformation exclusive to P-form helices than is glycine-based PNA. An intrinsic preference for this conformation is also exhibited by positively charged chiral PNA dimers carrying 3-amino-D-alanine or 4-aza-D-leucine residue units that provide for additional rigidity by side-chain hydrogen bonding to the backbone carbonyl oxygen. Structural modifications stabilizing P-form helices may obviate the need for large heterocycles to target DNA pyrimidine bases via PNA·DNA-PNA triplex formation. Quantum chemical modeling methods are used to propose candidate PNA Hoogsteen strand designs. PMID:17071666

  5. Exploiting hydrogen bonding interactions to probe smaller linear and cyclic diamines binding to G-quadruplexes: a DFT and molecular dynamics study.

    PubMed

    Kanti Si, Mrinal; Sen, Anik; Ganguly, Bishwajit

    2017-05-10

    G-quadruplexes are formed by the association of four guanine bases through Hoogsteen hydrogen bonding in guanine-rich sequences of DNA and exist in the telomere as well as in promoter regions of certain oncogenes. The sequences of G-quadruplex-DNA are targets for the design of molecules that can bind and can be developed as anti-cancer drugs. The linear and cyclic protonated diamines have been explored to bind to G-quadruplex-DNA through hydrogen bonding interactions. The quadruplex-DNA binders exploit π-stacking and hydrogen bonding interactions with the phosphate backbone of loops and grooves. In this study, linear and cyclic protonated diamines showed remarkable binding affinity for G-tetrads using hydrogen bonding interactions. The DFT M06-2X/6-31G(d)//B3LYP/6-31+G(d) level of theory showed that the cyclic ee-1,2-CHDA (equatorial-equatorial form of 1,2-disubstituted cyclohexadiamine di-cation) binds to the G-tetrads very strongly (∼70.0 kcal mol -1 ), with a much higher binding energy than the linear protonated diamines. The binding affinity of ligands for G-tetrads with counterions has also been examined. The binding preference of these small ligands for G-tetrads is higher than for DNA-duplex. The binding affinity of an intercalated acridine-based ligand (BRACO-19) for G-quadruplexes has been examined and the binding energy is relatively lower than that for the 1,2 disubstituted cyclohexadiamine di-cation with G-tetrads. The atoms-in-molecules (AIM) analysis reveals that the hydrogen bonding interactions between the organic systems with G-tetrads are primarily electrostatic in nature. The molecular dynamics simulations performed using a classical force field (GROMACS) also supported the phosphate backbone sites of G-quadruplex-DNA to bind to these diamines. To mimic the structural pattern of BRACO-19, the designed inhibitor N,2-bis-2(3,4-aminocyclohexyl) acetamide (9) examined possesses two 1,2-CHDA moieties linked through an acetamide group. The molecular dynamics results showed that the designed molecule 9 can efficiently bind to the base-pairs and the phosphate backbone of G quadruplex-DNA using H-bonding interactions. The binding affinity calculated for the intercalated acridine-based drug (BRACO-19) with G-quadruplexes is weaker compared to ee-1,2-CHDA. These ligands deliver a different binding motif (hydrogen bonding) compared to the reported G-quadruplex binders of π-delocalized systems and will kindle interest in examining such scaffolds to stabilize DNA.

  6. Effect of 5-methylcytosine on the stability of triple-stranded DNA--a thermodynamic study.

    PubMed Central

    Xodo, L E; Manzini, G; Quadrifoglio, F; van der Marel, G A; van Boom, J H

    1991-01-01

    We have previously shown that the pyrimidine oligonucleotide 5'CTTCCTCCTCT (Y11) recognizes the double-helical stem of hairpin 5'GAAGGAGGAGA-T4-TCTCCTCCTTC (h26) by triple-helix formation (1). In this paper, we report the effect on triplex formation of substituting the cytosine residues of Y11 with 5-methylcytosines (5meY11). In addition, we have studied the thermodynamics of the interaction between h26 and 5meY11. The results can be summarised as follows: (i) gel electrophoresis shows that at T = 5 degrees C and pH 5, both Y11 and 5meY11 form DNA triple helices with h26, whereas at pH 6.8 only the methylated strand binds to h26; (ii) pH-stability curves of the DNA triplexes formed from h26 + Y11 and h26 + 5meY11 show that Y11 and 5meY11 are semi-protonated at pH 5.7 and 6.7, respectively. Thus, it is concluded that cytosine methylation expands the pH range compatible with triplex formation by one pH unit; (iii) as the unmethylated triplex (h26:Y11), the methylated one (h26:5meY11) denatures in a biphasic manner, in which the low temperature transition results from the dissociation of 5meY11 from h26. The Tm of the triplex to h26 plus 5meY11 transition is strongly enhanced (about 10 degrees C) by cytosine methylation. A van 't Hoff analysis of denaturation curves is presented; (iv) DSC experiments show that triplex formation between 5meY11 and h26 is characterized by delta H = -237 +/- 25 kJ/mol and delta S = -758 +/- 75 J/Kmol, corresponding to an average delta H of -21 kJ/mol and delta S of -69 J/Kmol per Hoogsteen base pair; (v) the thermodynamic analysis indicates that the extra stability imparted to the triplex by methylcytosine is entropic in origin. Images PMID:1945840

  7. The role of molecular structure of sugar-phosphate backbone and nucleic acid bases in the formation of single-stranded and double-stranded DNA structures.

    PubMed

    Poltev, Valeri; Anisimov, Victor M; Danilov, Victor I; Garcia, Dolores; Sanchez, Carolina; Deriabina, Alexandra; Gonzalez, Eduardo; Rivas, Francisco; Polteva, Nina

    2014-06-01

    Our previous DFT computations of deoxydinucleoside monophosphate complexes with Na(+)-ions (dDMPs) have demonstrated that the main characteristics of Watson-Crick (WC) right-handed duplex families are predefined in the local energy minima of dDMPs. In this work, we study the mechanisms of contribution of chemically monotonous sugar-phosphate backbone and the bases into the double helix irregularity. Geometry optimization of sugar-phosphate backbone produces energy minima matching the WC DNA conformations. Studying the conformational variability of dDMPs in response to sequence permutation, we found that simple replacement of bases in the previously fully optimized dDMPs, e.g. by constructing Pyr-Pur from Pur-Pyr, and Pur-Pyr from Pyr-Pur sequences, while retaining the backbone geometry, automatically produces the mutual base position characteristic of the target sequence. Based on that, we infer that the directionality and the preferable regions of the sugar-phosphate torsions, combined with the difference of purines from pyrimidines in ring shape, determines the sequence dependence of the structure of WC DNA. No such sequence dependence exists in dDMPs corresponding to other DNA conformations (e.g., Z-family and Hoogsteen duplexes). Unlike other duplexes, WC helix is unique by its ability to match the local energy minima of the free single strand to the preferable conformations of the duplex. Copyright © 2013 Wiley Periodicals, Inc.

  8. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    PubMed

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  9. Prediction of pH-dependent properties of DNA triple helices.

    PubMed

    Hüsler, P L; Klump, H H

    1995-02-20

    The thermodynamic properties of two triple helices were investigated by uv thermal denaturation, differential scanning calorimetry, and pH titrations. Starting from the grand partition function and using matrix methods we present a formalism that describes pH effects on the thermal stability of triple helices. The formalism can be used over a wide pH range and is not restricted to the limiting case where the pH is larger or smaller than the pK alpha of cytosine. Furthermore, it covers nearest neighbor electrostatic effects of closely spaced cytosines in the Hoogsteen strand which can shift the pK alpha of cytosine to lower pH values. A procedure is employed to predict enthalpy and entropy changes for triplex formation. These values are in accordance with the results obtained by differential scanning calorimetry.

  10. How Does Mg2+ Modulate the RNA Folding Mechanism: A Case Study of the G:C W:W Trans Basepair.

    PubMed

    Halder, Antarip; Roy, Rohit; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2017-07-25

    Reverse Watson-Crick G:C basepairs (G:C W:W Trans) occur frequently in different functional RNAs. This is one of the few basepairs whose gas-phase-optimized isolated geometry is inconsistent with the corresponding experimental geometry. Several earlier studies indicate that through post-transcriptional modification, direct protonation, or coordination with Mg 2+ , accumulation of positive charge near N7 of guanine can stabilize the experimental geometry. Interestingly, recent studies reveal significant variation in the position of putatively bound Mg 2+ . This, in conjunction with recently raised doubts regarding some of the Mg 2+ assignments near the imino nitrogen of guanine, is suggestive of the existence of multiple Mg 2+ binding modes for this basepair. Our detailed investigation of Mg 2+ -bound G:C W:W Trans pairs occurring in high-resolution RNA crystal structures shows that they are found in 14 different contexts, eight of which display Mg 2+ binding at the Hoogsteen edge of guanine. Further examination of occurrences in these eight contexts led to the characterization of three different Mg 2+ binding modes: 1) direct binding via N7 coordination, 2) direct binding via O6 coordination, and 3) binding via hydrogen-bonding interaction with the first-shell water molecules. In the crystal structures, the latter two modes are associated with a buckled and propeller-twisted geometry of the basepair. Interestingly, respective optimized geometries of these different Mg 2+ binding modes (optimized using six different DFT functionals) are consistent with their corresponding experimental geometries. Subsequent interaction energy calculations at the MP2 level, and decomposition of its components, suggest that for G:C W:W Trans , Mg 2+ binding can fine tune the basepair geometries without compromising with their stability. Our results, therefore, underline the importance of the mode of binding of Mg 2+ ions in shaping RNA structure, folding and function. Copyright © 2017. Published by Elsevier Inc.

  11. Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

    PubMed

    Schneider, Uffe Vest

    2012-01-01

    This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

  12. Active-site monovalent cations revealed in a 1.55-Å-resolution hammerhead ribozyme structure.

    PubMed

    Anderson, Michael; Schultz, Eric P; Martick, Monika; Scott, William G

    2013-10-23

    We have obtained a 1.55-Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni under conditions that permit detailed observations of Na(+) ion binding in the ribozyme's active site. At least two such Na(+) ions are observed. The first Na(+) ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical with that previously observed for divalent cations. A second Na(+) ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with that of previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na(+), but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na(+) directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active-site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest-resolution ribozyme structure in the Protein Data Bank. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  14. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  15. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  16. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  18. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  19. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  20. Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

    PubMed

    Kimoto, Michiko; Hirao, Ichiro

    2017-10-20

    Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

  1. G-triplex structure and formation propensity

    PubMed Central

    Cerofolini, Linda; Amato, Jussara; Giachetti, Andrea; Limongelli, Vittorio; Novellino, Ettore; Parrinello, Michele; Fragai, Marco; Randazzo, Antonio; Luchinat, Claudio

    2014-01-01

    The occurrence of a G-triplex folding intermediate of thrombin binding aptamer (TBA) has been recently predicted by metadynamics calculations, and experimentally supported by Nuclear Magnetic Resonance (NMR), Circular Dichroism (CD) and Differential Scanning Calorimetry (DSC) data collected on a 3′ end TBA-truncated 11-mer oligonucleotide (11-mer-3′-t-TBA). Here we present the solution structure of 11-mer-3′-t-TBA in the presence of potassium ions. This structure is the first experimental example of a G-triplex folding, where a network of Hoogsteen-like hydrogen bonds stabilizes six guanines to form two G:G:G triad planes. The G-triplex folding of 11-mer-3′-t-TBA is stabilized by the potassium ion and destabilized by increasing the temperature. The superimposition of the experimental structure with that predicted by metadynamics shows a great similarity, with only significant differences involving two loops. These new structural data show that 11-mer-3′-t-TBA assumes a G-triplex DNA conformation as its stable form, reinforcing the idea that G-triplex folding intermediates may occur in vivo in human guanine-rich sequences. NMR and CD screening of eight different constructs obtained by removing from one to four bases at either the 3′ and the 5′ ends show that only the 11-mer-3′-t-TBA yields a relatively stable G-triplex. PMID:25378342

  2. The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.

    PubMed

    Slepokura, Katarzyna

    2012-08-01

    In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.

  3. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  4. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  5. Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms

    PubMed Central

    2015-01-01

    ABSTRACT Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

  6. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.

  7. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  8. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  9. Constitutional self-organization of adenine-uracil-derived hybrid materials.

    PubMed

    Arnal-Hérault, Carole; Barboiu, Mihai; Pasc, Andreea; Michau, Mathieu; Perriat, Pascal; van der Lee, Arie

    2007-01-01

    The alkoxysilane nucleobase adenine (A) and uracil (U) precursors described in this paper generate in solution a complex library of hydrogen-bonded aggregates, which can be expressed in the solid state as discrete higher oligomers. The different interconverting outputs that nucleobases may form by oligomerization define a dynamic polyfunctional diversity that may be "extracted selectively" in solid state by sol-gel transcription, under the intrinsic stability of the system. After the sol-gel process, unique constitutional preference for specific geometries in hybrid materials is consistent with a preferential arrangement of nucleobase systems, favoring the self-assembly by the Hoogsteen geometry. FTIR and NMR spectroscopy and X-ray powder diffraction experiments demonstrate the formation of self-organized hybrid supramolecular materials. Electron microscopy reveals the micrometric platelike morphology of the hybrid materials. The M(A-U) hybrid material is nanostructured in ordered circular domains of 5 nm in diameter of alternative light and dark rows with an one-dimensional periodicity of 3.5 A.

  10. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  11. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  12. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  13. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  14. How Y-Family DNA polymerase IV is more accurate than Dpo4 at dCTP insertion opposite an N2-dG adduct of benzo[a]pyrene.

    PubMed

    Sholder, Gabriel; Creech, Amanda; Loechler, Edward L

    2015-11-01

    To bypass DNA damage, cells have Y-Family DNA polymerases (DNAPs). One Y-Family-class includes DNAP κ and DNAP IV, which accurately insert dCTP opposite N(2)-dG adducts, including from the carcinogen benzo[a]pyrene (BP). Another class includes DNAP η and DNAP V, which insert accurately opposite UV-damage, but inaccurately opposite BP-N(2)-dG. To investigate structural differences between Y-Family-classes, regions are swapped between DNAP IV (a κ/IV-class-member) and Dpo4 (a η/V-class-member); the kinetic consequences are evaluated via primer-extension studies with a BP-N(2)-dG-containing template. Four key structural elements are revealed. (1) Y-Family DNAPs have discreet non-covalent contacts between their little finger-domain (LF-Domain) and their catalytic core-domain (CC-Domain), which we call "non-covalent bridges" (NCBs). Arg37 and Arg38 in DNAP IV's CC-Domain near the active site form a non-covalent bridge (AS-NCB) by interacting with Glu251 and Asp252, respectively, in DNAP IV's LF-Domain. Without these interactions dATP/dGTP/dTTP misinsertions increase. DNAP IV's AS-NCB suppresses misinsertions better than Dpo4's equivalent AS-NCB. (2) DNAP IV also suppresses dATP/dGTP/dTTP misinsertions via a second non-covalent bridge, which is ∼8Å from the active site (Distal-NCB). Dpo4 has no Distal-NCB, rendering it inferior at dATP/dGTP/dTTP suppression. (3) dCTP insertion is facilitated by the larger minor groove opening near the active site in DNAP IV versus Dpo4, which is sensible given that Watson/Crick-like [dCTP:BP-N(2)-dG] pairing requires the BP-moiety to be in the minor groove. (4) Compared to Dpo4, DNAP IV has a smaller major groove opening, which suppresses dGTP misinsertion, implying BP-N(2)-dG bulk in the major groove during Hoogsteen syn-adduct-dG:dGTP pairing. In summary, DNAP IV has a large minor groove opening to enhance dCTP insertion, a plugged major groove opening to suppress dGTP misinsertion, and two non-covalent bridges (near and distal to the active site) to suppress dATP/dGTP/dTTP misinsertions; collectively these four structural features enhance DNAP IV's dNTP insertion fidelity opposite a BP-N(2)-dG adduct compared to Dpo4. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  16. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  17. Rotational-translational fourier imaging system

    NASA Technical Reports Server (NTRS)

    Campbell, Jonathan W. (Inventor)

    2004-01-01

    This invention has the ability to create Fourier-based images with only two grid pairs. The two grid pairs are manipulated in a manner that allows (1) a first grid pair to provide multiple real components of the Fourier-based image and (2) a second grid pair to provide multiple imaginary components of the Fourier-based image. The novelty of this invention resides in the use of only two grid pairs to provide the same imaging information that has been traditionally collected with multiple grid pairs.

  18. Efficient Implementation of the Pairing on Mobilephones Using BREW

    NASA Astrophysics Data System (ADS)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  19. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  1. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  2. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  5. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  6. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Comparison of clinical knowledge bases for summarization of electronic health records.

    PubMed

    McCoy, Allison B; Sittig, Dean F; Wright, Adam

    2013-01-01

    Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okutsu, N.; Shimamura, K.; Shimizu, E.

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-Cmore » base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.« less

  9. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  10. Structure based alignment and clustering of proteins (STRALCP)

    DOEpatents

    Zemla, Adam T.; Zhou, Carol E.; Smith, Jason R.; Lam, Marisa W.

    2013-06-18

    Disclosed are computational methods of clustering a set of protein structures based on local and pair-wise global similarity values. Pair-wise local and global similarity values are generated based on pair-wise structural alignments for each protein in the set of protein structures. Initially, the protein structures are clustered based on pair-wise local similarity values. The protein structures are then clustered based on pair-wise global similarity values. For each given cluster both a representative structure and spans of conserved residues are identified. The representative protein structure is used to assign newly-solved protein structures to a group. The spans are used to characterize conservation and assign a "structural footprint" to the cluster.

  11. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  12. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  13. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  14. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  15. A fiber optic biosensor for fluorimetric detection of triple-helical DNA.

    PubMed

    Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J

    1997-10-15

    A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.

  16. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

  18. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  19. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  20. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  2. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    PubMed

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  3. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  4. Development and evaluation of a crowdsourcing methodology for knowledge base construction: identifying relationships between clinical problems and medications

    PubMed Central

    Wright, Adam; Laxmisan, Archana; Ottosen, Madelene J; McCoy, Jacob A; Butten, David; Sittig, Dean F

    2012-01-01

    Objective We describe a novel, crowdsourcing method for generating a knowledge base of problem–medication pairs that takes advantage of manually asserted links between medications and problems. Methods Through iterative review, we developed metrics to estimate the appropriateness of manually entered problem–medication links for inclusion in a knowledge base that can be used to infer previously unasserted links between problems and medications. Results Clinicians manually linked 231 223 medications (55.30% of prescribed medications) to problems within the electronic health record, generating 41 203 distinct problem–medication pairs, although not all were accurate. We developed methods to evaluate the accuracy of the pairs, and after limiting the pairs to those meeting an estimated 95% appropriateness threshold, 11 166 pairs remained. The pairs in the knowledge base accounted for 183 127 total links asserted (76.47% of all links). Retrospective application of the knowledge base linked 68 316 medications not previously linked by a clinician to an indicated problem (36.53% of unlinked medications). Expert review of the combined knowledge base, including inferred and manually linked problem–medication pairs, found a sensitivity of 65.8% and a specificity of 97.9%. Conclusion Crowdsourcing is an effective, inexpensive method for generating a knowledge base of problem–medication pairs that is automatically mapped to local terminologies, up-to-date, and reflective of local prescribing practices and trends. PMID:22582202

  5. Acuity of a Cryptochrome and Vision-Based Magnetoreception System in Birds

    PubMed Central

    Solov'yov, Ilia A.; Mouritsen, Henrik; Schulten, Klaus

    2010-01-01

    Abstract The magnetic compass of birds is embedded in the visual system and it has been hypothesized that the primary sensory mechanism is based on a radical pair reaction. Previous models of magnetoreception have assumed that the radical pair-forming molecules are rigidly fixed in space, and this assumption has been a major objection to the suggested hypothesis. In this article, we investigate theoretically how much disorder is permitted for the radical pair-forming, protein-based magnetic compass in the eye to remain functional. Our study shows that only one rotational degree of freedom of the radical pair-forming protein needs to be partially constrained, while the other two rotational degrees of freedom do not impact the magnetoreceptive properties of the protein. The result implies that any membrane-associated protein is sufficiently restricted in its motion to function as a radical pair-based magnetoreceptor. We relate our theoretical findings to the cryptochromes, currently considered the likeliest candidate to furnish radical pair-based magnetoreception. PMID:20655831

  6. A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

    PubMed Central

    Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

    2015-01-01

    The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

  7. Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

    PubMed Central

    van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

    1997-01-01

    The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

  8. Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

    DOE PAGES

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

  9. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  10. Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

    PubMed

    Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

    2015-11-30

    In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

  11. Orbital selective pairing and gap structures of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  12. Orbital selective pairing and gap structures of iron-based superconductors

    DOE PAGES

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

    2017-05-08

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  13. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed Central

    Nonin, S; Leroy, J L; Gueron, M

    1996-01-01

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

  14. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed

    Nonin, S; Leroy, J L; Gueron, M

    1996-02-15

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

  15. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    DTIC Science & Technology

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  16. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  17. Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

    PubMed

    Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

    2005-01-01

    Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

  18. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  19. [Mass spectrometric and quantum chemical study of dimeric associates of nucleosides].

    PubMed

    Sukhodub, L F; Aksenov, S A; Boldeskul, A I

    1995-01-01

    Deoxyribonucleosides H-bonded pairs were investigated using fast atom bombardment mass spectrometry and MNDO/H quantum chemistry method. It was shown that "rare" (enol or imin) forms of the nitrogen bases could form pairs with energy comparable with "canonical" base pair energy. It was shown that pair stability rows, which are measured using different experimental techniques, were in conformity each with other.

  20. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  1. Understanding the kinetic mechanism of RNA single base pair formation

    PubMed Central

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-01

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

  2. Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

    PubMed

    Nonin, S; Jiang, F; Patel, D J

    1997-05-02

    We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

  3. The electrostatic characteristics of G·U wobble base pairs

    PubMed Central

    Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

    2007-01-01

    G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

  4. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

    PubMed Central

    Cotton, R G; Rodrigues, N R; Campbell, R D

    1988-01-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

  5. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    PubMed

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

    ERIC Educational Resources Information Center

    Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

    2010-01-01

    This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

  7. Weak nanoscale chaos and anomalous relaxation in DNA

    NASA Astrophysics Data System (ADS)

    Mazur, Alexey K.

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  8. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  9. Weak nanoscale chaos and anomalous relaxation in DNA.

    PubMed

    Mazur, Alexey K

    2017-06-01

    Anomalous nonexponential relaxation in hydrated biomolecules is commonly attributed to the complexity of the free-energy landscapes, similarly to polymers and glasses. It was found recently that the hydrogen-bond breathing of terminal DNA base pairs exhibits a slow power-law relaxation attributable to weak Hamiltonian chaos, with parameters similar to experimental data. Here, the relationship is studied between this motion and spectroscopic signals measured in DNA with a small molecular photoprobe inserted into the base-pair stack. To this end, the earlier computational approach in combination with an analytical theory is applied to the experimental DNA fragment. It is found that the intensity of breathing dynamics is strongly increased in the internal base pairs that flank the photoprobe, with anomalous relaxation quantitatively close to that in terminal base pairs. A physical mechanism is proposed to explain the coupling between the relaxation of base-pair breathing and the experimental response signal. It is concluded that the algebraic relaxation observed experimentally is very likely a manifestation of weakly chaotic dynamics of hydrogen-bond breathing in the base pairs stacked to the photoprobe and that the weak nanoscale chaos can represent an ubiquitous hidden source of nonexponential relaxation in ultrafast spectroscopy.

  10. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  11. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  12. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  13. Layer-Based Approach for Image Pair Fusion.

    PubMed

    Son, Chang-Hwan; Zhang, Xiao-Ping

    2016-04-20

    Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.

  14. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  15. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  16. Base drive circuit

    DOEpatents

    Lange, A.C.

    1995-04-04

    An improved base drive circuit having a level shifter for providing bistable input signals to a pair of non-linear delays. The non-linear delays provide gate control to a corresponding pair of field effect transistors through a corresponding pair of buffer components. The non-linear delays provide delayed turn-on for each of the field effect transistors while an associated pair of transistors shunt the non-linear delays during turn-off of the associated field effect transistor. 2 figures.

