Plurihormonal cells of normal anterior pituitary: Facts and conclusions

PubMed Central

Mitrofanova, Lubov B.; Konovalov, Petr V.; Krylova, Julia S.; Polyakova, Victoria O.; Kvetnoy, Igor M.

2017-01-01

Introduction plurihormonality of pituitary adenomas is an ability of adenoma cells to produce more than one hormone. After the immunohistochemical analysis had become a routine part of the morphological study, a great number of adenomas appeared to be multihormonal in actual practice. We hypothesize that the same cells of a normal pituitary gland releases several hormones simultaneously. Objective To analyse a possible co-expression of hormones by the cells of the normal anterior pituitary of adult humans in autopsy material. Materials and methods We studied 10 pituitary glands of 4 women and 6 men with cardiovascular and oncological diseases. Double staining immunohistochemistry using 11 hormone combinations was performed in all the cases. These combinations were: prolactin/thyroid-stimulating hormone (TSH), prolactin/luteinizing hormone (LH), prolactin/follicle-stimulating hormone (FSH), prolactin/adrenocorticotropic hormone (ACTH), growth hormone (GH)/TSH, GH/LH, GH/FSH, GH/ACTH, TSH/LH, TSH/FSH, TSH/ACTH. Laser Confocal Scanning Microscopy with a mixture of primary antibodies was performed in 2 cases. These mixtures were ACTH/prolactin, FSH/prolactin, TSH/prolactin, ACTH/GH, and FSH/GH. Results We found that the same cells of the normal adenohypophysis can co-express prolactin with ACTH, TSH, FSH, LH; GH with ACTH, TSH, FSH, LH, and TSH with ACTH, FSH, LH. The comparison of the average co-expression coefficients of prolactin, GH and TSH with other hormones showed that the TSH co-expression coefficient was significantly the least (9,5±6,9%; 9,6±7,8%; 1,0±1,3% correspondingly). Conclusion Plurihormonality of normal adenohypophysis is an actually existing phenomenon. Identification of different hormones in pituitary adenomas enables to find new ways to improve both diagnostic process and targeted treatment. PMID:28418929

Using Hashimoto thyroiditis as gold standard to determine the upper limit value of thyroid stimulating hormone in a Chinese cohort.

PubMed

Li, Yu; Chen, Dong-Ning; Cui, Jing; Xin, Zhong; Yang, Guang-Ran; Niu, Ming-Jia; Yang, Jin-Kui

2016-11-06

Subclinical hypothyroidism, commonly caused by Hashimoto thyroiditis (HT), is a risk factor for cardiovascular diseases. This disorder is defined as merely having elevated serum thyroid stimulating hormone (TSH) levels. However, the upper limit of reference range for TSH is debated recently. This study was to determine the cutoff value for the upper normal limit of TSH in a cohort using the prevalence of Hashimoto thyroiditis as "gold" calibration standard. The research population was medical staff of 2856 individuals who took part in health examination annually. Serum free triiodothyronine (FT3), free thyroxine (FT4), TSH, thyroid peroxidase antibody (TPAb), thyroglobulin antibody (TGAb) and other biochemistry parameters were tested. Meanwhile, thyroid ultrasound examination was performed. The diagnosis of HT was based on presence of thyroid antibodies (TPAb and TGAb) and abnormalities of thyroid ultrasound examination. We used two different methods to estimate the cutoff point of TSH based on the prevalence of HT. Joinpoint regression showed the prevalence of HT increased significantly at the ninth decile of TSH value corresponding to 2.9 mU/L. ROC curve showed a TSH cutoff value of 2.6 mU/L with the maximized sensitivity and specificity in identifying HT. Using the newly defined cutoff value of TSH can detect patients with hyperlipidemia more efficiently, which may indicate our approach to define the upper limit of TSH can make more sense from the clinical point of view. A significant increase in the prevalence of HT occurred among individuals with a TSH of 2.6-2.9 mU/L made it possible to determine the cutoff value of normal upper limit of TSH.

Nuclear magnetic resonance and high-performance liquid chromatography techniques for the characterization of bioactive compounds from Humulus lupulus L. (hop).

PubMed

Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica

2018-06-01

Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.

Reference intervals for thyrotropin in an area of Northern Italy: the Pordenone thyroid study (TRIPP).

PubMed

Tozzoli, R; D'Aurizio, F; Metus, P; Steffan, A; Mazzon, C; Bagnasco, M

2018-01-16

Thyrotropin (TSH) is the most accurate marker of thyroid dysfunction in the absence of pituitary or hypothalamic disease. Studies on TSH reference intervals (RIs) showed wide inter-individual variability and prompted an intense debate about the best estimation of TSH RIs. We performed a population study on TSH RIs, using current data stored in the laboratory information system (LIS), at the Hospital Department of Laboratory Medicine, Pordenone (Italy), historically an area of mild-moderate iodine deficiency with a relatively high goiter prevalence. 136,650 individuals constituted the final sample. A TSH immunoassay was performed on fasting serum samples with the Dimension Vista 1500 analyzer (Siemens Healthineers). We adopted the Kairisto's procedure to analyze TSH data downloaded by the LIS, applying the indirect strategy for deriving RIs. TSH RIs of the entire population were 0.32-3.36 mIU/L with a distribution skewed towards higher values. RIs were 0.26-3.61 mIU/L for females, and 0.32-3.01 mIU/L for males. Unlike other studies, TSH median levels progressively decreased from 0-4 to 85-104 years in the overall population, both in male and in female subgroups, showing an inverse correlation between TSH and age in all groups. This study is the first to analyze a high percentage (40%) of individuals from an ethnically homogenous Caucasian population. The results obtained emphasize the opportunity to define the TSH RIs according to age, gender and race, in addition to assay methods, and provide further insight about the possible role of iodine status.

TSH Comparison Between Chemiluminescence (Architect) and Electrochemiluminescence (Cobas) Immunoassays: An Indian Population Perspective.

PubMed

Sarkar, Rajarshi

2014-04-01

Although 3rd generation TSH assays are the most widely used immunoassays, credible comparison studies, specially involving Indian sub-populations are practically non-existent. To compare the TSH measurements between chemiluminescence (Architect) and electrochemiluminescence (Cobas) inmmunoassays in an urban ambulatory Indian population. 1,615 subjects were selected randomly from the usual laboratory workflow, their TSH measured in Architect and Cobas and the paired data thus generated were statistically analysed. TSH values of Cobas were observed to be higher than the Architect values by 28.7 %, with a significant proportional difference between the two, but majority of the Cobas values (above 90 %) were within the limits of agreement with Architect values. In situations where both the instruments are in use simultaneously, a standardization of the methods is imperative, in larger interest of the patient populace.

Pituitary-hormone secretion by thyrotropinomas.

PubMed

Roelfsema, Ferdinand; Kok, Simon; Kok, Petra; Pereira, Alberto M; Biermasz, Nienke R; Smit, Jan W; Frolich, Marijke; Keenan, Daniel M; Veldhuis, Johannes D; Romijn, Johannes A

2009-01-01

Hormone secretion by somatotropinomas, corticotropinomas and prolactinomas exhibits increased pulse frequency, basal and pulsatile secretion, accompanied by greater disorderliness. Increased concentrations of growth hormone (GH) or prolactin (PRL) are observed in about 30% of thyrotropinomas leading to acromegaly or disturbed sexual functions beyond thyrotropin (TSH)-induced hyperthyroidism. Regulation of non-TSH pituitary hormones in this context is not well understood. We there therefore evaluated TSH, GH and PRL secretion in 6 patients with up-to-date analytical and mathematical tools by 24-h blood sampling at 10-min intervals in a clinical research laboratory. The profiles were analyzed with a new deconvolution method, approximate entropy, cross-approximate entropy, cross-correlation and cosinor regression. TSH burst frequency and basal and pulsatile secretion were increased in patients compared with controls. TSH secretion patterns in patients were more irregular, but the diurnal rhythm was preserved at a higher mean with a 2.5 h phase delay. Although only one patient had clinical acromegaly, GH secretion and IGF-I levels were increased in two other patients and all three had a significant cross-correlation between the GH and TSH. PRL secretion was increased in one patient, but all patients had a significant cross-correlation with TSH and showed decreased PRL regularity. Cross-ApEn synchrony between TSH and GH did not differ between patients and controls, but TSH and PRL synchrony was reduced in patients. We conclude that TSH secretion by thyrotropinomas shares many characteristics of other pituitary hormone-secreting adenomas. In addition, abnormalities in GH and PRL secretion exist ranging from decreased (joint) regularity to overt hypersecretion, although not always clinically obvious, suggesting tumoral transformation of thyrotrope lineage cells.

Reference interval for thyrotropin in a ultrasonography screened Korean population

PubMed Central

Kim, Mijin; Kim, Soo Han; Lee, Yunkyoung; Park, Su-yeon; Kim, Hyung-don; Kwon, Hyemi; Choi, Yun Mi; Jang, Eun Kyung; Jeon, Min Ji; Kim, Won Gu; Shong, Young Kee; Kim, Won Bae

2015-01-01

Background/Aims The diagnostic accuracy of thyroid dysfunctions is primarily affected by the validity of the reference interval for serum thyroid-stimulating hormone (TSH). Thus, the present study aimed to establish a reference interval for TSH using a normal Korean population. Methods This study included 19,465 subjects who were recruited after undergoing routine health check-ups. Subjects with overt thyroid disease, a prior history of thyroid disease, or a family history of thyroid cancer were excluded from the present analyses. The reference range for serum TSH was evaluated in a normal Korean reference population which was defined according to criteria based on the guidelines of the National Academy of Clinical Biochemistry, ultrasound (US) findings, and smoking status. Sex and age were also taken into consideration when evaluating the distribution of serum TSH levels in different groups. Results In the presence of positive anti-thyroid peroxidase antibodies or abnormal US findings, the central 95 percentile interval of the serum TSH levels was widened. Additionally, the distribution of serum TSH levels shifted toward lower values in the current smokers group. The reference interval for TSH obtained using a normal Korean reference population was 0.73 to 7.06 mIU/L. The serum TSH levels were higher in females than in males in all groups, and there were no age-dependent shifts. Conclusions The present findings demonstrate that the serum TSH reference interval in a normal Korean reference population was higher than that in other countries. This result suggests that the upper and lower limits of the TSH reference interval, which was previously defined by studies from Western countries, should be raised for Korean populations. PMID:25995664

Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

PubMed

Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

2017-09-01

The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Multicomponent UV Analysis of ["alpha"]- and ["beta"]-Acids in Hops

ERIC Educational Resources Information Center

Egts, Haley; Durben, Dan J.; Dixson, John A.; Zehfus, Micheal H.

2012-01-01

A method is presented for the determination of ["alpha"]- and ["beta"]-acids (humulones and lupulones) in a hops sample using a multicomponent UV spectroscopic analysis of a methanolic hop extract. When compared with standard methods, this lab can be considered "greener" because it uses smaller volumes of safer solvents (methanol instead of…

Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

PubMed

Hartmann, Richard; Strunz, Walter T

2017-12-12

We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

Varietal discrimination of hop pellets by near and mid infrared spectroscopy.

PubMed

Machado, Julio C; Faria, Miguel A; Ferreira, Isabel M P L V O; Páscoa, Ricardo N M J; Lopes, João A

2018-04-01

Hop is one of the most important ingredients of beer production and several varieties are commercialized. Therefore, it is important to find an eco-real-time-friendly-low-cost technique to distinguish and discriminate hop varieties. This paper describes the development of a method based on vibrational spectroscopy techniques, namely near- and mid-infrared spectroscopy, for the discrimination of 33 commercial hop varieties. A total of 165 samples (five for each hop variety) were analysed by both techniques. Principal component analysis, hierarchical cluster analysis and partial least squares discrimination analysis were the chemometric tools used to discriminate positively the hop varieties. After optimizing the spectral regions and pre-processing methods a total of 94.2% and 96.6% correct hop varieties discrimination were obtained for near- and mid-infrared spectroscopy, respectively. The results obtained demonstrate the suitability of these vibrational spectroscopy techniques to discriminate different hop varieties and consequently their potential to be used as an authenticity tool. Compared with the reference procedures normally used for hops variety discrimination these techniques are quicker, cost-effective, non-destructive and eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.

[The first discovery of endemic Lyme disease in Shandong province].

PubMed

Wang, L; Wan, K; Liu, S; Chen, Z; Feng, K; Hou, X; Shi, C

2000-08-01

To investigate the endemic area of Lyme disease in Shandong province. An investigation on endemic Lyme disease was conducted by means of serological and etiological methods in Shandong province from 1992 to 1999. Of 1919 forestry residents, 120 residents had a significant antibody titer against Borolo burgdorferi strain B(31). The prevalance rate of Lyme disease was 6.25%. Haemaphysalis longicornis was a prevailing species of Ixodidae in the region. Spirochetes were observed in the midguts of 50 H. longicornis in this area by direct fluorescence antibody method. The overall positive rate was 12.0% (6/50). Two strains (TSH(1), TSH(3)) of spirochetes were isolated from H. longicornis. Both TSH(1) and TSH(3) were positively responded to McAb H(5332) and H(9724), but negatively to H(6831). Spirochetes were observed in the kidneys of 46 Rattus in this area by direct fluorescence antibody method with a positive rate of 13.26% (6/46). It was the first time that the mountainous areas in Shandong province was confirmed endemic areas of Lyme disease.

New method of paired thyrotropin assay as a screening test for neonatal hypothyroidism. [/sup 125/I tracer technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyai, K.; Oura, T.; Kawashima, M.

1978-11-01

A simple and reliable method of paired TSH assay was developed and used in screening for neonatal primary hypothyroidism. In this method, a paired assay is first done. Equal parts of the extracts of dried blood spots on filter paper (9 mm diameter) from two infants 4 to 7 days old are combined and assayed for TSH by double antibody RIA. If the value obtained is over the cut-off point, the extracts are assayed separately for TSH in a second assay to identify the abnormal sample. Two systems, A and B, with different cut-off points were tested. On the basismore » of reference blood samples (serum levels of TSH, 80 ..mu..U/ml in system A and 40 ..mu..U/ml in system B), the cut-off point was selected as follows: upper 5 (A) or 4 (B) percentile in the paired assay and values of reference blood samples in the second individual assay. Four cases (2 in A and 2 in B) of neonatal primary hypothyroidism were found among 25 infants (23 in A and 2 in B) who were recalled from a general population of 41,400 infants (24,200 in A and 17,200 in B) by 22,700 assays. This paired TSH assay system saves labor and expense for screening neonatal hypothyroidism.« less

Treatment room length-of-stay and patient throughput with radioiodine thyroid remnant ablation in differentiated thyroid cancer: comparison of thyroid-stimulating hormone stimulation methods.

PubMed

Vallejo Casas, Juan Antonio; Mena Bares, Luisa M; Gálvez, María Angeles; Marlowe, Robert J; Latre Romero, José M; Martínez-Paredes, María

2011-09-01

We sought to empirically compare treatment room length-of-stay and patient throughput for recombinant human thyroid-stimulating hormone (rhTSH)-aided thyroid remnant ablation with thyroid hormone withdrawal (THW)-aided ablation in patients with differentiated thyroid carcinoma (DTC). We retrospectively reviewed charts of all eligible (near) totally thyroidectomized patients with DTC undergoing ablation and 1-year ablation success evaluation at our tertiary referral centre from January 2003 to February 2009 (N=274). M1 disease caused exclusion unless discovered by a postablation scan or present when rhTSH was the only tolerable stimulation method. We extracted data on the length-of-stay, defined as the time between treatment room admission and discharge, and patient throughput, defined as patients ablated per treatment room per week. The treatment room discharge criterion was a whole-body dose rate of less than 60 μSv/h at 50 cm. The treatment groups (rhTSH, n=187; THW, n=87) had mostly statistically similar characteristics, but differed in primary tumour status distribution. In addition, at ablation, the rhTSH patients had a greater prevalence of prior diagnostic scintigraphy, higher mean serum TSH, and shorter interval since surgery, and received a 5.6% larger mean ablation activity. On average, rhTSH patients had a significantly lower peak whole-body dose rate (57.1 vs. 83.4 μSv/h at 50 cm; P<0.0001) and a significantly shorter treatment room stay than did the THW patients (1.41 vs. 2.02 days; P<0.001). rhTSH use allowed significantly more patients to be ablated per room per week (2.7 vs. 1.2; P<0.001). Relative to THW, rhTSH use to aid ablation reduced mean treatment room length-of-stay by almost one-third and more than doubled the average weekly patient throughput, both of which were significant differences.

Beer spoilage bacteria and hop resistance.

PubMed

Sakamoto, Kanta; Konings, Wil N

2003-12-31

For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However, some potential hop-resistant strains cannot grow in beer unless they have first been exposed to subinhibitory concentration of hop compounds. The beer spoilage ability of Pectinatus spp. and M. cerevisiae has been poorly studied. Since all the strains have been reported to be capable of beer spoiling, species identification is sufficient for the breweries. However, with the current trend of beer flavor (lower alcohol and bitterness), there is the potential risk that not yet reported bacteria will contribute to beer spoilage. Investigation of the beer spoilage ability of especially Gram-negative bacteria may be useful to reduce this risk.

Treatment of hyperfunctioning thyroid nodules by percutaneous ethanol injection.

PubMed

Larijani, Bagher; Pajouhi, Mohammad; Ghanaati, Hossein; Bastanhagh, Mohammad-Hassan; Abbasvandi, Fereshteh; Firooznia, Kazem; Shirzad, Mahmood; Amini, Mohammad-Reza; Sarai, Maryam; Abbasvandi, Nasreen; Baradar-Jalili, Reza

2002-12-06

BACKGROUND: Autonomous thyroid nodules can be treated by a variety of methods. We assessed the efficacy of percutaneous ethanol injection in treating autonomous thyroid nodules. METHODS: 35 patients diagnosed by technetium-99 scanning with hyperfunctioning nodules and suppressed sensitive TSH (sTSH) were given sterile ethanol injections under ultrasound guidance. 29 patients had clinical and biochemical hyperthyroidism. The other 6 had sub-clinical hyperthyroidism with suppressed sTSH levels (<0.24 &mgr;IU/ml) and normal thyroid hormone levels. Ethanol injections were performed once every 1-4 weeks. Ethanol injections were stopped when serum T3, T4 and sTSH levels had returned to normal, or else injections could no longer be performed because significant side effects. Patients were followed up at 3, 6 and, in 15 patients, 24 months after the last injection. RESULTS: Average pre-treatment nodule volume [18.2 PlusMinus; 12.7 ml] decreased to 5.7 PlusMinus; 4.6 ml at 6 months follow-up [P < 0.001]. All patients had normal thyroid hormone levels at 3 and 6 months follow-up [P < 0.001 relative to baseline]. sTSH levels increased from 0.09 PlusMinus; 0.02 &mgr;IU/ml to 0.65 PlusMinus; 0.8 &mgr;IU/ml at the end of therapy [P < 0.05]. Only 3 patients had persistent sTSH suppression at 6 months post-therapy. T4 and sTSH did not change significantly between 6 months and 2 years [P > 0.05]. Ethanol injections were well tolerated by the patients, with only 2 cases of transient dysphonia. CONCLUSION: Our findings indicate that ethanol injection is an alternative to surgery or radioactive iodine in the treatment of autonomous thyroid nodules.

Experimental hypothyroidism increases content of collagen and glycosaminoglycans in the heart.

PubMed

Drobnik, J; Ciosek, J; Slotwinska, D; Stempniak, B; Zukowska, D; Marczynski, A; Tosik, D; Bartel, H; Dabrowski, R; Szczepanowska, A

2009-09-01

The connective tissue matrix of the heart remains under regulatory influence of the thyroid hormones. Some conflicting data describe the connective tissue changes in subjects with thyroid gland disorders. The aim of the study was to assess the changes of the connective tissue accumulation in the heart of rats in the state of hypothyroidism and to answer the question whether TSH is involved in mechanism of the observed phenomena. Hypothyroidism in rats was induced by methylotiouracil treatment or by thyreoidectomy. The thyroid hormones [freeT3 (fT3), freeT4 (fT4)] and pituitary TSH were measured in plasma with radioimmunological method. The glycosaminoglycans (GAG) and total collagen were measured in heart muscle of both left and right ventricles. Cells from the rat's heart were isolated and cultured. The cells were identified as myofibroblasts by electron microscopy method. The effects of TSH in concentrations ranging from 0.002 to 20 mIU/ml, on connective tissue accumulation in heart myofibroblasts cultures were tested. The primary hypothyroidism was developed both in groups with thyroidectomy and with methylthiouracil. The levels of fT3 and fT4 both in rats with thyreoidectomy and animals treated with methylthiouracil were decreased and TSH level in these two experimental groups was elevated. In the heart of the rats with experimental hypothyroidism increased content of both GAG and collagen was found. Myofibroblast number in culture was increased by TSH. Regardless of the method of its induction, hypothyroidism increased collagen and GAG contents in the heart. TSH is not involved in regulation of collagen and glycosaminoglycans accumulation in the heart of rats affected with primary hypothyroidism.

Age and body composition influence TSH concentrations after administration of rhTSH.

PubMed

Holthausen, F F; von Müller, F; Happel, C; Kranert, W T; Grünwald, F

2015-01-01

Previous studies listed body surface area (BSA), lean body mass (LBM), and age as modifying factors on the TSH concentrations after administration of recombinant human thyrotropin (rhTSH). The purpose of this study was to identify the main modifying factors on serum TSH levels and to compare the stimulation via single rhTSH injection after a short thyroid hormone withdrawal (THW) with that of the standard stimulating protocol. 106 patients with differentiated thyroid cancer (DTC) undergoing radioiodine therapy (RIT) after rhTSH administration were obtained through chart review. Two groups were evaluated: Group I was treated with a single rhTSH administration after two weeks of T3 therapy followed by one week of THW. Group II was stimulated according to the international standard protocol via rhTSH injections for two consecutive days. Serum TSH concentrations were documented prior to rhTSH administration (day 1 TSH), one day after (day 3 TSH) and 3-6 days after (mean 4.2 days, day 6 TSH) the last rhTSH injection. The following data was collected: age, gender, weight, height, BMI, LBM, BSA, residual thyroid tissue, CRP, creatinine, GFR, liver enzymes, alkaline phosphatase, cholesterol, and triglycerides. Group I: Age combined with anthropometric factors like BMI (TSH increase and day 6 TSH), BSA (TSH decrease), and gender (day 6 TSH) are the main modifying factors on serum TSH concentrations after rhTSH administration. Group II: Age and lean body mass (LBM) showed a significant impact on day 3 TSH, TSH increase (day 3-day 1), and TSH decrease (day 6-day 3). Day 6 TSH was found to be influenced by GFR (group II). Age and anthropometric parameters have significant independent influence on TSH concentrations after rhTSH injection in both groups. Anthropometric parameters (BSA, LBM) and demographic parameters (female gender) show strong influence on TSH concentrations. Further research should be conducted to examine the influence of body compartments on TSH levels through measuring total body water.

The frequency hopping pattern design for random hopping frequency signal based on stationary phase principle

NASA Astrophysics Data System (ADS)

Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun

2018-04-01

For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.

Clinical experience with recombinant human thyroid-stimulating hormone (rhTSH): whole-body scanning with iodine-131.

PubMed

Reiners, C; Luster, M; Lassmann, M

1999-01-01

Whole-body scanning (WBS) with iodine-131 (I-131) is currently used together with serum thyroglobulin (Tg) measurement in the diagnostic follow-up of well-differentiated thyroid carcinoma. One of the main disadvantages of I-131 WBS is its requirement of repeated weeks-long withdrawal of thyroid hormone suppression therapy (THST) to raise endogenous thyroid-stimulating hormone (TSH) production. This results in hypothyroidism and associated abnormalities, discomfort and morbidity. Recently, however, a series of multicentre clinical studies established the efficacy, safety, non-antigenicity, and quality of life benefits of recombinant human TSH (rhTSH, Thyrogen, thyrotropin alfa, Genzyme Corporation, Cambridge, MA, USA) in promoting radioiodine uptake and permitting sensitive I-131 WBS in patients on THST after initial therapy of well-differentiated thyroid cancer. Thus in everyday practice, rhTSH administration may in many cases supersede THST withdrawal as a preparative method for I-131 imaging. With the use of rhTSH, as whenever I-131 WBS is performed, useful and accurate imaging requires meticulous attention to good scanning practices. These include use of appropriate equipment, proper timing, sufficient scanning time, vigilance against artifacts and iodine contamination, and consideration of additional imaging in the case of ambiguous 48-hour scans. Whole-body retention of I-131 is approximately 50% greater during hypothyroidism after THST withdrawal than during euthyroidism on THST and rhTSH. Therefore, it is important to use an adequate diagnostic activity of > or =4 mCi (148 MBq) to compensate for the faster radioiodine clearance in the euthyroid state permitted by rhTSH administration. Ongoing dosimetric research eventually may provide more specific guidance regarding radioiodine activities for diagnostic, and, particularly, therapeutic purposes, with the use of rhTSH.

Targeting thyroid diseases with TSH receptor analogs.

PubMed

Galofré, Juan C; Chacón, Ana M; Latif, Rauf

2013-12-01

The thyroid-stimulating hormone (TSH) receptor (TSHR) is a major regulator of thyroid function and growth, and is the key antigen in several pathological conditions including hyperthyroidism, hypothyroidism, and thyroid tumors. Various effective treatment strategies are currently available for many of these clinical conditions such as antithyroid drugs or radioiodine therapy, but they are not devoid of side effects. In addition, treatment of complications of Graves' disease such as Graves' ophthalmopathy is often difficult and unsatisfactory using current methods. Recent advances in basic research on both in vitro and in vivo models have suggested that TSH analogs could be used for diagnosis and treatment of some of the thyroid diseases. The advent of high-throughput screening methods has resulted in a group of TSH analogs called small molecules, which have the potential to be developed as promising drugs. Small molecules are low molecular weight compounds with agonist, antagonist and, in some cases, inverse agonist activity on TSHR. This short review will focus on current advances in development of TSH analogs and their potential clinical applications. Rapid advances in this field may lead to the conduct of clinical trials of small molecules related to TSHR for the management of Graves' disease, thyroid cancer, and thyroid-related osteoporosis in the coming years. Copyright © 2012 SEEN. Published by Elsevier Espana. All rights reserved.

Non-hyperfunctioning nodules from multinodular goiters: a minor role in pathogenesis for somatic activating mutations in the TSH-receptor and Gsalpha subunit genes.

PubMed

Derrien, C; Sonnet, E; Gicquel, I; Le Gall, J Y; Poirier, J Y; David, V; Maugendre, D

2001-05-01

Constitutive activation of the cAMP pathway stimulates thyrocyte proliferation. Gain-of-function mutations in Gsalpha protein have already been identified in thyroid nodules which have lost the ability to trap iodine. In contrast, most of the studies failed to detect somatic activating mutations in the thyrotropin receptor (TSH-R) in non-hyperfunctioning thyroid tumors. The aim of this study was to screen for mutations TSH-R exon 10, encoding the whole intracytoplasmic area involved in signal transduction, and Gsalpha exons 8 and 9, containing the two hot-spot codons 201 and 227, in a subset of non-hyperfunctioning nodules from multinodular goiter. Identified by matching ultrasonography and scintiscan, 22 eufunctioning (normal 99Tc uptake) and 15 nonfunctioning (decreased 99Tc uptake) nodules from 27 non-toxic multinodular goiters were isolated. After DNA extraction, TSH-R exon 10 was analyzed by direct sequencing of the PCR products and Gsalpha exons 8 and 9 by Denaturing Gradient Gel Electrophoresis. No mutation of TSH-R or Gsalpha was detected in the 37 nodules analyzed. This absence of mutation, despite the use of two sensitive screening methods associated with the analysis of the TSH-R whole intracytoplasmic area and Gsalpha two hot-spot codons, suggests that TSH-R and Gsalpha play a minor role in the pathogenesis of non-toxic nodules from multinodular goiters.

Reactivity of thyroid papillary carcinoma cells to thyroid stimulating hormone-dominated endocrine therapy

PubMed Central

Ma, Yuqin; Zhang, Xia; Wang, Yutao

2017-01-01

This study investigated the effect of thyroid stimulating hormone (TSH) on the proliferation of papillary thyroid carcinoma (PTC) cells and the therapeutic effect of levothyroxine sodium (TH). PTC cells (TPC-1) were cultured using 0.1, 1.0 and 10 U/l TSH and 10−2, 10−4 and 10−6 mol/l TH. After the appropriate concentration was screened, TPC-1 cells were further divided into control group, TSH group, TH group and TSH+TH group. The cell proliferation was detected via methyl thiazolyl tetrazolium (MTT) method, TPC-1 cell cycle was detected via flow cytometer, and the mRNA and protein expression of cyclin D1 were detected via real-time polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA). Compared with control group, TSH significantly promoted the proliferation of TPC-1 cells (P<0.05 or P<0.01), obviously promoted the transition of TPC-1 cells from G1 phase to S phase (P<0.01) and remarkably increased the mRNA and protein expression of cyclin D1 (P<0.01); but TH had a significant inhibitory effect on these results of TSH (P<0.05 or P<0.01). TSH can promote the proliferation of PTC cells, and the appropriate complement of TH can inhibit its proliferation. PMID:29250166

The reference intervals of thyroid stimulating hormone in healthy individuals with normal levels of serum free thyroxine and without sonographic pathologies.

PubMed

Kutluturk, Faruk; Yildirim, Beytullah; Ozturk, Banu; Ozyurt, Huseyin; Bekar, Ulku; Sahin, Semsettin; Akturk, Yeliz; Akbas, Ali; Cetin, Ilhan; Etikan, Ilker

2014-01-01

The aim of the present study was to investigate the reference intervals for thyroid stimulating hormone (TSH) in healthy individuals with normal levels of serum free thyroxine (fT4) and without sonographic pathologies, and determine the effects of age, gender, and residence on the TSH reference intervals. This research was a population-based study conducted in 70 regions. The random sampling method was used to select the 1095 subjects of the study among inhabitants aged 18 and above. Patients who had a previous history of thyroid disease and had been taking medication were excluded from the study as this may have affected their fT4 or TSH levels. In addition, subjects who had serum fT4 without a reference range and abnormal ultrasonography findings were also excluded. A total of 408 subjects were used for establishing the reference intervals for TSH. The data for TSH in the study group were not normally distributed according to the Kolmogorov-Smirnov index. The geometric mean was 1.62 mIU/L, the median was 1.40 mIU/L, and the 95% reference intervals were 0.38-4.22 mIU/L. The median TSH level was higher in females compared to males (p < 0.05). In the female subjects 2.5th percentile of TSH was lower and 97.5th percentile was higher than those of males. The reference intervals of TSH were of lower values in subjects over 50 years old (p < 0.001). Studies suggest that determination of the TSH reference intervals may differ due to environmental influences or due to age, gender, and race. It is suggested that the lower limit of normal TSH for the adult Turkish population would be 0.38 mIU/L and the upper limit similar to the traditional value of 4.2 mIU/L. If each clinician uses their population-specific reference interval for TSH, thyroid function abnormalities can be accurately estimated.

High-throughput genotyping of hop (Humulus lupulus L.) utilising diversity arrays technology (DArT).

PubMed

Howard, E L; Whittock, S P; Jakše, J; Carling, J; Matthews, P D; Probasco, G; Henning, J A; Darby, P; Cerenak, A; Javornik, B; Kilian, A; Koutoulis, A

2011-05-01

Implementation of molecular methods in hop (Humulus lupulus L.) breeding is dependent on the availability of sizeable numbers of polymorphic markers and a comprehensive understanding of genetic variation. However, use of molecular marker technology is limited due to expense, time inefficiency, laborious methodology and dependence on DNA sequence information. Diversity arrays technology (DArT) is a high-throughput cost-effective method for the discovery of large numbers of quality polymorphic markers without reliance on DNA sequence information. This study is the first to utilise DArT for hop genotyping, identifying 730 polymorphic markers from 92 hop accessions. The marker quality was high and similar to the quality of DArT markers previously generated for other species; although percentage polymorphism and polymorphism information content (PIC) were lower than in previous studies deploying other marker systems in hop. Genetic relationships in hop illustrated by DArT in this study coincide with knowledge generated using alternate methods. Several statistical analyses separated the hop accessions into genetically differentiated North American and European groupings, with hybrids between the two groups clearly distinguishable. Levels of genetic diversity were similar in the North American and European groups, but higher in the hybrid group. The markers produced from this time and cost-efficient genotyping tool will be a valuable resource for numerous applications in hop breeding and genetics studies, such as mapping, marker-assisted selection, genetic identity testing, guidance in the maintenance of genetic diversity and the directed breeding of superior cultivars.

A Comparison of Vertical Stiffness Values Calculated from Different Measures of Center of Mass Displacement in Single-Leg Hopping.

PubMed

Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J

2017-02-01

This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.

Communication devices for network-hopping communications and methods of network-hopping communications

DOEpatents

Buttles, John W [Idaho Falls, ID

2011-12-20

Wireless communication devices include a software-defined radio coupled to processing circuitry. The processing circuitry is configured to execute computer programming code. Storage media is coupled to the processing circuitry and includes computer programming code configured to cause the processing circuitry to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

Communication devices for network-hopping communications and methods of network-hopping communications

DOEpatents

Buttles, John W

2013-04-23

Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

Follow-up of differentiated thyroid carcinoma.

PubMed

Pagano, L; Klain, M; Pulcrano, M; Angellotti, G; Pasano, F; Salvatore, M; Lombardi, G; Biondi, B

2004-12-01

Thyroid cancer is the most common endocrine malignancy. More than 90% of primary thyroid cancers are differentiated papillary or follicular types. The treatment of differentiated thyroid carcinoma (DTC) consists of total thyroidectomy and radioactive iodine ablation therapy, followed by L-thyroxine therapy. The extent of initial surgery, the indication for radioiodine ablation therapy and the degree of TSH-suppression are all issues that are still being debated cancers are in relation to the risk of recurrence. Total thyroidectomy reduces the risk of recurrence and facilitates (131)I ablation of thyroid remnants. The aim of radioiodine ablation is to destroy any normal or neoplastic residuals of thyroid tissue. These procedures also improve the sensitivity of thyroglobulin (Tg) as a marker of disease, and increase the sensitivity of (131)I total body scan (TBS) for the detection of persistent or recurrent disease. The aim of TSH-suppressive therapy is to restore euthyroidism and to decrease serum TSH levels, in order to reduce the growth and progression of thyroid cancer. After initial treatment, the objectives of the follow-up of DTC is to maintain adequate thyroxine therapy and to detect persistent or recurrent disease through the combined use of neck ultrasound (US) and serum Tg and (131)I TBS after TSH stimulation. The follow-up protocol should be adapted to the risk of recurrence. Recent advances in the follow-up of DTC are related to the use of recombinant human TSH (rhTSH) in order to stimulate Tg production and the ultrasensitive methods for Tg measurement. Undetectable serum Tg during TSH suppressive therapy with L-T4 does not exclude persistent disease, therefore serum Tg should be measured after TSH stimulation. The results of rhTSH administration and L-thyroxine therapy withdrawal are equivalent in detecting recurrent thyroid cancer, but the use of rhTSH helps to avoid the onset of hypothyroid symptoms and the negative effects of acute hypothyroidism on cardiovascular, hepatic, renal and neurological function. In low-risk DTC patients serum Tg after TSH stimulation, together with ultrasound of the neck, should be used to monitor persistent disease, avoiding diagnostic TBS which has a poor sensitivity. These recommendations do not apply when Tg antibodies are present in the serum, in patients with persistent or recurrent disease or limited thyroid surgery. Low-risk patients may be considered to be in remission when undetectable Tg after TSH stimulation and negative US evaluation of the neck are present. On the contrary, detectable Tg after TSH stimulation is an indicator in selecting patients who are candidates for further diagnostic procedures.

Classification of Scaffold Hopping Approaches

PubMed Central

Sun, Hongmao; Tawa, Gregory; Wallqvist, Anders

2012-01-01

The general goal of drug discovery is to identify novel compounds that are active against a preselected biological target with acceptable pharmacological properties defined by marketed drugs. Scaffold hopping has been widely applied by medicinal chemists to discover equipotent compounds with novel backbones that have improved properties. In this review, scaffold hopping is classified into four major categories, namely heterocycle replacements, ring opening or closure, peptidomimetics, and topology-based hopping. The structural diversity of original and final scaffolds with respect to each category will be reviewed. The advantages and limitations of small, medium, and large-step scaffold hopping will also be discussed. Software that is frequently used to facilitate different kinds of scaffold hopping methods will be summarized. PMID:22056715

Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea

PubMed Central

Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun

2016-01-01

Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293

[Monosymptomatic hyperthyroidism and TSH-producing adenoma: successful therapy with octreotide].

PubMed

Mayinger, B; Axelos, D; Pavel, M; Hahn, E G; Hensen, J

1999-01-29

Magnetic resonance imaging (MRI) of the central nervous system was performed on a 72-year-old woman who was hyperthyroid without suppression of the thyroid-stimulating hormone (TSH) and had complained of a recent onset of headaches. MRI demonstrated a space-occupying lesion, 1 cm in diameter, in the anterior pituitary. The clinical symptoms were marked by a long-standing monosymptomatic illness of rapidly changing mood swings with depressive and manic phases. Endocrinological-biochemical tests showed hyperthyroidism (fT3 10.55 pmol/l and fT4 39 pmol/l) but no TSH suppression (TSH: 2.9 microU/ml). Octreotide scintigraphy documented an activity-rich area in the anterior pituitary and the upper anterior mediastinum. Mediastinal MRI revealed a 5 cm space-occupying mass lying on the right atrium. 131I scintigraphy identified the mass as a retrosternal goitre. As an operation on the anterior pituitary would have carried a high risk for the patient who was in a poor general condition and she had refused to be operated, treatment with octreotide, a long-acting somatostatin analogue, was initiated. This achieved a euthyroid state with partly suppressed TSH, and the patient's emotional swings ceased. If hyperthyroidism coexists with non-suppressed TSH levels, a TSH-producing hypophyseal adenoma should be considered in the differential diagnosis despite its rarity. Octreotide administration is an effective and safe treatment and is the method of choice, especially when there are contraindications to surgical resection of the anterior pituitary.

Zinc oxide nanoparticles based microfluidic immunosensor applied in congenital hypothyroidism screening.

PubMed

Seia, Marco A; Pereira, Sirley V; Fernández-Baldo, Martin A; De Vito, Irma E; Raba, Julio; Messina, Germán A

2014-07-01

In this article, we present an innovative approach for congenital hypothyroidism (CHT) screening. This pathology is the most common preventable cause of mental retardation, affecting newborns around the world. Its consequences could be avoided with an early diagnosis through the thyrotropin (TSH) level measurement. To accomplish the determination of TSH, synthesized zinc oxide (ZnO) nanobeads (NBs) covered by chitosan (CH), ZnO-CH NBs, were covalently attached to the central channel of the designed microfluidic device. These beads were employed as platform for anti-TSH monoclonal antibody immobilization to specifically recognize and capture TSH in neonatal samples without any special pretreatment. Afterwards, the amount of this trapped hormone was quantified by horseradish peroxidase (HRP)-conjugated anti-TSH antibody. HRP reacted with its enzymatic substrate in a redox process, which resulted in the appearance of a current whose magnitude was directly proportional to the level of TSH in the neonatal sample. The structure and morphology of synthesized ZnO-CH NBs were characterized by scanning electron microscopy (SEM) and X-ray diffraction (XRD). The calculated detection limits for electrochemical detection and the enzyme-linked immunosorbent assay procedure were 0.00087 μUI mL(-1) and 0.015 μUI mL(-1), respectively, and the within- and between-assay coefficients of variation were below 6.31% for the proposed method. According to the cut-off value for TSH neonatal screening, a reasonably good limit of detection was achieved. These above-mentioned features make the system advantageous for routine clinical analysis adaptation.

Dual control of pituitary thyroid stimulating hormone secretion by thyroxine and triiodothyronine in athyreotic patients

PubMed Central

Hoermann, Rudolf; Midgley, John E. M.; Dietrich, Johannes W.; Larisch, Rolf

2017-01-01

Background: Patient responses to levothyroxine (LT4) monotherapy vary considerably. We sought to differentiate contributions of FT4 and FT3 in controlling pituitary thyroid stimulating hormone (TSH) secretion. Methods: We retrospectively assessed the relationships between TSH and thyroid hormones in 319 patients with thyroid carcinoma through 2914 visits on various LT4 doses during follow-up for 5.5 years (median, IQR 4.2, 6.9). We also associated patient complaints with the relationships. Results: Under varying dose requirements (median 1.84 µg/kg, IQR 1.62, 2.11), patients reached TSH targets below 0.4, 0.1 or 0.01 mIU/l at 73%, 54% and 27% of visits. While intercept, slope and fit of linearity of the relationships between lnTSH and FT4/FT3 varied between individuals, gender, age, LT4 dose and deiodinase activity influenced the relationships in the cohort (all p < 0.001). Deiodinase activity impaired by LT4 dose significantly affected the lnTSH–FT4 relationship. Dose increase and reduced conversion efficiency displaced FT3–TSH equilibria. In LT4-treated patients, FT4 and FT3 contributed on average 52% versus 38%, and by interaction 10% towards TSH suppression. Symptomatic presentations (11%) accompanied reduced FT3 concentrations (–0.23 pmol/l, p = 0.001) adjusted for gender, age and BMI, their relationships being shifted towards higher TSH values at comparable FT3/FT4 levels. Conclusions: Variation in deiodinase activity and resulting FT3 levels shape the TSH–FT4 relationship in LT4-treated athyreotic patients, suggesting cascade control of pituitary TSH production by the two hormones. Consequently, measurement of FT3 and calculation of conversion efficiency may identify patients with impaired biochemistry and a resulting lack of symptomatic control. PMID:28794850

SERUM THYROTROPIN CONCENTRATIONS ARE NOT PREDICTIVE OF AGGRESSIVE BREAST CANCER BIOLOGY IN EUTHYROID INDIVIDUALS

PubMed Central

Villa, Natalie M.; Li, Ning; Yeh, Michael W.; Hurvitz, Sara A.; Dawson, Nicole A.; Leung, Angela M.

2015-01-01

Objective The potential influence of hypothyroidism on breast cancer remains incompletely understood. The objective of this study was to investigate the relationship between serum thyrotropin [thyroid-stimulating hormone (TSH)] concentration and markers of aggressive breast cancer biology, as defined by receptor expression profile, tumor grade, and American Joint Committee on Cancer (AJCC) stage characteristics. Methods This was a retrospective cohort study of patients from 2002–2014. All breast cancer patients who had complete receptor (estrogen receptor, ER; progesterone receptor, PR; and Her2/neu) and pre-diagnosis serum TSH data (n=437) were included. All patients had one of six receptor profiles: ER+ PR+ Her2/neu −, ER+ PR− Her2/neu−, ER+ PR+ Her2/neu+, ER+ PRHer2/ neu+, ER− PR− Her2/neu+, ER− PR− Her2/neu−. Log-transformed serum TSH concentrations were analyzed using multinomial and logistic regressions for a potential relationship with markers of breast cancer aggressiveness. Results Increasing serum TSH concentration was associated with a lower probability of having the receptor expression profile ER+ PR+ Her2/neu+ compared to patients with the ER+ PR+ Her2/neu− profile (OR=0.52, p=0.0045). No significant associations between other receptor expression profiles and serum TSH concentration were found. All time-weighted and unweighted median serum TSH concentrations were within normal limits. No significant associations between serum TSH concentration and tumor grade, overall AJCC stage, or tumor size (T), lymph node positivity (N), or presence of metastasis (M) were observed. Conclusions Serum TSH was not associated with markers of breast cancer aggressiveness in our cohort. PMID:26121443

25-Hydroxyvitamin D and TSH as Risk Factors or Prognostic Markers in Thyroid Carcinoma

PubMed Central

Danilovic, Debora Lucia Seguro; Ferraz-de-Souza, Bruno; Fabri, Amanda Wictky; Santana, Nathalie Oliveira; Kulcsar, Marco Aurelio; Cernea, Claudio Roberto; Marui, Suemi; Hoff, Ana Oliveira

2016-01-01

Objective The increasing incidence of thyroid nodules demands identification of risk factors for malignant disease. Several studies suggested the association of higher TSH levels with cancer, but influence of 25-hydroxyvitamin D (25OHD) is controversial. This study aimed to identify the relationship of thyroid cancer with higher TSH levels and hypovitaminosis D and to evaluate their influence on prognostic characteristics of papillary thyroid carcinomas (PTC). Methods We retrospectively evaluated 433 patients submitted to thyroidectomy for thyroid nodules. Patients were categorized according to quartiles of TSH and 25OHD levels. Clinicopathological features were analyzed. Results Subjects with thyroid carcinomas were more frequently male and younger compared to those with benign disease. Their median TSH levels were higher and adjusted odds-ratio (OR) for cancer in the highest-quartile of TSH (> 2.4 mUI/mL) was 2.36 (1.36–4.09). Although vitamin D deficiency/insufficiency was prevalent in our cohort (84%), no significant differences in 25OHD levels or quartile distribution were observed between benign and malignant cases. Among 187 patients with PTC, analyses of prognostic features revealed increased risk of lymph nodes metastases for subjects with highest-quartile TSH levels (OR = 3.7, p = 0.029). Decreased 25OHD levels were not overtly associated with poor prognosis in PTC. Conclusions In this cross-sectional cohort, higher TSH levels increased the risk of cancer in thyroid nodules and influenced its prognosis, particularly favoring lymph nodes metastases. On the other hand, no association was found between 25OHD levels and thyroid carcinoma risk or prognosis, suggesting that serum 25OHD determination may not contribute to risk assessment workup of thyroid nodules. PMID:27737011

Comparative effect of Citrus sinensis and carbimazole on serum T4, T3 and TSH levels

PubMed Central

Uduak, Okon Akpan; Ani, Elemi John; Etoh, Emmauel Columba Inyang; Macstephen, Adienbo Ologbagno

2014-01-01

Background: There are previous independent reports on the anti-thyroid property of Citrus sinensis. This isoflavones and phenolic acid-rich natural agent is widely consumed as dietary supplement, thus the need to investigate its comparative effect with a standard anti-thyroid drug on T4, T3 and thyroid stimulating hormone (TSH) levels. Objective: To compare the effect of Citrus sinensis and carbimazole (CARB) on blood levels of thyroid hormones (T4 and T3) and TSH. Materials and Methods: Male wistar albino rats weighing 100-150 g were employed in this research. The rats were randomly assigned to four groups of seven rats per group. Group I served as control and were administered distilled water while groups II-IV were administered with 1500 mg/kg of Citrus sinensis (fresh orange juice; FOJ), 0.1 μg/g of levothyroxine (LVT) and 0.01 mg/g of CARB, respectively, per oral once daily for 28 days. The animals were sacrificed under chloroform anaesthesia and blood sample collected by cardiac puncture and processed by standard method to obtain serum. TSH, T4 and T3 were assayed with the serum using ARIA II automated radioimmunoassay instrument. Results: The results showed that TSH level was significantly (P < 0.05) decreased in LVT treated group compared with the FOJ group. T4 was significantly (P < 0.05) decreased in the FOJ and CARB groups compared with the control and LVT groups. LVT significantly increased T4 when compared with FOJ group. T3 was significantly (P < 0.05) decreased in the CARB group compared with the control. Conclusion: These findings suggest that FOJ alters thyroid hormones metabolism to reduce their serum levels with a compensatory elevations of TSH level in a direction similar to CARB. PMID:25013255

Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

PubMed Central

Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

2010-01-01

AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

Falsely undetectable TSH in a cohort of South Asian euthyroid patients.

PubMed

Drees, Julia C; Stone, Judith A; Reamer, C Randy; Arboleda, Victoria E; Huang, Karl; Hrynkow, Jane; Greene, Dina N; Petrie, Matthew S; Hoke, Carolyn; Lorey, Thomas S; Dlott, Richard S

2014-04-01

An index case of a clinically euthyroid woman of South Asian descent was identified with discordant TSH results: undetectable TSH on our routine assay and normal TSH on an alternate assay. Low TSH concentrations due to functionally compromising TSH mutations have been reported. Here we describe a new phenomenon of functional TSH that is undetectable by 4 widely used US Food and Drug Administration (FDA)-approved TSH immunoassays marketed by a single vendor. The purpose of this study was to identify additional cases and investigate the cause of the falsely undetectable TSH. All samples with TSH results of <0.01 μIU/mL were retested with a second TSH assay. Discordant samples were evaluated on up to 8 FDA-approved TSH immunoassays and the TSHβ gene was sequenced. Retrospectively, thyroid function tests, diagnoses, and medications from 1.6 million individuals were analyzed. Out of approximately 2 million individuals, we have identified a cohort of 20 hypothyroid and euthyroid patients of shared ethnicity with falsely undetectable TSH (<0.01 μIU/mL) in 4 of 8 commercially available TSH assays. Half of these individuals were initially treated based on repeated falsely undetectable TSH values (7 euthyroid patients were treated with methimazole and 2 hypothyroid patients had doses of levothyroxine decreased). In all cases, a retrospective chart review revealed that clinical assessments and free T4 and total T3 results were inconsistent with the undetectable TSH results. Specific antibodies failing to detect TSH in these cases were identified in the 4 affected assays. A novel TSHβ point mutation was identified. Our data suggest that these individuals have a previously unrecognized, functionally normal, TSH variant to which some monoclonal antibodies fail to bind. To assure appropriate patient management, clinicians and laboratorians need to be aware that certain TSH variants may be undetectable in some hyperselective TSH assays.

Surface hopping simulation of vibrational predissociation of methanol dimer

NASA Astrophysics Data System (ADS)

Jiang, Ruomu; Sibert, Edwin L.

2012-06-01

The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

Flexible scheme to truncate the hierarchy of pure states.

PubMed

Zhang, P-P; Bentley, C D B; Eisfeld, A

2018-04-07

The hierarchy of pure states (HOPS) is a wavefunction-based method that can be used for numerically modeling open quantum systems. Formally, HOPS recovers the exact system dynamics for an infinite depth of the hierarchy. However, truncation of the hierarchy is required to numerically implement HOPS. We want to choose a "good" truncation method, where by "good" we mean that it is numerically feasible to check convergence of the results. For the truncation approximation used in previous applications of HOPS, convergence checks are numerically challenging. In this work, we demonstrate the application of the "n-particle approximation" to HOPS. We also introduce a new approximation, which we call the "n-mode approximation." We then explore the convergence of these truncation approximations with respect to the number of equations required in the hierarchy in two exemplary problems: absorption and energy transfer of molecular aggregates.

Flexible scheme to truncate the hierarchy of pure states

NASA Astrophysics Data System (ADS)

Zhang, P.-P.; Bentley, C. D. B.; Eisfeld, A.

2018-04-01

The hierarchy of pure states (HOPS) is a wavefunction-based method that can be used for numerically modeling open quantum systems. Formally, HOPS recovers the exact system dynamics for an infinite depth of the hierarchy. However, truncation of the hierarchy is required to numerically implement HOPS. We want to choose a "good" truncation method, where by "good" we mean that it is numerically feasible to check convergence of the results. For the truncation approximation used in previous applications of HOPS, convergence checks are numerically challenging. In this work, we demonstrate the application of the "n-particle approximation" to HOPS. We also introduce a new approximation, which we call the "n-mode approximation." We then explore the convergence of these truncation approximations with respect to the number of equations required in the hierarchy in two exemplary problems: absorption and energy transfer of molecular aggregates.

Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

ERIC Educational Resources Information Center

Putnam, Michael

2006-01-01

This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

Degree of thyrotropin suppression as a prognostic determinant in differentiated thyroid cancer.

PubMed

Pujol, P; Daures, J P; Nsakala, N; Baldet, L; Bringer, J; Jaffiol, C

1996-12-01

We investigate whether the prognosis of patients with differentiated thyroid cancer is improved by maintaining a greater level of TSH suppression. One hundred and forty-one patients who underwent hormone therapy after thyroidectomy were followed up from 1970 to 1993 (mean, 95 months). Patients received levothyroxine (L-T4; mean dose, 2.6 micrograms/kg-day). TSH suppression was evaluated by TRH stimulation test until 1986 and thereafter by a second generation immunoradiometric assay. As TSH underwent fluctuation over time in most patients, we focused on subgroups of patients with relatively constant TSH levels during the follow-up. The relapse-free survival (RFS) was longer in the group with constantly suppressed TSH (all TSH values, < or = 0.05 mU/L; n = 18) than in the group with nonsuppressed TSH (all TSH values, > or = 1 mU/L; n = 15; P < 0.01). Age, sex, tumor node metastasis stage, and initial therapy were not different between the suppressed and nonsuppressed TSH groups. In the overall population, we analyzed the level of TSH suppression by studying the percentage of undetectable TSH values (< or = 0.05 mU/L) during the follow-up. The patients with a greater degree of TSH suppression (> 90% of undetectable TSH values; n = 19) had a trend toward a longer RFS than the remaining population (n = 102; P = 0.14). The patients with a lesser degree of TSH suppression (< 10% of undetectable TSH values; n = 27) had a shorter RFS than the remaining patients (n = 94; P < 0.01). In multivariate analysis that included TSH suppression, age, sex, histology, and tumor node metastasis stage, the degree of TSH suppression predicted RFS independently of other factors (P = 0.02). This study shows that a lesser degree of TSH suppression is associated with an increased incidence of relapse, supporting the hypothesis that a high level of TSH suppression is required for the endocrine management of thyroid cancer.

Evaluation of recombinant human thyroid-stimulating hormone to test thyroid function in dogs suspected of having hypothyroidism.

PubMed

Boretti, Felicitas S; Sieber-Ruckstuhl, Nadja S; Favrot, Claude; Lutz, Hans; Hofmann-Lehmann, Regina; Reusch, Claudia E

2006-12-01

To evaluate the use of recombinant human (rh) thyroid-stimulating hormone (TSH) in dogs with suspected hypothyroidism. 64 dogs with clinical signs of hypothyroidism. Dogs received rhTSH (75 microg/dog, IV) at a dose independent of their body weight. Blood samples were taken before and 6 hours after rhTSH administration for determination of total serum thyroxine (T(4)) concentration. Dogs were placed into 1 of 3 groups as follows: those with normal (ie, poststimulation values indicative of euthyroidism), unchanged (ie, poststimulation values indicative of hypothyroidism; no thyroid gland stimulation), or intermediate (ie, poststimulation values between unchanged and normal values) post-TSH T(4) concentrations. Serum canine TSH (cTSH) concentration was determined in prestimulation serum (ie, before TSH administration). 14, 35, and 15 dogs had unchanged, normal, and intermediate post-TSH T(4) concentrations, respectively. Basal T(4) and post-TSH T(4) concentrations were significantly different among groups. On the basis of basal serum T(4) and cTSH concentrations alone, 1 euthyroid (normal post-TSH T(4), low basal T(4), and high cTSH concentrations) and 1 hypothyroid dog (unchanged post-TSH T(4) concentration and low to with-in reference range T(4) and cTSH concentrations) would have been misinterpreted as hypothyroid and euthyroid, respectively. Nine of the 15 dogs with intermediate post-TSHT(4) concentrations had received medication known to affect thyroid function prior to the test, and 2 of them had severe nonthyroidal disease. The TSH-stimulation test with rhTSH is a valuable diagnostic tool to assess thyroid function in selected dogs in which a diagnosis of hypothyroidism cannot be based on basal T(4) and cTSH concentrations alone.

Weight Changes in Patients with Differentiated Thyroid Carcinoma during Postoperative Long-Term Follow-up under Thyroid Stimulating Hormone Suppression

PubMed Central

Sohn, Seo Young; Joung, Ji Young; Cho, Yoon Young; Park, Sun Mi; Jin, Sang Man; Chung, Jae Hoon

2015-01-01

Background There are limited data about whether patients who receive initial treatment for differentiated thyroid cancer (DTC) gain or lose weight during long-term follow-up under thyroid stimulating hormone (TSH) suppression. This study was aimed to evaluate whether DTC patients under TSH suppression experience long-term weight gain after initial treatment. We also examined the impact of the radioactive iodine ablation therapy (RAIT) preparation method on changes of weight, comparing thyroid hormone withdrawal (THW) and recombinant human TSH (rhTSH). Methods We retrospectively reviewed 700 DTC patients who underwent a total thyroidectomy followed by either RAIT and levothyroxine (T4) replacement or T4 replacement alone. The control group included 350 age-matched patients with benign thyroid nodules followed during same period. Anthropometric data were measured at baseline, 1 to 2 years, and 3 to 4 years after thyroidectomy. Comparisons were made between weight and body mass index (BMI) at baseline and follow-up. Results Significant gains in weight and BMI were observed 3 to 4 years after initial treatment for female DTC but not in male patients. These gains among female DTC patients were also significant compared to age-matched control. Women in the THW group gained a significant amount of weight and BMI compared to baseline, while there was no increase in weight or BMI in the rhTSH group. There were no changes in weight and BMI in men according to RAIT preparation methods. Conclusion Female DTC patients showed significant gains in weight and BMI during long-term follow-up after initial treatment. These changes were seen only in patients who underwent THW for RAIT. PMID:26248858

Impact of Drinking Water Fluoride on Human Thyroid Hormones: A Case- Control Study.

PubMed

Kheradpisheh, Zohreh; Mirzaei, Masoud; Mahvi, Amir Hossein; Mokhtari, Mehdi; Azizi, Reyhane; Fallahzadeh, Hossein; Ehrampoush, Mohammad Hassan

2018-02-08

The elevated fluoride from drinking water impacts on T 3 , T 4 and TSH hormones. The aim was study impacts of drinking water fluoride on T 3 , T 4 and TSH hormones inYGA (Yazd Greater Area). In this case- control study 198 cases and 213 controls were selected. Fluoride was determined by the SPADNS Colorimetric Method. T 3 , T 4 and TSH hormones tested in the Yazd central laboratory by RIA (Radio Immuno Assay) method. The average amount of TSH and T 3 hormones based on the levels of fluoride in two concentration levels 0-0.29 and 0.3-0.5 (mg/L) was statistically significant (P = 0.001 for controls and P = 0.001 for cases). In multivariate regression logistic analysis, independent variable associated with Hypothyroidism were: gender (odds ratio: 2.5, CI 95%: 1.6-3.9), family history of thyroid disease (odds ratio: 2.7, CI 95%: 1.6-4.6), exercise (odds ratio: 5.34, CI 95%: 3.2-9), Diabetes (odds ratio: 3.7, CI 95%: 1.7-8), Hypertension (odds ratio: 3.2, CI 95%: 1.3-8.2), water consumption (odds ratio: 4, CI 95%: 1.2-14). It was found that fluoride has impacts on TSH, T 3 hormones even in the standard concentration of less than 0.5 mg/L. Application of standard household water purification devices was recommended for hypothyroidism.

Generalized trajectory surface hopping method based on the Zhu-Nakamura theory

NASA Astrophysics Data System (ADS)

Oloyede, Ponmile; Mil'nikov, Gennady; Nakamura, Hiroki

2006-04-01

We present a generalized formulation of the trajectory surface hopping method applicable to a general multidimensional system. The method is based on the Zhu-Nakamura theory of a nonadiabatic transition and therefore includes the treatment of classically forbidden hops. The method uses a generalized recipe for the conservation of angular momentum after forbidden hops and an approximation for determining a nonadiabatic transition direction which is crucial when the coupling vector is unavailable. This method also eliminates the need for a rigorous location of the seam surface, thereby ensuring its applicability to a wide class of chemical systems. In a test calculation, we implement the method for the DH2+ system, and it shows a remarkable agreement with the previous results of C. Zhu, H. Kamisaka, and H. Nakamura, [J. Chem. Phys. 116, 3234 (2002)]. We then apply it to a diatomic-in-molecule model system with a conical intersection, and the results compare well with exact quantum calculations. The successful application to the conical intersection system confirms the possibility of directly extending the present method to an arbitrary potential of general topology.

Butanol production under microaerobic conditions with a symbiotic system of Clostridium acetobutylicum and Bacillus cereus.

PubMed

Wu, Pengfei; Wang, Genyu; Wang, Gehua; Børresen, Børre Tore; Liu, Hongjuan; Zhang, Jianan

2016-01-14

One major problem of ABE (acetone, butanol and ethanol) fermentation is high oxygen sensitivity of Clostridium acetobutylicum. Currently, no single strain has been isolated or genetically engineered to produce butanol effectively under aerobic conditions. In our previous work, a symbiotic system TSH06 has been developed successfully by our group, and two strains, C. acetobutylicum TSH1 and Bacillus cereus TSH2, were isolated from TSH06. Compared with single culture, TSH06 showed promotion on cell growth and solvent accumulation under microaerobic conditions. To simulate TSH06, a new symbiotic system was successfully re-constructed by adding living cells of B. cereus TSH2 into C. acetobutylicum TSH1 cultures. During the fermentation process, the function of B. cereus TSH2 was found to deplete oxygen and provide anaerobic environment for C. acetobutylicum TSH1. Furthermore, inoculation ratio of C. acetobutylicum TSH1 and B. cereus TSH2 affected butanol production. In a batch fermentation with optimized inoculation ratio of 5 % C. acetobutylicum TSH1 and 0.5 % B. cereus TSH2, 11.0 g/L butanol and 18.1 g/L ABE were produced under microaerobic static condition. In contrast to the single culture of C. acetobutylicum TSH1, the symbiotic system became more aerotolerant and was able to produce 11.2 g/L butanol in a 5 L bioreactor even with continuous 0.15 L/min air sparging. In addition, qPCR assay demonstrated that the abundance of B. cereus TSH2 increased quickly at first and then decreased sharply to lower than 1 %, whereas C. acetobutylicum TSH1 accounted for more than 99 % of the whole population in solventogenic phase. The characterization of a novel symbiotic system on butanol fermentation was studied. The new symbiotic system re-constructed by co-culture of C. acetobutylicum TSH1 and B. cereus TSH2 showed excellent performance on butanol production under microaerobic conditions. B. cereus TSH2 was a good partner for C. acetobutylicum TSH1 by providing an anaerobic environment. During fermentation process, the high ratio of Clostridium and low ratio of Bacillus composition indicated that this symbiotic system was an effective and easily controlled cultivation model for ABE fermentation under microaerobic conditions.

Analytical methods for quantitation of prenylated flavonoids from hops.

PubMed

Nikolić, Dejan; van Breemen, Richard B

2013-01-01

The female flowers of hops ( Humulus lupulus L.) are used as a flavoring agent in the brewing industry. There is growing interest in possible health benefits of hops, particularly as estrogenic and chemopreventive agents. Among the possible active constituents, most of the attention has focused on prenylated flavonoids, which can chemically be classified as prenylated chalcones and prenylated flavanones. Among chalcones, xanthohumol (XN) and desmethylxanthohumol (DMX) have been the most studied, while among flavanones, 8-prenylnaringenin (8-PN) and 6-prenylnaringenin (6-PN) have received the most attention. Because of the interest in medicinal properties of prenylated flavonoids, there is demand for accurate, reproducible and sensitive analytical methods to quantify these compounds in various matrices. Such methods are needed, for example, for quality control and standardization of hop extracts, measurement of the content of prenylated flavonoids in beer, and to determine pharmacokinetic properties of prenylated flavonoids in animals and humans. This review summarizes currently available analytical methods for quantitative analysis of the major prenylated flavonoids, with an emphasis on the LC-MS and LC-MS-MS methods and their recent applications to biomedical research on hops. This review covers all methods in which prenylated flavonoids have been measured, either as the primary analytes or as a part of a larger group of analytes. The review also discusses methodological issues relating to the quantitative analysis of these compounds regardless of the chosen analytical approach.

Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program

PubMed Central

Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

2016-01-01

Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968

Influence of human body composition on serum peak thyrotropin (TSH) after recombinant human TSH administration in patients with differentiated thyroid carcinoma.

PubMed

Castagna, Maria Grazia; Pinchera, Aldo; Marsili, Alessandro; Giannetti, Monica; Molinaro, Eleonora; Fierabracci, Paola; Grasso, Lucia; Pacini, Furio; Santini, Ferruccio; Elisei, Rossella

2005-07-01

In this study, we evaluated the influence of height, weight, body mass index (BMI), body surface area, and body composition [total lean body mass (LBM) and fat body mass] on serum peak TSH levels obtained after recombinant human (rh)TSH. Furthermore, to verify whether the serum peak TSH influenced the efficacy of radioiodine ((131)I), we compared the rate of thyroid remnant ablation according to the patients' BMI. We studied 105 patients with differentiated thyroid carcinoma who underwent rhTSH stimulation test. Serum TSH measurements were performed before and 24, 48, and 72 h after rhTSH administration. We also compared the rate of thyroid remnant ablation among 70 differentiated thyroid carcinoma patients with different BMI. The serum peak TSH after rhTSH was significantly lower in overweight and obese subjects compared with normal-weight subjects (92.1 +/- 41.8, 82.4 +/- 24.2, and 112.7 +/- 46.3 microU/ml, respectively; P = 0.01) and in males compared with females (74.6 +/- 22.3 and 105.0 +/- 43.0 microU/ml, respectively; P = 0.0002). By univariate analysis, serum peak TSH was negatively related to weight, height, body surface area, BMI, LBM, and fat body mass, but only LBM was independently associated with serum peak TSH levels. Although it was confirmed that overweight and obese patients had a lower serum peak TSH, the rate of ablation did not differ among normal-weight, overweight, and obese patients. With this study we demonstrated that LBM is the only parameter independently associated with serum peak TSH after rhTSH administration. However, the serum peak TSH does not influence the rate of (131)I remnant ablation.

Blocking mitochondrial cyclophilin D ameliorates TSH-impaired defensive barrier of artery.

PubMed

Liu, Xiaojing; Du, Heng; Chai, Qiang; Jia, Qing; Liu, Lu; Zhao, Meng; Li, Jun; Tang, Hui; Chen, Wenbin; Zhao, Lifang; Fang, Li; Gao, Ling; Zhao, Jiajun

2018-05-01

Endothelial cells (ECs) constitute the defensive barrier of vasculature, which maintains the vascular homeostasis. Mitochondrial oxidative stress (mitoOS) in ECs significantly affects the initiation and progression of vascular diseases. The higher serum thyroid stimulating hormone (TSH) level is being recognized as a nonconventional risk factor responsible for the increased risk of cardiovascular diseases in subclinical hypothyroidism (SCH). However, effects and underlying mechanisms of elevated TSH on ECs are still ambiguous. We sought to investigate whether cyclophilin D (CypD), emerging as a crucial mediator in mitoOS, regulates effects of TSH on ECs. SCH patients with TSH > = 10mIU/L showed a positive correlation between serum TSH and endothelin-1 levels. When TSH levels declined to normal in these subjects after levothyroxine therapy, serum endothelin-1 levels were significantly reduced. Supplemented with exogenous thyroxine to keep normal thyroid hormones, thyroid-specific TSH receptor (TSHR)-knockout mice with injection of exogenous TSH exhibited elevated serum TSH levels, significant endothelial oxidative injuries and disturbed endothelium-dependent vasodilation. However, Tshr -/- mice resisted to TSH-impaired vasotonia. We further confirmed that elevated TSH triggered excessive mitochondrial permeability transition pore (mPTP) opening and mitochondrial oxidative damages in mouse aorta, as well as in cultured ECs. Genetic or pharmacological inhibition of CypD (the key regulator for mPTP opening) attenuated TSH-induced mitochondrial oxidative damages and further rescued endothelial functions. Finally, we confirmed that elevated TSH could activate CypD by enhancing CypD acetylation via inhibiting adenosine monophosphate-activated protein kinase/sirtuin-3 signaling pathway in ECs. These findings reveal that elevated TSH triggers mitochondrial perturbations in ECs and provide insights that blocking mitochondrial CypD enhances the defensive ability of ECs under TSH exposure. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Endogenous Thyrotropin and Triiodothyronine Concentrations in Individuals with Thyroid Cancer

PubMed Central

Nsouli-Maktabi, Hala; Soldin, Steven J.

2008-01-01

Background Thyroid hormone suppression therapy is associated with decreased recurrence rates and improved survival in patients with differentiated thyroid cancer. Recently higher baseline thyrotropin (TSH) levels have been found to be associated with a postoperative diagnosis of differentiated thyroid cancer. Our objective was to confirm whether preoperative TSH levels were higher in patients who were diagnosed with differentiated thyroid cancer after undergoing thyroidectomy, compared with patients who were found to have benign disease. We also sought to determine whether thyroid hormone levels were lower in the patients with malignancy. Methods The study was a retrospective analysis of a prospective study. The study setting was the General Clinical Research Center of an Academic Medical Center. Participants were 50 euthyroid patients undergoing thyroidectomy. Thyroxine, triiodothyronine (T3), and TSH levels were documented in patients prior to their scheduled thyroidectomy. Following thyroidectomy, patients were divided into those with a histologic diagnosis of either differentiated thyroid cancer or benign disease. Preoperative thyroid profiles were correlated with patients' postoperative diagnoses. Results All patients had a normal serum TSH concentration preoperatively. One-third of the group was diagnosed with thyroid cancer as a result of their thyroidectomy. These patients had a higher serum TSH level (mean = 1.50 mIU/L, CI 1.22–1.78 mIU/L) than patients with benign disease (mean = 1.01 mIU/mL, CI 0.84–1.18 mIU/L). There was a greater risk of having thyroid cancer in patients with TSH levels in the upper three quartiles of TSH values, compared with patients with TSH concentrations in the lowest quartile of TSH values (odd ratio = 8.7, CI 2.2–33.7). Patients with a thyroid cancer diagnosis also had lower T3 concentrations measured by liquid chromatography tandem mass spectrometry (mean = 112.6 ng/dL, CI 103.8–121.4 ng/dL) than did patients with a benign diagnosis (mean 129.9 ng/dL, CI 121.4–138.4 ng/dL). Conclusion These data confirm that higher TSH concentrations, even within the normal range, are associated with a subsequent diagnosis of thyroid cancer in individuals with thyroid abnormalities. This further supports the hypothesis that TSH stimulates the growth or development of thyroid malignancy during its early or preclinical phase. We also show for the first time that patients with thyroid cancer also have lower T3 levels than patients with benign disease. PMID:18788918

Mortality in a complete 4-year follow up of 85-year-old residents of Leiden, classified by serum level of thyrotropin and thyroxine.

PubMed

Singer, Richard B

2006-01-01

The authors of the source article emphasize the clinical tendency to screen for, detect and treat for thyroid dysfunction in very elderly patients, in which it is a fairly common disorder, often with occult or no symptoms. Published evidence is conflicting on the benefit, if any, of such a program. Accordingly, they devised a prospective, population-based study to determine outcomes, including survival outcome, based on serum levels of thyroid-stimulating hormone (TSH) and thyroxine. A cohort of 558 subjects who had their 85th birthday between September 1997 and September 1999 was enrolled after consent of the subject and screening examination that included serum TSH and thyroxine levels. This represented a 79% sample of all 85-year-old residents of Leiden, the Netherlands. Follow up was complete for survival 4 years to the subject's 89th birthday or prior death, although 70 subjects refused the annual re-examination. Thyroid function, disability, cognitive function and number of chronic diseases were analyzed, in addition to mortality, through Cox regression and other statistical methods. In 67 subjects with abnormally high TSH (>4.8 mIU/ L), the mean annual mortality rate was derived as 64 deaths per 1000 per year. In the 491 subjects with normal TSH or low TSH (<0.3 mIU/L), the mean annual mortality rate was derived at 114 per 1000 per year. Laboratory evidence of hypothyroidism (initially low serum thyroxine) was found in only 37 of the 67 subjects. In the 13% of elderly subjects in Leiden with abnormally high serum TSH levels, the mean annual mortality rate was significantly lower than the mortality rate in the 87% of the elderly patients with normal or low serum TSH. The significance is based on 95% confidence levels of the Poisson distribution. The rate in the group with high TSH levels had 16 deaths in 264 person-years of follow up (FU). The majority with normal or low TSH levels had 193 deaths in 1698 person-years of FU.

The Influence of Thyroid-Stimulating Hormone and Thyroid-Stimulating Hormone Receptor Antibodies on Osteoclastogenesis

PubMed Central

Morshed, Syed; Latif, Rauf; Zaidi, Mone; Davies, Terry F.

2011-01-01

Background We have shown that thyroid-stimulating hormone (TSH) has a direct inhibitory effect on osteoclastic bone resorption and that TSH receptor (TSHR) null mice display osteoporosis. To determine the stage of osteoclast development at which TSH may exert its effect, we examined the influence of TSH and agonist TSHR antibodies (TSHR-Ab) on osteoclast differentiation from murine embryonic stem (ES) cells to gain insight into bone remodeling in hyperthyroid Graves' disease. Methods Osteoclast differentiation was initiated in murine ES cell cultures through exposure to macrophage colony stimulation factor, receptor activator of nuclear factor кB ligand, vitamin D, and dexamethasone. Results Tartrate resistant acid phosphatase (TRAP)-positive osteoclasts formed in ∼12 days. This coincided with the expected downregulation of known markers of self renewal and pluripotency (including Oct4, Sox2, and REX1). Both TSH and TSHR-Abs inhibited osteoclastogenesis as evidenced by decreased development of TRAP-positive cells (∼40%–50% reduction, p = 0.0047), and by decreased expression, in a concentration-dependent manner, of osteoclast differentiation markers (including the calcitonin receptor, TRAP, cathepsin K, matrix metallo-proteinase-9, and carbonic anhydrase II). Similar data were obtained using serum immunoglobulin-Gs (IgGs) from patients with hyperthyroid Graves' disease and known TSHR-Abs. TSHR stimulators inhibited tumor necrosis factor-alpha mRNA and protein expression, but increased the expression of osteoprotegerin (OPG), an antiosteoclastogenic human soluble receptor activator of nuclear factor кB ligand receptor. Neutralizing antibody to OPG reversed the inhibitory effect of TSH on osteoclast differentiation evidencing that the TSH effect was at least in part mediated by increased OPG. Conclusion These data establish ES-derived osteoclastogenesis as an effective model system to study the regulation of osteoclast differentiation in early development. The results support the observations that TSH has a bone protective action by negatively regulating osteoclastogenesis. Further, our results implicate TSHR-Abs in offering skeletal protection in hyperthyroid Graves' disease, even in the face of high thyroid hormone and low TSH levels. PMID:21745106

Serum Thyroid-Stimulating Hormone Levels and Body Mass Index Percentiles in Children with Primary Hypothyroidism on Levothyroxine Replacement

PubMed Central

Shaoba, Asma; Basu, Sanjib; Mantis, Stelios; Minutti, Carla

2017-01-01

Objective: To determine the association, if any, between thyroid-stimulating hormone (TSH) levels and body mass index (BMI) percentiles in children with primary hypothyroidism who are chemically euthyroid and on treatment with levothyroxine. Methods: This retrospective cross-sectional study consisted of a review of medical records from RUSH Medical Center and Stroger Hospital, Chicago, USA of children with primary hypothyroidism who were seen in the clinic from 2008 to 2014 and who were chemically euthyroid and on treatment with levothyroxine for at least 6 months. The patients were divided into two groups based on their TSH levels (0.34-<2.5 mIU/L and ≥2.5-5.6 mIU/L). The data were analyzed by Spearman rank correlation, linear regression, cross tabulation and chi-square, Mann-Whitney U test, and Kruskal-Wallis test. Results: One hundred and forty-six children were included, of which 26% were obese (BMI ≥95%), 21.9% overweight (BMI ≥85-<95%), and 52.1% of a healthy weight (BMI ≥5-<85%). There was a significant positive correlation between TSH and BMI percentiles (r=0.274, p=0.001) and a significant negative correlation between TSH and serum free T4 (r=-0.259, p=0.002). In the lower TSH group, 68.4% of the children had a healthy weight, while the percentage of obese children was 60.5% in the upper TSH group (p=0.012). Conclusion: In children diagnosed with primary hypothyroidism who are chemically euthyroid on treatment with levothyroxine, there is a positive association between higher TSH levels and higher BMI percentiles. However, it is difficult to establish if the higher TSH levels are a direct cause or a consequence of the obesity. Further studies are needed to establish causation beyond significant association. PMID:28766504

Thyroid-Stimulating Hormone Suppression for Protection Against Hypothyroidism Due to Craniospinal Irradiation for Childhood Medulloblastoma/Primitive Neuroectodermal Tumor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massimino, Maura; Gandola, Lorenza; Collini, Paola

Purpose: Hypothyroidism is one of the earliest endocrine effects of craniospinal irradiation (CSI). The effects of radiation also depend on circulating thyroid-stimulating hormone (TSH), which acts as an indicator of thyrocyte function and is the most sensitive marker of thyroid damage. Hence, our study was launched in 1998 to evaluate the protective effect of TSH suppression during CSI for medulloblastoma/primitive neuroectodermal tumor. Patients and Methods: From Jan 1998 to Feb 2001, a total of 37 euthyroid children scheduled for CSI for medulloblastoma/primitive neuroectodermal tumor underwent thyroid ultrasound and free triiodothyronine (FT3), free thyroxine (FT4), and TSH evaluation at the beginningmore » and end of CSI. From 14 days before and up to the end of CSI, patients were administered L-thyroxine at suppressive doses; every 3 days, TSH suppression was checked to ensure a value <0.3 {mu}M/ml. During follow-up, blood tests and ultrasound were repeated after 1 year; primary hypothyroidism was considered an increased TSH level greater than normal range. CSI was done using a hyperfractionated accelerated technique with total doses ranging from 20.8-39 Gy; models were used to evaluate doses received by the thyroid bed. Results: Of 37 patients, 25 were alive a median 7 years after CSI. They were well matched for all clinical features, except that eight children underwent adequate TSH suppression during CSI, whereas 17 did not. Hypothyroidism-free survival rates were 70% for the 'adequately TSH-suppressed' group and 20% for the 'inadequately TSH-suppressed' group (p = 0.02). Conclusions: Thyroid-stimulating hormone suppression with L-thyroxine had a protective effect on thyroid function at long-term follow-up. This is the first demonstration that transient endocrine suppression of thyroid activity may protect against radiation-induced functional damage.« less

Precipitation of the thyrotropin receptor and identification of thyroid autoantigens using Graves' disease immunoglobulins.

PubMed Central

Heyma, P; Harrison, L C

1984-01-01

The thyrotropin (TSH) receptor is a putative target for autoantibodies in Graves' hyperthyroidism and therefore, should be capable of being identified, isolated, and structurally characterized by immunological means. To this end, four sera from patients with hyperthyroidism, three of which inhibited the binding of 125I-TSH to Triton-solubilized human thyroid membranes, were used to isolate TSH receptors by immunoprecipitation. To account for an effect of TSH binding or receptor occupancy on the ability of Graves' immunoglobulins to precipitate TSH receptors, two approaches were taken: (a) specific 125I-TSH binding activity was measured after solubilized thyroid membranes had been incubated with Graves' sera followed by precipitation with Staphylococcus protein A ("receptor depletion"); (b) TSH binding sites were labeled with 125I-TSH and the complexes were precipitated using Graves' sera and Staphylococcus protein A ("receptor precipitation"). The three sera which inhibited 125I-TSH binding depleted 125I-TSH binding activity between 30-80%. Preformed complexes between Staphylococcus protein A and immunoglobulins in these sera were also able to deplete 125I-TSH binding activity. However, after receptor depletion, the one serum that did not inhibit 125I-TSH binding was associated with a significant increase in 125I-TSH binding. All four sera specifically precipitated 80-100% of receptors identified by prelabeling with 125I-TSH. The dilutions of sera that precipitated 50% of 125I-TSH-receptor complexes ranged from 1:150-1:20. Complexes were partially precipitated by high concentrations of control sera (1:20), but the relative potency of control sera was at least fourfold less than Graves' sera. Immunoprecipitates of 125I-labeled thyroid membranes were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography to reveal Graves'-specific bands of reduced molecular weights of 100-110,000, 80-90,000, and 70-75,000. These bands were similar to those obtained from 125I-labeled thyroid membranes purified by TSH affinity chromatography. Thus, Graves' immunoglobulins: (a) precipitate unoccupied and occupied TSH receptors, (b) in one case, neither inhibit binding nor immunodeplete the unoccupied receptor but immunoprecipitate 125I-TSH-receptor complexes, suggesting that binding of TSH may initiate an interaction between the binding site and a separate immunoreactive molecule, and (c) identify the molecular structure of Graves' autoantigens, putatively, the TSH receptor. Images PMID:6088581

Correlation of Body Mass Index (BMI) with Thyroid Function in Euthyroid Pregnant Women in Manipur, India.

PubMed

Kumar, Sumit; Chiinngaihlun, T; Singh, M Rameswar; Punyabati, O

2017-04-01

Body Mass Index (BMI) is significantly increased during pregnancy due to gain of weight with normal progression of pregnancy. The exact influence of thyroid function on BMI are ill defined in euthyroid pregnant women. To correlate serum levels of Free Triiodothyronine (FT3), Free Thyroxine (FT4) and Thyroid Stimulating Hormone (TSH) level with BMI of participant normal pregnant women in all the three trimesters. In this cross-sectional comparative study, total of 210 healthy pregnant women comprising of 70 participants in each trimester, attending Obstetrics Outpatient Department (OPD) for antenatal check-up were consecutively selected. Estimation of serum FT3, FT4 and TSH level was done by ELISA based methods. The correlation of BMI with serum levels of FT3, FT4 and TSH was done using Pearson correlation test (r) by SPSS version 21.0 software. TSH level of participant normal pregnant women showed significant positive correlation with BMI during first (r=0.254 and p=0.034) and second trimester (r=0.263 and p=0.028) of pregnancy. FT4 level showed significant negative correlation in second (r= -0.454 and p<0.001) and third trimester (r= -0.351 and p=0.003) of pregnancy. Correlation between BMI and FT3 level showed no significant association in any of the trimesters. BMI correlates positively with TSH level in first and second trimesters while it correlates negatively with FT4 level in second and third trimesters, but, failed to demonstrate significant association with FT3 level in any of trimesters in euthyroid pregnant women. Serum TSH along with FT4 level appears more useful modality compared to serum TSH alone for targeted thyroid screening particularly in obese pregnant women.

Functional diagnostics for thyrotropin hormone receptor autoantibodies: bioassays prevail over binding assays.

PubMed

Lytton, Simon David; Schluter, Anke; Banga, Paul J

2018-06-01

Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.

Impact of light exposure on thyroid-stimulating hormone results using the Siemens Advia Centaur TSH-3Ultra assay.

PubMed

Armer, Jane; Giles, Diane; Lancaster, Ian; Brownbill, Kathryn

2017-09-01

Background Thyroid-stimulating hormone (TSH) is used as the first-line test of thyroid function. Siemens Healthcare Diagnostics recommend that Siemens Centaur reagents must be protected from light in the assay information and on reagent packaging. We have compared the effect of light exposure on results using Siemens TSH-3Ultra and follicle-stimulating hormone reagents. The thyroid-stimulating hormone reagent includes fluoroscein thiocyanate whereas the follicle-stimulating hormone reagent does not. Methods Three levels of quality controls were analysed using SiemensTSH-3Ultra and follicle-stimulating hormone reagent packs that had been kept protected from light or exposed to light at 6-h intervals for 48 h and then at 96 h. Results Thyroid-stimulating hormone results were significantly lower after exposure of TSH-3Ultra reagent packs to light. Results were >15% lower at all three levels of quality control following 18 h of light exposure and continued to decrease until 96 h. There was no significant difference in follicle-stimulating hormone results whether reagents had been exposed to or protected from light. Conclusions Thyroid-stimulating hormone results but not follicle-stimulating hormone results are lowered after exposure of reagent packs to light. Laboratories must ensure that TSH-3Ultra reagents are not exposed to light and analyse quality control samples on every reagent pack to check that there has not been light exposure prior to delivery. The labelling on TSH-3Ultra reagent packs should reflect the significant effect of light exposure compared with the follicle-stimulating hormone reagent. We propose that the effect of light exposure on binding of fluoroscein thiocyanate to the solid phase antibody causes the falsely low results.

Design of Compressed Sensing Algorithm for Coal Mine IoT Moving Measurement Data Based on a Multi-Hop Network and Total Variation.

PubMed

Wang, Gang; Zhao, Zhikai; Ning, Yongjie

2018-05-28

As the application of a coal mine Internet of Things (IoT), mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH) is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.

Quantitation of 4-Methyl-4-sulfanylpentan-2-one (4MSP) in Hops by a Stable Isotope Dilution Assay in Combination with GC×GC-TOFMS: Method Development and Application To Study the Influence of Variety, Provenance, Harvest Year, and Processing on 4MSP Concentrations.

PubMed

Reglitz, Klaas; Steinhaus, Martin

2017-03-22

A stable isotope dilution assay was developed for quantitation of 4-methyl-4-sulfanylpentan-2-one (4MSP) in hops. The approach included the use of 4-( 13 C)methyl-4-sulfanyl(1,3,5- 13 C 3 )pentan-2-one as internal standard, selective isolation of hop thiols by mercurated agarose, and GC×GC-TOFMS analysis. Application of the method to 53 different hop samples revealed 4MSP concentrations between <1 and 114 μg/kg. Notably high concentrations were associated with United States varieties such as Citra, Eureka, Simcoe, and Apollo, whereas 4MSP was absent from traditional German and English varieties. Further experiments showed that besides the variety, also harvest year and storage vitally influenced 4MSP concentrations, whereas the impact of provenance was less pronounced. Hop processing such as drying and pelletizing had only a minor impact on 4MSP concentrations. Like the majority of other hop volatiles, 4MSP is predominantly located in the lupulin glands.

Mechanism of action of a nanomolar potent, allosteric antagonist of the thyroid-stimulating hormone receptor

PubMed Central

van Koppen, Chris J; de Gooyer, Marcel E; Karstens, Willem-Jan; Plate, Ralf; Conti, Paolo GM; van Achterberg, Tanja AE; van Amstel, Monique GA; Brands, Jolanda HGM; Wat, Jesse; Berg, Rob JW; Lane, J Robert D; Miltenburg, Andre MM; Timmers, C Marco

2012-01-01

BACKGROUND AND PURPOSE Graves' disease (GD) is an autoimmune disease in which the thyroid is overactive, producing excessive amounts of thyroid hormones, caused by thyroid-stimulating hormone (TSH) receptor-stimulating immunoglobulins (TSIs). Many GD patients also suffer from thyroid eye disease (Graves' ophthalmopathy or GO), as TSIs also activate TSH receptors in orbital tissue. We recently developed low molecular weight (LMW) TSH receptor antagonists as a novel therapeutic strategy for the treatment of GD and GO. Here, we determined the molecular pharmacology of a prototypic, nanomolar potent LMW TSH receptor antagonist, Org 274179-0. EXPERIMENTAL APPROACH Using CHO cells heterogeneously expressing human TSH receptors and rat FRTL-5 cells endogenously expressing rat TSH receptors, we determined the potency and efficacy of Org 274179-0 at antagonizing TSH- and TSI-induced TSH receptor signalling and its cross-reactivity at related follicle-stimulating hormone and luteinizing hormone receptors. We analysed the allosteric mode of interaction of Org 274179-0 and determined whether it is an inverse agonist at five naturally occurring, constitutively active TSH receptor mutants. KEY RESULTS Nanomolar concentrations of Org 274179-0 completely inhibited TSH (and TSI)-mediated TSH receptor activation with little effect on the potency of TSH, in accordance with an allosteric mechanism of action. Conversely, increasing levels of TSH receptor stimulation only marginally reduced the antagonist potency of Org 274179-0. Org 274179-0 fully blocked the increased basal activity of all the constitutively active TSH receptor mutants tested with nanomolar potencies. CONCLUSIONS AND IMPLICATIONS Nanomolar potent TSH receptor antagonists like Org 274179-0 have therapeutic potential for the treatment of GD and GO. PMID:22014107

Apigenin in Combination with Akt Inhibition Significantly Enhances Thyrotropin-Stimulated Radioiodide Accumulation in Thyroid Cells

PubMed Central

Lakshmanan, Aparna; Doseff, Andrea I.; Ringel, Matthew D.; Saji, Motoyasu; Rousset, Bernard; Zhang, Xiaoli

2014-01-01

Background: Selectively increased radioiodine accumulation in thyroid cells by thyrotropin (TSH) allows targeted treatment of thyroid cancer. However, the extent of TSH-stimulated radioiodine accumulation in some thyroid tumors is not sufficient to confer therapeutic efficacy. Hence, it is of clinical importance to identify novel strategies to selectively further enhance TSH-stimulated thyroidal radioiodine accumulation. Methods: PCCl3 rat thyroid cells, PCCl3 cells overexpressing BRAFV600E, or primary cultured tumor cells from a thyroid cancer mouse model, under TSH stimulation were treated with various reagents for 24 hours. Cells were then subjected to radioactive iodide uptake, kinetics, efflux assays, and protein extraction followed by Western blotting against selected antibodies. Results: We previously reported that Akt inhibition increased radioiodine accumulation in thyroid cells under chronic TSH stimulation. Here, we identified Apigenin, a plant-derived flavonoid, as a reagent to further enhance the iodide influx rate increased by Akt inhibition in thyroid cells under acute TSH stimulation. Akt inhibition is permissive for Apigenin's action, as Apigenin alone had little effect. This action of Apigenin requires p38 MAPK activity but not PKC-δ. The increase in radioiodide accumulation by Apigenin with Akt inhibition was also observed in thyroid cells expressing BRAFV600E and in primary cultured thyroid tumor cells from TRβPV/PV mice. Conclusion: Taken together, Apigenin may serve as a dietary supplement in combination with Akt inhibitors to enhance therapeutic efficacy of radioiodine for thyroid cancer. PMID:24400871

High incidence of congenital hypothyroidism in one region of the republic of macedonia.

PubMed

Anastasovska, V; Koviloska, R; Kocova, M

2014-06-01

Congenital hypothyroidism (CH) is the most common preventable cause of mental retardation in children. Diagnosis is difficult at birth without neonatal screening. Neonatal thyroid screening was established in Prilep, Republic of Macedonia as an integral part of the nationwide screening program. To estimate the prevalence of CH in this region, neonatal thyroid screening was performed on 9757 newborns, during the period 2002-2011. The DELFIA method was applied to measure the thyroid-stimulating hormone (TSH) concentration in dried blood spot samples on standard filter paper taken 48 hours after birth by heel-stick. The TSH cut-off level was 10 mU/L. The neonatal thyroid screening coverage was 93.4%. Eight newborns with CH were detected, with an incidence of 1:1220 live births, significantly higher compared to the nationwide results 1:2602. The TSH level was not significantly dependent on the gender of the newborn. There was a statistically significant difference between the TSH level and the timing of newborn screening sampling (p <0.05) and between the TSH level and the newborn birth weight (p = 0.01). One point ninety-two percent of newborns with TSH levels above 5 mU/L indicated an iodine sufficiency in Prilep. The incidence of CH in Prilep, which is higher when compared with that reported in surrounding countries, might be a consequence of the higher percentage of the Romany population in this region. Further analysis of this population in other regions is warranted.

TSH test

MedlinePlus

Thyrotropin; Thyroid stimulating hormone; Hypothyroidism - TSH; Hyperthyroidism - TSH; Goiter - TSH ... most often due to an underactive thyroid gland ( hypothyroidism ). There are many causes of this problem. A ...

Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

NASA Astrophysics Data System (ADS)

Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

2017-08-01

Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

Generalized trajectory surface-hopping method for internal conversion and intersystem crossing

NASA Astrophysics Data System (ADS)

Cui, Ganglong; Thiel, Walter

2014-09-01

Trajectory-based fewest-switches surface-hopping (FSSH) dynamics simulations have become a popular and reliable theoretical tool to simulate nonadiabatic photophysical and photochemical processes. Most available FSSH methods model internal conversion. We present a generalized trajectory surface-hopping (GTSH) method for simulating both internal conversion and intersystem crossing processes on an equal footing. We consider hops between adiabatic eigenstates of the non-relativistic electronic Hamiltonian (pure spin states), which is appropriate for sufficiently small spin-orbit coupling. This choice allows us to make maximum use of existing electronic structure programs and to minimize the changes to available implementations of the traditional FSSH method. The GTSH method is formulated within the quantum mechanics (QM)/molecular mechanics framework, but can of course also be applied at the pure QM level. The algorithm implemented in the GTSH code is specified step by step. As an initial GTSH application, we report simulations of the nonadiabatic processes in the lowest four electronic states (S0, S1, T1, and T2) of acrolein both in vacuo and in acetonitrile solution, in which the acrolein molecule is treated at the ab initio complete-active-space self-consistent-field level. These dynamics simulations provide detailed mechanistic insight by identifying and characterizing two nonadiabatic routes to the lowest triplet state, namely, direct S1 → T1 hopping as major pathway and sequential S1 → T2 → T1 hopping as minor pathway, with the T2 state acting as a relay state. They illustrate the potential of the GTSH approach to explore photoinduced processes in complex systems, in which intersystem crossing plays an important role.

High-throughput genotyping of hop (Humulus lupulus L.) utilising diversity arrays technology (DArT)

USDA-ARS?s Scientific Manuscript database

Implementation of molecular methods in hop breeding is dependent on the availability of sizeable numbers of polymorphic markers and a comprehensive understanding of genetic variation. Diversity Arrays Technology (DArT) is a high-throughput cost-effective method for the discovery of large numbers of...

TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

PubMed

Fayet, G; Aouani, A; Hovsépian, S

1986-01-06

The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation.

Thyrotropin-induced hyperthyroidism caused by selective pituitary resistance to thyroid hormone. A new syndrome of "inappropriate secretion of TSH".

PubMed Central

Gershengorn, M C; Weintraub, B D

1975-01-01

An 18-yr-old woman with clinical and laboratory features of hyperthyroidism had persistently elevated serum levels of immunoreative thyrotropin (TSH). During 11 yr of follow-up there had been no evidence of a pituitary tumor. After thyrotropin-releasing hormone (TRH), there was a marked increase in TSH and secondarily in triiodothyronine (T3), the latter observation confirming the biologic activity of the TSH. Exogenous T3 raised serum T3 and several measurements of peripheral thyroid hormone effect, while decreasing serum TSH, thyroxine (T4), and thyroidal radioiodine uptake. After T3, the TRH-stimulated TSH response was decreased but was still inappropriate for the elevated serum T3 levels. Dexamethasone reduced serum TSH but did not inhibit TRH stimulation of TSH. Propylthiouracil reduced serum T4 and T3 and raised TSH. This patient represents a new syndrome of TSH-induced hyperthyroidism, differing from previous reports in the absence of an obvious pituitary tumor and in the responsiveness of the TSH to TRH stimulation and thyroid hormone suppression. This syndrome appears to be caused by a selective, partial resistance of the pituitary to the action of thyroid hormone. This case is also compared with previous reports in the literature of patients with elevated serum levels of immunoreactive TSH in the presence of elevated total and free thyroid hormones. A classification of these cases, termed "inappropriate secretion of TSH," is proposed. PMID:1159077

Characterization and charge distribution of the asparagine-linked oligosaccharides on secreted mouse thyrotropin and free alpha-subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gesundheit, N.; Gyves, P.W.; DeCherney, G.S.

1989-06-01

Mouse hemipituitaries in vitro secrete TSH, composed of an alpha-beta heterodimer, as well as excess (free) alpha-subunits. By dual metabolic labeling with (35S)sulfate and (3H)mannose, we have characterized oligosaccharides from secreted TSH alpha, TSH beta, and free alpha-subunits released from the apoprotein by enzymatic deglycosylation. Oligosaccharides from each subunit displayed a distinct anion exchange HPLC profile due to a specific pattern of sialylation and sulfation. Six species were obtained from TSH alpha (with two glycosylation sites), including neutral oligosaccharides as well as those with one or two negative charges. For TSH beta (with one glycosylation site) at least eight oligosaccharidemore » species were noted, representing nearly every permutation of sialylation and sulfation; approximately 30% contained three or more negative charges. Analysis of (3H)mannose-labeled oligosaccharides on Concanavalin-A-agarose showed 85% binding for those from TSH alpha, 70% for free alpha, and 50% for those from TSH beta. These data demonstrate that oligosaccharides from secreted TSH beta were more sialylated and sulfated, consistent with a more complex branching pattern, than those from TSH alpha. Oligosaccharides from free alpha-subunit were more sialylated than those from TSH alpha, and the net negative charge was intermediate between those of TSH alpha and TSH beta. Although great microheterogeneity is present even at the single glycosylation site on the beta-subunit of secreted TSH, a pattern of sialylation and sulfation could be discerned.« less

Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-α-Acids▿ † ¶

PubMed Central

Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc

2010-01-01

The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041

Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network

NASA Astrophysics Data System (ADS)

Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji

In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.

Serial post-surgical stimulated and unstimulated highly sensitive thyroglobulin measurements in low- and intermediate-risk papillary thyroid carcinoma patients not receiving radioactive iodine.

PubMed

Kashat, Lawrence; Orlov, Steven; Orlov, David; Assi, Jasmeet; Salari, Farnaz; Walfish, Paul G

2016-11-01

The purpose of this study was to determine the natural temporal trends of serial thyroglobulin (Tg) among low/intermediate-risk PTC patients not receiving radioactive iodine (RAI) using TSH-stimulated Tg (Stim-Tg) and unstimulated highly sensitive Tg (u-hsTg). We prospectively analyzed serial Stim-Tg measurements after total thyroidectomy ± therapeutic central neck dissection among 121 consecutive low/intermediate-risk PTC patients who did not receive RAI, of whom 104 also had serial u-hsTg measurements available. Median follow-up was 6.5 years with Stim-Tg measurements commencing 3 months after surgery and u-hsTg commencing 1.8 years after surgery (when the assay became available). TSH stimulation was performed with 9-day T3 withdrawal, 22-day T4 withdrawal, or using recombinant human TSH (rhTSH). To account for within-patient correlations of repeated Tg measurements, temporal trends in Stim-Tg and u-hsTg were assessed using Generalized Estimating Equations. Stim-Tg models were adjusted for the method of TSH stimulation, whereas the u-hsTg models were adjusted for concurrent TSH level. Linear regression modeling was used to assess the trend in serial Stim-Tg and u-hsTg measurements as a function time from time of surgery throughout the duration of follow-up. The main outcome measured was the change in u-hsTg and Stim-Tg measurements over time. A total of 337 Stim-Tg (2.8/patient) and 602 u-hsTg (5.8/patient) measurements were analyzed. Among the 337 Stim-Tg measurements, Stim-Tg was assessed using rhTSH in 202 (60 %), T4 withdrawal in 41 (12 %), and T3 withdrawal in 94 (28 %) measurements. The overall mean ± 1SD for Stim-Tg and u-hsTg measured was 1.0 ± 1.2 and 0.2 ± 0.1 μg/L, respectively. When adjusted for method of TSH stimulation, serial Stim-Tg measurements did not significantly change over time (all p = NS). The estimated changes in Stim-Tg per year for rhTSH, T4 withdrawal, and T3 withdrawal were 0.01, -0.08, and 0.04 μg/L, respectively. Upon exclusion of 73 patients with an initial undetectable Stim-Tg (n = 48), serial Stim-Tg measurements did not change significantly over time (all p = NS). For these patients, the estimated changes in Stim-Tg per year for rhTSH, T4 withdrawal, and T3 withdrawal were -0.09, -0.10, and 0.01 μg/L, respectively. Serial u-hsTg measurements did not significantly change over time after adjusting for TSH level (p = NS). The estimated change in u-hsTg per year was -0.003 μg/L. No patients had any clinical or imaging evidence of a recurrence during the duration of their follow-up. Among low/intermediate-risk PTC patients not treated with RAI, serial post-surgical Stim-Tg and u-hsTg measurements do not change significantly over a median follow-up of 6.5 years.

The regulation of pituitary-thyroid abnormalities by peripheral administration of levothyroxine increased brain-derived neurotrophic factor and reelin protein expression in an animal model of Alzheimer's disease.

PubMed

Shabani, Sahreh; Farbood, Yaghoob; Mard, Seyyed Ali; Sarkaki, Alireza; Ahangarpour, Akram; Khorsandi, Layasadat

2018-03-01

Alzheimer's disease (AD) is associated with decreased serum levels of thyroid hormones (THs), increased levels of thyroid-stimulating hormone (TSH), and decreased protein expression of brain-derived neurotrophic factor (BDNF) and reelin in the hippocampus. In this study, we have evaluated the effect of subcutaneous administration of levothyroxine (L-T 4 ) on levels of THs and TSH as well as protein expression of BDNF and reelin in AD rats. To make an animal model of AD, amyloid-beta peptide (Aβ) plus ibotenic acid were infused intrahippocampally, and rats were treated with L-T 4 and (or) saline for 10 days. The levels of THs and TSH were measured by ELISA kits. Protein synthesis was detected by Western blotting method. Results have been shown that serum level of THs, BDNF, and reelin protein expression in the hippocampus were significantly decreased (P < 0.001) in AD animals and elevated significantly in AD rats treated with L-T 4 (P < 0.01). Data showed that TSH level significantly decreased in AD rats treated with L-T 4 (P < 0.05). These findings indicated that L-T 4 increased BDNF and reelin protein expression by regulation of serum THs and TSH level in Aβ-induced AD rats.

The Effect of Differentially Designed Fusion Proteins to Elicit Efficient Anti-human Thyroid Stimulating Hormone Immune Responses.

PubMed

Mard-Soltani, Maysam; Rasaee, Mohamad Javad; Khalili, Saeed; Sheikhi, Abdol-Karim; Hedayati, Mehdi; Ghaderi-Zefrehi, Hossein; Alasvand, Milad

2018-04-01

The production of human thyroid stimulating hormone (hTSH) immunoassays requires specific antibodies against hTSH which is a cumbersome process. Therefore, producing specific polyclonal antibodies against engineered recombinant fusion hTSH antigens would be of great significance. The best immunogenic region of the hTSH was selected based on in silico analyses and equipped with two different fusions. Standard methods were used for protein expression, purification, verification, structural evaluation, and immunizations of the white New Zealand rabbits. Ultimately, immunized serums were used for antibody titration, purification and characterization (specificity, sensitivity and cross reactivity). The desired antigens were successfully designed, sub-cloned, expressed, confirmed and used for in vivo immunization. Structural analyses indicated that only the bigger antigen has showed changed 2 dimensional (2D) and 3D structural properties in comparison to the smaller antigen. The raised polyclonal antibodies were capable of specific and sensitive hTSH detection, while the cross reactivity with the other members of the glycoprotein hormone family was minimum and negligible. The fusion which was solely composed of the tetanus toxin epitopes led to better protein folding and was capable of immunizing the host animals resulting into high titer antibody. Therefore, the minimal fusion sequences seem to be more effective in eliciting specific antibody responses.

TSH and Thyrotropic Agonists: Key Actors in Thyroid Homeostasis

PubMed Central

Dietrich, Johannes W.; Landgrafe, Gabi; Fotiadou, Elisavet H.

2012-01-01

This paper provides the reader with an overview of our current knowledge of hypothalamic-pituitary-thyroid feedback from a cybernetic standpoint. Over the past decades we have gained a plethora of information from biochemical, clinical, and epidemiological investigation, especially on the role of TSH and other thyrotropic agonists as critical components of this complex relationship. Integrating these data into a systems perspective delivers new insights into static and dynamic behaviour of thyroid homeostasis. Explicit usage of this information with mathematical methods promises to deliver a better understanding of thyrotropic feedback control and new options for personalised diagnosis of thyroid dysfunction and targeted therapy, also by permitting a new perspective on the conundrum of the TSH reference range. PMID:23365787

Thyrotropin suppression and disease progression in patients with differentiated thyroid cancer: results from the National Thyroid Cancer Treatment Cooperative Registry.

PubMed

Cooper, D S; Specker, B; Ho, M; Sperling, M; Ladenson, P W; Ross, D S; Ain, K B; Bigos, S T; Brierley, J D; Haugen, B R; Klein, I; Robbins, J; Sherman, S I; Taylor, T; Maxon, H R

1998-09-01

The ideal therapy for differentiated thyroid cancer is uncertain. Although thyroid hormone treatment is pivotal, the degree of thyrotropin (TSH) suppression that is required to prevent recurrences has not been studied in detail. We have examined the relation of TSH suppression to baseline disease characteristics and to the likelihood of disease progression in a cohort of thyroid cancer patients who have been followed in a multicenter thyroid cancer registry that was established in 1986. The present study describes 617 patients with papillary and 66 patients with follicular thyroid cancer followed annually for a median of 4.5 years (range 1-8.6 years). Cancer staging was assessed using a staging scheme developed and validated by the registry. Cancer status was defined as no residual disease; progressive disease at any follow-up time; or death from thyroid cancer. A mean TSH score was calculated for each patient by averaging all available TSH determinations, where 1 = undetectable TSH; 2 = subnormal TSH; 3 = normal TSH; and 4 = elevated TSH. Patients were also grouped by their TSH scores: group 1: mean TSH score 1.0-1.99; group 2: mean TSH score 2.0-2.99; group 3: mean TSH score 3.0-4.0. The degree of TSH suppression did not differ between papillary and follicular thyroid cancer patients. However, TSH suppression was greater in papillary cancer patients who were initially classified as being at higher risk for recurrence. This was not the case for follicular cancer patients, where TSH suppression was similar for all patients. For all stages of papillary cancer, a Cox proportional hazards model showed that disease stage, patient age, and radioiodine therapy all predicted disease progression, but TSH score category did not. However, TSH score category was an independent predictor of disease progression in high risk patients (p = 0.03), but was no longer significant when radioiodine therapy was included in the model (p = 0.09). There were too few patients with follicular cancer for multivariate analysis. These data suggest that physicians use greater degrees of TSH suppression in higher risk papillary cancer patients. Our data do not support the concept that greater degrees of TSH suppression are required to prevent disease progression in low-risk patients, but this possibility remains in high-risk patients. Additional studies with more patients and longer follow-up may provide the answer to this important question.

Sensitive thyrotropin and free thyroxine testing in outpatients. Are both necessary?

PubMed

Bauer, D C; Brown, A N

1996-11-11

The appropriate use of specific thyroid function tests to detect thyroid dysfunction remains controversial; some experts recommend both a sensitive thyrotropin (sTSH) test and a free thyroxine (FT4) test, while others recommend an sTSH test alone. To determine how often sTSH and FT4 tests are ordered simultaneously, how often the results are discordant, and under what circumstances a single test of thyroid function may be sufficient to rule out thyroid dysfunction. Retrospective descriptive study of all sTSH and FT4 tests performed on adult outpatients during a 6-month period. If both sTSH and FT4 tests were performed on a single serum specimen, the results were classified as concordant (both tests indicating hypothyroidism, hyperthyroidism, or euthyroidism) or discordant. Chart review was performed on patients with normal sTSH results and abnormal FT4 results. A total of 6551 sTSH and 3518 FT4 tests were performed during the study period. Both sTSH and FT4 tests were ordered together on 3143 specimens (48% and 89% of the total number of sTSH and FT4 tests ordered, respectively) from 2629 patients. Of the sTSH results, 69.8% were within the normal range, and 92.7% of the FT4 results were normal. The concordance between sTSH and FT4 results was 74.3%. Among the 1835 specimens with normal sTSH results, FT4 level was low in 11 patients (0.6%; 95% confidence interval, 0.3%-0.9%) and high in 24 (1.3%; 95% confidence interval, 0.8%-1.8%). Chart review did not disclose any instances when an abnormal FT4 results contributed to the treatment of an individual with a normal sTSH result. The sTSH test alone, and not the combination of sTSH and FT4 tests, should be ordered in most outpatients. An FT4 test should not be routinely ordered if the sTSH result is normal; at our institution this approach would obviate the need for at least half of the FT4 tests performed each year.

Diagnostic accuracy of basal TSH determinations based on the intravenous TRH stimulation test: an evaluation of 2570 tests and comparison with the literature.

PubMed

Moncayo, Helga; Dapunt, Otto; Moncayo, Roy

2007-08-02

Basal TSH levels reflect the metabolic status of thyroid function, however the definition and interpretation of the basal levels of TSH is a matter of controversial debate. The aim of this study was to evaluate basal TSH levels in relation to the physiological response to i.v. TRH stimulation. A series of 2570 women attending a specialized endocrine unit were evaluated. A standardized i.v. TRH stimulation test was carried out by applying 200 mug of TRH. TSH levels were measured both in the basal and the 30 minute blood sample. The normal response to TRH stimulation had been previously determined to be an absolute value lying between 2.5 and 20 mIU/l. Both TSH values were analyzed by cross tabulation. In addition the results were compared to reference values taken from the literature. Basal TSH values were within the normal range (0.3 to 3.5 mIU/l) in 91,5% of cases, diminished in 3,8% and elevated in 4.7%. Based on the response to TRH, 82.4% were considered euthyroid, 3.3% were latent hyperthyroid, and 14.3% were latent hypothyroid. Combining the data on basal and stimulated TSH levels, latent hypothyroidism was found in the following proportions for different TSH levels: 5.4% for TSH < 2.0 mIU/l, 30.2% for TSH between 2.0 and 3.0 mIU/l, 65,5% for TSH between 3.0 and 3.50 mIU/l, 87.5% for TSH between 3.5 and 4.0 mIU/l, and 88.2% for TSH between 4 and 5 mIU/l. The use of an upper normal range for TSH of 2.5 mIU/l, as recommended in the literature, misclassified 7.7% of euthyroid cases. Our analysis strategy allows us to delineate the predictive value of basal TSH levels in relation to latent hypothyroidism. A grey area can be identified for values between 3.0 and 3.5 mIU/l.

Dynamically Stable Legged Locomotion.

DTIC Science & Technology

1983-01-27

sweeps the leg during stance, and the third places the foot during flight and controls body attitude during stance. Each of the three methods elucidates...secondary strategy has been to examine systems with springy legs, so that the role of resonant oscillatory leg behavior might be better understood. ’ The ...body attitude : I lopping _leit: ’ The control system rcgulate:; hopping height by manlil)Lulating hopping energy. The leg is springy, so hopping is a

Diffusion in quasi-one-dimensional channels: A small system n, p, T, transition state theory for hopping times.

PubMed

Ahmadi, Sheida; Bowles, Richard K

2017-04-21

Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.

Hybrid spread spectrum radio system

DOEpatents

Smith, Stephen F [London, TN; Dress, William B [Camas, WA

2010-02-09

Systems and methods are described for hybrid spread spectrum radio systems. A method, includes receiving a hybrid spread spectrum signal including: fast frequency hopping demodulating and direct sequence demodulating a direct sequence spread spectrum signal, wherein multiple frequency hops occur within a single data-bit time and each bit is represented by chip transmissions at multiple frequencies.

Patterns of Interferon-Alpha–Induced Thyroid Dysfunction Vary with Ethnicity, Sex, Smoking Status, and Pretreatment Thyrotropin in an International Cohort of Patients Treated for Hepatitis C

PubMed Central

Ghazarian, Sharon R.; Rosen, Antony; Ladenson, Paul W.

2013-01-01

Background Interferon-alpha (IFNα)–induced thyroid dysfunction occurs in up to 20% of patients undergoing therapy for hepatitis C. The diversity of thyroid disease presentations suggests that several different pathological mechanisms are involved, such as autoimmunity and direct toxicity. Elucidating the relationships between risk factors and disease phenotype provides insight into the mechanisms of disease pathophysiology. Methods We studied 869 euthyroid patients from the ACHIEVE 2/3 trial, a randomized international clinical trial comparing pegylated-IFNα2a weekly or albumin-IFNα2b every 2 weeks for up to 24 weeks in patients with hepatitis C, genotype 2 or 3, from 136 centers. The study population was 60% male and 55% white. Serum thyrotropin (TSH) and free thyroxine were measured before therapy, monthly during treatment from week 8, and at 4- and 12-week follow-up visits. Results Overall, 181 (20.8%) participants had at least one abnormal TSH during the study. Low TSH occurred in 71 (8.2%), of whom 30 (3.5%) had a suppressed TSH below 0.1 mU/L. Hypothyroidism occurred in 53 patients (6.1%), with peak TSH above 10 mU/L in 12 patients (1.4%). Fifty-seven patients had a biphasic thyroiditis (6.6%), with extreme values for the nadir and/or peak TSH in all but one. Medical therapy was given to one thyrotoxic patient, four hypothyroid patients, and 26 biphasic thyroiditis patients. Multivariate logistic regression analysis demonstrated that biphasic thyroiditis is associated with being female and higher pretreatment serum TSH, whereas being Asian or a current smoker decreased the risk of thyroiditis. Hypo- and hyperthyroidism are most strongly predicted by the pretreatment TSH. Conclusions Biphasic thyroiditis accounted for the majority (58%) of clinically relevant IFNα-induced thyroid dysfunction. We confirmed our recent findings in a related cohort that female sex is a risk factor for thyroiditis but not hypothyroidism. Further, in this large multiethnic study, the risk of thyroiditis is dramatically increased, specifically for white women. Smoking was found to be protective of thyroiditis. These results support closer monitoring of women and those with a serum TSH at the extremes of the normal range during therapy so that prompt intervention can mitigate the consequences of thyroid dysfunction associated with IFNα treatment. PMID:23517287

Endogenous TSH in the diagnosis of hypothyroidism in dogs.

PubMed

Boretti, F S; Reusch, C E

2004-04-01

To determine whether measurement of canine thyrotropin (cTSH) would aid in the diagnosis of hypothyroidism, serum samples of 65 dogs with clinical signs suggestive of hypothyroidism were evaluated. Diagnosis was confirmed in 26 dogs and excluded in 39 dogs based on TSH-stimulation testing. Total thyroxine (T4) was significantly lower and cTSH significantly higher in hypothyroid dogs compared to euthyroid dogs. Canine TSH was above (> 0.6 ng/ml) in 15 (57.7%) and below the upper limit of the reference range in 11 (42.3%) of the hypothyroid dogs. All of the euthyroid dogs had a cTSH < 0.6 ng/ml. In all dogs with a cTSH above the upper limit of the reference range hypothyroidism could be confirmed. Therefore, our results show that measurement of cTSH has an excellent specificity (100%) and is a valuable tool in confirming canine hypothyroidism. However, due to the low sensitivity of cTSH assays (60%), it can not be recommended to exclude the disease.

Differential regulation of detoxification enzymes in hepatic and mammary tissue by hops (Humulus lupulus) in vitro and in vivo

PubMed Central

Dietz, Birgit M.; Hagos, Ghenet K.; Eskra, Jillian N.; Wijewickrama, Gihani T.; Anderson, Jeffrey R.; Nikolic, Dejan; Guo, Jian; Wright, Brian; Chen, Shao-Nong; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

2013-01-01

Scope Hops contain the phytoestrogen, 8-prenylnaringenin, and the cytoprotective compound, xanthohumol (XH). XH induces the detoxification enzyme, NAD(P)H-quinone oxidoreductase (NQO1) in vitro; however, the tissue distribution of XH and 8-prenylnaringenin and their tissue specific activity have not been analyzed. Methods and results A standardized hop extract (p.o.) and XH (s.c.) were administered to Sprague-Dawley rats over four days. LC-MS-MS analysis of plasma, liver and mammary gland revealed that XH accumulated in liver and mammary glands. Compared with the low level in the original extract, 8-prenylnaringenin was enriched in the tissues. Hops and XH induced NQO1 in the liver, while only hops reduced NQO1 activity in the mammary gland. Mechanistic studies revealed that hops modulated NQO1 through three mechanisms. In liver cells, 1) XH modified Keap1 leading to Nrf2 translocation and antioxidant response element (ARE) activation; 2) hop-mediated ARE induction was partially mediated through phosphorylation of Nrf2 by PKC; 3) in breast cells, 8-prenylnaringenin reduced NQO1 likely through binding to ERα, recruiting Nrf2, and downregulating ARE-regulated genes. Conclusions XH and 8-prenylnaringenin in dietary hops are bioavailable to the target tissues. While hops and XH might be cytoprotective in the liver, 8-prenylnaringenin seems responsible for hop-mediated NQO1 reduction in the mammary gland. PMID:23512484

Use of thyroid-stimulating hormone tests for identifying primary hypothyroidism in family medicine patients.

PubMed

Birk-Urovitz, Elizabeth; Elisabeth Del Giudice, M; Meaney, Christopher; Grewal, Karan

2017-09-01

To assess the use of thyroid-stimulating hormone (TSH) tests for identifying primary hypothyroidism in 2 academic family medicine settings. Descriptive study involving a retrospective electronic chart review of family medicine patients who underwent TSH testing. Two academic family practice sites: one site is within a tertiary hospital in Toronto, Ont, and the other is within a community hospital in Newmarket, Ont. A random sample of 205 adult family medicine patients who had 1 or more TSH tests for identifying potential primary hypothyroidism between July 1, 2009, and September 15, 2013. Exclusion criteria included a previous diagnosis of any thyroid condition or abnormality, as well as pregnancy or recent pregnancy within the year preceding the study period. The proportion of normal TSH test results and the proportion of TSH tests that did not conform to test-ordering guidelines. Of the 205 TSH test results, 200 (97.6%, 95% CI 94.4% to 99.2%) showed TSH levels within the normal range. All 5 patients with abnormal TSH test results had TSH levels above the upper reference limits. Nearly one-quarter (22.4%, 95% CI 16.9% to 28.8%) of tests did not conform to test-ordering guidelines. All TSH tests classified as not conforming to test-ordering guidelines showed TSH levels within normal limits. There was a significant difference ( P < .001) between the proportions of nonconforming TSH tests at the tertiary site (14.3%, 95% CI 8.2% to 22.5%) and the community site (31.0%, 95% CI 22.1% to 41.0%). Preliminary analyses examining which variables might be associated with abnormal TSH levels showed that only muscle cramps or myalgia ( P = .0286) and a history of an autoimmune disorder ( P = .0623) met or approached statistical significance. In this study, the proportion of normal TSH test results in the context of primary hypothyroidism case finding and screening was high, and the overall proportion of TSH tests that did not conform to test-ordering guidelines was relatively high as well. These results highlight a need for more consistent TSH test-ordering guidelines for primary hypothyroidism and perhaps some educational interventions to help curtail the overuse of TSH tests in the family medicine setting. Copyright© the College of Family Physicians of Canada.

Diural TSH variations in hypothyroidism.

PubMed

Weeke, J; Laurberg, P

1976-07-01

There is a circadian variation in serum TSH in euthyroid subjects. A similar diurnal variation has been demonstrated in patients with hypothyroidism. In the present study the 24-hour pattern of serum TSH was investigated in eight patients with hypothyroidism of varying severity and in five hypothyroid patients treated with thyroxine (T4). There was a circadian variation in serum TSH in patients with hypothyroidism of moderate degree, and in patients treated for severe hypothyrodism with thyroxine. The pattern was similar to that found in normal subjects, i.e., low TSH levels in the daytime and higher levels at night. In severely hypothyroid patients, no diurnal variation in serum TSH was observed. A practical consequence is that blood samples for TSH measurements in patients with moderately elevated TSH levels are best taken after 1100 h, when the low day levels are reached.

Inability of recombinant human thyrotropin to predict the evolution from subclinical hypothyroidism to overt disease. A pilot study.

PubMed

Zafon, C; Rodríguez, B; Montoro, J B; Cabo, D; Mesa, J

2012-01-01

The use of recombinant human TSH (rhTSH) is indicated to evaluate thyroid carcinoma patients. In recent years, some authors have reported that rhTSH could serve as a dynamic test of thyroid reserve. The aim of the present study was to determine whether or not rhTSH can predict the evolution from subclinical hypothyroidism (SH) to overt hypothyroidism. Twenty-one women who met the diagnostic criteria of SH were enrolled. All patients received a single dose of rhTSH (0.1 mg). Basal blood samples for TSH, free T4 (fT4), thyroglobulin (Tg), and anti-thyoperoxidase and anti-Tg antibodies were obtained before and 1 day after rhTSH administration. All patients were followed for 2 yr, and blood samples were obtained every 6 months. Twenty-four hours after rhTSH administration, the TSH level increased to >20 mU/l in 14 patients; the serum peak TSH levels remained <10 mU/l in only 5 patients. On follow-up, 7 women (33%) required L-T4 replacement therapy for overt hypothyroidism or a persistent TSH level >10 mlU/l. None of the parameters analyzed differed significantly between patients who developed overt hypothyroidism from those who had persistent SH. The response of thyroid function tests to a single low dose of rhTSH is not useful in identifying those patients with SH who will develop overt hypothyroidism over a 2-yr period.

Association of TSH With Cardiovascular Disease Risk in Overweight and Obese Children During Lifestyle Intervention.

PubMed

Rijks, Jesse M; Plat, Jogchum; Dorenbos, Elke; Penders, Bas; Gerver, Willem-Jan M; Vreugdenhil, Anita C E

2017-06-01

Overweight and obese children have an increased risk to develop cardiovascular diseases (CVDs) in which thyroid-stimulating hormone (TSH) has been suggested as an intermediary factor. However, results of cross-sectional studies are inconclusive, and intervention studies investigating changes in TSH concentrations in association with changes in cardiovascular risk parameters in overweight and obese children are scarce. To gain insight in associations of circulating TSH concentrations and cardiovascular risk parameters in overweight and obese children. Nonrandomized lifestyle intervention. Centre for Overweight Adolescent and Children's Healthcare. Three hundred thirty euthyroid overweight and obese children. Long-term lifestyle intervention. TSH concentrations, pituitary TSH release in response to thyrotropin-releasing hormone (TRH), and cardiovascular risk parameters. At baseline, serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), triacylglycerol (TAG), and monocyte chemotactic protein 1 concentrations were significantly associated with serum TSH concentrations. TSH release by the pituitary in response to exogenous TRH was not associated with cardiovascular risk parameters. During lifestyle intervention, several cardiovascular risk parameters significantly improved. In children whose body mass index z score improved, changes in TSH concentrations were significantly associated with changes in TC, LDL-C, and TAG concentrations. In euthyroid overweight and obese children, circulating TSH concentrations are positively associated with markers representing increased CVD risk. Changes in TSH concentrations are also associated with changes in lipid concentrations in children with successful weight loss, which is consistent with TSH being an intermediary factor in modulating lipid and lipoprotein metabolism. Copyright © 2017 Endocrine Society

Prevalence of subclinical hypothyroidism in adults visiting primary health-care setting in Riyadh.

PubMed

Al Eidan, Eidan; Ur Rahman, Saeed; Al Qahtani, Saeed; Al Farhan, Ali I; Abdulmajeed, Imad

2018-01-01

Background and objectives : Subclinical hypothyroidism is an asymptomatic condition with normal thyroxin and raised thyroid stimulating hormone (TSH) level. The objective of the study was to determine the prevalence of subclinical hypothyroidism in primary health care (PHC) settings in Riyadh and explore the relationship of TSH level with age, gender, family history, body mass index, and co-morbid conditions. Subjects and methods : A cross-sectional study of adult visitors to nine satellites PHC clinics in military housing in Riyadh was carried out. TSH concentration and free T4 levels were measured. Data were collected by nurses and physicians during routine clinical practice in primary care. Descriptive analysis was performed on all variables in study, and relationships were explored using chi-square, t -test, analysis of variance, and linear regression. Results : A total of 340 out of 394 participants in the study gave blood samples. Subclinical hyperthyroidism was identified in 2.1% ( p  = .001) and subclinical hypothyroidism in 10.3% ( p  = .001) of the PHC visitors. TSH levels were found to be significantly higher ( p  = .047) in elderly population of ≥60 years and those with family history of thyroid disease. Non-significant upward trends were noted in TSH levels with hyperlipidemia and increasing blood pressure. No overt hyperthyroidism or hypothyroidism was found in our study sample. Conclusion : Subclinical hypothyroidism has a prevalence of 10% of adults visiting PHC's. TSH levels are higher in the elderly, which warrants screening of those aged 60 years and above.

Apparent genetic difference between hypothyroid patients with blocking-type thyrotropin receptor antibody and those without, as shown by restriction fragement length polymorphism analyses of HLA-DP loci

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoue, Daisuke; Sugawa, Hideo; Akamizu, Takashi

1993-09-01

HLA types in Japanese patients with primary hypothyroidism were analyzed to see whether those with blocking-type TSH receptor antibody (TSH-R BAb M) differed genetically from those with idiopathic myxedema (IM). HLA typings of -A, -B, -C, -DR, and -DQ (73 antigens) were performed serologically, and those of -D and -DP (29 antigens) were analyzed by the restriction fragment length polymorphism method. Thirty patients were studied with TSH-R BAb M, and 28 with IM. The data were analyzed and compared with previous results from 88 Graves' patients, 46 Hashimoto patients, and 186 control subjects. Overall, 192 patients with 4 autoimmune thyroidmore » disorders showed a decrease in -Aw19 and an increase in -DQw4 (corrected P < 0.05) and significant associations of -Aw33, -Bw46, -Cw3, -DRw8, -DR9, and -DQw3. In TSH-R BAb M patients, increases in -B35, -Bw60, and -Dw8 and decreases in -DR4 and -DPw2 were seen, whereas IM patients showed increased -DPw2, -Bw61, and -Dw23. In comparisons between TSH-R-BAb M and IM, the difference in -DPw2 was highly significant. HLA-B35 differed significantly in these 2 types of hypothyroidism. In conclusion, TSH-R BAb M patients have decreased frequency of -DPw2 and are genetically similar to Graves' disease, whereas IM patients are characterized by high frequency of -DPw2 and are genetically similar to Hashimoto's thyroiditis. 39 refs., 2 figs., 3 tabs.« less

Landing Mechanics During Side Hopping and Crossover Hopping Maneuvers in Noninjured Women and Women With Anterior Cruciate Ligament Reconstruction

PubMed Central

Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.

2011-01-01

Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years after surgery, and women who have undergone a procedure such as ACL reconstruction may continue to exhibit knee-joint abduction moments that increase the risk of additional knee injury. PMID:21257128

Subclinical hypothyroidism diagnosed by thyrotropin-releasing hormone stimulation test in infertile women with basal thyroid-stimulating hormone levels of 2.5 to 5.0 mIU/L.