  17. An Intelligent Model for Pairs Trading Using Genetic Algorithms.

    PubMed

    Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

  18. An Intelligent Model for Pairs Trading Using Genetic Algorithms

    PubMed Central

    Hsu, Chi-Jen; Chen, Chi-Chung; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice. PMID:26339236

  19. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

  20. Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

    NASA Astrophysics Data System (ADS)

    Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

    2018-01-01

    We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

  1. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  2. Structural Basis for the Lesion-scanning Mechanism of the MutY DNA Glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Lan; Chakravarthy, Srinivas; Verdine, Gregory L.

    The highly mutagenic A:8-oxoguanine (oxoG) base pair is generated mainly by misreplication of the C:oxoG base pair, the oxidation product of the C:G base pair. The A:oxoG base pair is particularly insidious because neither base in it carries faithful information to direct the repair of the other. The bacterial MutY (MUTYH in humans) adenine DNA glycosylase is able to initiate the repair of A:oxoG by selectively cleaving the A base from the A:oxoG base pair. The difference between faithful repair and wreaking mutagenic havoc on the genome lies in the accurate discrimination between two structurally similar base pairs: A:oxoG andmore » A:T. Here we present two crystal structures of the MutY N-terminal domain in complex with either undamaged DNA or DNA containing an intrahelical lesion. These structures have captured for the first time a DNA glycosylase scanning the genome for a damaged base in the very first stage of lesion recognition and the base extrusion pathway. The mode of interaction observed here has suggested a common lesion-scanning mechanism across the entire helix-hairpin-helix superfamily to which MutY belongs. In addition, small angle X-ray scattering studies together with accompanying biochemical assays have suggested a possible role played by the C-terminal oxoG-recognition domain of MutY in lesion scanning.« less

  3. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    PubMed

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  5. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  6. Efficient Acceleration of the Pair-HMMs Forward Algorithm for GATK HaplotypeCaller on Graphics Processing Units.

    PubMed

    Ren, Shanshan; Bertels, Koen; Al-Ars, Zaid

    2018-01-01

    GATK HaplotypeCaller (HC) is a popular variant caller, which is widely used to identify variants in complex genomes. However, due to its high variants detection accuracy, it suffers from long execution time. In GATK HC, the pair-HMMs forward algorithm accounts for a large percentage of the total execution time. This article proposes to accelerate the pair-HMMs forward algorithm on graphics processing units (GPUs) to improve the performance of GATK HC. This article presents several GPU-based implementations of the pair-HMMs forward algorithm. It also analyzes the performance bottlenecks of the implementations on an NVIDIA Tesla K40 card with various data sets. Based on these results and the characteristics of GATK HC, we are able to identify the GPU-based implementations with the highest performance for the various analyzed data sets. Experimental results show that the GPU-based implementations of the pair-HMMs forward algorithm achieve a speedup of up to 5.47× over existing GPU-based implementations.

  7. DNA bases ring-expanded with a cyclopentadiene free radical: a theoretical investigation of building blocks with diradical character.

    PubMed

    Zhao, Peiwen; Bu, Yuxiang

    2016-01-14

    In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.

  8. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    NASA Astrophysics Data System (ADS)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  9. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Radical-pair based avian magnetoreception

    NASA Astrophysics Data System (ADS)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  11. Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

    PubMed Central

    Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

    1987-01-01

    We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

  12. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position.

    PubMed

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y; Tor, Yitzhak; Cooperman, Barry S

    2017-08-29

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon University of California base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5'- and 3'-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix.

  13. Building a knowledge base of severe adverse drug events based on AERS reporting data using semantic web technologies.

    PubMed

    Jiang, Guoqian; Wang, Liwei; Liu, Hongfang; Solbrig, Harold R; Chute, Christopher G

    2013-01-01

    A semantically coded knowledge base of adverse drug events (ADEs) with severity information is critical for clinical decision support systems and translational research applications. However it remains challenging to measure and identify the severity information of ADEs. The objective of the study is to develop and evaluate a semantic web based approach for building a knowledge base of severe ADEs based on the FDA Adverse Event Reporting System (AERS) reporting data. We utilized a normalized AERS reporting dataset and extracted putative drug-ADE pairs and their associated outcome codes in the domain of cardiac disorders. We validated the drug-ADE associations using ADE datasets from SIDe Effect Resource (SIDER) and the UMLS. We leveraged the Common Terminology Criteria for Adverse Event (CTCAE) grading system and classified the ADEs into the CTCAE in the Web Ontology Language (OWL). We identified and validated 2,444 unique Drug-ADE pairs in the domain of cardiac disorders, of which 760 pairs are in Grade 5, 775 pairs in Grade 4 and 2,196 pairs in Grade 3.

  14. Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

    PubMed

    Nonin, S; Leroy, J L; Guéron, M

    1995-08-22

    We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

  15. Hybrid-denovo: a de novo OTU-picking pipeline integrating single-end and paired-end 16S sequence tags.

    PubMed

    Chen, Xianfeng; Johnson, Stephen; Jeraldo, Patricio; Wang, Junwen; Chia, Nicholas; Kocher, Jean-Pierre A; Chen, Jun

    2018-03-01

    Illumina paired-end sequencing has been increasingly popular for 16S rRNA gene-based microbiota profiling. It provides higher phylogenetic resolution than single-end reads due to a longer read length. However, the reverse read (R2) often has significant low base quality, and a large proportion of R2s will be discarded after quality control, resulting in a mixture of paired-end and single-end reads. A typical 16S analysis pipeline usually processes either paired-end or single-end reads but not a mixture. Thus, the quantification accuracy and statistical power will be reduced due to the loss of a large amount of reads. As a result, rare taxa may not be detectable with the paired-end approach, or low taxonomic resolution will result in a single-end approach. To have both the higher phylogenetic resolution provided by paired-end reads and the higher sequence coverage by single-end reads, we propose a novel OTU-picking pipeline, hybrid-denovo, that can process a hybrid of single-end and paired-end reads. Using high-quality paired-end reads as a gold standard, we show that hybrid-denovo achieved the highest correlation with the gold standard and performed better than the approaches based on paired-end or single-end reads in terms of quantifying the microbial diversity and taxonomic abundances. By applying our method to a rheumatoid arthritis (RA) data set, we demonstrated that hybrid-denovo captured more microbial diversity and identified more RA-associated taxa than a paired-end or single-end approach. Hybrid-denovo utilizes both paired-end and single-end 16S sequencing reads and is recommended for 16S rRNA gene targeted paired-end sequencing data.

  16. Relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian: Relativistic pair correlation energies of the Xe atom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eliav, E.; Kaldor, U.; Ishikawa, Y.

    1994-12-31

    Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.

  17. On twelve types of covering-based rough sets.

    PubMed

    Safari, Samira; Hooshmandasl, Mohammad Reza

    2016-01-01

    Covering approximation spaces are a generalization of equivalence-based rough set theories. In this paper, we will consider twelve types of covering based approximation operators by combining four types of covering lower approximation operators and three types of covering upper approximation operators. Then, we will study the properties of these new pairs and show they have most of the common properties among existing covering approximation pairs. Finally, the relation between these new pairs is studied.

  18. Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.

    PubMed

    Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay

    2005-12-01

    Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yujie; Gong, Sha; Wang, Zhen

    The thermodynamic and kinetic parameters of an RNA base pair were obtained through a long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The thermodynamic parameters were in good agreement with the nearest-neighbor model. The opening rates showed strong temperature dependence, however, the closing rates showed only weak temperature dependence. The transition path time was weakly temperature dependent and was insensitive to the energy barrier. The diffusion constant exhibited super-Arrhenius behavior. The free energy barrier of breaking a single base stack results from the enthalpy increase, ΔH, caused by the disruption ofmore » hydrogen bonding and base-stacking interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss, ΔS, caused by the restriction of torsional angles. These results suggest that a one-dimensional free energy surface is sufficient to accurately describe the dynamics of base pair opening and closing, and the dynamics are Brownian.« less

  20. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.

  1. Effect of genome sequence on the force-induced unzipping of a DNA molecule.

    PubMed

    Singh, N; Singh, Y

    2006-02-01

    We considered a dsDNA polymer in which distribution of bases are random at the base pair level but ordered at a length of 18 base pairs and calculated its force elongation behaviour in the constant extension ensemble. The unzipping force F(y) vs. extension y is found to have a series of maxima and minima. By changing base pairs at selected places in the molecule we calculated the change in F(y) curve and found that the change in the value of force is of the order of few pN and the range of the effect depending on the temperature, can spread over several base pairs. We have also discussed briefly how to calculate in the constant force ensemble a pause or a jump in the extension-time curve from the knowledge of F(y).

  2. Quantum entanglement and quantum information in biological systems (DNA)

    NASA Astrophysics Data System (ADS)

    Hubač, Ivan; Švec, Miloslav; Wilson, Stephen

    2017-12-01

    Recent studies of DNA show that the hydrogen bonds between given base pairs can be treated as diabatic systems with spin-orbit coupling. For solid state systems strong diabaticity and spin-orbit coupling the possibility of forming Majorana fermions has been discussed. We analyze the hydrogen bonds in the base pairs in DNA from this perspective. Our analysis is based on a quasiparticle supersymmetric transformation which couples electronic and vibrational motion and includes normal coordinates and the corresponding momenta. We define qubits formed by Majorana fermions in the hydrogen bonds and also discuss the entangled states in base pairs. Quantum information and quantum entropy are introduced. In addition to the well-known classical information connected with the DNA base pairs, we also consider quantum information and show that the classical and quantum information are closely connected.

  3. Paired peer review of university classroom teaching in a school of nursing and midwifery.

    PubMed

    Bennett, Paul N; Parker, Steve; Smigiel, Heather

    2012-08-01

    Peer review of university classroom teaching can increase the quality of teaching but is not universally practiced in Australian universities. To report an evaluation of paired peer-review process using both paper and web based teaching evaluation tools. Twenty university teachers in one metropolitan Australian School of Nursing and Midwifery were randomly paired and then randomly assigned to a paper based or web-based peer review tool. Each teacher reviewed each other's classroom teaching as part of a peer review program. The participants then completed an 18 question survey evaluating the peer review tool and paired evaluation process. Responses were analyzed using frequencies and percentages. Regardless of the tool used, participants found this process of peer review positive (75%), collegial (78%), supportive (61%) and non-threatening (71%). Participants reported that the peer review will improve their own classroom delivery (61%), teaching evaluation (61%) and planning (53%). The web-based tool was found to be easier to use and allowed more space than the paper-based tool. Implementation of a web-based paired peer review system can be a positive method of peer review of university classroom teaching. Pairing of teachers to review each other's classroom teaching is a promising strategy and has the potential to improve teaching in teaching universities. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  5. Structural energetics of the adenine tract from an intrinsic transcription terminator.

    PubMed

    Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

    2010-04-02

    Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

  6. Stringent Nucleotide Recognition by the Ribosome at the Middle Codon Position

    PubMed Central

    Liu, Wei; Shin, Dongwon; Ng, Martin; Sanbonmatsu, Karissa Y.; Tor, Yitzhak; Cooperman, Barry S.

    2017-01-01

    Accurate translation of the genetic code depends on mRNA:tRNA codon:anticodon base pairing. Here we exploit an emissive, isosteric adenosine surrogate that allows direct measurement of the kinetics of codon:anticodon base formation during protein synthesis. Our results suggest that codon:anticodon base pairing is subject to tighter constraints at the middle position than at the 5′- and 3′-positions, and further suggest a sequential mechanism of formation of the three base pairs in the codon:anticodon helix. PMID:28850078

  7. The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

    ERIC Educational Resources Information Center

    Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

    2007-01-01

    The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

  8. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  9. Base drive circuit

    DOEpatents

    Lange, Arnold C.

    1995-01-01

    An improved base drive circuit (10) having a level shifter (24) for providing bistable input signals to a pair of non-linear delays (30, 32). The non-linear delays (30, 32) provide gate control to a corresponding pair of field effect transistors (100, 106) through a corresponding pair of buffer components (88, 94). The non-linear delays (30, 32) provide delayed turn-on for each of the field effect transistors (100, 106) while an associated pair of transistors (72, 80) shunt the non-linear delays (30, 32) during turn-off of the associated field effect transistor (100, 106).

  10. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  11. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  12. Retinal biometrics based on Iterative Closest Point algorithm.

    PubMed

    Hatanaka, Yuji; Tajima, Mikiya; Kawasaki, Ryo; Saito, Koko; Ogohara, Kazunori; Muramatsu, Chisako; Sunayama, Wataru; Fujita, Hiroshi

    2017-07-01

    The pattern of blood vessels in the eye is unique to each person because it rarely changes over time. Therefore, it is well known that retinal blood vessels are useful for biometrics. This paper describes a biometrics method using the Jaccard similarity coefficient (JSC) based on blood vessel regions in retinal image pairs. The retinal image pairs were rough matched by the center of their optic discs. Moreover, the image pairs were aligned using the Iterative Closest Point algorithm based on detailed blood vessel skeletons. For registration, perspective transform was applied to the retinal images. Finally, the pairs were classified as either correct or incorrect using the JSC of the blood vessel region in the image pairs. The proposed method was applied to temporal retinal images, which were obtained in 2009 (695 images) and 2013 (87 images). The 87 images acquired in 2013 were all from persons already examined in 2009. The accuracy of the proposed method reached 100%.

  13. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    PubMed

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.

    Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less

  15. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

    PubMed Central

    Watkins, Norman E.; SantaLucia, John

    2005-01-01

    Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

  17. Using Pair Programming to Teach CAD Based Engineering Graphics

    ERIC Educational Resources Information Center

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  18. Magnetic field homogeneity of a conical coaxial coil pair.

    PubMed

    Salazar, F J; Nieves, F J; Bayón, A; Gascón, F

    2017-09-01

    An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

  19. Magnetic field homogeneity of a conical coaxial coil pair

    NASA Astrophysics Data System (ADS)

    Salazar, F. J.; Nieves, F. J.; Bayón, A.; Gascón, F.

    2017-09-01

    An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

  20. Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

    PubMed Central

    Ghorbani, Maryam; Mohammad-Rafiee, Farshid

    2011-01-01

    We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

  1. Intermolecular ‘cross-torque’: the N4-cytosine propargyl residue is rotated to the ‘CH’-edge as a result of Watson–Crick interaction

    PubMed Central

    Domingo, Olwen; Hellmuth, Isabell; Jäschke, Andres; Kreutz, Christoph; Helm, Mark

    2015-01-01

    Propargyl groups are attractive functional groups for labeling purposes, as they allow CuAAC-mediated bioconjugation. Their size minimally exceeds that of a methyl group, the latter being frequent in natural nucleotide modifications. To understand under which circumstances propargyl-containing oligodeoxynucleotides preserve base pairing, we focused on the exocyclic amine of cytidine. Residues attached to the exocyclic N4 may orient away from or toward the Watson–Crick face, ensuing dramatic alteration of base pairing properties. ROESY-NMR experiments suggest a uniform orientation toward the Watson–Crick face of N4-propargyl residues in derivatives of both deoxycytidine and 5-methyl-deoxycytidine. In oligodeoxynucleotides, however, UV-melting indicated that N4-propargyl-deoxycytidine undergoes standard base pairing. This implies a rotation of the propargyl moiety toward the ‘CH’-edge as a result of base pairing on the Watson–Crick face. In oligonucleotides containing the corresponding 5-methyl-deoxycytidine derivative, dramatically reduced melting temperatures indicate impaired Watson–Crick base pairing. This was attributed to a steric clash of the propargyl moiety with the 5-methyl group, which prevents back rotation to the ‘CH’-edge, consequently preventing Watson–Crick geometry. Our results emphasize the tendency of an opposing nucleic acid strand to mechanically rotate single N4-substituents to make way for Watson–Crick base pairing, providing no steric hindrance is present on the ‘CH’-edge. PMID:25934805

  2. The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

    PubMed Central

    Przybilski, Rita; Hammann, Christian

    2007-01-01

    Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

  3. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  4. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    PubMed

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  5. Nanoenergetics and High Hydrogen Content Materials for Space Propulsion

    DTIC Science & Technology

    2014-01-28

    follows [141]: ( ) ( )2 2 , 2 ln 2 ln /Al Al p ox oxAl Al R r R a a r λ λ λ λ λ λ λ = ⎡ ⎤− − − +⎣ ⎦ (29) where ( ) ;Al Al b R a b R r...predictions of the transformation from acid -base pairs (e.g., nitric acid and ammonia) to ion pairs (e.g., NH4+ and NO3-), that is, proton transfer, in...calculations were performed to study the transformation from the stable acid -base pair for isolated formula units to stable ion pairs, as described in the

  6. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    PubMed Central

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  7. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  8. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    DTIC Science & Technology

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

  9. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Mechanism Underlying the Nucleobase-Distinguishing Ability of Benzopyridopyrimidine (BPP).

    PubMed

    Kochman, Michał A; Bil, Andrzej; Miller, R J Dwayne

    2017-11-02

    Benzopyridopyrimidine (BPP) is a fluorescent nucleobase analogue capable of forming base pairs with adenine (A) and guanine (G) at different sites. When incorporated into oligodeoxynucleotides, it is capable of differentiating between the two purine nucleobases by virtue of the fact that its fluorescence is largely quenched when it is base-paired to guanine, whereas base-pairing to adenine causes only a slight reduction of the fluorescence quantum yield. In the present article, the photophysics of BPP is investigated through computer simulations. BPP is found to be a good charge acceptor, as demonstrated by its positive and appreciably large electron affinity. The selective quenching process is attributed to charge transfer (CT) from the purine nucleobase, which is predicted to be efficient in the BPP-G base pair, but essentially inoperative in the BPP-A base pair. The CT process owes its high selectivity to a combination of two factors: the ionization potential of guanine is lower than that of adenine, and less obviously, the site occupied by guanine enables a greater stabilization of the CT state through electrostatic interactions than the one occupied by adenine. The case of BPP illustrates that molecular recognition via hydrogen bonding can enhance the selectivity of photoinduced CT processes.

  11. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Duration comparison: relative stimulus differences stimulus age, and stimulus predictiveness.

    PubMed Central

    Stubbs, D A; Dreyfus, L R; Fetterman, J G; Boynton, D M; Locklin, N; Smith, L D

    1994-01-01

    Under a psychophysical trials procedure, pigeons were presented with a red light of one duration followed by a green light of a second duration. Eight geometrically spaced base durations were paired with one of four shorter and four longer durations as the alternate member of a duration pair, with different pairs randomly intermixed. One choice was reinforced if red had lasted longer than green, and a second choice was reinforced if green had lasted longer. Performance was compared when all the base durations and their pair members were included (entire-range condition) or when only the four longest base durations and their comparison durations (restricted-range condition) were used. Discrimination sensitivity decreased for longer duration pairs under both conditions, supporting a memory-based account. Sensitivity was lower under the restricted-range condition. Under both conditions, a bias to report "green as longer" increased as the second green duration increased. Bias changed as a matching function of the green-duration predictiveness of the correct choice. The results are related to a quantitative model of timing and remembering proposed by Staddon. PMID:8064211

  13. DincRNA: a comprehensive web-based bioinformatics toolkit for exploring disease associations and ncRNA function.

    PubMed

    Cheng, Liang; Hu, Yang; Sun, Jie; Zhou, Meng; Jiang, Qinghua

    2018-06-01

    DincRNA aims to provide a comprehensive web-based bioinformatics toolkit to elucidate the entangled relationships among diseases and non-coding RNAs (ncRNAs) from the perspective of disease similarity. The quantitative way to illustrate relationships of pair-wise diseases always depends on their molecular mechanisms, and structures of the directed acyclic graph of Disease Ontology (DO). Corresponding methods for calculating similarity of pair-wise diseases involve Resnik's, Lin's, Wang's, PSB and SemFunSim methods. Recently, disease similarity was validated suitable for calculating functional similarities of ncRNAs and prioritizing ncRNA-disease pairs, and it has been widely applied for predicting the ncRNA function due to the limited biological knowledge from wet lab experiments of these RNAs. For this purpose, a large number of algorithms and priori knowledge need to be integrated. e.g. 'pair-wise best, pairs-average' (PBPA) and 'pair-wise all, pairs-maximum' (PAPM) methods for calculating functional similarities of ncRNAs, and random walk with restart (RWR) method for prioritizing ncRNA-disease pairs. To facilitate the exploration of disease associations and ncRNA function, DincRNA implemented all of the above eight algorithms based on DO and disease-related genes. Currently, it provides the function to query disease similarity scores, miRNA and lncRNA functional similarity scores, and the prioritization scores of lncRNA-disease and miRNA-disease pairs. http://bio-annotation.cn:18080/DincRNAClient/. biofomeng@hotmail.com or qhjiang@hit.edu.cn. Supplementary data are available at Bioinformatics online.

  14. Self-association and base pairing of guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide solution measured by 15N nuclear magnetic resonance spectroscopy.

    PubMed Central

    Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D

    1980-01-01

    The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658

  15. Sequence of retrovirus provirus resembles that of bacterial transposable elements

    NASA Astrophysics Data System (ADS)

    Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

    1980-06-01

    The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

  16. Extending the language of DNA molecular recognition by polyamides: unexpected influence of imidazole and pyrrole arrangement on binding affinity and specificity.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Howard, Cameron M; Horick, Sarah M; Uthe, Peter B; Le, N Minh; Cox, Kari K; Nguyen, Binh; Pacheco, Kimberly A O; Wilson, W David; Lee, Moses

    2005-01-19

    Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (DeltaT(M)), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-ImPyIm for its cognate DNA (K(eq) = 1.9 x 10(8) M(-1)) and f-PyPyIm for its cognate DNA (K(eq) = 5.9 x 10(5) M(-1)), which could not have been anticipated prior to characterization of these compounds. Moreover, f-ImPyIm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy > -PyPy- > -PyIm- approximately -ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/Im and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/Im has a 10-fold greater affinity for C/G than f/Py has for T/A.

  17. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: an ab initio study.

    PubMed

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.

  18. On the use of magnets to disrupt the physiological compass of birds.

    PubMed

    Wang, K; Mattern, E; Ritz, T

    2006-10-04

    Behavioral researchers have attached magnets to birds during orientation experiments, assuming that such magnets will disrupt their ability to obtain magnetic information. Here, we investigate the effect of an attached magnet on the ability to derive directional information from a radical-pair based compass mechanism. We outline in some detail the geometrical symmetries that would allow a bird to identify magnetic directions in a radical-pair based compass. We show that the artificial field through an attached magnet will quickly disrupt the birds' ability to distinguish pole-ward from equator-ward headings, but that much stronger fields are necessary to disrupt their ability to detect the magnetic axis. Together with estimates of the functional limits of a radical-pair based compass, our calculations suggest that artificial fields of comparable size to the geomagnetic field are not generally sufficient to render a radical-pair based compass non-functional.

  19. Orbital-selective pairing and superconductivity in iron selenides

    NASA Astrophysics Data System (ADS)

    Nica, Emilian M.; Yu, Rong; Si, Qimiao

    2017-12-01

    An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.

  20. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Two-photon production of dilepton pairs in peripheral heavy ion collisions

    NASA Astrophysics Data System (ADS)

    Klein, Spencer R.

    2018-05-01

    The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.

  2. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    PubMed

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Light-dependent magnetoreception in birds: the crucial step occurs in the dark.

    PubMed

    Wiltschko, Roswitha; Ahmad, Margaret; Nießner, Christine; Gehring, Dennis; Wiltschko, Wolfgang

    2016-05-01

    The Radical Pair Model proposes that the avian magnetic compass is based on spin-chemical processes: since the ratio between the two spin states singlet and triplet of radical pairs depends on their alignment in the magnetic field, it can provide information on magnetic directions. Cryptochromes, blue light-absorbing flavoproteins, with flavin adenine dinucleotide as chromophore, are suggested as molecules forming the radical pairs underlying magnetoreception. When activated by light, cryptochromes undergo a redox cycle, in the course of which radical pairs are generated during photo-reduction as well as during light-independent re-oxidation. This raised the question as to which radical pair is crucial for mediating magnetic directions. Here, we present the results from behavioural experiments with intermittent light and magnetic field pulses that clearly show that magnetoreception is possible in the dark interval, pointing to the radical pair formed during flavin re-oxidation. This differs from the mechanism considered for cryptochrome signalling the presence of light and rules out most current models of an avian magnetic compass based on the radical pair generated during photo-reduction. Using the radical pair formed during re-oxidation may represent a specific adaptation of the avian magnetic compass. © 2016 The Authors.

  4. Definition of the persistence length in the coarse-grained models of DNA elasticity.

    PubMed

    Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

    2012-11-01

    By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

  5. Pair correlations in low-lying T =0 states of odd-odd nuclei with six nucleons

    NASA Astrophysics Data System (ADS)

    Fu, G. J.; Zhao, Y. M.; Arima, A.

    2018-02-01

    In this paper, we study pair correlations in low-lying T =0 states for two typical cases of odd-odd N =Z nuclei. The first case is six nucleons in a single j =9 /2 shell, for which we study the S -broken-pair approximation, the isoscalar spin-1 pair condensation, and the isoscalar spin-aligned pair condensation, with schematic interactions. In the second case, we study pair approximations and correlation energies for 22Na, 34Cl, 46V, 62Ga, and 94Ag in multi-j shells with effective interactions. A few T =0 states are found to be well represented by isoscalar nucleon pairs. The isoscalar spin-aligned pairs play an important role for the yrast T =0 states with I ˜2 j and I ˜Imax in 22Na, 46V, and 94Ag. The overlap between the isoscalar J =1 pair wave function and the shell-model wave function is around 0.5 for the I =1 ,3 states of 34Cl and the I =1 state of 94Ag. The I =9 state of 62Ga is very well described by the isoscalar J =3 pair condensation. The broken-pair approximation (which is similar to the 2-quasiparticle excitation of the isovector pair condensation) is appropriate for quite few states, such as the I =1 -3 states of 34Cl and the I =5 state of 62Ga. The correlation energies are presented in this paper. It is noted that the picture based on nucleon-pair wave functions is not always in agreement with the picture based on correlation energies.

  6. PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

    NASA Technical Reports Server (NTRS)

    Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

    2003-01-01

    Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

  7. Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

    PubMed

    Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

    1998-03-03

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

  8. Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

    PubMed Central

    Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

    1998-01-01

    The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

  9. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  10. Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

    PubMed

    Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

    2014-05-01

    The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

  11. Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

    PubMed Central

    Been, M D; Perrotta, A T

    1995-01-01

    A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

  12. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  13. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE PAGES

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-02

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  14. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    PubMed

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  15. Organic ion association in aqueous phase and ab initio-based force fields: The case of carboxylate/ammonium salts

    NASA Astrophysics Data System (ADS)

    Houriez, Céline; Vallet, Valérie; Réal, Florent; Meot-Ner Mautner, Michael; Masella, Michel

    2017-10-01

    We performed molecular dynamics simulations of carboxylate/methylated ammonium ion pairs solvated in bulk water and of carboxylate/methylated ammonium salt solutions at ambient conditions using an ab initio-based polarizable force field whose parameters are assigned to reproduce only high end quantum computations, at the Møller-Plesset second-order perturbation theory/complete basis set limit level, regarding single ions and ion pairs as isolated and micro-hydrated in gas phase. Our results agree with the available experimental results regarding carboxylate/ammonium salt solutions. For instance, our force field approach predicts the percentage of acetate associated with ammonium ions in CH3 COO-/CH3 NH3+ solutions at the 0.2-0.8M concentration scale to range from 14% to 35%, in line with the estimates computed from the experimental ion association constant in liquid water. Moreover our simulations predict the number of water molecules released from the ion first hydration shell to the bulk upon ion association to be about 2.0 ± 0.6 molecules for acetate/protonated amine ion pairs, 3.1 ± 1.5 molecules for the HCOO-/NH4+ pair and 3.3 ± 1.2 molecules for the CH3COO-/(CH3)4N+ pair. For protonated amine-based ion pairs, these values are in line with experiment for alkali/halide pairs solvated in bulk water. All these results demonstrate the promising feature of ab initio-based force fields, i.e., their capacity in accurately modeling chemical systems that cannot be readily investigated using available experimental techniques.

  16. New Common Proper-Motion Pairs with R.A. Between 00h and 01h

    NASA Astrophysics Data System (ADS)

    Caballero, Rafael

    2015-07-01

    This paper presents 37 new common proper-motion pairs. The new pairs have been obtained employing a semi-automatic procedure based on the inspection of images using the tool Aladin, completed with information obtained from the catalogs available at VizieR. All the pairs fulfill the Halbwachs criteria, employed to increase the probability of a physical bond between the two components.

  17. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  18. Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

    PubMed

    De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

    2018-06-05

    Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  20. The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

    PubMed

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2013-10-01

    The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

  1. Effect of proton transfer on the electronic coupling in DNA

    NASA Astrophysics Data System (ADS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-06-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

  2. Functional network connectivity analysis based on partial correlation in Alzheimer's disease

    NASA Astrophysics Data System (ADS)

    Zhang, Nan; Guan, Xiaoting; Zhang, Yumei; Li, Jingjing; Chen, Hongyan; Chen, Kewei; Fleisher, Adam; Yao, Li; Wu, Xia

    2009-02-01

    Functional network connectivity (FNC) measures the temporal dependency among the time courses of functional networks. However, the marginal correlation between two networks used in the classic FNC analysis approach doesn't separate the FNC from the direct/indirect effects of other networks. In this study, we proposed an alternative approach based on partial correlation to evaluate the FNC, since partial correlation based FNC can reveal the direct interaction between a pair of networks, removing dependencies or influences from others. Previous studies have demonstrated less task-specific activation and less rest-state activity in Alzheimer's disease (AD). We applied present approach to contrast FNC differences of resting state network (RSN) between AD and normal controls (NC). The fMRI data under resting condition were collected from 15 AD and 16 NC. FNC was calculated for each pair of six RSNs identified using Group ICA, thus resulting in 15 (2 out of 6) pairs for each subject. Partial correlation based FNC analysis indicated 6 pairs significant differences between groups, while marginal correlation only revealed 2 pairs (involved in the partial correlation results). Additionally, patients showed lower correlation than controls among most of the FNC differences. Our results provide new evidences for the disconnection hypothesis in AD.

  3. Comparative reactivity of mismatched and unpaired bases in relation to their type and surroundings. Chemical cleavage of DNA mismatches in mutation detection analysis.

    PubMed

    Yakubovskaya, Marianna G; Belyakova, Anna A; Gasanova, Viktoria K; Belitsky, Gennady A; Dolinnaya, Nina G

    2010-07-01

    Systematic study of chemical reactivity of non-Watson-Crick base pairs depending on their type and microenvironment was performed on a model system that represents two sets of synthetic DNA duplexes with all types of mismatched and unmatched bases flanked by T.A or G.C pairs. Using comparative cleavage pattern analysis, we identified the main and additional target bases and performed quantitative study of the time course and efficacy of DNA modification caused by potassium permanganate or hydroxylamine. Potassium permanganate in combination with tetraethylammonium chloride was shown to induce DNA cleavage at all mismatched or bulged T residues, as well as at thymines of neighboring canonical pairs. Other mispaired (bulged) bases and thymine residues located on the second position from the mismatch site were not the targets for KMnO(4) attack. In contrast, hydroxylamine cleaved only heteroduplexes containing mismatched or unmatched C residues, and did not modify adjacent cytosines. However when G.C pairs flank bulged C residue, neighboring cytosines are also attacked by hydroxylamine due to defect migration. Chemical reactivity of target bases was shown to correlate strongly with the local disturbance of DNA double helix at mismatch or bulge site. With our model system, we were able to prove the absence of false-negative and false-positive results. Portion of heteroduplex reliably revealed in a mixture with corresponding homoduplex consists of 5% for bulge bases and "open" non-canonical pairs, and 10% for wobble base pairs giving minimal violations in DNA structure. This study provides a complete understanding of the principles of mutation detection methodology based on chemical cleavage of mismatches and clarifies the advantages and limitations of this approach in various biological and conformational studies of DNA. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  4. A Heterogeneous Metal-Free Catalyst for Hydrogenation: Lewis Acid-Base Pairs Integrated into a Carbon Lattice.

    PubMed

    Ding, Yuxiao; Huang, Xing; Yi, Xianfeng; Qiao, Yunxiang; Sun, Xiaoyan; Zheng, Anmin; Su, Dang Sheng

    2018-06-04

    Designing heterogeneous metal-free catalysts for hydrogenation is a long-standing challenge in catalysis. Nanodiamond-based carbon materials were prepared that are surface-doped with electron-rich nitrogen and electron-deficient boron. The two heteroatoms are directly bonded to each other to form unquenched Lewis pairs with infinite π-electron donation from the surrounding graphitic structure. Remarkably, these Lewis pairs can split H 2 to form H + /H - pairs, which subsequently serve as the active species for hydrogenation of different substrates. This unprecedented finding sheds light on the uptake of H 2 across carbon-based materials and suggests that dual Lewis acidity-basicity on the carbon surface may be used to heterogeneously activate a variety of small molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Action-outcome learning and prediction shape the window of simultaneity of audiovisual outcomes.

    PubMed

    Desantis, Andrea; Haggard, Patrick

    2016-08-01

    To form a coherent representation of the objects around us, the brain must group the different sensory features composing these objects. Here, we investigated whether actions contribute in this grouping process. In particular, we assessed whether action-outcome learning and prediction contribute to audiovisual temporal binding. Participants were presented with two audiovisual pairs: one pair was triggered by a left action, and the other by a right action. In a later test phase, the audio and visual components of these pairs were presented at different onset times. Participants judged whether they were simultaneous or not. To assess the role of action-outcome prediction on audiovisual simultaneity, each action triggered either the same audiovisual pair as in the learning phase ('predicted' pair), or the pair that had previously been associated with the other action ('unpredicted' pair). We found the time window within which auditory and visual events appeared simultaneous increased for predicted compared to unpredicted pairs. However, no change in audiovisual simultaneity was observed when audiovisual pairs followed visual cues, rather than voluntary actions. This suggests that only action-outcome learning promotes temporal grouping of audio and visual effects. In a second experiment we observed that changes in audiovisual simultaneity do not only depend on our ability to predict what outcomes our actions generate, but also on learning the delay between the action and the multisensory outcome. When participants learned that the delay between action and audiovisual pair was variable, the window of audiovisual simultaneity for predicted pairs increased, relative to a fixed action-outcome pair delay. This suggests that participants learn action-based predictions of audiovisual outcome, and adapt their temporal perception of outcome events based on such predictions. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Age-related Associative Memory Deficits in Value-based Remembering: The Contribution of Agenda-based Regulation and Strategy Use

    PubMed Central

    Ariel, Robert; Price, Jodi; Hertzog, Christopher

    2015-01-01

    Value-based remembering in free recall tasks may be spared from the typical age-related cognitive decline observed for episodic memory. However, it is unclear whether value-based remembering for associative information is also spared from age-related cognitive decline. The current experiments evaluated the contribution of agenda-based based regulation and strategy use during study to age differences and similarities in value-based remembering of associative information. Participants studied word pairs (Experiments 1-2) or single words (Experiment 2) slated with different point values by moving a mouse controlled cursor to different spatial locations to reveal either items for study or the point value associated with remembering each item. Some participants also provided strategy reports for each item. Younger and older adults allocated greater time to studying high than low valued information, reported using normatively effective encoding strategies to learn high-valued pairs, and avoided study of low-valued pairs. As a consequence, both age groups selectively remembered more high than low-valued items. Despite nearly identical regulatory behavior, an associative memory deficit for older adults was present for high valued pairs. Age differences in value-based remembering did not occur when the materials were word lists. Fluid intelligence also moderated the effectiveness of older adults’ strategy use for high valued pairs (Experiment 2). These results suggest that age differences in associative value-based remembering may be due to some older adults’ gleaning less benefit from using normatively effective encoding strategies rather than age differences in metacognitive self-regulation per se. PMID:26523692

  7. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.

  8. Error-correcting pairs for a public-key cryptosystem

    NASA Astrophysics Data System (ADS)

    Pellikaan, Ruud; Márquez-Corbella, Irene

    2017-06-01

    Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.

  9. Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

    PubMed Central

    Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

  10. Demonstration of spectral correlation control in a source of polarization-entangled photon pairs at telecom wavelength.

    PubMed

    Lutz, Thomas; Kolenderski, Piotr; Jennewein, Thomas

    2014-03-15

    Spectrally correlated photon pairs can be used to improve the performance of long-range fiber-based quantum communication protocols. We present a source based on spontaneous parametric downconversion, which allows one to control spectral correlations within the entangled photon pair without spectral filtering by changing the pump-pulse duration or the characteristics of the coupled spatial modes. The spectral correlations and polarization entanglement are characterized. We find that the generated photon pairs can feature both positive spectral correlations, decorrelation, or negative correlations at the same time as polarization entanglement with a high fidelity of 0.97 (no background subtraction) with the expected Bell state.

  11. The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

    PubMed Central

    Mooers, Blaine H.M.; Singh, Amritanshu

    2011-01-01

    Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

  12. Superordinate Level Processing Has Priority Over Basic-Level Processing in Scene Gist Recognition

    PubMed Central

    Sun, Qi; Zheng, Yang; Sun, Mingxia; Zheng, Yuanjie

    2016-01-01

    By combining a perceptual discrimination task and a visuospatial working memory task, the present study examined the effects of visuospatial working memory load on the hierarchical processing of scene gist. In the perceptual discrimination task, two scene images from the same (manmade–manmade pairing or natural–natural pairing) or different superordinate level categories (manmade–natural pairing) were presented simultaneously, and participants were asked to judge whether these two images belonged to the same basic-level category (e.g., street–street pairing) or not (e.g., street–highway pairing). In the concurrent working memory task, spatial load (position-based load in Experiment 1) and object load (figure-based load in Experiment 2) were manipulated. The results were as follows: (a) spatial load and object load have stronger effects on discrimination of same basic-level scene pairing than same superordinate level scene pairing; (b) spatial load has a larger impact on the discrimination of scene pairings at early stages than at later stages; on the contrary, object information has a larger influence on at later stages than at early stages. It followed that superordinate level processing has priority over basic-level processing in scene gist recognition and spatial information contributes to the earlier and object information to the later stages in scene gist recognition. PMID:28382195

  13. Hot carrier-enhanced interlayer electron-hole pair multiplication in 2D semiconductor heterostructure photocells

    NASA Astrophysics Data System (ADS)

    Barati, Fatemeh; Grossnickle, Max; Su, Shanshan; Lake, Roger K.; Aji, Vivek; Gabor, Nathaniel M.

    2017-12-01

    Strong electronic interactions can result in novel particle-antiparticle (electron-hole, e-h) pair generation effects, which may be exploited to enhance the photoresponse of nanoscale optoelectronic devices. Highly efficient e-h pair multiplication has been demonstrated in several important nanoscale systems, including nanocrystal quantum dots, carbon nanotubes and graphene. The small Fermi velocity and nonlocal nature of the effective dielectric screening in ultrathin layers of transition-metal dichalcogenides (TMDs) indicates that e-h interactions are very strong, so high-efficiency generation of e-h pairs from hot electrons is expected. However, such e-h pair multiplication has not been observed in 2D TMD devices. Here, we report the highly efficient multiplication of interlayer e-h pairs in 2D semiconductor heterostructure photocells. Electronic transport measurements of the interlayer I-VSD characteristics indicate that layer-indirect e-h pairs are generated by hot-electron impact excitation at temperatures near T = 300 K. By exploiting this highly efficient interlayer e-h pair multiplication process, we demonstrate near-infrared optoelectronic devices that exhibit 350% enhancement of the optoelectronic responsivity at microwatt power levels. Our findings, which demonstrate efficient carrier multiplication in TMD-based optoelectronic devices, make 2D semiconductor heterostructures viable for a new class of ultra-efficient photodetectors based on layer-indirect e-h excitations.

  14. Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

    NASA Astrophysics Data System (ADS)

    Kingsland, Addie

    DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

  15. Four base recognition by triplex-forming oligonucleotides at physiological pH

    PubMed Central

    Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.

    2005-01-01

    We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633

  16. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  17. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    PubMed

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  18. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA

    PubMed Central

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R.

    2010-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure. PMID:20502534

  19. Multi-user distribution of polarization entangled photon pairs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trapateau, J.; Orieux, A.; Diamanti, E.

    We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on themore » demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.« less

  20. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    PubMed

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  1. A Metacognitive Approach to Pair Programming: Influence on Metacognitive Awareness

    ERIC Educational Resources Information Center

    Breed, Betty; Mentz, Elsa; van der Westhuizen, Gert

    2014-01-01

    Introduction: The research focused on metacognition in a collaborative learning setting. Based on a comprehensive literature study the researchers designed a metacognitive teaching-learning strategy for pair programmers. Our purpose was to investigate the influence of this metacognitive teaching-learning strategy during pair programming in an…

  2. Constructing Pairing-Friendly Elliptic Curves under Embedding Degree 1 for Securing Critical Infrastructures.

    PubMed

    Wang, Maocai; Dai, Guangming; Choo, Kim-Kwang Raymond; Jayaraman, Prem Prakash; Ranjan, Rajiv

    2016-01-01

    Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user's public key based on the user's identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al.

  3. Genome Editing Tools in Plants

    PubMed Central

    Mohanta, Tapan Kumar; Bashir, Tufail; Hashem, Abeer; Bae, Hanhong

    2017-01-01

    Genome editing tools have the potential to change the genomic architecture of a genome at precise locations, with desired accuracy. These tools have been efficiently used for trait discovery and for the generation of plants with high crop yields and resistance to biotic and abiotic stresses. Due to complex genomic architecture, it is challenging to edit all of the genes/genomes using a particular genome editing tool. Therefore, to overcome this challenging task, several genome editing tools have been developed to facilitate efficient genome editing. Some of the major genome editing tools used to edit plant genomes are: Homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), pentatricopeptide repeat proteins (PPRs), the CRISPR/Cas9 system, RNA interference (RNAi), cisgenesis, and intragenesis. In addition, site-directed sequence editing and oligonucleotide-directed mutagenesis have the potential to edit the genome at the single-nucleotide level. Recently, adenine base editors (ABEs) have been developed to mutate A-T base pairs to G-C base pairs. ABEs use deoxyadeninedeaminase (TadA) with catalytically impaired Cas9 nickase to mutate A-T base pairs to G-C base pairs. PMID:29257124

  4. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Constructing Pairing-Friendly Elliptic Curves under Embedding Degree 1 for Securing Critical Infrastructures

    PubMed Central

    Dai, Guangming

    2016-01-01

    Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user’s public key based on the user’s identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al. PMID:27564373

  6. Micrometer-Scale Ballistic Transport of Electron Pairs in LaAlO_{3}/SrTiO_{3} Nanowires.

    PubMed

    Tomczyk, Michelle; Cheng, Guanglei; Lee, Hyungwoo; Lu, Shicheng; Annadi, Anil; Veazey, Joshua P; Huang, Mengchen; Irvin, Patrick; Ryu, Sangwoo; Eom, Chang-Beom; Levy, Jeremy

    2016-08-26

    High-mobility complex-oxide heterostructures and nanostructures offer new opportunities for extending the paradigm of quantum transport beyond the realm of traditional III-V or carbon-based materials. Recent quantum transport investigations with LaAlO_{3}/SrTiO_{3}-based quantum dots reveal the existence of a strongly correlated phase in which electrons form spin-singlet pairs without becoming superconducting. Here, we report evidence for the micrometer-scale ballistic transport of electron pairs in quasi-1D LaAlO_{3}/SrTiO_{3} nanowire cavities. In the paired phase, Fabry-Perot-like quantum interference is observed, in sync with conductance oscillations observed in the superconducting regime (at a zero magnetic field). Above a critical magnetic field B_{p}, the electron pairs unbind and the conductance oscillations shift with the magnetic field. These experimental observations extend the regime of ballistic electronic transport to strongly correlated phases.

  7. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  8. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers.

    PubMed

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-12-09

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs.

  9. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers

    PubMed Central

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-01-01

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs. PMID:21197382

  10. Estimation of Disability Weights in the General Population of South Korea Using a Paired Comparison

    PubMed Central

    Ock, Minsu; Ahn, Jeonghoon; Yoon, Seok-Jun; Jo, Min-Woo

    2016-01-01

    We estimated the disability weights in the South Korean population by using a paired comparison-only model wherein ‘full health’ and ‘being dead’ were included as anchor points, without resorting to a cardinal method, such as person trade-off. The study was conducted via 2 types of survey: a household survey involving computer-assisted face-to-face interviews and a web-based survey (similar to that of the GBD 2010 disability weight study). With regard to the valuation methods, paired comparison, visual analogue scale (VAS), and standard gamble (SG) were used in the household survey, whereas paired comparison and population health equivalence (PHE) were used in the web-based survey. Accordingly, we described a total of 258 health states, with ‘full health’ and ‘being dead’ designated as anchor points. In the analysis, 4 models were considered: a paired comparison-only model; hybrid model between paired comparison and PHE; VAS model; and SG model. A total of 2,728 and 3,188 individuals participated in the household and web-based survey, respectively. The Pearson correlation coefficients of the disability weights of health states between the GBD 2010 study and the current models were 0.802 for Model 2, 0.796 for Model 1, 0.681 for Model 3, and 0.574 for Model 4 (all P-values<0.001). The discrimination of values according to health state severity was most suitable in Model 1. Based on these results, the paired comparison-only model was selected as the best model for estimating disability weights in South Korea, and for maintaining simplicity in the analysis. Thus, disability weights can be more easily estimated by using paired comparison alone, with ‘full health’ and ‘being dead’ as one of the health states. As noted in our study, we believe that additional evidence regarding the universality of disability weight can be observed by using a simplified methodology of estimating disability weights. PMID:27606626

  11. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  12. Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems

    PubMed Central

    Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194

  13. The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

    PubMed Central

    Solberg, Katherine M; Hanley, Gregory P; Layer, Stacy A; Ingvarsson, Einar T

    2007-01-01

    The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once the snack paired with reinforcement was selected most frequently, the three types of reinforcement were systematically faded. Frequent selections of the previously less preferred snack option were produced with paired reinforcement, but were disrupted for all children as the paired reinforcement was reduced to low levels. These data showed that paired reinforcement was initially effective in increasing preference for the originally less preferred snack options, but more permanent changes in the value of the snack options were not achieved. Conditions for producing persistent changes in children's snack choices are discussed. PMID:18189095

  14. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    PubMed

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  15. Optimizing photon-pair generation electronically using a p-i-n diode incorporated in a silicon microring resonator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Savanier, Marc, E-mail: msavanier@eng.ucsd.edu; Kumar, Ranjeet; Mookherjea, Shayan, E-mail: smookherjea@eng.ucsd.edu

    Silicon photonic microchips may be useful for compact, inexpensive, room-temperature optically pumped photon-pair sources, which unlike conventional photon-pair generators based on crystals or optical fibers, can be manufactured using CMOS-compatible processes on silicon wafers. It has been shown that photon pairs can be created in simple structures such as microring resonators at a rate of a few hundred kilohertz using less than a milliwatt of optical pump power, based on the process of spontaneous four-wave mixing. To create a practical photon-pair source, however, also requires some way of monitoring the device and aligning the pump wavelength when the temperature varies,more » since silicon resonators are highly sensitive to temperature. In fact, monitoring photodiodes are standard components in classical laser diodes, but the incorporation of germanium or InGaAs photodiodes would raise the cost and fabrication complexity. Here, we present a simple and effective all-electronic technique for finding the optimum operating point for the microring used to generate photon pairs, based on measuring the reverse-biased current in a silicon p-i-n junction diode fabricated across the waveguide that constitutes the silicon microring. We show that by monitoring the current, and using it to tune the pump laser wavelength, the photon-pair generation properties of the microring can be preserved over a temperature range of more than 30 °C.« less

  16. Complexes of oligo(poly)nucleotides with structural anomalies

    NASA Astrophysics Data System (ADS)

    Dolinnaya, N. G.; Gryaznova, O. I.

    1989-08-01

    The results of studies on the structure and properties of DNA-RNA hybrids and complexes of oligo(poly)nucleotides containing non-canonical base pairs or unpaired bases both within and at the ends of the double helix are surveyed. The methods used in the study of such systems are briefly characterised: X-ray diffraction analysis, NMR and UV spectroscopy, circular dichroism, scanning microcalorimetry, etc. A comparative analysis of the influence of the non-canonical pairs on the structure and the energetic and kinetic parameters of the formation and dissociation of the oligonucleotide complexes has been carried out. The question of the stability of the non-canonical pairs as a function of their nature and position in the double helix is considered. The mechanisms of the formation of the hydrogen bonds between the bases of non-complementary pairs are discussed. The bibliography includes 171 references.