PubMed

Lee, You-Jeong; Kim, Chung-Hoon; Kwack, Jae-Young; Ahn, Jun-Woo; Kim, Sung-Hoon; Chae, Hee-Dong; Kang, Byung-Moon

2014-11-01

To investigate the prevalence of subclinical hypothyroidism (SH) diagnosed by thyrotropin-releasing hormone (TRH) stimulating test in infertile women with basal thyroid-stimulating hormone (TSH) levels of 2.5 to 5.0 mIU/L. This study was performed in 39 infertile women with ovulatory disorders (group 1) and 27 infertile women with male infertility only (group 2, controls) who had basal serum TSH levels of 2.5 to 5.0 mIU/L and a TRH stimulating test. Serum TSH levels were measured before TRH injection (TSH0) and also measured at 20 minutes (TSH1) and 40 minutes (TSH2) following intravenous injection of 400 µg TRH. Exaggerated TSH response above 30 mIU/L following TRH injection was diagnosed as SH. Group 1 was composed of poor responders (subgroup A), patients with polycystic ovary syndrome (subgroup B) and patients with WHO group II anovulation except poor responder or polycystic ovary syndrome (subgroup C). The prevalence of SH was significantly higher in group 1 of 46.2% (18/39) compared with 7.4% (2/27) in group 2 (P=0.001). TSH0, TSH1, and TSH2 levels were significantly higher in group 1 than the corresponding values in group 2 (P<0.001, P<0.001, P<0.001). In group 1, TSH1 and TSH2 levels were significantly lower in subgroup C compared with those in subgroup A and B (P=0.008, P=0.006, respectively). TRH stimulation test had better be performed in infertile women with ovulatory disorders who have TSH levels between 2.5 and 5.0 mIU/L for early detection and appropriate treatment of SH.

Effects of Holder pasteurization on the protein profile of human milk.

PubMed

Peila, Chiara; Coscia, Alessandra; Bertino, Enrico; Cavaletto, Maria; Spertino, Stefano; Icardi, Sara; Tortone, Claudia; Visser, Gerard H A; Gazzolo, Diego

2016-04-07

The most widespread method for the treatment of donor milk is the Holder pasteurization (HoP). The available literature data show that HoP may cause degradation of some bioactive components. The aim of this study was to determine the effect of HoP on the protein profile of human milk (HM) using a GeLC-MS method, a proteomic approach and a promising technique able to offer a qualitative HM protein profile. HM samples were collected by standardized methods from 20 mothers carrying both preterm and term newborns. A aliquot of each sample was immediately frozen at -80 °C, whilst another one was Holder pasteurized and then frozen. All samples were then analyzed by GeLC-MS. The protein bands of interest were excised from the gel, digested with trypsin and identified by nano-HPLC-MS/MS analysis. The protein profile before and after HoP showed qualitative differences only in 6 samples out of 20, while in the remaining 14 no detectable differences were found. The differences interested only colostrums and transitional milk samples and regarded the decrease of the electrophoretic bands corresponding to alpha and beta-casein, tenascin, lactoferrin and immunoglobulin. In the majority of samples, HoP did not cause any modification, thereby preserving the biological activity of HM proteins.

Pituitary response to thyrotropin releasing hormone in children with overweight and obesity.

PubMed

Rijks, Jesse; Penders, Bas; Dorenbos, Elke; Straetemans, Saartje; Gerver, Willem-Jan; Vreugdenhil, Anita

2016-08-03

Thyroid stimulating hormone (TSH) concentrations in the high normal range are common in children with overweight and obesity, and associated with increased cardiovascular disease risk. Prior studies aiming at unravelling the mechanisms underlying these high TSH concentrations mainly focused on factors promoting thyrotropin releasing hormone (TRH) production as a cause for high TSH concentrations. However, it is unknown whether TSH release of the pituitary in response to TRH is affected in children with overweight and obesity. Here we describe TSH release of the pituitary in response to exogenous TRH in 73 euthyroid children (39% males) with overweight or (morbid) obesity. Baseline TSH concentrations (0.9-5.5 mU/L) were not associated with BMI z score, whereas these concentrations were positively associated with TSH concentrations 20 minutes after TRH administration (r(2) = 0.484, p < 0.001) and the TSH incremental area under the curve during the TRH stimulation test (r(2) = 0.307, p < 0.001). These results suggest that pituitary TSH release in response to TRH stimulation might be an important factor contributing to high normal serum TSH concentrations, which is a regular finding in children with overweight and obesity. The clinical significance and the intermediate factors contributing to pituitary TSH release need to be elucidated in future studies.

Pituitary response to thyrotropin releasing hormone in children with overweight and obesity

PubMed Central

Rijks, Jesse; Penders, Bas; Dorenbos, Elke; Straetemans, Saartje; Gerver, Willem-Jan; Vreugdenhil, Anita

2016-01-01

Thyroid stimulating hormone (TSH) concentrations in the high normal range are common in children with overweight and obesity, and associated with increased cardiovascular disease risk. Prior studies aiming at unravelling the mechanisms underlying these high TSH concentrations mainly focused on factors promoting thyrotropin releasing hormone (TRH) production as a cause for high TSH concentrations. However, it is unknown whether TSH release of the pituitary in response to TRH is affected in children with overweight and obesity. Here we describe TSH release of the pituitary in response to exogenous TRH in 73 euthyroid children (39% males) with overweight or (morbid) obesity. Baseline TSH concentrations (0.9–5.5 mU/L) were not associated with BMI z score, whereas these concentrations were positively associated with TSH concentrations 20 minutes after TRH administration (r2 = 0.484, p < 0.001) and the TSH incremental area under the curve during the TRH stimulation test (r2 = 0.307, p < 0.001). These results suggest that pituitary TSH release in response to TRH stimulation might be an important factor contributing to high normal serum TSH concentrations, which is a regular finding in children with overweight and obesity. The clinical significance and the intermediate factors contributing to pituitary TSH release need to be elucidated in future studies. PMID:27485208

AC and DC conductivity due to hopping mechanism in double ion doped ceramics

NASA Astrophysics Data System (ADS)

Rizwana, Mahboob, Syed; Sarah, P.

2018-04-01

Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.

Comparison of 2 doses of recombinant human thyrotropin for thyroid function testing in healthy and suspected hypothyroid dogs.

PubMed

Boretti, F S; Sieber-Ruckstuhl, N S; Wenger-Riggenbach, B; Gerber, B; Lutz, H; Hofmann-Lehmann, R; Reusch, C E

2009-01-01

Various protocols using different doses of recombinant human thyrotropin (rhTSH) in TSH stimulation testing have been described. However, the influence of TSH dosage on thyroxine (T4) concentration has not yet been evaluated in suspected hypothyroid dogs. To evaluate the effectiveness of 2 doses of rhTSH. Fifteen dogs with clinical signs consistent with hypothyroidism and abnormal stimulation results with 75 microg rhTSH and 18 clinically healthy dogs. All dogs were stimulated with 75 and 150 microg rhTSH IV in a 1st and 2nd stimulation test, respectively. Blood samples were taken before and 6 hours after rhTSH administration for determination of total T4 concentration. Using the higher dose led to a normal test interpretation in 9 of the 15 dogs, in which stimulation had been abnormal using the lower dose. Based on follow-up information, hypothyroidism was excluded in 7 of these 9 dogs. In all 6 dogs with a blunted response to the higher dose, hypothyroidism could be confirmed. Healthy dogs showed significantly higher post-TSH T4 concentrations with the higher compared with the lower dose. Post-TSH T4 concentrations after TSH stimulation were not related to dogs' body weight in either healthy or diseased dogs. TSH dose significantly influenced test interpretation in suspected hypothyroid dogs. Differentiation between primary hypothyroidism and nonthyroidal disease was improved with 150 microg rhTSH. Because this effect was independent of the dogs' body weight, the higher dose is recommended in dogs that have concurrent disease or are receiving medication.

Maternal TSH level and TPOAb status in early pregnancy and their relationship to the risk of gestational diabetes mellitus.

PubMed

Ying, Hao; Tang, Yu-Ping; Bao, Yi-Rong; Su, Xiu-Juan; Cai, XueYa; Li, Yu-Hong; Wang, De-Fen

2016-12-01

Subclinical hypothyroidism is common in pregnant women and often related to adverse pregnancy outcomes, but its relationship with gestational diabetes remains controversial. In particular, the impact of thyroperoxidase antibodies status on the relationship between subclinical hypothyroidism and gestational diabetes is not clear. We investigated the association between combined thyroid stimulating hormone (TSH) level and thyroperoxidase antibodies status in early pregnancy (<20 weeks of gestation) and gestational diabetes mellitus. A total of 7084 pregnant women met the inclusion criteria, which included thyroperoxidase antibodies-positive subclinical hypothyroidism [TSH(H)TPOAb(+)] (n = 78), thyroperoxidase antibodies-negative subclinical hypothyroidism [TSH(H)TPOAb(-)] (n = 281), thyroperoxidase antibodies-positive euthyroidism [TSH(N)TPOAb(+)] (n = 648), and thyroperoxidase antibodies-negative euthyroidism [TSH(N)TPOAb(-)] (n = 6077). Of the 7084 cases included in our study, 1141 cases were diagnosed with gestational diabetes mellitus at 24-28 weeks of pregnancy. The prevalence of gestational diabetes mellitus in TSH(N)TPOAb(-), TSH(H)TPOAb(-), TSH(N)TPOAb(+), and TSH(H)TPOAb(+) was 14.65, 19.57, 24.85, and 46.15 %, respectively. Compared with TSH(N)TPOAb(-) women, the risk of gestational diabetes mellitus was increased in all other groups of women in early pregnancy. After dividing early pregnancy into first and second trimesters, we found that TSH(H)TPOAb(-) women in the first trimester do not show this increase. Our study suggests that subclinical hypothyroidism and thyroperoxidase antibodies-positive euthyroidism in early pregnancy are associated with an increased risk of gestational diabetes mellitus.

Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

PubMed

Liu, Zechang; Wang, Liping; Liu, Yumei

2018-01-18

Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

PubMed Central

Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

2007-01-01

The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

Metformin and low levels of thyroid-stimulating hormone in patients with type 2 diabetes mellitus

PubMed Central

Fournier, Jean-Pascal; Yin, Hui; Yu, Oriana Hoi Yun; Azoulay, Laurent

2014-01-01

Background: Small cross-sectional studies have suggested that metformin, a first-line oral hypoglycemic agent, may lower thyroid-stimulating hormone (TSH) levels. Our objective was to determine whether the use of metformin monotherapy, when compared with sulfonylurea monotherapy, is associated with an increased risk of low TSH levels (< 0.4 mIU/L) in patients with type 2 diabetes mellitus. Methods: Using the Clinical Practice Research Datalink, we identified patients who began receiving metformin or sulfonylurea monotherapy between Jan. 1, 1988, and Dec. 31, 2012. We assembled 2 subcohorts of patients with treated hypothyroidism or euthyroidism, and followed them until Mar. 31, 2013. We used Cox proportional hazards models to evaluate the association of low TSH levels with metformin monotherapy, compared with sulfonylurea monotherapy, in each subcohort. Results: A total of 5689 patients with treated hypothyroidism and 59 937 euthyroid patients were included in the subcohorts. Among patients with treated hypothyroidism, 495 events of low TSH levels were observed during follow-up (incidence rate 119.7/1000 person-years). In the euthyroid group, 322 events of low TSH levels were observed (incidence rate 4.5/1000 person-years). Compared with sulfonylurea monotherapy, metformin monotherapy was associated with a 55% increased risk of low TSH levels in patients with treated hypothyroidism (incidence rate 79.5/1000 person-years v. 125.2/1000 person-years, adjusted hazard ratio [HR] 1.55, 95% confidence interval [CI] 1.09–2.20), with the highest risk in the 90–180 days after initiation (adjusted HR 2.30, 95% CI 1.00–5.29). No association was observed in euthyroid patients (adjusted HR 0.97, 95% CI 0.69–1.36). Interpretation: In this longitudinal population-based study, metformin use was associated with an increased incidence of low TSH levels in patients with treated hypothyroidism, but not in euthyroid patients. The clinical consequences of this need further investigation. PMID:25246411

Implementation of a School Nurse-led Intervention for Children With Severe Obesity in New York City Schools.

PubMed

Schroeder, Krista; Jia, Haomiao; Wang, Y Claire; Smaldone, Arlene

The Healthy Options and Physical Activity Program (HOP) is a school nurse-led intervention for children with severe obesity. HOP was developed by experts at the New York City Department of Health and Mental Hygiene and implemented in New York City schools beginning in 2012. The purpose of this study was to evaluate HOP implementation with the goal of informing HOP refinement and potential future HOP dissemination. This study entailed a retrospective analysis of secondary data. Analytic methods included descriptive statistics, Wilcoxon rank sum and Chi square tests, and multivariate logistic regression. During the 2012-2013 school year, 20,518 children were eligible for HOP. Of these, 1054 (5.1%) were enrolled in the program. On average, enrolled children attended one HOP session during the school year. Parent participation was low (3.2% of HOP sessions). Low nurse workload, low school poverty, higher grade level, higher BMI percentile, and chronic illness diagnosis were associated with student enrollment in HOP. As currently delivered, HOP is not likely to be efficacious. Lessons learned from this evaluation are applicable to future nurse-led obesity interventions. Prior to implementing a school nurse-led obesity intervention, nursing workload and available support must be carefully considered. Interventions should be designed to facilitate (and possibly require) parent involvement. Nurses who deliver obesity interventions may require additional training in obesity treatment. With attention to these lessons learned, evidence-based school nurse-led obesity interventions can be developed. Copyright © 2017 Elsevier Inc. All rights reserved.

Are lower TSH cutoffs in neonatal screening for congenital hypothyroidism warranted?

PubMed Central

Lain, Samantha; Trumpff, Caroline; Grosse, Scott D; Olivieri, Antonella; Van Vliet, Guy

2018-01-01

When newborn screening (NBS) for congenital hypothyroidism (CH) using thyroid-stimulating hormone (TSH) as a primary screening test was introduced, typical TSH screening cutoffs were 20–50 U/L of whole blood. Over the years, lowering of TSH cutoffs has contributed to an increased prevalence of detected CH. However, a consensus on the benefit deriving from lowering TSH cutoffs at screening is lacking. The present paper outlines arguments both for and against the lowering of TSH cutoffs at NBS. It includes a review of recently published evidence from Australia, Belgium and Italy. A section focused on economic implications of lowering TSH cutoffs is also provided. One issue that bears further examination is the extent to which mild iodine deficiency at the population level might affect the association of neonatal TSH values with cognitive and developmental outcomes. A debate on TSH cutoffs provides the opportunity to reflect on how to make NBS for CH more effective and to guarantee optimum neurocognitive development and a good quality of life to babies with mild as well as with severe CH. All authors of this debate article agree on the need to establish optimal TSH cutoffs for screening programs in various settings and to ensure the benefits of screening and access to care for newborns worldwide. PMID:28694389

Termitarium-inhabiting Bacillus endophyticus TSH42 and Bacillus cereus TSH77 colonizing Curcuma longa L.: isolation, characterization, and evaluation of their biocontrol and plant-growth-promoting activities.

PubMed

Chauhan, Ankit Kumar; Maheshwari, Dinesh Kumar; Kim, Kangmin; Bajpai, Vivek K

2016-10-01

Bacillus strains were isolated from termitarium soil and screened for their antifungal activity through the production of diffusible and volatile metabolites. Further, the bacterial strains that showed antifungal activity were evaluated for their biocontrol potential on the basis of their plant-growth-promoting attributes. Termitarium-inhabiting Bacillus strains TSH42 and TSH77 significantly reduced the growth of pathogenic fungus Fusarium solani, controlled the symptoms of rhizome rot in turmeric (Curcuma longa L.), and demonstrated various plant-growth-promoting traits in different in vitro assays. On the basis of morphological, physiological, biochemical, and 16S rDNA characteristics, isolates TSH42 and TSH77 were identified as Bacillus endophyticus (KT379993) and Bacillus cereus (KT379994), respectively. Through liquid chromatography - mass spectrometry analysis, acidified cell-free culture filtrate (CFCF) of B. cereus TSH77 was shown to contain surfactin and fengycin, while CFCF of B. endophyticus TSH42 contained iturin in addition to surfactin and fengycin. Treatment of the turmeric (C. longa L.) plants with TSH42 and TSH77 significantly reduced the percentage incidence of rhizome rot disease caused by F. solani. The same treatment also increased the fresh rhizome biomass and plant growth in greenhouse conditions.

Hypothyroidism in the elderly: diagnosis and management

PubMed Central

Bensenor, Isabela M; Olmos, Rodrigo D; Lotufo, Paulo A

2012-01-01

Thyroid disorders are highly prevalent, occurring most frequently in aging women. Thyroid-associated symptoms are very similar to symptoms of the aging process; thus, improved methods for diagnosing overt and subclinical hypothyroidism in elderly people are crucial. Thyrotropin measurement is considered to be the main test for detecting hypothyroidism. Combined evaluations of thyroid stimulating hormone (TSH) and free-thyroxine can detect overt hypothyroidism (high TSH with low free-thyroxine levels) and subclinical hypothyroidism (high TSH with normal free-thyroxine levels). It is difficult to confirm the diagnosis of thyroid diseases based only on symptoms, but presence of symptoms could be an indicator of who should be evaluated for thyroid function. The most important reasons to treat overt hypothyroidism are to relieve symptoms and avoid progression to myxedema. Overt hypothyroidism is classically treated using L-thyroxine; elderly patients require a low initial dose that is increased every 4 to 6 weeks until normalization of TSH levels. After stabilization, TSH levels are monitored yearly. There is no doubt about the indication for treatment of overt hypothyroidism, but indications for treatment of subclinical disease are controversial. Although treatment of subclinical hypothyroidism may result in lipid profile improvement, there is no evidence that this improvement is associated with decreased cardiovascular or all-cause mortality in elderly patients. In patients with a high risk of progression from subclinical to overt disease, close monitoring of thyroid function could be the best option. PMID:22573936

Frequency and Clinical Implication of the R450H Mutation in the Thyrotropin Receptor Gene in the Japanese Population Detected by Smart Amplification Process 2

PubMed Central

Yanagawa, Yoshimaro; Aoki, Tomoyuki; Morimura, Tadashi; Araki, Osamu; Kimura, Takao; Ogiwara, Takayuki; Kotajima, Nobuo; Yanagawa, Masumi; Murakami, Masami

2014-01-01

In Japanese pediatric patients with thyrotropin (TSH) resistance, the R450H mutation in TSH receptor gene (TSHR) is occasionally observed. We studied the frequency and clinical implication of the R450H mutation in TSHR in the general population of Japanese adults using smart amplification process 2 (SmartAmp2). We designed SmartAmp2 primer sets to detect this mutation using a drop of whole blood. We analyzed thyroid function, antithyroid antibodies, and this mutation in 429 Japanese participants who had not been found to have thyroid disease. Two cases without antithyroid antibodies were heterozygous for the R450H mutation in TSHR. Thus, the prevalence of this mutation was 0.47% in the general population and 0.63% among those without antithyroid antibodies. Their serum TSH concentrations were higher than the average TSH concentration not only in subjects without antithyroid antibodies but also in those with antithyroid antibodies. The R450H mutation in TSHR is relatively common in the Japanese population and potentially affects thyroid function. The present study demonstrates that the SmartAmp2 method is useful to detect the R450H mutation in TSHR, which is one of the common causes of TSH resistance in the Japanese population. PMID:24895636

Do TSH, FT3, and FT4 Impact BAT Visualization of Clinical FDG-PET/CT Images?

PubMed Central

Nagamachi, Shigeki; Mizutani, Youichi; Terada, Tamasa; Kiyohara, Syogo; Wakamatsu, Hideyuki; Fujita, Seigo; Higashi, Tatsuya; Yoshinaga, Keiichiro; Saga, Tsuneo; Hirai, Toshinori

2018-01-01

Objective We retrospectively analyzed activated BAT visualization on FDG-PET/CT in patients with various conditions and TH levels to clarify the relationships between visualization of BAT on FDG-PET/CT and the effect of TH. Methods Patients who underwent clinical FDG-PET/CT were reviewed and we categorized patients into 5 groups: (i) thyroid hormone withdrawal (THW) group; (ii) recombinant human thyrotropin (rhTSH) group; (iii) hypothyroidism group; (iv) hyperthyroidism group; and (v) BAT group. A total of sixty-two FDG-PET/CT imaging studies in fifty-nine patients were performed. To compare each group, gender; age; body weight; serum TSH, FT3, and FT4 levels; and outside temperature were evaluated. Results No significant visualization of BAT was noted in any of the images in the THW, rhTSH, hypothyroidism, and hyperthyroidism groups. All patients in the BAT group were in a euthyroid state. When the BAT-negative and BAT-positive patient groups were compared, it was noted that the minimum and maximum temperature on the day of the PET study and maximum temperature of the one day before the PET study were significantly lower in BAT-positive group than in all those of other groups. Conclusions Elevated TSH condition before RIT, hyperthyroidism, or hypothyroidism did not significantly impact BAT visualization of clinical FDG-PET/CT images. PMID:29666563

The Number of Trials Required to Obtain a Representative Movement Pattern During a Hurdle Hop Exercise.

PubMed

Gore, Shane J; Marshall, Brendan M; Franklyn-Miller, Andrew D; Falvey, Eanna C; Moran, Kieran A

2016-06-01

When reporting a subject's mean movement pattern, it is important to ensure that reported values are representative of the subject's typical movement. While previous studies have used the mean of 3 trials, scientific justification of this number is lacking. One approach is to determine statistically how many trials are required to achieve a representative mean. This study compared 4 methods of calculating the number of trials required in a hopping movement to achieve a representative mean. Fifteen males completed 15 trials of a lateral hurdle hop. Range of motion at the trunk, pelvis, hip, knee, and ankle, in addition to peak moments for the latter 3 joints were examined. The number of trials required was computed using a peak intraclass correlation coefficient method, sequential analysis with a bandwidth of acceptable variance in the mean, and a novel method based on the standard error of measurement (SEMind). The number of trials required across all variables ranged from 2 to 12 depending on method, joint, and anatomical plane. The authors advocate the SEMind method as it demonstrated fewer limitations than the other methods. Using the SEMind, the required number of trials for a representative mean during the lateral hurdle hop is 6.

Radioactive body burden measurements in (131)iodine therapy for differentiated thyroid cancer: effect of recombinant thyroid stimulating hormone in whole body (131)iodine clearance.

PubMed

Ravichandran, Ramamoorthy; Al Saadi, Amal; Al Balushi, Naima

2014-01-01

Protocols in the management of differentiated thyroid cancer, recommend adequate thyroid stimulating hormone (TSH) stimulation for radioactive (131)I administrations, both for imaging and subsequent ablations. Commonly followed method is to achieve this by endogenous TSH stimulation by withdrawal of thyroxine. Numerous studies worldwide have reported comparable results with recombinant human thyroid stimulating hormone (rhTSH) intervention as conventional thyroxine hormone withdrawal. Radiation safety applications call for the need to understand radioactive (131)I (RA(131)I) clearance pattern to estimate whole body doses when this new methodology is used in our institution. A study of radiation body burden estimation was undertaken in two groups of patients treated with RA(131)I; (a) one group of patients having thyroxine medication suspended for 5 weeks prior to therapy and (b) in the other group retaining thyroxine support with two rhTSH injections prior to therapy with RA(131)I. Sequential exposure rates at 1 m in the air were measured in these patients using a digital auto-ranging beta gamma survey instrument calibrated for measurement of exposure rates. The mean measured exposure rates at 1 m in μSv/h immediately after administration and at 24 h intervals until 3 days are used for calculating of effective ½ time of clearance of administered activity in both groups of patients, 81 patients in conventionally treated group (stop thyroxine) and 22 patients with rhTSH administration. The (131)I activities ranged from 2.6 to 7.9 GBq. The mean administered (131)I activities were 4.24 ± 0.95 GBq (n = 81) in "stop hormone" group and 5.11 ± 1.40 GBq (n = 22) in rhTSH group. The fall of radioactive body burden showed two clearance patterns within observed 72 h. Calculated T½eff values were 16.45 h (stop hormone group) 12.35 h (rhTSH group) for elapsed period of 48 h. Beyond 48 h post administration, clearance of RA(131)I takes place with T½eff> 20 h in both groups. Neck and stomach exposure rate measurements showed reduced uptakes in the neck for rhTSH patients compared with "stop thyroxine" group and results are comparable with other studies. Whole body clearance is faster for patients with rhTSH injection, resulting in less whole body absorbed doses, and dose to blood. These patients clear circulatory radioactivity faster, enabling them to be discharged sooner, thus reduce costs of the hospitalization. Reduction in background whole body count rate may improve the residual thyroid images in whole body scan. rhTSH provides TSH stimulation without withdrawal of thyroid hormone and hence can help patients to take up therapy without hormone deficient problems in the withdrawn period prior to RA(131)I therapy. This also will help in reducing the restriction time periods for patients to mix up with the general population and children.

T3 Regulates a Human Macrophage-Derived TSH-β Splice Variant: Implications for Human Bone Biology.

PubMed

Baliram, R; Latif, R; Morshed, S A; Zaidi, M; Davies, T F

2016-09-01

TSH and thyroid hormones (T3 and T4) are intimately involved in bone biology. We have previously reported the presence of a murine TSH-β splice variant (TSH-βv) expressed specifically in bone marrow-derived macrophages and that exerted an osteoprotective effect by inducing osteoblastogenesis. To extend this observation and its relevance to human bone biology, we set out to identify and characterize a TSH-β variant in human macrophages. Real-time PCR analyses using human TSH-β-specific primers identified a 364-bp product in macrophages, bone marrow, and peripheral blood mononuclear cells that was sequence verified and was homologous to a human TSH-βv previously reported. We then examined TSH-βv regulation using the THP-1 human monocyte cell line matured into macrophages. After 4 days, 46.1% of the THP-1 cells expressed the macrophage markers CD-14 and macrophage colony-stimulating factor and exhibited typical morphological characteristics of macrophages. Real-time PCR analyses of these cells treated in a dose-dependent manner with T3 showed a 14-fold induction of human TSH-βv mRNA and variant protein. Furthermore, these human TSH-βv-positive cells, induced by T3 exposure, had categorized into both M1 and M2 macrophage phenotypes as evidenced by the expression of macrophage colony-stimulating factor for M1 and CCL-22 for M2. These data indicate that in hyperthyroidism, bone marrow resident macrophages have the potential to exert enhanced osteoprotective effects by oversecreting human TSH-βv, which may exert its local osteoprotective role via osteoblast and osteoclast TSH receptors.

Hyperthyroidism caused by an ectopic thyrotropin-secreting tumor of the nasopharynx: a case report and review of the literature.

PubMed

Tong, Anli; Xia, Weibo; Qi, Fang; Jin, Zimeng; Yang, Di; Zhang, Zhuhua; Li, Fang; Xing, Xiaoping; Lian, Xiaolan

2013-09-01

Ectopic thyrotropin (TSH)-secreting tumors are extremely rare. To our knowledge, only three cases have previously been reported so far, but the tumors were not studied ultrastructurally and in vitro. We present a case that was extensively examined to gain deeper insights in terms of the histopathological features and hormonal secretion profile of the tumor. A 49-year-old female complained of nasal obstruction for 15 years and thyrotoxicosis for one and a half years. Except for a high basal TSH with concomitantly elevated free tri-iodothyronine (FT3) and free thyroxine (FT4) levels, her pituitary hormone profile yielded normal results. Magnetic resonance imaging revealed a 2 cm × 2 cm mass in the nasopharynx, which showed an increased tracer uptake on octreotide scintigraphy. Preoperative treatment with octreotide effectively reduced serum TSH, FT3, and FT4 to normal levels. The mass was endoscopically removed via an endonasal approach. Immunophenotyping and hormone determination of cultured cells confirmed that the mass was a plurihormonal TSH-/growth hormone (GH)-/prolactin (PRL)-producing adenoma. Co-expression of TSH and GH was found in most cells. Electron microscopy showed that the adenoma was formed by a single cell type, with secretory granules of small size. In vitro studies demonstrated that octreotide reduced both TSH and GH secretion. We report an ectopic TSH-secreting tumor, which had plurihormonal secretion in vitro, including TSH, GH, and PRL. Histologically, it mimicked a TSH-secreting pituitary adenoma. Octreotide was useful in the diagnosis and treatment of this ectopic TSH-secreting tumor. Ectopic TSH-secreting tumors are extremely rare. In terms of hormone secretion profile, histological characteristics, and response to octreotide, they are similar to pituitary TSH-secreting adenomas, suggesting that they are of identical cell origin.

Inhibiting thyrotropin/insulin-like growth factor 1 receptor crosstalk to treat Graves' ophthalmopathy: studies in orbital fibroblasts in vitro.

PubMed

Place, Robert F; Krieger, Christine C; Neumann, Susanne; Gershengorn, Marvin C

2017-02-01

Crosstalk between thyrotropin (TSH) receptors and insulin-like growth factor 1 (IGF-1) receptors initiated by activation of TSH receptors could be important in the development of Graves' ophthalmopathy (GO). Specifically, TSH receptor activation alone is sufficient to stimulate hyaluronic acid (HA) secretion, a major component of GO, through both IGF-1 receptor-dependent and -independent pathways. Although an anti-IGF-1 receptor antibody is in clinical trials, its effectiveness depends on the relative importance of IGF-1 versus TSH receptor signalling in GO pathogenesis. TSH and IGF-1 receptor antagonists were used to probe TSH/IGF-1 receptor crosstalk in primary cultures of Graves' orbital fibroblasts (GOFs) following activation with monoclonal TSH receptor antibody, M22. Inhibition of HA secretion following TSH receptor stimulation was measured by modified HA elisa. TSH receptor antagonist, ANTAG3 (NCGC00242364), inhibited both IGF-1 receptor -dependent and -independent pathways at all doses of M22; whereas IGF-1 receptor antagonists linsitinib and 1H7 (inhibitory antibody) lost efficacy at high M22 doses. Combining TSH and IGF-1 receptor antagonists exhibited Loewe additivity within the IGF-1 receptor-dependent component of the M22 concentration-response. Similar effects were observed in GOFs activated by autoantibodies from GO patients' sera. Our data support TSH and IGF-1 receptors as therapeutic targets for GO, but reveal putative conditions for anti-IGF-1 receptor resistance. Combination treatments antagonizing both receptors yield additive effects by inhibiting crosstalk triggered by TSH receptor stimulatory antibodies. Combination therapy may be an effective strategy for dose reduction and/or compensate for any loss of anti-IGF-1 receptor efficacy. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Inhibiting thyrotropin/insulin‐like growth factor 1 receptor crosstalk to treat Graves' ophthalmopathy: studies in orbital fibroblasts in vitro

PubMed Central

Place, Robert F; Neumann, Susanne; Gershengorn, Marvin C

2017-01-01

Background and Purpose Crosstalk between thyrotropin (TSH) receptors and insulin‐like growth factor 1 (IGF‐1) receptors initiated by activation of TSH receptors could be important in the development of Graves' ophthalmopathy (GO). Specifically, TSH receptor activation alone is sufficient to stimulate hyaluronic acid (HA) secretion, a major component of GO, through both IGF‐1 receptor‐dependent and ‐independent pathways. Although an anti‐IGF‐1 receptor antibody is in clinical trials, its effectiveness depends on the relative importance of IGF‐1 versus TSH receptor signalling in GO pathogenesis. Experimental Approach TSH and IGF‐1 receptor antagonists were used to probe TSH/IGF‐1 receptor crosstalk in primary cultures of Graves' orbital fibroblasts (GOFs) following activation with monoclonal TSH receptor antibody, M22. Inhibition of HA secretion following TSH receptor stimulation was measured by modified HA elisa. Key Results TSH receptor antagonist, ANTAG3 (NCGC00242364), inhibited both IGF‐1 receptor ‐dependent and ‐independent pathways at all doses of M22; whereas IGF‐1 receptor antagonists linsitinib and 1H7 (inhibitory antibody) lost efficacy at high M22 doses. Combining TSH and IGF‐1 receptor antagonists exhibited Loewe additivity within the IGF‐1 receptor‐dependent component of the M22 concentration‐response. Similar effects were observed in GOFs activated by autoantibodies from GO patients' sera. Conclusions and Implications Our data support TSH and IGF‐1 receptors as therapeutic targets for GO, but reveal putative conditions for anti‐IGF‐1 receptor resistance. Combination treatments antagonizing both receptors yield additive effects by inhibiting crosstalk triggered by TSH receptor stimulatory antibodies. Combination therapy may be an effective strategy for dose reduction and/or compensate for any loss of anti‐IGF‐1 receptor efficacy. PMID:27987211

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taguchi, M.; Field, J.B.

Thyrotropin (TSH) and carbachol stimulated in a dose-dependent manner the accumulation of 3H-glycerophosphoinositol (GPI), 3H-inositol monophosphate (IP1), 3H-inositol bisphosphate (IP2) and 3H-inositol trisphosphate (IP3) in primary cultures of dog thyroid cells prelabeled with myo-(2-3H)inositol. TSH, 250 mU/mL, stimulated 3H-IP3 level after a 10-minute incubation while 10 mU/mL TSH increased it during a 60-minute incubation. The effect of carbachol was more rapid and greater than that of TSH. Carbachol, 100 mumol/L, elevated 3H-IP3 after a 2-minute incubation and 3H-IP3 formation was increased by as little as 1 mumol/L carbachol. TSH stimulation was observed only if the cells were deprived of TSHmore » for 5 days before being labeled with 3H-inositol. Prolongation of the labeling period or addition of TSH, (Bu)2cAMP or carbachol during the labeling increased 3H-inositol incorporation into polyphoinositides (PIPs). When the cells were labeled without any other addition, control and TSH-stimulated 3H-IP3 levels increased in parallel with 3H-PIP levels. However, TSH or carbachol-stimulated 3H-IP3 levels did not increase in proportion to 3H-PIPs level when the cells were labeled with TSH or (Bu)2cAMP. Thus, the ratio of 3H-IP3/3H-PIPs (both control and TSH or carbachol-stimulated) decreased in the cells labeled with TSH or (Bu)2cAMP, which might reflect TSH stimulation of 3H-inositol incorporation into PIPs pool(s) that do not participate in hormone-induced hydrolysis of PIPs.« less

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

PubMed Central

2018-01-01

As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation. PMID:29329248

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

PubMed

Jung, Haejoon; Lee, In-Ho

2018-01-12

As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

Interaction of alcoholic extracts of hops with cocaine and paracetamol in mice.

PubMed

Horvat, Olga; Raskovic, Aleksandar; Jakovljevic, Vida; Sabo, Jan; Berenji, Janos

2007-01-01

This work describes a study of the interaction in the mouse model of alcoholic extracts of hops of Magnum, Aroma and wild genotypes with drugs that have excitatory effect on the cerebral cortex (cocaine) and analgesic action (paracetamol). Hop drying and preparation of the extracts were carried out according to standard pharmacological procedures for preparing total alcoholic extracts of dry herbs, consisting of one part of dry drug and two parts of 70% alcohol. The mice received four doses i.p. of 0.5% aqueous solutions of the above-mentioned extracts (10 ml/kg) 24, 16, 4 and 0.5 h prior to receiving cocaine (25 mg/kg) or paracetamol (80 mg/kg). The parameter investigated was the change in spontaneous motility of mice after combined treatment with the extracts and cocaine/paracetamol compared to control animals that received the same dose of the drug after treatment with physiological solution. Only the ethanolic extract of Magnum hops increased the spontaneous motility of mice, while none of the extracts showed analgesic action as measured by the hot-plate method. In the interaction with cocaine, the extract of Magnum hops suppressed almost completely the action of cocaine compared to controls. Extracts of the other hops also decreased the cocaine-induced locomotor activity of mice, but to a lesser extent. Hop extracts exhibited a significant pharmacological interaction with paracetamol, with the most pronounced increase in analgesic action being found for the ethanolic extract of Aroma hops and the tert-butanolic extract of wild hops.

Variable Suppression of Serum Thyroxine in Female Mice of Different Inbred Strains by Triiodothyronine Administered in Drinking Water

PubMed Central

Hamidi, Sepehr; Aliesky, Holly; Chen, Chun-Rong; Rapoport, Basil

2010-01-01

Background Recombinant-inbred mouse strains differ in their susceptibility to Graves'-like hyperthyroidism induced by immunization with adenovirus expressing the human thyrotropin (TSH) receptor. Because one genetic component contributing to this susceptibility is altered thyroid sensitivity to TSH receptor agonist stimulation, we wished to quantify thyroid responsiveness to TSH. For such studies, it is necessary to suppress endogenous TSH by administering L-3,5,3′-triiodothyronine (L-T3), with the subsequent decrease in serum thyroxine (T4) reflecting endogenous TSH suppression. Our two objectives were to assess in different inbred strains of mice (i) the extent of serum T4 suppression after L-T3 administration and (ii) the magnitude of serum T4 increase induced by TSH. Methods Mice were tail-bled to establish baseline-serum T4 before L-T3 administration. We initially employed a protocol of L-T3-supplemented drinking water for 7 days. In subsequent experiments, we injected L-T3 intraperitoneally (i.p.) daily for 3 days. Mice were then injected i.p. with bovine TSH (10 mU) and euthanized 5 hours later. Serum T4 was assayed before L-T3 administration, and before and after TSH injection. In some experiments, serum T3 and estradiol were measured in pooled sera. Results Oral L-T3 (3 or 5 μg/mL) suppressed serum T4 levels by 26%–64% in female BALB/c mice but >95% in males. T4 suppression in female B6 mice ranged from 0% to 90%. In C3H mice, L-T3 at 3 μg/mL was ineffective but 5 μg/mL achieved >80% serum T4 reduction. Unlike inbred mice, in outbred CF1 mice the same protocol was more effective: 83% in females and 100% suppression in males. The degree of T4 suppression was unrelated to baseline T4, T3, or estradiol, but was related to mouse weight and postmortem T3, with greater suppression in larger mice (outbred CF1 animals and inbred males). Among females with serum T4 suppression >80%, the increase in serum T4 after TSH injection was greater for BALB/c and C3H versus B6 mice. Moreover, the T4 increment was higher in female than in male BALB/c. Conclusions Our data provide important, practical information for future in vivo studies in inbred mice: we recommend that responses to TSH be performed in female animals injected with L-T3 i.p. to suppress baseline T4. PMID:20860425

Thyroid stimulating hormone suppression post-therapy in patients with Graves' disease: a systematic review of pathophysiology and clinical data.

PubMed

Yu, Huan; Farahani, Pendar

2015-04-08

Post-treatment hypothyroidism is common in Graves' disease, and clinical guidelines recommend monitoring for it; however, thyroid stimulating hormone (TSH) can remain suppressed in these patients following treatment. The objectives of this study were to explore the proposed pathophysiology behind the phenomenon of post-therapy TSH suppression and to systematically review existing clinical data on post-therapy TSH suppression in patients with Graves' disease. A systematic literature search was performed using EMBASE and PubMed databases, with several combinations of MeSH terms. Bibliography mining was also done on relevant articles to be as inclusive as possible. A total of 18 articles described possible mechanisms for post-therapy TSH suppression. Several of the studies demonstrate evidence of thyrotroph atrophy and hypothesize that this contributes to the ongoing suppression. TSH receptors have been identified in folliculo-stellate cells of the pituitary as well as astroglial cells of the hypothalamus, mediating paracrine feedback. A few studies have demonstrated inverse correlation between autoantibody titres and TSH levels, suggestive of their role in mediating ongoing TSH suppression in patients with Graves' disease. In addition, five studies were identified that provided clinical data on the duration of TSH suppression. Combined data show that 45.5% of patients recover TSH by 3 months after treatment, increasing to 69.3% by 6 months, and plateauing to 73.8% by 12 months (p>0.0001). Sub-analysis also shows that for patients who are TBII negative, 80.7% recover their TSH by 6 months compared with only 58.7% in those who are TBII positive (p= 0.003). Clinical data suggests that TSH recovery is most likely to occur within the first 6 months after treatment, with recovery plateauing at approximately 70% of patients, suggesting that reliance on this assay for monitoring can be very misleading. Furthermore, TBII positivity is associated with lower likelihood of TSH recovery. Pathophysiology behind suppressed TSH involves not only anatomical but also autoimmune mechanisms.

2013 ETA Guideline: Management of Subclinical Hypothyroidism

PubMed Central

Pearce, Simon H.S.; Brabant, Georg; Duntas, Leonidas H.; Monzani, Fabio; Peeters, Robin P.; Razvi, Salman; Wemeau, Jean-Louis

2013-01-01

Subclinical hypothyroidism (SCH) should be considered in two categories according to the elevation in serum thyroid-stimulating hormone (TSH) level: mildly increased TSH levels (4.0-10.0 mU/l) and more severely increased TSH value (>10 mU/l). An initially raised serum TSH, with FT4 within reference range, should be investigated with a repeat measurement of both serum TSH and FT4, along with thyroid peroxidase antibodies, preferably after a 2- to 3-month interval. Even in the absence of symptoms, replacement therapy with L-thyroxine is recommended for younger patients (<65-70 years) with serum TSH >10 mU/l. In younger SCH patients (serum TSH <10 mU/l) with symptoms suggestive of hypothyroidism, a trial of L-thyroxine replacement therapy should be considered. For such patients who have been started on L-thyroxine for symptoms attributed to SCH, response to treatment should be reviewed 3 or 4 months after a serum TSH within reference range is reached. If there is no improvement in symptoms, L-thyroxine therapy should generally be stopped. Age-specific local reference ranges for serum TSH should be considered in order to establish a diagnosis of SCH in older people. The oldest old subjects (>80-85 years) with elevated serum TSH ≤10 mU/l should be carefully followed with a wait-and-see strategy, generally avoiding hormonal treatment. If the decision is to treat SCH, then oral L-thyroxine, administered daily, is the treatment of choice. The serum TSH should be re-checked 2 months after starting L-thyroxine therapy, and dosage adjustments made accordingly. The aim for most adults should be to reach a stable serum TSH in the lower half of the reference range (0.4-2.5 mU/l). Once patients with SCH are commenced on L-thyroxine treatment, then serum TSH should be monitored at least annually thereafter. PMID:24783053

Comparative effect of Citrus sinensis and carbimazole on serum T4, T3 and TSH levels.

PubMed

Uduak, Okon Akpan; Ani, Elemi John; Etoh, Emmauel Columba Inyang; Macstephen, Adienbo Ologbagno

2014-05-01

There are previous independent reports on the anti-thyroid property of Citrus sinensis. This isoflavones and phenolic acid-rich natural agent is widely consumed as dietary supplement, thus the need to investigate its comparative effect with a standard anti-thyroid drug on T4, T3 and thyroid stimulating hormone (TSH) levels. To compare the effect of Citrus sinensis and carbimazole (CARB) on blood levels of thyroid hormones (T4 and T3) and TSH. Male wistar albino rats weighing 100-150 g were employed in this research. The rats were randomly assigned to four groups of seven rats per group. Group I served as control and were administered distilled water while groups II-IV were administered with 1500 mg/kg of Citrus sinensis (fresh orange juice; FOJ), 0.1 μg/g of levothyroxine (LVT) and 0.01 mg/g of CARB, respectively, per oral once daily for 28 days. The animals were sacrificed under chloroform anaesthesia and blood sample collected by cardiac puncture and processed by standard method to obtain serum. TSH, T4 and T3 were assayed with the serum using ARIA II automated radioimmunoassay instrument. The results showed that TSH level was significantly (P < 0.05) decreased in LVT treated group compared with the FOJ group. T4 was significantly (P < 0.05) decreased in the FOJ and CARB groups compared with the control and LVT groups. LVT significantly increased T4 when compared with FOJ group. T3 was significantly (P < 0.05) decreased in the CARB group compared with the control. These findings suggest that FOJ alters thyroid hormones metabolism to reduce their serum levels with a compensatory elevations of TSH level in a direction similar to CARB.

Cytomorphologic spectrum of lymphocytic thyroiditis and correlation between cytological grading and biochemical parameters

PubMed Central

Anila, KR; Nayak, Nileena; Jayasree, K

2016-01-01

Introduction: Chronic lymphocytic thyroiditis [Hashimoto thyroiditis (HT)] is a common thyroid lesion diagnosed on fine-needle aspiration cytology (FNAC). Apart from FNAC, various other parameters, such as clinical features, ultrasonographic findings, antithyroid antibody levels, hormone profiles, and radionuclide thyroid scan, are also taken into consideration in making a diagnosis of HT. Aims: To grade lymphocytic thyroiditis based on the cytomorphology and to correlate the cytological grades with the levels of antithyroid peroxidase antibody (ATPO), antithyroglobulin antibody (ATG), and thyroid stimulating hormone (TSH). Materials and Methods: During a period of one and half years, 1,667 cases underwent FNAC of thyroid at our tertiary care center. Of these, 128 cases had cytological evidence of lymphocytic thyroiditis. Out of these, in 60 cases the levels of ATPO, ATG, and TSH were known. The cytological grades of lymphocytic thyroiditis in these cases were correlated with these parameters. Results: Out of the 60 cases, 55 were females. Age ranged from 5 years to 70 years, with majority of patients in third decade. Diffuse enlargement of thyroid was the commonest presentation. However, 14 cases presented with nodular disease. Majority of the patients had grade 1 thyroiditis (27 cases), followed by grade 2 thyroiditis (22 cases). Cytomorphology was diagnostic of thyroiditis in all 60 cases. ATPO was elevated in 57 cases and ATG was elevated in 40 cases. Elevated level of TSH was seen in only 18 cases. In 39 cases, TSH value was normal. There was no correlation between the cytological grades of thyroiditis and the levels of antithyroid antibodies and TSH. Conclusion: Lymphocytic infiltration of thyroid follicles is pathognomonic of lymphocytic thyroiditis. Positivity for antithyroid antibodies is strongly associated with HT but no correlation was observed between the grades of thyroiditis and the levels of ATPO, ATG, and TSH. PMID:27756987

Distribution of subpopulations of dendritic cells in peripheral blood of patients treated with exogenous thyrotropin

PubMed Central

2012-01-01

Background Dendritic cells (DCs) play a major role as regulators of inflammatory events associated with thyroid pathology. The immunoregulatory function of DCs depends strongly on their subtype, as well as maturation and activation status. Numerous hormonal factors modulate the immune properties of DCs, however, little is known about effects exerted by the hypothalamus-pituitary-thyroid-axis. Recently, we have shown a direct regulatory influence of thyroid hormones (TH) on human DCs function. The aim of the present study was to analyze the effect of systemically administered thyrotropin (TSH) on human blood DCs ex vivo. Methods Blood samples for the cytometric analysis of peripheral blood plasmacytoid and myeloid DCs subtypes were collected from patients subjected to total thyroidectomy because of differentiated thyroid carcinoma at 2 time points: (i) directly before the commencement of TSH administration and (ii) 5 days after first TSH injection. The whole blood quantitative and phenotypic analysis of plasmacytoid and myeloid DCs subtypes was performed by flow cytometry. Results Administration of TSH did not influence the percentage of plasmacytoid DCs in peripheral blood of study participants. Also the percentage of the two main myeloid DCs subpopulations – CD1c/BDCA1+ DCs and CD141/BDCA3+ DCs did not change significantly. TSH administration had no effect on the surface expression of CD86 – one of the major costimulatory molecules – neither in the whole peripheral blood mononuclear cell (PBMC) fraction nor in particular DCs subtypes. Conclusions In the present study, we demonstrated no influence of systemic TSH administration on human peripheral blood DCs subtypes. These results are in accordance with our previous work suggesting the direct effect of TH on human DCs ex vivo. PMID:23199104

Eliciting an antibody response against a recombinant TSH containing fusion protein.

PubMed

Mard-Soltani, Maysam; Rasaee, Mohamad Javad; Sheikhi, AbdolKarim; Hedayati, Mehdi

2017-01-01

Designing novel antigens to rise specific antibodies for Thyroid Stimulating Hormone (TSH) detection is of great significance. A novel fusion protein consisting of the C termini sequence of TSH beta subunit and a fusion sequence was designed and produced for rabbit immunization. Thereafter, the produced antibodies were purified and characterized for TSH detection. Our results indicate that the produced antibody is capable of sensitive and specific detection of TSH with low cross reactivity. This study underscores the applicability of designed fusion protein for specific and sensitive polyclonal antibody production and the importance of selecting an amenable region of the TSH for immunization.

Thyroid stimulating hormone increases hepatic gluconeogenesis via CRTC2.

PubMed

Li, Yujie; Wang, Laicheng; Zhou, Lingyan; Song, Yongfeng; Ma, Shizhan; Yu, Chunxiao; Zhao, Jiajun; Xu, Chao; Gao, Ling

2017-05-05

Epidemiological evidence indicates that thyroid stimulating hormone (TSH) is positively correlated with abnormal glucose levels. We previously reported that TSH has direct effects on gluconeogenesis. However, the underlying molecular mechanism remains unclear. In this study, we observed increased fasting blood glucose and glucose production in a mouse model of subclinical hypothyroidism (only elevated TSH levels). TSH acts via the classical cAMP/PKA pathway and CRTC2 regulates glucose homeostasis. Thus, we explore whether CRTC2 is involved in the process of TSH-induced gluconeogenesis. We show that TSH increases CRTC2 expression via the TSHR/cAMP/PKA pathway, which in turn upregulates hepatic gluconeogenic genes. Furthermore, TSH stimulates CRTC2 dephosphorylation and upregulates p-CREB (Ser133) in HepG2 cells. Silencing CRTC2 and CREB decreases the effect of TSH on PEPCK-luciferase, the rate-limiting enzyme of gluconeogenesis. Finally, the deletion of TSHR reduces the levels of the CRTC2:CREB complex in mouse livers. This study demonstrates that TSH activates CRTC2 via the TSHR/cAMP/PKA pathway, leading to the formation of a CRTC2:CREB complex and increases hepatic gluconeogenesis. Copyright © 2017 Elsevier B.V. All rights reserved.

Phase 2 study of treatment selection based on tumor thymidylate synthase expression in previously untreated patients with metastatic colorectal cancer: A trial of the ECOG-ACRIN Cancer Research Group (E4203).

PubMed

Meropol, Neal J; Feng, Yang; Grem, Jean L; Mulcahy, Mary F; Catalano, Paul J; Kauh, John S; Hall, Michael J; Saltzman, Joel N; George, Thomas J; Zangmeister, Jeffrey; Chiorean, Elena G; Cheema, Puneet S; O'Dwyer, Peter J; Benson, Al B

2018-02-15

The authors hypothesized that patients with metastatic colorectal cancer (mCRC) who had tumors with low thymidylate synthase (TS-L) expression would have a higher response rate to combined 5-fluorouracil, leucovorin, and oxaliplatin (FOLFOX) plus bevacizumab (FOLFOX/Bev) than those with high TS (TS-H) expression and that combined irinotecan and oxaliplatin (IROX) plus bevacizumab (IROX/Bev) would be more effective than FOLFOX/Bev in those with TS-H tumors. TS protein expression was determined in mCRC tissue. Patients who had TS-L tumors received FOLFOX/Bev, and those who had TS-H tumors were randomly assigned to receive either FOLFOX/Bev or IROX/Bev. The primary endpoint was the response rate (complete plus partial responses). In total, 211 of 247 patients (70% TS-H) were registered to the treatment phase. Efficacy analyses included eligible patients who had started treatment (N = 186). The response rates for patients who received IROX/Bev (TS-H), FOLFOX/Bev (TS-H), and FOLFOX/Bev (TS-L) were 33%, 38%, and 49%, respectively (P = nonsignificant). The median progression-free survival (PFS) was 10 months (95% confidence interval [CI], 9-12 months; 10 months in the IROX/Bev TS-H group, 9 months in the FOLFOX/Bev TS-H group, and 13 months in the FOLFOX/Bev TS-L group). The TS-L group had improved PFS compared with the TS-H group that received FOLFOX/Bev (hazard ratio, 1.6; 95% CI, 1.0%-2.4%; P = .04; Cox regression). The median overall survival (OS) was 22 months (95% CI, 20 29 months; 18 months in the IROX/Bev TS-H group, 21 months in the FOLFOX/Bev TS-H group, and 32 months in the TS-L group). OS comparisons for the 2 TS-H arms and for the FOLFOX/Bev TS-H versus TS-L arms were not significantly different. TS expression was prognostic: Patients with TS-L tumors who received FOLFOX/Bev had a longer PFS than those with TS-H tumors, along with a trend toward longer OS. Patients with TS-H tumors did not benefit more from IROX/Bev than from FOLFOX/Bev. Cancer 2018;124:688-97. © 2017 American Cancer Society. © 2017 American Cancer Society.

Establishment of reference intervals for serum thyroid-stimulating hormone, free and total thyroxine, and free and total triiodothyronine for the Beckman Coulter DxI-800 analyzers by indirect method using data obtained from Chinese population in Zhejiang Province, China.

PubMed

Wang, Yan; Zhang, Yu-Xia; Zhou, Yong-Lie; Xia, Jun

2017-07-01

In order to establish suitable reference intervals of thyroid-stimulating hormone (TSH), free (unbound) T4 (FT4), free triiodothyronine (FT3), total thyroxine (T4), and total triiodothyronine (T3) for the patients collected in Zhejiang, China, an indirect method was developed using the data from the people presented for routine health check-up. Fifteen thousand nine hundred and fifty-six person's results were reviewed. Box-Cox or Case Rank was used to transform the data to normal distribution. Tukey and Box-Plot methods were used to exclude the outliers. Nonparametric method was used to establish the reference intervals following the EP28-A3c guideline. Pearson correlation was used to evaluate the correlation between hormone levels and age, while Mann-Whitney U test was employed for quantification of concentration differences on the people who are younger and older than 50 years old. Reference intervals were 0.66-4.95 mIU/L (TSH), 8.97-14.71 pmol/L (FT4), 3.75-5.81 pmol/L (FT3), 73.45-138.93 nmol/L (total T4), and 1.24-2.18 nmol/L (total T3) in male; conversely, reference intervals for female were 0.72-5.84 mIU/L (TSH), 8.62-14.35 pmol/L (FT4), 3.59-5.56 pmol/L (FT3), 73.45-138.93 nmol/L (total T4), and 1.20-2.10 nmol/L (total T3). FT4, FT3, and total T3 levels in male and FT4 level in female had an inverse correlation with age. Total T4 and TSH levels in female were directly correlated. Significant differences in these hormones were also found between younger and older than 50 years old except FT3 in female. Indirect method can be applied for establishment of reference intervals for TSH, FT4, FT3, total T4, and total T3. The reference intervals are narrower than those previously established. Age factor should also be considered. © 2016 Wiley Periodicals, Inc.

Multiple-hopping trajectories near a rotating asteroid

NASA Astrophysics Data System (ADS)

Shen, Hong-Xin; Zhang, Tian-Jiao; Li, Zhao; Li, Heng-Nian

2017-03-01

We present a study of the transfer orbits connecting landing points of irregular-shaped asteroids. The landing points do not touch the surface of the asteroids and are chosen several meters above the surface. The ant colony optimization technique is used to calculate the multiple-hopping trajectories near an arbitrary irregular asteroid. This new method has three steps which are as follows: (1) the search of the maximal clique of candidate target landing points; (2) leg optimization connecting all landing point pairs; and (3) the hopping sequence optimization. In particular this method is applied to asteroids 433 Eros and 216 Kleopatra. We impose a critical constraint on the target landing points to allow for extensive exploration of the asteroid: the relative distance between all the arrived target positions should be larger than a minimum allowed value. Ant colony optimization is applied to find the set and sequence of targets, and the differential evolution algorithm is used to solve for the hopping orbits. The minimum-velocity increment tours of hopping trajectories connecting all the landing positions are obtained by ant colony optimization. The results from different size asteroids indicate that the cost of the minimum velocity-increment tour depends on the size of the asteroids.

Differential effect of inhibitors of oligosaccharide processing on the secretion of thyrotropin from dispersed rodent pituitary cells.

PubMed

Stannard, B S; Gesundheit, N; Thotakura, N R; Gyves, P W; Ronin, C; Weintraub, B D

1989-12-15

We examined the effect of various inhibitors of oligosaccharide processing on the content and secretion of newly synthesized thyroid-stimulating hormone (TSH) from dispersed hypothyroid rodent pituitary cells. 1-deoxynojirimycin and N-methyl-1-deoxynojirimycin, both inhibitors of glucosidases I and II, decreased intracellular TSH (to 60-76% of control) and secreted TSH (to 60-63% of control) after a 1-hour incubation (pulse) with [35S]methionine and an 8-hour incubation (chase) in isotope-free media. In contrast, deoxymannojirimycin and swainsonine, inhibitors of mannosidase I and II, respectively, increased both intracellular TSH (to 267-309% of control) and secreted TSH (to 192% of control) at 8 hours. TSH oligosaccharides synthesized in the presence of these glucosidase and mannosidase inhibitors were largely sensitive to endo-beta-N-acetylglucosaminidase H (endo H), confirming inhibition of processing. Despite differences in oligosaccharide structure, the in vitro bioactivities of these secreted TSH isoforms were nearly identical. These data confirm and extend previous work performed with 1-deoxynojirimycin suggesting that glucosylated high mannose forms of TSH are more susceptible to intracellular degradation. The novel finding that deoxymannojirimycin and swainsonine increase secreted and total TSH above control levels suggests that non-glucosylated high mannose forms as well as hybrid-type oligosaccharides may facilitate secretion and direct TSH away from a natural degradation pathway.

Radioimmunoassay of Human Serum Thyrotrophin

PubMed Central

Hall, Reginald; Amos, Jacqueline; Ormston, Brian J.

1971-01-01

The double antibody radioimmunoassay of serum thyroid-stimulating hormone (TSH) allows measurement of circulating levels of the hormone in most normal subjects. The serum TSH level in normal subjects is 1·6 ± 0·8μU/ml. Patients with non-toxic goitre and acromegaly have normal TSH levels. Values are always raised in hypothyroid patients (with primary thyroid disease) and are significantly lowered in those with hyperthyroidism. Of the many stimuli used in an attempt to raise TSH levels in normal adult subjects only three—synthetic thyrotrophin-releasing hormone, ethinyloestradiol, and carbimazole plus iodides—have been effective. The major clinical application of the TSH immunoassay lies in the diagnosis of minor degrees of hypothyroidism. An impaired response of serum TSH to synthetic thyrotrophin-releasing hormone should also help in the diagnosis of hypopituitarism affecting TSH production. PMID:5548300

Pretreatment with a single, low dose of recombinant human thyrotropin allows dose reduction of radioiodine therapy in patients with nodular goiter.

PubMed

Nieuwlaat, Willy-Anne; Huysmans, Dyde A; van den Bosch, Harrie C; Sweep, C G Fred; Ross, H Alec; Corstens, Frans H; Hermus, Ad R

2003-07-01

In patients with nodular goiter, radioiodine ((131)I) therapy results in a mean reduction in thyroid volume (TV) of approximately 40% after 1 yr. We have demonstrated that pretreatment with a single, low dose of recombinant human TSH (rhTSH) doubles 24-h radioactive iodine uptake (RAIU) in these patients. We have now studied the safety and efficacy of therapy with a reduced dose of (131)I after pretreatment with rhTSH. Twenty-two patients with nodular goiter received (131)I therapy, 24 h after im administration of 0.01 (n = 12) or 0.03 (n = 10) mg rhTSH. In preceding diagnostic studies using tracer doses of (131)I, 24-h RAIU without and with rhTSH pretreatment (either 0.01 or 0.03 mg) were compared. Therapeutic doses of (131)I were adjusted to the rhTSH-induced increases in 24-h RAIU and were aimed at 100 micro Ci/g thyroid tissue retained at 24 h. Pretreatment with rhTSH allowed dose reduction of (131)I therapy by a factor of 1.9 +/- 0.5 in the 0.01-mg and by a factor of 2.4 +/- 0.4 in the 0.03-mg rhTSH group (P < 0.05, 0.01 vs. 0.03 mg rhTSH). Before and 1 yr after therapy, TV and the smallest cross-sectional area of the tracheal lumen were measured with magnetic resonance imaging. During the year of follow-up, serum TSH, free T(4) (FT(4)), T(3), and TSH receptor antibodies were measured at regular intervals. TV before therapy was 143 +/- 54 ml in the 0.01-mg group and 103 +/- 44 ml in the 0.03-mg rhTSH group. One year after treatment, TV reduction was 35 +/- 14% (0.01 mg rhTSH) and 41 +/- 12% (0.03 mg rhTSH). In both groups, smallest cross-sectional area of the tracheal lumen increased significantly. In the 0.01-mg rhTSH group, serum FT(4) rose, after (131)I treatment, from 15.8 +/- 2.8 to 23.2 +/- 4.4 pM. In the 0.03-mg rhTSH group, serum FT(4) rose from 15.5 +/- 2.5 to 23.5 +/- 5.1 pM. Individual peak FT(4) levels, reached between 1 and 28 d after (131)I treatment, were above the normal range in 12 patients. TSH receptor antibodies were negative in all patients before therapy and became positive in 4 patients. Hyperthyroidism developed in 3 of these 4 patients between 23 and 25 wk after therapy. In conclusion, in patients with nodular goiter pretreatment with a single, low dose of rhTSH allowed approximately 50-60% reduction of the therapeutic dose of radioiodine without compromising the efficacy of TV reduction.

Nerve Conduction Through Dendrites via Proton Hopping.

PubMed

Kier, Lemont B

2017-01-01

In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

PubMed

Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

2018-03-30

Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

Aspirin increases susceptibility of Helicobacter pylori to metronidazole by augmenting endocellular concentrations of antimicrobials

PubMed Central

Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang

2009-01-01

AIM: To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. METHODS: H pylori reference strain 26 695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-3H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26 695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. RESULTS: The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. CONCLUSION: Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression. PMID:19248190

Deodorant effects of a supercritical hops extract: antibacterial activity against Corynebacterium xerosis and Staphylococcus epidermidis and efficacy testing of a hops/zinc ricinoleate stick in humans through the sensory evaluation of axillary deodorancy.

PubMed

Dumas, Elizabeth R; Michaud, Amy E; Bergeron, Chantal; Lafrance, Jennifer L; Mortillo, Susan; Gafner, Stefan

2009-09-01

There is little scientific evidence to support the efficacy of natural deodorants and therefore, such products may be perceived as inefficacious. The evaluation of the in vitro antibacterial activity of a hop extract and the evaluation of the odor-reducing capacity of a hops/zinc ricinoleate-containing product by a sensory evaluation panel is employed to verify deodorant performance. The goal of this study was to evaluate the in vitro antibacterial activity of a hop extract against Corynebacterium xerosis and Staphylococcus epidermidis and to verify in vivo deodorant performance of a hops/zinc ricinoleate-containing product. The hops extract was evaluated on a culture of an armpit swab from six volunteers. Furthermore, the extract was submitted to a zone of inhibition test and an agar-dilution assay against two major odor-causing bacteria. The clinical evaluation of the finished product was carried out according to a standard method for substantiating deodorant efficacy using trained odor judges for the assessment of axillary malodor (ASTM method E 1207-87 Standard Practice for the Sensory Evaluation of Axillary Deodorancy). The supercritical hops extract showed good antibacterial activities in all three tests. Minimum inhibitory concentration values of 6.25 and 25 mug/mL against C. xerosis and S. aureus, respectively, were obtained in the agar-dilution assay. In the clinical underarm odor-reduction evaluation, the mean malodor score dropped from 6.28 (+/-0.70) to 1.80 (+/-0.71) after 8 h of application. There was still a noticeable effect at both 12 and 24 h after the application, with a score of 1.82 (+/-0.74) and 2.24 (+/-0.77), respectively. The hops extract has good in vitro antibacterial properties and, in combination with zinc ricinoleate in an appropriate base, delivers in vivo odor reduction. The clinical efficacy is likely due to a combination of the base ingredients and the antibacterial actives.