  17. Apparatus And Method For Reducing Drag Of A Bluff Body In Ground Effect Using Counter-Rotating Vortex Pairs

    DOEpatents

    Ortega, Jason M.; Sabari, Kambiz

    2005-12-27

    An aerodynamic base drag reduction apparatus and method for bluff bodies, such as tractor-trailer trucks, utilizing a pair of lift surfaces extending to lift surface tips and located alongside the bluff body such as on opposing left and right side surfaces. In a flowstream substantially parallel to the longitudinal centerline of the bluff body, the pair of lift surfaces generate a pair of counter-rotating trailing vortices which confluence together in the wake of the bluff body in a direction orthogonal to the flowstream. The confluence draws or otherwise turns the flowstream, such as the flowstream passing over a top surface of the bluff body, in and around behind a trailing end of the bluff body to raise the pressure on a base surface at the trailing end and thereby reduce the aerodynamic base drag.

  18. Apparatus And Method For Reducing Drag Of A Bluff Body In Ground Effect Using Counter-Rotating Vortex Pairs

    DOEpatents

    Ortega, Jason M.; Salari, Kambiz

    2005-08-09

    An aerodynamic base drag reduction apparatus and method for bluff bodies, such as tractor-trailer trucks, utilizing a pair of lift surfaces extending to lift surface tips and located alongside the bluff body such as on opposing left and right side surfaces. In a flowstream substantially parallel to the longitudinal centerline of the bluff body, the pair of lift surfaces generate a pair of counter-rotating trailing vortices which confluence together in the wake of the bluff body in a direction orthogonal to the flowstream. The confluence draws or otherwise turns the flowstream, such as the flowstream passing over a top surface of the bluff body, in and around behind a trailing end of the bluff body to raise the pressure on a base surface at the trailing end and thereby reduce the aerodynamic base drag.

  19. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2009-12-29

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  20. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2011-10-04

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  1. Compositions of orthogonal lysyl-tRNA and aminoacyl-tRNA synthetase pairs and uses thereof

    DOEpatents

    Anderson, J Christopher [San Francisco, CA; Wu, Ning [Brookline, MA; Santoro, Stephen [Cambridge, MA; Schultz, Peter G [La Jolla, CA

    2009-08-18

    Compositions and methods of producing components of protein biosynthetic machinery that include orthogonal lysyl-tRNAs, orthogonal lysyl-aminoacyl-tRNA synthetases, and orthogonal pairs of lysyl-tRNAs/synthetases, which incorporate homoglutamines into proteins are provided in response to a four base codon. Methods for identifying these orthogonal pairs are also provided along with methods of producing proteins with homoglutamines using these orthogonal pairs.

  2. All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

    PubMed Central

    Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

    1981-01-01

    In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

  3. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  4. Quantum chemical investigations of AlN-doped C60 for use as a nano-biosensor in detection of mispairing between DNA bases.

    PubMed

    Siddiqui, Shamoon Ahmad; Bouarissa, Nadir; Rasheed, Tabish; Al-Hajry, A

    2014-12-01

    Quantum chemical calculations were carried out to study the electronic structure and stability of adenine-thymine and the rare tautomer of adenine-thymine base pairs along with their Cu 2+ complexes and their interactions with AlN-modified fullerene (C58AlN) using Density Functional Theory (B3LYP method). Since, these two forms of base pairs and their Cu 2+ complexes have almost similar electronic structures, their chemical differentiation is an extremely difficult task. In this investigation, we have observed that AlN-doped C 60 could be used as a potentially viable nanoscale sensor to detect these two base pairs as well as their Cu2+ complexes.

  5. On the binding of indeno[1,2-c]isoquinolines in the DNA-topoisomerase I cleavage complex.

    PubMed

    Xiao, Xiangshu; Antony, Smitha; Pommier, Yves; Cushman, Mark

    2005-05-05

    An ab initio quantum mechanics calculation is reported which predicts the orientation of indenoisoquinoline 4 in the ternary cleavage complex formed from DNA and topoisomerase I (top1). The results of this calculation are consistent with the hypothetical structures previously proposed for the indenoisoquinoline-DNA-top1 ternary complexes based on molecular modeling, the crystal structure of a recently reported ternary complex, and the biological results obtained with a pair of diaminoalkyl-substituted indenoisoquinoline enantiomers. The results of these studies indicate that the pi-pi stacking interactions between the indenoisoquinolines and the neighboring DNA base pairs play a major role in determining binding orientation. The calculation of the electrostatic potential surface maps of the indenoisoquinolines and the adjacent DNA base pairs shows electrostatic complementarity in the observed binding orientation, leading to the conclusion that electrostatic attraction between the intercalators and the base pairs in the cleavage complex plays a major stabilizing role. On the other hand, the calculation of LUMO and HOMO energies of indenoisoquinoline 13b and neighboring DNA base pairs in conjunction with NBO analysis indicates that charge transfer complex formation plays a relatively minor role in stabilizing the ternary complexes derived from indenoisoquinolines, DNA, and top1. The results of these studies are important in understanding the existing structure-activity relationships for the indenoisoquinolines as top1 inhibitors and as anticancer agents, and they will be important in the future design of indenoisoquinoline-based top1 inhibitors.

  6. Platinum(II)-Oligonucleotide Coordination Based Aptasensor for Simple and Selective Detection of Platinum Compounds.

    PubMed

    Cai, Sheng; Tian, Xueke; Sun, Lianli; Hu, Haihong; Zheng, Shirui; Jiang, Huidi; Yu, Lushan; Zeng, Su

    2015-10-20

    Wide use of platinum-based chemotherapeutic regimens for the treatment for carcinoma calls for a simple and selective detection of platinum compound in biological samples. On the basis of the platinum(II)-base pair coordination, a novel type of aptameric platform for platinum detection has been introduced. This chemiluminescence (CL) aptasensor consists of a designed streptavidin (SA) aptamer sequence in which several base pairs were replaced by G-G mismatches. Only in the presence of platinum, coordination occurs between the platinum and G-G base pairs as opposed to the hydrogen-bonded G-C base pairs, which leads to SA aptamer sequence activation, resulting in their binding to SA coated magnetic beads. These Pt-DNA coordination events were monitored by a simple and direct luminol-peroxide CL reaction through horseradish peroxidase (HRP) catalysis with a strong chemiluminescence emission. The validated ranges of quantification were 0.12-240 μM with a limit of detection of 60 nM and selectivity over other metal ions. This assay was also successfully used in urine sample determination. It will be a promising candidate for the detection of platinum in biomedical and environmental samples.

  7. Theoretical Probing of Weak Anion-Cation Interactions in Certain Pyridinium-Based Ionic Liquid Ion Pairs and the Application of Molecular Electrostatic Potential in Their Ionic Crystal Density Determination: A Comparative Study Using Density Functional Approach.

    PubMed

    Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Padmanabhan, A S; Mathew, Suresh

    2018-01-11

    A comprehensive study on the structure, nature of interaction, and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF 4 - ), chloride (Cl - ), and bromide (Br - ) anions have been carried out using density functional theory (DFT). The anion-cation interaction energy (ΔE int ), thermochemistry values, theoretical band gap, molecular orbital energy order, DFT-based chemical activity descriptors [chemical potential (μ), chemical hardness (η), and electrophilicity index (ω)], and distribution of density of states (DOS) of these ion pairs were investigated. The ascendancy of the -CH 3 substituent at the fourth position of the 1-butylpyridinium cation ring on the values of ΔE int , theoretical band gap and chemical activity descriptors was evaluated. The ΔE int values were negative for all six ion pairs and were highest for Cl - containing ion pairs. The theoretical band gap value after -CH 3 substitution increased from 3.78 to 3.96 eV (for Cl - ) and from 2.74 to 2.88 eV (for Br - ) and decreased from 4.9 to 4.89 eV (for BF 4 - ). Ion pairs of BF 4 - were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH 3 substitution. The change in η and μ values due to the -CH 3 substituent is negligibly small in all cases except for the ion pairs of Cl - . Critical-point (CP) analyses were carried out to investigate the AIM topological parameters at the interionic bond critical points (BCPs). The RDG isosurface analysis indicated that the anion-cation interaction was dominated by strong H cat ···X ani and C cat ···X ani interactions in ion pairs of Cl - and Br - whereas a weak van der Waal's effect dominated in ion pairs of BF 4 - . The molecular electrostatic potential (MESP)-based parameter ΔΔV min measuring the anion-cation interaction strength showed a good linear correlation with ΔE int for all 1-butylpyridinium ion pairs (R 2 = 0.9918). The ionic crystal density values calculated by using DFT-based MESP showed only slight variations from experimentally reported values.

  8. Experimental extraction of an entangled photon pair from two identically decohered pairs.

    PubMed

    Yamamoto, Takashi; Koashi, Masato; Ozdemir, Sahin Kaya; Imoto, Nobuyuki

    2003-01-23

    Entanglement is considered to be one of the most important resources in quantum information processing schemes, including teleportation, dense coding and entanglement-based quantum key distribution. Because entanglement cannot be generated by classical communication between distant parties, distribution of entangled particles between them is necessary. During the distribution process, entanglement between the particles is degraded by the decoherence and dissipation processes that result from unavoidable coupling with the environment. Entanglement distillation and concentration schemes are therefore needed to extract pairs with a higher degree of entanglement from these less-entangled pairs; this is accomplished using local operations and classical communication. Here we report an experimental demonstration of extraction of a polarization-entangled photon pair from two decohered photon pairs. Two polarization-entangled photon pairs are generated by spontaneous parametric down-conversion and then distributed through a channel that induces identical phase fluctuations to both pairs; this ensures that no entanglement is available as long as each pair is manipulated individually. Then, through collective local operations and classical communication we extract from the two decohered pairs a photon pair that is observed to be polarization-entangled.

  9. Milestone Report:3.2.2.26 Appliances, HVAC & Water Heating R&D-Select Sorption Technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ally, Moonis Raza

    The purpose of this report is to select a sorption technology based on recent work completed on characterizing working pairs for both absorption and adsorption technologies based on Global Warming Potential (GWP) of less than 100 (relative to carbon dioxide, 100-year atmospheric life span) and zero Ozone Depletion Potential (ODP). From a total of eighty-three potential working pairs (absorption technology), there were only two candidate working pairs for the absorption technology, and 8 potential working pairs for adsorption technology. After screening these ten potential candidates on the basis of sizes of the desorber, absorber/adsorber, evaporator, condenser, and rectifier (where applicable),more » the ORNL-Georgia Tech study concluded that best working pairs are NH3-H2O for the most compact system in terms of heat transfer equipment surface area, and NH3-LiNO3 and MeOH-[mmin][DMP] where efficiency is most important. Based on a single-stage absorption and adsorption modeling using the Engineering Equation Solver (EES), the performance of both sorption systems was evaluated from known heat transfer correlations, and thermos-physical properties. Based on these results, the technology chosen is absorption technology. The selected technology is absorption for the reasons cited in Section 4.« less

  10. The role of the AT pairs in the acid denaturation of DNA.

    PubMed Central

    Hermann, P; Fredericq, E

    1977-01-01

    It has been determined previously that the protonation of the GC pairs induces a DNA conformation change which leads to a "metastable" structure. The role of the AT pairs, however, is no well known because the protonation does not modify their spectral properties. By means of an indirect method based on the binding of proflavine, it has been determined that the AT pairs are protonated before the acid-induced denaturation and that they seem to be unable to assume a conformation change when protonated. These results would indicate that the protonated AT pairs may be responsible for the induction of the acid denaturation and not the GC pairs as it was thought previously. PMID:20604

  11. Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

    PubMed Central

    Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

    2016-01-01

    A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

  12. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: An ab initio study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D., E-mail: sdchao@spring.iam.ntu.edu.tw

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF{sub 3}X—B that involve one trifluorohalomethane CF{sub 3}X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH{sub 3} and PH{sub 3}), two n-pairs (H{sub 2}O and H{sub 2}S), two n-pairs with an unsaturated bond (H{sub 2}CO and H{sub 2}CS), and a single π-pairmore » (C{sub 2}H{sub 4}) and two π-pairs (C{sub 2}H{sub 2}). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C–X bond lengths shorten, while the C–X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.« less

  13. The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

    PubMed Central

    Van Kreijl, C F; Bos, J L

    1977-01-01

    The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

  14. Sample size considerations for paired experimental design with incomplete observations of continuous outcomes.

    PubMed

    Zhu, Hong; Xu, Xiaohan; Ahn, Chul

    2017-01-01

    Paired experimental design is widely used in clinical and health behavioral studies, where each study unit contributes a pair of observations. Investigators often encounter incomplete observations of paired outcomes in the data collected. Some study units contribute complete pairs of observations, while the others contribute either pre- or post-intervention observations. Statistical inference for paired experimental design with incomplete observations of continuous outcomes has been extensively studied in literature. However, sample size method for such study design is sparsely available. We derive a closed-form sample size formula based on the generalized estimating equation approach by treating the incomplete observations as missing data in a linear model. The proposed method properly accounts for the impact of mixed structure of observed data: a combination of paired and unpaired outcomes. The sample size formula is flexible to accommodate different missing patterns, magnitude of missingness, and correlation parameter values. We demonstrate that under complete observations, the proposed generalized estimating equation sample size estimate is the same as that based on the paired t-test. In the presence of missing data, the proposed method would lead to a more accurate sample size estimate comparing with the crude adjustment. Simulation studies are conducted to evaluate the finite-sample performance of the generalized estimating equation sample size formula. A real application example is presented for illustration.

  15. A comparative review of methods for comparing means using partially paired data.

    PubMed

    Guo, Beibei; Yuan, Ying

    2017-06-01

    In medical experiments with the objective of testing the equality of two means, data are often partially paired by design or because of missing data. The partially paired data represent a combination of paired and unpaired observations. In this article, we review and compare nine methods for analyzing partially paired data, including the two-sample t-test, paired t-test, corrected z-test, weighted t-test, pooled t-test, optimal pooled t-test, multiple imputation method, mixed model approach, and the test based on a modified maximum likelihood estimate. We compare the performance of these methods through extensive simulation studies that cover a wide range of scenarios with different effect sizes, sample sizes, and correlations between the paired variables, as well as true underlying distributions. The simulation results suggest that when the sample size is moderate, the test based on the modified maximum likelihood estimator is generally superior to the other approaches when the data is normally distributed and the optimal pooled t-test performs the best when the data is not normally distributed, with well-controlled type I error rates and high statistical power; when the sample size is small, the optimal pooled t-test is to be recommended when both variables have missing data and the paired t-test is to be recommended when only one variable has missing data.

  16. Reference set for performance testing of pediatric vaccine safety signal detection methods and systems.

    PubMed

    Brauchli Pernus, Yolanda; Nan, Cassandra; Verstraeten, Thomas; Pedenko, Mariia; Osokogu, Osemeke U; Weibel, Daniel; Sturkenboom, Miriam; Bonhoeffer, Jan

    2016-12-12

    Safety signal detection in spontaneous reporting system databases and electronic healthcare records is key to detection of previously unknown adverse events following immunization. Various statistical methods for signal detection in these different datasources have been developed, however none are geared to the pediatric population and none specifically to vaccines. A reference set comprising pediatric vaccine-adverse event pairs is required for reliable performance testing of statistical methods within and across data sources. The study was conducted within the context of the Global Research in Paediatrics (GRiP) project, as part of the seventh framework programme (FP7) of the European Commission. Criteria for the selection of vaccines considered in the reference set were routine and global use in the pediatric population. Adverse events were primarily selected based on importance. Outcome based systematic literature searches were performed for all identified vaccine-adverse event pairs and complemented by expert committee reports, evidence based decision support systems (e.g. Micromedex), and summaries of product characteristics. Classification into positive (PC) and negative control (NC) pairs was performed by two independent reviewers according to a pre-defined algorithm and discussed for consensus in case of disagreement. We selected 13 vaccines and 14 adverse events to be included in the reference set. From a total of 182 vaccine-adverse event pairs, we classified 18 as PC, 113 as NC and 51 as unclassifiable. Most classifications (91) were based on literature review, 45 were based on expert committee reports, and for 46 vaccine-adverse event pairs, an underlying pathomechanism was not plausible classifying the association as NC. A reference set of vaccine-adverse event pairs was developed. We propose its use for comparing signal detection methods and systems in the pediatric population. Published by Elsevier Ltd.

  17. Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

    PubMed Central

    Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

    2002-01-01

    An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.

    Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less

  19. Energy hyperspace for stacking interaction in AU/AU dinucleotide step: Dispersion-corrected density functional theory study.

    PubMed

    Mukherjee, Sanchita; Kailasam, Senthilkumar; Bansal, Manju; Bhattacharyya, Dhananjay

    2014-01-01

    Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014. Copyright © 2013 Wiley Periodicals, Inc.

  20. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Measuring Three-Dimensional Thorax Motion Via Biplane Radiographic Imaging: Technique and Preliminary Results.

    PubMed

    Baumer, Timothy G; Giles, Joshua W; Drake, Anne; Zauel, Roger; Bey, Michael J

    2016-01-01

    Measures of scapulothoracic motion are dependent on accurate imaging of the scapula and thorax. Advanced radiographic techniques can provide accurate measures of scapular motion, but the limited 3D imaging volume of these techniques often precludes measurement of thorax motion. To overcome this, a thorax coordinate system was defined based on the position of rib pairs and then compared to a conventional sternum/spine-based thorax coordinate system. Alignment of the rib-based coordinate system was dependent on the rib pairs used, with the rib3:rib4 pairing aligned to within 4.4 ± 2.1 deg of the conventional thorax coordinate system.

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. Pair distribution function study and mechanical behavior of as-cast and structurally relaxed Zr-based bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Fan, Cang; Liaw, P. K.; Wilson, T. W.; Choo, H.; Gao, Y. F.; Liu, C. T.; Proffen, Th.; Richardson, J. W.

    2006-12-01

    Contrary to reported results on structural relaxation inducing brittleness in amorphous alloys, the authors found that structural relaxation actually caused an increase in the strength of Zr55Cu35Al10 bulk metallic glass (BMG) without changing the plasticity. Three dimensional models were rebuilt for the as-cast and structurally relaxed BMGs by reverse Monte Carlo (RMC) simulations based on the pair distribution function (PDF) measured by neutron scattering. Only a small portion of the atom pairs was found to change to more dense packing. The concept of free volume was defined based on the PDF and RMC studies, and the mechanism of mechanical behavior was discussed.

  4. ClaRNA: a classifier of contacts in RNA 3D structures based on a comparative analysis of various classification schemes

    PubMed Central

    Waleń, Tomasz; Chojnowski, Grzegorz; Gierski, Przemysław; Bujnicki, Janusz M.

    2014-01-01

    The understanding of folding and function of RNA molecules depends on the identification and classification of interactions between ribonucleotide residues. We developed a new method named ClaRNA for computational classification of contacts in RNA 3D structures. Unique features of the program are the ability to identify imperfect contacts and to process coarse-grained models. Each doublet of spatially close ribonucleotide residues in a query structure is compared to clusters of reference doublets obtained by analysis of a large number of experimentally determined RNA structures, and assigned a score that describes its similarity to one or more known types of contacts, including pairing, stacking, base–phosphate and base–ribose interactions. The accuracy of ClaRNA is 0.997 for canonical base pairs, 0.983 for non-canonical pairs and 0.961 for stacking interactions. The generalized squared correlation coefficient (GC2) for ClaRNA is 0.969 for canonical base pairs, 0.638 for non-canonical pairs and 0.824 for stacking interactions. The classifier can be easily extended to include new types of spatial relationships between pairs or larger assemblies of nucleotide residues. ClaRNA is freely available via a web server that includes an extensive set of tools for processing and visualizing structural information about RNA molecules. PMID:25159614

  5. Homologous Chromosome Pairing in Drosophila melanogaster Proceeds through Multiple Independent Initiations

    PubMed Central

    Fung, Jennifer C.; Marshall, Wallace F.; Dernburg, Abby; Agard, David A.; Sedat, John W.

    1998-01-01

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites. PMID:9531544

  6. Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.

    PubMed

    Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W

    1998-04-06

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.

  7. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: monitoring by circular dichroism spectroscopy.

    PubMed

    Goncharova, Iryna

    2014-01-24

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Ag(I)-mediated homo and hetero pairs of guanosine and cytidine: Monitoring by circular dichroism spectroscopy

    NASA Astrophysics Data System (ADS)

    Goncharova, Iryna

    2014-01-01

    Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.

  9. Socialization in Pigtailed Macaques (Macaca nemestrina)

    PubMed Central

    WORLEIN, JULIE M.; KROEKER, ROSE; LEE, GRACE H.; THOM, JINHEE P.; BELLANCA, RITA U.; CROCKETT, CAROLYN M.

    2018-01-01

    In response to new emphasis by regulatory agencies regarding socialization, behavioral management programs are allocating greater resources to maximize socialization opportunities for laboratory primates. Information regarding predictors of compatibility and risk of injury for all laboratory-housed species of macaques are needed to make social introductions and pairings as efficient and safe as possible. This study presents data on 674 pairs of pigtailed macaques (Macaca nemestrina) at the Washington National Primate Research Center over a 7-year period. During pair introduction, behavior was monitored while the degree of tactile contact was gradually increased. Based on observed behavior, pairs were assigned a behavioral introduction score (BIS), rating the quality of their interactions for each day of introduction. Animals deemed compatible, based on the BIS and technologist judgment, were allowed to progress to continuous contact with no staff present. A small proportion of animals deemed compatible at introduction was later separated for subsequent incompatibility or aggression; these proportions were higher in full contact compared to protected contact pairings. Of 674 pairs, 75% were deemed compatible at introduction in protected contact; 86 of these pairs were later transitioned to full contact with 98% compatibility. Predictors of decreased compatibility assessed during protected contact introductions included age (adult pairs were less compatible), the BIS on the last day of introduction, and aggression or injury during the introductory period. Predictors of injuries during the protected contact introduction process included: aggression on the first day of introduction, a negative BIS on the first or last day of introduction, and, surprisingly, the presence of grooming on the first day of introduction. Injuries during both introduction and subsequent pairing in protected contact were rare; however, injury rates increased significantly during full-contact pairing. These findings underscore the necessity of species-specific data to guide decision-making during the social introduction process. PMID:27109591

  10. Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

    PubMed Central

    Suh, E R; Waring, R B

    1990-01-01

    It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

  11. Mediated Activity in the Primary Classroom: Girls, Boys and Computers.

    ERIC Educational Resources Information Center

    Fitzpatrick, Helen; Hardman, Margaret

    2000-01-01

    Studied the social interaction of 7- and 9-year-olds working in the same or mixed gender pairs on language-based computer and noncomputer tasks. At both ages, mixed gender pairs showed more assertive and less transactive (collaborative) interaction than same gender pairs on both tasks. Discusses the mediational role of the computer and the social…

  12. Memory for Object Locations: Priority Effect and Sex Differences in Associative Spatial Learning

    ERIC Educational Resources Information Center

    Cinan, Sevtap; Atalay, Deniz; Sisman, Simge; Basbug, Gokce; Dervent-Ozbek, Sevinc; Teoman, Dalga D.; Karagoz, Ayca; Karadeniz, A. Yezdan; Beykurt, Sinem; Suleyman, Hediye; Memis, H. Ozge; Yurtsever, Ozgur D.

    2007-01-01

    This paper reports two experiments conducted to examine priority effects and sex differences in object location memory. A new task of paired position-learning was designed, based on the A-B A-C paradigm, which was used in paired word learning. There were three different paired position-learning conditions: (1) positions of several different…

  13. A Macroscopic Analogue of the Nuclear Pairing Potential

    ERIC Educational Resources Information Center

    Dunlap, Richard A.

    2013-01-01

    A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…

  14. Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

    NASA Astrophysics Data System (ADS)

    Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

    This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

  15. Analyzing Population Genetics Using the Mitochondrial Control Region and Bioinformatics

    ERIC Educational Resources Information Center

    Sato, Takumi; Phillips, Bonnie; Latourelle, Sandra M.; Elwess, Nancy L.

    2010-01-01

    The 14-base pair hypervariable region in mitochondrial DNA (mtDNA) of Asian populations, specifically Japanese and Chinese students at Plattsburgh State University, was examined. Previous research on this 14-base pair region showed it to be susceptible to mutations and as a result indicated direct correlation with specific ethnic populations.…

  16. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  17. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    PubMed

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  18. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  19. Large-Scale, Exhaustive Lattice-Based Structural Auditing of SNOMED CT

    NASA Astrophysics Data System (ADS)

    Zhang, Guo-Qiang

    One criterion for the well-formedness of ontologies is that their hierarchical structure form a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT. We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the 518K non-lattice pairs, among over 34 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA computational pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links. This work is based on collaboration with Olivier Bodenreider from the National Library of Medicine, Bethesda, USA.

  20. An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

    PubMed

    Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

    2004-05-01

    In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

  1. Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Di Felice, Rosa

    2011-05-01

    Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

  2. Are herb-pairs of traditional Chinese medicine distinguishable from others? Pattern analysis and artificial intelligence classification study of traditionally defined herbal properties.

    PubMed

    Ung, Choong Yong; Li, Hu; Cao, Zhi Wei; Li, Yi Xue; Chen, Yu Zong

    2007-05-04

    Multi-herb prescriptions of traditional Chinese medicine (TCM) often include special herb-pairs for mutual enhancement, assistance, and restraint. These TCM herb-pairs have been assembled and interpreted based on traditionally defined herbal properties (TCM-HPs) without knowledge of mechanism of their assumed synergy. While these mechanisms are yet to be determined, properties of TCM herb-pairs can be investigated to determine if they exhibit features consistent with their claimed unique synergistic combinations. We analyzed distribution patterns of TCM-HPs of TCM herb-pairs to detect signs indicative of possible synergy and used artificial intelligence (AI) methods to examine whether combination of their TCM-HPs are distinguishable from those of non-TCM herb-pairs assembled by random combinations and by modification of known TCM herb-pairs. Patterns of the majority of 394 known TCM herb-pairs were found to exhibit signs of herb-pair correlation. Three AI systems, trained and tested by using 394 TCM herb-pairs and 2470 non-TCM herb-pairs, correctly classified 72.1-87.9% of TCM herb-pairs and 91.6-97.6% of the non-TCM herb-pairs. The best AI system predicted 96.3% of the 27 known non-TCM herb-pairs and 99.7% of the other 1,065,100 possible herb-pairs as non-TCM herb-pairs. Our studies suggest that TCM-HPs of known TCM herb-pairs contain features distinguishable from those of non-TCM herb-pairs consistent with their claimed synergistic or modulating combinations.

  3. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    PubMed

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

    PubMed

    Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

    2018-05-01

    The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

  5. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  6. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  7. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    PubMed

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  8. Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

    PubMed

    Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

    2018-06-15

    Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

  9. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    NASA Astrophysics Data System (ADS)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  10. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  11. Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

    PubMed Central

    Sharma, Kishor; Tollervey, David

    1999-01-01

    The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

  12. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

  13. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  14. In search of functional association from time-series microarray data based on the change trend and level of gene expression

    PubMed Central

    He, Feng; Zeng, An-Ping

    2006-01-01

    Background The increasing availability of time-series expression data opens up new possibilities to study functional linkages of genes. Present methods used to infer functional linkages between genes from expression data are mainly based on a point-to-point comparison. Change trends between consecutive time points in time-series data have been so far not well explored. Results In this work we present a new method based on extracting main features of the change trend and level of gene expression between consecutive time points. The method, termed as trend correlation (TC), includes two major steps: 1, calculating a maximal local alignment of change trend score by dynamic programming and a change trend correlation coefficient between the maximal matched change levels of each gene pair; 2, inferring relationships of gene pairs based on two statistical extraction procedures. The new method considers time shifts and inverted relationships in a similar way as the local clustering (LC) method but the latter is merely based on a point-to-point comparison. The TC method is demonstrated with data from yeast cell cycle and compared with the LC method and the widely used Pearson correlation coefficient (PCC) based clustering method. The biological significance of the gene pairs is examined with several large-scale yeast databases. Although the TC method predicts an overall lower number of gene pairs than the other two methods at a same p-value threshold, the additional number of gene pairs inferred by the TC method is considerable: e.g. 20.5% compared with the LC method and 49.6% with the PCC method for a p-value threshold of 2.7E-3. Moreover, the percentage of the inferred gene pairs consistent with databases by our method is generally higher than the LC method and similar to the PCC method. A significant number of the gene pairs only inferred by the TC method are process-identity or function-similarity pairs or have well-documented biological interactions, including 443 known protein interactions and some known cell cycle related regulatory interactions. It should be emphasized that the overlapping of gene pairs detected by the three methods is normally not very high, indicating a necessity of combining the different methods in search of functional association of genes from time-series data. For a p-value threshold of 1E-5 the percentage of process-identity and function-similarity gene pairs among the shared part of the three methods reaches 60.2% and 55.6% respectively, building a good basis for further experimental and functional study. Furthermore, the combined use of methods is important to infer more complete regulatory circuits and network as exemplified in this study. Conclusion The TC method can significantly augment the current major methods to infer functional linkages and biological network and is well suitable for exploring temporal relationships of gene expression in time-series data. PMID:16478547

  15. The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

    PubMed

    Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

    2017-04-01

    Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

  16. Magnetoreception in birds: different physical processes for two types of directional responses

    PubMed Central

    Wiltschko, Roswitha; Stapput, Katrin; Ritz, Thorsten; Thalau, Peter; Wiltschko, Wolfgang

    2007-01-01

    Migratory orientation in birds involves an inclination compass based on radical-pair processes. Under certain light regimes, however, “fixed-direction” responses are observed that do not undergo the seasonal change between spring and autumn typical for migratory orientation. To identify the underlying transduction mechanisms, we analyzed a fixed-direction response under a combination of 502 nm turquoise and 590 nm yellow light, with migratory orientation under 565 nm green light serving as the control. High-frequency fields, diagnostic for a radical-pair mechanism, disrupted migratory orientation without affecting fixed-direction responses. Local anaesthesia of the upper beak where magnetite is found in birds, in contrast, disrupted the fixed-direction response without affecting migratory orientation. The two types of responses are thus based on different physical principles, with the compass response based on a radical pair mechanism and the fixed-direction responses probably originating in magnetite-based receptors in the upper beak. Directional input from these receptors seems to affect the behavior only when the regular inclination compass does not work properly. Evolutionary considerations suggest that magnetite-based receptors may represent an ancient mechanism that, in birds, has been replaced by the modern inclination compass based on radical-pair processes now used for directional orientation. PMID:19404459

  17. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  18. Sequence-based evidence for major histocompatibility complex-disassortative mating in a colonial seabird.

    PubMed

    Juola, Frans A; Dearborn, Donald C

    2012-01-07

    The major histocompatibility complex (MHC) is a polymorphic gene family associated with immune defence, and it can play a role in mate choice. Under the genetic compatibility hypothesis, females choose mates that differ genetically from their own MHC genotypes, avoiding inbreeding and/or enhancing the immunocompetence of their offspring. We tested this hypothesis of disassortative mating based on MHC genotypes in a population of great frigatebirds (Fregata minor) by sequencing the second exon of MHC class II B. Extensive haploid cloning yielded two to four alleles per individual, suggesting the amplification of two genes. MHC similarity between mates was not significantly different between pairs that did (n = 4) or did not (n = 42) exhibit extra-pair paternity. Comparing all 46 mated pairs to a distribution based on randomized re-pairings, we observed the following (i): no evidence for mate choice based on maximal or intermediate levels of MHC allele sharing (ii), significantly disassortative mating based on similarity of MHC amino acid sequences, and (iii) no evidence for mate choice based on microsatellite alleles, as measured by either allele sharing or similarity in allele size. This suggests that females choose mates that differ genetically from themselves at MHC loci, but not as an inbreeding-avoidance mechanism.

  19. Large-scale, Exhaustive Lattice-based Structural Auditing of SNOMED CT.

    PubMed

    Zhang, Guo-Qiang; Bodenreider, Olivier

    2010-11-13

    One criterion for the well-formedness of ontologies is that their hierarchical structure forms a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT (> 300k concepts). We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the over 544k non-lattice pairs, among over 356 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links.

  20. Error simulation of paired-comparison-based scaling methods

    NASA Astrophysics Data System (ADS)

    Cui, Chengwu

    2000-12-01

    Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

  1. Large-scale, Exhaustive Lattice-based Structural Auditing of SNOMED CT

    PubMed Central

    Zhang, Guo-Qiang; Bodenreider, Olivier

    2010-01-01

    One criterion for the well-formedness of ontologies is that their hierarchical structure forms a lattice. Formal Concept Analysis (FCA) has been used as a technique for assessing the quality of ontologies, but is not scalable to large ontologies such as SNOMED CT (> 300k concepts). We developed a methodology called Lattice-based Structural Auditing (LaSA), for auditing biomedical ontologies, implemented through automated SPARQL queries, in order to exhaustively identify all non-lattice pairs in SNOMED CT. The percentage of non-lattice pairs ranges from 0 to 1.66 among the 19 SNOMED CT hierarchies. Preliminary manual inspection of a limited portion of the over 544k non-lattice pairs, among over 356 million candidate pairs, revealed inconsistent use of precoordination in SNOMED CT, but also a number of false positives. Our results are consistent with those based on FCA, with the advantage that the LaSA pipeline is scalable and applicable to ontological systems consisting mostly of taxonomic links. PMID:21347113

  2. Biophysics of Artificially Expanded Genetic Information Systems. Thermodynamics of DNA Duplexes Containing Matches and Mismatches Involving 2-Amino-3-nitropyridin-6-one (Z) and Imidazo[1,2-a]-1,3,5-triazin-4(8H)one (P).

    PubMed

    Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D

    2017-05-19

    Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.

  3. New Quantum Key Distribution Scheme Based on Random Hybrid Quantum Channel with EPR Pairs and GHZ States

    NASA Astrophysics Data System (ADS)

    Yan, Xing-Yu; Gong, Li-Hua; Chen, Hua-Ying; Zhou, Nan-Run

    2018-05-01

    A theoretical quantum key distribution scheme based on random hybrid quantum channel with EPR pairs and GHZ states is devised. In this scheme, EPR pairs and tripartite GHZ states are exploited to set up random hybrid quantum channel. Only one photon in each entangled state is necessary to run forth and back in the channel. The security of the quantum key distribution scheme is guaranteed by more than one round of eavesdropping check procedures. It is of high capacity since one particle could carry more than two bits of information via quantum dense coding.

  4. Narrowing of the balance function with centrality in Au+Au collisions at the square root of SNN = 130 GeV.

    PubMed

    Adams, J; Adler, C; Ahammed, Z; Allgower, C; Amonett, J; Anderson, B D; Anderson, M; Averichev, G S; Balewski, J; Barannikova, O; Barnby, L S; Baudot, J; Bekele, S; Belaga, V V; Bellwied, R; Berger, J; Bichsel, H; Billmeier, A; Bland, L C; Blyth, C O; Bonner, B E; Boucham, A; Brandin, A; Bravar, A; Cadman, R V; Caines, H; Calderónde la Barca Sánchez, M; Cardenas, A; Carroll, J; Castillo, J; Castro, M; Cebra, D; Chaloupka, P; Chattopadhyay, S; Chen, Y; Chernenko, S P; Cherney, M; Chikanian, A; Choi, B; Christie, W; Coffin, J P; Cormier, T M; Corral, M M; Cramer, J G; Crawford, H J; Derevschikov, A A; Didenko, L; Dietel, T; Draper, J E; Dunin, V B; Dunlop, J C; Eckardt, V; Efimov, L G; Emelianov, V; Engelage, J; Eppley, G; Erazmus, B; Fachini, P; Faine, V; Faivre, J; Fatemi, R; Filimonov, K; Finch, E; Fisyak, Y; Flierl, D; Foley, K J; Fu, J; Gagliardi, C A; Gagunashvili, N; Gans, J; Gaudichet, L; Germain, M; Geurts, F; Ghazikhanian, V; Grachov, O; Grigoriev, V; Guedon, M; Guertin, S M; Gushin, E; Hallman, T J; Hardtke, D; Harris, J W; Heinz, M; Henry, T W; Heppelmann, S; Herston, T; Hippolyte, B; Hirsch, A; Hjort, E; Hoffmann, G W; Horsley, M; Huang, H Z; Humanic, T J; Igo, G; Ishihara, A; Ivanshin, Yu I; Jacobs, P; Jacobs, W W; Janik, M; Johnson, I; Jones, P G; Judd, E G; Kaneta, M; Kaplan, M; Keane, D; Kiryluk, J; Kisiel, A; Klay, J; Klein, S R; Klyachko, A; Kollegger, T; Konstantinov, A S; Kopytine, M; Kotchenda, L; Kovalenko, A D; Kramer, M; Kravtsov, P; Krueger, K; Kuhn, C; Kulikov, A I; Kunde, G J; Kunz, C L; Kutuev, R Kh; Kuznetsov, A A; Lamont, M A C; Landgraf, J M; Lange, S; Lansdell, C P; Lasiuk, B; Laue, F; Lauret, J; Lebedev, A; Lednický, R; Leontiev, V M; LeVine, M J; Li, Q; Lindenbaum, S J; Lisa, M A; Liu, F; Liu, L; Liu, Z; Liu, Q J; Ljubicic, T; Llope, W J; Long, H; Longacre, R S; Lopez-Noriega, M; Love, W A; Ludlam, T; Lynn, D; Ma, J; Magestro, D; Majka, R; Margetis, S; Markert, C; Martin, L; Marx, J; Matis, H S; Matulenko, Yu A; McShane, T S; Meissner, F; Melnick, Yu; Meschanin, A; Messer, M; Miller, M L; Milosevich, Z; Minaev, N G; Mitchell, J; Moore, C F; Morozov, V; de Moura, M M; Munhoz, M G; Nelson, J M; Nevski, P; Nikitin, V A; Nogach, L V; Norman, B; Nurushev, S B; Odyniec, G; Ogawa, A; Okorokov, V; Oldenburg, M; Olson, D; Paic, G; Pandey, S U; Panebratsev, Y; Panitkin, S Y; Pavlinov, A I; Pawlak, T; Perevoztchikov, V; Peryt, W; Petrov, V A; Planinic, M; Pluta, J; Porile, N; Porter, J; Poskanzer, A M; Potrebenikova, E; Prindle, D; Pruneau, C; Putschke, J; Rai, G; Rakness, G; Ravel, O; Ray, R L; Razin, S V; Reichhold, D; Reid, J G; Renault, G; Retiere, F; Ridiger, A; Ritter, H G; Roberts, J B; Rogachevski, O V; Romero, J L; Rose, A; Roy, C; Rykov, V; Sakrejda, I; Salur, S; Sandweiss, J; Savin, I; Schambach, J; Scharenberg, R P; Schmitz, N; Schroeder, L S; Schüttauf, A; Schweda, K; Seger, J; Seliverstov, D; Seyboth, P; Shahaliev, E; Shestermanov, K E; Shimanskii, S S; Simon, F; Skoro, G; Smirnov, N; Snellings, R; Sorensen, P; Sowinski, J; Spinka, H M; Srivastava, B; Stephenson, E J; Stock, R; Stolpovsky, A; Strikhanov, M; Stringfellow, B; Struck, C; Suaide, A A P; Sugarbaker, E; Suire, C; Sumbera, M; Surrow, B; Symons, T J M; de Toledo, A Szanto; Szarwas, P; Tai, A; Takahashi, J; Tang, A H; Thein, D; Thomas, J H; Thompson, M; Tikhomirov, V; Tokarev, M; Tonjes, M B; Trainor, T A; Trentalange, S; Tribble, R E; Trofimov, V; Tsai, O; Ullrich, T; Underwood, D G; Van Buren, G; Vander Molen, A M; Vasilevski, I M; Vasiliev, A N; Vigdor, S E; Voloshin, S A; Wang, F; Ward, H; Watson, J W; Wells, R; Westfall, G D; Whitten, C; Wieman, H; Willson, R; Wissink, S W; Witt, R; Wood, J; Xu, N; Xu, Z; Yakutin, A E; Yamamoto, E; Yang, J; Yepes, P; Yurevich, V I; Zanevski, Y V; Zborovský, I; Zhang, H; Zhang, W M; Zoulkarneev, R; Zubarev, A N

    2003-05-02

    The balance function is a new observable based on the principle that charge is locally conserved when particles are pair produced. Balance functions have been measured for charged particle pairs and identified charged pion pairs in Au+Au collisions at the square root of SNN = 130 GeV at the Relativistic Heavy Ion Collider using STAR. Balance functions for peripheral collisions have widths consistent with model predictions based on a superposition of nucleon-nucleon scattering. Widths in central collisions are smaller, consistent with trends predicted by models incorporating late hadronization.

  5. Time series regression-based pairs trading in the Korean equities market

    NASA Astrophysics Data System (ADS)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  6. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    PubMed

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  7. Configurations of base-pair complexes in solutions. [nucleotide chemistry

    NASA Technical Reports Server (NTRS)

    Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

    1978-01-01

    A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

  8. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    PubMed

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  9. Enhancing acronym/abbreviation knowledge bases with semantic information.

    PubMed

    Torii, Manabu; Liu, Hongfang

    2007-10-11

    In the biomedical domain, a terminology knowledge base that associates acronyms/abbreviations (denoted as SFs) with the definitions (denoted as LFs) is highly needed. For the construction such terminology knowledge base, we investigate the feasibility to build a system automatically assigning semantic categories to LFs extracted from text. Given a collection of pairs (SF,LF) derived from text, we i) assess the coverage of LFs and pairs (SF,LF) in the UMLS and justify the need of a semantic category assignment system; and ii) automatically derive name phrases annotated with semantic category and construct a system using machine learning. Utilizing ADAM, an existing collection of (SF,LF) pairs extracted from MEDLINE, our system achieved an f-measure of 87% when assigning eight UMLS-based semantic groups to LFs. The system has been incorporated into a web interface which integrates SF knowledge from multiple SF knowledge bases. Web site: http://gauss.dbb.georgetown.edu/liblab/SFThesurus.

  10. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    PubMed

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  11. Transition from Sign-Reversed to Sign-Preserved Cooper-Pairing Symmetry in Sulfur-Doped Iron Selenide Superconductors.

    PubMed

    Wang, Qisi; Park, J T; Feng, Yu; Shen, Yao; Hao, Yiqing; Pan, Bingying; Lynn, J W; Ivanov, A; Chi, Songxue; Matsuda, M; Cao, Huibo; Birgeneau, R J; Efremov, D V; Zhao, Jun

    2016-05-13

    An essential step toward elucidating the mechanism of superconductivity is to determine the sign or phase of the superconducting order parameter, as it is closely related to the pairing interaction. In conventional superconductors, the electron-phonon interaction induces attraction between electrons near the Fermi energy and results in a sign-preserved s-wave pairing. For high-temperature superconductors, including cuprates and iron-based superconductors, prevalent weak coupling theories suggest that the electron pairing is mediated by spin fluctuations which lead to repulsive interactions, and therefore that a sign-reversed pairing with an s_{±} or d-wave symmetry is favored. Here, by using magnetic neutron scattering, a phase sensitive probe of the superconducting gap, we report the observation of a transition from the sign-reversed to sign-preserved Cooper-pairing symmetry with insignificant changes in T_{c} in the S-doped iron selenide superconductors K_{x}Fe_{2-y}(Se_{1-z}S_{z})_{2}. We show that a rather sharp magnetic resonant mode well below the superconducting gap (2Δ) in the undoped sample (z=0) is replaced by a broad hump structure above 2Δ under 50% S doping. These results cannot be readily explained by simple spin fluctuation-exchange pairing theories and, therefore, multiple pairing channels are required to describe superconductivity in this system. Our findings may also yield a simple explanation for the sometimes contradictory data on the sign of the superconducting order parameter in iron-based materials.

  12. An Evolutionary Computation Approach to Examine Functional Brain Plasticity.

    PubMed

    Roy, Arnab; Campbell, Colin; Bernier, Rachel A; Hillary, Frank G

    2016-01-01

    One common research goal in systems neurosciences is to understand how the functional relationship between a pair of regions of interest (ROIs) evolves over time. Examining neural connectivity in this way is well-suited for the study of developmental processes, learning, and even in recovery or treatment designs in response to injury. For most fMRI based studies, the strength of the functional relationship between two ROIs is defined as the correlation between the average signal representing each region. The drawback to this approach is that much information is lost due to averaging heterogeneous voxels, and therefore, the functional relationship between a ROI-pair that evolve at a spatial scale much finer than the ROIs remain undetected. To address this shortcoming, we introduce a novel evolutionary computation (EC) based voxel-level procedure to examine functional plasticity between an investigator defined ROI-pair by simultaneously using subject-specific BOLD-fMRI data collected from two sessions seperated by finite duration of time. This data-driven procedure detects a sub-region composed of spatially connected voxels from each ROI (a so-called sub-regional-pair) such that the pair shows a significant gain/loss of functional relationship strength across the two time points. The procedure is recursive and iteratively finds all statistically significant sub-regional-pairs within the ROIs. Using this approach, we examine functional plasticity between the default mode network (DMN) and the executive control network (ECN) during recovery from traumatic brain injury (TBI); the study includes 14 TBI and 12 healthy control subjects. We demonstrate that the EC based procedure is able to detect functional plasticity where a traditional averaging based approach fails. The subject-specific plasticity estimates obtained using the EC-procedure are highly consistent across multiple runs. Group-level analyses using these plasticity estimates showed an increase in the strength of functional relationship between DMN and ECN for TBI subjects, which is consistent with prior findings in the TBI-literature. The EC-approach also allowed us to separate sub-regional-pairs contributing to positive and negative plasticity; the detected sub-regional-pairs significantly overlap across runs thus highlighting the reliability of the EC-approach. These sub-regional-pairs may be useful in performing nuanced analyses of brain-behavior relationships during recovery from TBI.

  13. Structure and conversion kinetics of a bi-stable DNA i-motif: broken symmetry in the [d(5mCCTCC)]4 tetramer.

    PubMed

    Nonin, S; Leroy, J L

    1996-08-23

    At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.

  14. Involving Parents in Paired Reading with Preschoolers: Results from a Randomized Controlled Trial

    ERIC Educational Resources Information Center

    Lam, Shui-fong; Chow-Yeung, Kamfung; Wong, Bernard P. H.; Lau, Kwok Kiu; Tse, Shuk In

    2013-01-01

    A paired reading program was implemented for 195 Hong Kong preschoolers (mean age = 4.7 years) and their parents from families with a wide range of family income. The preschoolers were randomly assigned to experimental or waitlist control groups. The parents in the experimental group received 12 sessions of school-based training on paired reading…

  15. Characterization of the LCLS “nanosecond two-bunch” mode for x-ray speckle visibility spectroscopy experiments

    DOE PAGES

    Sun, Yanwen; Zhu, Diling; Song, Sanghoon; ...

    2017-05-23

    The generation of two X-ray pulses with tunable nanosecond scale time separations has recently been demonstrated at the Linac Coherent Light Source using an accelerator based technique. This approach offers the opportunity to extend X-ray Photon Correlation Spectroscopy techniques to the yet unexplored regime of nanosecond timescales by means of X-ray Speckle Visibility Spectroscopy. As the two pulses originate from two independent Spontaneous Amplified Stimulated Emission processes, the beam properties fluctuate from pulse pair to pulse pair, but as well between the individual pulses within a pair. However, two-pulse XSVS experiments require the intensity of the individual pulses to bemore » either identical in the ideal case, or with a accurately known intensity ratio. We present the design and performances of a non-destructive intensity diagnostic based on measurement of scattering from a transparent target using a high-speed photo-detector. Individual pulses within a pulse pair with time delays as short as 0.7 ns can be resolved. Moreover, using small angle coherent scattering, we characterize the averaged spatial overlap of the focused pulse pairs. Furthermore, the multi-shot average-speckle contrasts from individual pulses and pulse pairs are compared.« less

  16. The X3LYP extended density functional accurately describes H-bonding but fails completely for stacking.

    PubMed

    Cerný, Jirí; Hobza, Pavel

    2005-04-21

    The performance of the recently introduced X3LYP density functional which was claimed to significantly improve the accuracy for H-bonded and van der Waals complexes was tested for extended H-bonded and stacked complexes (nucleic acid base pairs and amino acid pairs). In the case of planar H-bonded complexes (guanine...cytosine, adenine...thymine) the DFT results nicely agree with accurate correlated ab initio results. For the stacked pairs (uracil dimer, cytosine dimer, adenine...thymine and guanine...cytosine) the DFT fails completely and it was even not able to localize any minimum at the stacked subspace of the potential energy surface. The geometry optimization of all these stacked clusters leads systematically to the planar H-bonded pairs. The amino acid pairs were investigated in the crystal geometry. DFT again strongly underestimates the accurate correlated ab initio stabilization energies and usually it was not able to describe the stabilization of a pair. The X3LYP functional thus behaves similarly to other current functionals. Stacking of nucleic acid bases as well as interaction of amino acids was described satisfactorily by using the tight-binding DFT method, which explicitly covers the London dispersion energy.