[A case of GH and TSH secreting pituitary macroadenoma].

PubMed

Gołkowski, Filip; Buziak-Bereza, Monika; Stefańska, Agnieszka; Trofimiuk, Małgorzata; Pantofliński, Jacek; Huszno, Bohdan; Czepko, Ryszard; Adamek, Dariusz

2006-01-01

A case of GH and TSH secreting pituitary macroadenoma is reported. A 45-year-old female presented clinical features of acromegaly (the abnormal growth of the hands and feet, with lower jaw protrusion), diabetes mellitus, hypertension, nodular goiter and hyperthyroidism of unclear origin. NMR pituitary imaging revealed intra and extrasellar tumor. The laboratory examinations showed very high plasma levels of GH and IGF-1 and normal level of TSH coexisting with high plasma levels of free thyroid hormones. Pharmacological pretreatment with somatostatin analogues caused the substantial reduction of GH and TSH plasma levels. Histological and immunohistochemical examination of the tissue obtained at transsphenoidal surgery showed GH and TSH secreting adenoma. The laboratory examinations after surgery showed normal GH and IGF-1 plasma levels and reduced insulin requirement, what indicates radical operation. The very low plasma levels of TSH and free thyroid hormones after surgery and immunohistochemical examination suggest central hyperthyroidism due to TSH secreting pituitary tumor (thyrotropinoma).

Use of recombinant human thyroid-stimulating hormone for thyrotropin stimulation test in healthy, hypothyroid and euthyroid sick dogs.

PubMed

Daminet, Sylvie; Fifle, Lyanne; Paradis, Manon; Duchateau, Luc; Moreau, Maxim

2007-12-01

Recombinant human thyroid-stimulating hormone (rhTSH) was evaluated for the diagnosis of canine hypothyroidism, using TSH response tests. Phase I stimulation tests were performed in 6 healthy dogs weighing over 20 kg, using 50 and then 100 microg of freshly reconstituted rhTSH administered intravenously. In phase II, the same dogs were stimulated by using 100 microg of rhTSH frozen for 3 months at -20 degrees C. Phase III stimulation tests were performed by using 50 or 100 microg of freshly reconstituted or frozen rhTSH in healthy (n = 14), euthyroid sick (n = 11) and hypothyroid dogs (n = 9). A dose of 100 microg of rhTSH was judged more appropriate for dogs weighing more than 20 kg. Biological activity of rhTSH after freezing at -20 degrees C for up to 12 weeks was maintained. When stimulated, significant (P < 0.05) increases in total thyroxine concentration were observed only in healthy and euthyroid sick dogs. Results of this study show that the rhTSH stimulation test is able to differentiate euthyroidism from hypothyroidism in dogs.

Validation of an immunoassay for canine thyroid-stimulating hormone and changes in serum concentration following induction of hypothyroidism in dogs.

PubMed

Williams, D A; Scott-Moncrieff, C; Bruner, J; Sustarsic, D; Panosian-Sahakian, N; Unver, E; el Shami, A S

1996-11-15

To validate a new immunoradiometric assay for canine thyroid-stimulating hormone (cTSH) and to document changes in serum cTSH concentration during induction of hypothyroidism in dogs. Six healthy adult male Beagles. Sensitivity, specificity, precision, and accuracy of the cTSH assay were evaluated in vitro. Hypothyroidism was induced in dogs by i.v. administration of sodium iodide I 131 solution. Subsequently, L-thyroxine was administered orally to normalize serum thyroxine concentrations. The cTSH assay appeared to be specific and was sufficiently sensitive to detect cTSH in the serum of these dogs prior to induction of hypothyroidism. There was a 35-fold increase in mean serum cTSH concentration following induction of hypothyroidism, and 35 days after initiation of thyroid replacement therapy, mean serum cTSH concentration was not significantly greater than mean baseline value. Assay of serum cTSH is likely to prove helpful in the differential diagnosis of primary, secondary, and tertiary hypothyroidism in dogs, and in monitoring response to thyroid hormone replacement treatment.

Functional central hypothyroidism in the elderly.

PubMed

Sell, Maren A; Schott, Matthias; Tharandt, Lutz; Cissewski, Klaus; Scherbaum, Werner A; Willenberg, Holger S

2008-06-01

Previous studies have shown that blood concentrations of free thyroxin and basal thyroid-stimulating hormone (TSH) decrease during adult life. Suggested mechanisms include reduced thyroid activity resulting from decreased serum TSH concentrations, impairment of peripheral 5'-deiodinase, and an increase in reverse 3,5,3'-triiodothyronine due to non-thyroidal illness. However, testing of pituitary reserves leads to contradictory results and has infrequently been evaluated in studies. We investigated whether the response of TSH to thyrotropin-releasing hormone (TRH) is preserved during aging. This was tested in a cohort of 387 subjects aged 13 to 100 years in whom thyroid disease was excluded by normal thyroid ultrasound, normal values for free thyroxin, free triiodothyronin, TSH, and negative thyroid peroxidase antibodies. Serum concentrations of free thyroxin remained almost unchanged, whereas free triiodothyronin and TSH levels were lower in older subjects. In addition, the TSH response to TRH was blunted in older subjects, especially in male individuals. There is evidence that the decreased thyroid hormone levels observed in aging are due to lower TSH concentrations, and that lower TSH concentrations may be linked to an impaired pituitary activity.

[Low levels of TSH measured by a sensitive assay: do they reflect hyperthyroidism? A critical analysis of 580 cases].

PubMed

Rohmer, V; Ligeard-Ducoroy, A; Perdrisot, R; Beldent, V; Jallet, P; Bigorgne, J C

1990-05-12

Highly sensitive TSH assays make it easier to diagnose thyroid diseases. During one year, we performed 5,300 sensitive TSH assays (normal range: 0.15-4 mU/l) in various patients. The purpose of this work was to test the value of the low TSH plasma concentrations found in 580 patients. In 99.7 percent of the cases, low TSH levels were the consequence of a thyroid disorder or a treatment by thyroid hormones; non thyroidal illnesses were detected in only 0.3 percent. However, not all TSH values below 0.15 mU/l were associated with overt or occult thyrotoxicosis. When TSH was undetectable (less than 0.04 mU/l), and excluding thyroid hormone-treated patients, thyrotoxicosis was present in 97 percent of the cases. On the other hand, when TSH values were between 0.04 and 0.15 mU/l, 41 percent of the patients failed to show any sign or symptom of hyperthyroidism, although they had functioning thyroid nodules, multinodular goitre or iodine overload, or they received thyroid hormones.

Thyroid hyperfunctioning adenomas with and without Gsp/TSH receptor mutations show similar clinical features.

PubMed

Arturi, F; Capula, C; Chiefari, E; Filetti, S; Russo, D

1998-01-01

Activating mutations of Gs alpha protein (gsp) and TSH receptor (TSH-R) identified in autonomously hyperfunctioning thyroid adenomas have been proposed as the primary event responsible for this disease. Since mutations have not been detected in 100% (ranging from less than 10% to 90%) of the patients, we evaluated whether the presence of gsp and TSH-R mutations cause differences in the clinical and biochemical parameters of the affected patients. Fifteen consecutive patients (11 women and 4 men) with autonomously hyperfunctioning thyroid adenomas who underwent thyroidectomy, previously examined for the presence of gsp or TSH-R mutations, were investigated. In all of the patients we examined plasma free T3, free T4, TSH levels and ultrasound volume of the nodules. The patients with mutations in gsp or TSH-R were similar to the patients without mutations for clinical presentation, sex distribution and mean age. Furthermore, basal serum FT3, TSH and tumor volume in the patients with mutations were not significantly different from the group without mutations. Our preliminary data demonstrate that no significant differences are present in the two groups of patients examined, suggesting that factors other than gsp or TSH-R mutations play a role in the clinical presentation of the disease.

Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy

PubMed Central

Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.

2016-01-01

Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD0-200ms, and the knee extension moment was positively associated with RTD0-200ms. At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD0-200ms, and RTD0–peak torque. Conclusion: Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Clinical Relevance: Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance. PMID:28210647

Serum TSH levels are associated with cardiovascular risk factors in overweight and obese adolescents.

PubMed

Souza, Luciana Lopes de; Guedes, Erika Paniago; Teixeira, Patrícia Fátima Dos Santos; Moreira, Rodrigo Oliveira; Godoy-Matos, Amelio Fernando; Vaisman, Mario

2016-01-01

To investigate the relationship between serum thyrotropin (TSH), insulin resistance (IR), and cardiovascular risk factors (CRF) in a sample of overweight and obese Brazilian adolescents. A retrospective, longitudinal analysis of 199 overweight and obese pubescent adolescents was performed. The TSH and free T4 (fT4) levels, anthropometric measurements, and laboratory test results of these patients were analyzed. 27 individuals (13.56%) presented with TSH levels above the normal level (subclinical hypothyroidism [SCH]). Their waist circumference (WC) was significantly higher than those of euthyroid individuals. Serum TSH was positively correlated with the homeostasis model assessment of insulin resistance (HOMA-IR) index, triglycerides (TG) and high-density lipoprotein cholesterol (HDL-C). Using TSH and BMI as independent variables, TSH levels were shown to be independently related to HOMA-IR (p=0.001) and TG (p=0.007). Among euthyroid subjects, individuals with TSH values <2.5mIU/mL exhibited statistically significant decreases in waist-to-hip ratio, HDL-C levels, and HOMA-IR scores and a tendency toward lower WC values. SCH in overweight and obese adolescents appears to be associated with excess weight, especially visceral weight. In euthyroid adolescents, there appears to be a direct relationship between TSH and some CRF. In conclusion, in the present sample of overweight and obese adolescents, TSH levels appear to be associated with IR and CRF. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Clinician-Friendly Physical Performance Tests for the Hip, Ankle, and Foot.

PubMed

Vogler, Joseph H; Csiernik, Alexander J; Yorgey, Marissa K; Harrison, Jerrod J; Games, Kenneth E

2017-09-01

Reference:  Hegedus EJ, McDonough SM, Bleakley C, Baxter D, Cook CE. Clinician-friendly lower extremity physical performance tests in athletes: a systematic review of measurement properties and correlation with injury. Part 2: the tests for the hip, thigh, foot, and ankle including the Star Excursion Balance Test. Br J Sports Med. 2015;49(10):649-656.   Do individual physical performance tests (PPTs) for the lower extremity have any relation to injury in athletes 12 years of age and older?   The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were followed to locate articles. Three databases were searched from inception to January 13, 2014: PubMed, CINAHL, and SPORTDiscus. Search phrases were sport, athletics, athletes, and injuries combined with strength, power, endurance, agility, and function. Reference lists of all remaining articles and personal collections of the authors were then reviewed for any missing articles.   Studies were included according to the following criteria: (1) published in English, (2) presented as complete articles (ie, no abstracts or posters), and (3) involved human participants. Studies were excluded on the following criteria: (1) a combination of PPTs was examined, (2) the results were measured using equipment that was expensive or not readily available to the average clinician, (3) the PPTs examined impairment-level data, (4) the PPTs examined tasks not relevant to the lower extremity, or (5) the participants scored 4 or less on the Tegner Activity Scale. The final analysis involved 31 studies.   The name of the PPT and methods were extracted. Each PPT was then critiqued using the Consensus-Based Standards for the Selection of Health Measurement Instruments, a 4-point Likert scale. Data were also summarized using a score of unknown, strong, moderate, limited, or conflicting for the best evidence synthesis.   A total of 14 PPTs were examined; however, names and methods of the PPTs were inconsistent throughout the literature. In descending order, based on frequency of appearance in the literature, the PPTs were (1) 1-legged hop for distance, (2) vertical jump, (3) Star Excursion Balance Test, (4) shuttle run, (5) 6-m timed hop, (6) triple hop, (7) 40-yd sprint, (8) triple crossover hop for distance, (9) 6-m timed crossover hop, (10) T-agility, (11) hexagon hop, (12) medial hop, (13) lateral hop, and (14) multi-stage fitness (beep test). The Star Excursion Balance Test in the anterior, posteromedial, and posterolateral directions was the only test that could help identify injury risk. The 1-legged hop for distance and hexagon hop showed a moderate ability to differentiate between normal and unstable ankles. In dancers, the medial hop in dancers differentiated between painful and normal hips with moderate evidence.   Very little evidence supports the use of PPTs for athletes with lower extremity injuries. A panel of experts needs to standardize the names and methods of widely accepted tests.

Detrending with Empirical Mode Decomposition (DEMD): Theory, Evaluation, and Application

NASA Astrophysics Data System (ADS)

Bolch, Michael Adam

Land-surface heterogeneity (LSH) at different scales has significant influence on atmospheric boundary layer (ABL) buoyant and shear turbulence generation and transfers of water, carbon and heat. The extent of proliferation of this influence into larger-scale circulations and atmospheric structures is a topic continually investigated in experimental and numerical studies, in many cases with the hopes of improving land-atmosphere parameterizations for modeling purposes. The blending height is a potential metric for the vertical propagation of LSH effects into the ABL, and has been the subject of study for several decades. Proper assessment of the efficacy of blending height theory invites the combination of observations throughout ABLs above different LSH scales with model simulations of the observed ABL and LSH conditions. The central goal of this project is to develop an apt and thoroughly scrutinized method for procuring ABL observations that are accurately detrended and justifiably relevant for such a study, referred to here as Detrending with Empirical Mode Decomposition (DEMD). The Duke University helicopter observation platform (HOP) provides ABL data [wind (u, v, and w), temperature ( T), moisture (q), and carbon dioxide (CO 2)] at a wide range of altitudes, especially in the lower ABL, where LSH effects are most prominent, and where other aircraft-based platforms cannot fly. Also, lower airspeeds translate to higher resolution of the scalars and fluxes needed to evaluate blending height theory. To confirm noninterference of the main rotor downwash with the HOP sensors, and also to identify optimal airspeeds, analytical, numerical, and observational studies are presented. Analytical analysis clears the main rotor downwash from the HOP nose at airspeeds above 10 m s-1. Numerical models find an acceptable range from 20-40 m s-1, due to a growing compressed air preceding the HOP nose. The first observational study finds no impact of different HOP airspeeds on measurements from ˜18 m s -1 to ˜55 m s-1 over a stable marine boundary layer (MBL). Another set of observations studies HOP and tower data, using the Duke University Mobile Micrometeorological Station (MMS) over an MBL, and concludes that HOP sensible heat (SH), latent heat (LE), and carbon dioxide (F CO2) fluxes align well with MMS findings. The HOP sensors provide ABL data at 40 Hz, as well as a real-time display of theta for in-flight ABL height estimation. Sensor calibration and alignment procedures indicate usable ABL measurements. HOP data are especially susceptible to the spurious influence of platform motion on ABL data, largely due to the low-altitude and low-airspeed capabilities of the HOP. For example, HOP altitude motion in the presence of a lapse rate can cause spurious T fluctuations. Empirical mode decomposition (EMD) can separate HOP data into a set of adaptive and unique intrinsic mode functions (IMFs), often with physical meaning. DEMD aims to correct for spurious contributions to HOP data, while merging EMD with a correlation analysis to adjust data without eliminating relevant ABL dynamics. To evaluate DEMD efficacy, two-dimensional synthetic T fields with simulated turbulence over a prescribed lapse rate are sampled with altitude fluctuations similar to HOP flights, and with a wide range of T perturbation and sampling path parameter variations. DEMD recovers the prescribed lapse rate within 1% on average for the 552 test cases passing the filtering criteria. The method is further evaluated via application to vertical cross sections taken from the Ocean-Land-Atmosphere Model (OLAM) large-eddy simulation (LES) results, where DEMD shows improved accuracy of SH recovery. DEMD is applied to three low-altitude HOP flight legs flown on 19 June 2007 during the Cloud and Land Surface Interaction Campaign (CLASIC), both as an example of practical application and to compare DEMD to the initially proposed method (Holder et al. 2011, hereafter H11). H11 dictates the elimination of correlated IMFs, along with other subtle differences from DEMD, which also eliminates any ABL motions embedded in those IMFs. As suspected, the H11 method produces marked reductions of variances and turbulence kinetic energy (TKE) and substantial deviations in SH, LE, and FCO2 compared to DEMD. DEMD detrends without unnecessary elimination. DEMD is vital for ensuring accurate scalars and fluxes from HOP data, and a strategy for future research is presented that integrates properly detrended observations from the CLASIC HOP dataset with OLAM simulations to explore LSH effects on ABL processes and evaluate blending height theory.

Fall in thyroid stimulating hormone (TSH) may be an early marker of ipilimumab-induced hypophysitis.

PubMed

De Sousa, Sunita M C; Sheriff, Nisa; Tran, Chau H; Menzies, Alexander M; Tsang, Venessa H M; Long, Georgina V; Tonks, Katherine T T

2018-06-01

Hypophysitis develops in up to 19% of melanoma patients treated with ipilimumab, a cytotoxic T-lymphocyte antigen-4 antibody. Early detection may avert life-threatening hypopituitarism. We aimed to assess the incidence of ipilimumab-induced hypophysitis (IH) at a quaternary melanoma referral centre, and to determine whether cortisol or thyroid stimulating hormone (TSH) monitoring could predict IH onset. We performed a retrospective cohort study of ipilimumab-treated patients at a quaternary melanoma referral centre in Australia. The inclusion criteria were patients with metastatic or unresectable melanoma treated with ipilimumab monotherapy, and cortisol and TSH measurements prior to ≥ 2 infusions. The main outcomes were IH incidence and TSH and cortisol patterns in patients who did and did not develop IH. Of 78 ipilimumab-treated patients, 46 met the study criteria and 9/46 (20%) developed IH at a median duration of 13.0 weeks (range 7.7-18.1) following ipilimumab initiation. All patients whose TSH fell ≥ 80% compared to baseline developed IH, and, in 5/9 patients with IH, TSH fell prior to cortisol fall and IH diagnosis. Pre-cycle-4 TSH was significantly lower in those who developed IH (0.31 vs. 1.73 mIU/L, P = 0.006). TSH fall was detected at a median time of 9.2 (range 7.7-16.4) weeks after commencing ipilimumab, and a median of 3.6 (range of - 1.4 to 9.7) weeks before IH diagnosis. There was no difference in TSH between the groups before cycles 1-3 or in cortisol before cycles 1-4. TSH fall ≥ 80% may be an early marker of IH. Serial TSH measurement during ipilimumab therapy may be an inexpensive tool to expedite IH diagnosis.

Gestational Age-specific Cut-off Values Are Needed for Diagnosis of Subclinical Hypothyroidism in Early Pregnancy.

PubMed

Kim, Hye Sung; Kim, Byoung Jae; Oh, Sohee; Lee, Da Young; Hwang, Kyu Ri; Jeon, Hye Won; Lee, Seung Mi

2015-09-01

During the first trimester of pregnancy, thyroid-stimulating hormone (TSH) >2.5 mIU/L has been suggested as the universal criterion for subclinical hypothyroidism. However, TSH levels change continuously during pregnancy, even in the first trimester. Therefore the use of a fixed cut-off value for TSH may result in a different diagnosis rate of subclinical hypothyroidism according to gestational age. The objective of this study was to obtain the normal reference range of TSH during the first trimester in Korean gravida and to determine the diagnosis rate of subclinical hypothyroidism using the fixed cut-off value (TSH >2.5 mIU/L). The study population consisted of pregnant women who were measured for TSH during the first trimester of pregnancy (n=492) and nonpregnant women (n=984). Median concentration of TSH in pregnant women was lower than in non-pregnant women. There was a continuous decrease of median TSH concentration during the first trimester of pregnancy (median TSH concentration: 1.82 mIU/L for 3+0 to 6+6 weeks; 1.53 mIU/L for 7+0 to 7+6 weeks; and 1.05 mIU/L for 8+0 to 13+6 weeks). Using the fixed cut-off value of TSH >2.5 mIU/L, the diagnosis rate of subclinical hypothyroidism decreased significantly according to the gestational age (GA) at TSH (25% in 3+0 to 6+6 weeks, 13% in 7+0 to 7+6 weeks, and 9% for 8+0 to 13+6 weeks, P<0.001), whereas the diagnosis rate was 5% in all GA with the use of a GA-specific cut-off value (P=0.995). Therefore, GA-specific criteria might be more appropriate for the diagnosis of subclinical hypothyroidism.

Evaluation of Serum Thyroid-Stimulating Hormone Concentration as a Diagnostic Test for Hyperthyroidism in Cats.

PubMed

Peterson, M E; Guterl, J N; Nichols, R; Rishniw, M

2015-01-01

In humans, measurement of serum thyroid-stimulating hormone (TSH) concentration is commonly used as a first-line discriminatory test of thyroid function. Recent reports indicate that canine TSH (cTSH) assays can be used to measure feline TSH and results can help diagnose or exclude hyperthyroidism. To investigate the usefulness of cTSH measurements as a diagnostic test for cats with hyperthyroidism. Nine hundred and seventeen cats with untreated hyperthyroidism, 32 euthyroid cats suspected of having hyperthyroidism, and 131 clinically normal cats. Prospective study. Cats referred to the Animal Endocrine Clinic for suspected hyperthyroidism were evaluated with serum T4, T3, free T4 (fT4), and TSH concentrations. Thyroid scintigraphy was used as the gold standard to confirm or exclude hyperthyroidism. Median serum TSH concentration in the hyperthyroid cats (<0.03 ng/mL) was significantly (P < .001) lower than concentrations in clinically normal cats (0.05 ng/mL) or euthyroid cats with suspected thyroid disease (0.06 ng/mL). Only 18 (2.0%) hyperthyroid cats had measurable TSH concentrations (≥0.03 ng/mL), whereas 114 (69.9%) of the 163 euthyroid cats had detectable concentrations. Combining serum TSH with T4 or fT4 concentrations lowered the test sensitivity of TSH from 98.0 to 97.0%, but markedly increased overall test specificity (from 69.9 to 98.8%). Serum TSH concentrations are suppressed in 98% of hyperthyroid cats, but concentrations are measurable in a few cats with mild-to-moderate hyperthyroidism. Measurement of serum TSH represents a highly sensitive but poorly specific test for diagnosis of hyperthyroidism and is best measured in combination with T4 and fT4. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Serum TSH within the reference range as a predictor of future hypothyroidism and hyperthyroidism: 11-year follow-up of the HUNT Study in Norway.

PubMed

Åsvold, Bjørn O; Vatten, Lars J; Midthjell, Kristian; Bjøro, Trine

2012-01-01

Serum TSH in the upper part of the reference range may sometimes be a response to autoimmune thyroiditis in early stage and may therefore predict future hypothyroidism. Conversely, relatively low serum TSH could predict future hyperthyroidism. The objective of the study was to assess TSH within the reference range and subsequent risk of hypothyroidism and hyperthyroidism. This was a prospective population-based study with linkage to the Norwegian Prescription Database. A total of 10,083 women and 5,023 men without previous thyroid disease who had a baseline TSH of 0.20-4.5 mU/liter and who participated at a follow-up examination 11 yr later. Predicted probabilities of developing hypothyroidism or hyperthyroidism during follow-up, by categories of baseline TSH, were estimated. During 11 yr of follow-up, 3.5% of women and 1.3% of men developed hypothyroidism, and 1.1% of women and 0.6% of men developed hyperthyroidism. In both sexes, the baseline TSH was positively associated with the risk of subsequent hypothyroidism. The risk increased gradually from TSH of 0.50-1.4 mU/liter [women, 1.1%, 95% confidence interval (CI) 0.8-1.4; men, 0.3%, 95% CI 0.1-0.6] to a TSH of 4.0-4.5 mU/liter (women, 31.5%, 95% CI 24.6-39.3; men, 14.7%, 95% CI 7.7-26.2). The risk of hyperthyroidism was higher in women with a baseline TSH of 0.20-0.49 mU/liter (3.9%, 95% CI 1.8-8.4) than in women with a TSH of 0.50-0.99 mU/liter (1.4%, 95% CI 0.9-2.1) or higher (∼1.0%). TSH within the reference range is positively and strongly associated with the risk of future hypothyroidism. TSH at the lower limit of the reference range may be associated with an increased risk of hyperthyroidism.

Paediatric reference interval and biological variation trends of thyrotropin (TSH) and free thyroxine (T4) in an Asian population.

PubMed

Loh, Tze Ping; Sethi, Sunil Kumar; Metz, Michael Patrick

2015-08-01

To describe the reference intervals and biological variation data for thyrotropin (TSH) and free thyroxine (FT4) in a mixed Asian population using an indirect sampling approach and to compare them with published reports. TSH and FT4 of children measured once or twice over a 7-year period (2008-2014) at primary-care and tertiary-care settings were extracted from the laboratory information system. After excluding outliers, age-related reference intervals were derived using the Lambda-Mu-Sigma (LMS) approach, while age-partitioned biological variation data were obtained according to recommendations by Fraser and Harris. Both TSH and FT4 were very high at birth and declined with age. Similarly within-individual and between-individual biological variations were higher for both TSH and FT4 at birth and also declined with age. Our data were broadly similar to previous studies. Significant heterogeneity in study population and methods prohibited direct numerical comparison between this and previously published studies. This study fills two important gaps in our knowledge of paediatric thyroid function by reporting the centile trends (and reference values) in a mixed Asian population, as well as providing age-partitioned biological variation data. The variation in published reference intervals highlights the difficulty in harmonising paediatric thyroid reference intervals or recommending universal clinical cut-offs. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Impaired Fertility Associated with Subclinical Hypothyroidism and Thyroid Autoimmunity: The Danish General Suburban Population Study

PubMed Central

Pedersen, Palle L.; Larsen, Jacob

2015-01-01

Introduction. The aim of this study was to estimate the significance of TSH, thyroid peroxidase antibody (TPOAb), and mild (subclinical) hypothyroidism in women from The Danish General Suburban Population Study (GESUS) on the number of children born, the number of pregnancies, and the number of spontaneous abortions. Methods. Retrospective cross sectional study of 11254 women participating in GESUS. Data included biochemical measurements and a self-administrated questionnaire. Results. 6.7% had mild (subclinical) hypothyroidism and 9.4% prevalent hypothyroidism. In women with mild hypothyroidism TPOAb was significantly elevated and age at first child was older compared to controls. TSH and TPOAb were negatively linearly associated with the number of children born and the number of pregnancies in the full cohort in age-adjusted and multiadjusted models. TSH or TPOAb was not associated with spontaneous abortions. Mild (subclinical) hypothyroidism was associated with a risk of not having children and a risk of not getting pregnant in age-adjusted and multiadjusted models. Prevalent hypothyroidism was not associated with the number of children born, the number of pregnancies, or spontaneous abortions. Conclusion. Impaired fertility is associated with TSH, TPOAb, and mild (subclinical) hypothyroidism in a Danish population of women. PMID:26351582

Quality of life changes and clinical outcomes in thyroid cancer patients undergoing radioiodine remnant ablation (RRA) with recombinant human TSH (rhTSH): a randomized controlled study.

PubMed

Taïeb, D; Sebag, F; Cherenko, M; Baumstarck-Barrau, K; Fortanier, C; Farman-Ara, B; De Micco, C; Vaillant, J; Thomas, S; Conte-Devolx, B; Loundou, A; Auquier, P; Henry, J F; Mundler, O

2009-07-01

Recombinant human TSH (rhTSH) has become the modality of choice for radioiodine remnant ablation (RRA) in low-risk thyroid cancer patients. The aims of the present prospective randomized study were to evaluate the impact of TSH stimulation procedure (hypothyroidism vs. rhTSH) on quality of life (QoL) of thyroid cancer patients undergoing RRA and to evaluate efficacy of both procedures. L-T4 was initiated in both groups after thyroidectomy. After randomization, L-T4 was discontinued in hypothyroid (hypo) group and continued in rhTSH group. A measure of 3.7 GBq of radioiodine was given to both groups. The functional assessment of chronic illness therapy-fatigue (FACIT-F) was administered from the early postoperative period to 9 months. Socio-demographic parameters, anxiety and depression scales were also evaluated (CES-D, BDI and Spielberger state-trait questionnaires). At 9 months, patients underwent an rhTSH stimulation test, diagnostic (131)I whole body scan (dxWBS) and neck ultrasonography. A total of 74 patients were enrolled for the study. There was a significant decrease in QoL from baseline (t0) to t1 (RRA period) in the hypothyroid group with significant differences in FACIT-F TOI (P < 10(-3)), FACT-G total score (P = 0.005) and FACIT-F total score (P = 0.003). By contrast, QoL was preserved in the rhTSH group. In the multivariate analysis, FACIT-TOI changes were only affected by the modality of TSH stimulation performed for RRA. From 3 to 9 months, changes of QoL scales and subscales were no longer statistically different in both groups of patients. Based on serum rhTSH-stimulated Tg alone (Tg < 0.8 microg/l, BRAHMS Tg Kryptor), no difference in ablation success was observed between rhTSH and hypothyroidism groups, 91.7% and 97.1%, respectively. A higher rate of persistent thyroid remnants was observed in the rhTSH arm, although in most cases uptake was < 0.1% and of no clinical significance. rhTSH preserves QoL of patients undergoing RRA with similar rates of ablation success compared to hypothyrodism. However, there is a wide heterogeneity in the clinical impact of hypothyroidism.

Hypothyroidism during antithyroid drug treatment with methimazole is a favorable prognostic indicator in patients with Graves' disease.

PubMed

Choo, Young Kwang; Yoo, Won Sang; Kim, Dong Woo; Chung, Hyun-Kyung

2010-09-01

A major problem with antithyroid drug (ATD) therapy in Graves' disease is the high relapse rate. Therefore, clinicians have sought prognostic indicators of permanent remission. Suppression of serum thyrotropin (TSH) when ATD therapy is stopped carries a poor prognosis, but little is known regarding the significance of elevated serum TSH concentrations in the course of ATD therapy. The objective of this study was to determine if elevated serum TSH concentrations during methimazole (MMI) therapy is associated with a favorable long-term prognosis. We retrospectively studied patients with Graves' disease who were initially on MMI, in whom this drug was stopped because they had undetectable thyroid-stimulating antibodies (TSAbs) or were euthyroid after at least 24 months on MMI treatment. A strategy of high MMI doses plus T4 was not used in these patients. We identified 40 patients with elevated serum TSH concentration (>10 microIU/mL) during MMI therapy (H-TSH group). Eighty-five percent of the H-TSH group had negative tests for TSAb. The H-TSH group was sex- and age-matched with 37 patients who had similar selection criteria, but did not have elevated serum TSH concentration during MMI therapy (N-TSH group). The H-TSH and N-TSH groups were similar in gross thyroid size, percentage of patients with exophthalmos, serum free thyroxine, duration of MMI treatment, TSAb status, duration that their TSAb tests remained negative, and thyroid peroxidase antibody titers. The patients were followed for 24 months after stopping MMI. In the H-TSH group, MMI-associated hypothyroidism typically occurred after 7-8 months of treatment with daily doses of 10-15 mg MMI. No patient had severe symptoms of hypothyroidism. The percentage of patients in remission at 6, 12, and 24 months after discontinuation of MMI was 90.0, 87.5, and 85.0, respectively, in the H-TSH group and 70.3, 67.6, and 54.1, respectively, in the N-TSH group (p  <  0.05 for the comparison of groups at 6 and 12 months and p  <  0.001 for comparison of the groups at 24 months). In patients with Graves' disease who are treated with MMI for at least 2 years and become euthyroid, the occurrence of elevated serum TSH concentrations during MMI treatment is a favorable indicator for long-term remission and is independent of multiple other factors including TSAb status, duration of MMI treatment, and gross parameters of goiter size.

Condom Use and Hip Hop Culture: The Case of Urban Young Men in New York City

PubMed Central

Muñoz-Laboy, Miguel A.; Castellanos, Daniel H.; Haliburton, Chanel S.; del Aguila, Ernesto Vasquez; Weinstein, Hannah J.; Parker, Richard G.

2008-01-01

Objectives. We explored how young men’s perceptions of and participation in hip hop culture—urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music—and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. Methods. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Results. Differences in young men’s perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Conclusions. Popular discourses on young men’s health risks often blame youths’ cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men’s lives and what aspects of youths’ culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk. PMID:18445799

A comparison of optimisation methods and knee joint degrees of freedom on muscle force predictions during single-leg hop landings.

PubMed

Mokhtarzadeh, Hossein; Perraton, Luke; Fok, Laurence; Muñoz, Mario A; Clark, Ross; Pivonka, Peter; Bryant, Adam L

2014-09-22

The aim of this paper was to compare the effect of different optimisation methods and different knee joint degrees of freedom (DOF) on muscle force predictions during a single legged hop. Nineteen subjects performed single-legged hopping manoeuvres and subject-specific musculoskeletal models were developed to predict muscle forces during the movement. Muscle forces were predicted using static optimisation (SO) and computed muscle control (CMC) methods using either 1 or 3 DOF knee joint models. All sagittal and transverse plane joint angles calculated using inverse kinematics or CMC in a 1 DOF or 3 DOF knee were well-matched (RMS error<3°). Biarticular muscles (hamstrings, rectus femoris and gastrocnemius) showed more differences in muscle force profiles when comparing between the different muscle prediction approaches where these muscles showed larger time delays for many of the comparisons. The muscle force magnitudes of vasti, gluteus maximus and gluteus medius were not greatly influenced by the choice of muscle force prediction method with low normalised root mean squared errors (<48%) observed in most comparisons. We conclude that SO and CMC can be used to predict lower-limb muscle co-contraction during hopping movements. However, care must be taken in interpreting the magnitude of force predicted in the biarticular muscles and the soleus, especially when using a 1 DOF knee. Despite this limitation, given that SO is a more robust and computationally efficient method for predicting muscle forces than CMC, we suggest that SO can be used in conjunction with musculoskeletal models that have a 1 or 3 DOF knee joint to study the relative differences and the role of muscles during hopping activities in future studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

PARALLEL HOP: A SCALABLE HALO FINDER FOR MASSIVE COSMOLOGICAL DATA SETS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skory, Stephen; Turk, Matthew J.; Norman, Michael L.

2010-11-15

Modern N-body cosmological simulations contain billions (10{sup 9}) of dark matter particles. These simulations require hundreds to thousands of gigabytes of memory and employ hundreds to tens of thousands of processing cores on many compute nodes. In order to study the distribution of dark matter in a cosmological simulation, the dark matter halos must be identified using a halo finder, which establishes the halo membership of every particle in the simulation. The resources required for halo finding are similar to the requirements for the simulation itself. In particular, simulations have become too extensive to use commonly employed halo finders, suchmore » that the computational requirements to identify halos must now be spread across multiple nodes and cores. Here, we present a scalable-parallel halo finding method called Parallel HOP for large-scale cosmological simulation data. Based on the halo finder HOP, it utilizes message passing interface and domain decomposition to distribute the halo finding workload across multiple compute nodes, enabling analysis of much larger data sets than is possible with the strictly serial or previous parallel implementations of HOP. We provide a reference implementation of this method as a part of the toolkit {sup yt}, an analysis toolkit for adaptive mesh refinement data that include complementary analysis modules. Additionally, we discuss a suite of benchmarks that demonstrate that this method scales well up to several hundred tasks and data sets in excess of 2000{sup 3} particles. The Parallel HOP method and our implementation can be readily applied to any kind of N-body simulation data and is therefore widely applicable.« less

Extensions, Validation, and Clinical Applications of a Feedback Control System Simulator of the Hypothalamo-Pituitary-Thyroid Axis

PubMed Central

Samuels, Mary; DiStefano, Joseph J.

2008-01-01

Background We upgraded our recent feedback control system (FBCS) simulation model of human thyroid hormone (TH) regulation to include explicit representation of hypothalamic and pituitary dynamics, and updated TH distribution and elimination (D&E) parameters. This new model greatly expands the range of clinical and basic science scenarios explorable by computer simulation. Methods We quantified the model from pharmacokinetic (PK) and physiological human data and validated it comparatively against several independent clinical data sets. We then explored three contemporary clinical issues with the new model: combined triiodothyronine (T3)/thyroxine (T4) versus T4-only treatment, parenteral levothyroxine (L-T4) administration, and central hypothyroidism. Results Combined T3/T4 therapy—In thyroidectomized patients, the L-T4–only replacement doses needed to normalize plasma T3 or average tissue T3 were 145 μg L-T4/day or 165 μgL-T4/day, respectively. The combined T4 + T3 dosing needed to normalize both plasma and tissue T3 levels was 105 μg L-T4 + 9 μgT3 per day. For all three regimens, simulated mean steady-state plasma thyroid-stimulating hormone (TSH), T3, and T4 was within normal ranges (TSH: 0.5–5 mU/L; T4: 5–12 μg/dL; T3: 0.8–1.9 ng/mL). Parenteral T4 administration—800 μg weekly or 400 μg twice weekly normalized average tissue T3 levels both for subcutaneous (SC) and intramuscular (IM) routes of administration. TSH, T3, and T4 levels were maintained within normal ranges for all four of these dosing schemes (1× vs. 2× weekly, SC vs. IM). Central hypothyroidism—We simulated steady-state plasma T3,T4, and TSH concentrations in response to varying degrees of central hypothyroidism, reducing TSH secretion from 50% down to 0.1% of normal. Surprisingly, TSH, T3, and T4 plasma concentrations remained within normal ranges for TSH secretion as low as 25% of normal. Conclusions Combined T3/T4 treatment—Simulated standard L-T4–only therapy was sufficient to renormalize average tissue T3 levels and maintain normal TSH, T3, and T4 plasma levels, supporting adequacy of standard L-T4–only treatment. Parenteral T4 administration—TSH, T3, and T4 levels were maintained within normal ranges for all four of these dosing schemes (1× vs. 2× weekly, SC vs. IM), supporting these therapeutic alternatives for patients with compromised L-T4 gut absorption. Central hypothyroidism—These results highlight how highly nonlinear feedback in the hypothalamic-pituitary-thyroid axis acts to maintain normal hormone levels, even with severely reduced TSH secretion. PMID:18844475

[Influence of gender, age and season on thyroid hormone reference interval].

PubMed

Qiu, L; Wang, D C; Xu, T; Cheng, X Q; Sun, Q; Hu, Y Y; Liu, H C; Lu, S Y; Yang, G H; Wang, Z J

2018-05-29

Objective: Using clinical "big data" , to investigate the factors that affect the levels of thyroid hormones, and to explore the partitioning criteria for reference intervals (RI) of these hormones. Methods: An observation study was conducted. Information of 107 107 individuals undergoing routine physical examination in Peking Union Medical College Hospital from September 1(st,) 2013 to August 31(st,) 2016 was collected, thyroid hormone of these subjects were detected. To explore the test results distribution and differences of TSH, FT4 and FT3 by gender and age; according to the seasonal division standard of China Meteorological Administration, the study period was divided into four seasons, and the seasonal fluctuation on TSH was analyzed.To define the appropriate partition by gender, age and season according to significant difference analysis. Results: In male and female, the distributions of TSH were 1.779(0.578-4.758), 2.023(0.420-5.343)mU/L, respectively, and the level of TSH in female was higher than in male ( Z =-37.600, P <0.001). The distributions of FT4 were 0.127(0.098-0.162), 0.117(0.091-0.151) μg/L, the distributions of FT3 were 3.33(2.47-3.74), 3.01(2.35-3.57)ng/L. And the level of FT4, FT3 in female were significantly lower than in male ( Z =-94.000, -154.600, all P <0.001). Furthermore, males were divided into two groups by 65 years old and female were divided by 50 years old, respectively, and the distributions of TSH in male and female of older group were 1.818(0.528-5.240), 2.111(0.348-5.735)mU/L, in younger group were 1.778(0.582-4.696), 1.991(0.427-5.316)mU/L. The level of TSH in older group was significantly higher than in younger group ( Z =-2.269, -10.400, all P <0.05), and the distribution of TSH in older group was much wider than in younger. The distribution of whole in spring, summer and autumn was 1.869( 0.510-5.042)mU/L, in winter was 1.978(0.527-5.250) mU/L, and the difference between them had statistical significance ( Z =-15.000, P <0.001). Conclusions: Gender and age significantly affect the serum levels of TSH, FT4, and FT3, the distribution of TSH in female and elder group are wider than in male, and that of FT4, FT3 are lower.Seasons significantly affect the serum TSH level, the peak value is observed in winter. There are obviously differences between "rough" RIs and manufacture recommended RIs. Each laboratory should establish reference intervals for thyroid hormones on the premise of appropriate grouping.

Thyrotropin serum levels are differentially associated with biochemical markers of bone turnover and stiffness in women and men: results from the SHIP cohorts.

PubMed

Tsourdi, E; Wallaschofski, H; Rauner, M; Nauck, M; Pietzner, M; Rettig, R; Ittermann, T; Völzke, H; Völker, U; Hofbauer, L C; Hannemann, A

2016-02-01

In two large German population-based cohorts, we showed positive associations between serum thyrotropin (TSH) concentrations and the Fracture Risk Assessment score (FRAX) in men and positive associations between TSH concentrations and bone turnover markers in women. The role of thyroid hormones on bone stiffness and turnover is poorly defined. Existing studies are confounded by differences in design and small sample size. We assessed the association between TSH serum concentrations and bone stiffness and turnover in the SHIP cohorts, which are two population-based cohorts from a region in Northern Germany comprising 2654 men and women and 3261 men and women, respectively. We calculated the bone stiffness index using quantitative ultrasound (QUS) at the calcaneus, employed FRAX score for assessment of major osteoporotic fractures, and measured bone turnover markers, N-terminal propeptide of type I procollagen (P1NP), bone-specific alkaline phosphatase (BAP), osteocalcin, and type I collagen cross-linked C-telopeptide (CTX) in all subjects and sclerostin in a representative subgroup. There was no association between TSH concentrations and the stiffness index in both genders. In men, TSH correlated positively with the FRAX score both over the whole TSH range (p < 0.01) and within the reference TSH range (p < 0.01). There were positive associations between TSH concentrations and P1NP, BAP, osteocalcin, and CTX (p < 0.01) in women but not in men. There was no significant association between TSH and sclerostin levels. TSH serum concentrations are associated with gender-specific changes in bone turnover and stiffness.

Effects of irradiation and semistarvation on rat thyrotropin beta subunit messenger ribonucleic acid, pituitary thyrotropin content, and thyroid hormone levels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Litten, R.Z.; Carr, F.E.; Fein, H.G.

1990-01-01

The effect of radiation-induced anorexia on serum thyrotropin (TSH), pituitary TSH-{beta} mRNA, pituitary TSH content, serum thyroxine (T{sub 4}), and serum 3,5,3{prime}-triiodothyronine (T{sub 3}) was investigated using feed-matched controls. Rats received 10 Gy gamma whole-body irradiation and were examined 1-3 days postirradiation. Feed-matched and untreated controls were also studied. The average food intake of the irradiated and feed-matched groups was approximately 18% of the untreated controls. Over the three day period both the irradiated and feed-matched groups lost a significant amount of body weight. The serum T{sub 4} levels of both the irradiated and feed-matched groups were not significantly differentmore » from each other, but were significantly depressed when compared to the untreated control group. The serum TSH and T{sub 3} were, however, significantly greater in the irradiated than the feed-matched groups at day 3 posttreatment. To determine if the difference in the serum TSH level between the two groups was due to a pretranslational alteration in TSH production, we measured the TSH-{beta} mRNA using an RNA blot hybridization assay. We found that the TSH-{beta} mRNA level was the same in the irradiated and feed-matched groups, suggesting that the mechanism responsible for the radiation-induced increase in the serum TSH level is posttranscriptional. Pituitary TSH content in the irradiated rats was significantly less than in pair-fed controls, suggesting that irradiation may permit enhanced secretion of stored hormone.« less

Use of recombinant human thyroid-stimulating hormone for thyrotropin stimulation test in healthy, hypothyroid and euthyroid sick dogs

PubMed Central

Daminet, Sylvie; Fifle, Lyanne; Paradis, Manon; Duchateau, Luc; Moreau, Maxim

2007-01-01

Recombinant human thyroid-stimulating hormone (rhTSH) was evaluated for the diagnosis of canine hypothyroidism, using TSH response tests. Phase I stimulation tests were performed in 6 healthy dogs weighing over 20 kg, using 50 and then 100 μg of freshly reconstituted rhTSH administered intravenously. In phase II, the same dogs were stimulated by using 100 μg of rhTSH frozen for 3 months at −20°C. Phase III stimulation tests were performed by using 50 or 100 μg of freshly reconstituted or frozen rhTSH in healthy (n = 14), euthyroid sick (n = 11) and hypothyroid dogs (n = 9). A dose of 100 μg of rhTSH was judged more appropriate for dogs weighing more than 20 kg. Biological activity of rhTSH after freezing at −20°C for up to 12 weeks was maintained. When stimulated, significant (P < 0.05) increases in total thyroxine concentration were observed only in healthy and euthyroid sick dogs. Results of this study show that the rhTSH stimulation test is able to differentiate euthyroidism from hypothyroidism in dogs. PMID:18189051

[Harmonization of TSH Measurements.

PubMed

Takeoka, Keiko; Hidaka, Yoh; Hishinuma, Akira; Ikeda, Katsuyoshi; Okubo, Shigeo; Tsuchiya, Tatsuyuki; Hashiguchi, Teruto; Furuta, Koh; Hotta, Taeko; Matsushita, Kazuyuki; Matsumoto, Hiroyuki; Murakami, Masami; Maekawa, Masato

2016-05-01

The measured concentration of thyroid stimulating hormone (TSH) differs depending on the reagents used. Harmonization of TSH is crucial because the decision limits are described in current clinical practice guide- lines as absolute values, e.g. 2.5 mIU/L in early pregnancy. In this study, we tried to harmonize the report- ed concentrations of TSH using the all-procedure trimmed mean. TSH was measured in 146 serum samples, with values ranging from 0.01 to 18.8 mIU/L, using 4 immunoassays. The concentration of TSH was highest with E test TOSOH and lowest with LUMIPULSE. The concentrations with each reagent were recalculated with the following formulas: E test TOSOH 0.855x-0.014; ECLusys 0.993x+0.079; ARCHITECT 1.041x- 0.010; and LUMIPULSE 1.096x-0.015. Recalculation eliminated the between-assay discrepancy. These formulas may be used until harmonization of TSH is achieved by the International Federation of Clinical Chemistry and Laboratory Medicine (IFCC).

Critical Hip Hop Pedagogy as a Form of Liberatory Praxis

ERIC Educational Resources Information Center

Akom, A. A.

2009-01-01

This article uses Paulo Freire's problem-posing method, youth participatory action research, and case study methodology to introduce an alternative instructional strategy called Critical Hip Hop Pedagogy (CHHP). This approach attempts to address deep-rooted ideologies to social inequities by creating a space in teacher education courses for…

Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.

PubMed

Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J

2006-04-01

A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and knee flexion and generated powers for the knee and ankle joints during take-off, and less hip joint moments during landing under fatigued conditions. The large negative power values observed at the knee joint during the landing phase of the single-leg hop, during which the quadriceps muscle activates eccentrically, indicate that not only hop distance but also the ability to perform successful landings should be investigated when assessing dynamic knee function.

Thyroid Function Tests

MedlinePlus

... problem that is directly affecting the thyroid (primary hypothyroidism). The opposite situation, in which the TSH level ... making enough TSH to stimulate the thyroid (secondary hypothyroidism). In most healthy individuals, a normal TSH value ...

Assessment of thyroid function in dogs with low plasma thyroxine concentration.

PubMed

Diaz Espineira, M M; Mol, J A; Peeters, M E; Pollak, Y W E A; Iversen, L; van Dijk, J E; Rijnberk, A; Kooistra, H S

2007-01-01

Differentiation between hypothyroidism and nonthyroidal illness in dogs poses specific problems, because plasma total thyroxine (TT4) concentrations are often low in nonthyroidal illness, and plasma thyroid stimulating hormone (TSH) concentrations are frequently not high in primary hypothyroidism. The serum concentrations of the common basal biochemical variables (TT4, freeT4 [fT4], and TSH) overlap between dogs with hypothyroidism and dogs with nonthyroidal illness, but, with stimulation tests and quantitative measurement of thyroidal 99mTcO4(-) uptake, differentiation will be possible. In 30 dogs with low plasma TT4 concentration, the final diagnosis was based upon histopathologic examination of thyroid tissue obtained by biopsy. Fourteen dogs had primary hypothyroidism, and 13 dogs had nonthyroidal illness. Two dogs had secondary hypothyroidism, and 1 dog had metastatic thyroid cancer. The diagnostic value was assessed for (1) plasma concentrations of TT4, fT4, and TSH; (2) TSH-stimulation test; (3) plasma TSH concentration after stimulation with TSH-releasing hormone (TRH); (4) occurrence of thyroglobulin antibodies (TgAbs); and (5) thyroidal 99mTcO4(-) uptake. Plasma concentrations of TT4, fT4, TSH, and the hormone pairs TT4/TSH and fT4/TSH overlapped in the 2 groups, whereas, with TgAbs, there was 1 false-negative result. Results of the TSH- and TRH-stimulation tests did not meet earlier established diagnostic criteria, overlapped, or both. With a quantitative measurement of thyroidal 99mTcO4(-) uptake, there was no overlap between dogs with primary hypothyroidism and dogs with nonthyroidal illness. The results of this study confirm earlier observations that, in dogs, accurate biochemical diagnosis of primary hypothyroidism poses specific problems. Previous studies, in which the TSH-stimulation test was used as the "gold standard" for the diagnosis of hypothyroidism may have suffered from misclassification. Quantitative measurement of thyroidal 99mTcO- uptake has the highest discriminatory power with regard to the differentiation between primary hypothyroidism and nonthyroidal illness.

Development of gestation-specific reference intervals for thyroid hormones in normal pregnant Northeast Chinese women: What is the rational division of gestation stages for establishing reference intervals for pregnancy women?

PubMed

Liu, Jianhua; Yu, Xiaojun; Xia, Meng; Cai, Hong; Cheng, Guixue; Wu, Lina; Li, Qiang; Zhang, Ying; Sheng, Mengyuan; Liu, Yong; Qin, Xiaosong

2017-04-01

A laboratory- and region-specific trimester-related reference interval for thyroid hormone assessment of pregnant women was recommended. Whether the division by trimester is suitable requires verification. Here, we tried to establish appropriate reference intervals of thyroid-related hormones and antibodies for normal pregnant women in Northeast China. A total of 947 pregnant women who underwent routine prenatal care were grouped via two methods. The first method entailed division by trimester: stages T1, T2, and T3. The second method entailed dividing T1, T2, and T3 stages into two stages each: T1-1, T1-2, T2-1, T2-2, T3-1, and T3-2. Serum levels of TSH, FT3, FT4, Anti-TPO, and Anti-TG were measured by three detection systems. No significant differences were found in TSH values between T1-1 group and the non-pregnant women group. However, the TSH value of the T1-1 group was significantly higher than that of T1-2 group (P<0.05). The TSH values in stage T3-2 increased significantly compared to those in stage T3-1 measured by three different assays (P<0.05). FT4 and FT3 values decreased significantly in the T2-1 and T2-2 stages compared to the previous stage (P<0.05). The serum levels of Anti-TPO and Anti-TG were not having significant differences between the six stages. The diagnosis and treatment of thyroid dysfunction during pregnancy should base on pregnancy- and method-specific reference intervals. More detailed staging is required to assess the thyroid function of pregnant women before 20 gestational weeks. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

How sensitive (second-generation) thyroglobulin measurement is changing paradigms for monitoring patients with differentiated thyroid cancer, in the absence or presence of thyroglobulin autoantibodies

PubMed Central

Spencer, Carole; LoPresti, Jonathan; Fatemi, Shireen

2014-01-01

Purpose of review To discuss new insights regarding how sensitive (second-generation) thyroglobulin immunometric assays (Tg2GIMAs), (functional sensitivities ≤0.10 μg/L) necessitate different approaches for postoperative thyroglobulin monitoring of patients with differentiated thyroid cancer (DTC), depending on the presence of thyroglobulin autoantibodies (TgAbs). Recent findings Reliable low-range serum thyroglobulin measurement has both enhanced clinical utility and economic advantages, provided TgAb is absent (∼75% DTC patients). Basal [nonthyroid-stimulating hormone (TSH) stimulated] Tg2GIMA measurement obviates the need for recombinant human TSH stimulation because basal Tg2GIMA below 0.20 μg/L has comparable negative predictive value (>95%) to recombinant human TSH-stimulated thyroglobulin values below the cutoff of 2 μg/L. Now that radioiodine remnant ablation is no longer considered necessary to treat low-risk DTC, the trend and doubling time of low basal thyroglobulin values arising from postsurgical thyroid remnants have recognized prognostic significance. The major limitation of Tg2GIMA testing is interference by TgAb (∼25% DTC patients), causing Tg2GIMA underestimation that can mask disease. When TgAb is present, the trend in TgAb concentrations (measured by the same method) can serve as the primary (surrogate) tumor-marker and be augmented by thyroglobulin measured by a TgAb-resistant class of method (radioimmunoassay or liquid chromatography-tandem mass spectrometry). Summary The growing use of Tg2GIMA measurement is changing paradigms for postoperative DTC monitoring. When TgAb is absent, it is optimal to monitor the basal Tg2GIMA trend and doubling time (using the same method) in preference to recombinant human TSH-stimulated thyroglobulin testing. When TgAb is present, interference renders Tg2GIMA testing unreliable and the trend in serum TgAb concentrations per se (same method) can serve as a (surrogate) tumor-marker. PMID:25122493

Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes

PubMed Central

Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

2017-01-01

Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types. Conclusion: The single-leg hop tests and isokinetic strength measurements were both useful for a bilateral comparison of knee functional performance and strength. Knee flexion strength deficits and flexion-to-extension ratios seemed to be correlated with single-leg hop test performance. There was no difference in postoperative hop test performance or knee strength according to graft type. PMID:29164167

CO-occurring exposure to perchlorate, nitrate and thiocyanate alters thyroid function in healthy pregnant women

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horton, Megan K., E-mail: megan.horton@mssm.edu; Blount, Benjamin C.; Valentin-Blasini, Liza

Background: Adequate maternal thyroid function during pregnancy is necessary for normal fetal brain development, making pregnancy a critical window of vulnerability to thyroid disrupting insults. Sodium/iodide symporter (NIS) inhibitors, namely perchlorate, nitrate, and thiocyanate, have been shown individually to competitively inhibit uptake of iodine by the thyroid. Several epidemiologic studies examined the association between these individual exposures and thyroid function. Few studies have examined the effect of this chemical mixture on thyroid function during pregnancy Objectives: We examined the cross sectional association between urinary perchlorate, thiocyanate and nitrate concentrations and thyroid function among healthy pregnant women living in New Yorkmore » City using weighted quantile sum (WQS) regression. Methods: We measured thyroid stimulating hormone (TSH) and free thyroxine (FreeT4) in blood samples; perchlorate, thiocyanate, nitrate and iodide in urine samples collected from 284 pregnant women at 12 (±2.8) weeks gestation. We examined associations between urinary analyte concentrations and TSH or FreeT4 using linear regression or WQS adjusting for gestational age, urinary iodide and creatinine. Results: Individual analyte concentrations in urine were significantly correlated (Spearman's r 0.4–0.5, p<0.001). Linear regression analyses did not suggest associations between individual concentrations and thyroid function. The WQS revealed a significant positive association between the weighted sum of urinary concentrations of the three analytes and increased TSH. Perchlorate had the largest weight in the index, indicating the largest contribution to the WQS. Conclusions: Co-exposure to perchlorate, nitrate and thiocyanate may alter maternal thyroid function, specifically TSH, during pregnancy. - Highlights: • Perchlorate, nitrate, thiocyanate and iodide measured in maternal urine. • Thyroid function (TSH and Free T4) measured in maternal blood. • Weighted quantile sum (WQS) regression examined complex mixture effect. • WQS identified an inverse association between the exposure mixture and maternal TSH. • Perchlorate indicated as the ‘bad actor’ of the mixture.« less

Reference Values for TSH and Free Thyroid Hormones in Healthy Pregnant Women in Poland: A Prospective, Multicenter Study.

PubMed

Kostecka-Matyja, Marta; Fedorowicz, Anna; Bar-Andziak, Ewa; Bednarczuk, Tomasz; Buziak-Bereza, Monika; Dumnicka, Paulina; Górska, Maria; Krasnodębska, Małgorzata; Niedźwiedzka, Beata; Pach, Dorota; Ruchała, Marek; Siewko, Katarzyna; Solnica, Bogdan; Sowiński, Jerzy; Szelachowska, Małgorzata; Trofimiuk-Müldner, Małgorzata; Wachowiak-Ochmańska, Katarzyna; Hubalewska-Dydejczyk, Alicja

2017-04-01

The diagnosis and treatment of thyroid diseases in pregnant women remains a challenge. Various medical associations recommend establishing the reference intervals for thyroid hormones by a local laboratory. Considering differences within geophysical, socioeconomic conditions, and iodine prophylaxis in various populations, it is advisable to assess reference intervals for thyroid hormones specific to a region of residence. The objective was to assess trimester-specific reference intervals for TSH, fT 3 , and fT 4 for pregnant women in the Polish population. We conducted a prospective study in 4 centers representing different regions of Poland (Krakow, Warsaw, Poznan, and Bialystok). Our study included consecutive, healthy pregnant women (172 patients), with an age range of 27-47 years. All women had a negative history for thyroid diseases, normal thyroid peroxidase antibody levels, and proper iodine prophylaxis. All newborns had TSH levels in the appropriate reference range. Serum TSH, fT 3 , fT 4 , and thyroid-peroxidase antibodies were measured in each trimester. The reference intervals were calculated using the percentile method, as recommended by the International Federation of Clinical Chemistry. The reference values calculated were 0.009-3.177, 0.05-3.442, and 0.11-3.53 mIU/L for TSH; 3.63-6.55, 3.29-5.45, and 3.1-5.37 pmol/L for fT 3 ; and 11.99-21.89, 10.46-16.67, and 8.96-17.23 pmol/L for fT 4 in consecutive trimesters of pregnancy. Reference intervals for pregnant women when compared to the general population showed a lower concentration of TSH in every trimester of pregnancy and lower fT 4 in the 2nd and 3rd trimesters. Using appropriate trimester-specific reference intervals may improve care of pregnant women by preventing misdiagnosis and inadequate treatment.

Higher Incidence Rates of Hypothyroidism and Late TSH Rise in Preterm Very-Low-Birth-Weight Infants at a Tertiary Care Center.

PubMed

Tfayli, Hala; Charafeddine, Lama; Tamim, Hani; Saade, Joanne; Daher, Rose T; Yunis, Khalid

2018-04-11

Preterm newborns with a very low birth weight (VLBW) of < 1,500 g have an atypical form of hypothyroidism with a delayed rise in TSH, necessitating a second newborn screening specimen collection. The aims of this study were to survey the compliance with second newborn screening to detect delayed TSH rise in VLBW preterm infants at a tertiary care center, and to determine the rate of atypical hypothyroidism. Retrospective review of the records of 104 preterm VLBW infants. Late TSH rise was defined as an increase in TSH concentration after 14 days of age in the presence of a normal initial screen. The compliance rate was 92% for the second screening. High rates of hypothyroidism (16.3%) and of late TSH rise (4.8%) were detected. Patients with hypothyroidism had a significantly lower birth weight (p = 0.01) and longer hospital stay (p = 0.004). Patients with late versus those with early TSH rise had a significantly lower mean birth weight (851 ± 302 vs. 1,191 ± 121 g, p = 0.004). The rates of early and late TSH rise in this VLBW population were higher than those in the literature and could be due to the use of povidone-iodine disinfectants. The yield of a second TSH screening in this study was high indicating the need for vigilance in screening VLBW preterm infants. © 2018 S. Karger AG, Basel.

CD34− Orbital Fibroblasts From Patients With Thyroid-Associated Ophthalmopathy Modulate TNF-α Expression in CD34+ Fibroblasts and Fibrocytes

PubMed Central

Lu, Yan; Atkins, Stephen J.; Fernando, Roshini; Trierweiler, Aaron; Mester, Tünde; Grisolia, Ana Beatriz Diniz; Mou, Pei; Novaes, Priscila; Smith, Terry J.

2018-01-01

Purpose Orbital fibroblasts from patients with Graves' disease (GD-OF) express many different cytokines when treated with bovine thyrotropin (bTSH). The present study aimed to determine why TNF-α cannot be induced by bTSH in GD-OF. Methods Fibrocytes and GD-OFs were cultivated from donors who were patients in a busy academic medical center practice. Real-time PCR, Western blot analysis, reporter gene assays, cell transfections, mRNA stability assays, ELISA, and flow cytometry were performed. Results We found that bTSH induces TNF-α dramatically in fibrocytes but is undetectable in GD-OF. The induction in fibrocytes is a consequence of increased TNF-α gene promoter activity and is independent of ongoing protein synthesis. It could be attenuated by dexamethasone and the IGF-1 receptor inhibiting antibody, teprotumumab. When separated into pure CD34+ OF and CD34− OF subsets, TNF-α mRNA became highly inducible by bTSH in CD34+ OF but remained undetectable in CD34− OF. Conditioned medium from CD34− OF inhibited induction of TNF-α in fibrocytes. Conclusions Our data indicate that CD34− OF appear to release a soluble(s) factor that downregulates expression and induction by bTSH of TNF-α in fibrocytes and their derivative CD34+ OF. We proffer that CD34− OF produce an unidentified modulatory factor that attenuates TNF-α expression in GD-OF and may do so in the TAO orbit. PMID:29847668

Colchicum autumnale in Patients with Goitre with Euthyroidism or Mild Hyperthyroidism: Indications for a Therapeutic Regulative Effect—Results of an Observational Study

PubMed Central

Scheffer, Christian; Debus, Marion; Heckmann, Christian; Cysarz, Dirk; Girke, Matthias

2016-01-01

Introduction. Goitre with euthyroid function or with subclinical or mild hyperthyroidism due to thyroid autonomy is common. In anthroposophic medicine various thyroid disorders are treated with Colchicum autumnale (CAU). We examined the effects of CAU in patients with goitre of both functional states. Patients and methods. In an observational study, 24 patients with goitre having suppressed thyroid stimulating hormone (TSH) levels with normal or slightly elevated free thyroxine (fT4) and free triiodothyronine (fT3) (group 1, n = 12) or normal TSH, fT3, and fT4 (group 2, n = 12) were included. After 3 months and after 6 to 12 months of CAU treatment, we investigated clinical pathology using the Hyperthyroid Symptom Scale (HSS), hormone status (TSH, fT4, and fT3), and thyroidal volume (tV). Results. After treatment with CAU, in group 1 the median HSS decreased from 4.5 (2.3–11.8) to 2 (1.3–3) (p < 0.01) and fT3 decreased from 3.85 (3.5–4.78) to 3.45 (3.3–3.78) pg/mL (p < 0.05). In group 2 tV (13.9% (18.5%–6.1%)) and TSH (p < 0.01) were reduced. Linear regression for TSH and fT3 in both groups indicated a regulative therapeutic effect of CAU. Conclusions. CAU positively changed the clinical pathology of subclinical hyperthyroidism and thyroidal volume in patients with euthyroid goitre by normalization of the regulation of thyroidal hormones. PMID:26955394

Colchicum autumnale in Patients with Goitre with Euthyroidism or Mild Hyperthyroidism: Indications for a Therapeutic Regulative Effect-Results of an Observational Study.

PubMed

Scheffer, Christian; Debus, Marion; Heckmann, Christian; Cysarz, Dirk; Girke, Matthias

2016-01-01

Introduction. Goitre with euthyroid function or with subclinical or mild hyperthyroidism due to thyroid autonomy is common. In anthroposophic medicine various thyroid disorders are treated with Colchicum autumnale (CAU). We examined the effects of CAU in patients with goitre of both functional states. Patients and methods. In an observational study, 24 patients with goitre having suppressed thyroid stimulating hormone (TSH) levels with normal or slightly elevated free thyroxine (fT4) and free triiodothyronine (fT3) (group 1, n = 12) or normal TSH, fT3, and fT4 (group 2, n = 12) were included. After 3 months and after 6 to 12 months of CAU treatment, we investigated clinical pathology using the Hyperthyroid Symptom Scale (HSS), hormone status (TSH, fT4, and fT3), and thyroidal volume (tV). Results. After treatment with CAU, in group 1 the median HSS decreased from 4.5 (2.3-11.8) to 2 (1.3-3) (p < 0.01) and fT3 decreased from 3.85 (3.5-4.78) to 3.45 (3.3-3.78) pg/mL (p < 0.05). In group 2 tV (13.9% (18.5%-6.1%)) and TSH (p < 0.01) were reduced. Linear regression for TSH and fT3 in both groups indicated a regulative therapeutic effect of CAU. Conclusions. CAU positively changed the clinical pathology of subclinical hyperthyroidism and thyroidal volume in patients with euthyroid goitre by normalization of the regulation of thyroidal hormones.

A functional thyrotropin- and growth hormone-secreting pituitary adenoma with a ultrastructurally monomorphic feature: a case study.

PubMed

Ozawa, Y; Kameya, T; Kasuga, A; Naritaka, H; Kanda, N; Maruyama, H; Saruta, T

1998-04-01

A 38-yr-old female with a TSH- and GH-secreting pituitary adenoma is described, who had both overt symptoms, hyperthyroidism and acromegaly. Her serum TSH was not suppressed despite high concentrations of free T3 and free T4, and her alpha-subunit/TSH molar ratio was high. Her serum GH was consistently high, and was not suppressed by an oral glucose tolerance test. Preoperative testing revealed that, although the TSH response was impaired, TSH, alpha-subunit and GH were increased by TRH injection, and that these hormones were reduced by bromocriptine or somatostatin analog. Although she did not have hyperprolactinemia, the in vitro culture and immunohistochemical studies revealed that the adenoma cells produced and released PRL, in addition to TSH, alpha-subunit and GH. Immunohistochemical studies showed the presence of GH in the cytoplasm of many adenoma cells. TSH beta-positive adenoma cells were less frequently seen than GH-positive adenoma cells. No cells showed the coexistence of GH and TSH beta, and a few cells were positive for PRL. By electron microscopy, the adenoma was found to be composed of a single cell type resembling thyrotrophs, and did not have any characteristics of somatotrophs. This case was considered to be of interest, because the adenoma was ultrastructurally monomorphous, but immunohistochemically polymorphous.

WOMEN IN CANCER THEMATIC REVIEW: Thyroid-stimulating hormone in thyroid cancer: does it matter?

PubMed

Nieto, Hannah; Boelaert, Kristien

2016-11-01

Differentiated thyroid cancer is the most common endocrine malignancy and the incidence is increasing rapidly worldwide. Appropriate diagnosis and post-treatment monitoring of patients with thyroid tumours are critical. Fine needle aspiration cytology remains the gold standard for diagnosing thyroid cancer, and although there have been significant refinements to this technique, diagnostic surgery is often required for patients suspected to have malignancy. Serum thyroid-stimulating hormone (TSH) is higher in patients with malignant thyroid nodules than in those with benign disease, and TSH is proportionally increased in more aggressive tumours. Importantly, we have shown that the pre-operative serum TSH concentration independently predicts the presence of malignancy in subjects presenting with thyroid nodules. Establishing the use of TSH measurements in algorithms identifying high-risk thyroid nodules in routine clinical practice represents an exciting, cost-efficient and non-invasive approach to optimise thyroid cancer diagnosis. Binding of TSH to receptors on thyrocytes stimulates a number of growth promoting pathways both in normal and malignant thyroid cells, and TSH suppression with high doses of levothyroxine is routinely used after thyroidectomy to prevent cancer recurrence, especially in high-risk tumours. This review examines the relationship between serum TSH and thyroid cancer and reflects on the clinical potential of TSH measurements in diagnosis and disease monitoring. © 2016 Society for Endocrinology.

Chronic subdural haematoma evolving from traumatic subdural hydroma.

PubMed

Wang, Yaodong; Wang, Chuanwei; Liu, Yuguang

2015-01-01

This study aimed to investigate the incidence and clinical characteristics of chronic subdural haematoma (CSDH) evolving from traumatic subdual hydroma (TSH). The clinical characteristics of 44 patients with CSDH evolving from TSH were analysed retrospectively and the relevant literature was reviewed. In 22.6% of patients, TSH evolved into CSDH. The time required for this evolution was 14-100 days after injury. All patients were cured with haematoma drainage. TSH is one possible origin of CSDH. The clinical characteristics of TSH evolving into CSDH include polarization of patient age and chronic small effusion. The injuries usually occur during deceleration and are accompanied by mild cerebral damage.

Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

PubMed

Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

2015-03-01

The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation. Antimicrobial hop extracts could be used as natural preservatives in food applications to extend the shelf life and to increase the safety of fresh products. © 2014 The Society for Applied Microbiology.

Multiple Signal Classification for Determining Direction of Arrival of Frequency Hopping Spread Spectrum Signals

DTIC Science & Technology

2014-03-27

42 4.2.3 Number of Hops Hs . . . . . . . . . . . . . . . . . . . . . . . . . 45 4.2.4 Number of Sensors M... 45 4.5 Standard deviation vs. Ns. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46 4.6 Bias...laboratory MTM multiple taper method MUSIC multiple signal classification MVDR minimum variance distortionless reposnse PSK phase shift keying QAM

Ultrasonic Multiple-Access Ranging System Using Spread Spectrum and MEMS Technology for Indoor Localization

PubMed Central

Segers, Laurent; Tiete, Jelmer; Braeken, An; Touhafi, Abdellah

2014-01-01

Indoor localization of persons and objects poses a great engineering challenge. Previously developed localization systems demonstrate the use of wideband techniques in ultrasound ranging systems. Direct sequence and frequency hopping spread spectrum ultrasound signals have been proven to achieve a high level of accuracy. A novel ranging method using the frequency hopping spread spectrum with finite impulse response filtering will be investigated and compared against the direct sequence spread spectrum. In the first setup, distances are estimated in a single-access environment, while in the second setup, two senders and one receiver are used. During the experiments, the micro-electromechanical systems are used as ultrasonic sensors, while the senders were implemented using field programmable gate arrays. Results show that in a single-access environment, the direct sequence spread spectrum method offers slightly better accuracy and precision performance compared to the frequency hopping spread spectrum. When two senders are used, measurements point out that the frequency hopping spread spectrum is more robust to near-far effects than the direct sequence spread spectrum. PMID:24553084

Genetic confirmation for a central role for TNFα in the direct action of thyroid stimulating hormone on the skeleton

PubMed Central

Sun, Li; Zhu, Ling-Ling; Lu, Ping; Yuen, Tony; Li, Jianhua; Ma, Risheng; Baliram, Ramkumarie; Moonga, Surinder S.; Liu, Peng; Zallone, Alberta; New, Maria I.; Davies, Terry F.; Zaidi, Mone

2013-01-01

Clinical data showing correlations between low thyroid-stimulating hormone (TSH) levels and high bone turnover markers, low bone mineral density, and an increased risk of osteoporosis-related fractures are buttressed by mouse genetic and pharmacological studies identifying a direct action of TSH on the skeleton. Here we show that the skeletal actions of TSH deficiency are mediated, in part, through TNFα. Compound mouse mutants generated by genetically deleting the Tnfα gene on a Tshr−/− (homozygote) or Tshr+/− (heterozygote) background resulted in full rescue of the osteoporosis, low bone formation, and hyperresorption that accompany TSH deficiency. Studies using ex vivo bone marrow cell cultures showed that TSH inhibits and stimulates TNFα production from macrophages and osteoblasts, respectively. TNFα, in turn, stimulates osteoclastogenesis but also enhances the production in bone marrow of a variant TSHβ. This locally produced TSH suppresses osteoclast formation in a negative feedback loop. We speculate that TNFα elevations due to low TSH signaling in human hyperthyroidism contribute to the bone loss that has traditionally been attributed solely to high thyroid hormone levels. PMID:23716650

cAMP dependent and independent regulation of thyroglobulin synthesis by two clones of the OVNIS 6H thyroid cell line.

PubMed

Aouani, A; Hovsépian, S; Fayet, G

1987-07-01

The hormonal regulation of thyroglobulin synthesis has been studied using two independent clones of the OVNIS 6H cell line. Insulin, hydrocortisone and TSH were able to stimulate thyroglobulin synthesis, whereas transferrin, somatostatin and glycyl-histidyl-lysine were without effect. Insulin stimulated thyroglobulin synthesis without affecting cAMP production. Hydrocortisone, when combined with insulin was a stimulator too; this stimulation was not accompanied by an increase in cAMP. TSH alone was unable to stimulate either cAMP or thyroglobulin synthesis. The stimulatory effect of TSH on thyroglobulin synthesis took place only when combined with insulin or insulin plus hydrocortisone, and was mediated by cAMP. Consequently, insulin and hydrocortisone stimulated thyroglobulin synthesis by cAMP-independent mechanisms, whereas TSH acted via the cAMP system. Forskolin mimicked TSH effects on cAMP and thyroglobulin synthesis. Calf serum inhibited cAMP and thyroglobulin production. Optimal cAMP and thyroglobulin synthesis as well as TSH responsiveness were obtained in serum-free medium supplemented with 5 micrograms/ml insulin, 100 nM hydrocortisone and 1 mU/ml TSH.

Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network

NASA Astrophysics Data System (ADS)

Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen

2018-06-01

We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.

Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network

NASA Astrophysics Data System (ADS)

Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen

2018-02-01

We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.

A case of methimazole-induced hypothyroidism in a patient with endemic goiter: effects of endogenous TSH hyperstimulation after discontinuation of the drug.

PubMed

Messina, M; Manieri, C; Spagnuolo, F; Sardi, E; Allegramente, L; Monaco, A; Ciccarelli, E

1989-04-01

Serum thyroid hormone and TSH concentrations were monitored in a patient with multinodular endemic goiter and severe methimazole (MMI) induced hypothyrodism up to 190 days after drug withdrawal. Serum concentrations of TT3, TT4 and TSH returned to normal values at the 6th., the 140th, and the 120th. day respectively. Within the first 20 days after MMI withdrawal the increase of serum T3 levels was correlated with the observed decrease of serum TSH concentrations. Successively T3 values decreased and T4 levels progressively increased. Six months after MMI withdrawal basal serum TSH concentration was normal while an exaggerated response to TRH was observed. We think that this peculiar hormone pattern is due to iodine depletion. In this case TSH hyperstimulation increases predominantly T3 secretion demonstrating the reduced thyroidal ability to produce T4 when hyperstimulated.

Termitarium-Inhabiting Bacillus spp. Enhanced Plant Growth and Bioactive Component in Turmeric (Curcuma longa L.).

PubMed

Chauhan, Ankit Kumar; Maheshwari, Dinesh Kumar; Dheeman, Shrivardhan; Bajpai, Vivek K

2017-02-01

Curcumin (diferuloyl methane) is the main bioactive component of turmeric (Curcuma longa L.) having remarkable multipotent medicinal and therapeutic applications. Two Bacilli isolated from termitarium soil and identified as Bacillus endophyticus TSH42 and Bacillus cereus TSH77 were used for bacterization of rhizome for raising C. longa ver. suguna for growth and enhancement. Both the strains showed remarkable PGP activities and also chemotactic in nature with high chemotactic index. Turmeric plants bacterized with strains B. endophyticus TSH42 and B. cereus TSH77 individually and in combination increased plant growth and turmeric production up to 18% in field trial in comparison to non-bacterized plants. High-performance liquid chromatography analysis was performed to determine the content of curcumin, which showed concentration of curcumin in un-inoculated turmeric as 3.66 g which increased by 13.6% (4.16 g) when combination of TSH42 and TSH77 was used.

Serum thyrotropin and thyroid hormone levels in elderly and middle-aged euthyroid persons.

PubMed

Hershman, J M; Pekary, A E; Berg, L; Solomon, D H; Sawin, C T

1993-08-01

To determine whether serum thyrotropin (TSH) levels are altered in euthyroid older persons compared with middle-aged adults. Serum TSH and thyroid hormone levels were measured in a large group of older persons (> 70 years old, n = 216) and their middle-aged offspring (40-60 years old, n = 211) after excluding those with clinical or historical evidence of thyroid disease or abnormal thyroid function. Serum TSH, thyroxine (T4), free T4 index, estimated free T4, triiodothyronine (T3), estimated free T3, and ferritin levels were measured on the Abbott IMx instrument. Peroxidase and thyroglobulin antibodies were measured by radioimmunoassay using Kronus kits. Overall, serum TSH showed a log-normal distribution. The geometric mean TSH (mU/L) and 95% confidence limits in the older persons, 1.24 (0.29-5.4), did not differ significantly from that in the middle-aged, 1.45 (0.54-3.9). The mean TSH in the 264 women, 1.37 (0.34-5.5), was similar to that of the 163 men, 1.30 (0.48-3.5). The mean TSH in older women, 1.21 (0.22-6.6), was slightly but significantly lower than that in middle-aged women, 1.52 (0.55-4.2). However, when euthyroid women with positive antibodies were excluded, this difference was not significant. Four of the 123 older women had TSH < 0.1 mU/L, but none of the men or middle-aged women had a suppressed serum TSH. The mean TSH in older men, 1.28 (0.43-3.8), was similar to that in middle-aged men, 1.32 (0.55-3.2). Free T4 was slightly higher in older women than middle-aged women. There were no significant correlations between TSH and any thyroid hormone level. Serum ferritin, measured as a potential marker for the action of thyroid hormone, did not correlate with any measure of thyroid function. At least one antibody level was > 10 U/mL in 14.6% of older women, 15.6% of middle-aged women, 4.3% of older men, and no middle-aged men. When those with milder elevations of antibody levels were included (at least one level > 1 U/mL), the prevalence was 32% of older women, 43.3% of middle-aged women, 15% of older men, and 11.4% of middle-aged men. Euthyroid older persons have about the same levels of serum TSH as younger ones, although older euthyroid women have a slightly lower serum TSH than middle-aged women. We recommend that the normal range of serum TSH in the elderly be considered to be the same as that in healthy middle-aged subjects.

A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications

PubMed Central

Fernández de Gorostiza, Erlantz; Mabe, Jon

2018-01-01

Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method. PMID:29473910

A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications.

PubMed

Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto

2018-02-23

Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.

DC electrical conductivity of Ag2O-TeO2-V2O5 glassy systems

NASA Astrophysics Data System (ADS)

Souri, D.; Tahan, Z. Esmaeili; Salehizadeh, S. A.

2016-04-01

In the present article, samples of xAg2O-40TeO2-(60 - x)V2O5 ternary tellurite glasses with 0 ≤ x ≤ 50 (in mol%) have been prepared using the melt-quenching technique. XRD analysis, density measurement by Archimedes' law, determination of reduced vanadium ions by titration method, and electrical conductivity measurement by using four-probe methods have been done for these glasses. The mixed electronic-ionic conduction of these glasses has been investigated over a wide temperature range of 150-380 K. The experimental results have been analyzed with different theoretical models of hopping conduction. The analysis shows that at high temperatures the conductivity data are consistent with Mott's model of phonon-assisted polaronic hopping, while Mott's variable-range hopping model and Greaves' hopping model are valid at low temperatures. The temperature dependence of the conductivity has been also interpreted in the framework of the percolation model proposed by Triberis and Friedman. The analysis of the conductivity data also indicates that the hopping in these tellurite glasses occurs in the non-adiabatic regime. In each sample, based upon the justified transport mechanism, carrier density and mobility have been determined at different temperatures. The values of oxygen molar volume indicate the effect of Ag2O concentration on the thermal stability or fragility of understudied samples.

Site-specific PEGylation of human thyroid stimulating hormone to prolong duration of action.

PubMed

Qiu, Huawei; Boudanova, Ekaterina; Park, Anna; Bird, Julie J; Honey, Denise M; Zarazinski, Christine; Greene, Ben; Kingsbury, Jonathan S; Boucher, Susan; Pollock, Julie; McPherson, John M; Pan, Clark Q

2013-03-20

Recombinant human thyroid stimulating hormone (rhTSH or Thyrogen) has been approved for thyroid cancer diagnostics and treatment under a multidose regimen due to its short circulating half-life. To reduce dosing frequency, PEGylation strategies were explored to increase the duration of action of rhTSH. Lysine and N-terminal PEGylation resulted in heterogeneous product profiles with 40% or lower reaction yields of monoPEGylated products. Eleven cysteine mutants were designed based on a structure model of the TSH-TSH receptor (TSHR) complex to create unique conjugation sites on both α and β subunits for site-specific conjugation. Sequential screening of mutant expression level, oligomerization tendency, and conjugation efficiency resulted in the identification of the αG22C rhTSH mutant for stable expression and scale-up PEGylation. The introduced cysteine in the αG22C rhTSH mutant was partially blocked when isolated from conditioned media and could only be effectively PEGylated after mild reduction with cysteine. This produced a higher reaction yield, ~85%, for the monoPEGylated product. Although the mutation had no effect on receptor binding, PEGylation of αG22C rhTSH led to a PEG size-dependent decrease in receptor binding. Nevertheless, the 40 kDa PEG αG22C rhTSH showed a prolonged duration of action compared to rhTSH in a rat pharmacodynamics model. Reverse-phase HPLC and N-terminal sequencing experiments confirmed site-specific modification at the engineered Cys 22 position on the α-subunit. This work is another demonstration of successful PEGylation of a cysteine-knot protein by an engineered cysteine mutation.

Prevalence of thyrotropin receptor germline mutations and clinical courses in 89 hyperthyroid patients with diffuse goiter and negative anti-thyrotropin receptor antibodies.

PubMed

Nishihara, Eijun; Fukata, Shuji; Hishinuma, Akira; Amino, Nobuyuki; Miyauchi, Akira

2014-05-01

We studied the frequency of thyrotropin (TSH) receptor mutations in hyperthyroid patients with diffuse goiter and negative TSH receptor antibodies (TRAb), and the clinical pictures of the hyperthyroid patients in the presence and absence of mutations. From 2003 through 2012, 89 hyperthyroid patients with diffuse goiter and negative TRAb based on a second- or third-generation assay underwent sequence analysis of the TSH receptor gene from peripheral leukocytes. The outcome of hyperthyroidism in patients with a TSH receptor mutation and their affected family members was compared with that in patients without any mutation after a 1-10-year follow-up. Germline mutations of the TSH receptor occurred in 4 of the 89 patients (4.5%), including 3 definitive constitutively activating mutations (L512Q, E575K, and D617Y). The main difference in the clinical outcome of hyperthyroidism was that no patients with a TSH receptor mutation achieved euthyroidism throughout the follow-up, while 23.5% of patients without any mutation entered remission. The progression from subclinical to overt hyperthyroidism was not significantly different between patients with or without a mutation. Meanwhile, 10.3% of TRAb-negative patients without any TSH receptor mutation developed TRAb-positive Graves' hyperthyroidism during the follow-up. The prevalence of nonautoimmune hyperthyroidism with TSH receptor mutations is lower than that of latent Graves' disease in TRAb-negative patients with hyperthyroidism. However, all affected patients with a TSH receptor mutation showed persistent hyperthyroidism regardless of subclinical or overt hyperthyroidism throughout the follow-up.

Evaluation of thyroid stimulating hormone (TSH) alone as a first-line thyroid function test (TFT) in Papua New Guinea.

PubMed

Kende, M; Kandapu, S

2002-01-01

In the Port Moresby General Hospital, the Chemical Pathology Department assays both thyroid stimulating hormone (TSH) and free thyroxine (FT4) on all requests for a thyroid function test (TFT). The cost of assaying both tests is obviously higher than either test alone. In order to minimize the cost of a TFT we aimed to determine if TSH or FT4 alone as a first-line test would be adequate in assessing the thyroid hormone status of patients. We analyzed TFT records from January 1996 to May 2000 in the Port Moresby General Hospital. A total of 3089 TSH and 2867 FT4 were assayed at an annual reagent cost of Papua New Guinea kina 14,500. When TSH alone is used as a first-line test at the Port Moresby General Hospital, the biochemical status of 95% of patients will be appropriately categorized as euthyroidism, hypothyroidism or hyperthyroidism with only 5% discrepant (ie, normal TSH with abnormal FT4) results. In contrast, using FT4 alone as a first-line test correctly classifies only 84% of TFTs. Euthyroid status is observed in 50% of patients and FT4 assays on these samples will be excluded appropriately if a TSH-only protocol is adopted. Furthermore, we will save a quarter of the yearly cost of TFTs on reagents alone by performing TSH only. We conclude that TSH alone is an adequate first-line thyroid function test in Papua New Guinea and when it is normal no further FT4 test is necessary unless clinically indicated.

Effect of maternal and neonatal factors on neonatal thyroid stimulating hormone: Results from a population-based prospective cohort study in China.

PubMed

Zhang, Yixin; Du, Cong; Wang, Wei; Chen, Wen; Shao, Ping; Wang, Chongdan; Leng, Junhong; Shen, Jun; Tan, Long; Zhang, Wanqi

2018-09-01

Neonatal TSH screening is effective in detecting congenital hypothyroidism and estimating iodine status in a given population, but various factors influence TSH levels. The aim of this study was to evaluate the effect of maternal and neonatal factors on neonatal TSH levels. Data were obtained from an ongoing prospective cohort study. A total of 988 pregnant women and their newborn infants participated in the study from April 2015 to May 2017 at Tianjin Maternal and Child Health Center and Tanggu Maternity Hospital in Tianjin, China. Maternal demographic information, including age, height, and parity, was recorded by questionnaire. Fasting blood and urinary samples were collected from all pregnant women. After parturition, information on gestation duration, mode of delivery, neonatal sex, neonatal TSH, neonatal birth weight, and neonatal birth height were recorded. Maternal age, maternal BMI, gestation duration, parity, and neonatal birth weight and height were significantly correlated with neonatal TSH (p < 0.05). Quantile regression revealed that maternal age, TSH, FT 4 , and gestation duration were positively correlated with neonatal TSH level. A logistic regression model identified maternal BMI, TSH, and birth height as risk factors for having neonatal TSH > 5 mIU/L (p < 0.05). Neonatal TSH levels are dynamic and may be affected by several maternal and neonatal factors including maternal age, TSH, FT 4 , and birth weight and height. Identification of these confounders is useful for assessing the status of neonatal thyroid development. STRENGTHS AND LIMITATIONS OF THIS STUDY: (1) Iodine deficiency disorder has generally been eliminated, so the median urinary iodine concentration of pregnancy is higher than 150 μg/L even in mildly or moderately iodine deficient areas. (2) Unlike many other studies, which did not consider the complexity of factors or examined only one or two variables, this study used a multivariate model to analyze the data. (3) This study examined numerous high-risk factors in pregnant women and considered the biological interrelation between them. Future studies should consider these confounding factors for neonatal TSH levels and establish a proper neonatal TSH range for monitoring the iodine status of a population or diagnosing congenital hypothyroidism. Copyright © 2018 Elsevier GmbH. All rights reserved.

Effect of lithosperm on thyroidal /sup 32/P uptake at various times of injection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breneman, W.R.; Zeller, F.J.

These experiments were performed to increase our understanding of possible side effects in the use of extracts of the plant Lithospermum ruderale (LSPM) as a contraceptive. Cold-water extracts of LSPM were used to note possible effects on injected TSH and on endogenous TSH which was increased by the use of propylthiouracil. It was demonstrated that LSPM had a biphasic effect on both endogenous and exogenous TSH activity as measured by chick thyroid /sup 32/P uptake. When given 18h before autopsy, LSPM decreased TSH activity in both, whereas when LSPM was administered 42h or 44h before autopsy, TSH activity was significantlymore » increased.« less

Comparative evaluation of therapy with L-thyroxine versus no treatment in children with idiopathic and mild subclinical hypothyroidism.

PubMed

Wasniewska, Malgorzata; Corrias, Andrea; Aversa, Tommaso; Valenzise, Mariella; Mussa, Alessandro; De Martino, Lucia; Lombardo, Fortunato; De Luca, Filippo; Salerno, Mariacarolina

2012-01-01

The question of whether children with subclinical hypothyroidism (SH) should be treated or not is controversial due to the lack of studies on outcomes of SH children treated with L-thyroxine (L-T(4)) versus those receiving no therapy. (a) To evaluate thyroid tests under L-T(4) and after therapy withdrawal in 69 SH children (group A) and (b) to compare our results with those recorded in 92 untreated children (group B). Group A children were treated for 24 months and TSH and FT(4) levels 3 months after therapy withdrawal were compared with those measured in group B at the end of follow-up in order to investigate treatment effects. The prevalence of children who had normalized TSH at the end of follow-up was higher in group A, but the prevalence of those who had normalized or maintained unchanged TSH was similar in the two groups, as was the prevalence of children who exhibited a TSH increase >10 mU/l. In group A, TSH values at 27 months were associated with baseline values. (a) Two-year treatment in SH children is unable to modify posttherapy outcome of hyperthyrotropinemia; (b) therapy is unable to prevent the risk of further TSH increase after treatment withdrawal, and (c) posttherapy TSH outcome is conditioned by baseline TSH. Copyright © 2012 S. Karger AG, Basel.

Long-term outcome after radioiodine therapy with adjuvant rhTSH treatment: comparison between patients with non-toxic and pre-toxic large multinodular goitre.

PubMed

Giusti, M; Caorsi, V; Mortara, L; Caputo, M; Monti, E; Schiavo, M; Bagnara, M C; Minuto, F; Bagnasco, M

2014-03-01

In multinodular goitre (MNG), low radioiodine (RAI) activity after recombinant human (rh) TSH is able to reduce thyroid volume (TV) and improve symptoms. Our aim was to evaluate the long-term outcome of RAI after rhTSH treatment in patients who were divided according to their baseline TSH levels. Eighteen patients (69.2 ± 6.1 year) presented non-toxic (TSH >0.3 mIU/l) MNG (TV: 61.0 ± 3.8 ml; group 1), while 13 patients (74.1 ± 7.9 year) had non-autoimmune pre-toxic (TSH <0.3 mIU/l) MNG (TV: 82.6 ± 14.4 ml; group 2). TSH, thyroid hormones, TV (by ultrasonography), body mass index (BMI), symptoms and quality of life (QoL) were evaluated. Treatment induced short-term thyrotoxicosis in both groups, but this was slightly more marked in group 2 than in group 1. The number and severity of adverse events were similar. The follow-up period was 55.3 ± 4.1 months in group 1 and 57.2 ± 5.1 months in group 2. The final TV reduction was similar in groups 1 (63.4 ± 3.6%) and 2 (57.2 ± 4.6%) and TV reduction positively correlated only with initial TV. At the last examination, 14 group-1 subjects were on L-T4 therapy, while 2 group-2 subjects were on methimazole. An increase in BMI was noted only in group 2. MNG-related symptoms were significantly reduced in both groups. Symptoms related to sub-clinical hyperthyroidism improved in group 2, while no significant changes in QoL were noted in either group. This study confirms the effectiveness of rhTSH adjuvant treatment in reducing TV after low RAI activities, irrespective of baseline thyroid status. TSH levels <0.3 mIU/l proved to be predictive of a more severe thyrotoxic phase after rhTSH and RAI, while initial TSH levels >0.3 mIU/l were more frequently followed by a need for L-T4 therapy. Compressive symptoms improved in the majority of subjects.

Rapid differentiation of citrus Hop stunt viroid variants by use of real-time RT-PCR and high resolution melting analysis

USDA-ARS?s Scientific Manuscript database

The RNA genome of Hop stunt viroid (HSVd) contains five to six nucleotides in a variable (V) domain, called the cachexia expression motif, which is associated with pathogenic and non-pathogenic variants in citrus. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological i...

The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers

NASA Astrophysics Data System (ADS)

Di, Bing; Wang, Ya-Dong; Zhang, Ya-Lin; An, Zhong

2013-06-01

The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons.

Elevated TSH in adults treated for hypothyroidism is associated with increased mortality.

PubMed

Akirov, Amit; Gimbel, Hannah; Grossman, Alon; Shochat, Tzipora; Shimon, Ilan

2017-01-01

Numerous studies investigated the link between hypothyroidism and mortality, but a definite conclusion is hard to reach as these were limited by a number of factors, including age of participants, comorbidities and single measurement of thyroid function. To evaluate the association between TSH and fT4 levels and mortality in patients with levothyroxine-treated hypothyroidism. Observational data of hospitalized patients (2011-2014). TSH and fT4 levels obtained between at least 30 days after discharge and until death or end of follow-up were collected. Median TSH and fT4 levels were stratified into categories. In total, 611 patients with treated hypothyroidism, aged 60-80 years (72% females, mean age 71 ± 6 years) were included in the study. All-cause mortality up to 66 months after discharge, by TSH and fT4 categories. During follow-up, the average numbers of TSH and fT4 measurements were 5.5 ± 3.8 and 2.5 ± 4.2 per patient respectively. Mortality rates were 28%, 29% and 54% with median TSH of 0.5-2.5, 2.5-5.0 and 5.0-10.0 IU/L respectively. Adjusted hazard ratios for mortality with median TSH between 5.0 and 10.0 IU/L were 2.3 (95% CI: 1.6-3.4) and 2.2 (95% CI: 1.6-3.2) compared with patients with TSH between 0.5-2.5 IU/L and 2.5-5 IU/L respectively. There was no difference in mortality between patients with median fT4 10-15 or 15-20 pmol/L. In treated hypothyroid adult patients and serial measurements of thyroid function tests, median TSH levels of 5-10 IU/L are associated with increased mortality with no effect of fT4 levels. Treatment should aim at achieving euthyroidism to improve survival. © 2017 European Society of Endocrinology.

Childhood obesity, thyroid function, and insulin resistance – is there a link? A longitudinal study.

PubMed

Santos, Maria Inês; Limbert, Catarina; Marques, Filipa Carlota; Rosário, Frederico; Lopes, Lurdes

2015-05-01

Serum thyroid stimulating hormone (TSH) levels are frequently elevated in obese children and are most likely to be associated with insulin resistance. However, clinical relevance of this association remains unclear. To assess the prevalence of hyperthyrotropinemia; to analyze the relationship between TSH and homeostasis model assessment - insulin resistance (HOMA-IR); and to verify whether TSH levels and HOMA-IR vary with weight loss in obese children. Retrospective longitudinal study with data from baseline and 1 year after lifestyle intervention in a pediatric obese group (344 children were recruited and 100 among them completed follow-up). For postintervention analysis, three groups were considered according to body mass index-standard deviation score (BMI-SDS) variations: ≤-0.5 (significant weight loss); 0.5-0 (weight loss); and >0 (weight gain). Statistical analysis was performed using SPSS 19.0®. The prevalence of increased TSH levels was 9.3%. At baseline TSH (p=0.007), fT4 (p=0.006), and HOMA-IR (p<0.001) were positively correlated to BMI-SDS (n=344). Weight reduction was verified in 67 out of 100 cases but significant loss was present in only 21 cases. Decreases in both TSH and BMI-SDS were independently associated with decreases in HOMA-IR (p=0.005 and p=0.016, respectively). There was no correlation between TSH and BMI-SDS variation. Significant decreases in the HOMA-IR (p=0.006) were only achieved in the significant weight loss group. The prevalence of hyperthyrotropinemia was lower than previously reported. However, cutoff values were adjusted to pubertal stage, suggesting an over report in other studies. Insulin resistance and TSH were positively correlated, independent of body status. Although weight loss was not associated with TSH variation, a decrease in TSH levels was independently associated with decreases in HOMA-IR.

Long-term treatment with bromocriptine of a plurihormonal pituitary adenoma secreting thyrotropin, growth hormone and prolactin.

PubMed

Shimatsu, A; Murabe, H; Nakamura, Y; Mizuta, H; Ihara, C; Nakao, K

1999-02-01

A 48-year-old female presented with acromegaly, amenorrhea and hyperthyroidism associated with high serum free T4 levels and measurable TSH concentrations. The administration of GHRH induced significant increases in GH, PRL and TSH. Conversely, intravenous infusion of dopamine or oral administration of bromocriptine effectively inhibited GH, PRL and TSH secretion. Serum alpha-subunit levels were neither affected by GHRH, dopamine nor bromocriptine. Transsphenoidal surgery was performed and immunostaining of the tissue showed that the adenoma cells were positive for GH, PRL or TSH. The patient was treated with bromocriptine at a daily oral dose of 10 mg after surgery. Serum TSH were initially suppressed but returned within reference intervals with persistent normalized free T4 levels. Serum PRL became undetectable and GH levels were stable around 6 ng/ml except the periods of poor drug compliance, when serum TSH, GH and PRL levels rose considerably. The patient was followed-up for 10 years without any change in the residual adenoma tissues as detected by magnetic resonance imaging. These findings suggest that long-term bromocriptine therapy is effective in treating the hypersecretory state of a plurihormonal adenoma secreting TSH, GH and PRL.

Thyrotoxicosis presenting as hypogonadism: a case of central hyperthyroidism.

PubMed

Childress, R Dale; Qureshi, M Nauman; Kasparova, Meri; Oktaei, Hooman; Williams-Cleaves, Beverly; Solomon, Solomon S

2004-11-01

Herein, we present a case of central thyrotoxicosis with well-documented serial therapeutic interventions. Thyroid-stimulating hormone (TSH)-secreting pituitary tumors represent a rare cause of hyperthyroidism. It is being diagnosed more frequently with the third-generation TSH assay. Many conditions can produce normal or elevated TSH levels in combination with elevated thyroid hormone levels. The differential diagnosis includes resistance to thyroid hormone (RTH, Refetoff's syndrome), assay interference from anti-T4/T3 and heterophile antibodies, elevated or altered binding proteins, drugs affecting peripheral metabolism, and noncompliance with thyroid replacement therapy. In contrast to RTH, our patient presented had high alpha-subunit-to-TSH molar ratio, failed TSH response to thyrotropin-releasing hormone stimulation, and a large pituitary mass. Normal or high TSH in the presence of elevated T4 or T3 is a fairly common clinical scenario with many etiologic possibilities. This TSH-producing adenoma represents an unusual initial clinical presentation, as hypogonadism appeared before features of thyrotoxicosis were appreciated. This case represents the most modern therapeutic approach to the management of this rare disease. Our patient has done well on octreotide with control of thyrotoxicosis and an additional 30% shrinkage of his tumor mass.

Familial Dysalbuminemic Hyperthyroxinemia in a Japanese Man Caused by a Point Albumin Gene Mutation (R218P)

PubMed Central

Osaki, Yoshinori; Hayashi, Yoshitaka; Nakagawa, Yoshinori; Yoshida, Katsumi; Ozaki, Hiroshi; Fukazawa, Hiroshi

2016-01-01

Familial dysalbuminemic hyperthyroxinemia (FDH) is a familial autosomal dominant disease caused by mutation in the albumin gene that produces a condition of euthyroid hyperthyroxinemia. In patients with FDH, serum-free thyroxine (FT4) and free triiodothyronine (FT3) concentrations as measured by several commercial methods are often falsely increased with normal thyrotropin (TSH). Therefore, several diagnostic steps are needed to differentiate TSH-secreting tumor or generalized resistance to thyroid hormone from FDH. We herein report a case of a Japanese man born in Aomori prefecture, with FDH caused by a mutant albumin gene (R218P). We found that a large number of FDH patients reported in Japan to date might have been born in Aomori prefecture and have shown the R218P mutation. In conclusion, FDH needs to be considered among the differential diagnoses in Japanese patients born in Aomori prefecture and showing normal TSH levels and elevated FT4 levels. PMID:27081329

Associations Among Quadriceps Strength and Rate of Torque Development 6 Weeks Post Anterior Cruciate Ligament Reconstruction and Future Hop and Vertical Jump Performance: A Prospective Cohort Study.

PubMed

Pua, Yong-Hao; Mentiplay, Benjamin F; Clark, Ross A; Ho, Jia-Ying

2017-11-01

Study Design Prospective cohort. Background Quadriceps strength is associated with hop distance and jump height in persons who have undergone anterior cruciate ligament (ACL) reconstruction. However, it is unknown whether the ability to rapidly generate quadriceps torque in the early phase of recovery is associated with future hopping and jumping performance in this population. Objective To evaluate the prospective associations among quadriceps strength and rate of torque development (RTD) and single-leg hop for distance, vertical jump height, vertical ground reaction force (vGRF), and vertical force loading rate during a landing task in persons who have undergone ACL reconstruction. Methods Seventy patients with unilateral ACL reconstruction participated. At 6 weeks post ACL reconstruction, isometric quadriceps strength and RTD were measured using a dynamometer. At 6 months following ACL reconstruction, patients performed the single-leg hop for distance test. Patients also performed the single-leg vertical jump test on a force plate that measured maximum jump height, vGRF, and average loading rate during landing. Results Both quadriceps strength and RTD at 6 weeks post ACL reconstruction were associated with all hopping and jumping measures at 6 months post ACL reconstruction (P≤.04). Single-leg hop distance was associated more closely with quadriceps strength than with quadriceps RTD (P = .05), and vertical jump height and vGRF measures were associated more closely with quadriceps RTD than with quadriceps strength (P = .05 and P<.01, respectively). Both quadriceps measures were associated with loading rate. Conclusion Quadriceps strength and RTD are complementary but distinct predictors of future hopping and jumping performance in persons who have undergone ACL reconstruction. These findings may contribute to improved rehabilitation of patients who are at risk for poor jumping/hopping performance and abnormal knee loading. J Orthop Sports Phys Ther 2017;47(11):845-852. Epub 13 Oct 2017. doi:10.2519/jospt.2017.7133.

Characterization of thyroid function and antithyroid antibody tests among Saudis

PubMed Central

Jammah, Anwar A.; Alshehri, Anwar S.; Alrakhis, Afaf A.; Alhedaithy, Asma S.; Almadhi, Asma M.; Alkwai, Hala M.; Alhamad, Maram M.; Alzahrani, Saad H.

2015-01-01

Objective: To determine the reference intervals for thyroid function tests and the prevalence of thyroid autoimmunity in the Saudi population. Methods: A cross-sectional prospective study was conducted in King Khalid University Hospital, Riyadh, Saudi Arabia from January to June 2013. History and physical examination were obtained. Thyroid-stimulating hormone (TSH), free thyroxine (FT4), and free triiodothyronine (FT3) were measured by Electro-chemiluminescence Immunoassay system-assay. Anti-thyroperoxidase, and anti-thyroglobulin antibodies were measured using enzyme-linked immunosorbent-assay. Subjects with previous or a family history of thyroid disorders, those taking medications affecting thyroid function, pregnant or lactating women, and those with goiter were excluded. Individuals with positive antibodies were excluded from the final analysis of the TSH reference range, but were used to determine the prevalence of thyroid autoimmunity. Results: Out of 337 Saudi subjects initially screened, 132 (aged 13-60 years) were candidates for reference calculation, the mean±standard deviation, and (2.5th-97.5th) percentile of TSH (mIU/L) was 1.96±0.9 (0.59-4.37), for FT4 (pmol/L) was 15.47±1.83 (12.04-19.13), and for FT3 (pmol/L) was 5.22±0.7 (4.07-6.76). The TSH was higher in the antibodies positive group (2.5±1.17 mIU/L) compared with the negative one (1.96±0.9 mIU/L) (p<0.05). Finally, 26% of subjects were tested positive for antithyroid antibodies. Conclusion: The TSH reference range was similar to laboratory references. Thyroid antibodies were prevalent in Saudis, necessitating further work in larger scale studies. PMID:25987111

Correlation of degree of hypothyroidism with survival outcomes in patients with metastatic renal cell carcinoma receiving vascular endothelial growth factor receptor tyrosine kinase inhibitors.

PubMed

Bailey, Erin B; Tantravahi, Srinivas K; Poole, Austin; Agarwal, Archana M; Straubhar, Alli M; Batten, Julia A; Patel, Shiven B; Wells, Chesley E; Stenehjem, David D; Agarwal, Neeraj

2015-06-01

Hypothyroidism is a common adverse effect of vascular endothelial growth factor receptor tyrosine kinase inhibitor (VEGFR-TKI) therapy in patients with metastatic renal cell carcinoma (mRCC). Some studies have shown an association with improved survival. However, hypothyroidism severity has not been correlated with survival outcomes. We report the incidence and severity of VEGFR-TKI therapy-associated hypothyroidism in correlation with the survival outcomes of patients with mRCC. A retrospective analysis of patients with mRCC who received VEGFR-TKIs (2004 through 2013) was conducted from a single institutional database. Hypothyroidism, progression-free survival (PFS), and overall survival (OS) were assessed. Univariate and multivariate analyses were performed using the Kaplan-Meier method and Cox proportional hazard models. Of 125 patients with mRCC, 65 were eligible. Their median age was 59 years (range, 45-79 years), and 46 (70.8%) were male. Hypothyroidism occurred in 25 patients (38.5%), of whom 13 had a peak thyroid-stimulating hormone (TSH) level > 10 mIU/L during treatment. The median OS was significantly longer in patients with a peak TSH > 10 mIU/L than in patients with a peak TSH of ≤ 10 mIU/L (not reached vs. 21.4 months, P = .005). On multivariate analysis, risk criteria, number of previous therapies, and severe hypothyroidism (TSH > 10 mIU/L) during VEGFR-TKI therapy remained significant for improvements in PFS and OS. The severity of VEGFR-TKI therapy-associated hypothyroidism (TSH > 10 mIU/L) was associated with improved survival outcomes in patients with mRCC and should not necessitate a dose reduction or therapy discontinuation. Copyright © 2015 Elsevier Inc. All rights reserved.

Associations between brominated flame retardants in human milk and Thyroid-Stimulating Hormone (TSH) in neonates

PubMed Central

Eggesbø, Merete; Thomsen, Cathrine; Jørgensen, Jens V.; Becher, Georg; Odland, Jon Øyvind; Longnecker, Matthew P.

2011-01-01

Background Brominated flame retardants (BFRs) have been in widespread use in a vast array of consumer products since the 1970s. The metabolites of some BFRs show a structural similarity to thyroid hormones and experimental animal studies have confirmed that they may interfere with thyroid hormone homeostasis. A major concern has been whether intrauterine exposure to BFRs may disturb thyroid homeostasis since the fetal brain is particularly susceptible to alterations in thyroid hormones. However, few reports on newborns have been published to date. Objectives To evaluate the association between BFRs and neonatal thyroid-stimulating hormone (TSH). Methods We studied six polybrominated diphenyl ethers (PBDEs) measured in milk samples from 239 women who were part of the “Norwegian Human Milk Study” (HUMIS), 2003–2006. Hexabromocyclododecane (HBCD) and BDE-209 were measured in a subset of the women (193 and 46 milk samples, respectively). The milk was sampled at a median of 33 days after delivery. TSH was measured in babies three days after delivery as part of the routine national screening program for early detection of congenital hypothyroidism. Additional information was obtained through the Medical Birth Registry and questionnaires to the mothers. Results The PBDE concentrations in human milk in Norway were comparable to concentrations reported from other European countries and Asia, but not the US and Canada where levels are approximately one order of magnitude higher. We observed no statistically significant associations between BDE-47, 99, 153, 154, 209 and HBCD in human milk and TSH in models adjusted for possible confounders and other environmental toxicants including polychlorinated biphenyls (PCBs). Conclusions We did not observe an association between TSH and exposure to HBCD and PBDEs within the exposure levels observed. PMID:21601188

Image analysis for TSH mRNA in situ hybridization in pituitary glands from rats with thyroid follicular cell hypertrophy after treatment with three different test compounds.

PubMed

Funk, Juergen; Ebeling, Martin; Singer, Thomas; Landes, Christian

2017-10-01

The goal of this in situ hybridization and image analysis technique is to study the effects of new pharmacological/chemical entities on the thyroid and pituitary gland in rats, reveal the pathogenesis of thyroid follicular cell hypertrophy and to retrospectively exclude the risk of thyroid tumor development in humans. In the present study, we describe the increase of thyroid-stimulating hormone- (TSH-) beta subunit mRNA in the pars distalis of the pituitary gland and the quantitative measurement of TSH mRNA positive cells from rats of three 4-week toxicity studies treated with three different test compounds inducing thyroid follicular cell and hepatocellular hypertrophy in rats. Compared to immunohistochemistry (IHC), in situ hybridization (ISH) for TSH was found to be more sensitive. With this technique we are able to exclude a direct effect of the test compound on the thyroid gland by showing the activation of thyrotrope cells from the pituitary gland and therefore this technique retrospectively enables us to exclude a possible risk for humans at an early stage of drug development. Also in case blood serum samples for evaluation of TSH are not available anymore or hepatocellular hypertrophy is not present (close metabolic relationship between thyroid gland and liver in rodents), the described method allows retrospective investigations on thyroid follicular cell hypertrophy or hyperplasia. This can be of high relevance in human safety assessment for certain drugs in order to exclude a primary effect on the thyroid gland especially when it comes to thyroid neoplasia in rodents as previously described. Copyright © 2017 Elsevier Ltd. All rights reserved.

Single-legged Hop Tests as Predictors of Self-reported Knee Function After Anterior Cruciate Ligament Reconstruction

PubMed Central

Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn

2012-01-01

Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times more likely to have a crossover hop LSI greater than the 95% cutoff than those with knee function below normal ranges. No preoperative single-legged hop test predicted self-reported knee function within normal ranges 1 year after ACL reconstruction (all P > .353). Conclusion Single-legged hop tests conducted 6 months after ACL reconstruction can predict the likelihood of successful and unsuccessful outcome 1 year after ACL reconstruction. Patients demonstrating less than the 88% cutoff score on the 6-m timed hop test at 6 months may benefit from targeted training to improve limb symmetry in an attempt to normalize function. Patients with minimal side-to-side differences on the crossover hop test at 6 months possibly will have good knee function at 1 year if they continue with their current training regimen. Preoperative single-legged hop tests are not able to predict postoperative outcomes. PMID:22926749

Evaluation of serum free thyroxine and thyrotropin concentrations in the diagnosis of canine hypothyroidism.

PubMed

Dixon, R M; Mooney, C T

1999-02-01

Canine thyroid-stimulating hormone (cTSH), total thyroxine (T4) and free T4 by equilibrium dialysis (fT4d) were measured in serum samples from 107 dogs with clinical signs suggestive of hypothyroidism in which the diagnosis was either confirmed (n = 30) or excluded (n = 77) by exogenous TSH response testing. Median serum total T4 and fT4d concentrations were significantly lower and cTSH significantly higher (P < 0.001) in hypothyroid compared with euthyroid dogs. Differential positive rate analysis determined optimal cut-off values of less than 14.9 nmol/litre (total T4), less than 5.42 pmol/litre (fT4d), greater than 0.68 ng/ml (cTSH), less than 17.3 (T4 to cTSH ratio), and less than 7.5 (fT4d to cTSH ratio) for hypothyroidism. These had a sensitivity and specificity of 100 and 75.3 per cent, 80 and 93.5 per cent, 86.7 and 81.8 per cent, 86.7 and 92.2 per cent, and 80 and 97.4 per cent, respectively, for diagnosing hypothyroidism. Corresponding areas under the receiver operating characteristic curves were 0.92, 0.93, 0.87, 0.93 and 0.93. Unexpectedly low cTSH values in hypothyroid dogs may have resulted from concurrent non-thyroidal illness. Unexpectedly high serum cTSH values in the euthyroid dogs might have resulted from recovery from illness or concurrent potentiated sulphonamide therapy. Measurement of endogenous cTSH concentration is a valuable diagnostic tool for canine hypothyroidism if used in association with assessment of T4. Estimation of fT4d added only limited additional information over total T4 measurement.

Serum thyroid-stimulating hormone and cognition in older people.

PubMed

Ojala, Anna K; Schalin-Jäntti, Camilla; Pitkälä, Kaisu H; Tilvis, Reijo S; Strandberg, Timo E

2016-01-01

high TSH concentrations and cognitive decline are both very common among older people and could be linked. to assess cognition in our cohort of 335 home-dwelling older people (75 years and older) and to cross-sectionally relate the results to thyroid-stimulating hormone (TSH) concentrations. Our special focus was on the upper normal TSH range and subclinical hypothyroidism. cognitive performance was evaluated using the Consortium to Establish a Registry for Alzheimer's disease neuropsychological battery (CERAD-nb). The Clinical Dementia Rating (CDR) scale was used to evaluate severity of cognitive disorder. The APOEε4 genotype was also defined. Subjects were divided into quartiles based on the TSH concentrations, and results were compared between these groups. expected relations were observed between CERAD domains and both educational level and APOEε4 genotype. Female sex significantly associated with better performance in Boston naming (OR = 0.48; 95% CI = 0.27-0.85). In the whole cohort, higher TSH concentrations tended to associate with better scores in most parts of the CERAD-nb tests, but differences were not statistically significant. However, subjects with the highest TSH concentration (90th TSH percentile, range 4.14-14.4 mU/l) had better CDR scores compared with subjects with the lowest TSH concentration (10th percentile, range 0.001-0.63 mIU/l; OR 0.10; 95% CI 0.014-0.76). our results do not support the notion that higher TSH concentrations, not even in the range of subclinical hypothyroidism, would adversely affect cognition among older people. © The Author 2015. Published by Oxford University Press on behalf of the British Geriatrics Society. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Relationship Between Circulating Concentrations of Thyrotropin, Free Thyroxine, and Free Triiodothyronine and 9-Year Mortality in Euthyroid Elderly Subjects

PubMed Central

Ceresini, Graziano; Marina, Michela; Lauretani, Fulvio; Maggio, Marcello; Bandinelli, Stefania; Ceda, Gian Paolo; Ferrucci, Luigi

2015-01-01

Objectives Thyroid dysfunction in the elderly is associated with adverse clinical outcomes, with mortality being associated with low TSH. However, it is still unknown whether variability of thyroid function test within the reference range is associated with mortality in older adults. We studied the association between plasma levels of TSH, free T3 (FT3), and free T4 (FT4), and all-cause mortality in older adults who had all three hormones within the normal range. Design Longitudinal study Setting Community-based Participants Total of 815 euthyroid participants of the InCHIANTI study, aged 65 years or older Measurements All subjects had TSH, FT3, and FT4 within the reference range at baseline. Plasma TSH, FT3 and FT4 were predictors and 9-year all-cause mortality was the outcome. Cox proportional hazards models adjusted for confounders were used to examine the relationship between quartiles of TSH, FT3, and FT4 and all-cause mortality over 9 years of follow-up. Results During the follow-up (mean persons-years 8643.74 [min-max, 35.36-16985.00]), 181 deaths occurred (22.2%). Participants with TSH in the lower quartile had higher mortality than the rest of the population. After adjusting for multiple confounders, participants with TSH in the lowest quartile (Hazard Ratio: 2.22; 95% Confidence Interval: 1.19–4.22) had significantly higher all-cause mortality than those with TSH in the highest quartile. Neither FT3 nor FT4 were associated with mortality. Conclusions In euthyroid elderly subjects, normal-low TSH represents an independent risk factor for all-cause mortality. PMID:27000328

Prevalence of subclinical hypothyroidism in a morbidly obese population and improvement after weight loss induced by Roux-en-Y gastric bypass.

PubMed

Moulin de Moraes, Cristiane M; Mancini, Marcio C; de Melo, Maria Edna; Figueiredo, Daniela Andraus; Villares, Sandra Mara F; Rascovski, Alessandra; Zilberstein, Bruno; Halpern, Alfredo

2005-10-01

There are many studies concerning thyroid function in obesity, and some of them describe higher TSH levels in obese subjects. Few studies evaluated long-term changes in thyroid function caused by weight loss after bariatric surgery. Our aims were to evaluate the prevalence of subclinical hypothyroidism (SH) in a morbidly obese population and to analyze the effect of weight loss induced by Roux-en-Y gastric bypass (RYGBP) on TSH and thyroid hormone (TH) levels. TSH, free thyroxine (fT4) and total triiodothyronine (T3) levels were analyzed before and 12 months after RYGBP in patients with grade III or grade II obesity with co-morbidities. Subjects taking TH and/or with positive antithyroid antibodies and/or with overt hypothyroidism were excluded. 72 subjects (62F/10M), with mean age 39.6+/-9.8 years and mean BMI 53.0+/-10.4 kg/m2 were studied. The prevalence of SH before RYGBP was 25% (n=18). There was a significant post-surgical decrease in BMI in the whole population, as well as in SH patients. In the SH group and normal TSH group, there was a decrease in TSH and T3, but not in fT4. TSH was not correlated with initial BMI or percent change in BMI. TSH concentrations reached normal values in all SH patients after RYGBP. Our data confirm that severe obesity is associated with increased TSH. The decrease in TSH was independent of BMI, but occurred in all SH patients. A putative effect of weight reduction on the improvement of SH in all patients may be an additional benefit of bariatric surgery.

Relations of thyroid function to body weight: cross-sectional and longitudinal observations in a community-based sample.

PubMed

Fox, Caroline S; Pencina, Michael J; D'Agostino, Ralph B; Murabito, Joanne M; Seely, Ellen W; Pearce, Elizabeth N; Vasan, Ramachandran S

2008-03-24

Overt hypothyroidism and hyperthyroidism may be associated with weight gain and loss. We assessed whether variations in thyroid function within the reference (physiologic) range are associated with body weight. Framingham Offspring Study participants (n=2407) who attended 2 consecutive routine examinations, were not receiving thyroid hormone therapy, and had baseline serum thyrotropin (TSH) concentrations of 0.5 to 5.0 mIU/L and follow-up concentrations of 0.5 to 10.0 mIU/L were included in this study. Baseline TSH concentrations were related to body weight and body weight change during 3.5 years of follow-up. At baseline, adjusted mean weight increased progressively from 64.5 to 70.2 kg in the lowest to highest TSH concentration quartiles in women (P< .001 for trend), and from 82.8 (lowest quartile) to 85.6 kg (highest quartile) in men (P= .007 for trend). During 3.5 years of follow-up, mean (SD) body weight increased by 1.5 (5.6) kg in women and 1.0 (5.0) kg in men. Baseline TSH concentrations were not associated with weight change during follow-up. However, an increase in TSH concentration at follow-up was positively associated with weight gain in women (0.5-2.3 kg across increasing quartiles of TSH concentration change; P< .001 for trend) and men (0.4-1.3 kg across quartiles of TSH concentration change; P= .007 for trend). Thyroid function (as assessed by serum TSH concentration) within the reference range is associated with body weight in both sexes. Our findings raise the possibility that modest increases in serum TSH concentrations within the reference range may be associated with weight gain.

The association between soya consumption and serum thyroid-stimulating hormone concentrations in the Adventist Health Study-2.

PubMed

Tonstad, Serena; Jaceldo-Siegl, Karen; Messina, Mark; Haddad, Ella; Fraser, Gary E

2016-06-01

Consumers may choose soya foods as healthful alternatives to animal products, but concern has arisen that eating large amounts of soya may adversely affect thyroid function. The present study aimed to examine the association between soya food consumption and serum thyroid-stimulating hormone (TSH) concentrations in North American churchgoers belonging to the Seventh-day Adventist denomination that encourages vegetarianism. Participants completed six repeated 24 h dietary recalls within a 6-month period. Soya protein and soya isoflavone intakes were estimated, and their relationships to TSH concentrations measured at the end of 6 months were calculated using logistic regression analyses. Calibration sub-study of the Adventist Health Study-2. Women (n 548) and men (n 295) who were not taking thyroid medications. In men, age and urinary iodine concentrations were associated with high serum TSH concentrations (>5 mIU/l), while among women White ethnicity was associated with high TSH. In multivariate models adjusted for age, ethnicity and urinary iodine, soya isoflavone and protein intakes were not associated with high TSH in men. In women higher soya isoflavone consumption was associated with higher TSH, with an adjusted odds ratio (highest v. lowest quintile) of 4·17 (95 % CI 1·73, 10·06). Likewise, women with high consumption of soya protein (midpoint of highest quintile, 11 g/d) v. low consumption (midpoint of lowest quintile, 0 g/d) carried increased odds of high TSH (OR=2·69; 95 % CI 1·34, 5·30). In women high consumption of soya was associated with elevated TSH concentrations. No associations between soya intake and TSH were found in men.

Central hypothyroidism in adults: better understanding for better care.

PubMed

Grunenwald, Solange; Caron, Philippe

2015-02-01

Central hypothyroidism (CH) is a rare cause of hypothyroidism generally related to a hypothalamic-pituitary disorder or arising as an iatrogenic complication. In adults, CH may be secondary to quantitative and/or qualitative alterations in thyroid-stimulating hormone (TSH) secretion. The disease is difficult to diagnose clinically because it lacks specific clinical signs and these may be masked by other anterior pituitary hormone secretion deficiencies. In patients with long-standing and marked CH, a diagnosis may be made based on low free T4 levels and normal, low or moderately increased TSH levels. In patients with early-stage or moderate CH, exploration of the circadian TSH cycle, determination of TSH response after a TRH test or recombinant TSH injection, estimation of TSH index, or evaluation of peripheral indexes of thyroid hormone metabolism may be required to establish a diagnosis. Regarding treatment, patients should receive levothyroxine replacement therapy, but hormone objectives during follow-up need to be precisely determined in order to reduce cardiovascular risks and to improve the quality of life of patients.

Thyroid-stimulating hormone, 5-HTTLPR genotype, and antidepressant response in depressed women.

PubMed

Gressier, Florence; Trabado, Séverine; Verstuyft, Céline; Bouaziz, Elodie; Hardy, Patrick; Fève, Bruno; Becquemont, Laurent; Corruble, Emmanuelle

2011-10-01

Basal serum thyroid-stimulating hormone (TSH) levels may predict antidepressant efficacy in patients with major depressive episodes (MDE), but data are inconsistent. As the SS genotype of the 5-HTTLPR polymorphism has been associated with a lower antidepressant efficacy in women with MDE, we aimed at assessing the relationship between normal basal TSH, 5-HTTLPR, and antidepressant efficacy in women. A total of 71 women and 28 men, with normal baseline TSH serum levels, hospitalized for a MDE, were assessed for 5-HTTLPR genotypes and prospectively followed for short-term antidepressant efficacy. Women with SS genotype had higher TSH levels (P=0.002) and a worse antidepressant response (P=0.046) than the women with LL/LS genotype, whereas no significant difference was shown in men. In multivariate analyses, antidepressant response in women was explained by TSH and 5-HTTLPR, but not by other variables. Further research is needed to understand the underlying mechanism explaining interactions between sex, TSH, and serotonergic function.

Direct evidence that ganglioside is an integral component of the thyrotropin receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kielczynski, W.; Harrison, L.C.; Leedman, P.J.

1991-03-01

Gangliosides were extracted from purified human and porcine thyrotropin (TSH) receptors (TSH-R) and were detected by probing with an {sup 125}I-labeled sialic acid-specific lectin, Limax flavus agglutinin. Gangliosides copurified with human and porcine TSH-R migrated between monosialoganglioside GM1 and disialoganglioside GD1a. Ceramide glycanase digestion of the purified human TSH-R-associated glycolipid confirmed its ganglioside nature. It was resistant to Vibrio cholerae sialidase, which digest all gangliosides except GM1, but was sensitive to Arthrobacter ureafaciens sialidase, which digests all gangliosides including GM1. These findings indicate that the human TSH-R contains ganglioside that belongs to the galactosyl({beta}1{r arrow} 3)-N-acetylgalactosaminyl({beta}1{r arrow} 4)-(N-acetylneuraminyl({alpha}2{r arrow} 3))galactosyl({beta}1more » {r arrow} 4)glucosyl({beta}1 {r arrow} 1)ceramide (GM1) family. Its intimate association with receptor protein implies a key role for ganglioside in the structure and function of the TSH-R.« less

Effect of recombinant human thyroid stimulating hormone on serum thyroxin and thyroid scintigraphy in euthyroid cats.

PubMed

van Hoek, Ingrid M; Peremans, Kathelijne; Vandermeulen, Eva; Duchateau, Luc; Gommeren, Kris; Daminet, Sylvie

2009-04-01

This study investigated the thyroidal response to administration of recombinant human thyroid stimulating hormone (rhTSH) by means of serum total thyroxine (TT(4)) concentration and pertechnetate uptake by the thyroid gland in six healthy euthyroid spayed female cats. A pertechnetate scan was performed on day 1 to calculate thyroid/salivary gland (T/S) uptake ratio. On day 3, 25 microg rhTSH was injected intravenously. Six hours later the thyroid scan was repeated as on day 1. Blood was drawn for serum TT(4) measurement prior to injection of rhTSH and performance of the pertechnetate scan. Statistically significant differences in mean serum TT(4) concentration, T/S uptake ratio before and 6h after rhTSH administration and T/S uptake ratio between left and right lobes were noted. We can conclude that 25 microg rhTSH increases pertechnetate uptake in the thyroid glands of cats, this should be taken into account when thyroid scintigraphy after rhTSH administration is interpreted.

Regulation of hormone release by cultured cells from a thyrotropin-growth hormone-secreting pituitary tumor. Direct inhibiting effects of 3,5,3'-triiodothyronine and dexamethasone on thyrotropin secretion.

PubMed

Lamberts, S W; Oosterom, R; Verleun, T; Krenning, E P; Assies, H

1984-08-01

The regulation of TSH and GH secretion was investigated in cultured tumor cells prepared from a mixed TSH/GH secreting pituitary tumor. The tumor tissue had been removed transsphenoidally from a patient with hyperthyroidism and inappropriately high serum TSH levels and acromegaly. TSH and GH secretion by cultured cells were stimulated in a parallel way by TRH (300 nM) and LHRH (50 nM), but were unaffected by bromocriptine (10 nM). Exposure of the tumor cells to dexamethasone (0.1 microM) or T3 (50 nM) had differential effects on hormone secretion. GH secretion was greatly stimulated by dexamethasone, but unaffected by T3. TSH secretion was inhibited both by T3 and by dexamethasone. So, T3 and glucocorticoids inhibit TSH release by the human pituitary tumor cells studied at least partly by means of a direct effect.

Effective dynamics of a random walker on a heterogeneous ring: Exact results

NASA Astrophysics Data System (ADS)

Masharian, S. R.

2018-07-01

In this paper, by considering a biased random walker hopping on a one-dimensional lattice with a ring geometry, we investigate the fluctuations of the speed of the random walker. We assume that the lattice is heterogeneous i.e. the hopping rate of the random walker between the first and the last lattice sites is different from the hopping rate of the random walker between the other links of the lattice. Assuming that the average speed of the random walker in the steady-state is v∗, we have been able to find the unconditional effective dynamics of the random walker where the absolute value of the average speed of the random walker is -v∗. Using a perturbative method in the large system-size limit, we have also been able to show that the effective hopping rates of the random walker near the defective link are highly site-dependent.