  17. Sequence-similar, structure-dissimilar protein pairs in the PDB.

    PubMed

    Kosloff, Mickey; Kolodny, Rachel

    2008-05-01

    It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We have established a data base of sequence-similar, structurally dissimilar protein pairs that will help address this problem (http://luna.bioc.columbia.edu/rachel/seqsimstrdiff.htm).

  18. The Interplay between Value and Relatedness as Bases for Metacognitive Monitoring and Control: Evidence for Agenda-Based Monitoring

    ERIC Educational Resources Information Center

    Soderstrom, Nicholas C.; McCabe, David P.

    2011-01-01

    Two experiments are reported examining how value and relatedness interact to influence metacognitive monitoring and control processes. Participants studied unrelated and related word pairs, each accompanied by point values denoting how important the items were to remember. These values were presented either before or after each pair in a…

  19. Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning

    ERIC Educational Resources Information Center

    Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei

    2012-01-01

    In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…

  20. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    PubMed

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  1. Cloning and characterization of an abalone (Haliotis discus hannai) actin gene

    NASA Astrophysics Data System (ADS)

    Ma, Hongming; Xu, Wei; Mai, Kangsen; Liufu, Zhiguo; Chen, Hong

    2004-10-01

    An actin encoding gene was cloned by using RT-PCR, 3‧ RACE and 5‧ RACE from abalone Haliotis discus hannai. The full length of the gene is 1532 base pairs, which contains a long 3‧ untranslated region of 307 base pairs and 79 base pairs of 5‧ untranslated sequence. The open reading frame encodes 376 amino acid residues. Sequence comparison with those of human and other mollusks showed high conservation among species at amino acid level. The identities was 96%, 97% and 96% respectively compared with Aplysia californica, Biomphalaria glabrata and Homo sapience β-actin. It is also indicated that this actin is more similar to the human cytoplasmic actin (β-actin) than to human muscle actin.

  2. Pairing versus phase coherence of doped holes in distinct quantum spin backgrounds

    NASA Astrophysics Data System (ADS)

    Zhu, Zheng; Sheng, D. N.; Weng, Zheng-Yu

    2018-03-01

    We examine the pairing structure of holes injected into two distinct spin backgrounds: a short-range antiferromagnetic phase versus a symmetry protected topological phase. Based on density matrix renormalization group (DMRG) simulation, we find that although there is a strong binding between two holes in both phases, phase fluctuations can significantly influence the pair-pair correlation depending on the spin-spin correlation in the background. Here the phase fluctuation is identified as an intrinsic string operator nonlocally controlled by the spins. We show that while the pairing amplitude is generally large, the coherent Cooper pairing can be substantially weakened by the phase fluctuation in the symmetry-protected topological phase, in contrast to the short-range antiferromagnetic phase. It provides an example of a non-BCS mechanism for pairing, in which the paring phase coherence is determined by the underlying spin state self-consistently, bearing an interesting resemblance to the pseudogap physics in the cuprate.

  3. Switch wear leveling

    DOEpatents

    Wu, Hunter; Sealy, Kylee; Gilchrist, Aaron

    2015-09-01

    An apparatus for switch wear leveling includes a switching module that controls switching for two or more pairs of switches in a switching power converter. The switching module controls switches based on a duty cycle control technique and closes and opens each switch in a switching sequence. The pairs of switches connect to a positive and negative terminal of a DC voltage source. For a first switching sequence a first switch of a pair of switches has a higher switching power loss than a second switch of the pair of switches. The apparatus includes a switch rotation module that changes the switching sequence of the two or more pairs of switches from the first switching sequence to a second switching sequence. The second switch of a pair of switches has a higher switching power loss than the first switch of the pair of switches during the second switching sequence.

  4. Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

    PubMed Central

    Zhang, X; Gottlieb, P A

    1995-01-01

    Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

  5. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. DNA-Mediated Electrochemistry

    PubMed Central

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  7. Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

    NASA Astrophysics Data System (ADS)

    Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

    2013-04-01

    We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

  8. Linear separability in superordinate natural language concepts.

    PubMed

    Ruts, Wim; Storms, Gert; Hampton, James

    2004-01-01

    Two experiments are reported in which linear separability was investigated in superordinate natural language concept pairs (e.g., toiletry-sewing gear). Representations of the exemplars of semantically related concept pairs were derived in two to five dimensions using multidimensional scaling (MDS) of similarities based on possession of the concept features. Next, category membership, obtained from an exemplar generation study (in Experiment 1) and from a forced-choice classification task (in Experiment 2) was predicted from the coordinates of the MDS representation using log linear analysis. The results showed that all natural kind concept pairs were perfectly linearly separable, whereas artifact concept pairs showed several violations. Clear linear separability of natural language concept pairs is in line with independent cue models. The violations in the artifact pairs, however, yield clear evidence against the independent cue models.

  9. Identifying miRNA-mediated signaling subpathways by integrating paired miRNA/mRNA expression data with pathway topology.

    PubMed

    Vrahatis, Aristidis G; Dimitrakopoulos, Georgios N; Tsakalidis, Athanasios K; Bezerianos, Anastasios

    2015-01-01

    In the road for network medicine the newly emerged systems-level subpathway-based analysis methods offer new disease genes, drug targets and network-based biomarkers. In parallel, paired miRNA/mRNA expression data enable simultaneously monitoring of the micronome effect upon the signaling pathways. Towards this orientation, we present a methodological pipeline for the identification of differentially expressed subpathways along with their miRNA regulators by using KEGG signaling pathway maps, miRNA-target interactions and expression profiles from paired miRNA/mRNA experiments. Our pipeline offered new biological insights on a real application of paired miRNA/mRNA expression profiles with respect to the dynamic changes from colostrum to mature milk whey; several literature supported genes and miRNAs were recontextualized through miRNA-mediated differentially expressed subpathways.

  10. Transdermal penetration of vasoconstrictors--present understanding and assessment of the human epidermal flux and retention of free bases and ion-pairs.

    PubMed

    Cross, Sheree E; Thompson, Melanie J; Roberts, Michael S

    2003-02-01

    As reductions in dermal clearance increase the residence time of solutes in the skin and underlying tissues we compared the topical penetration of potentially useful vasoconstrictors (VCs) through human epidermis as both free bases and ion-pairs with salicylic acid (SA). We determined the in vitro epidermal flux of ephedrine, naphazoline, oxymetazoline, phenylephrine, and xylometazoline applied as saturated solutions in propylene glycol:water (1:1) and of ephedrine, naphazoline and tetrahydrozoline as 10% solutions of 1:1 molar ratio ion-pairs with SA in liquid paraffin. As free bases, ephedrine had the highest maximal flux, Jmax = 77.4 +/- 11.7 microg/cm2/h, being 4-fold higher than tetrahydrozoline and xylometazoline, 6-fold higher than phenylephrine, 10-fold higher than naphazoline and 100-fold higher than oxymetazoline. Stepwise regression of solute physicochemical properties identified melting point as the most significant predictor of flux. As ion-pairs with SA, ephedrine and naphazoline had similar fluxes (11.5 +/- 2.3 and 12.0 +/- 1.6 microg/cm2/h respectively), whereas tetrahydrozoline was approximately 3-fold slower. Corresponding fluxes of SA from the ion-pairs were 18.6 +/- 0.6, 7.8+/- 0.8 and 1.1 +/- 0.1 respectively. Transdermal transport of VC's is discussed. Epidermal retention of VCs and SA did not correspond to their molar ratio on application and confirmed that following partitioning into the stratum corneum, ion-pairs separate and further penetration is governed by individual solute characteristics.

  11. Assessing relative abundance and reproductive success of shrubsteppe raptors

    USGS Publications Warehouse

    Lehman, Robert N.; Carpenter, L.B.; Steenhof, Karen; Kochert, Michael N.

    1998-01-01

    From 1991-1994, we quantified relative abundance and reproductive success of the Ferruginous Hawk (Buteo regalis), Northern Harrier (Circus cyaneus), Burrowing Owl (Speotytoc unicularia), and Short-eared Owl (Asio flammeus) on the shrubsteppe plateaus (benchlands) in and near the Snake River Birds of Prey National Conservation Area in southwestern Idaho. To assess relative abundance, we searched randomly selected plots using four sampling methods: point counts, line transects, and quadrats of two sizes. On a persampling-effort basis, transects were slightly more effective than point counts and quadrats for locating raptor nests (3.4 pairs detected/100 h of effort vs. 2.2-3.1 pairs). Random sampling using quadrats failed to detect a Short-eared Owl population increase from 1993 to 1994. To evaluate nesting success, we tried to determine reproductive outcome for all nesting attempts located during random, historical, and incidental nest searches. We compared nesting success estimates based on all nesting attempts, on attempts found during incubation, and the Mayfield model. Most pairs used to evaluate success were pairs found incidentally. Visits to historical nesting areas yielded the highest number of pairs per sampling effort (14.6/100 h), but reoccupancy rates for most species decreased through time. Estimates based on all attempts had the highest sample sizes but probably overestimated success for all species except the Ferruginous Hawk. Estimates of success based on nesting attempts found during incubation had the lowest sample sizes. All three methods yielded biased nesting snccess estimates for the Northern Harrier and Short-eared Owl. The estimate based on pairs found during incubation probably provided the least biased estimate for the Burrowing Owl. Assessments of nesting success were hindered by difficulties in confirming egg laying and nesting success for all species except the Ferruginous hawk.

  12. Evaluation of interatomic potentials for rainbow scattering under axial channeling at KCl(0 0 1) surface by three-dimensional computer simulations based on binary collision approximation

    NASA Astrophysics Data System (ADS)

    Takeuchi, Wataru

    2017-05-01

    The rainbow angles corresponding to prominent peaks in the angular distributions of scattered projectiles with small angle, attributed to rainbow scattering (RS), under axial surface channeling conditions are strongly influenced by the interatomic potentials between projectiles and target atoms. The dependence of rainbow angles on normal energy of projectile energy to the target surface, being experimentally obtained by Specht et al. for RS of He, N, Ne and Ar atoms under <1 0 0> and <1 1 0> axial channeling conditions at a KCl(0 0 1) surface with projectile energies of 1-60 keV, was evaluated by the three-dimensional computer simulations using the ACOCT code based on the binary collision approximation with interatomic pair potentials. Good agreement between the ACOCT results using the ZBL pair potential and the individual pair potentials calculated from Hartree-Fock (HF) wave functions and the experimental ones was found for RS of He, N and Ne atoms from the atomic rows along <1 0 0> direction. For <1 1 0> direction, the ACOCT results employing the Moliere pair potential with adjustable screening length of O'Connor-Biersack (OB) formula, the ZBL pair potential and the individual HF pair potentials except for Ar → KCl using the OB pair potential are nearly in agreement with the experimental ones.

  13. Large-scale extraction of accurate drug-disease treatment pairs from biomedical literature for drug repurposing

    PubMed Central

    2013-01-01

    Background A large-scale, highly accurate, machine-understandable drug-disease treatment relationship knowledge base is important for computational approaches to drug repurposing. The large body of published biomedical research articles and clinical case reports available on MEDLINE is a rich source of FDA-approved drug-disease indication as well as drug-repurposing knowledge that is crucial for applying FDA-approved drugs for new diseases. However, much of this information is buried in free text and not captured in any existing databases. The goal of this study is to extract a large number of accurate drug-disease treatment pairs from published literature. Results In this study, we developed a simple but highly accurate pattern-learning approach to extract treatment-specific drug-disease pairs from 20 million biomedical abstracts available on MEDLINE. We extracted a total of 34,305 unique drug-disease treatment pairs, the majority of which are not included in existing structured databases. Our algorithm achieved a precision of 0.904 and a recall of 0.131 in extracting all pairs, and a precision of 0.904 and a recall of 0.842 in extracting frequent pairs. In addition, we have shown that the extracted pairs strongly correlate with both drug target genes and therapeutic classes, therefore may have high potential in drug discovery. Conclusions We demonstrated that our simple pattern-learning relationship extraction algorithm is able to accurately extract many drug-disease pairs from the free text of biomedical literature that are not captured in structured databases. The large-scale, accurate, machine-understandable drug-disease treatment knowledge base that is resultant of our study, in combination with pairs from structured databases, will have high potential in computational drug repurposing tasks. PMID:23742147

  14. Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids

    PubMed Central

    2015-01-01

    Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies. PMID:26505212

  15. Finite-dimensional Liouville integrable Hamiltonian systems generated from Lax pairs of a bi-Hamiltonian soliton hierarchy by symmetry constraints

    NASA Astrophysics Data System (ADS)

    Manukure, Solomon

    2018-04-01

    We construct finite-dimensional Hamiltonian systems by means of symmetry constraints from the Lax pairs and adjoint Lax pairs of a bi-Hamiltonian hierarchy of soliton equations associated with the 3-dimensional special linear Lie algebra, and discuss the Liouville integrability of these systems based on the existence of sufficiently many integrals of motion.

  16. Northern spotted owls: influence of prey base and landscape character.

    Treesearch

    A.B. Carey; S.P. Horton; B.L. Biswell

    1992-01-01

    We studied prey populations and the use and composition of home ranges of 47 Northern Spotted Owls (Strix occidentalis caurina) over 12 mo in five landscapes in two forest types in southwestern Oregon. We measured 1-yr home ranges of 23 owl pairs, 2-yr home ranges of 13 pairs, and 3-yr home ranges of 3 pairs. The landscapes differed in the degree...

  17. The structure of the L3 loop from the hepatitis delta virus ribozyme: a syn cytidine.

    PubMed Central

    Lynch, S R; Tinoco, I

    1998-01-01

    The structure of the L3 central hairpin loop isolated from the antigenomic sequence of the hepatitis delta virus ribozyme with the P2 and P3 stems from the ribozyme stacked on top of the loop has been determined by NMR spectroscopy. The 26 nt stem-loop structure contains nine base pairs and a 7 nt loop (5'-UCCUCGC-3'). This hairpin loop is critical for efficient catalysis in the intact ribozyme. The structure was determined using homonuclear and heteronuclear NMR techniques on non-labeled and15N-labeled RNA oligonucleotides. The overall root mean square deviation for the structure was 1.15 A (+/- 0.28 A) for the loop and the closing C.G base pair and 0.90 A (+/- 0.18 A) for the loop and the closing C.G base pair but without the lone purine in the loop, which is not well defined in the structure. The structure indicates a U.C base pair between the nucleotides on the 5'- and 3'-ends of the loop. This base pair is formed with a single hydrogen bond involving the cytosine exocyclic amino proton and the carbonyl O4 of the uracil. The most unexpected finding in the loop is a syn cytidine. While not unprecedented, syn pyrimidines are highly unusual. This one can be confidently established by intranucleotide distances between the ribose and the base determined by NMR spectroscopy. A similar study of the structure of this loop showed a somewhat different three-dimensional structure. A discussion of differences in the two structures, as well as possible sites of interaction with the cleavage site, will be presented. PMID:9461457

  18. Updates on Pairing Issues with the US Antarctic Meteorite Collection

    NASA Technical Reports Server (NTRS)

    Righter, K.; Satterwhite, C.; Schutt, J.

    2015-01-01

    The US Antarctic meteorite program has re-covered >21,000 meteorites since 1976, with thousands of those recovered from several icefields over multiple seasons, some-times spanning over a decade [1]. Pairing is assigned as best as possible at the time of classification, based on information from the field team, macro-scale hand sample features in the lab, and petrography, but later focused studies can reveal details that suggest re-evaluation of pairing groups. As a result, pairing groups are revealed over time, and must be continuously updated. Here we examine a few groups with known issues and give an update on some of the larger or more significant pairing groups.

  19. The pairing center plays a key role in homolog paring: an explanation for adjacent-2 segregation in interchange heterozygotes.

    PubMed

    Luo, Peigao

    2009-05-01

    Having reflected on the discrepancy between various views of chromosome behavior during meiosis, we propose an alternative description of Mendel's first law of segregation by referring to the segregation of pairing centers instead of centromeres. We also propose an alternative description of Mendel's second law of independent assortment, which refers to the free combination of different pairing centers. This interpretation is based on the modified concept that true 'homologous chromosomes' should carry the pairing center rather than centromere: the length of homology or the importance of the homologous segment on the chromosome is the crucial factor in homologous chromosome pairing and synapsis.

  20. 22. TYPICAL FOR THE FIRST FLOOR INTERIORS, ARE PAIRED COLUMN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. TYPICAL FOR THE FIRST FLOOR INTERIORS, ARE PAIRED COLUMN PILASTERS IN KEENE CEMENT PLASTER. BASE OF PILASTER IS SHOWN. - Pacific Telephone & Telegraph Company Building, 1519 Franklin Street, Oakland, Alameda County, CA

  1. ID-based encryption scheme with revocation

    NASA Astrophysics Data System (ADS)

    Othman, Hafizul Azrie; Ismail, Eddie Shahril

    2017-04-01

    In 2015, Meshram proposed an efficient ID-based cryptographic encryption based on the difficulty of solving discrete logarithm and integer-factoring problems. The scheme was pairing free and claimed to be secure against adaptive chosen plaintext attacks (CPA). Later, Tan et al. proved that the scheme was insecure by presenting a method to recover the secret master key and to obtain prime factorization of modulo n. In this paper, we propose a new pairing-free ID-based encryption scheme with revocation based on Meshram's ID-based encryption scheme, which is also secure against Tan et al.'s attacks.

  2. Young Learners' Interactional Development in Task-Based Paired-Assessment in Their First and Foreign Languages: A Case of English Learners in China

    ERIC Educational Resources Information Center

    Butler, Yuko Goto; Zeng, Wei

    2015-01-01

    In response to the growing interest in evaluating young learners' foreign language (FL) performance, this study aims to deepen our understanding of young learners' developmental differences in interaction during task-based paired-language assessments. To examine age effects separately from the effect of general language proficiency, we analysed…

  3. Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

    PubMed

    Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

    2014-01-25

    Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

  4. Signature scheme based on bilinear pairs

    NASA Astrophysics Data System (ADS)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  5. Origami-based tunable truss structures for non-volatile mechanical memory operation.

    PubMed

    Yasuda, Hiromi; Tachi, Tomohiro; Lee, Mia; Yang, Jinkyu

    2017-10-17

    Origami has recently received significant interest from the scientific community as a method for designing building blocks to construct metamaterials. However, the primary focus has been placed on their kinematic applications by leveraging the compactness and auxeticity of planar origami platforms. Here, we present volumetric origami cells-specifically triangulated cylindrical origami (TCO)-with tunable stability and stiffness, and demonstrate their feasibility as non-volatile mechanical memory storage devices. We show that a pair of TCO cells can develop a double-well potential to store bit information. What makes this origami-based approach more appealing is the realization of two-bit mechanical memory, in which two pairs of TCO cells are interconnected and one pair acts as a control for the other pair. By assembling TCO-based truss structures, we experimentally verify the tunable nature of the TCO units and demonstrate the operation of purely mechanical one- and two-bit memory storage prototypes.Origami is a popular method to design building blocks for mechanical metamaterials. Here, the authors assemble a volumetric origami-based structure, predict its axial and rotational movements during folding, and demonstrate the operation of mechanical one- and two-bit memory storage.

  6. AUCTSP: an improved biomarker gene pair class predictor.

    PubMed

    Kagaris, Dimitri; Khamesipour, Alireza; Yiannoutsos, Constantin T

    2018-06-26

    The Top Scoring Pair (TSP) classifier, based on the concept of relative ranking reversals in the expressions of pairs of genes, has been proposed as a simple, accurate, and easily interpretable decision rule for classification and class prediction of gene expression profiles. The idea that differences in gene expression ranking are associated with presence or absence of disease is compelling and has strong biological plausibility. Nevertheless, the TSP formulation ignores significant available information which can improve classification accuracy and is vulnerable to selecting genes which do not have differential expression in the two conditions ("pivot" genes). We introduce the AUCTSP classifier as an alternative rank-based estimator of the magnitude of the ranking reversals involved in the original TSP. The proposed estimator is based on the Area Under the Receiver Operating Characteristic (ROC) Curve (AUC) and as such, takes into account the separation of the entire distribution of gene expression levels in gene pairs under the conditions considered, as opposed to comparing gene rankings within individual subjects as in the original TSP formulation. Through extensive simulations and case studies involving classification in ovarian, leukemia, colon, breast and prostate cancers and diffuse large b-cell lymphoma, we show the superiority of the proposed approach in terms of improving classification accuracy, avoiding overfitting and being less prone to selecting non-informative (pivot) genes. The proposed AUCTSP is a simple yet reliable and robust rank-based classifier for gene expression classification. While the AUCTSP works by the same principle as TSP, its ability to determine the top scoring gene pair based on the relative rankings of two marker genes across all subjects as opposed to each individual subject results in significant performance gains in classification accuracy. In addition, the proposed method tends to avoid selection of non-informative (pivot) genes as members of the top-scoring pair.

  7. Mutation load in melanoma is affected by MC1R genotype.

    PubMed

    Johansson, Peter A; Pritchard, Antonia L; Patch, Ann-Marie; Wilmott, James S; Pearson, John V; Waddell, Nicola; Scolyer, Richard A; Mann, Graham J; Hayward, Nicholas K

    2017-03-01

    Whole-genome sequencing of matched germline and tumour pairs in a well-characterized cohort of melanoma patients allowed investigation of associations between melanoma body site, age at melanoma onset and MC1R variant status with overall mutation burden and specific base pair changes observed in the corresponding melanoma. We observed statistically significant associations between mutation burden in melanoma and body site, age at onset and MC1R genotype, for both ultraviolet radiation (UVR) signature changes (C>T and CC>TT) and non-UVR base pair substitutions, as well as with overall variant load. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. All-optical switching application based on optical nonlinearity of Yb(3+) doped aluminosilicate glass fiber with a long-period fiber gratings pair.

    PubMed

    Kim, Yune; Kim, Nam; Chung, Youngjoo; Paek, Un-Chul; Han, Won-Taek

    2004-02-23

    We propose a new fiber-type all-optical switching device based on the optical nonlinearity of Yb(3+) doped fiber and a long-period fiber gratings(LPG) pair. The all-optical ON-OFF switching with the continuous wave laser signal at ~1556nm in the LPG pair including the 25.5cm long Yb(3+) doped fiber was demonstrated up to ~200Hz upon pumping with the modulated square wave pulses at 976nm, where a full optical switching with the ~18dB extinction ratio was obtained at the launched pump power of ~35mW.

  9. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    PubMed

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Large-scale parentage inference with SNPs: an efficient algorithm for statistical confidence of parent pair allocations.

    PubMed

    Anderson, Eric C

    2012-11-08

    Advances in genotyping that allow tens of thousands of individuals to be genotyped at a moderate number of single nucleotide polymorphisms (SNPs) permit parentage inference to be pursued on a very large scale. The intergenerational tagging this capacity allows is revolutionizing the management of cultured organisms (cows, salmon, etc.) and is poised to do the same for scientific studies of natural populations. Currently, however, there are no likelihood-based methods of parentage inference which are implemented in a manner that allows them to quickly handle a very large number of potential parents or parent pairs. Here we introduce an efficient likelihood-based method applicable to the specialized case of cultured organisms in which both parents can be reliably sampled. We develop a Markov chain representation for the cumulative number of Mendelian incompatibilities between an offspring and its putative parents and we exploit it to develop a fast algorithm for simulation-based estimates of statistical confidence in SNP-based assignments of offspring to pairs of parents. The method is implemented in the freely available software SNPPIT. We describe the method in detail, then assess its performance in a large simulation study using known allele frequencies at 96 SNPs from ten hatchery salmon populations. The simulations verify that the method is fast and accurate and that 96 well-chosen SNPs can provide sufficient power to identify the correct pair of parents from amongst millions of candidate pairs.