The crossover between tunnel and hopping conductivity in granulated films of noble metals

NASA Astrophysics Data System (ADS)

Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

2017-11-01

The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

A comparison of 1850 (50 mCi) and 3700 MBq (100 mCi) 131-iodine administered doses for recombinant thyrotropin-stimulated postoperative thyroid remnant ablation in differentiated thyroid cancer.

PubMed

Pilli, Tania; Brianzoni, Ernesto; Capoccetti, Francesca; Castagna, Maria Grazia; Fattori, Sara; Poggiu, Angela; Rossi, Gloria; Ferretti, Francesca; Guarino, Elisa; Burroni, Luca; Vattimo, Angelo; Cipri, Claudia; Pacini, Furio

2007-09-01

Recently, a multicenter study in differentiated thyroid cancer (DTC) patients showed that 3700 MBq 131-iodine ((131)I) after recombinant human TSH (rhTSH) had a successful thyroid ablation rate similar to that obtained after thyroid hormone withdrawal. We investigated whether 1850 MBq (131)I had a similar successful rate to 3700 MBq in patients prepared with rhTSH. A total of 72 patients with DTC were randomly assigned to receive 1850 (group A, n = 36) or 3700 MBq (group B, n = 36) (131)I after rhTSH. One injection of 0.9 mg rhTSH was administered for 2 consecutive days; (131)I therapy was delivered 24 h after the last injection, followed by a posttherapy whole-body scan. Successful ablation was assessed 6-8 months later. Successful ablation (no visible uptake in the diagnostic whole-body scan after rhTSH stimulation) was achieved in 88.9% of group A and B patients. Basal and rhTSH-stimulated serum thyroglobulin was undetectable (<1 ng/ml) in 78.9% of group A and 66.6% of group B patients (P = 0.46). Similar rates of ablation were obtained in both groups also in patients with node metastases. Therapeutic (131)I activities of 1850 MBq are equally effective as 3700 MBq for thyroid ablation in DTC patients prepared with rhTSH, even in the presence of node metastases.

Hypothyroidism following treatment for head and neck cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vrabec, D.P.; Heffron, T.J.

One hundred ninety-six head and neck patients were studied to determine the effects of radiation therapy and surgery on thyroid function. Serum thyroid-stimulating hormone (TSH) levels were obtained as a screening test for primary hypothyroidism. Elevated TSH levels were found in 57 of the 196 patients (29.1%). The highest incidence of abnormal TSH values (66%) occurred in the group treated with combination radiation therapy and surgery, including partial thyroidectomy. TSH levels rose early in the posttreatment period with 60% of the abnormal values occurring within the first three posttreatment years. Posttreatment thyroid dysfunction was twice as common in women (48.6%)more » as in men (25.4%). When serum thyroxine levels by radioimmunoassay (T4RIA) were correlated with the elevated serum TSH levels, a similar pattern was seen with 65% of the patients in Group 3 having a decreased T4RIA level indicating overt hypothyroidism. Pretreatment levels of thyroid function including thyroid antibody studies should be established for all patients. Serial TSH levels should be done every three months during the first three posttreatment years and semiannually thereafter as long as the patient will return for follow-up care. All patients treated with combination radiation therapy and surgery who develop elevated TSH levels should be treated with thyroid replacement therapy. Patients receiving radiation therapy alone should receive replacement thyroid therapy if they develop a depressed T4RIA value or a pattern of gradually increasing TSH levels.« less

Treatment of subclinical hypothyroidism in pregnancy using fixed thyroxine daily doses of 75 μg.

PubMed

Penin, Manuel; Trigo, Cristina; López, Yolanda; Barragáns, María

2014-01-01

Treatment of hypothyroid pregnant women is usually calculated based on weight (1 μg/kg/day) and TSH levels. This study assessed the usefulness of treating these women with a fixed dose of 75 μg/day. All women with pregnancy diagnosed from January to August 2012 in the Vigo Health Area (Spain) without previous diagnosis of thyroid disease or thyroxine treatment and with TSH levels over 4,5 mUI/ml were enrolled by consecutive sampling. All 116 women in the sample were treated with a fixed daily dose of thyroxine 75 μg-thyroxine levels were measured at two, four, and six months, and thyroxine dose was modified if TSH level was lower than 0.3 or higher than 4.5 mUI/ml. A woman had a TSH level less than 0.3 mUI/ml in a test; reduction of thyroxine dose to 50 μg/day allowed for maintaining TSH level within the desired range until delivery. Six women had TSH levels over 4.5 mUI/ml in one test; in all of them, increase in thyroxine dose to 100 μg/day allowed for maintaining the level within the desired range until delivery. Fixed daily doses of thyroxine 75 μg allowed for achieving goal TSH levels in most of our pregnant women with subclinical hypothyroidism, irrespective of their weight and baseline TSH level. Copyright © 2013 SEEN. Published by Elsevier Espana. All rights reserved.

Central hypothyroidism - a neglected thyroid disorder.

PubMed

Beck-Peccoz, Paolo; Rodari, Giulia; Giavoli, Claudia; Lania, Andrea

2017-10-01

Central hypothyroidism is a rare and heterogeneous disorder that is characterized by a defect in thyroid hormone secretion in an otherwise normal thyroid gland due to insufficient stimulation by TSH. The disease results from the abnormal function of the pituitary gland, the hypothalamus, or both. Moreover, central hypothyroidism can be isolated or combined with other pituitary hormone deficiencies, which are mostly acquired and are rarely congenital. The clinical manifestations of central hypothyroidism are usually milder than those observed in primary hypothyroidism. Obtaining a positive diagnosis for central hypothyroidism can be difficult from both a clinical and a biochemical perspective. The diagnosis of central hypothyroidism is based on low circulating levels of free T 4 in the presence of low to normal TSH concentrations. The correct diagnosis of both acquired (also termed sporadic) and congenital (also termed genetic) central hypothyroidism can be hindered by methodological interference in free T 4 or TSH measurements; routine utilization of total T 4 or T 3 measurements; concurrent systemic illness that is characterized by low levels of free T 4 and normal TSH concentrations; the use of the sole TSH-reflex strategy, which is the measurement of the sole level of TSH, without free T 4 , if levels of TSH are in the normal range; and the diagnosis of congenital hypothyroidism based on TSH analysis without the concomitant measurement of serum levels of T 4 . In this Review, we discuss current knowledge of the causes of central hypothyroidism, emphasizing possible pitfalls in the diagnosis and treatment of this disorder.

A stable high-order perturbation of surfaces method for numerical simulation of diffraction problems in triply layered media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Youngjoon, E-mail: hongy@uic.edu; Nicholls, David P., E-mail: davidn@uic.edu

The accurate numerical simulation of linear waves interacting with periodic layered media is a crucial capability in engineering applications. In this contribution we study the stable and high-order accurate numerical simulation of the interaction of linear, time-harmonic waves with a periodic, triply layered medium with irregular interfaces. In contrast with volumetric approaches, High-Order Perturbation of Surfaces (HOPS) algorithms are inexpensive interfacial methods which rapidly and recursively estimate scattering returns by perturbation of the interface shape. In comparison with Boundary Integral/Element Methods, the stable HOPS algorithm we describe here does not require specialized quadrature rules, periodization strategies, or the solution ofmore » dense non-symmetric positive definite linear systems. In addition, the algorithm is provably stable as opposed to other classical HOPS approaches. With numerical experiments we show the remarkable efficiency, fidelity, and accuracy one can achieve with an implementation of this algorithm.« less

An Open-Label Randomized Control Trial of Hopping and Jumping Training versus Sensorimotor Rehabilitation Programme on Postural Capacities in Individuals with Intellectual Disabilities

ERIC Educational Resources Information Center

Borji, Rihab; Sahli, Sonia; Baccouch, Rym; Laatar, Rabeb; Kachouri, Hiba; Rebai, Haithem

2018-01-01

Background: This study aimed to compare the effectiveness of a hopping and jumping training programme (HJP) versus a sensorimotor rehabilitation programme (SRP) on postural performances in children with intellectual disability. Methods: Three groups of children with intellectual disability participated in the study: the HJP group, the SRP group…

Guiding the Influence of Hip-Hop Music on Middle-School Students' Feelings, Thinking, and Behaving

ERIC Educational Resources Information Center

Brown, Veda

2006-01-01

Although the nature of the relationship of music on students' emotional development remains an issue for continued research, my overall purpose is to provide adults with research-based methods to help children become better consumers of hip-hop music. First, I identify research-based recommendations to prepare adults as facilitators of children's…

What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

ERIC Educational Resources Information Center

Love, Bettina L.

2015-01-01

Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

Pedagogical Ideas on Sonic, Mediated, and Virtual Musical Landscapes: Teaching Hip Hop in a University Classroom

ERIC Educational Resources Information Center

Dhokai, Niyati

2012-01-01

Based on the experience of teaching the history of American hip hop music to a classroom of Canadian university students, the author considers the disjuncture between the cultural orientations of herself and her students. The author considers teaching methods to solve the place-based disjuncture that often occurs when teaching genres such as hip…

Optimisation of active suspension control inputs for improved vehicle ride performance

NASA Astrophysics Data System (ADS)

Čorić, Mirko; Deur, Joško; Xu, Li; Tseng, H. Eric; Hrovat, Davor

2016-07-01

A collocation-type control variable optimisation method is used in the paper to analyse to which extent the fully active suspension (FAS) can improve the vehicle ride comfort while preserving the wheel holding ability. The method is first applied for a cosine-shaped bump road disturbance of different heights, and for both quarter-car and full 10 degree-of-freedom vehicle models. A nonlinear anti-wheel hop constraint is considered, and the influence of bump preview time period is analysed. The analysis is then extended to the case of square- or cosine-shaped pothole with different lengths, and the quarter-car model. In this case, the cost function is extended with FAS energy consumption and wheel damage resilience costs. The FAS action is found to be such to provide a wheel hop over the pothole, in order to avoid or minimise the damage at the pothole trailing edge. In the case of long pothole, when the FAS cannot provide the wheel hop, the wheel is travelling over the pothole bottom and then hops over the pothole trailing edge. The numerical optimisation results are accompanied by a simplified algebraic analysis.

Radioiodine remnant ablation in differentiated thyroid cancer after combined endogenous and exogenous TSH stimulation.

PubMed

Vrachimis, A; Schober, O; Riemann, B

2012-01-01

Radioiodine remnant ablation (RRA) after (near-)total thyroidectomy (TE) is a key element in patients with differentiated thyroid cancer (DTC). The use of exogenous TSH stimulation (rhTSH) prior to RRA has shown promising results as compared to conventional thyroid hormone withdrawal (THW). As yet, the efficacy of RRA after brief THW and single rhTSH administration has not been assessed. The study sample comprised 147 patients with DTC referred to our center between May 2008 and September 2010. All patients received TE with subsequent RRA. None of these 147 patients had evidence of distant metastasis. 93 patients had endogenous TSH stimulation 4-5 weeks after surgery (group I) and twenty-six received two rhTSH injections (group II). 28 patients were treated with a single rhTSH injection after a brief THW (group III). RRA-Efficacy was assessed three months after therapy by diagnostic whole-body scan and measurement of the tumour marker thyroglobulin (Tg) under TSH stimulation. Three categories of success were defined for remnant ablation. Based on the definition of successful remnant ablation no visible uptake and a Tg ≤ 2.0 ng/ml (category 1) was seen in 62/93 patients in group I, in 17/26 patients in group II (p = n.s.) and in 12/28 patients in group III (p < 0.05). Visible radioiodine uptake and a Tg ≤ 2.0 ng/ml (category 2) was seen in 16/28 patients of group III and thus significantly more frequent than in group I (28/93 patients) (p < 0.01). However, patients in group III (16/28 patients) and group II (8/26 patients) showed no significant difference in this category (p = n.s.). Visible radioiodine uptake and a Tg > 2.0 ng/ml (category 3) was found in 3/93 patients in group I and 1/26 patients in group II but in no patient in group III. The third strategy of remnant ablation using a single injection of rhTSH after a brief THW period resulted in a significant higher rate of patients with residual uptake in the thyroid bed and a Tg level below 2 ng/ml three months after remnant ablation in comparison to THW. However, the overall efficacy of the third protocol was not significantly different as compared to two rhTSH injections. Under the aspect of the supply shortage of rhTSH the combined endogenous and exogenous TSH stimulation may be an attractive alternative for remnant ablation in differentiated thyroid cancer.

Cell-phone-based measurement of TSH using Mie scatter optimized lateral flow assays.

PubMed

You, David J; Park, Tu San; Yoon, Jeong-Yeol

2013-02-15

Semi-quantitative thyr oid stimulating hormone (TSH) lateral flow immunochromatographic assays (LFA) are used to screen for serum TSH concentration >5 mIUL(-1) (hypothyroidism). The LFA format, however, is unable to measure TSH in the normal range or detect suppressed levels of TSH (<0.4 mIU L(-1); hyperthyroidism). In fact, it does not provide quantitative TSH values at all. Obtaining quantitative TSH results, especially in the low concentration range, has until now required the use of centralized clinical laboratories which require specimen transport, specialized equipment and personnel, and result in increased cost and delays in the timely reporting of important clinical results. We have conducted a series of experiments to develop and validate an optical system and image analysis algorithm based upon a cell phone platform. It is able to provide point-of-care quantitative TSH results with a high level of sensitivity and reproducibility comparable to that of a clinical laboratory-based third-generation TSH immunoassay. Our research approach uses the methodology of the optimized Rayleigh/Mie scatter detection by taking into consideration the optical characteristics of a nitrocellulose membrane and gold nanoparticles on an LFA for quantifying TSH levels. Using a miniature spectrometer, LED light source, and optical fibers on a rotating benchtop apparatus, the light intensity from different angles of incident light and angles of detection to the LFA were measured. The optimum angles were found that the minimized Mie scattering from nitrocellulose membrane, consequently maximizes the Rayleigh scatter detection from the gold nanoparticles in the LFA bands. Using the results from the benchtop apparatus, a cell-phone-based apparatus was designed which utilized the embedded flash in the cell phone camera as the light source, piped the light with an optical fiber from the flash through a collimating lens to illuminate the LFA. Quantification of TSH was performed in an iOS application directly on the phone and verified using the code written in MATLAB. The limit of detection of the system was determined to be 0.31 mIU L(-1) (never achieved before on an LFA format), below the commonly accepted minimum concentration of 0.4 mIU L(-1) indicating clinical significance of hyperthyroidism. The system was further evaluated using human serum showing an accurate and reproducible platform for rapid and point-of-care quantification of TSH using a cell phone. Copyright © 2012 Elsevier B.V. All rights reserved.

Effects of hyperthyroidism and hypothyroidism on rat growth hormone release induced by thyrotropin-releasing hormone.

PubMed

Chihara, K; Kato, Y; Ohgo, S; Iwasaki, Y; Maeda, K

1976-06-01

The effect of synthetic thyrotropin-releasing hormone (TRH) on the release of growth hormone (GH) and thyroid-stimulating hormone (TSH) was investigated in euthyroid, hypothyroid, and hyperthyroid rats under urethane anesthesia. In euthyroid control rats, intravenous injection of TRH (200 ng/100 g BW) resulted in a significant increase in both plasma GH and TSH. In rats made hypothyroid by treatment with propylthiouracil or by thyroidectomy, basal GH and TSH levels were significantly elevated with exaggerated responses to TRH. In contrast, plasma GH and TSH responses to TRH were both significantly inhibited in rats made hyperthyroid by L-thyroxine (T4) treatment. These results suggest that altered thyroid status influences GH release as well as TSH secretion induced by TRH in rats.

Unstable Thyroid Function in Older Adults Is Caused by Alterations in Both Thyroid and Pituitary Physiology and Is Associated with Increased Mortality.

PubMed

Mammen, Jennifer S; McGready, John; Ladenson, Paul W; Simonsick, Eleanor M

2017-11-01

Average thyrotropin (TSH) levels are known to be higher in older adults when measured in cross-sectional populations. Possible etiologies include differential survival, neutral aging changes, or increased disease prevalence at older ages. This study aimed to elucidate the mechanisms underlying changing thyroid function during aging, and to determine the association of changes with survival, by analyzing the individual thyroid axis over time. Individual patterns of changing TSH and free thyroxine (fT4) were determined in 640 participants in the Baltimore Longitudinal Study of Aging who had at least three measures of serum TSH and fT4, not on medications, over an average of seven years of follow-up. Participants with changing phenotypes were identified based on quintiles for both slopes. Those with alterations in primary thyroid gland function demonstrated intact negative feedback (rising TSH with declining fT4 or declining TSH with rising fT4). Other participants had a parallel rise or fall of TSH and fT4 levels, consistent with pituitary dysfunction. Predictors of phenotype were analyzed by logistic regression. Differential survival between thyroid aging phenotypes was analyzed using multivariate Cox regression. While the majority of participants at all ages had stable thyroid function, changes were more common among older adults, with 32.3% of those aged >80 years but only 9.5% of those aged <60 years demonstrating thyroid function changes in the highest and lowest quintiles. Regression to the mean accounts for some of the changes, for example increased baseline TSH was associated with a falling TSH pattern (odds ratio = 1.4 [confidence interval 1.1-1.7] per 1 mIU/L). Importantly, changing thyroid function in either the upper or lower quintiles of slope for TSH and fT4 was associated with increased risk of death compared to stable thyroid status (hazard ratio = 5.4 [confidence interval 3.1-9.5]). Changing thyroid hormone function is increasingly common at older ages and is associated with decreased survival. Nonetheless, the tendency for abnormal thyroid function tests to resolve, along with altered pituitary responsiveness underlying some TSH elevations, suggests that an elevated TSH level should be not assumed to represent subclinical hypothyroidism in older adults. Thus, caution is appropriate when determining the need for thyroid hormone supplements in older adults.

Thyrotropin-induced hydrogen peroxide production in FRTL-5 thyroid cells is mediated not by adenosine 3',5'-monophosphate, but by Ca2+ signaling followed by phospholipase-A2 activation and potentiated by an adenosine derivative.

PubMed

Kimura, T; Okajima, F; Sho, K; Kobayashi, I; Kondo, Y

1995-01-01

The production of hydrogen peroxide (H2O2) as an essential process for iodide organification is a key reaction in TSH-induced thyroid hormone synthesis. Here we characterize the signal transduction pathway involved in TSH-induced H2O2 production in FRTL-5 thyroid cells. At higher than 1 nM TSH, N6-(L-2-phenylisopropyl)adenosine (PIA), an adenosine receptor agonist having, by itself, no influence on H2O2 generation, potentiated this TSH action, whereas the TSH increase and PIA addition reduced cAMP accumulation. RO 20-1724, a phosphodiesterase inhibitor, amplified the TSH-induced cAMP accumulation, but did not change H2O2 generation in the whole range of TSH used. Ca(2+)-mobilizing agonists, GTP and ATP, also induced H2O2 production without stimulating cAMP accumulation. Chelation of intracellular Ca2+ markedly inhibited the TSH action, but intracellular Ca2+ increases by either thapsigargin or ionomycin mimicking it. All of the findings show the participation of Ca2+, but not cAMP, in the action of TSH. Desensitization of protein kinase-C (PKC) did not influence the receptor-mediated H2O2 production, suggesting the reduced importance of PKC activation compared to Ca2+ signaling to the reaction. A rise in intracellular Ca2+ independent of receptor activation also induced H2O2 production as well as arachidonate release, and both were potentiated by PIA. In addition, inhibitors of phospholipase-A2 and the arachidonate metabolic pathway depressed H2O2 generation, suggesting the participation of an arachidonate cascade in the Ca(2+)-dependent H2O2 production. Lipoxygenase inhibitors depressed the Ca2+ action without influencing arachidonate release, suggesting the involvement of a lipoxygenase product(s) of arachidonate in the Ca(2+)-signaling mechanism. In conclusion, in FRTL-5 cells, TSH-induced H2O2 production is mediated not by cAMP, but by the phospholipase-C/Ca2+ cascade, possibly followed by the Ca(2+)-dependent phospholipase-A2/arachidonate cascade. PIA amplifies TSH-induced H2O2 production at the steps of phospholipase-C and phospholipase-A2 activation in a pertussis toxin-sensitive manner.

Negative correlation between bone mineral density and TSH receptor antibodies in long-term euthyroid postmenopausal women with treated Graves’ disease

PubMed Central

2013-01-01

Background Thyrotoxicosis is a cause of secondary osteoporosis. High concentrations of triiodotironine (T3) in Graves’ disease stimulate bone turnover, but it is unclear if euthyroidism will always normalize bone metabolism. Thyrotropin (TSH) is known to affect directly the bone metabolism through the TSH receptor and TSH receptor antibodies (TRAb) may have an important role in bone turn-over. The aim of our study was to determine, in pre and postmenopausal euthyroidism patients with previous overt hyperthyroidism due to Graves’ disease the bone mineral density (BMD) as well as factors that could affect BMD in each group, including TRAb. Methods Cross-sectional, non-interventional study. Fifty-seven patients with previous hyperthyroidism due to Graves’ disease (premenopausal: 30, postmenopausal: 27) that remained euthyroid for at least 6 months prior to study were included and compared with fifty- two matched respective controls. Thyrotoxine (T4), TSH, TRAb and BMD were measured. Results Only euthyroid postmenopausal patients with a history of hyperthyroidism due to Graves’ disease showed lower whole body BMD than matched controls. The BMD expressed as Z-score was less in whole body and lumbar spine in postmenopausal in relation to premenopausal women with previous overt hyperthyroidism due to Graves’ disease. In the postmenopausal patients, the Z-score of lumbar spine BMD correlated negatively with TRAb (r = −0,53, p < 0.008), positively with the time of evolution of the disease (r = +0.42, p < 0.032) and positively with the time of euthyroidism (r = + 0.50, p < 0.008), but neither with serum T4 nor TSH. In a multiple regression analysis TRAb was the only significant independent variable in relation to lumbar spine BMD (F = 3. 90, p < 0.01). Conclusions In euthyroid women with a history of Graves’ hyperthyroidism, BMD was only affected in the postmenopausal group. The negative correlation of Z-score of lumbar spine BMD with TRAb suggests that this antibody may affect the bone metabolism. PMID:24020400

Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

PubMed

Haakensen, M; Schubert, A; Ziola, B

2009-03-15

Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

Network-assisted target identification for haploinsufficiency and homozygous profiling screens

PubMed Central

Wang, Sheng

2017-01-01

Chemical genomic screens have recently emerged as a systematic approach to drug discovery on a genome-wide scale. Drug target identification and elucidation of the mechanism of action (MoA) of hits from these noisy high-throughput screens remain difficult. Here, we present GIT (Genetic Interaction Network-Assisted Target Identification), a network analysis method for drug target identification in haploinsufficiency profiling (HIP) and homozygous profiling (HOP) screens. With the drug-induced phenotypic fitness defect of the deletion of a gene, GIT also incorporates the fitness defects of the gene’s neighbors in the genetic interaction network. On three genome-scale yeast chemical genomic screens, GIT substantially outperforms previous scoring methods on target identification on HIP and HOP assays, respectively. Finally, we showed that by combining HIP and HOP assays, GIT further boosts target identification and reveals potential drug’s mechanism of action. PMID:28574983

Genetic and epigenetic stability of cryopreserved and cold-stored hops (Humulus lupulus L.).

PubMed

Peredo, Elena L; Arroyo-García, Rosa; Reed, Barbara M; Revilla, M Angeles

2008-12-01

Conventional cold storage and cryopreservation methods for hops (Humulus lupulus L.) are available but, to our knowledge, the genetic and epigenetic stability of the recovered plants have not been tested. This study analyzed 51 accessions of hop using the molecular techniques, Random Amplified DNA Polymorphism (RAPD) and Amplified Fragment Length Polymorphism (AFLP), revealing no genetic variation among greenhouse-grown controls and cold stored or cryopreserved plants. Epigenetic stability was evaluated using Methylation Sensitive Amplified Polymorphism (MSAP). Over 36% of the loci were polymorphic when the cold and cryo-treated plants were compared to greenhouse plants. The main changes were demethylation events and they were common to the cryopreserved and cold stored plants indicating the possible effect of the in vitro establishment process, an essential step in both protocols. Protocol-specific methylation patterns were also detected indicating that both methods produced epigenetic changes in plants following cold storage and cryopreservation.

Plasmodium falciparum Hop (PfHop) Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

PubMed

Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore

2015-01-01

Heat shock proteins (Hsps) play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70) is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90) facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop). We previously characterised the Hop protein from Plasmodium falciparum (PfHop). We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR) analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we observed that recombinant PfHop occasionally eluted as a protein species of twice its predicted size, suggesting that it may occur as a dimer. We conducted SPR analysis which suggested that PfHop is capable of self-association in presence or absence of ATP/ADP. Overall, our findings suggest that PfHop is a stress-inducible protein that directly associates with PfHsp70-1 and PfHsp90. In addition, the protein is capable of self-association. The findings suggest that PfHop serves as a module that brings these two prominent chaperones (PfHsp70-1 and PfHsp90) into a functional complex. Since PfHsp70-1 and PfHsp90 are essential for parasite growth, findings from this study are important towards the development of possible antimalarial inhibitors targeting the cooperation of these two chaperones.

[Prevalence of thyroid function in pregnant and lactating women in areas with different iodine levels of Shanxi province].

PubMed

Ren, Y T; Jia, Q Z; Zhang, X D; Guo, B S; Zhang, F F; Cheng, X T; Wang, Y P

2018-05-10

Objective: To investigate the effects of high iodine intake on thyroid function in pregnant and lactating women. Methods: A cross sectional epidemiological study was conducted among 130 pregnant women and 220 lactating women aged 19-40 years in areas with high environment iodine level (>300 μg/L) or proper environment iodine level (50-100 μg/L) in Shanxi in 2014. The general information, urine samples and blood samples of the women surveyed and water samples were collected. The water and urine iodine levels were detected with arsenic and cerium catalysis spectrophotometric method, the blood TSH level was detected with electrochemiluminescence immunoassay, and thyroid stimulating hormone (FT(4)), antithyroid peroxidase autoantibody (TPOAb) and anti-thyroglobulin antibodies (TGAb) were detected with chemiluminescence immunoassay. Results: The median urine iodine levels of the four groups were 221.9, 282.5, 814.1 and 818.6 μg/L, respectively. The median serum FT(4) of lactating women in high iodine area and proper iodine area were 12.96 and 13.22 pmol/L, and the median serum TSH was 2.45 and 2.17 mIU/L, respectively. The median serum FT(4) of pregnant women in high iodine area and proper iodine area were 14.66 and 16.16 pmol/L, and the median serum TSH was 2.13 and 1.82 mIU/L, respectively. The serum FT(4) levels were lower and the abnormal rates of serum TSH were higher in lactating women than in pregnant women in both high iodine area and proper iodine area, the difference was statistically significant (FT(4): Z =-6.677, -4.041, P <0.01; TSH: Z =8.797, 8.910, P <0.01). In high iodine area, the abnormal rate of serum FT(4) in lactating women was higher than that in pregnant women, the difference was statistically significant ( Z =7.338, P =0.007). The serum FT(4) level of lactating women in high iodine area was lower than that in proper iodine area, the difference was statistically significant ( Z =-4.687, P =0.000). In high iodine area, the median serum FT(4) in early pregnancy, mid-pregnancy and late pregnancy was 16.26, 14.22 and 14.80 pmol/L, respectively, and the median serum TSH was 1.74, 1.91 and 2.38 mIU/L, respectively. In high iodine area, the serum FT(4) level in early pregnancy was higher than that in mid-pregnancy and late pregnancy, and the serum TSH level was lower than that in mid-pregnancy and late pregnancy, the difference was statistically significant (FT(4): Z =-2.174, -2.238, P <0.05; TSH: Z =-2.985, -1.978, P <0.05). There were no significant differences in the positive rates of serum thyroid autoantibodies among the four groups of women and women in different periods of pregnancy ( P >0.05). The morbidity rates of subclinical hyperthyroidism in pregnant women and lactating women in high iodine area were obviously higher than those in proper iodine areas, the difference was statistically significant ( χ (2)=5.363, 5.007, P <0.05). Conclusions: Excessive iodine intake might increase the risk of subclinical hypothyroidism in pregnant women and lactating women. It is suggested to strengthen the iodine nutrition and thyroid function monitoring in women, pregnant women and lactating women in areas with high environmental iodine.

Prevalence of Thyroid Dysfunction in a Large Southern European Population Analysis of modulatory factors The APNA Study.

PubMed

Santos Palacios, Silvia; Llavero Valero, María; Brugos-Larumbe, Antonio; Díez, Juan José; Guillén-Grima, Francisco; Galofré, Juan C

2018-06-12

To study the prevalence of thyroid dysfunction in a very large unselected population. To determine the prevalence of abnormal thyroid function and evaluate potential modulatory factors. The Estudio de Atención Primaria de Navarra, The APNA Study, is a cross-sectional study conducted in northern Spain. It involved 303,883 people, of 20 years of age and older, who live in the Navarra region. Participants are covered by the public healthcare system and medical records are digitalized. The information was gathered from e-registered data regarding serum thyrotropin (TSH), thyroid hormones, thyroid antibody concentration, and clinical context. Measurements were logged (demographic information and potential thyroid function modulatory factors). Serum TSH (mU/L) normal range was established at 0.7-4.28. At the time of the study 87% of the Navarra population had a TSH level within the normal range. Mean serum TSH in euthyroid individuals was higher in women (2.15) than in men (1.96); (P<0.001); and higher in the obese with body mass index (BMI) ≥30 kg/m 2 (2.12) as compared to the non-obese, BMI <30 kg/m 2 , (2.06); (P <0.001). Mean TSH for the entire population was 1.9. The native Spanish population had statistically significantly lower TSH (1.87) than non-native Spanish (2.15); (P <0.001). Additionally, we observed that serum TSH levels decreased with age and an increase in the prevalence of hypothyroidism in the elderly and among people with low income levels. The prevalence of thyroid dysfunction in Navarra was 12.3%. The prevalence of hypothyroidism (or high TSH) in the population was 8.8% (13.3% in women, 4.2% in men) and the prevalence of hyperthyroidism (or low TSH) was 4.3% (5.6% in women, 3.0% in men). Nearly 15% of the general population suffers from biochemical thyroid dysfunction. The serum TSH level appears to be influenced by sex, BMI, age, ethnic origin and socio-economic status. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Impact of TSH during the first trimester of pregnancy on obstetric and foetal complications: Usefulness of 2.5 mIU/L cut-off value.

PubMed

Hernández, Marta; López, Carolina; Soldevila, Berta; Cecenarro, Laura; Martínez-Barahona, María; Palomera, Elisabet; Rius, Ferran; Lecube, Albert; Pelegay, Maria José; García, Jordi; Mauricio, Dídac; Puig Domingo, Manel

2018-05-01

An association of pregnancy outcomes with subclinical hypothyroidism has been reported; however, there still exists a strong controversy regarding whether subclinical hypothyroidism ought to be dealt with or not. The objective of the study was to evaluate the association of foetal-maternal complications with first trimester maternal Thyrotropin (TSH) values. A retrospective study in a single tertiary care hospital was performed. A total of 1981 pregnant women were studied during 2012. Thyrotropin (TSH) universal screening was performed between 9 and 12 weeks of gestation. Outcomes included foetal-maternal complications and newborn health parameters. Median TSH was 1.72 (0.99-2.61) mIU/L. The incidence of perinatal loss, miscarriage and stillbirth was 7.2%, 5.9% and 1.1%, respectively. Median TSH of women with and without miscarriage was 1.97 (1.29-3.28) vs 1.71 (0.96-2.58) mIU/L (P = .009). Incidence of pre-eclampsia was 3.2%; TSH in these women was 2.10 (1.40-2.74) vs 1.71 (0.98-2.59) mIU/L in those without (P = .027). TSH in women with dystocia in labour was 1.76 (1.00-2.53) vs 1.68 (0.94-2.59) mIU/L in those who gave birth with normal progression (P = .044). Women with TSH 2.5-5.1 mIU/L had a higher risk of perinatal loss [OR 1.589 (1.085-2.329)], miscarriage [OR 1.702 (1.126-2.572)] and premature birth [OR 1.39 (1.013-1.876)], adjusted by mother's age. There was no association with the other outcomes analysed. There is a positive association between maternal TSH in the first trimester of pregnancy and the incidence of perinatal loss and miscarriage. The TSH cut-off value of 2.5 mIU/L identified women with higher adverse pregnancy outcomes. © 2018 John Wiley & Sons Ltd.

Thyroid function appears to be significantly reduced in Space-borne MDS mice

NASA Astrophysics Data System (ADS)

Saverio Ambesi-Impiombato, Francesco; Curcio, Francesco; Fontanini, Elisabetta; Perrella, Giuseppina; Spelat, Renza; Zambito, Anna Maria; Damaskopoulou, Eleni; Peverini, Manola; Albi, Elisabetta

It is known that prolonged space flights induced changes in human cardiovascular, muscu-loskeletal and nervous systems whose function is regulated by the thyroid gland but, until now, no data were reported about thyroid damage during space missions. We have demonstrated in vitro that, during space missions (Italian Soyuz Mission "ENEIDE" in 2005, Shuttle STS-120 "ESPERIA" in 2007), thyroid in vitro cultured cells did not respond to thyroid stimulating hor-mone (TSH) treatment; they appeared healthy and alive, despite their being in a pro-apopotic state characterised by a variation of sphingomyelin metabolism and consequent increase in ce-ramide content. The insensitivity to TSH was largely due to a rearrangement of specific cell membrane microdomains, acting as platforms for TSH-receptor (TEXUS-44 mission in 2008). To study if these effects were present also in vivo, as part of the Mouse Drawer System (MDS) Tissue Sharing Program, we performed experiments in mice maintained onboard the Interna-tional Space Station during the long-duration (90 days) exploration mission STS-129. After return to earth, the thyroids isolated from the 3 animals were in part immediately frozen to study the morphological modification in space and in part immediately used to study the effect of TSH treatment. For this purpose small fragments of tissue were treated with 10-7 or 10-8 M TSH for 1 hour by using untreated fragments as controls. Then the fragments were fixed with absolute ethanol for 10 min at room temperature and centrifuged for 20 min. at 3000 x g. The supernatants were used for cAMP analysis whereas the pellet were used for protein amount determination and for immunoblotting analysis of TSH-receptor, sphingomyelinase and sphingomyelin-synthase. The results showed a modification of the thyroid structure and also the values of cAMP production after treatment with 10-7 M TSH for 1 hour were significantly lower than those obtained in Earth's gravity. The treatment with TSH induced relevant quanti-tative variations of TSH-receptor, sphingomyelinase and sphingomyelin-synthase, probably due to membrane microdomain structure modifications which in turn, as it occurs in vitro, influence the cellular response to TSH treatment.

β-Arrestin-1 mediates thyrotropin-enhanced osteoblast differentiation.

PubMed

Boutin, Alisa; Eliseeva, Elena; Gershengorn, Marvin C; Neumann, Susanne

2014-08-01

Thyrotropin (TSH) activation of the TSH receptor (TSHR), a 7-transmembrane-spanning receptor (7TMR), may have osteoprotective properties by direct effects on bone. TSHR activation by TSH phosphorylates protein kinases AKT1, p38α, and ERK1/2 in some cells. We found TSH-induced phosphorylation of these kinases in 2 cell lines engineered to express TSHRs, human embryonic kidney HEK-TSHR cells and human osteoblastic U2OS-TSHR cells. In U2OS-TSHR cells, TSH up-regulated pAKT1 (7.1±0.5-fold), p38α (2.9±0.4-fold), and pERK1/2 (3.1±0.2-fold), whereas small molecule TSHR agonist C2 had no or little effect on pAKT1 (1.8±0.08-fold), p38α (1.2±0.09-fold), and pERK1/2 (1.6±0.19-fold). Furthermore, TSH increased expression of osteoblast marker genes ALPL (8.2±4.6-fold), RANKL (21±5.9-fold), and osteopontin (OPN; 17±5.3-fold), whereas C2 had little effect (ALPL, 1.7±0.5-fold; RANKL, 1.3±0.6-fold; and OPN, 2.2±0.7-fold). β-Arrestin-1 and -2 can mediate activatory signals by 7TMRs. TSH stimulated translocation of β-arrestin-1 and -2 to TSHR, whereas C2 failed to translocate either β-arrestin. Down-regulation of β-arrestin-1 by siRNA inhibited TSH-stimulated phosphorylation of ERK1/2, p38α, and AKT1, whereas down-regulation of β-arrestin-2 increased phosphorylation of AKT1 in both cell types and of ERK1/2 in HEK-TSHR cells. Knockdown of β-arrestin-1 inhibited TSH-stimulated up-regulation of mRNAs for OPN by 87 ± 1.7% and RANKL by 73 ± 2.4%, and OPN secretion by 74 ± 10%. We conclude that TSH enhances osteoblast differentiation in U2OS cells that is, in part, caused by activatory signals mediated by β-arrestin-1. © FASEB.

Relapse of Graves' disease after successful outcome of antithyroid drug therapy: results of a prospective randomized study on the use of levothyroxine.

PubMed

Hoermann, Rudolf; Quadbeck, Beate; Roggenbuck, Ulla; Szabolcs, István; Pfeilschifter, Johannes; Meng, Wieland; Reschke, Kirsten; Hackenberg, Klaus; Dettmann, Juergen; Prehn, Brigitte; Hirche, Herbert; Mann, Klaus

2002-12-01

Antithyroid drugs are effective in restoring euthyroidism in Graves' disease, but many patients experience relapse after withdrawal. Prevention of recurrence would therefore be a desirable goal. In a prospective study, patients with successful outcome of 12 to 15 months antithyroid drug therapy were stratified for risk factors and randomly assigned to receive levothyroxine in a variable thyrotropin (TSH)-suppressive dose for 2 years or no treatment. The levothyroxine group was randomized to continue or discontinue levothyroxine after 1 year. End points included relapse of overt hyperthyroidism. Of 346 patients with Graves' disease enrolled 225 were euthyroid 4 weeks after antithyroid drug withdrawal and were randomly assigned to receive levothyroxine (114 patients) or no treatment (controls, 111 patients). Of those not randomized, 39 patients showed early relapse within 4 weeks, 61 endogenous TSH suppression, 7 TSH elevation, and 14 had to be excluded. Dropout rate during the study were 13.3%. Kaplan-Meier analyses showed relapse rates to be similar in the levothyroxine group (20% after 1 year, 32% after 2 years) and the randomized controls (18%, 24%), whereas relapses were significantly more frequent in the follow-up group of patients with endogenously suppressed TSH (33%, 49%). Levothyroxine therapy did not influence TSH-receptor antibody, nor did it reduce goiter size. The best prognostic marker available was basal TSH determined 4 weeks after withdrawal of antithyroid drugs (posttreatment TSH). The study demonstrates that levothyroxine does not prevent relapse of hyperthyroidism after successful restoration of euthyroid function by antithyroid drugs and characterizes posttreatment TSH as a main prognostic marker.

Thyrotropin Suppressive Therapy for Low-Risk Small Thyroid Cancer: A Propensity Score-Matched Cohort Study.

PubMed

Park, Suyeon; Kim, Won Gu; Han, Minkyu; Jeon, Min Ji; Kwon, Hyemi; Kim, Mijin; Sung, Tae-Yon; Kim, Tae Yong; Kim, Won Bae; Hong, Suck Joon; Shong, Young Kee

2017-09-01

Thyrotropin (TSH) suppression has improved the clinical outcomes of patients with differentiated thyroid cancer (DTC). However, the efficacy of TSH suppressive therapy (TST) is unclear in patients with low-risk DTC. This study aimed to evaluate the efficacy of TST and optimal TSH levels of patients with low-risk DTC. This retrospective propensity score-matched cohort study included DTC patients (n = 446) who underwent lobectomy from 2002 to 2008 with or without TST (TST group and No-TST group). Disease-free survival (DFS) and dynamic risk stratification were compared between both groups using serum TSH levels. Approximately 74% of TST patients and 11% of No-TST patients had suppressed serum TSH levels (<2 mIU/L). The median follow-up period was 8.6 years. During follow-up, the disease recurred in 10 (2.7%) patients, with no significant difference in DFS between the groups (p = 0.63). The proportion of patients with excellent treatment response was similar between the TST (65.2%) and No-TST (64.4%) groups. Incomplete biochemical response was noted in 17.2% of the TST group patients and 9.4% of the No-TST group patients. No significant difference was observed in the DFS between both groups by comparing serum TSH level (p = 0.57). TST did not improve clinical outcomes, and serum TSH levels were not associated with recurrence in patients with low-risk small DTC. No clinical benefits were shown for TSH suppression in low-risk patients who underwent lobectomy. Thus, levothyroxine is not necessary for patients without evidence of hypothyroidism.

Evaluation of predictors for the diagnosis of hyperthyroidism in cats.

PubMed

Wakeling, Jennifer; Elliott, Jonathan; Syme, Harriet

2011-01-01

In humans, subclinical hyperthyroidism is diagnosed when serum thyroid hormone concentrations are within the reference range but thyroid stimulating hormone (TSH) concentration is subnormal. In a previous study, a higher prevalence of thyroid nodular disease was found in euthyroid geriatric cats with undetectable TSH (<0.03 ng/mL) compared to those with detectable TSH concentrations, suggesting subclinical hyperthyroidism might also exist in cats. Euthyroid cats with undetectable TSH concentrations have subclinical hyperthyroidism and may subsequently develop overt signs of hyperthyroidism. One-hundred four client-owned cats. In this prospective cohort study, euthyroid geriatric (≥ 9 years) cats were recruited during routine health checks. Plasma biochemistry was performed at baseline and every 6 months thereafter. Total thyroxine and TSH concentrations were determined annually. Short-term follow-up data (within 14 months of recruitment) were used to detect variables at entry that were predictive of the diagnosis of hyperthyroidism, using univariable analysis followed by multivariable logistic regression analysis. Log rank analysis was used to test the association of initial TSH concentration with diagnosis of hyperthyroidism during the total available follow-up. Median (range) follow-up was 26 (0-54) months and annual incidence of hyperthyroidism during the study was 7.4%. Cats that became hyperthyroid within 14 months had higher ALKP activity (P = 0.02) and higher prevalence of goiter (P = .03) at baseline than controls. Cats with undetectable TSH at baseline (29/104; 28%) were significantly (P < .001) more likely to be diagnosed with hyperthyroidism. However, not all cats with undetectable TSH became hyperthyroid during the study. Copyright © 2011 by the American College of Veterinary Internal Medicine.

TSH/IGF-1 Receptor Cross-Talk Rapidly Activates Extracellular Signal-Regulated Kinases in Multiple Cell Types.

PubMed

Krieger, Christine C; Perry, Joseph D; Morgan, Sarah J; Kahaly, George J; Gershengorn, Marvin C

2017-10-01

We previously showed that thyrotropin (TSH)/insulinlike growth factor (IGF)-1 receptor cross-talk appears to be involved in Graves' orbitopathy (GO) pathogenesis and upregulation of thyroid-specific genes in human thyrocytes. In orbital fibroblasts from GO patients, coadministration of TSH and IGF-1 induces synergistic increases in hyaluronan secretion. In human thyrocytes, TSH plus IGF-1 synergistically increased expression of the sodium-iodide symporter that appeared to involve ERK1/2 activation. However, the details of ERK1/2 activation were not known, nor was whether ERK1/2 was involved in this synergism in other cell types. Using primary cultures of GO fibroblasts (GOFs) and human thyrocytes, as well as human embryonic kidney (HEK) 293 cells overexpressing TSH receptors (HEK-TSHRs), we show that simultaneous activation of TSHRs and IGF-1 receptors (IGF-1Rs) causes rapid, synergistic phosphorylation/activation of ERK1 and ERK2 in all three cell types. This effect is partially inhibited by pertussis toxin, an inhibitor of TSHR coupling to Gi/Go proteins. In support of a role for Gi/Go proteins in ERK1/2 phosphorylation, we found that knockdown of Gi(1-3) and Go in HEK-TSHRs inhibited ERK1/2 phosphorylation stimulated by TSH and TSH plus IGF-1. These data demonstrate that the synergistic effects of TSH plus IGF-1 occur early in the TSHR signaling cascade and further support the idea that TSHR/IGF-1R cross-talk is an important mechanism for regulation of human GOFs and thyrocytes.

Adaptive Transmission and Channel Modeling for Frequency Hopping Communications

DTIC Science & Technology

2009-09-21

proposed adaptive transmission method has much greater system capacity than conventional non-adaptive MC direct- sequence ( DS )- CDMA system. • We...several mobile radio systems. First, a new improved allocation algorithm was proposed for multicarrier code-division multiple access (MC- CDMA ) system...Multicarrier code-division multiple access (MC- CDMA ) system with adaptive frequency hopping (AFH) has attracted attention of researchers due to its

Lower-normal TSH is associated with better metabolic risk factors: a cross-sectional study on spanish men

USDA-ARS?s Scientific Manuscript database

Background and aims: Subclinical thyroid conditions, defined by normal thyroxin (T4) but abnormal thyroid-stimulating hormone (TSH) levels, may be associated with cardiovascular and metabolic risk. More recently, TSH levels within the normal range have been suggested to be associated with metabolic ...

Effective visualization of suppressed thyroid tissue by means of baseline 99mTc-methoxy isobutyl isonitrile in comparison with 99mTc-pertechnetate scintigraphy after TSH stimulation.

PubMed

Vattimo, A; Bertelli, P; Burroni, L

1992-01-01

Baseline 99mTc-MIBI thyroid scintigraphy was compared with 99mTc-pertechnetate scintigraphy after TSH stimulation in seven patients with suppressed thyroid tissue due to an autonomously functioning thyroid nodule (AFTN). In all patients the suppressed thyroid tissue was visualized by means of both baseline 99mTc-MIBI and post-TSH 99mTc-pertechnetate scintigraphy, and in some cases the former technique provided better visualization. In one patient presenting a "warm" nodule T3-suppression did not affect the nodular/extranodular uptake ratio of 99mTc-MIBI, whereas the 99mTc-pertechnetate uptake ratio increased significantly. This leads us to hypothesize that the thyroid uptake of 99mTc-MIBI is not related to TSH control, but rather to other mechanisms such as the blood flow. Since exogenous TSH is no longer available, 99mTc-MIBI scintigraphy can be successfully used in the place of repeated 99mTc-pertechnetate scintigraphy after TSH stimulation in the assessment of AFTN.

Transient neonatal hypothyroidism due to transplacental transfer of maternal immunoglobulins that inhibit TSH binding, TSH-induced cAMP increase and cell growth.

PubMed

Cho, B Y; Shong, Y K; Lee, H K; Koh, C S; Min, H K; Lee, M

1988-12-01

Transient neonatal hypothyroidism due to transplacental transfer of maternal blocking type TSH receptor antibodies (TRAb) was found in a baby born to a 27-yr-old mother, who had been receiving thyroxine medication for primary myxedema. Maternal IgG inhibited radiolabelled TSH binding to its receptor (TBII), TSH-stimulated thyroid adenylate cyclase (AC) activation (TSII) and TSH-stimulated 3H-thymidine uptake (TGII) in cultured rat thyroid cells (FRTL-5). At birth, the baby's IgG showed similar activities to maternal IgG but all these activities decreased gradually, and disappeared from her serum within 12 weeks of age. In the baby, initially nonvisualized thyroid was clearly visualized on 99 m-Tc thyroid scintigraphy when all these blocking activities disappeared, TSII and TGII being decreased more slowly than TBII, and the baby remained euthyroid after discontinuation of thyroxine. This study suggests that such IgGs induced hypothyroidism and thyroid atrophy in the mother and were responsible for transient neonatal hypothyroidism in the baby.

HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.

PubMed

Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar

2018-05-08

HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.

Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

PubMed

Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

2016-09-01

[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping

PubMed Central

Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

2016-01-01

[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results. PMID:27799670

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Discovery of a Positive Allosteric Modulator of the Thyrotropin Receptor: Potentiation of Thyrotropin-Mediated Preosteoblast Differentiation In Vitro

PubMed Central

Eliseeva, Elena; Boutin, Alisa; Barnaeva, Elena; Ferrer, Marc; Southall, Noel; Kim, David; Hu, Xin; Morgan, Sarah J.; Marugan, Juan J.; Gershengorn, Marvin C.

2018-01-01

Recently, we showed that TSH-enhanced differentiation of a human preosteoblast-like cell model involved a β-arrestin 1 (β-Arr 1)-mediated pathway. To study this pathway in more detail, we sought to discover a small molecule ligand that was functionally selective toward human TSH receptor (TSHR) activation of β-Arr 1. High-throughput screening using a cell line stably expressing mutated TSHRs and mutated β-Arr 1 (DiscoverX1 cells) led to the discovery of agonists that stimulated translocation of β-Arr 1 to the TSHR, but did not activate Gs-mediated signaling pathways, i.e., cAMP production. D3-βArr (NCGC00379308) was selected. In DiscoverX1 cells, D3-βArr stimulated β-Arr 1 translocation with a 5.1-fold greater efficacy than TSH and therefore potentiated the effect of TSH in stimulating β-Arr 1 translocation. In human U2OS-TSHR cells expressing wild-type TSHRs, which is a model of human preosteoblast-like cells, TSH upregulated the osteoblast-specific genes osteopontin (OPN) and alkaline phosphatase (ALPL). D3-βArr alone had only a weak effect to upregulate these bone markers, but D3-βArr potentiated TSH-induced upregulation of ALPL and OPN mRNA levels 1.6-fold and 5.5-fold, respectively, at the maximum dose of ligands. Furthermore, the positive allosteric modulator effect of D3-βArr resulted in an increase of TSH-induced secretion of OPN protein. In summary, we have discovered the first small molecule positive allosteric modulator of TSHR. As D3-βArr potentiates the effect of TSH to enhance differentiation of a human preosteoblast in an in vitro model, it will allow a novel experimental approach for probing the role of TSH-induced β-Arr 1 signaling in osteoblast differentiation. PMID:29089368

Discovery of a Positive Allosteric Modulator of the Thyrotropin Receptor: Potentiation of Thyrotropin-Mediated Preosteoblast Differentiation In Vitro.

PubMed

Neumann, Susanne; Eliseeva, Elena; Boutin, Alisa; Barnaeva, Elena; Ferrer, Marc; Southall, Noel; Kim, David; Hu, Xin; Morgan, Sarah J; Marugan, Juan J; Gershengorn, Marvin C

2018-01-01

Recently, we showed that TSH-enhanced differentiation of a human preosteoblast-like cell model involved a β -arrestin 1 ( β -Arr 1)-mediated pathway. To study this pathway in more detail, we sought to discover a small molecule ligand that was functionally selective toward human TSH receptor (TSHR) activation of β -Arr 1. High-throughput screening using a cell line stably expressing mutated TSHRs and mutated β -Arr 1 (DiscoverX1 cells) led to the discovery of agonists that stimulated translocation of β -Arr 1 to the TSHR, but did not activate G s -mediated signaling pathways, i.e., cAMP production. D3- β Arr (NCGC00379308) was selected. In DiscoverX1 cells, D3- β Arr stimulated β -Arr 1 translocation with a 5.1-fold greater efficacy than TSH and therefore potentiated the effect of TSH in stimulating β -Arr 1 translocation. In human U2OS-TSHR cells expressing wild-type TSHRs, which is a model of human preosteoblast-like cells, TSH upregulated the osteoblast-specific genes osteopontin (OPN) and alkaline phosphatase (ALPL). D3- β Arr alone had only a weak effect to upregulate these bone markers, but D3- β Arr potentiated TSH-induced upregulation of ALPL and OPN mRNA levels 1.6-fold and 5.5-fold, respectively, at the maximum dose of ligands. Furthermore, the positive allosteric modulator effect of D3- β Arr resulted in an increase of TSH-induced secretion of OPN protein. In summary, we have discovered the first small molecule positive allosteric modulator of TSHR. As D3- β Arr potentiates the effect of TSH to enhance differentiation of a human preosteoblast in an in vitro model, it will allow a novel experimental approach for probing the role of TSH-induced β -Arr 1 signaling in osteoblast differentiation. U.S. Government work not protected by U.S. copyright.

Localization of the aromatase enzyme expression in the human pituitary gland and its effect on growth hormone, prolactin, and thyroid stimulating hormone axis.

PubMed

Caglar, Asli Sezgin; Kapucu, Aysegul; Dar, Kadriye Akgun; Ozkaya, Hande Mefkure; Caglar, Erkan; Ince, Haluk; Kadioglu, Pinar

2015-08-01

The aim of this study is to evaluate aromatase expression in prolactin (PRL), thyroid stimulating hormone (TSH), and growth hormone (GH) secreting cells. Nontumoral human pituitary specimens were obtained from autopsy samples. Aromatase co-expression was determined by double immunohistochemical staining and assessed using H scores. H scores for GH-aromatase co-expression (GH-aromatase), TSH-aromatase co-expression (TSH-aromatase), and PRL-aromatase co-expression (PRL-aromatase) were 83.1 ± 13.1, 95.6 ± 16.1, and 83.7 ± 14.5, respectively. TSH producing cells exhibited the highest H score for co-expression of aromatase (p < 0.001). There was no gender difference in terms of H scores for aromatase expression and double immunohistochemical staining results (p > 0.05 for all). There was a negative correlation between the H scores for aromatase and PRL-aromatase, GH-aromatase and TSH-aromatase, respectively (r = -0.592, p < 0.001; r = -0.593, p < 0.001; r = -0.650, p < 0.001, respectively). Also, H scores for aromatase co-expression of each hormone were negatively correlated with the H scores for the corresponding hormone (r = -0.503, p < 0.001 for PRL-aromatase and PRL; r = -0.470, p < 0.001 for GH-aromatase, and GH; r = -0.641, p < 0.001 for TSH-aromatase and TSH). H scores for mean aromatase, GH-aromatase, TSH-aromatase were invariant of age (p > 0.05 for all). Age was negatively correlated with PRL-aromatase H score (r = -0.373, p = 0.008). Our study demonstrated significant aromatase co-expression in PRL, GH, and TSH secreting cells of the human anterior pituitary gland. The mutual paracrinal regulation between aromatase and three adenohypophyseal hormones indicates that aromatase may have a regulatory role on the synthesis and secretion of these hormones.

Assessment of thyroid function during first-trimester pregnancy: what is the rational upper limit of serum TSH during the first trimester in Chinese pregnant women?

PubMed

Li, Chenyan; Shan, Zhongyan; Mao, Jinyuan; Wang, Weiwei; Xie, Xiaochen; Zhou, Weiwei; Li, Chenyang; Xu, Bin; Bi, Lihua; Meng, Tao; Du, Jianling; Zhang, Shaowei; Gao, Zhengnan; Zhang, Xiaomei; Yang, Liu; Fan, Chenling; Teng, Weiping

2014-01-01

Guidelines of the American Thyroid Association (ATA) proposed that the upper limit of the TSH reference range should be 2.5 mIU/L in first trimester, but the reported ranges in China are significantly higher. Our objective was to establish a rational reference range of serum TSH for diagnosis of subclinical hypothyroidism in the first trimester of pregnant women in China. We screened 4800 pregnant women in the first trimester and 2000 women who planned to become pregnant and evaluated 535 pregnant women in follow-up visits during the second and third trimester. Median concentrations of serum TSH decreased significantly from the seventh week of gestation. The median of TSH from 4 to 6 weeks was significantly higher than from 7 to 12 weeks (2.15 [0.56-5.31] mIU/L vs 1.47 [0.10-4.34] mIU/L, P<.001); however, there was no significant difference compared with nonpregnant women (2.07 [0.69-5.64] mIU/L; P=.784). The median of free T4 was not significantly altered in the first trimester. The prevalence of subclinical hypothyroidism in the 4800 pregnant women was 27.8% on the diagnostic criteria of TSH>2.5 mIU/L and 4.0% using the reference interval derived by our laboratory (0.14-4.87 mIU/L).Additionally, of 118 pregnant women who had serum TSH>2.5 mIU/L in the first trimester, only 30.0% and 20.3% of them at the 20th and 30th week of gestation had TSH>3.0 mIU/L. The reference range for nonpregnant women can be used for the assessment of pregnant women at 4 to 6 weeks of gestation. The upper limit of serum TSH in the first trimester was much higher than 2.5 mIU/L in Chinese pregnant women.

Hyperthyroidism caused by a pituitary thyrotrophin-secreting tumour with excessive secretion of thyrotrophin-releasing hormone and subsequently followed by Graves' disease in a middle-aged woman.

PubMed

Kamoi, K; Mitsuma, T; Sato, H; Yokoyama, M; Washiyama, K; Tanaka, R; Arai, O; Takasu, N; Yamada, T

1985-11-01

A 46-year-old woman had signs of thyrotoxicosis and galactorrhoea. Serum immunoreactive TSH and its alpha-subunit increased in the presence of high serum triiodothyronine (T3), thyroxine (T4), and free T4 concentrations, whereas beta-subunit TSH was undetectable. Exogenous TRH failed to increase serum TSH. Serum TSH was markedly suppressed by glucocorticoid, but was increased by antithyroid drug. L-Dopa or bromocriptine partially suppressed, but nomifensine had no influence on serum TSH. Serum prolactin (Prl) was above normal and markedly increased by TRH, but depressed by bromocriptine and not suppressed by nomifensine. Plasma TRH was normal in the hyperthyroid state, but was increased by glucocorticoid and antithyroid drug. Excess thyroid hormone depressed plasma TRH concentrations. Basal serum GH levels were constantly low. Transsphenoidal removal of the tumour normalized serum hormones (T3, T4 free T4, TSH, alpha-subunit and Prl), and eradicated the clinical signs of hyperthyroidism and galactorrhoea. Histological study of the tumour tissue demonstrated both thyrotrophes and somatotrophes. A reciprocal relationship between serum TSH and T4 concentrations shifted to a higher level before but was normalized after removal of the tumour. Ten months later, the clinical signs of thyrotoxicosis and the increase in serum thyroid hormone recurred without a concomitant increase in serum TSH and its alpha-subunit. Thyroidal auto-antibodies were slightly positive, but thyrotrophin-binding inhibitor immunoglobulin (TBII) was negative. Administration of antithyroid drug produced a euthyroid state, but 3 years later, discontinuation of the treatment resulted in recurrent hyperthyroidism without suppressed plasma TRH and with no evidence of regrowth of the pituitary tumour. It is suggested that the patient initially had hyperthyroidism owing to excessive TSH secretion from the tumour caused by abnormal TRH secretion, and subsequently had hyperthyroidism owing to Graves' disease.

Thyroid Signaling, Insulin Resistance, and 2 Diabetes Mellitus: A Mendelian Randomization Study.

PubMed

Bos, Maxime M; Smit, Roelof A J; Trompet, Stella; van Heemst, Diana; Noordam, Raymond

2017-06-01

Increasing evidence suggests an association between thyroid-stimulating hormone (TSH), free thyroxine (fT4), and deiodinases with insulin resistance and type 2 diabetes mellitus (T2D). We examined whether TSH and fT4 levels and deiodinases are causally associated with insulin resistance and T2D, using Mendelian randomization. We selected 20 genetic variants for TSH level and four for fT4 level (identified in a genome-wide association study (GWAS) meta-analysis of European-ancestry cohorts) as instrumental variables for TSH and fT4 levels, respectively. We used summary data from GWASs on the outcomes T2D [Diabetes, Genetics Replication and Meta-analysis (DIAGRAM), n = 12,171 cases and n = 56,862 control subjects] and glycemic traits in patients without diabetes [Meta-Analyses of Glucose and Insulin-Related Traits Consortium (MAGIC), n = 46,186 for fasting glucose and insulin and n = 46,368 for hemoglobin A1c]. To examine whether the associations between TSH/fT4 levels and the study outcomes were causal, we combined the effects of the genetic instruments. Furthermore, we examined the associations among 16 variants in DIO1, DIO2, DIO3, and T2D and glycemic traits. We found no evidence for an association between the combined genetic instrumental variables for TSH and fT4 and the study outcomes. For example, we did not observe a genetically determined association between high TSH level and T2D (odds ratio, 0.91 per standard deviation TSH increase; 95% confidence interval, 0.78 to 1.07). Selected genetic variants in DIO1 (e.g., rs7527713) were associated with measures of insulin resistance. We found no evidence for a causal association between circulatory levels of TSH and fT4 with insulin resistance and T2D, but we found suggestive evidence that DIO1 affects glucose metabolism. Copyright © 2017 by the Endocrine Society

Psychoneuroendocrine effects of combined thyroxine and triiodothyronine versus tyrosine during prolonged Antarctic residence.

PubMed

Palinkas, Lawrence A; Reedy, Kathleen R; Smith, Mark; Anghel, Mihai; Steel, Gary D; Reeves, Dennis; Shurtleff, David; Case, H Samuel; Van Do, Nhan; Reed, H Lester

2007-12-01

We previously reported that cognitive function improves with thyroxine and that there is a circannual pattern to mood and human TSH during Antarctic residence. To extend these findings, we examined the effects of tyrosine and a combined levothyroxine/liothyronine supplement in euthyroid men and women who spent the austral summer (n = 43) and/or winter (n = 42) in Antarctica. Randomized, placebo-controlled, clinical trial. Subjects were randomized to receive the following each day for 91.6 +/- 3.2 days in summer and/or 138.0 +/- 3.2 days in winter: (1) 12g tyrosine mixed in 113g applesauce; (2) 50 microg of levothyroxine and 12.5 microg of liothyronine (T4-T3 Supplement); or (3) placebo. Cognitive performance and mood were assessed using the Automatic Neuropsychological Assessment Metric - Isolated and Confined Environments. With placebo in summer, mood did not change while TSH decreased by 28%; in winter, there was a 136% degradation in mood (p < 0.01) and TSH increased by 18%. With combined T4-T3 supplement, there was a 51% degradation in mood in summer compared with placebo (p < 0.05) and TSH decreased by 57%; in winter there was a 135% degradation in mood while TSH was reduced by 26% (p < 0.05). Tyrosine use in summer was associated with no change in mood and a 30% decline in TSH, while in winter there was a 47% improvement in mood and TSH decreased by 28% along with a 6% increase in fT3 (p < 0.05). Administration of tyrosine leads to a significant reduction in serum TSH and improvement in mood in winter compared with placebo, while the combined T4-T3 supplement leads to a worsening of mood in summer and no improvement in winter. There appears to be a seasonal influence on the psychological response to interventions and the relationship to changes in TSH reductions.

Thyroid function testing in primary care: overused and under-evidenced? A study examining which clinical features correspond to an abnormal thyroid function result.

PubMed

Werhun, Alexander; Hamilton, William

2015-04-01

Diagnostic testing is increasing in primary care, including for thyroid disease. This study examined which clinical features were associated with an abnormal thyroid stimulating hormone (TSH) result. This was a cross-sectional study in one general practice of 16,487 patients in Exeter, Devon, UK. We examined the primary care records relating to every TSH test taken in the year from August 2012, and extracted symptoms and/or the indication for testing. Associations with an abnormal result were tested using multivariable logistic regression. A cohort study was then performed of 100 patients newly recorded with each of the six features associated with an abnormal test result in the cross-sectional study, and the proportions tested for TSH and the results of that testing identified. Two thousand thirty-five patients (12% of the practice population) had TSH testing in the year. Of these 35 (1.7%) had a TSH >4.5 mIU/l, suggesting hypothyroidism, and 7 (0.3%) had TSH <0.01 mIu/l suggesting hyperthyroidism. Features associated with an abnormal TSH were: pregnancy, odds ratio 41 (95% confidence interval 9.3-180), constipation 9.7 (2.1-45), palpitations 23 (3.4-150), hair loss, 21 (2.0-230), weight gain, 18 (1.6-190) and diarrhoea, 13 (1.2-130); in separate analyses only pregnancy and constipation were associated with a raised TSH, and the remaining four features with a low TSH. The diagnostic yield of thyroid disease in this study was 2.1% suggests testing could be better targeted without missing diagnoses. The symptoms associated with thyroid disease differ from those generally reported. This may represent fewer patients presenting with advanced disease. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Serum thyrotrophin at baseline predicts the natural course of subclinical hyperthyroidism.

PubMed

Das, G; Ojewuyi, T A; Baglioni, P; Geen, J; Premawardhana, L D; Okosieme, O E

2012-07-01

Optimal therapeutic strategies for subclinical hyperthyroidism are undecided. Overt disease develops in a minority of cases, but the risk factors for progression remain unclear. We examined whether a baseline thyrotrophin (TSH) predicted progression to overt hyperthyroidism in asymptomatic individuals with subclinical hyperthyroidism. This was a retrospective study of 323 patients with subclinical hyperthyroidism seen in our institution from 2003 to 2010 (mean age 71 years, males 26·9%, females 73·1%, mean follow-up duration 32 months, range 6-93 months). Serum TSH and free thyroxine (FT4) were documented at baseline and during follow-up. After excluding individuals with nonthyroid causes of low TSH, patients were grouped according to initial TSH as: TSH 0·10-0·39 mU/l (grade I) and TSH < 0·10 mU/l (grade II). Only 38 patients (11·8%) developed overt hyperthyroidism with annual progression rates of 0·6-3·7%. Most patients reverted to normal thyroid status (31·6%) or remained subclinically hyperthyroid (56·7%). Progression to frank hyperthyroidism was higher in grade II than in grade I patients (20·3% vs 6·8%, P < 0·001, Chi square test). Kaplan-Meier curves showed faster progression rates in grade II than grade I (P < 0·001, log rank test). In stepwise multivariate Cox regression analysis, TSH < 0·1 mU/l was associated with overt hyperthyroidism (hazard ratio 3·4, confidence interval 1·6-7·0), whereas age, gender, FT4 and aetiological diagnosis were not associated with hyperthyroidism. Thyrotrophin predicts overt hyperthyroidism in asymptomatic individuals with subclinical hyperthyroidism. Patients with TSH < 0·10 mU/l have a higher risk of progressing to hyperthyroidism than those with TSH 0·10-0·39 mU/l. © 2012 Blackwell Publishing Ltd.

The TSH levels and risk of hypothyroidism: Results from a population based prospective cohort study in an Iranian adult's population.

PubMed

Aminorroaya, Ashraf; Meamar, Rokhsareh; Amini, Massoud; Feizi, Awat; Nasri, Maryam; Tabatabaei, Azamosadat; Faghihimani, Elham

2017-06-01

The aim of current study was to assess the relationship between serum TSH levels and hypothyroidism risk in the euthyroid population. In a population-based cohort study, a total of 615 individuals with a normal baseline TSH, from of total population (n=2254) in 2006, were followed up for 6years. TSH, total T4, thyroid peroxidase antibody (TPOAb), and thyroglobulin antibody (TgAb) were measured. The relative risk (RR) and 95% confidence interval (95%CI) were calculated based on logistic regression. The Receiver Operating Characteristic (ROC) analysis along with area under the curve (AUC) was used to prediction of future hypothyroidism. TSH level in 2006 was a significant predictor for overt hypothyroidism, in the total population (RR=3.5) and female (RR=1.37) (all, P value<0.05). A cutoff value of TSH at 2.05mIU/L [AUC: (CI95 %), 0.68 (0.44-0.92; P=0.05)] was obtained for differentiating the patients with overt hypothyroidism from euthyroid. However, this cut off was not observed when we included only negative TPO and TgAbs people in 2006. The RR of hypothyroidism increased gradually when TSH level increased from 2.06-3.6mIU/L to >3.6mIU/L in the total population and both sexes. In women, the risk of overt hypothyroidism was significantly higher in subjects with TSH above 3.6 than those subject with THS levels≤2.05 [RR: (CI95 %), 20.57(2.-207.04), P value<0.05]. A cutoff value of TSH at 2.05mIU/L could predict the development of overt hypothyroidism in future. However, it was not applicable for people with negative TPOAb and negative TgAb. Copyright © 2016 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.

Ability of the rhTSH stimulation test to predict relapse in patients with differentiated thyroid carcinoma, after long-term follow-up

PubMed Central

MARCELINO, MAFALDA; LOPES, ANA FILIPA; MADUREIRA, DEOLINDA; FERREIRA, TERESA C.; LIMBERT, EDWARD; LEITE, VALERIANO

2015-01-01

The analysis of serum thyroglobulin (Tg) following thyroid-stimulating hormone (TSH) stimulation (sTg) has been recommended in the follow-up of differentiated thyroid carcinoma (DTC) patients, however, its routine use remains controversial. The aim of the current study was to evaluate the accuracy of sTg testing following recombinant human (rh) TSH stimulation in DTC patients, with a follow-up of 12.4 years. Retrospective studies were conducted of 125 DTC patients, who underwent rhTSH stimulation testing between 1999 and 2002. The exclusion criteria were: Patients with anti-Tg antibodies, Tg levels >1 ng/ml under TSH suppression and the absence of radioactive iodine (RAI) ablation therapy following surgery. In total, 49 patients were included in the study and all had been previously treated with total or near total thyroidectomy (with or without central neck dissection) and RAI, postoperatively. The Tg functional sensitivity was 1.0 ng/ml. The follow-up for patients was performed annually. During the median follow-up of 12.4 years after the rhTSH stimulation test, nine patients exhibited recurrence (18.4%). Of the nine patients, six exhibited sTg levels >2 ng/ml (positive result) and three exhibited levels <2 ng/ml (negative result). Relapse occurred at a mean of 5.9 years following the rhTSH stimulation test. The positive predictive value and negative predictive value (NPV) of positive sTg were 50 and 91.9%, respectively, with a sensitivity of 66.6% and a specificity of 85.0%. The rhTSH-stimulated Tg levels have a high NPV, allowing the identification of the patients who are free of the tumour. These results are consistent with the previously published data; however, to the best of our knowledge, this is the study with the longest follow-up duration after rhTSH stimulation. PMID:25663898

Expression of G(alpha)(s) proteins and TSH receptor signalling in hyperfunctioning thyroid nodules with TSH receptor mutations.

PubMed

Holzapfel, Hans-Peter; Bergner, Beate; Wonerow, Peter; Paschke, Ralf

2002-07-01

Constitutively activating mutations of the thyrotrophin receptor (TSHR) are the main molecular cause of hyperfunctioning thyroid nodules (HTNs). The G protein coupling is an important and critical step in the TSHR signalling which mainly includes G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins. We investigated the in vitro consequences of overexpressing G(alpha) proteins on signalling of the wild-type (WT) or mutated TSHR. Moreover, we investigated whether changes in G(alpha) protein expression are pathophysiologically relevant in HTNs or cold thyroid nodules (CTNs). Wild-type TSH receptor and mutated TSH receptors were coexpressed with G(alpha)(s), G(alpha)(i) or G(alpha)(q)/11, and cAMP and inositol phosphate (IP) production was measured after stimulation with TSH. The expression of G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins was examined by Western blotting in 28 HTNs and 14 CTNs. Coexpression of G(alpha)(s) with the WT TSH receptor in COS 7 cells significantly increased the basal and TSH-stimulated cAMP accumulation while coexpression of the G(alpha)(q) or G(alpha)11 protein significantly increased the production of cAMP and inositol triphosphate (IP(3)). The coexpression of the TSH receptor mutants (I486F, DEL613-621), known to couple constitutively to G(alpha)(s) and G(alpha)(q) with G(alpha)(s) and G(alpha)(q)/11, significantly increased the basal and stimulated cAMP and IP(3) accumulation. Coexpression of the TSH receptor mutant V556F with G(alpha)(s) only increased the basal and stimulated cAMP production while its coexpression with G(alpha)(q)/11 increased the basal and stimulated IP(3) signalling. The expression of G(alpha)(s) protein subunits determined by Western blotting was significantly decreased in 14 HTNs with a constitutively activating TSH receptor mutation in comparison with the corresponding surrounding tissue, while in 14 HTNs without TSH receptor or G(alpha)(s) protein mutation and in 14 CTNs the expression of G(alpha)(s) protein was not different compared with the surrounding tissue. The expression of G(alpha)(i) and G(alpha)(q)/11 proteins in HTNs or CTNs was not significantly different compared with the surrounding tissue. The reduced expression of G(alpha)(s) protein subunits in HTNs with TSHR mutations could act as a feedback mechanism to desensitise the chronically stimulated cAMP cascade. As G(alpha) protein expression was not significantly increased in the majority of CTNs and HTNs an influence of G(alpha) overexpression on TSH signalling could be excluded in these nodules.

Multi-Hop Teleportation of an Unknown Qubit State Based on W States

NASA Astrophysics Data System (ADS)

Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen

2018-04-01

Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.

Hyperthyrotropinemia in newly diagnosed cystic fibrosis patients with pancreatic insufficiency reversed by enzyme therapy.

PubMed

Giannakopoulos, Aris; Katelaris, Anni; Noni, Maria; Karakonstantakis, Theodore; Kanaka-Gantenbein, Christina; Doudounakis, Stavros

2018-05-01

Patients with cystic fibrosis (CF) commonly present with an elevated TSH concentration, suggesting subclinical hypothyroidism. Its relation to concomitant pancreatic insufficiency and its natural course upon initiation of enzyme replacement have not been adequately studied. Herein, we investigated the thyroid function in newly diagnosed infants with CF and monitored the course of thyroid function response to pancreatic enzyme substitution treatment. Fourteen, newly diagnosed infants with CF and pancreatic insufficiency, were followed every 6-8 weeks for 6 months ensuing onset of pancreatic enzyme substitution therapy. All infants had normal TSH values on neonatal screening. Ten out of 14 (71%) had hyperthyrotropinemia and normal freeT4 values at presentation. No patient received thyroxine. Upon follow-up, after 6 months, TSH values normalized in 90% of infants with CF and hyperthyrotropinemia. Serum selenium levels were negatively correlated with TSH levels. Mild TSH elevation is a frequent finding in newly diagnosed cystic fibrosis patients with pancreatic insufficiency during infancy. TSH elevation resolves in most cases after initiation of enzyme substitution and improvement of nutritional status without any substitutive therapy with thyroxine. What is Known: • Newly diagnosed infants with cystic fibrosis often present with a state of hyperthyrotropinemia suggesting subclinical hypothyroidism. What is New: • Pancreatic enzyme substitution and improvement of nutrition restores normal TSH levels without the need of thyroxine therapy.

Relationship Between Circulating Thyroid-Stimulating Hormone, Free Thyroxine, and Free Triiodothyronine Concentrations and 9-Year Mortality in Euthyroid Elderly Adults.

PubMed

Ceresini, Graziano; Marina, Michela; Lauretani, Fulvio; Maggio, Marcello; Bandinelli, Stefania; Ceda, Gian P; Ferrucci, Luigi

2016-03-01

To determine the association between plasma thyroid-stimulating hormone (TSH), free triiodothyronine (FT3), and free thyroxine (FT4) levels and all-cause mortality in older adults who had levels of all three hormones in the normal range. Longitudinal. Community-based. Euthyroid Invecchiare in Chianti study participants aged 65 and older (N = 815). Plasma TSH, FT3, and FT4 levels were predictors, and 9-year all-cause mortality was the outcome. Cox proportional hazards models adjusted for confounders were used to examine the relationship between TSH, FT3, and FT4 quartiles and all-cause mortality over 9 years of follow-up. During follow-up (mean person-years 8,643.7, range 35.4-16,985.0), 181 deaths occurred (22.2%). Participants with TSH in the lowest quartile had higher mortality than the rest of the population. After adjusting for multiple confounders, participants with TSH in the lowest quartile (hazard ratio = 2.22, 95% confidence interval = 1.19-4.22) had significantly higher all-cause mortality than those with TSH in the highest quartile. Neither FT3 nor FT4 was associated with mortality. In elderly euthyroid subjects, normal-low TSH is an independent risk factor for all-cause mortality. © 2016, Copyright the Authors Journal compilation © 2016, The American Geriatrics Society.

Partially entangled states bridge in quantum teleportation

NASA Astrophysics Data System (ADS)

Cai, Xiao-Fei; Yu, Xu-Tao; Shi, Li-Hui; Zhang, Zai-Chen

2014-10-01

The traditional method for information transfer in a quantum communication system using partially entangled state resource is quantum distillation or direct teleportation. In order to reduce the waiting time cost in hop-by-hop transmission and execute independently in each node, we propose a quantum bridging method with partially entangled states to teleport quantum states from source node to destination node. We also prove that the designed specific quantum bridging circuit is feasible for partially entangled states teleportation across multiple intermediate nodes. Compared to two traditional ways, our partially entanglement quantum bridging method uses simpler logic gates, has better security, and can be used in less quantum resource situation.

DETERMINATION OF CLINICALLY RELEVANT DIFFERENCES IN FRONTAL PLANE HOP TESTS IN WOMEN'S COLLEGIATE BASKETBALL AND SOCCER PLAYERS

PubMed Central

Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung

2017-01-01

Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p < 0.05). Significant side differences (p = 0.02) were identified in the entire population for the medial triple hop test, such that participants jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally, the medial triple hop for distance test may be effective at identifying side‐to‐side asymmetries Level of Evidence 3 PMID:28515972

From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

NASA Astrophysics Data System (ADS)

Dolberry, Maurice E.

Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of engagement for STEAM educators. It concluded with suggestions for future research that further explicates hip hop epistemology and Hip Hop STEAM Pedagogy.

RELIABILITY AND VALIDITY OF FUNCTIONAL PERFORMANCE TESTS IN DANCERS WITH HIP DYSFUNCTION

PubMed Central

Carcia, Christopher R.; Clemente, F. Richard; Phelps, Amy L.; Martin, RobRoy L.

2013-01-01

Study Design: Quasi-experimental, repeated measures. Purpose/Background: Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. Methods: Nineteen female dancers (age: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Results: Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = −4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = −0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = −0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = −1.84, p=0.08) were not statistically different between sides. Conclusion: The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. Level of Evidence: 3b. Non-consecutive cohort study PMID:24175123

Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment.

PubMed

Traore, Boubacar; Pedesseau, Laurent; Assam, Linda; Che, Xiaoyang; Blancon, Jean-Christophe; Tsai, Hsinhan; Nie, Wanyi; Stoumpos, Constantinos C; Kanatzidis, Mercouri G; Tretiak, Sergei; Mohite, Aditya D; Even, Jacky; Kepenekian, Mikaël; Katan, Claudine

2018-04-24

Layered hybrid organic-inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers' confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignments becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Thus, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.

Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment

DOE PAGES

Traore, Boubacar; Pedesseau, Laurent; Assam, Linda; ...

2018-02-26

Layered hybrid organic–inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers’ confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignmentsmore » becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Furthermore, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.« less

Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully’s fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronicmore » wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.« less

Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Traore, Boubacar; Pedesseau, Laurent; Assam, Linda

Layered hybrid organic–inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers’ confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignmentsmore » becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Furthermore, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.« less

Thyroid Status and Death Risk in US Veterans With Chronic Kidney Disease.

PubMed

Rhee, Connie M; Kalantar-Zadeh, Kamyar; Ravel, Vanessa; Streja, Elani; You, Amy S; Brunelli, Steven M; Nguyen, Danh V; Brent, Gregory A; Kovesdy, Csaba P

2018-05-01

Given that patients with non-dialysis-dependent chronic kidney disease (NDD-CKD) have a disproportionately higher prevalence of hypothyroidism compared with their non-CKD counterparts, we sought to determine the association between thyroid status, defined by serum thyrotropin (TSH) levels, and mortality among a national cohort of patients with NDD-CKD. Among 227,422 US veterans with stage 3 NDD-CKD with 1 or more TSH measurements during the period October 1, 2004, to September 30, 2012, we first examined the association of thyroid status, defined by TSH categories of less than 0.5, 0.5 to 5.0 (euthyroidism), and more than 5.0 mIU/L, with all-cause mortality. We then evaluated 6 granular TSH categories: less than 0.1, 0.1 to less than 0.5, 0.5 to less than 3.0, 3.0 to 5.0, more than 5.0 to 10.0, and more than 10.0 mIU/L. We concurrently examined thyroid status, thyroid-modulating therapy, and mortality in sensitivity analyses. In expanded case-mix adjusted Cox analyses, compared with euthyroidism, baseline and time-dependent TSH levels of more than 5.0 mIU/L were associated with higher mortality (adjusted hazard ratios [aHRs] [95% CI], 1.19 [1.15-1.24] and 1.23 [1.19-1.28], respectively), as were baseline and time-dependent TSH levels of less than 0.5 mIU/L (aHRs [95% CI], 1.18 [1.15-1.22] and 1.41 [1.37-1.45], respectively). Granular examination of thyroid status showed that incrementally higher TSH levels of 3.0 mIU/L or more were associated with increasingly higher mortality in baseline and time-dependent analyses, and TSH categories of less than 0.5 mIU/L were associated with higher mortality (reference, 0.5-<3.0 mIU/L) in baseline analyses. In time-dependent analyses, untreated and undertreated hypothyroidism and untreated hyperthyroidism were associated with higher mortality (reference, spontaneous euthyroidism), whereas hypothyroidism treated-to-target showed lower mortality. Among US veterans with NDD-CKD, high-normal TSH (≥3.0 mIU/L) and lower TSH (<0.5 mIU/L) levels were associated with higher death risk. Interventional studies identifying the target TSH range associated with the greatest survival in patients with NDD-CKD are warranted. Copyright © 2018 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

Differentiation expression during proliferative activity induced through different pathways: in situ hybridization study of thyroglobulin gene expression in thyroid epithelial cells

PubMed Central

1990-01-01

In canine thyrocytes in primary culture, our previous studies have identified three mitogenic agents and pathways: thyrotropin (TSH) acting through cyclic AMP (cAMP), EGF and its receptor tyrosine protein kinase, and the phorbol esters that stimulate protein kinase C. TSH enhances, while EGF and phorbol esters inhibit, the expression of differentiation. Given that growth and differentiation expression are often considered as mutually exclusive activities of the cells, it was conceivable that the differentiating action of TSH was restricted to noncycling (Go) cells, while the inhibition of the differentiation expression by EGF and phorbol esters only concerned proliferating cells. Therefore, the capacity to express the thyroglobulin (Tg) gene, the most prominent marker of differentiation in thyrocytes, was studied in proliferative cells (with insulin) and in quiescent cells (without insulin). Using cRNA in situ hybridization, we observed that TSH (and, to a lesser extent, insulin and insulin-like growth factor I) restored or maintained the expression of the Tg gene. Without these hormones, the Tg mRNA content became undetectable in most of the cells. EGF and 12-0-tetradecanoyl phorbol-13-acetate (TPA) inhibited the Tg mRNA accumulation induced by TSH (and/or insulin). Most of the cells (up to 90%) responded to both TSH and EGF. Nevertheless, the range of individual response was quite variable. The effects of TSH and EGF on differentiation expression were not dependent on insulin and can therefore be dissociated from their mitogenic effects. Cell cycling did not affect the induction of Tg gene. Indeed, the same cell distribution of Tg mRNA content was observed in quiescent cells stimulated by TSH alone, or in cells approximately 50% of which had performed one mitotic cycle in response to TSH + insulin. Moreover, after proliferation in "dedifferentiating" conditions (EGF + serum + insulin), thyrocytes had acquired a fusiform fibroblast-like morphology, and responded to TSH by regaining a characteristic epithelial shape and high Tg mRNA content. 32 h after the replacement of EGF by TSH, cells in mitosis presented the same distribution of the Tg mRNA content as the rest of the cell population. This implies that cell cycling (at least 27 h, as previously shown) did not affect the induction of the Tg gene which is clearly detectable after a time lag of at least 24 h. The data unequivocally show that the reexpression of differentiation and proliferative activity are separate but fully compatible processes when induced by cAMP in thyrocytes.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:2199463

Alteration of Lipid Parameters in Patients With Subclinical Hypothyroidism

PubMed Central

Laway, Bashir Ahmad; War, Fayaz Ahmad; Shah, Sonaullah; Misgar, Raiz Ahmad; Kumar Kotwal, Suman

2014-01-01

Background: Overt hypothyroidism is associated with abnormalities of lipid metabolism, but conflicting results regarding the degree of lipid changes in subclinical hypothyroidism (SCH) exist. Objectives: The aim of this study was to assess differences in lipid profile parameters between subjects with and without SCH in a north Indian population. Patients and Methods: Serum lipid parameters of 70 patients with subclinical hypothyroidism and 100 age and sex matched euthyroid controls were evaluated in a cross-sectional study. Results: Mean serum total cholesterol (TC), triglycerides (TG) and very low-density cholesterol (VLDL) were significantly higher in patients with SCH than controls (P < 0.05). Mean TC, TG and low-density cholesterol (LDL) concentrations were higher in patients with serum thyroid stimulating hormone (TSH) greater than 10 mU/L than those with serum TSH equal to or less than 10 mU/L, but this difference was not statistically significant. No association was found between serum high-density cholesterol (HDL-C) concentration and serum TSH level. Conclusions: High TC, TG and VLDL were observed in our patients with SCH. PMID:25237326

Maternal thyroid function and the outcome of external cephalic version: a prospective cohort study

PubMed Central

2011-01-01

Background To investigate the relation between maternal thyroid function and the outcome of external cephalic version (ECV) in breech presentation. Methods Prospective cohort study in 141 women (≥ 35 weeks gestation) with a singleton fetus in breech. Blood samples for assessing thyroid function were taken prior to ECV. Main outcome measure was the relation between maternal thyroid function and ECV outcome indicated by post ECV ultrasound. Results ECV success rate was 77/141 (55%), 41/48 (85%) in multipara and 36/93 (39%) in primipara. Women with a failed ECV attempt had significantly higher TSH concentrations than women with a successful ECV (p < 0.001). Multiple logistic regression showed that TSH (OR: 0.52, 95% CI: 0.30-0.90), nulliparity (OR: 0.11, 95% CI: 0.03-0.36), frank breech (OR: 0.30, 95% CI: 0.10-0.93) and placenta anterior (OR: 0.31, 95% CI: 0.11-0.85) were independently related to ECV success. Conclusions Higher TSH levels increase the risk of ECV failure. Trial registration number ClinicalTrials.gov: NCT00516555 PMID:21269431

Thyroid stimulating hormone and serum, plasma, and platelet brain-derived neurotrophic factor during a 3-month follow-up in patients with major depressive disorder.

PubMed

Baek, Ji Hyun; Kang, Eun-Suk; Fava, Maurizio; Mischoulon, David; Nierenberg, Andrew A; Lee, Dongsoo; Heo, Jung-Yoon; Jeon, Hong Jin

2014-12-01

Thyroid dysfunction and elevated thyroid stimulating hormone (TSH) are common in patients with depression. TSH might exert its function in the brain through blood levels of brain-derived neurotrophic factor (BDNF). BDNF decreases during depressed states and normalize after treatment. The gap is that the association between TSH and BDNF in patients with major depressive disorder (MDD) is unknown. We studied 105 subjects ≥18 years of age with MDD and measured serum, plasma, and platelet BDNF at baseline, 1 month and 3 months during antidepressant treatment. Other baseline measurements included hypothalamic-pituitary-thyroid axis hormones such as TSH, triiodothyronine (T3) and thyroxine (T4); hypothalamic-pituitary-adrenal (HPA) axis hormones and hypothalamic-pituitary-gonadal (HPG) axis hormones and prolactin. Linear mixed model effect analyses revealed that baseline TSH level was negatively associated with changes of serum BDNF from baseline to 3 months (F=7.58, p=0.007) after adjusting for age, sex, and body mass index, but was not associated with plasma and platelet BDNF. In contrast, T3 and T4, HPA axis hormones, HPG axis hormones, and prolactin were not associated with serum, plasma, or platelet BDNF levels. Patients in the highest quartile of TSH showed significantly lower serum BDNF than in the other quartiles (F=4.54, p=0.038), but no significant differences were found based on T3 and T4 levels. TSH was only measured at baseline. Higher TSH is associated with lower baseline and reduced the increase of serum BDNF levels during antidepressant treatment in patients with MDD. Copyright © 2014 Elsevier B.V. All rights reserved.

The Natural History of Subclinical Hypothyroidism in the Elderly: The Cardiovascular Health Study

PubMed Central

Somwaru, Lily L.; Rariy, Chevon M.; Arnold, Alice M.

2012-01-01

Context: Studies of long-term outcomes of subclinical hypothyroidism have assessed only baseline thyroid function, despite natural transitions to euthyroidism and overt hypothyroidism over time. Objective: We provide estimates of persistence, resolution, and progression of subclinical hypothyroidism over 4 yr, stratified by baseline TSH, anti-thyroid peroxidase antibody (TPOAb) status, age, and sex. Design, Setting, and Participants: Participants were 3996 U.S. individuals at least 65 yr old enrolled in the Cardiovascular Health Study. Subclinical hypothyroidism was detected at baseline in 459 individuals not taking thyroid medication. Main Outcome Measure: Thyroid function was evaluated at 2 and 4 yr and initiation of thyroid medication annually. Results were stratified by baseline TSH, TPOAb status, age, and sex. Results: Persistence of subclinical hypothyroidism was 56% at 2 and 4 yr. At 2 yr, resolution was more common with a TSH of 4.5–6.9 mU/liter (46 vs. 10% with TSH 7–9.9 mU/liter and 7% with TSH ≥10 mU/liter; P < 0.001) and with TPOAb negativity (48 vs. 15% for positive; P < 0.001). Higher TSH and TPOAb positivity were independently associated with lower likelihood of reversion to euthyroidism (P < 0.05). TSH of 10 mU/liter or higher was independently associated with progression to overt hypothyroidism (P < 0.05). Transitions between euthyroidism and subclinical hypothyroidism were common between 2 and 4 yr. Age and sex did not affect transitions. Conclusions: Subclinical hypothyroidism persists for 4 yr in just over half of older individuals, with high rates of reversion to euthyroidism in individuals with lower TSH concentrations and TPOAb negativity. Future studies should examine the impact of transitions in thyroid status on clinical outcomes. PMID:22438233

LONGITUDINAL TRAJECTORIES OF GESTATIONAL THYROID FUNCTION: A NEW APPROACH TO BETTER UNDERSTAND CHANGES IN THYROID FUNCTION.

PubMed

Pop, Victor; Broeren, Maarten; Wijnen, Hennie; Endendijk, Joyce; van Baar, Anneloes; Wiersinga, Wilmar; Williams, Graham R

2018-05-28

Most studies of thyroid function changes during pregnancy use a cross-sectional design comparing means between groups rather than similarities within groups. Latent class growth analysis (LCGA) is a novel approach to investigate longitudinal changes that provide dynamic understanding of the relationship between thyroid status and advancing pregnancy. Prospective observational study with repeated assessments. General community. 1100 healthy pregnant women who were included at their first antenatal visit at 12 weeks gestation. Statistically defined distinct groups based on determined specific changing trajectories by LCGA of both fT4 and TSH at each trimester. LCGA revealed three trajectory classes. Class 1 (n = 1019, 92.4%), a 'Low increasing TSH' reference group, had a gradual increase in TSH throughout gestation (from 1.1 to 1.3 IU/l). Class 2 (n = 30, 2.8%), 'High increasing TSH'', displayed the largest increase in TSH (from 1.9 to 3.3 IU/l); Class 3 (n = 51, 4.6%), 'Decreasing TSH', had the largest fall in TSH (from 3.2 to 2.4 IU/l). (Sub)clinical hypothyroidism at 12 weeks occurred in up to 60% of class 3 women and was accompanied by elevated TPO-Ab titres (50%) and a parental history of thyroid dysfunction (23%). 70% of class 2 women were nulliparous compared to 46% and 49% in classes 1 and 3. LCGA revealed distinct trajectories of longitudinal changes of fT4 and TSH levels during pregnancy in 7.4% of women. These trajectories were correlated with parity and TPO-Ab status and followed patterns that might reflect differences in pregnancy-specific immune tolerance between nulliparous and multiparous women.

Functioning and nonfunctioning thyroid adenomas involve different molecular pathogenetic mechanisms.

PubMed

Tonacchera, M; Vitti, P; Agretti, P; Ceccarini, G; Perri, A; Cavaliere, R; Mazzi, B; Naccarato, A G; Viacava, P; Miccoli, P; Pinchera, A; Chiovato, L

1999-11-01

The molecular biology of follicular cell growth in thyroid nodules is still poorly understood. Because gain-of-function (activating) mutations of the thyroid-stimulating hormone receptor (TShR) and/or Gs alpha genes may confer TSh-independent growth advantage to neoplastic thyroid cells, we searched for somatic mutations of these genes in a series of hyperfunctioning and nonfunctioning follicular thyroid adenomas specifically selected for their homogeneous gross anatomy (single nodule in an otherwise normal thyroid gland). TShR gene mutations were identified by direct sequencing of exons 9 and 10 of the TShR gene in genomic DNA obtained from surgical specimens. Codons 201 and 227 of the Gs alpha gene were also analyzed. At histology, all hyperfunctioning nodules and 13 of 15 nonfunctioning nodules were diagnosed as follicular adenomas. Two nonfunctioning thyroid nodules, although showing a prevalent microfollicular pattern of growth, had histological features indicating malignant transformation (a minimally invasive follicular carcinoma and a focal papillary carcinoma). Activating mutations of the TShR gene were found in 12 of 15 hyperfunctioning follicular thyroid adenomas. In one hyperfunctioning adenoma, which was negative for TShR mutations, a mutation in codon 227 of the Gs alpha gene was identified. At variance with hyperfunctioning thyroid adenomas, no mutation of the TShR or Gs alpha genes was detected in nonfunctioning thyroid nodules. In conclusion, our findings clearly define a different molecular pathogenetic mechanism in hyperfunctioning and nonfunctioning follicular thyroid adenomas. Activation of the cAMP cascade, which leads to proliferation but maintains differentiation of follicular thyroid cells, typically occurs in hyperfunctioning thyroid adenomas. Oncogenes other than the TShR and Gs alpha genes are probably involved in nonfunctioning follicular adenomas.

Longitudinal trends in thyroid function in relation to iodine intake: ongoing changes of thyroid function despite adequate current iodine status.

PubMed

van de Ven, Annenienke C; Netea-Maier, Romana T; Ross, H Alec; van Herwaarden, Teun A E; Holewijn, Suzanne; de Graaf, Jacqueline; Kiemeney, Bart L A; van Tienoven, Doorlène; Wetzels, Jack F M; Smit, Johannes W; Sweep, Fred C G J; Hermus, Ad R M M; den Heijer, Martin

2014-01-01

Several cross-sectional studies on populations with iodine deficiency showed that TSH-levels are negatively associated with age, while in populations with high iodine intake TSH is positively associated with age. The question is whether such an age-thyroid function relation is an ongoing process apparent also in longitudinal studies and whether it reflects an actual iodine deficiency or an iodine insufficiency in the past. In an area with a borderline iodine status in the past, we studied 980 participants of the Nijmegen Biomedical Study. We measured serum TSH, free thyroxine (FT₄), total triiodothyronine (T₃), peroxidase antibodies, and the urine iodine and creatinine concentration 4 years after our initial survey of thyroid function, in which we reported a negative association between TSH and age. within 4 years, TSH decreased by 5.4% (95% ci 2.58.3%) and FT₄ increased by 3.7% (95% ci 2.94.6%). median urinary iodine concentration was 130 μg/l. estimated 24-h iodine excretion was not associated with TSH, T₃, change of TSH, or FT₄ over time or with the presence of antibodies against thyroid peroxidase. Only FT₄ appeared to be somewhat higher at lower urine iodine levels: a 1.01% (95% CI 0.17-1.84%) higher FT₄ for each lower iodine quintile. In this longitudinal study, we found an ongoing decrease in TSH and increase in FT₄ in a previously iodine insufficient population, despite the adequate iodine status at present. This suggests that low iodine intake at young age leads to thyroid autonomy (and a tendency to hyperthyroidism) that persists despite normal iodine intake later in life.

Clinical characteristics of patients with thyrotropin-secreting pituitary adenoma.

PubMed

Wu, Yung-Yen; Chang, Hung-Yu; Lin, Jen-Der; Chen, Kwang-Wen; Huang, Yu-Yao; Jung, Shih-Ming

2003-03-01

Thyroid-stimulating hormone (thyrotropin, TSH)-secreting pituitary adenoma is a very rare cause of hyperthyroidism. Diagnosis of this condition is often delayed due to lack of availability of TSH radioimmunoassay (RIA), the failure to recognize the utility of RIA and the incorrect attribution of the condition to other causes of thyrotoxicosis. This retrospective study analyzed the clinical characteristics of patients with this disorder treated from 1991 to 2002. Seven patients (6 females, 1 male; mean age, 48 years; range, 33 to 72 years) with a diagnosis of TSHsecreting pituitary adenoma based on detectable TSH levels with high serum free thyroid hormone or triiodothyronine concentrations and pituitary lesions found on neuroimaging were included in this study. Patient records including clinical features, endocrine studies, immunohistochemistry studies, and response to treatment were reviewed. All 7 patients had hyperthyroidism, elevated free thyroxine or triiodothyronine levels, and unsuppressed levels of TSH. Imaging studies demonstrated a pituitary mass or lesion in all patients. Six patients had macroadenomas and 1 patient had a microadenoma. One of the patients had coexisting acromegalic features and hypersecretion of growth hormone was diagnosed. All of the patients had been treated with thionamides or thyroidectomy for presumed primary hyperthyroidism. Serum alpha-subunit level was uncharacteristically normal in 2 patients and elevated in 1 patient. Alpha-subunit/TSH molar ratios were elevated in 3 patients. Five patients underwent transsphenoidal adenomectomy but only one of them remained well-controlled at follow-up. Three patients received administration of somatostatin analogs and they achieved normalization of serum TSH and free thyroid hormones during the period of therapy. TSH immunoassay has an important role in the evaluation of hyperthyroid patients to determine the presence of inappropriate secretion. TSH-secreting pituitary adenoma exhibits heterogeneity in clinical presentation, hormonal expression and therapeutic response.

Excess Mortality in Treated and Untreated Hyperthyroidism Is Related to Cumulative Periods of Low Serum TSH.

PubMed

Lillevang-Johansen, Mads; Abrahamsen, Bo; Jørgensen, Henrik Løvendahl; Brix, Thomas Heiberg; Hegedüs, Laszlo

2017-07-01

Cumulative time-dependent excess mortality in hyperthyroid patients has been suggested. However, the effect of antithyroid treatment on mortality, especially in subclinical hyperthyroidism, remains unclarified. We investigated the association between hyperthyroidism and mortality in both treated and untreated hyperthyroid individuals. Register-based cohort study of 235,547 individuals who had at least one serum thyroid-stimulating hormone (TSH) measurement in the period 1995 to 2011 (7.3 years median follow-up). Hyperthyroidism was defined as at least two measurements of low serum TSH. Mortality rates for treated and untreated hyperthyroid subjects compared with euthyroid controls were calculated using multivariate Cox regression analyses, controlling for age, sex, and comorbidities. Cumulative periods of decreased serum TSH were analyzed as a time-dependent covariate. Hazard ratio (HR) for mortality was increased in untreated [1.23; 95% confidence interval (CI), 1.12 to 1.37; P < 0.001], but not in treated, hyperthyroid patients. When including cumulative periods of TSH in the Cox regression analyses, HR for mortality per every 6 months of decreased TSH was 1.11 (95% CI, 1.09 to 1.13; P < 0.0001) in untreated hyperthyroid patients (n = 1137) and 1.13 (95% CI, 1.11 to 1.15; P < 0.0001) in treated patients (n = 1656). This corresponds to a 184% and 239% increase in mortality after 5 years of decreased TSH in untreated and treated hyperthyroidism, respectively. Mortality is increased in hyperthyroidism. Cumulative periods of decreased TSH increased mortality in both treated and untreated hyperthyroidism, implying that excess mortality may not be driven by lack of therapy, but rather inability to keep patients euthyroid. Meticulous follow-up during treatment to maintain biochemical euthyroidism may be warranted. Copyright © 2017 by the Endocrine Society

Multiple Transduction Pathways Mediate Thyrotropin Receptor Signaling in Preosteoblast-Like Cells

PubMed Central

Boutin, Alisa; Neumann, Susanne

2016-01-01

It has been shown that the TSH receptor (TSHR) couples to a number of different signaling pathways, although the Gs-cAMP pathway has been considered primary. Here, we measured the effects of TSH on bone marker mRNA and protein expression in preosteoblast-like U2OS cells stably expressing TSHRs. We determined which signaling cascades are involved in the regulation of IL-11, osteopontin (OPN), and alkaline phosphatase (ALPL). We demonstrated that TSH-induced up-regulation of IL-11 is primarily mediated via the Gs pathway as IL-11 was up-regulated by forskolin (FSK), an adenylyl cyclase activator, and inhibited by protein kinase A inhibitor H-89 and by silencing of Gαs by small interfering RNA. OPN levels were not affected by FSK, but its up-regulation was inhibited by TSHR/Gi-uncoupling by pertussis toxin. Pertussis toxin decreased p38 MAPK kinase phosphorylation, and a p38 inhibitor and small interfering RNA knockdown of p38α inhibited OPN induction by TSH. Up-regulation of ALPL expression required high doses of TSH (EC50 = 395nM), whereas low doses (EC50 = 19nM) were inhibitory. FSK-stimulated cAMP production decreased basal ALPL expression, whereas protein kinase A inhibition by H-89 and silencing of Gαs increased basal levels of ALPL. Knockdown of Gαq/11 and a protein kinase C inhibitor decreased TSH-stimulated up-regulation of ALPL, whereas a protein kinase C activator increased ALPL levels. A MAPK inhibitor and silencing of ERK1/2 inhibited TSH-stimulated ALPL expression. We conclude that TSH regulates expression of different bone markers via distinct signaling pathways. PMID:26950201

Serum Thyroid-Stimulating Hormone Levels and Body Mass Index Percentiles in Children with Primary Hypothyroidism on Levothyroxine Replacement.

PubMed

Shaoba, Asma; Basu, Sanjib; Mantis, Stelios; Minutti, Carla

2017-12-15

To determine the association, if any, between thyroid-stimulating hormone (TSH) levels and body mass index (BMI) percentiles in children with primary hypothyroidism who are chemically euthyroid and on treatment with levothyroxine. This retrospective cross-sectional study consisted of a review of medical records from RUSH Medical Center and Stroger Hospital, Chicago, USA of children with primary hypothyroidism who were seen in the clinic from 2008 to 2014 and who were chemically euthyroid and on treatment with levothyroxine for at least 6 months. The patients were divided into two groups based on their TSH levels (0.34-<2.5 mIU/L and ≥2.5-5.6 mIU/L). The data were analyzed by Spearman rank correlation, linear regression, cross tabulation and chi-square, Mann-Whitney U test, and Kruskal-Wallis test. One hundred and forty-six children were included, of which 26% were obese (BMI ≥95%), 21.9% overweight (BMI ≥85-<95%), and 52.1% of a healthy weight (BMI ≥5-<85%). There was a significant positive correlation between TSH and BMI percentiles (r=0.274, p=0.001) and a significant negative correlation between TSH and serum free T4 (r=-0.259, p=0.002). In the lower TSH group, 68.4% of the children had a healthy weight, while the percentage of obese children was 60.5% in the upper TSH group (p=0.012). In children diagnosed with primary hypothyroidism who are chemically euthyroid on treatment with levothyroxine, there is a positive association between higher TSH levels and higher BMI percentiles. However, it is difficult to establish if the higher TSH levels are a direct cause or a consequence of the obesity. Further studies are needed to establish causation beyond significant association.

Thyrotropin levels within the lower normal range are associated with an increased risk of hip fractures in euthyroid women, but not men, over the age of 65 years.

PubMed

Leader, Avi; Ayzenfeld, Racheli Heffez; Lishner, Michael; Cohen, Efrat; Segev, David; Hermoni, Doron

2014-08-01

The contemporary literature on the relationship between serum TSH levels and osteoporotic fractures in euthyroid individuals is limited by conflicting results and analyses conducted on a small number of fractures. Our objective was to examine the association between the normal range of variation of TSH and the incidence of hip fractures in male and female euthyroid patients aged 65 years or older. We performed a population-based historical prospective cohort study within the Clalit Health Services population. Clalit Health Services members aged ≥65 years with at least 1 TSH measurement during the year 2004. We excluded patients with preexisting hip fracture, thyroid disease, malignancy, or chronic kidney disease. The primary outcome was hip fracture, and the secondary outcome was any other osteoporotic fracture. Adjusted odds ratios comparing episodes of each outcome across 3 TSH groups (low, 0.35-1.6 mIU/L; intermediate, 1.7-2.9 mIU/L; high, 3-4.2 mIU/L) were generated using logistic regression models. The 14 325 included participants suffered from 514 hip fractures (mean follow-up, 102 ± 3 months). Women, but not men, in the lowest TSH group had a higher incidence of hip fractures (odds ratio = 1.28, 95% confidence interval = 1.03-1.59, P = .029) when compared with the intermediate group, after multivariate adjustment for age, comorbidities, and use of drugs affecting bone metabolism. There was no difference in hip fracture incidence between intermediate- and high-TSH groups. No association was found between TSH levels and other osteoporotic fractures. TSH levels within the lower normal range are associated with an increased risk of hip fractures in euthyroid women, but not men, aged 65 years and more.

A 10-Year Prospective Trial of a Patient Management Algorithm and Screening Examination for Highly Active Individuals with ACL Injury. Part II: Determinants of Dynamic Knee Stability

PubMed Central

Hurd, Wendy J.; Axe, Michael J.; Snyder-Mackler, Lynn

2010-01-01

Objectives To clarify the determinants of dynamic knee stability early after anterior cruciate ligament (ACL) injury. Materials and Methods 345 consecutive patients who were regular participants in IKDC level I/II sports before injury and had an acute isolated ACL injury from the practice of a single orthopaedic surgeon underwent a screening examination including clinical measures, knee laxity, quadriceps strength, hop testing, and patient self-reported knee function an average of 6 weeks after injury when impairments were resolved. Independent t-tests were performed to evaluate differences in quadriceps strength and anterior knee laxity between potential copers and noncopers. Hierarchical regression was performed to determine the influence of quadriceps strength, pre-injury activity level, and anterior knee laxity on hop test performance, as well as the influence of timed hop, cross-over hop, quadriceps strength, pre-injury activity level, and anterior knee laxity on self-assessed global function. Results Neither anterior knee laxity nor quadriceps strength differed between potential copers and non-copers. Quadriceps strength influenced hop test performance more significantly than pre-injury activity level or anterior knee laxity, but the variance accounted for by quadriceps strength was low (Range: 4-8%). Timed hop performance was the only variable that impacted self-assessed global function. Conclusions Traditional surgical decision making based on passive anterior knee laxity and pre-injury activity level is not supported by the results, as neither are good predictors of dynamic knee stability. Clinical tests that capture neuromuscular adaptations, including the timed hop test, may be useful in predicting function and guiding individualized patient management after ACL injury. PMID:17932399

Human longevity is characterised by high thyroid stimulating hormone secretion without altered energy metabolism.

PubMed

Jansen, S W; Akintola, A A; Roelfsema, F; van der Spoel, E; Cobbaert, C M; Ballieux, B E; Egri, P; Kvarta-Papp, Z; Gereben, B; Fekete, C; Slagboom, P E; van der Grond, J; Demeneix, B A; Pijl, H; Westendorp, R G J; van Heemst, D

2015-06-19

Few studies have included subjects with the propensity to reach old age in good health, with the aim to disentangle mechanisms contributing to staying healthier for longer. The hypothalamic-pituitary-thyroid (HPT) axis maintains circulating levels of thyroid stimulating hormone (TSH) and thyroid hormone (TH) in an inverse relationship. Greater longevity has been associated with higher TSH and lower TH levels, but mechanisms underlying TSH/TH differences and longevity remain unknown. The HPT axis plays a pivotal role in growth, development and energy metabolism. We report that offspring of nonagenarians with at least one nonagenarian sibling have increased TSH secretion but similar bioactivity of TSH and similar TH levels compared to controls. Healthy offspring and spousal controls had similar resting metabolic rate and core body temperature. We propose that pleiotropic effects of the HPT axis may favour longevity without altering energy metabolism.

Association between rs12045440 Polymorphism in the CAPZB Intron and Serum TSH Concentrations in Chinese Thyroid Tumor Patients

PubMed Central

Feng, Shouhao; Lin, Shengli; Zou, Jidong; Wang, Yulong; Ji, Qinghai; Lv, Zhenghua

2015-01-01

The aim of this study was to investigate the possible influence of different genotypes of the lead single nucleotide polymorphisms (SNPs) rs10917468 and rs12045440 in the CAPZB gene on the thyroid function in papillary thyroid carcinoma (PTC) and benign thyroid neoplasm (BN) patients. In the study, a significant association was detected between rs12045440 and serum TSH concentrations in thyroid tumor patients (p = 0.001). After the adjustment of relevant covariates, the difference between the mean serum TSH levels in different genotypes of rs12045440 was still significant in the BN group (p = 0.003) but was not significant in the PTC cases (p = 0.115). No significant association of rs10917468 with TSH levels was found. The SNP rs12045440 was associated with the serum TSH concentrations in Chinese thyroid tumor patients, especially in benign thyroid tumor cases. PMID:26273293

Study of hopping type conduction from AC conductivity in multiferroic composite

NASA Astrophysics Data System (ADS)

Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan

2018-05-01

0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).

A Large-Scale Multi-Hop Localization Algorithm Based on Regularized Extreme Learning for Wireless Networks.

PubMed

Zheng, Wei; Yan, Xiaoyong; Zhao, Wei; Qian, Chengshan

2017-12-20

A novel large-scale multi-hop localization algorithm based on regularized extreme learning is proposed in this paper. The large-scale multi-hop localization problem is formulated as a learning problem. Unlike other similar localization algorithms, the proposed algorithm overcomes the shortcoming of the traditional algorithms which are only applicable to an isotropic network, therefore has a strong adaptability to the complex deployment environment. The proposed algorithm is composed of three stages: data acquisition, modeling and location estimation. In data acquisition stage, the training information between nodes of the given network is collected. In modeling stage, the model among the hop-counts and the physical distances between nodes is constructed using regularized extreme learning. In location estimation stage, each node finds its specific location in a distributed manner. Theoretical analysis and several experiments show that the proposed algorithm can adapt to the different topological environments with low computational cost. Furthermore, high accuracy can be achieved by this method without setting complex parameters.

Thyroid function changes related to use of iodinated water in the U.S. Space Program.

PubMed

McMonigal, K A; Braverman, L E; Dunn, J T; Stanbury, J B; Wear, M L; Hamm, P B; Sauer, R L; Billica, R D; Pool, S L

2000-11-01

The National Aeronautics and Space Administration (NASA) has used iodination as a method of microbial disinfection of potable water systems in U.S. spacecraft and long-duration habitability modules. A review of thyroid function tests of NASA astronauts who had consumed iodinated water during spaceflight was conducted. Thyroid function tests of all past and present astronauts were reviewed. Medical records of astronauts with a diagnosis of thyroid disease were reviewed. Iodine consumption by space crews from water and food was determined. Serum thyroid-stimulating hormone (TSH) and urinary iodine excretion from space crews were measured following modification of the Space Shuttle potable water system to remove most of the iodine. Mean TSH significantly increased in 134 astronauts who had consumed iodinated water during spaceflight. Serum TSH, and urine iodine levels of Space Shuttle crewmembers who flew following modification of the potable water supply system to remove iodine did not show a statistically significant change. There was no evidence supporting association between clinical thyroid disease and the number of spaceflights, amount of iodine consumed, or duration of iodine exposure. It is suggested that pharmacological doses of iodine consumed by astronauts transiently decrease thyroid function, as reflected by elevated serum TSH values. Although adverse effects of excess iodine consumption in susceptible individuals are well documented, exposure to high doses of iodine during spaceflight did not result in a statistically significant increase in long-term thyroid disease in the astronaut population.

Hypothyroidism, new nodule formation and increase in nodule size in patients who have undergone hemithyroidectomy

PubMed Central

Ersoy, Reyhan Ünlü; Anıl, Cüneyd; Demir, Özgür; Erdoğan, Murat Faik; Güllü, Sevim; Berker, Dilek; Gül, Kamile; Ünlütürk, Uğur; Erdoğan, Gürbüz

2012-01-01

Introduction The current medical literature has conflicting results about factors related to hypothyroidism and nodular recurrences during follow-up of hemithyroidectomized patients. We aimed to evaluate factors that may have a role in new nodule formation, hypothyroidism, increase in thyroid lobe and increase in nodule volumes in these patients with and without Hashimoto's thyroiditis (HT), and with and without levothyroxine (LT4) use. Material and methods We enrolled 140 patients from five different hospitals in Ankara and evaluated their thyroid tests, autoantibody titre results and ultrasonographic findings longitudinally between two visits with a minimum 6-month interval. Results In patients with HT there was no significant difference between the two visits but in patients without HT, thyroid stimulating hormone (TSH) levels and nodule volume were higher, and free T4 levels were lower in the second visit. Similarly, in patients with LT4 treatment there was no difference in TSH, free T4 levels, or lobe or nodule size between the two visits, but the patients without LT4 had free T4 levels lower in the second visit. Regression analysis revealed a relationship between first visit TSH levels and hypothyroidism during follow-up. Conclusions Patients who have undergone hemithyroidectomy without LT4 treatment and without HT diagnosis should be followed up more carefully for thyroid tests, new nodule formation and increase in nodule size. The TSH levels at the beginning of the follow-up may be helpful to estimate hypothyroidism in hemithyroidectomized patients. PMID:22661999

Down's syndrome and thyroid disorder.

PubMed

Dinani, S; Carpenter, S

1990-04-01

The thyroid status of 106 adults with Down's syndrome was assessed. Six were previously diagnosed as hypothyroid and were already receiving thyroxine. A further 37 patients showed abnormal thyroid function. Biochemical evidence of hypothyroidism (T4 less than 50 nmol/l and T.S.H. greater than 4 mu/less than) was found in one person. Six patients were found to have an unequivocally elevated T.S.H. but normal T4 (T4 greater than 50 nmol/l and T.S.H. greater than 20 mu/l) and 29 were found to have a modest elevation of T.S.H. but normal T4 concentration (T4 greater than 50 nmol/l and T.S.H. between 4 and 20 mu/l). There was one patient with mild thyrotoxicosis (T4 = 180 nmol/l and T.S.H. less than 0.1 mu/l). Clinical findings were of little use in making a diagnosis of hypothyroidism in this group of patients. A raised level of thyroid microsomal auto-antibodies was found in about a third of the patients, this occurred more commonly in females and slightly more often in those with a raised thyroid stimulating hormone. The importance of this is discussed. Recommendations for regular biochemical screening are made.

Macro- and microadenoma of thyrotropin secreting pituitary tumors--two clinical cases.

PubMed

Hubalewska-Hola, Alicja; Fröss, Katarzyna; Kostecka-Matyja, Marta; Sowa-Staszczak, Anna; Szybiński, Zbigniew; Huszno, Bohdan; Ptak, Marzena

2003-01-01

Thyrotropin secreting adenoma, thyrotropinoma (TSH-oma), is a rare cause of hyperthyroidism--called secondary hyperthyroidism. The hormonal profile in pituitary hyperthyroidism is characterized by a nonsuppressed TSH in the presence of high levels of free thyroid hormones (fT4, fT3) reflecting an abnormal feedback. The diagnosis of TSH-oma is often made at the stage of macroadenoma because of the aggressive nature of the tumor and due to the fact that patients are mistakenly treated for more common primary hyperthyroidism for a long time. Two cases of TSH-secreting adenoma were detected in Chair and Department of Endocrinology, Collegium Medicum of the Jagiellonian University in Krakow for the last twenty years. Case 1: 49 year old woman was admitted to the Clinic of Endocrinology in 1999 with recurring hyperthyroidism treated with surgical thyroid ablation in 1992 and thyreostatics for the previous nine years. On admission to the Clinic her thyroid panel presented with elevated free hormone levels (mainly fT3-14.8 pmol/l) and not suppressed TSH-0.7 mIU/l suggesting central hyperthyroidism. MRI scan of the pituitary gland revealed microadenoma of 5 mm in diameter. She was qualified to transsphenoidal resection of the tumor. Histopathology revealed acidophilic adenoma with positive TSH staining. Thyroid hormones 8 days after the operation suggested full effectiveness of the surgery. Case 2: 65 year old man treated for one year with L-Thyroxin because of elevated TSH (60 mIU/l) and then with thyreostatics for elevated fT3 and fT4 was admitted to the Clinic of Endocrinology in 2000 with suspected thyrotropinoma. On admission to the Clinic thyroid panel suggested hyperthyroidism with fT4-40 pmol/l, FT3-11.2 pmol/l without suppression of TSH 2.2 mIU/l. MRI scan revealed a pituitary tumor 20 x 18 x 20 mm, compressing the optic chiasm. He was administered octreotide as a preparation for the operation. The patient underwent trans-sphenoidal resection of the adenoma (histopathologically a chromophobic adenoma). The example of presented patients suggests that clinical course of the pituitary tumor producing TSH and the rate of the tumor growth may differ significantly. Surgical resection of TSH producing adenoma is the most effective therapy. It should be proceeded by octreotide administration in patients with macroadenoma.

Effect of thyrotropin-releasing factor on serum thyroid-stimulating hormone

PubMed Central

Costom, Bruce H.; Grumbach, Melvin M.; Kaplan, Selna L.

1971-01-01

To test the hypothesis that the primary defect in some patients with idiopathic hypopituitary dwarfism is failure to secrete hypothalamic hypophysiotropic-releasing factors, synthetic thyrotropin-releasing factor (TRF), 500 μg, wa given intravenously, and timed venous samples obtained for determination of the concentration of plasma TSH by radioimmunoassay in three groups of subjects: (a) 11 patients without evidence of endocrine or systemic disease, (group I) (b) 8 with isolated growth hormone deficiency and normal thyroid function, (group II) and (c) 9 patients with idiopathic hypopituitary dwarfism and thyroid-stimulating hormone (TSH) deficiency (group III). The mean fasting plasma TSH value was 4.1 μU/ml in group I, and 3.9 μU/ml in group II; in both groups there was a brisk rise in plasma TSH to peak levels of 12-45 μU/ml at 30-45 min, and a fall toward base line levels at 120 min. All children in group III had basal TSH levels of < 1.5 μU/ml; one failed to respond to TRF; eight exhibited a rise in plasma TSH with peak values comparable with those in groups I and II. In four of eight children in group III who responded to TRF, the TSH response was delayed and the initial rise in plasma TSH was not detectable until 10-60 min. In these four patients, plasma TSH levels continued to rise at 120 min. The mean fasting concentration of plasma thyroxine iodide (T4) in subjects with normal thyroid function (groups I and II) was 5.6 μg/100 ml, and the mean plasma T4 level at 120 min was 6.6 μg/100 ml. This difference between fasting and postTRF plasma T4 was significant (P < 0.001) by paired analysis. Mean fasting plasma T4 concentration in group III patients was 1.3 μg/100 ml; after TRF a significant rise in T4 concentration was not detected in this group. The results indicate that TRF test is useful in distinguishing between primary hypothalamic and pituitary forms of TSH deficiency. In light of the evidence of TRF deficiency in eight of nine patients with idiopathic hypopituitary dwarfism, it seems likely that in these patients, other pituitary hormone deficiencies may be attributable to deficiency of their respective releasing factors. Images PMID:4330007

Development of a new high-performance liquid chromatography method with diode array and electrospray ionization-mass spectrometry detection for the metabolite fingerprinting of bioactive compounds in Humulus lupulus L.

PubMed

Prencipe, Francesco Pio; Brighenti, Virginia; Rodolfi, Margherita; Mongelli, Andrea; dall'Asta, Chiara; Ganino, Tommaso; Bruni, Renato; Pellati, Federica

2014-07-04

The study was aimed at developing a new analytical method for the metabolite fingerprinting of bioactive compounds in Humulus lupulus L. (hop), together with a simple extraction procedure. Different extraction techniques, including maceration, heat reflux extraction (HRE), ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE), were compared in order to obtain a high yield of the target analytes. Dynamic maceration for 30min with MeOH-HCOOH (99:1, v/v) as the extraction solvent provided the best result in terms of recovery of secondary metabolites. The analysis of hop constituents, including prenylflavonoids and prenylphloroglucinols (bitter acids), was carried out by means of HPLC-UV/DAD, HPLC-ESI-MS and MS(2), using an ion trap mass analyzer. An Ascentis Express C18 column (150mm×3.0mm I.D., 2.7μm) was used for the HPLC analysis, with a mobile phase composed of 0.25% formic acid in both water and acetonitrile, under gradient elution. The method validation was performed to show compliance with ICH guidelines. The validated technique was successfully applied to the phytochemical analysis of ten commercial cultivars and twenty-three wild Italian hop genotypes, thus demonstrating to be a reliable and useful tool for the comprehensive multi-component analysis of hop secondary metabolites. Copyright © 2014 Elsevier B.V. All rights reserved.

Adenohypophyseal function in dogs with primary hypothyroidism and nonthyroidal illness.

PubMed

Diaz-Espiñeira, M M; Mol, J A; Rijnberk, A; Kooistra, H S

2009-01-01

A recent study of dogs with induced primary hypothyroidism (PH) demonstrated that thyroid hormone deficiency leads to loss of thyrotropin (TSH) hypersecretion, hypersomatotropism, hypoprolactinemia, and pituitary enlargement with large vacuolated "thyroid deficiency" cells that double-stained for growth hormone (GH) and TSH, indicative of transdifferentiation of somatotropes to thyrosomatropes. Similar functional changes in adenohypophyseal function occur in dogs with spontaneous PH as do in dogs with induced PH, but not in dogs with nonthyroidal illness (NTI). Fourteen dogs with spontaneous PH and 13 dogs with NTI. Adenohypophyseal function was investigated by combined intravenous administration of 4 hypophysiotropic releasing hormones (4RH test), followed by measurement of plasma concentrations of ACTH, GH, luteinizing hormone (LH), prolactin (PRL), and TSH. In the PH dogs this test was repeated after 4 and 12 weeks of thyroxine treatment. In 6 PH dogs, the basal TSH concentration was within the reference range. In the PH dogs, the TSH concentrations did not increase with the 4RH test. However, TSH concentrations increased significantly in the NTI dogs. Basal and stimulated GH and PRL concentrations indicated reversible hypersomatotropism and hyperprolactinemia in the PH dogs, but not in the NTI dogs. Basal and stimulated LH and ACTH concentrations did not differ between groups. Dogs with spontaneous PH hypersecrete GH but have little or no TSH hypersecretion. Development of hyperprolactinemia (and possible galactorrhea) in dogs with PH seems to occur only in sexually intact bitches. In this group of dogs with NTI, basal and stimulated plasma adenohypophyseal hormone concentrations were not altered.

Dynamic changes of central thyroid functions in the management of Cushing's syndrome.

PubMed

Dogansen, Sema Ciftci; Yalin, Gulsah Yenidunya; Canbaz, Bulent; Tanrikulu, Seher; Yarman, Sema

2018-01-01

The aim of this study was to determine the frequency of central thyroid dysfunctions in Cushing's syndrome (CS). We also aimed to evaluate the frequency of hyperthyroidism due to the syndrome of the inappropriate secretion of TSH (SITSH), which was recently defined in patients with insufficient hydrocortisone replacement after surgery. We evaluated thyroid functions (TSH and free thyroxine [fT4]) at the time of diagnosis, during the hypothalamo-pituitary-adrenal axis recovery, and after surgery in 35 patients with CS. The patients were separated into two groups: ACTH-dependent CS (group 1, n = 20) and ACTH-independent CS (group 2, n = 15). Patients' clinical and laboratory findings were evaluated in five visits in the outpatient clinic of the endocrinology department. The frequency of baseline suppressed TSH levels and central hypothyroidism were determined to be 37% (n = 13) and 26% (n = 9), respectively. A negative correlation was found between baseline cortisol and TSH levels (r = -0.45, p = 0.006). All patients with central hypothyroidism and suppressed TSH levels showed recovery at the first visit without levothyroxine treatment. SITSH was not detected in any of the patients during the postoperative period. No correlation was found between prednisolone replacement after surgery and TSH or fT4 levels on each visit. Suppressed TSH levels and central hypothyroidism may be detected in CS, independent of etiology. SITSH was not detected in the early postoperative period due to our adequate prednisolone replacement doses.

Cost-effectiveness of using recombinant human thyroid-stimulating hormone before radioiodine ablation for thyroid cancer treatment in Spanish hospitals.

PubMed

Vallejo, J A; Muros, M A

In thyroid cancer treatment, the thyroid-stimulating hormone (TSH) must be elevated before radioiodine ablation, either by exogenous (with recombinant human thyrotropin [rhTSH]) or endogenous stimulation by thyroid hormone withdrawal (THW). The use of rhTSH avoids hypothyroidism and favours the subsequent elimination of radioiodine, but involves the cost of the product. For this reason, a cost-effectiveness analysis was performed, taking into account all costs involved and the benefits associated with the use of this therapy. Using a Markov modelling with two analysis arms (rhTSH and THW), stratified into high (100mCi/3700 MBq) and low (30mCi/1110 MBq) radioiodine doses, and using 17 weekly cycles, the incremental cost per quality-adjusted life-year (QALY) related to the use of rhTSH was determined. The clinical inputs included in the model were based on published studies and in a treatment survey conducted in Spain. Radioablation preparation with rhTSH is superior to THW, showing additional benefits (0.048 AVAC), as well as cost savings (-€614.16), with an incremental cost-effectiveness rate (ICER) of -€12,795/QALY. The univariate and multivariate sensitivity analyses showed the result to be robust. The use of rhTSH previous to radioablation in Spain has cost savings, as well as a series of health benefits for the patient, making it highly cost-effective. Copyright © 2017 Elsevier España, S.L.U. y SEMNIM. All rights reserved.

Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.

PubMed

Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F

2006-10-01

Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.

Energy management that generates terrain following versus apex-preserving hopping in man and machine.

PubMed

Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

2012-01-01

While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

Breed-specific reference intervals for assessing thyroid function in seven dog breeds.