  11. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks

    PubMed Central

    2018-01-01

    Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ai Yuejie; Zhang Feng; Theoretical Chemistry, School of Biotechnology, Royal Institute of Technology, S-10691 Stockholm

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized {sup 1}{pi}{pi}* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations.more » The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.« less

  13. Hydro lazy tongs energy booster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lamonica, M.

    1987-06-09

    An apparatus is described for converting hydraulic power to rotational power. The apparatus comprises: a support base; a source of hydraulic fluid; a pair of piston and cylinder assemblies in communication with the source of hydraulic fluid and mounted to the support base such that the pistons thereof are generally parallel with one another but extending substantially opposite directions; means for alternating directly hydraulic fluid to each of the piston and cylinder assemblies; lazy tong assemblies comprising a first lazy tong assembly, a last lazy tong assembly and an intermediate lazy tong assembly. Each lazy tong assembly comprises at leastmore » one block slidably mounted in proximity to the support base and at least one pair of lazy tongs with each lazy tong having a pair of opposed ends.« less

  14. Comparative study of the requantization of the time-dependent mean field for the dynamics of nuclear pairing

    NASA Astrophysics Data System (ADS)

    Ni, Fang; Nakatsukasa, Takashi

    2018-04-01

    To describe quantal collective phenomena, it is useful to requantize the time-dependent mean-field dynamics. We study the time-dependent Hartree-Fock-Bogoliubov (TDHFB) theory for the two-level pairing Hamiltonian, and compare results of different quantization methods. The one constructing microscopic wave functions, using the TDHFB trajectories fulfilling the Einstein-Brillouin-Keller quantization condition, turns out to be the most accurate. The method is based on the stationary-phase approximation to the path integral. We also examine the performance of the collective model which assumes that the pairing gap parameter is the collective coordinate. The applicability of the collective model is limited for the nuclear pairing with a small number of single-particle levels, because the pairing gap parameter represents only a half of the pairing collective space.

  15. Feature-based attention to unconscious shapes and colors.

    PubMed

    Schmidt, Filipp; Schmidt, Thomas

    2010-08-01

    Two experiments employed feature-based attention to modulate the impact of completely masked primes on subsequent pointing responses. Participants processed a color cue to select a pair of possible pointing targets out of multiple targets on the basis of their color, and then pointed to the one of those two targets with a prespecified shape. All target pairs were preceded by prime pairs triggering either the correct or the opposite response. The time interval between cue and primes was varied to modulate the time course of feature-based attentional selection. In a second experiment, the roles of color and shape were switched. Pointing trajectories showed large priming effects that were amplified by feature-based attention, indicating that attention modulated the earliest phases of motor output. Priming effects as well as their attentional modulation occurred even though participants remained unable to identify the primes, indicating distinct processes underlying visual awareness, attention, and response control.

  16. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  17. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  18. Supramolecular latching system based on ultrastable synthetic binding pairs as versatile tools for protein imaging.

    PubMed

    Kim, Kyung Lock; Sung, Gihyun; Sim, Jaehwan; Murray, James; Li, Meng; Lee, Ara; Shrinidhi, Annadka; Park, Kyeng Min; Kim, Kimoon

    2018-04-27

    Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system.

  19. A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

    PubMed

    Sawada, Tomohisa; Fujita, Makoto

    2010-05-26

    Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

  20. Prediction of missing common genes for disease pairs using network based module separation on incomplete human interactome.

    PubMed

    Akram, Pakeeza; Liao, Li

    2017-12-06

    Identification of common genes associated with comorbid diseases can be critical in understanding their pathobiological mechanism. This work presents a novel method to predict missing common genes associated with a disease pair. Searching for missing common genes is formulated as an optimization problem to minimize network based module separation from two subgraphs produced by mapping genes associated with disease onto the interactome. Using cross validation on more than 600 disease pairs, our method achieves significantly higher average receiver operating characteristic ROC Score of 0.95 compared to a baseline ROC score 0.60 using randomized data. Missing common genes prediction is aimed to complete gene set associated with comorbid disease for better understanding of biological intervention. It will also be useful for gene targeted therapeutics related to comorbid diseases. This method can be further considered for prediction of missing edges to complete the subgraph associated with disease pair.

  1. Numerical simulation and optimal design of Segmented Planar Imaging Detector for Electro-Optical Reconnaissance

    NASA Astrophysics Data System (ADS)

    Chu, Qiuhui; Shen, Yijie; Yuan, Meng; Gong, Mali

    2017-12-01

    Segmented Planar Imaging Detector for Electro-Optical Reconnaissance (SPIDER) is a cutting-edge electro-optical imaging technology to realize miniaturization and complanation of imaging systems. In this paper, the principle of SPIDER has been numerically demonstrated based on the partially coherent light theory, and a novel concept of adjustable baseline pairing SPIDER system has further been proposed. Based on the results of simulation, it is verified that the imaging quality could be effectively improved by adjusting the Nyquist sampling density, optimizing the baseline pairing method and increasing the spectral channel of demultiplexer. Therefore, an adjustable baseline pairing algorithm is established for further enhancing the image quality, and the optimal design procedure in SPIDER for arbitrary targets is also summarized. The SPIDER system with adjustable baseline pairing method can broaden its application and reduce cost under the same imaging quality.

  2. Evidence of Antiblockade in an Ultracold Rydberg Gas

    NASA Astrophysics Data System (ADS)

    Amthor, Thomas; Giese, Christian; Hofmann, Christoph S.; Weidemüller, Matthias

    2010-01-01

    We present the experimental observation of the antiblockade in an ultracold Rydberg gas recently proposed by Ates et al. [Phys. Rev. Lett. 98, 023002 (2007)PRLTAO0031-900710.1103/PhysRevLett.98.023002]. Our approach allows the control of the pair distribution in the gas and is based on a strong coupling of one transition in an atomic three-level system, while introducing specific detunings of the other transition. When the coupling energy matches the interaction energy of the Rydberg long-range interactions, the otherwise blocked excitation of close pairs becomes possible. A time-resolved spectroscopic measurement of the Penning ionization signal is used to identify slight variations in the Rydberg pair distribution of a random arrangement of atoms. A model based on a pair interaction Hamiltonian is presented which well reproduces our experimental observations and allows one to deduce the distribution of nearest-neighbor distances.

  3. Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.

    PubMed Central

    Wilson, J H

    1979-01-01

    Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028

  4. Majorana edge States in atomic wires coupled by pair hopping.

    PubMed

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  5. SeaQuaKE: Sea-optimized Quantum Key Exchange

    DTIC Science & Technology

    2014-11-01

    ONRBAA13-001). In this technical report, we describe modeling results of an entangled photon - pair source based on spontaneous four-wave mixing for...Distribution Special Notice (13-SN- 0004 under ONRBAA13-001). In this technical report, we describe modeling results of an entangled photon - pair ...areas over the last quarter include (i) development of a wavelength-dependent, entangled photon - pair source model and (ii) end-to-end system modeling

  6. Evidence of Knowledge Acquisition in a Cognitive Flexibility-Based Computer Learning Environment

    PubMed Central

    Heath, Scott; Higgs, John; Ambruso, Daniel R.

    2008-01-01

    Background A computer-based learning experience was developed using cognitive flexibility theory to overcome the pitfalls often encountered in existing medical education. An earlier study (not published) showed significant pretest-posttest increase in scores, as well as a significant positive correlation between choosing to complete the module individually or in pairs. Method This experience was presented as part of a second-year course in medical school with randomized assignment for students to complete the program as pairs or individuals. Results Sixty-six scores of 101 medical students (31 from students working as singles and 35 from 70 working in pairs) were analyzed. Out of 47 possible points, the mean pretest score was 15.1 (SD = 6.4, range 13.7-15.9). The mean posttest score was 22.9 (SD = 5.2, range 21.1-24.2). Posttest scores were statistically significantly higher than pretest scores (p<.001, Cohen's d = 1.17, average gain 7.8 points). Both pairs and singles showed pre-to-post test score gains, but the score gains of pairs and singles were not significantly different. Conclusion This learning module served as an effective instructional intervention. However, the effect of collaboration, measured by score gains for pairs, was not significantly different from score gains of students completing the assignment individually. PMID:20165544

  7. Same-sex partner preference in zebra finches: pairing flexibility and choice.

    PubMed

    Tomaszycki, Michelle L; Zatirka, Brendon P

    2014-11-01

    This study examined flexibility and choice in same-sex pair-bonding behavior in adult zebra finches (Taeniopygia guttata). Zebra finches form life-long monogamous relationships and extra pair behavior is very low, making them an ideal species in which to study same-sex pairing. We examined same-sex behaviors using both semi-naturalistic choice paradigms and skewed sex ratios. In the first experiment, we allowed zebra finches to pair in aviaries with equal sex ratios as part of multiple experiments. On average, 6.4% (N = 78) of unmanipulated pairs were same-sex: all but one was female-female. In a second experiment, we identified pairs from same-sex cages and selected 20 total same-sex pairs (10 of each sex). We then gave pairs a chance to court and pair with members of the opposite sex and observed their behavior for three days. Females did not retain their partner, but most paired with males. In contrast, some males did retain their partner. Similarly, females were more likely to engage in pairing behaviors with males than with their partners or other females whereas males were equally likely to engage in same-sex and opposite-sex pairing behaviors. These findings suggest that same-sex partnerships in zebra finches can be facultative, based on the sex ratio of the group in which they live, but can also be a choice, when opportunities to pair with opposite-sex individuals are possible. Furthermore, it is possible that females are more flexible in this choice of same-sex partnerships than are males.

  8. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  9. Same-Sex and Race-Based Disparities in Statutory Rape Arrests.

    PubMed

    Chaffin, Mark; Chenoweth, Stephanie; Letourneau, Elizabeth J

    2016-01-01

    This study tests a liberation hypothesis for statutory rape incidents, specifically that there may be same-sex and race/ethnicity arrest disparities among statutory rape incidents and that these will be greater among statutory rape than among forcible sex crime incidents. 26,726 reported incidents of statutory rape as defined under state statutes and 96,474 forcible sex crime incidents were extracted from National Incident-Based Reporting System data sets. Arrest outcomes were tested using multilevel modeling. Same-sex statutory rape pairings were rare but had much higher arrest odds. A victim-offender romantic relationship amplified arrest odds for same-sex pairings, but damped arrest odds for male-on-female pairings. Same-sex disparities were larger among statutory than among forcible incidents. Female-on-male incidents had uniformly lower arrest odds. Race/ethnicity effects were smaller than gender effects and more complexly patterned. The findings support the liberation hypothesis for same-sex statutory rape arrest disparities, particularly among same-sex romantic pairings. Support for race/ethnicity-based arrest disparities was limited and mixed. © The Author(s) 2014.

  10. Unbiased Protein Association Study on the Public Human Proteome Reveals Biological Connections between Co-Occurring Protein Pairs

    PubMed Central

    2017-01-01

    Mass-spectrometry-based, high-throughput proteomics experiments produce large amounts of data. While typically acquired to answer specific biological questions, these data can also be reused in orthogonal ways to reveal new biological knowledge. We here present a novel method for such orthogonal data reuse of public proteomics data. Our method elucidates biological relationships between proteins based on the co-occurrence of these proteins across human experiments in the PRIDE database. The majority of the significantly co-occurring protein pairs that were detected by our method have been successfully mapped to existing biological knowledge. The validity of our novel method is substantiated by the extremely few pairs that can be mapped to existing knowledge based on random associations between the same set of proteins. Moreover, using literature searches and the STRING database, we were able to derive meaningful biological associations for unannotated protein pairs that were detected using our method, further illustrating that as-yet unknown associations present highly interesting targets for follow-up analysis. PMID:28480704

  11. Quantum cryptography using entangled photons in energy-time bell states

    PubMed

    Tittel; Brendel; Zbinden; Gisin

    2000-05-15

    We present a setup for quantum cryptography based on photon pairs in energy-time Bell states and show its feasibility in a laboratory experiment. Our scheme combines the advantages of using photon pairs instead of faint laser pulses and the possibility to preserve energy-time entanglement over long distances. Moreover, using four-dimensional energy-time states, no fast random change of bases is required in our setup: Nature itself decides whether to measure in the energy or in the time base, thus rendering eavesdropper attacks based on "photon number splitting" less efficient.

  12. A nucleobase-centered coarse-grained representation for structure prediction of RNA motifs.

    PubMed

    Poblete, Simón; Bottaro, Sandro; Bussi, Giovanni

    2018-02-28

    We introduce the SPlit-and-conQueR (SPQR) model, a coarse-grained (CG) representation of RNA designed for structure prediction and refinement. In our approach, the representation of a nucleotide consists of a point particle for the phosphate group and an anisotropic particle for the nucleoside. The interactions are, in principle, knowledge-based potentials inspired by the $\\mathcal {E}$SCORE function, a base-centered scoring function. However, a special treatment is given to base-pairing interactions and certain geometrical conformations which are lost in a raw knowledge-based model. This results in a representation able to describe planar canonical and non-canonical base pairs and base-phosphate interactions and to distinguish sugar puckers and glycosidic torsion conformations. The model is applied to the folding of several structures, including duplexes with internal loops of non-canonical base pairs, tetraloops, junctions and a pseudoknot. For the majority of these systems, experimental structures are correctly predicted at the level of individual contacts. We also propose a method for efficiently reintroducing atomistic detail from the CG representation.

  13. Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms

    DTIC Science & Technology

    2009-05-01

    base pair)  Watson ‐ Crick  strand pairs that bind perfectly within pairs, but poorly across pairs. A variety  of  DNA  strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE

  14. Exact solutions for a type of electron pairing model with spin-orbit interactions and Zeeman coupling.

    PubMed

    Liu, Jia; Han, Qiang; Shao, L B; Wang, Z D

    2011-07-08

    A type of electron pairing model with spin-orbit interactions or Zeeman coupling is solved exactly in the framework of the Richardson ansatz. Based on the exact solutions for the case with spin-orbit interactions, it is shown rigorously that the pairing symmetry is of the p + ip wave and the ground state possesses time-reversal symmetry, regardless of the strength of the pairing interaction. Intriguingly, how Majorana fermions can emerge in the system is also elaborated. Exact results are illustrated for two systems, respectively, with spin-orbit interactions and Zeeman coupling.

  15. Pair production of scalar dyons in Kerr-Newman black holes

    NASA Astrophysics Data System (ADS)

    Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi

    2018-06-01

    We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.

  16. Femtosecond Laser--Pumped Source of Entangled Photons for Quantum Cryptography Applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, D.; Donaldson, W.; Sobolewski, R.

    2007-07-31

    We present an experimental setup for generation of entangled-photon pairs via spontaneous parametric down-conversion, based on the femtosecond-pulsed laser. Our entangled-photon source utilizes a 76-MHz-repetition-rate, 100-fs-pulse-width, mode-locked, ultrafast femtosecond laser, which can produce, on average, more photon pairs than a cw laser of an equal pump power. The resulting entangled pairs are counted by a pair of high-quantum-efficiency, single-photon, silicon avalanche photodiodes. Our apparatus is intended as an efficient source/receiver system for the quantum communications and quantum cryptography applications.

  17. Case Study Projects for College Mathematics Courses Based on a Particular Function of Two Variables

    ERIC Educational Resources Information Center

    Shi, Y.

    2007-01-01

    Based on a sequence of number pairs, a recent paper (Mauch, E. and Shi, Y., 2005, Using a sequence of number pairs as an example in teaching mathematics, "Mathematics and Computer Education," 39(3), 198-205) presented some interesting examples that can be used in teaching high school and college mathematics classes such as algebra, geometry,…

  18. Children's agenda-based regulation: The effects of prior performance and reward on elementary school children's study choices.

    PubMed

    Lipowski, Stacy; Ariel, Robert; Tauber, Sarah K; Dunlosky, John

    2017-12-01

    The main goal of the current experiments was to examine the influence of monitoring and reward on elementary school children's study decisions. First and third graders studied names for 10 animals (e.g., "The elephant's name is Suzy") and then were given a cued recall test on which they were shown the animal and needed to recall the name. Next, they were given an opportunity to restudy the animal-name pairs, and some of these pairs were slated to earn a reward (a sticker) if correctly recalled. In Experiment 1, both groups of children were (a) more likely to restudy previously unrecalled pairs than previously recalled pairs and (b) more likely to restudy pairs that were slated to receive a reward. In Experiment 2, we further explored children's use of reward using a forced-choice selection task. Namely, during selection, pairs were presented in dyads where one pair was slated for a reward and the other pair was not, and the children could choose only one pair from each dyad for restudy. Both first and third graders chose to restudy pairs slated for a reward. Thus, even young elementary school children consider both rewards and performance monitoring when regulating their learning. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Birds choose long-term partners years before breeding

    USGS Publications Warehouse

    Teitelbaum, Claire S.; Converse, Sarah J.; Mueller, Thomas

    2017-01-01

    Pair bonds can provide social benefits to long-term monogamous species alongside their benefits for reproduction. However, little is known about when these bonds form, in particular how long they are present before breeding. Previous studies of pair formation in long-term monogamous birds have been rather data-limited, but for many migratory birds they report pair formation on the wintering grounds. We provide the first systematic investigation of prebreeding association patterns of long-term monogamous pairs by examining entire life histories based on tracking data of migratory whooping cranes, Grus americana. We found that a substantial portion (62%) of breeding pairs started associating at least 12 months before first breeding, with 16 of 58 breeding pairs beginning to associate over 2 years before first breeding. For most pairs, these associations with future breeding partners also became unique and distinguishable from association patterns with nonpartner individuals 12 months before first breeding. In addition, 60% of pair associations began before at least one partner had reached nominal sexual maturity. Most pairs began associating in the late spring upon arrival at the summer grounds, while associations beginning at other times of the year were rare. Patterns in the associations of pairs prior to breeding can point to the potential benefits of prebreeding relationships, for instance providing support in competitive interactions or increasing partner familiarity.

  20. Designed Synthesis of Mesoporous Solid-Supported Lewis Acid-Base Pairs and Their CO2 Adsorption Behaviors.

    PubMed

    Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges

    2018-04-18

    Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.

  1. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    PubMed Central

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

  2. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    PubMed

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  3. Measurement of Beta Particles Induced Electron-Hole Pairs Recombination in Depletion Region of GaAs PN Junction

    NASA Astrophysics Data System (ADS)

    Chen, Hai-Yang; Jiang, Lan; Li, Da-Rang

    2011-05-01

    PN junctions and schottky diodes are widely employed as electron-hole pair collectors in electron beam induced current (EBIC) techniques and betavoltaic batteries, in which the recombination in depletion regions is ignored. We measured the beta particles induced electron-hole pairs recombination in the depletion region of a GaAs P+PN+ junction, based on comparisons between measured short currents and ideal values. The results show that only 20% electron-hole pairs in the depletion can be collected, causing the short current. This indicates an electron-hole pair diffusion length of 0.2μm in the depletion region. Hence, it is necessary to evaluate the recombination in the EBIC techniques and betavoltaic design.

  4. Exact solution of mean-field plus an extended T = 1 nuclear pairing Hamiltonian in the seniority-zero symmetric subspace

    NASA Astrophysics Data System (ADS)

    Pan, Feng; Ding, Xiaoxue; Launey, Kristina D.; Dai, Lianrong; Draayer, Jerry P.

    2018-05-01

    An extended pairing Hamiltonian that describes multi-pair interactions among isospin T = 1 and angular momentum J = 0 neutron-neutron, proton-proton, and neutron-proton pairs in a spherical mean field, such as the spherical shell model, is proposed based on the standard T = 1 pairing formalism. The advantage of the model lies in the fact that numerical solutions within the seniority-zero symmetric subspace can be obtained more easily and with less computational time than those calculated from the mean-field plus standard T = 1 pairing model. Thus, large-scale calculations within the seniority-zero symmetric subspace of the model is feasible. As an example of the application, the average neutron-proton interaction in even-even N ∼ Z nuclei that can be suitably described in the f5 pg9 shell is estimated in the present model, with a focus on the role of np-pairing correlations.

  5. Pair-Wise Trajectory Management-Oceanic (PTM-O) . [Concept of Operations—Version 3.9

    NASA Technical Reports Server (NTRS)

    Jones, Kenneth M.

    2014-01-01

    This document describes the Pair-wise Trajectory Management-Oceanic (PTM-O) Concept of Operations (ConOps). Pair-wise Trajectory Management (PTM) is a concept that includes airborne and ground-based capabilities designed to enable and to benefit from, airborne pair-wise distance-monitoring capability. PTM includes the capabilities needed for the controller to issue a PTM clearance that resolves a conflict for a specific pair of aircraft. PTM avionics include the capabilities needed for the flight crew to manage their trajectory relative to specific designated aircraft. Pair-wise Trajectory Management PTM-Oceanic (PTM-O) is a regional specific application of the PTM concept. PTM is sponsored by the National Aeronautics and Space Administration (NASA) Concept and Technology Development Project (part of NASA's Airspace Systems Program). The goal of PTM is to use enhanced and distributed communications and surveillance along with airborne tools to permit reduced separation standards for given aircraft pairs, thereby increasing the capacity and efficiency of aircraft operations at a given altitude or volume of airspace.

  6. Production of e+e- Pairs Accompanied by Nuclear Dissociation in Ultra-peripheral Heavy Ion Collisions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adams, J.; Adler, C.; Aggarwal, M.M.

    2004-04-07

    We present the first data on e{sup +}e{sup -} pair production accompanied by nuclear breakup in ultra-peripheral gold-gold collisions at a center of mass energy of 200 GeV per nucleon pair. The nuclear breakup requirement selects events at small impact parameters, where higher-order corrections to the pair production cross section should be enhanced. We compare the pair kinematic distributions with two calculations: one based on the equivalent photon approximation, and the other using lowest-order quantum electrodynamics (QED); the latter includes the photon virtuality. The cross section, pair mass, rapidity and angular distributions are in good agreement with both calculations. Themore » pair transverse momentum, p{sub T}, spectrum agrees with the QED calculation, but not with the equivalent photon approach. We set limits on higher-order contributions to the cross section. The e{sup +} and e{sup -} p{sub T} spectra are similar, with no evidence for interference effects due to higher-order diagrams.« less

  7. Changing US Attributes After CS-US Pairings Changes CS-Attribute-Assessments: Evidence for CS-US Associations in Attribute Conditioning.

    PubMed

    Förderer, Sabine; Unkelbach, Christian

    2016-03-01

    Attribute Conditioning (AC) refers to people's changed assessments of stimuli's (CSs) attributes due to repeated pairing with stimuli (USs) possessing these attributes; for example, when an athletic person (US) is paired with a neutral person (CS), the neutral person is judged to be more athletic after the pairing. We hypothesize that this AC effect is due to CSs' associations with USs rather than direct associations with attributes. Three experiments test this hypothesis by changing US attributes after CS-US pairings. Experiments 1 and 2 conditioned athleticism by pairing neutral men (CSs) with athletic and non-athletic USs. Post-conditioning, USs' athleticism was reversed, which systematically influenced participants' assessment of CS athleticism. Experiment 3 conditioned athleticism and changed USs' musicality after CS-US pairings. This post-conditioning change affected musicality assessments of CSs but did not influence athleticism-assessments. The results indicate that AC effects are based on an associative CS-US-attribute structure. © 2016 by the Society for Personality and Social Psychology, Inc.

  8. Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

    PubMed

    Pley, H W; Flaherty, K M; McKay, D B

    1994-11-03

    In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

  9. Towards building a disease-phenotype knowledge base: extracting disease-manifestation relationship from literature

    PubMed Central

    Xu, Rong; Li, Li; Wang, QuanQiu

    2013-01-01

    Motivation: Systems approaches to studying phenotypic relationships among diseases are emerging as an active area of research for both novel disease gene discovery and drug repurposing. Currently, systematic study of disease phenotypic relationships on a phenome-wide scale is limited because large-scale machine-understandable disease–phenotype relationship knowledge bases are often unavailable. Here, we present an automatic approach to extract disease–manifestation (D-M) pairs (one specific type of disease–phenotype relationship) from the wide body of published biomedical literature. Data and Methods: Our method leverages external knowledge and limits the amount of human effort required. For the text corpus, we used 119 085 682 MEDLINE sentences (21 354 075 citations). First, we used D-M pairs from existing biomedical ontologies as prior knowledge to automatically discover D-M–specific syntactic patterns. We then extracted additional pairs from MEDLINE using the learned patterns. Finally, we analysed correlations between disease manifestations and disease-associated genes and drugs to demonstrate the potential of this newly created knowledge base in disease gene discovery and drug repurposing. Results: In total, we extracted 121 359 unique D-M pairs with a high precision of 0.924. Among the extracted pairs, 120 419 (99.2%) have not been captured in existing structured knowledge sources. We have shown that disease manifestations correlate positively with both disease-associated genes and drug treatments. Conclusions: The main contribution of our study is the creation of a large-scale and accurate D-M phenotype relationship knowledge base. This unique knowledge base, when combined with existing phenotypic, genetic and proteomic datasets, can have profound implications in our deeper understanding of disease etiology and in rapid drug repurposing. Availability: http://nlp.case.edu/public/data/DMPatternUMLS/ Contact: rxx@case.edu PMID:23828786

  10. Accelerating calculations of RNA secondary structure partition functions using GPUs

    PubMed Central

    2013-01-01

    Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434

  11. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  12. Interaction of influenza virus polymerase with viral RNA in the 'corkscrew' conformation.

    PubMed

    Flick, R; Hobom, G

    1999-10-01

    The influenza virus RNA (vRNA) promoter structure is known to consist of the 5'- and 3'-terminal sequences of the RNA, within very narrow boundaries of 16 and 15 nucleotides, respectively. A complete set of single nucleotide substitutions led to the previously proposed model of a binary hooked or 'corkscrew' conformation for the vRNA promoter when it interacts with the viral polymerase. This functional structure is confirmed here with a complete set of complementary double substitutions, of both the regular A:U and G:C type and also the G:U type of base-pair exchanges. The proposed structure consists of a six base-pair RNA rod in the distal element in conjunction with two stem-loop structures of two short-range base-pairs (positions 2-9; 3-8). These support an exposed tetranucleotide loop within each branch of the proximal element, in an overall oblique organization due to a central unpaired A residue at position 10 in the 5' sequence. Long-range base-pairing between the entire 5' and 3' branches, as required for an unmodified 'panhandle' model, has been excluded for the proximal element, while it is known to represent the mode of interaction within the distal element. A large number of short-range base-pair exchanges in the proximal element constitute promoter-up mutations, which show activities several times above that of the wild-type in reporter gene assays. The unique overall conformation and rather few invariant nucleotides appear to be the core elements in vRNA recognition by polymerase and also in viral ribonucleoprotein packaging, to allow discrimination against the background of other RNA molecules in the cell.

  13. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    PubMed Central

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  14. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    NASA Astrophysics Data System (ADS)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  15. Universal spectral signatures in pnictides and cuprates: the role of quasiparticle-pair coupling.

    PubMed

    Sacks, William; Mauger, Alain; Noat, Yves

    2017-11-08

    Understanding the physical properties of a large variety of high-T c superconductors (SC), the cuprate family as well as the more recent iron-based superconductors, is still a major challenge. In particular, these materials exhibit the 'peak-dip-hump' structure in the quasiparticle density of states (DOS). The origin of this structure is explained within our pair-pair interaction (PPI) model: The non-superconducting state consists of incoherent pairs, a 'Cooper-pair glass' which, due to the PPI, undergoes a Bose-like condensation below T c to the coherent SC state. We derive the equations of motion for the quasiparticle operators showing that the DOS 'peak-dip-hump' is caused by the coupling between quasiparticles and excited pair states, or 'super-quasiparticles'. The renormalized SC gap function becomes energy-dependent and non retarded, reproducing accurately the experimental spectra of both pnictides and cuprates, despite the large difference in gap value.

  16. Understanding child-based effects on parenting: temperament as a moderator of genetic and environmental contributions to parenting.

    PubMed

    Ganiban, Jody M; Ulbricht, Jennifer; Saudino, Kimberly J; Reiss, David; Neiderhiser, Jenae M

    2011-05-01

    The degree to which child temperament moderates genetic and environmental contributions to parenting was examined. Participants were drawn from the Nonshared Environment and Adolescent Development project and included 720 sibling pairs, ages 13.5 + 2.0 years (Sibling 1) to 12.1 + 1.3 years (Sibling 2). The sample consisted of 6 sibling types: 93 monozygotic twin pairs, 99 dizygotic twin pairs, and 95 full sibling pairs from never-divorced families and 182 full-sibling, 109 half-sibling, and 130 unrelated-sibling pairs residing in stepfamilies. Composite child temperament ratings (negative emotionality, activity, shyness, and sociability) were derived from mothers' and fathers' reports. Composite parenting ratings (negativity, warmth) for mothers and fathers were generated from children's and parents' reports. Analyses indicated that at higher levels of negative emotionality and sociability, child-based genetic contributions to mothers' and fathers' negativity increased, whereas the contributions of environmental factors declined. The opposite pattern was observed for child shyness. These same characteristics had less impact on parental warmth. For fathers only, nonshared environmental contributions to fathers' warmth increased in the presence of high child activity and sociability but declined when children were very shy. Overall these findings indicate that child-based effects on negative parenting are enhanced when children demonstrate potentially challenging characteristics but are weaker in the absence of such characteristics. (c) 2011 APA, all rights reserved.

  17. 3D-Subspace-Based Auto-Paired Azimuth Angle, Elevation Angle, and Range Estimation for 24G FMCW Radar with an L-Shaped Array

    PubMed Central

    Nam, HyungSoo; Choi, ByungGil; Oh, Daegun

    2018-01-01

    In this paper, a three-dimensional (3D)-subspace-based azimuth angle, elevation angle, and range estimation method with auto-pairing is proposed for frequency-modulated continuous waveform (FMCW) radar with an L-shaped array. The proposed method is designed to exploit the 3D shift-invariant structure of the stacked Hankel snapshot matrix for auto-paired azimuth angle, elevation angle, and range estimation. The effectiveness of the proposed method is verified through a variety of experiments conducted in a chamber. For the realization of the proposed method, K-band FMCW radar is implemented with an L-shaped antenna. PMID:29621193

  18. Effect of Destined High-Pressure Torsion on the Structure and Mechanical Properties of Rare Earth-Based Metallic Glasses

    NASA Astrophysics Data System (ADS)

    Zhao, W.; Cheng, H.; Jiang, X.; Wu, M. L.; Li, G.

    2018-03-01

    Changes in the atomic structure and mechanical properties of rare earth-based metallic glasses caused by destined high-pressure torsion (HPT) were studied by X-ray diffraction synchrotron radiation and nanoindentation. Results showed that destined HPT improved nanohardness and wear resistance, which indicated the significant contributions of this technique. The diffraction patterns showed that the contents of pairs between solvent and solute atoms with a large negative mixing enthalpy increased, whereas those of pairs between solvent atoms and between solute atoms decreased after destined HPT. Thus, the process was improved by increasing the proportion of high-intensity pairs between solvent and solute atoms.

  19. Sensitivity of gap symmetry to an incipient band: Application to iron based superconductors

    NASA Astrophysics Data System (ADS)

    Mishra, Vivek; Scalapino, Douglas; Maier, Thomas

    Observation of high temperature superconductivity in iron-based superconductors with a submerged hole band has attracted wide interest. A spin fluctuation mediated pairing mechanism has been proposed as a possible explanation for the high transition temperatures observed in these systems. Here we discuss the importance of the submerged band in the context of the gap symmetry. We show that the incipient band can lead to an attractive pairing interaction and thus have significant effects on the pairing symmetry. We propose a framework to include the effect of the incipient band in the standard multi-orbital spin-fluctuation theories which are widely used for studying various iron-based superconductors. Research sponsored by the Laboratory Directed Research and Development Program of Oak Ridge National Laboratory, managed by UT-Battelle, LLC, for the U. S. Department of Energy.

  20. High-Fidelity Down-Conversion Source for Secure Communications Using On-Demand Single Photons

    NASA Technical Reports Server (NTRS)

    Roberts, Tony

    2015-01-01

    AdvR, Inc., has built an efficient, fully integrated, waveguide-based source of spectrally uncorrelated photon pairs that will accelerate research and development (R&D) in the emerging field of quantum information science. Key to the innovation is the use of submicron periodically poled waveguides to produce counter propagating photon pairs, which is enabled by AdvR's patented segmented microelectrode poling technique. This novel device will provide a high brightness source of down-conversion pairs with enhanced spectral properties and low attenuation, and it will operate in the visible to the mid-infrared spectral region. A waveguide-based source of spectrally and spatially pure heralded photons will contribute to a wide range of NASA's advanced technology development efforts, including on-demand single photon sources for high-rate spaced-based secure communications.

  1. Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

    NASA Astrophysics Data System (ADS)

    Pinski, Peter; Neese, Frank

    2018-01-01

    Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

  2. Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

    PubMed Central

    Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

    1995-01-01

    A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

  3. Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

    NASA Astrophysics Data System (ADS)

    Sun, S. M.; Slightom, J. L.; Hall, T. C.

    1981-01-01

    A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

  4. Associations between birth size and later height from infancy through adulthood: An individual based pooled analysis of 28 twin cohorts participating in the CODATwins project.

    PubMed

    Jelenkovic, Aline; Yokoyama, Yoshie; Sund, Reijo; Hur, Yoon-Mi; Harris, Jennifer R; Brandt, Ingunn; Nilsen, Thomas Sevenius; Ooki, Syuichi; Ullemar, Vilhelmina; Almqvist, Catarina; Magnusson, Patrik K E; Saudino, Kimberly J; Stazi, Maria A; Fagnani, Corrado; Brescianini, Sonia; Nelson, Tracy L; Whitfield, Keith E; Knafo-Noam, Ariel; Mankuta, David; Abramson, Lior; Cutler, Tessa L; Hopper, John L; Llewellyn, Clare H; Fisher, Abigail; Corley, Robin P; Huibregtse, Brooke M; Derom, Catherine A; Vlietinck, Robert F; Bjerregaard-Andersen, Morten; Beck-Nielsen, Henning; Sodemann, Morten; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Alexandra Burt, S; Klump, Kelly L; Dubois, Lise; Boivin, Michel; Brendgen, Mara; Dionne, Ginette; Vitaro, Frank; Willemsen, Gonneke; Bartels, Meike; van Beijsterveld, Catharina E M; Craig, Jeffrey M; Saffery, Richard; Rasmussen, Finn; Tynelius, Per; Heikkilä, Kauko; Pietiläinen, Kirsi H; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Haworth, Claire M A; Plomin, Robert; Ji, Fuling; Ning, Feng; Pang, Zengchang; Rebato, Esther; Tarnoki, Adam D; Tarnoki, David L; Kim, Jina; Lee, Jooyeon; Lee, Sooji; Sung, Joohon; Loos, Ruth J F; Boomsma, Dorret I; Sørensen, Thorkild I A; Kaprio, Jaakko; Silventoinen, Karri

    2018-05-01

    There is evidence that birth size is positively associated with height in later life, but it remains unclear whether this is explained by genetic factors or the intrauterine environment. To analyze the associations of birth weight, length and ponderal index with height from infancy through adulthood within mono- and dizygotic twin pairs, which provides insights into the role of genetic and environmental individual-specific factors. This study is based on the data from 28 twin cohorts in 17 countries. The pooled data included 41,852 complete twin pairs (55% monozygotic and 45% same-sex dizygotic) with information on birth weight and a total of 112,409 paired height measurements at ages ranging from 1 to 69 years. Birth length was available for 19,881 complete twin pairs, with a total of 72,692 paired height measurements. The association between birth size and later height was analyzed at both the individual and within-pair level by linear regression analyses. Within twin pairs, regression coefficients showed that a 1-kg increase in birth weight and a 1-cm increase in birth length were associated with 1.14-4.25 cm and 0.18-0.90 cm taller height, respectively. The magnitude of the associations was generally greater within dizygotic than within monozygotic twin pairs, and this difference between zygosities was more pronounced for birth length. Both genetic and individual-specific environmental factors play a role in the association between birth size and later height from infancy to adulthood, with a larger role for genetics in the association with birth length than with birth weight. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Universal quantum gates for Single Cooper Pair Box based quantum computing

    NASA Technical Reports Server (NTRS)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  6. Past, present and future of kidney paired donation transplantation in India

    PubMed Central

    Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

    2017-01-01

    One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized patients. This review assists in the development of similar programs in other developing countries. PMID:28507916

  7. Past, present and future of kidney paired donation transplantation in India.

    PubMed

    Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

    2017-04-24

    One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized patients. This review assists in the development of similar programs in other developing countries.

  8. NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

    PubMed

    Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

    2014-03-07

    Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

  9. Multi-Particle Interferometry Based on Double Entangled States

    NASA Technical Reports Server (NTRS)

    Pittman, Todd B.; Shih, Y. H.; Strekalov, D. V.; Sergienko, A. V.; Rubin, M. H.

    1996-01-01

    A method for producing a 4-photon entangled state based on the use of two independent pair sources is discussed. Of particular interest is that each of the pair sources produces a two-photon state which is simultaneously entangled in both polarization and space-time variables. Performing certain measurements which exploit this double entanglement provides an opportunity for verifying the recent demonstration of nonlocality by Greenberger, Horne, and Zeilinger.

  10. A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs

    ERIC Educational Resources Information Center

    Ilhan, Mustafa

    2016-01-01

    The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…

  11. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    PubMed

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. A terrain-based paired-site sampling design to assess biodiversity losses from eastern hemlock decline

    USGS Publications Warehouse

    Young, J.A.; Smith, D.R.; Snyder, C.D.; Lemarie, D.P.

    2002-01-01

    Biodiversity surveys are often hampered by the inability to control extraneous sources of variability introduced into comparisons of populations across a heterogenous landscape. If not specifically accounted for a priori, this noise can weaken comparisons between sites, and can make it difficult to draw inferences about specific ecological processes. We developed a terrain-based, paired-site sampling design to analyze differences in aquatic biodiversity between streams draining eastern hemlock (Tsuga canadensis) forests, and those draining mixed hardwood forests in Delaware Water Gap National Recreation Area (USA). The goal of this design was to minimize variance due to terrain influences on stream communities, while representing the range of hemlock dominated stream environments present in the park. We used geographic information systems (GIS) and cluster analysis to define and partition hemlock dominated streams into terrain types based on topographic variables and stream order. We computed similarity of forest stands within terrain types and used this information to pair hemlock-dominated streams with hardwood counterparts prior to sampling. We evaluated the effectiveness of the design through power analysis and found that power to detect differences in aquatic invertebrate taxa richness was highest when sites were paired and terrain type was included as a factor in the analysis. Precision of the estimated difference in mean richness was nearly doubled using the terrain-based, paired site design in comparison to other evaluated designs. Use of this method allowed us to sample stream communities representative of park-wide forest conditions while effectively controlling for landscape variability.

  13. Stereoselective virtual screening of the ZINC database using atom pair 3D-fingerprints.

    PubMed

    Awale, Mahendra; Jin, Xian; Reymond, Jean-Louis

    2015-01-01

    Tools to explore large compound databases in search for analogs of query molecules provide a strategically important support in drug discovery to help identify available analogs of any given reference or hit compound by ligand based virtual screening (LBVS). We recently showed that large databases can be formatted for very fast searching with various 2D-fingerprints using the city-block distance as similarity measure, in particular a 2D-atom pair fingerprint (APfp) and the related category extended atom pair fingerprint (Xfp) which efficiently encode molecular shape and pharmacophores, but do not perceive stereochemistry. Here we investigated related 3D-atom pair fingerprints to enable rapid stereoselective searches in the ZINC database (23.2 million 3D structures). Molecular fingerprints counting atom pairs at increasing through-space distance intervals were designed using either all atoms (16-bit 3DAPfp) or different atom categories (80-bit 3DXfp). These 3D-fingerprints retrieved molecular shape and pharmacophore analogs (defined by OpenEye ROCS scoring functions) of 110,000 compounds from the Cambridge Structural Database with equal or better accuracy than the 2D-fingerprints APfp and Xfp, and showed comparable performance in recovering actives from decoys in the DUD database. LBVS by 3DXfp or 3DAPfp similarity was stereoselective and gave very different analogs when starting from different diastereomers of the same chiral drug. Results were also different from LBVS with the parent 2D-fingerprints Xfp or APfp. 3D- and 2D-fingerprints also gave very different results in LBVS of folded molecules where through-space distances between atom pairs are much shorter than topological distances. 3DAPfp and 3DXfp are suitable for stereoselective searches for shape and pharmacophore analogs of query molecules in large databases. Web-browsers for searching ZINC by 3DAPfp and 3DXfp similarity are accessible at www.gdb.unibe.ch and should provide useful assistance to drug discovery projects. Graphical abstractAtom pair fingerprints based on through-space distances (3DAPfp) provide better shape encoding than atom pair fingerprints based on topological distances (APfp) as measured by the recovery of ROCS shape analogs by fp similarity.

  14. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    PubMed

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood stasis. Under the same dose but different preparations, 50% alcohol DH could obviously improve the hemorheology and blood coagulation function in acute blood stasis rats. These results suggested that DH herb pair with different preparations could obviously ameliorate the abnormality of hemorheology and blood coagulation function in acute blood stasis rats, and the optimized preparation of DH herb pair on promoting blood effects was 50% alcohol extract, providing scientific basis for more effective application of the DH herb pair in modern clinic medicine. Copyright© by the Chinese Pharmaceutical Association.

  15. AfterQC: automatic filtering, trimming, error removing and quality control for fastq data.

    PubMed

    Chen, Shifu; Huang, Tanxiao; Zhou, Yanqing; Han, Yue; Xu, Mingyan; Gu, Jia

    2017-03-14

    Some applications, especially those clinical applications requiring high accuracy of sequencing data, usually have to face the troubles caused by unavoidable sequencing errors. Several tools have been proposed to profile the sequencing quality, but few of them can quantify or correct the sequencing errors. This unmet requirement motivated us to develop AfterQC, a tool with functions to profile sequencing errors and correct most of them, plus highly automated quality control and data filtering features. Different from most tools, AfterQC analyses the overlapping of paired sequences for pair-end sequencing data. Based on overlapping analysis, AfterQC can detect and cut adapters, and furthermore it gives a novel function to correct wrong bases in the overlapping regions. Another new feature is to detect and visualise sequencing bubbles, which can be commonly found on the flowcell lanes and may raise sequencing errors. Besides normal per cycle quality and base content plotting, AfterQC also provides features like polyX (a long sub-sequence of a same base X) filtering, automatic trimming and K-MER based strand bias profiling. For each single or pair of FastQ files, AfterQC filters out bad reads, detects and eliminates sequencer's bubble effects, trims reads at front and tail, detects the sequencing errors and corrects part of them, and finally outputs clean data and generates HTML reports with interactive figures. AfterQC can run in batch mode with multiprocess support, it can run with a single FastQ file, a single pair of FastQ files (for pair-end sequencing), or a folder for all included FastQ files to be processed automatically. Based on overlapping analysis, AfterQC can estimate the sequencing error rate and profile the error transform distribution. The results of our error profiling tests show that the error distribution is highly platform dependent. Much more than just another new quality control (QC) tool, AfterQC is able to perform quality control, data filtering, error profiling and base correction automatically. Experimental results show that AfterQC can help to eliminate the sequencing errors for pair-end sequencing data to provide much cleaner outputs, and consequently help to reduce the false-positive variants, especially for the low-frequency somatic mutations. While providing rich configurable options, AfterQC can detect and set all the options automatically and require no argument in most cases.

  16. Fluorescence Excitation Spectroscopy for Phytoplankton Species Classification Using an All-Pairs Method: Characterization of a System with Unexpectedly Low Rank.

    PubMed

    Rekully, Cameron M; Faulkner, Stefan T; Lachenmyer, Eric M; Cunningham, Brady R; Shaw, Timothy J; Richardson, Tammi L; Myrick, Michael L

    2018-03-01

    An all-pairs method is used to analyze phytoplankton fluorescence excitation spectra. An initial set of nine phytoplankton species is analyzed in pairwise fashion to select two optical filter sets, and then the two filter sets are used to explore variations among a total of 31 species in a single-cell fluorescence imaging photometer. Results are presented in terms of pair analyses; we report that 411 of the 465 possible pairings of the larger group of 31 species can be distinguished using the initial nine-species-based selection of optical filters. A bootstrap analysis based on the larger data set shows that the distribution of possible pair separation results based on a randomly selected nine-species initial calibration set is strongly peaked in the 410-415 pair separation range, consistent with our experimental result. Further, the result for filter selection using all 31 species is also 411 pair separations; The set of phytoplankton fluorescence excitation spectra is intuitively high in rank due to the number and variety of pigments that contribute to the spectrum. However, the results in this report are consistent with an effective rank as determined by a variety of heuristic and statistical methods in the range of 2-3. These results are reviewed in consideration of how consistent the filter selections are from model to model for the data presented here. We discuss the common observation that rank is generally found to be relatively low even in many seemingly complex circumstances, so that it may be productive to assume a low rank from the beginning. If a low-rank hypothesis is valid, then relatively few samples are needed to explore an experimental space. Under very restricted circumstances for uniformly distributed samples, the minimum number for an initial analysis might be as low as 8-11 random samples for 1-3 factors.

  17. A convergence algorithm for correlation of breech face images based on the congruent matching cells (CMC) method.

    PubMed

    Chen, Zhe; Song, John; Chu, Wei; Soons, Johannes A; Zhao, Xuezeng

    2017-11-01

    The Congruent Matching Cells (CMC) method was invented at the National Institute of Standards and Technology (NIST) for accurate firearm evidence identification and error rate estimation. The CMC method is based on the principle of discretization. The toolmark image of the reference sample is divided into correlation cells. Each cell is registered to the cell-sized area of the compared image that has maximum surface topography similarity. For each resulting cell pair, one parameter quantifies the similarity of the cell surface topography and three parameters quantify the pattern congruency of the registration position and orientation. An identification (declared match) requires a significant number of CMCs, that is, cell pairs that meet both similarity and pattern congruency requirements. The use of cell correlations reduces the effects of "invalid regions" in the compared image pairs and increases the correlation accuracy. The identification accuracy of the CMC method can be further improved by considering a feature named "convergence," that is, the tendency of the x-y registration positions of the correlated cell pairs to converge at the correct registration angle when comparing same-source samples at different relative orientations. In this paper, the difference of the convergence feature between known matching (KM) and known non-matching (KNM) image pairs is characterized, based on which an improved algorithm is developed for breech face image correlations using the CMC method. Its advantage is demonstrated by comparison with three existing CMC algorithms using four datasets. The datasets address three different brands of consecutively manufactured pistol slides, with significant differences in the distribution overlap of cell pair topography similarity for KM and KNM image pairs. For the same CMC threshold values, the convergence algorithm demonstrates noticeably improved results by reducing the number of false-positive or false-negative CMCs in a comparison. Published by Elsevier B.V.

  18. Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

    PubMed

    Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

    2018-06-08

    A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

  19. Strongly exchange-coupled triplet pairs in an organic semiconductor

    NASA Astrophysics Data System (ADS)

    Weiss, Leah R.; Bayliss, Sam L.; Kraffert, Felix; Thorley, Karl J.; Anthony, John E.; Bittl, Robert; Friend, Richard H.; Rao, Akshay; Greenham, Neil C.; Behrends, Jan

    2017-02-01

    From biological complexes to devices based on organic semiconductors, spin interactions play a key role in the function of molecular systems. For instance, triplet-pair reactions impact operation of organic light-emitting diodes as well as photovoltaic devices. Conventional models for triplet pairs assume they interact only weakly. Here, using electron spin resonance, we observe long-lived, strongly interacting triplet pairs in an organic semiconductor, generated via singlet fission. Using coherent spin manipulation of these two-triplet states, we identify exchange-coupled (spin-2) quintet complexes coexisting with weakly coupled (spin-1) triplets. We measure strongly coupled pairs with a lifetime approaching 3 μs and a spin coherence time approaching 1 μs, at 10 K. Our results pave the way for the utilization of high-spin systems in organic semiconductors.

  20. Is incest common in gray wolf packs?

    USGS Publications Warehouse

    Smith, Deborah E; Meier, Thomas J.; Geffen, Eli; Mech, L. David; Burch, John W.; Adams, Layne G.; Wayne, Robert K.

    1997-01-01

    Wolf packs generally consist of a breeding pair and their maturing offspring that help provision and protect pack young. Because the reproductive tenure in wolves is often short, reproductively mature offspring might replace their parents, resulting in sibling or parent-offspring matings. To determine the extent of incestuous pairings, we measured relatedness based on variability in 20 microsatellite loci of mated pairs, parent-offspring pairs, and siblings in two populations of gray wolves. Our 16 sampled mated pairs had values of relatedness not overlapping those of known parent-offspring or sibling dyads, which is consistent with their being unrelated or distantly related. These results suggest that full siblings or a parent and its offspring rarely mate and that incest avoidance is an important constraint on gray wolf behavioral ecology.

Top