PubMed

Hegstad-Davies, Rebecca L; Torres, Sheila M F; Sharkey, Leslie C; Gresch, Sarah C; Muñoz-Zanzi, Claudia A; Davies, Peter R

2015-11-01

Thyroxine (T4), free T4 (FT4), and thyrotropin (TSH) concentrations were measured in serum from 693 healthy representatives from 7 dog breeds (Alaskan Malamute, Collie, English Setter, Golden Retriever, Keeshond, Samoyed, or Siberian Husky) to determine whether breed-specific reference intervals (RIs) are warranted. Veterinarians reviewed the health history, performed a physical examination, and approved laboratory data for the enrolled dogs. Many purebred dogs had T4 and FT4 concentrations that were at, or below, the lower limits previously determined for non-breed-specific RIs. Mean concentrations of T4, FT4, and TSH varied significantly among breeds. The range of mean concentration of T4 (19.7 nmol/L [1.53 µg/dL] in English Setters to 29.0 nmol/L [2.25 µg/dL] in Keeshonds) and FT4 (12.6 pmol/L [0.98 ng/dL] in English Setters to 20.2 pmol/L [1.57 ng/dL] in Samoyeds) was considerable. Median TSH values ranged from 6.10 mIU/L (0.07 ng/mL; Alaskan Malamute and Golden Retriever) to 17.6 mIU/L (0.26 ng/mL; Collie). Mean T4 and FT4 concentrations were higher in females. Increasing age was associated with decreasing T4 and FT4, and increasing TSH concentration. The substantial ranges across breeds of measures of central tendency (mean, median) for all hormones indicate that breed-specific RIs are warranted. RIs encompassing the central 95% of reference values for all breeds combined, and for individual breeds, were calculated using nonparametric (TSH) and robust (T4, FT4) methods. Use of breed-specific RIs in combination with careful attention to the potential for pre-analytical and analytical variability in test results will improve thyroid function assessment in these breeds. © 2015 The Author(s).

Prospectively measured triiodothyronine levels are positively associated with breast cancer risk in postmenopausal women

PubMed Central

2010-01-01

Introduction The potential association between hypo- and hyperthyroid disorders and breast cancer has been investigated in a large number of studies during the last decades without conclusive results. This prospective cohort study investigated prediagnostic levels of thyrotropin (TSH) and triiodothyronine (T3) in relation to breast cancer incidence in pre- and postmenopausal women. Methods In the Malmö Preventive Project, 2,696 women had T3 and/or TSH levels measured at baseline. During a mean follow-up of 19.3 years, 173 incident breast cancer cases were retrieved using record linkage with The Swedish Cancer Registry. Quartile cut-points for T3 and TSH were based on the distribution among all women in the study cohort. A Cox's proportional hazards analysis was used to estimate relative risks (RR), with a confidence interval (CI) of 95%. Trends over quartiles of T3 and TSH were calculated considering a P-value < 0.05 as statistically significant. All analyses were repeated for pre- and peri/postmenopausal women separately. Results Overall there was a statistically significant association between T3 and breast cancer risk, the adjusted RR in the fourth quartile, as compared to the first, was 1.87 (1.12 to 3.14). In postmenopausal women the RRs for the second, third and fourth quartiles, as compared to the first, were 3.26 (0.96 to 11.1), 5.53 (1.65 to 18.6) and 6.87 (2.09 to 22.6), (P-trend: < 0.001). There were no such associations in pre-menopausal women, and no statistically significant interaction between T3 and menopausal status. Also, no statistically significant association was seen between serum TSH and breast cancer. Conclusions This is the first prospective study on T3 levels in relation to breast cancer risk. T3 levels in postmenopausal women were positively associated with the risk of breast cancer in a dose-response manner. PMID:20540734

The −258 A/G (SNP rs12885300) polymorphism of the human type-2 deiodinase gene is associated with a shift in the pattern of secretion of thyroid hormones following a TRH-induced acute rise in TSH

PubMed Central

Peltsverger, Maya Y.; Butler, Peter W.; Alberobello, Anna Teresa; Smith, Sheila; Guevara, Yanina; Dubaz, Ornella M.; Luzon, Javier A.; Linderman, Joyce; Celi, Francesco S.

2012-01-01

Objective Type-2 deiodinase gene (DIO2) polymorphisms have been associated with changes in pituitary-thyroid axis homeostasis. The −258 A/G (SNP rs12885300) polymorphism has been associated with increased enzymatic activity, but data are conflicting. To characterize the effects of the −258 A/G polymorphism on intra-thyroidal T4 to T3 conversion and thyroid hormone secretion pattern we studied the effects of acute, TRH-mediated, TSH stimulation of the thyroid gland. Design Retrospective analysis. Methods The thyroid hormone secretion in response to 500 mcg iv TRH injection was studied in 45 healthy volunteers. Results Twenty-six subjects (16 females, 10 males, 32.8±10.4 years) were homozygous for the ancestral (−258 A/A) allele, 19 (11 females, 8 males, 31.1±10.9 years) were carrier of the (−258 G/x) variant. While no differences in the peak TSH and T3 levels were observed, carriers of the −258G/x allele showed a blunted rise in free T4 (p<0.01). The −258G/x 92Thr/Thr haplotype, compared to the other groups, had lower TSH values at 60' (p<0.03). No differences were observed between genotypes in baseline thyroid hormone levels. Conclusions The −258G/x DIO2 polymorphism variant is associated with a decreased rate of acute TSH-stimulated free T4 secretion with a normal T3 release from the thyroid consistent with a shift in the reaction equilibrium toward the product. These data indicate that the −258G DIO2 polymorphism cause changes in the pattern of hormonal secretion. These findings are a proof-of-concept that common polymorphisms in the DIO2 can subtly affect the circulating levels of thyroid hormone and might modulate the thyroid hormone homeostasis. PMID:22307573

Multi-hop teleportation based on W state and EPR pairs

NASA Astrophysics Data System (ADS)

Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

2016-05-01

Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

Method to suppress DDFS spurious signals in a frequency-hopping synthesizer with DDFS-driven PLL architecture.

PubMed

Kwon, Kun-Sup; Yoon, Won-Sang

2010-01-01

In this paper we propose a method of removing from synthesizer output spurious signals due to quasi-amplitude modulation and superposition effect in a frequency-hopping synthesizer with direct digital frequency synthesizer (DDFS)-driven phase-locked loop (PLL) architecture, which has the advantages of high frequency resolution, fast transition time, and small size. There are spurious signals that depend on normalized frequency of DDFS. They can be dominant if they occur within the PLL loop bandwidth. We suggest that such signals can be eliminated by purposefully creating frequency errors in the developed synthesizer.

FUNCTIONAL PERFORMANCE AND KNEE LAXITY IN NORMAL INDIVIDUALS AND IN INDIVIDUALS SUBMITTED TO ANTERIOR CRUCIATE LIGAMENT RECONSTRUCTION

PubMed Central

de Vasconcelos, Rodrigo Antunes; Bevilaqua-Grossi, Débora; Shimano, Antonio Carlos; Jansen Paccola, Cleber Antonio; Salvini, Tânia Fátima; Prado, Christiane Lanatovits; Mello Junior, Wilson A.

2015-01-01

The aim of this study was to analyze the correlation between deficits in the isokinetic peak torque of the knee extensors and flexors with hop tests, postoperative knee laxity and functional scores in normal and ACL- reconstructed subjects with patellar tendon and hamstring tendon autografts. Methods: Sixty male subjects were enrolled and subdivided into three groups: Twenty subjects without knee injuries (GC group) and two groups of 20 subjects submitted to ACL reconstruction with patellar tendon (GTP group) and hamstrings autograft (GTF group). Results: The results showed significant correlation between knee extensors peak torque and performance in the hop tests for GTF and GC groups. There are no significantly correlations between post op knee laxity and Lysholm score compared with the hop tests and peak torque deficits. Concerning the differences between groups, the GTP group showed greater peak torque deficits in knee extensors, worst Lysholm scores and higher percentage of individuals with lower limb symmetry index (ISM) < 90% in both hop tests when compared to the other two groups. Conclusion: It is not recommendable to use only one measurement instrument for the functional evaluation of ACL-reconstructed patients, because significant correlation between peak torque, subject's functional score, knee laxity and hop tests were not observed in all groups. PMID:26998464

Towards an Efficient Flooding Scheme Exploiting 2-Hop Backward Information in MANETs

NASA Astrophysics Data System (ADS)

Le, Trong Duc; Choo, Hyunseung

Flooding is an indispensable operation for providing control or routing functionalities to mobile ad hoc networks (MANETs). Previously, many flooding schemes have been studied with the intention of curtailing the problems of severe redundancies, contention, and collisions in traditional implementations. A recent approach with relatively high efficiency is 1HI by Liu et al., which uses only 1-hop neighbor information. The scheme achieves local optimality in terms of the number of retransmission nodes with time complexity &Theta(n log n), where n is the number of neighbors of a node; however, this method tends to make many redundant transmissions. In this paper, we present a novel flooding algorithm, 2HBI (2-hop backward information), that efficiently reduces the number of retransmission nodes and solves the broadcast storm problem in ad hoc networks using our proposed concept, “2-hop backward information.” The most significant feature of the proposed algorithm is that it does not require any extra communication overhead other than the exchange of 1-hop HELLO messages but maintains high deliverability. Comprehensive computer simulations show that the proposed scheme significantly reduces redundant transmissions in 1HI and in pure flooding, up to 38% and 91%, respectively; accordingly it alleviates contention and collisions in networks.

Hopping and the Stokes–Einstein relation breakdown in simple glass formers

PubMed Central

Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco

2014-01-01

One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition—like that of other statistical systems—is exact when the spatial dimension d→∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions, d=2,3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes–Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses. PMID:25288722

Hopping and the Stokes-Einstein relation breakdown in simple glass formers.

PubMed

Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco

2014-10-21

One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition--like that of other statistical systems--is exact when the spatial dimension d → ∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions,d = 2, 3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes-Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses.

Holder pasteurization affects S100B concentrations in human milk.

PubMed

Peila, Chiara; Coscia, Alessandra; Bertino, Enrico; Li Volti, Giovanni; Galvano, Fabio; Visser, Gerard H A; Gazzolo, Diego

2018-02-01

Donor milk (DM) represents an important nutrition source for high-risk newborns. Holder pasteurization (HoP) is the most recommended procedure for DM treatment, providing a good compromise between microbiological safety and biological quality. HoP was previously shown to affect DM cytokines, growth factors and hormones levels, whilst no data concerning the possible effects of HoP on neurobiomarkers (NB) are available. Therefore, our study investigated whether the concentration in DM of a well-known NB involved in brain development/damage, namely S100B, changes due to HoP. We conducted a pretest-test study in 11 mothers, whose DM samples were sub-divided into two parts: the first was immediately frozen (-80 °C); the second was pasteurized with Holder method before freezing. S100B DM levels were measured using a commercially available immunoluminometric assay. S100B protein was detected in all milk samples. Results showed significant differences between groups (p < 0.05) in S100B levels after HoP. Our data provide evidence that S100B is present in preterm milk as well as in term milk during maturation degree. Moreover, the results confirm the susceptibility of this neurotrophic factor to pasteurization stresses and the need to develop new storage techniques to preserve the biological quality of human milk.

Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

ERIC Educational Resources Information Center

Adjapong, Edmund S.; Emdin, Christopher

2015-01-01

A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

Over- and Under-Treatment of Hypothyroidism Is Associated with Excess Mortality: A Register-Based Cohort Study.

PubMed

Lillevang-Johansen, Mads; Abrahamsen, Bo; Jørgensen, Henrik Løvendahl; Brix, Thomas Heiberg; Hegedüs, Laszlo

2018-05-01

This study investigated the association between hypothyroidism and mortality in both treated and untreated hypothyroid patients, and the consequences of over- and under-treatment with respect to mortality. This was a register-based cohort study of 235,168 individuals who had at least one serum thyrotropin (TSH) during 1995-2011 (median follow-up 7.2 years). Hypothyroidism was defined as at least two measurements of TSH >4.0 mIU/L within a half year spaced by at least 14 days, or one measurement of TSH >4.0 mIU/L and two filled prescriptions of levothyroxine the following year. All-cause mortality rates were calculated using multivariable Cox regression analysis adjusted for age, sex, and comorbidities using the Charlson Comorbidity Index. Mortality was increased in untreated hypothyroid individuals (n = 673; hazard ratio [HR] = 1.46 [confidence interval (CI) 1.26-1.69]; p < 0.001) compared to euthyroid controls. Results remained significant even when subdividing according to mild (TSH >4.0 mIU/L and ≤10 mIU/L; p < 0.001) and marked hypothyroidism (TSH >10 mIU/L; p = 0.002). Mortality was increased in both treated and untreated hypothyroid individuals for each six months a patient had increased TSH (HR = 1.05 [CI 1.02-1.07], p < 0.0001, and HR = 1.05 [CI 1.02-1.07], p = 0.0009, respectively). In patients who received levothyroxine, the HR for mortality increased by a factor 1.18 ([CI 1.15-1.21]; p < 0.0001) for each six months a patient exhibited decreased TSH. This finding was essentially unchanged after stratification by disease severity (mild or marked hypothyroidism) and age (older and younger than 65 years). Mortality was increased in untreated but not in treated hypothyroid individuals, independently of age and severity of hypothyroidism. Duration of decreased TSH in treated individuals had a greater impact on mortality than did duration of elevated TSH. These results stress the need for close monitoring of treatment in individuals receiving thyroid hormone replacement therapy.

Epitope mapping of tsh receptor-blocking antibodies in Graves' disease that appear during pregnancy.

PubMed

Kung, A W; Lau, K S; Kohn, L D

2001-08-01

Spontaneous remission of Graves' disease during pregnancy is thought to be due to a reduction of thyroid-stimulating antibody activity. We suspected, however, that a broader change in TSH receptor antibody characteristics might play an important role in modulating disease activity during pregnancy. We measured TSH binding inhibitory Ig, thyroid-stimulating antibody, and thyroid stimulating-blocking antibody activities in 13 pregnant Graves' disease patients at first, second, and third trimesters and 4 months postpartum. To measure and epitope-map thyroid-stimulating antibody and thyroid stimulating-blocking antibody activities, we used CHO cells transfected with wild-type human TSH receptor or with several TSH receptor-LH/hCG receptor chimeras: Mc1+2, Mc2, and Mc4. These chimeric cells have their respective TSH receptor residues 9-165, 90-165, and 261-370 substituted with equivalent residues of the LH/hCG receptor. Overall thyroid-stimulating antibody decreased, whereas thyroid stimulating-blocking antibody increased progressively during pregnancy. TSH binding inhibitory Ig fluctuated in individual patients, but overall the activities remained statistically unchanged. Thyroid stimulating-blocking antibody appeared in subjects who were either negative for thyroid-stimulating antibody or whose thyroid-stimulating antibody activity increased or decreased during pregnancy. Epitope mapping showed that the thyroid-stimulating antibodies were mainly directed against residues 9-165 of the N-terminus of the TSH receptor extracellular domain. All thyroid stimulating-blocking antibodies had blocking activities against residues 261-370 of the C-terminus of the ectodomain. However, the majority of the thyroid stimulating-blocking antibodies had a hybrid conformational epitope directed against N-terminal residues 9-89 or 90-165 as well. Despite a change in the activity level, we did not observe any change in the epitope of either the stimulatory or blocking Abs as pregnancy advanced. In conclusion, a change in the specificity of TSH receptor antibody from stimulatory to blocking activity was observed during pregnancy, and the appearance of thyroid stimulating-blocking antibody may contribute to the remission of Graves' disease during pregnancy.

The role of glutamic or aspartic acid in position four of the epitope binding motif and thyrotropin receptor-extracellular domain epitope selection in Graves' disease.

PubMed

Inaba, Hidefumi; Martin, William; Ardito, Matt; De Groot, Anne Searls; De Groot, Leslie J

2010-06-01

Development of Graves' disease (GD) is related to HLA-DRB1*0301 (DR3),and more specifically to arginine at position 74 of the DRB1 molecule. The extracellular domain (ECD) of human TSH receptor (hTSH-R) contains the target antigen. We analyzed the relation between hTSH-R-ECD peptides and DR molecules to determine whether aspartic acid (D) or glutamic acid (E) at position four in the binding motif influenced selection of functional epitopes. Peptide epitopes from TSH-R-ECD with D or E in position four (D/E+) had higher affinity for binding to DR3 than peptides without D/E (D/E-) (IC(50) 29.3 vs. 61.4, P = 0.0024). HLA-DR7, negatively correlated with GD, and DRB1*0302 (HLA-DR18), not associated with GD, had different profiles of epitope binding. Toxic GD patients who are DR3+ had higher responses to D/E+ peptides than D/E- peptides (stimulation index 1.42 vs. 1.22, P = 0.028). All DR3+ GD patients (toxic + euthyroid) had higher responses, with borderline significance (Sl; 1.32 vs. 1.18, P = 0.051). Splenocytes of DR3 transgenic mice immunized to TSH-R-ECD responded to D/E+ peptides more than D/E- peptides (stimulation index 1.95 vs. 1.69, P = 0.036). Seven of nine hTSH-R-ECD peptide epitopes reported to be reactive with GD patients' peripheral blood mononuclear cells contain binding motifs with D/E at position four. TSH-R-ECD epitopes with D/E in position four of the binding motif bind more strongly to DRB1*0301 than epitopes that are D/E- and are more stimulatory to GD patients' peripheral blood mononuclear cells and to splenocytes from mice immunized to hTSH-R. These epitopes appear important in immunogenicity to TSH-R due to their favored binding to HLA-DR3, thus increasing presentation to T cells.

Analysis of hop-derived terpenoids in beer and evaluation of their behavior using the stir bar-sorptive extraction method with GC-MS.

PubMed

Kishimoto, Toru; Wanikawa, Akira; Kagami, Noboru; Kawatsura, Katsuyuki

2005-06-15

Hop aroma components, which mainly comprise terpenoids, contribute to the character of beers. However, pretreatments are necessary before analyzing these components because of their trace levels and complicated matrixes. Here, the stir bar-sorptive extraction (SBSE) method was used to detect and quantify many terpenoids simultaneously from small samples. This simple technique showed low coefficients of variation, high accuracy, and low detection limits. An investigation of the behavior of terpenoids identified two distinct patterns of decreasing concentration during wort boiling. The first, which was seen in myrcene and linalool, involved a rapid decrease that was best fitted by a quadratic curve. The second, which was observed in beta-eudesmol, humulene, humulene epoxide I, beta-farnesene, caryophyllene, and geraniol, involved a gentle linear decrease. Conversely, the concentration of beta-damascenone increased after boiling. As the aroma composition depended on the hop variety, we also examined the relationship between terpenoid content and sensory analysis in beer.

Efficient kinetic Monte Carlo method for reaction-diffusion problems with spatially varying annihilation rates

NASA Astrophysics Data System (ADS)

Schwarz, Karsten; Rieger, Heiko

2013-03-01

We present an efficient Monte Carlo method to simulate reaction-diffusion processes with spatially varying particle annihilation or transformation rates as it occurs for instance in the context of motor-driven intracellular transport. Like Green's function reaction dynamics and first-passage time methods, our algorithm avoids small diffusive hops by propagating sufficiently distant particles in large hops to the boundaries of protective domains. Since for spatially varying annihilation or transformation rates the single particle diffusion propagator is not known analytically, we present an algorithm that generates efficiently either particle displacements or annihilations with the correct statistics, as we prove rigorously. The numerical efficiency of the algorithm is demonstrated with an illustrative example.

A meta-analysis of the associations between common variation in the PDE8B gene and thyroid hormone parameters, including assessment of longitudinal stability of associations over time and effect of thyroid hormone replacement

PubMed Central

Taylor, Peter N; Panicker, Vijay; Sayers, Adrian; Shields, Beverley; Iqbal, Ahmed; Bremner, Alexandra P; Beilby, John P; Leedman, Peter J; Hattersley, Andrew T; Vaidya, Bijay; Frayling, Timothy; Evans, Jonathan; Tobias, Jonathan H; Timpson, Nicholas J; Walsh, John P; Dayan, Colin M

2011-01-01

Objective Common variants in PDE8B are associated with TSH but apparently without any effect on thyroid hormone levels that is difficult to explain. Furthermore, the stability of the association has not been examined in longitudinal studies or in patients on levothyroxine (l-T4). Design Totally, four cohorts were used (n=2557): the Busselton Health Study (thyroid function measured on two occasions), DEPTH, EFSOCH (selective cohorts), and WATTS (individuals on l-T4). Methods Meta-analysis to clarify associations between the rs4704397 single nucleotide polymorphism in PDE8B on TSH, tri-iodothyronine (T3), and T4 levels. Results Meta-analysis confirmed that genetic variation in PDE8B was associated with TSH (P=1.64×10−10 0.20 s.d./allele, 95% confidence interval (CI) 0.142, 0.267) and identified a possible new association with free T4 (P=0.023, −0.07 s.d./allele, 95% CI −0.137, −0.01), no association was seen with free T3 (P=0.218). The association between PDE8B and TSH was similar in 1981 (0.14 s.d./allele, 95% CI 0.04, 0.238) and 1994 (0.20 s.d./allele, 95% CI 0.102, 0.300) and even more consistent between PDE8B and free T4 in 1981 (−0.068 s.d./allele, 95% CI −0.167, 0.031) and 1994 (−0.07 s.d./allele, 95% CI −0.170, 0.030). No associations were seen between PDE8B and thyroid hormone parameters in individuals on l-T4. Conclusion Common genetic variation in PDE8B is associated with reciprocal changes in TSH and free T4 levels that are consistent over time and lost in individuals on l-T4. These findings identify a possible genetic marker reflecting variation in thyroid hormone output that will be of value in epidemiological studies and provides additional evidence that PDE8B is involved in TSH signaling in the thyroid. PMID:21317282

Impact of thyroid function abnormalities on reproductive hormones during menstrual cycle in premenopausal HIV infected females at NAUTH, Nnewi, Nigeria

PubMed Central

Emelumadu, Obiageli Fidelia; Igwegbe, Anthony Osita; Monago, Ifeoma Nwamaka; Ilika, Amobi Linus

2017-01-01

Background This was a prospective study designed to evaluate the impact of thyroid function abnormalities on reproductive hormones during menstrual cycle in HIV infected females at Nnamdi Azikiwe University Teaching Hospital Nnewi, South-East Nigeria. Methods The study randomly recruited 35 Symptomatic HIV infected females and 35 Symptomatic HIV infected females on antiretroviral therapy (HAART) for not less than six weeks from an HIV clinic and 40 apparently heathy control females among the hospital staff of NAUTH Nnewi. They were all premenopausal females with regular menstrual cycle and aged between 15–45 years. Blood samples were collected at follicular and luteal phases of their menstrual cycle for assay of Thyroid indices (FT3, FT4 and TSH) and Reproductive indices (FSH, LH, Estrogen, Progesterone, Prolactin and Testosterone) using ELISA method. Results The result showed significantly higher FSH and LH but significantly lower progesterone (prog) and estrogen (E2) in the test females compared to control females at both phases of menstrual cycle (P<0.05). There was significantly lower FT3 but significantly higher TSH value in Symptomatic HIV females (P<0.05). FSH, LH and TSH values were significantly lowered while prog and FT3 were significantly higher in Symptomatic HIV on ART compared to Symptomatic HIV females (P<0.05). FT3, FT4, Prog and E2 were inversely correlated while FSH and LH were positively correlated with duration of HIV infection in HIV females (P<0.05 respectively). There was a direct correlation between CD4+ count and FT3 while inverse correlation was found between CD4+ count and TSH levels (P<0.05). Discussion The present study demonstrated hypothyroidism with a significant degree of primary hypogonadism in Symptomatic HIV infected females at both follicular and luteal phases of menstrual cycle which tends to normalize on treatments. PMID:28723963

Treatment of homozygous familial hypercholesterolaemia in paediatric patients: A monocentric experience.

PubMed

Buonuomo, Paola S; Macchiaiolo, Marina; Leone, Giovanna; Valente, Paola; Mastrogiorgio, Gerarda; Gnazzo, Maria; Rana, Ippolita; Gonfiantini, Michaela V; Gagliardi, Maria G; Romano, Francesca; Bartuli, Andrea

2018-01-01

Background Homozygous familial hypercholesterolaemia is a rare life-threatening disease characterized by markedly elevated low-density lipoprotein cholesterol (LDL-C) concentrations and accelerated atherosclerosis. The presence of double gene defects in the LDL-Receptor, either the same defect (homozygous) or two different LDL-raising mutations (compound heterozygotes) or other variants, identify the homozygous phenotype (HopFH). Apheresis is a procedure in which plasma is separated from red blood cells before the physical removal of LDL-C or the LDL-C is directly removed from whole blood. It is currently the treatment of choice for patients with HopFH whose LDL-C levels are not able to be reduced to target levels with conventional lipid-lowering drug therapy. Design The aim of this study is to report a cohort of six paediatric patients and to evaluate the long term efficacy of combined medical therapy and LDL-apheresis on LDL-C reduction. Methods We collected data from six children with confirmed diagnosis of HopFH (two females and four males; age range at diagnosis 3-8 years, mean 6 ± 1 years) from a single clinical hospital in Italy from 2007 to 2017. Results Clinical manifestations and outcomes may greatly vary in children with HopFH. Medical therapy and LDL-apheresis for the severe form should be started promptly in order to prevent cardiovascular disease. Conclusions Lipoprotein apheresis is a very important tool in managing patients with HopFH at high risk of cardiovascular disease. Based on our experience and the literature data, the method is feasible in very young children, efficient regarding biological results and cardiac events, and safe with minor side-effects and technical problems. We advise treating homozygous and compound heterozygous children as soon as possible.

Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

PubMed Central

Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

2017-01-01

The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

PubMed

Reeb-Whitaker, Carolyn K; Bonauto, David K

2014-11-01

There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Targeting the thyroid gland with thyroid-stimulating hormone (TSH)-nanoliposomes.

PubMed

Paolino, Donatella; Cosco, Donato; Gaspari, Marco; Celano, Marilena; Wolfram, Joy; Voce, Pasquale; Puxeddu, Efisio; Filetti, Sebastiano; Celia, Christian; Ferrari, Mauro; Russo, Diego; Fresta, Massimo

2014-08-01

Various tissue-specific antibodies have been attached to nanoparticles to obtain targeted delivery. In particular, nanodelivery systems with selectivity for breast, prostate and cancer tissue have been developed. Here, we have developed a nanodelivery system that targets the thyroid gland. Nanoliposomes have been conjugated to the thyroid-stimulating hormone (TSH), which binds to the TSH receptor (TSHr) on the surface of thyrocytes. The results indicate that the intracellular uptake of TSH-nanoliposomes is increased in cells expressing the TSHr. The accumulation of targeted nanoliposomes in the thyroid gland following intravenous injection was 3.5-fold higher in comparison to untargeted nanoliposomes. Furthermore, TSH-nanoliposomes encapsulated with gemcitabine showed improved anticancer efficacy in vitro and in a tumor model of follicular thyroid carcinoma. This drug delivery system could be used for the treatment of a broad spectrum of thyroid diseases to reduce side effects and improve therapeutic efficacy. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Subclinical hyperthyroidism and cardiovascular risk: recommendations for treatment.

PubMed

Palmeiro, Christopher; Davila, Maria I; Bhat, Mallika; Frishman, William H; Weiss, Irene A

2013-01-01

Subclinical hyperthyroidism (SHy), the mildest form of hyperthyroidism, is diagnosed in patients having a persistently low or undetectable serum concentration of thyroid-stimulating hormone (TSH) with normal free T4 and T3 concentrations. Although overt hyperthyroidism is associated with an increased risk of adverse cardiovascular outcomes, the cardiovascular risk of SHy is controversial. Multiple studies have demonstrated an increased risk of atrial fibrillation, especially in older individuals with TSH levels <0.1 mU/L. The effects of SHy on all-cause and cardiovascular mortality are not clear, but recent meta-analyses suggest a modest increase in mortality, with the risk increasing with age and associated with the lowest TSH levels. The long-term consequences of SHy in young- and middle-aged adults, and in those with TSH levels are mildly low, are uncertain. For these reasons, guidelines for treatment are based on patient age, the degree of TSH suppression, symptoms consistent with hyperthyroidism, and overall cardiovascular and osteoporotic fracture risks.

Thyroid-Stimulating Hormone (TSH) Concentration at Birth in Belgian Neonates and Cognitive Development at Preschool Age

PubMed Central

Trumpff, Caroline; De Schepper, Jean; Vanderfaeillie, Johan; Vercruysse, Nathalie; Van Oyen, Herman; Moreno-Reyes, Rodrigo; Tafforeau, Jean; Vanderpas, Jean; Vandevijvere, Stefanie

2015-01-01

The main objective of the study was to investigate the effect of MID during late pregnancy, assessed by the thyroid-stimulating hormone (TSH) concentration at neonatal screening, on cognitive development of preschool children. A retrospective cohort study including 311 Belgian preschool children of 4–6 years old was conducted. Children were selected at random from the total list of neonates screened in 2008, 2009, and 2010 by the Brussels new-born screening center. Infants with congenital hypothyroidism, low birth weight, and/or prematurity were excluded from the selection. The selected children were stratified by gender and TSH-range (0.45–15 mIU/L). Cognitive abilities were assessed using Wechsler Preschool and Primary Scale of Intelligence—third edition. In addition, several socioeconomic, parental, and child confounding factors were assessed. Neonatal TSH concentration—a surrogate marker for MID—was not associated with Full Scale and Performance IQ scores in children. Lower Verbal IQ scores were found in children with neonatal TSH values comprised between 10–15 mIU/L compared to lower TSH levels in univariate analysis but these results did not hold when adjusting for confounding factors. Current levels of iodine deficiency among pregnant Belgian women may not be severe enough to affect the neurodevelopment of preschool children. PMID:26540070

Recent advances in central congenital hypothyroidism

PubMed Central

Schoenmakers, Nadia; Alatzoglou, Kyriaki S; Chatterjee, V Krishna; Dattani, Mehul T

2015-01-01

Central congenital hypothyroidism (CCH) may occur in isolation, or more frequently in combination with additional pituitary hormone deficits with or without associated extrapituitary abnormalities. Although uncommon, it may be more prevalent than previously thought, affecting up to 1:16 000 neonates in the Netherlands. Since TSH is not elevated, CCH will evade diagnosis in primary, TSH-based, CH screening programs and delayed detection may result in neurodevelopmental delay due to untreated neonatal hypothyroidism. Alternatively, coexisting growth hormones or ACTH deficiency may pose additional risks, such as life threatening hypoglycaemia. Genetic ascertainment is possible in a minority of cases and reveals mutations in genes controlling the TSH biosynthetic pathway (TSHB, TRHR, IGSF1) in isolated TSH deficiency, or early (HESX1, LHX3, LHX4, SOX3, OTX2) or late (PROP1, POU1F1) pituitary transcription factors in combined hormone deficits. Since TSH cannot be used as an indicator of euthyroidism, adequacy of treatment can be difficult to monitor due to a paucity of alternative biomarkers. This review will summarize the normal physiology of pituitary development and the hypothalamic–pituitary–thyroid axis, then describe known genetic causes of isolated central hypothyroidism and combined pituitary hormone deficits associated with TSH deficiency. Difficulties in diagnosis and management of these conditions will then be discussed. PMID:26416826

Thyroid-Stimulating Hormone (TSH) Concentration at Birth in Belgian Neonates and Cognitive Development at Preschool Age.

PubMed

Trumpff, Caroline; De Schepper, Jean; Vanderfaeillie, Johan; Vercruysse, Nathalie; Van Oyen, Herman; Moreno-Reyes, Rodrigo; Tafforeau, Jean; Vanderpas, Jean; Vandevijvere, Stefanie

2015-11-02

The main objective of the study was to investigate the effect of MID during late pregnancy, assessed by the thyroid-stimulating hormone (TSH) concentration at neonatal screening, on cognitive development of preschool children. A retrospective cohort study including 311 Belgian preschool children of 4-6 years old was conducted. Children were selected at random from the total list of neonates screened in 2008, 2009, and 2010 by the Brussels new-born screening center. Infants with congenital hypothyroidism, low birth weight, and/or prematurity were excluded from the selection. The selected children were stratified by gender and TSH-range (0.45-15 mIU/L). Cognitive abilities were assessed using Wechsler Preschool and Primary Scale of Intelligence-third edition. In addition, several socioeconomic, parental, and child confounding factors were assessed. Neonatal TSH concentration-a surrogate marker for MID-was not associated with Full Scale and Performance IQ scores in children. Lower Verbal IQ scores were found in children with neonatal TSH values comprised between 10-15 mIU/L compared to lower TSH levels in univariate analysis but these results did not hold when adjusting for confounding factors. Current levels of iodine deficiency among pregnant Belgian women may not be severe enough to affect the neurodevelopment of preschool children.

Seasonal Changes in Serum Thyrotropin Concentrations Observed from Big Data Obtained During Six Consecutive Years from 2010 to 2015 at a Single Hospital in Japan.

PubMed

Yoshihara, Ai; Noh, Jaeduk Yoshimura; Watanabe, Natsuko; Iwaku, Kenji; Kunii, Yo; Ohye, Hidemi; Suzuki, Miho; Matsumoto, Masako; Suzuki, Nami; Sugino, Kiminori; Thienpont, Linda M; Hishinuma, Akira; Ito, Koichi

2018-04-01

This study analyzed big data for serum thyrotropin (TSH), free triiodothyronine (fT3), and free thyroxine (fT4) concentrations in patients who had attended the outpatient clinic of Ito Hospital (Tokyo, Japan) during a recent six-year period (between January 1, 2010, and December 31, 2015) in order to investigate for seasonal changes. The serum TSH concentrations were reviewed for all 135,417 patients aged >20 years. Patients with any thyroid diseases were included, irrespective of whether they were receiving drug therapy. In total 1,637,721 serum samples were analyzed for TSH, 1,626,269 for fT3, and 1,669,381 for fT4. It was observed that the TSH concentrations showed annual changes during the six-year period. They decreased during the summer, while they increased during the winter. The TSH concentrations were negatively correlated with the daily temperatures (Spearman rank correlation coefficient -0.4486; p < 0.0001). The same applied for the correlation between fT3 concentrations and daily temperatures. The fact that the TSH concentrations show annual changes in areas where the temperature ranges during the year are rather wide should be borne in mind for interpretation of results.

Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

NASA Astrophysics Data System (ADS)

Beyer, Eric W.

The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions is shown to validate the dynamic model. Using the validated dynamic model, simulations were performed to better understand the dynamics of the device. In addition, key parameters such as system weight, rotor speed, internal mass weight and location, as well as battery capacity are varied to explore and optimize flight performance characteristics such as single hop height and range, number of hops, and total achievable range. The sensitivity of the Hopping Rotochute to atmospheric winds is also investigated as is the ability of the device to perform trajectory shaping.

Gender disparities in screening for congenital hypothyroidism using thyroxine as a primary screen.

PubMed

DeMartino, Lenore; McMahon, Rebecca; Caggana, Michele; Tavakoli, Norma Parvin

2018-06-26

Newborn screening for congenital hypothyroidism (CH) is based on testing for the markers thyroxine (T4) and/or thyroid stimulating hormone (TSH). Diagnosis of CH is complicated because many factors affect the levels of these hormones including infant birth weight, prematurity, and age at specimen collection. We investigated whether the sex of the newborn affected the levels of T4 and TSH and consequently the outcome of newborn screening. In New York State, the Newborn Screening program initially tests all infants for T4 and any baby with a result in the lowest 10% is triaged for TSH screening. We analyzed data from 2008 to 2016 to determine mean and median T4 and TSH values and how these results correlate with the sex of infants who are reported as borderline, referred and confirmed with CH. T4 and TSH concentrations in dried blood spots were measured using commercially available fluoroimmunoassays. From 2008 to 2016, of the 2.4 million specimens tested for thyroxine, 51.5% were from male and 48.5% were from female infants. Male infants constituted 60% of specimens triaged for TSH testing, 64.9% of repeat requests and 59.6% of referrals, but only 49% of confirmed CH cases. The mean and median T4 values were lower (a difference of approximately 0.8-1.1 μg/dL each year), and the median TSH values were higher in male compared to female infants. Natural differences in thyroid hormone levels in male and female infants leads to male infants being disproportionately represented in the false positive category.

Thyrotropin receptor and membrane interactions in FRTL-5 thyroid cell strain in microgravity.

PubMed

Albi, E; Ambesi-Impiombato, F S; Peverini, M; Damaskopoulou, E; Fontanini, E; Lazzarini, R; Curcio, F; Perrella, G

2011-01-01

The aim of this work was to analyze the possible alteration of thyrotropin (TSH) receptors in microgravity, which could explain the absence of thyroid cell proliferation in the space environment. Several forms of the TSH receptor are localized on the plasma membrane associated with caveolae and lipid rafts. The TSH regulates the fluidity of the cell membrane and the presence of its receptors in microdomains that are rich in sphingomyelin and cholesterol. TSH also stimulates cyclic adenosine monophosphate (cAMP) accumulation and cell proliferation. Reported here are the results of an experiment in which the FRTL-5 thyroid cell line was exposed to microgravity during the Texus-44 mission (launched February 7, 2008, from Kiruna, Sweden). When the parabolic flight brought the sounding rocket to an altitude of 264 km, the culture media were injected with or without TSH in the different samples, and weightlessness prevailed on board for 6 minutes and 19 seconds. Control experiments were performed, in parallel, in an onboard 1g centrifuge and on the ground in Kiruna laboratory. Cell morphology and function were analyzed. Results show that in microgravity conditions the cells do not respond to TSH treatment and present an irregular shape with condensed chromatin, a modification of the cell membrane with shedding of the TSH receptor in the culture medium, and an increase of sphingomyelin-synthase and Bax proteins. It is possible that real microgravity induces a rearrangement of specific sections of the cell membrane, which act as platforms for molecular receptors, thus influencing thyroid cell function in astronauts during space missions.

Thyrotropin Receptor and Membrane Interactions in FRTL-5 Thyroid Cell Strain in Microgravity

NASA Astrophysics Data System (ADS)

Albi, E.; Ambesi-Impiombato, F. S.; Peverini, M.; Damaskopoulou, E.; Fontanini, E.; Lazzarini, R.; Curcio, F.; Perrella, G.

2011-01-01

The aim of this work was to analyze the possible alteration of thyrotropin (TSH) receptors in microgravity, which could explain the absence of thyroid cell proliferation in the space environment. Several forms of the TSH receptor are localized on the plasma membrane associated with caveolae and lipid rafts. The TSH regulates the fluidity of the cell membrane and the presence of its receptors in microdomains that are rich in sphingomyelin and cholesterol. TSH also stimulates cyclic adenosine monophosphate (cAMP) accumulation and cell proliferation. Reported here are the results of an experiment in which the FRTL-5 thyroid cell line was exposed to microgravity during the Texus-44 mission (launched February 7, 2008, from Kiruna, Sweden). When the parabolic flight brought the sounding rocket to an altitude of 264km, the culture media were injected with or without TSH in the different samples, and weightlessness prevailed on board for 6 minutes and 19 seconds. Control experiments were performed, in parallel, in an onboard 1g centrifuge and on the ground in Kiruna laboratory. Cell morphology and function were analyzed. Results show that in microgravity conditions the cells do not respond to TSH treatment and present an irregular shape with condensed chromatin, a modification of the cell membrane with shedding of the TSH receptor in the culture medium, and an increase of sphingomyelin-synthase and Bax proteins. It is possible that real microgravity induces a rearrangement of specific sections of the cell membrane, which act as platforms for molecular receptors, thus influencing thyroid cell function in astronauts during space missions.

Management of Subclinical Hyperthyroidism

PubMed Central

Santos Palacios, Silvia; Pascual-Corrales, Eider; Galofre, Juan Carlos

2012-01-01

The ideal approach for adequate management of subclinical hyperthyroidism (low levels of thyroid-stimulating hormone [TSH] and normal thyroid hormone level) is a matter of intense debate among endocrinologists. The prevalence of low serum TSH levels ranges between 0.5% in children and 15% in the elderly population. Mild subclinical hyperthyroidism is more common than severe subclinical hyperthyroidism. Transient suppression of TSH secretion may occur because of several reasons; thus, corroboration of results from different assessments is essential in such cases. During differential diagnosis of hyperthyroidism, pituitary or hypothalamic disease, euthyroid sick syndrome, and drug-mediated suppression of TSH must be ruled out. A low plasma TSH value is also typically seen in the first trimester of gestation. Factitial or iatrogenic TSH inhibition caused by excessive intake of levothyroxine should be excluded by checking the patient’s medication history. If these nonthyroidal causes are ruled out during differential diagnosis, either transient or long-term endogenous thyroid hormone excess, usually caused by Graves’ disease or nodular goiter, should be considered as the cause of low circulating TSH levels. We recommend the following 6-step process for the assessment and treatment of this common hormonal disorder: 1) confirmation, 2) evaluation of severity, 3) investigation of the cause, 4) assessment of potential complications, 5) evaluation of the necessity of treatment, and 6) if necessary, selection of the most appropriate treatment. In conclusion, management of subclinical hyperthyroidism merits careful monitoring through regular assessment of thyroid function. Treatment is mandatory in older patients (> 65 years) or in presence of comorbidities (such as osteoporosis and atrial fibrillation). PMID:23843809

GLIS3 is indispensable for TSH/TSHR-dependent thyroid hormone biosynthesis and follicular cell proliferation

PubMed Central

Kang, Hong Soon; Kumar, Dhirendra; Liao, Grace; Lichti-Kaiser, Kristin; Gerrish, Kevin; Liao, Xiao-Hui; Refetoff, Samuel; Jothi, Raja; Jetten, Anton M.

2017-01-01

Deficiency in Krüppel-like zinc finger transcription factor GLI-similar 3 (GLIS3) in humans is associated with the development of congenital hypothyroidism. However, the functions of GLIS3 in the thyroid gland and the mechanism by which GLIS3 dysfunction causes hypothyroidism are unknown. In the current study, we demonstrate that GLIS3 acts downstream of thyroid-stimulating hormone (TSH) and TSH receptor (TSHR) and is indispensable for TSH/TSHR-mediated proliferation of thyroid follicular cells and biosynthesis of thyroid hormone. Using ChIP-Seq and promoter analysis, we demonstrate that GLIS3 is critical for the transcriptional activation of several genes required for thyroid hormone biosynthesis, including the iodide transporters Nis and Pds, both of which showed enhanced GLIS3 binding at their promoters. The repression of cell proliferation of GLIS3-deficient thyroid follicular cells was due to the inhibition of TSH-mediated activation of the mTOR complex 1/ribosomal protein S6 (mTORC1/RPS6) pathway as well as the reduced expression of several cell division–related genes regulated directly by GLIS3. Consequently, GLIS3 deficiency in a murine model prevented the development of goiter as well as the induction of inflammatory and fibrotic genes during chronic elevation of circulating TSH. Our study identifies GLIS3 as a key regulator of TSH/TSHR-mediated thyroid hormone biosynthesis and proliferation of thyroid follicular cells and uncovers a mechanism by which GLIS3 deficiency causes neonatal hypothyroidism and prevents goiter development. PMID:29083325

High levels of thyroid-stimulating hormone are associated with aortic wall thickness in the general population.

PubMed

Ittermann, Till; Lorbeer, Roberto; Dörr, Marcus; Schneider, Tobias; Quadrat, Alexander; Heßelbarth, Lydia; Wenzel, Michael; Lehmphul, Ina; Köhrle, Josef; Mensel, Birger; Völzke, Henry

2016-12-01

Our aim was to investigate the association of thyroid function defined by serum concentrations of thyroid-stimulating hormone (TSH) with thoracic aortic wall thickness (AWT) as a marker of atherosclerotic processes. We pooled data of 2,679 individuals from two independent population-based surveys of the Study of Health in Pomerania. Aortic diameter and AWT measurements were performed on a 1.5-T MRI scanner at the concentration of the right pulmonary artery displaying the ascending and the descending aorta. TSH, treated as continuous variable, was significantly associated with descending AWT (β = 0.11; 95 % confidence interval (CI) 0.02-0.21), while the association with ascending AWT was not statistically significant (β = 0.20; 95 % CI -0.01-0.21). High TSH (>3.29 mIU/L) was significantly associated with ascending (β = 0.12; 95 % CI 0.02-0.23) but not with descending AWT (β = 0.06; 95 % CI -0.04-0.16). There was no consistent association between TSH and aortic diameters. Our study demonstrated that AWT values increase with increasing serum TSH concentrations. Thus, a hypothyroid state may be indicative for aortic atherosclerosis. These results fit very well to the findings of previous studies pointing towards increased atherosclerotic risk in the hypothyroid state. • Serum TSH concentrations are positively associated with aortic wall thickness. • Serum TSH concentrations are not associated with the aortic diameters. • Serum 3,5-diiodothyronine concentrations may be positively associated with aortic wall thickness.

Low serum thyroid-stimulating hormone levels are associated with lipid profile in depressive patients with long symptom duration.

PubMed

Peng, Rui; Li, Yan

2017-08-01

The current study was designed to investigate the association between serum thyroid hormones and thyroid-stimulating hormone (TSH) levels with lipid profile in depressive disorder. A total of 370 depressive individuals aged 18 years and above were recruited in this cross-section study. All participants underwent a Structured Clinical Interview for DSM-IV (SCID) and recorded the duration of their symptoms. The serum levels of total cholesterol (TCH), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), lipoprotein A (Lp(a)), high-sensitivity C-reactive protein (hsCRP), free thyroxine (FT4), free triiodothyronine (FT3) and TSH levels were determined and the ratios of TCH/HDL-C were assessed. Depressed subjects with a symptom duration ≥3 years had higher TG levels, increased TCH/HDL-C ratios and lower levels of HDL-C, FT4 and TSH compared with depressive patients with a symptom duration <3 years. Correlation analysis displayed that TSH is positively and significantly associated with TCH and LDL-C (p<0.05); the above FT4 and FT3 are negatively, significantly and respectively associated with TCH/HDL-C (p<0.05) and TCH, HDL-C, LDL-C (p<0.05). Multiple linear regression analysis indicated that serum TG and TSH levels are associated with depressive symptom duration. According to our results,These findings indicate that low serum TSH levels are associated with lipid profile, TG and TSH levels have significant association with symptom duration in depressive patients. Copyright © 2017. Published by Elsevier B.V.

Human thyrotropin receptor subunits characterized by thyrotropin affinity purification and western blotting.

PubMed

Leedman, P J; Newman, J D; Harrison, L C

1989-07-01

We studied the subunit structure of the human TSH receptor in thyroid tissue from patients with Graves' disease and multinodular goiter by TSH affinity chromatography, immunoprecipitation with Graves' immunoglobulins (Igs), and a modified technique of Western blotting. Human TSH receptor-binding activity was purified about 1,270-fold by sequential affinity chromatography on wheat germ lectin-agarose and TSH-agarose. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of nonreduced affinity-purified receptors eluted in sodium dodecyl sulfate sample buffer revealed three noncovalently linked subunits of 70,000, 50,000, and 35,000 mol wt. When reduced, a major subunit of 25,000 mol wt was identified. When 3 mol/L NaCl was used to elute affinity-purified receptors only the 50,000 mol wt nonreduced subunit was detected. This subunit bound [125I]bovine TSH and was precipitated by Graves' Igs. Modifications to the conventional Western blotting technique enabled thyroglobulin components (approximately 220,000 mol wt), thyroid microsomal antigen (a doublet of approximately 110,000 mol wt), and putative TSH receptor subunits of 70,000 and 50,000 mol wt to be identified in thyroid particulate membranes by Graves' Igs. Blotting of affinity-purified receptors eluted in sodium dodecyl sulfate sample buffer revealed subunits of either 70,000 or 50,000 mol wt, with a minority of Graves' serum samples. We conclude that the nonreduced human TSH receptor is an oligomeric complex comprising three different subunits of 70,000, 50,000, and 35,000 mol wt. The reduced receptor exists as a single subunit of 25,000 mol wt, which may be disulfide linked to form the higher mol wt forms. The 70,000 and 50,000 mol wt subunits contain epitopes that bind Graves' Igs in modified Western blots, thus directly confirming that the human TSH receptor is a target for Graves' Igs.

Homeostatic equilibria between free thyroid hormones and pituitary thyrotropin are modulated by various influences including age, body mass index and treatment.

PubMed

Hoermann, Rudolf; Midgley, John E M; Giacobino, Adrienne; Eckl, Walter A; Wahl, Hans Günther; Dietrich, Johannes W; Larisch, Rolf

2014-12-01

We examined the interrelationships of pituitary thyrotropin (TSH) with circulating thyroid hormones to determine whether they were expressed either invariably or conditionally and distinctively related to influences such as levothyroxine (L-T4) treatment. This prospective study employing 1912 consecutive patients analyses the interacting equilibria of TSH and free triiodothyronine (FT3) and free thyroxine (FT4) in the circulation. The complex interrelations between FT3, FT4 and TSH were modulated by age, body mass, thyroid volume, antibody status and L-T4 treatment. By group comparison and confirmation by more individual TSH-related regression, FT3 levels were significantly lower in L-T4-treated vs untreated nonhypothyroid autoimmune thyroiditis (median 4·6 vs 4·9 pm, P < 0·001), despite lower TSH (1·49 vs 2·93 mU/l, P < 0·001) and higher FT4 levels (16·8 vs 13·8 pm, P < 0·001) in the treated group. Compared with disease-free controls, the FT3-TSH relationship was significantly displaced in treated patients with carcinoma, with median TSH of 0·21 vs 1·63 (P < 0·001) at a comparable FT3 of 5·0 pm in the groups. Disparities were reflected by calculated deiodinase activity and remained significant even after accounting for confounding influences in a multivariable model. TSH, FT4 and FT3 each have their individual, but also interlocking roles to play in defining the overall patterns of thyroidal expression, regulation and metabolic activity. Equilibria typical of the healthy state are not invariant, but profoundly altered, for example, by L-T4 treatment. Consequently, this suggests the revisitation of strategies for treatment optimization. © 2014 John Wiley & Sons Ltd.

Loss-of-function mutations in the thyrotropin receptor gene as a major determinant of hyperthyrotropinemia in a consanguineous community.

PubMed

Tenenbaum-Rakover, Yardena; Grasberger, Helmut; Mamanasiri, Sunee; Ringkananont, Usanee; Montanelli, Lucia; Barkoff, Marla S; Dahood, Ahmad Mahameed-Hag; Refetoff, Samuel

2009-05-01

Resistance to TSH (RTSH) is a condition of impaired responsiveness of the thyroid gland to TSH, characterized by elevated serum TSH, low or normal thyroid hormone levels, and hypoplastic or normal-sized thyroid gland. The aim of the study was to evaluate the clinical course and the genotype-phenotype relationship of RTSH caused by two different TSH receptor (TSHR) gene mutations in a consanguineous population. We conducted a clinical and genetic investigation of 46 members of an extended family and 163 individuals living in the same town. In vitro functional studies of the mutant TSHRs were also performed. Two TSHR gene mutations (P68S and L653V) were identified in 33 subjects occurring as homozygous L653V (five subjects), heterozygous L653V (20 subjects), heterozygous P68S (four subjects), and compound heterozygous L653V/P68S (four subjects). With the exception of one individual with concomitant autoimmune thyroid disease, all homozygotes and compound heterozygotes presented with compensated RTSH (high TSH with free T(4) and T(3) in the normal range). Only nine of 24 heterozygotes had mild hyperthyrotropinemia. The L653V mutation resulted in a higher serum TSH concentration and showed a more severe in vitro abnormality than P68S. Haplotype analysis predicted a founder of the L653V six to seven generations earlier, whereas the P68S is older. Cross-sectional and prospective longitudinal studies indicate that TSH and T(4) concentrations remain stable over time. High frequency hyperthyrotropinemia in an Israeli Arab-Muslim consanguineous community is attributed to two inactivating TSHR gene mutations. Concordant genotype-phenotype was demonstrated clinically and by in vitro functional analysis. Retrospective and prospective studies indicate that in the absence of concomitant autoimmune thyroid disease, elevated TSH levels reflect stable compensated RTSH.

Molecular basis for the autoreactivity against thyroid stimulating hormone receptor.

PubMed

Kohn, L D; Kosugi, S; Ban, T; Saji, M; Ikuyama, S; Giuliani, C; Hidaka, A; Shimura, H; Akamizu, T; Tahara, K

1992-01-01

The present report identifies an important immunogenic region of the TSH receptor and determinants on the TSH receptor for the two types of autoantibodies seen in hyperthyroid Graves' disease and hypothyroid idiopathic myxedema, TSAbs and TSBAbs, respectively. The immunogenic domain with no important functional determinants, is contained within residues 303-382 and involves residues 352-366 in particular. There are determinants flanking the immunogenic domain on the C-terminal portion of the receptor which are the TSBAb and high affinity TSH binding sites: residues 295-306, 387-395, and tyrosine 385. Determinants on the N-terminal portion of the external domain, centered on residues 38-45, are TSAb interactions linked to low affinity TSH binding important for signal generation: threonine 40 and residues 30-33, 34-37, 42-45, 52-56, and 58-61. These determinants are conserved in human and rat receptors, are not present in gonadotropin receptors, and are each related to separate actions of TSH: binding vs. signal generation. They can, therefore, account for organ specific autoimmunity and the different disease expression effected by TSBAbs vs TSAbs, i.e. hypo- vs. hyperthyroidism, respectively. It is proposed that, in the thyroid, hormonal (TSH, insulin, hydrocortisone, IGF-I) suppression of class I genes might be one means of preserving self-tolerance in the face of the hormone action to increase the expression of tissue specific genes such as thyroglobulin and thyroid peroxidase. Inappropriately high class I expression in the thyroid, i.e. if induced by interferon, viruses, or some as yet unknown agent, would contribute to the generation of autoimmune disease. Thus, it would result in increased antigen presentation to the immune system, particularly those autoantigens increased by TSH and its cAMP signal such as thyroglobulin or thyroid peroxidase, or whose turnover is increased by TSH and its cAMP signal, such as the TSH receptor. In the case of the latter, peptide 352-366, known to be near a protease sensitive site on the receptor [41,49], would now act as a potent self-antigen and induce the formation of receptor autoantibodies. It is further proposed that methimazole and high doses of iodide are therapeutically effective agents in thyroid autoimmune disease because they, in part, decrease MHC class I gene expression. Speculation is presented which suggests that elimination of negative regulation of MHC class I and the TSH receptor is an important factor in the development of autoimmune thyroid disease.(ABSTRACT TRUNCATED AT 400 WORDS)

Mitotane treatment in patients with adrenocortical cancer causes central hypothyroidism.

PubMed

Russo, Marco; Scollo, Claudia; Pellegriti, Gabriella; Cotta, Oana Ruxandra; Squatrito, Sebastiano; Frasca, Francesco; Cannavò, Salvatore; Gullo, Damiano

2016-04-01

Mitotane, a steroidogenesis inhibitor with adrenolytic properties used to treat adrenocortical cancer (ACC), can affect thyroid function. A reduction of FT4 levels with normal FT3 and TSH has been described in these patients. Using an in vitro murine model, the secretory capacity of thyrotrophic cells has been shown to be inhibited by mitotane. To investigate the pathogenesis of thyroid abnormalities in mitotane-treated patients with ACC. In five female patients with ACC (median age 47; range 31-65) treated with mitotane (dosage 1·5 g/day; 1·0-3·0), we analysed the pattern of TSH and thyroid function index (FT4, FT3 and FT3/FT4 ratio) compared to an age- and gender-matched control group. The in vivo secretory activity of the thyrotrophic cells was evaluated using a standard TRH test (200 μg), and the response was compared to both a group of age-matched female controls (n = 10) and central hypothyroid patients (n = 10). Basal TSH (median 1·54 mU/l; range 1·20-2·17) was normal and scattered around our median reference value, FT3 levels (median 3·80 pmol/l; 3·30-4·29) were normal but below the median reference value of 4·37 pmol/l and FT4 levels were below the normal range in all patients (median 8·40 pmol/l; 7·6-9·9). FT3/FT4 ratio was in the upper range in 4 patients and higher than normal in one patient. A blunted TSH response to TRH was observed in mitotane-treated patients. ΔTSH (absolute TSH response, peak TSH minus basal TSH) was 3·65 (range 3·53-5·26), 12·37 (range 7·55-19·97) and 1·32 mU/l (range 0·52-4·66) in mitotane-treated patients, controls and central hypothyroid patients, respectively. PRL secretion was normal. Mitotane-treated patients with ACC showed low FT4, normal FT3 and TSH and impaired TSH response to TRH, characteristic of central hypothyroidism. Furthermore, the elevated FT3/FT4 ratio of these subjects reflects an enhanced T4 to T3 conversion rate, a compensatory mechanism characteristic of thyroid function changes observed in hypothyroid conditions. This finding thus confirms in vitro studies and may have a therapeutic implication for treatment with thyroid hormones, as suggested by current guidelines for this specific condition. © 2015 John Wiley & Sons Ltd.

Hypothyroidism in adults. Levothyroxine if warranted by clinical and laboratory findings, not for simple TSH elevation.

PubMed

2015-10-01

Hypothyroidism is a common disorder due to inadequate thyroid hormone secretion. When a patient has signs and symptoms suggestive of hypothyroidism, how is it determined whether thyroid hormone replacement therapy will have a favourable harm-benefit balance? How should treatment be managed? To answer these questions, we conducted a review of the literature using the standard Prescrire methodology. The symptoms of hypothyroidism are due to slow metabolism (constipation, fatigue, sensitivity to cold, weight gain, etc.) and to polysaccharide accumulation in certain tissues, leading to hoarseness, eyelid swelling, etc. A blood TSH concentration of less than 4 or 5 mlU/L rules out peripheral hypothyroidism. TSH levels increase with age. Between 30% and 60% of high TSH levels are not confirmed on a second blood test. In overt hypothyroidism, the TSH level is high and the free T4 (thyroxine) level is low. Most of these patients are symptomatic. So-called subclinical hypothyroidism, which is rarely symptomatic, is characterised by high blood TSH levels and normal free T4 levels. The natural history of hypothyroidism depends on its cause. In chronic autoimmune thyroiditis, the most common form seen in rich countries, hypothyroidism generally worsens over time. However, other situations can lead to transient hypothyroidism that may last several weeks or months. Subclinical hypothyroidism, as the name implies, is usually asymptomatic. The risk of progression to overt hypothyroidism is about 3% to 4% per year overall but increases with the initial TSH level. Treatment guidelines are mainly based on physiological and pharmacological considerations and generally recommend levothyroxine therapy. The adverse effects of levothyroxine are signs of thyrotoxicosis in case of overdose (tachycardia, tremor, sweating, etc.). Even a slight overdose carries a risk of osteoporotic fractures and atrial fibrillation, especially in the elderly. In young adults, levothyroxine is usually started at a dose of about 1.5 microg/kg per day, taken on an empty stomach. Elderly patients and those with coronary artery disease should start at a lower dose: 12.5 to 50 microg per day. Treatment monitoring is based mainly on blood TSH assay. Dose adjustment should only be considered after 6 to 12 weeks, given the long half-life of levothyroxine. Certain drugs, such as iron and calcium, reduce the gastrointestinal absorption of levothyroxine. Enzyme inducers reduce its efficacy. In 2015, there is no robust evidence that levothyroxine therapy has any tangible benefit in patients with subclinical hypothyroidism. Some practice guidelines recommend treatment when the TSH level is above 10 mIU/L, or sometimes trial treatment for a few months for patients with symptoms suggestive of hypothyroidism. In practice, replacement therapy is needed for patients with overt hypothyroidism and a blood TSH concentration above 10 mIU/L. The main challenge is to recognise transient hypothyroidism, which does not require life-long treatment. When the TSH is only slightly elevated, there is a risk of attributing non-specific symptoms to an abnormal laboratory result and prescribing unnecessary treatment. Watchful waiting is an alternative to routine levothyroxine prescription in case of TSH elevation.

HapHop-Physio: a computer game to support cognitive therapies in children

PubMed Central

Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

2017-01-01

Background Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. PMID:28740440

Effects of interdot hopping and Coulomb blockade on the thermoelectric properties of serially coupled quantum dots

PubMed Central

2012-01-01

We have theoretically studied the thermoelectric properties of serially coupled quantum dots (SCQDs) embedded in an insulator connected to metallic electrodes. In the framework of Keldysh Green’s function technique, the Landauer formula of transmission factor is obtained using the equation of motion method. Based on such analytical expressions of charge and heat currents, we calculate the electrical conductance, Seebeck coefficient, electron thermal conductance, and figure of merit (ZT) of SCQDs in the linear response regime. The effects of interdot hopping and electron Coulomb interactions on ZT are analyzed. We demonstrate that ZT is not a monotonic increasing function of interdot electron hopping strength (tc). We also show that in the absence of phonon thermal conductance, SCQD can reach the Carnot efficiency as tcapproaches zero. PMID:22591807

Parallel Monotonic Basin Hopping for Low Thrust Trajectory Optimization

NASA Technical Reports Server (NTRS)

McCarty, Steven L.; McGuire, Melissa L.

2018-01-01

Monotonic Basin Hopping has been shown to be an effective method of solving low thrust trajectory optimization problems. This paper outlines an extension to the common serial implementation by parallelizing it over any number of available compute cores. The Parallel Monotonic Basin Hopping algorithm described herein is shown to be an effective way to more quickly locate feasible solutions, and improve locally optimal solutions in an automated way without requiring a feasible initial guess. The increased speed achieved through parallelization enables the algorithm to be applied to more complex problems that would otherwise be impractical for a serial implementation. Low thrust cislunar transfers and a hybrid Mars example case demonstrate the effectiveness of the algorithm. Finally, a preliminary scaling study quantifies the expected decrease in solve time compared to a serial implementation.,

Relational Stability of Thyroid Hormones in Euthyroid Subjects and Patients with Autoimmune Thyroid Disease

PubMed Central

Hoermann, Rudolf; Midgley, John E.M.; Larisch, Rolf; Dietrich, Johannes W.

2016-01-01

Background/Aim Operating far from its equilibrium resting point, the thyroid gland requires stimulation via feedback-controlled pituitary thyrotropin (TSH) secretion to maintain adequate hormone supply. We explored and defined variations in the expression of control mechanisms and physiological responses across the euthyroid reference range. Methods We analyzed the relational equilibria between thyroid parameters defining thyroid production and thyroid conversion in a group of 271 thyroid-healthy subjects and 86 untreated patients with thyroid autoimmune disease. Results In the euthyroid controls, the FT3-FT4 (free triiodothyronine-free thyroxine) ratio was strongly associated with the FT4-TSH ratio (tau = −0.22, p < 0.001, even after correcting for spurious correlation), linking T4 to T3 conversion with TSH-standardized T4 production. Using a homeostatic model, we estimated both global deiodinase activity and maximum thyroid capacity. Both parameters were nonlinearly and inversely associated, trending in opposite directions across the euthyroid reference range. Within the panel of controls, the subgroup with a relatively lower thyroid capacity (<2.5 pmol/s) displayed lower FT4 levels, but maintained FT3 at the same concentrations as patients with higher functional and anatomical capacity. The relationships were preserved when extended to the subclinical range in the diseased sample. Conclusion The euthyroid panel does not follow a homogeneous pattern to produce random variation among thyroid hormones and TSH, but forms a heterogeneous group that progressively displays distinctly different levels of homeostatic control across the euthyroid range. This suggests a concept of relational stability with implications for definition of euthyroidism and disease classification. PMID:27843807

Co-occurring exposure to perchlorate, nitrate and thiocyanate alters thyroid function in healthy pregnant women

PubMed Central

Horton, Megan K.; Blount, Benjamin C.; Valentin-Blasini, Liza; Wapner, Ronald; Whyatt, Robin; Gennings, Chris; Factor-Litvak, Pam

2015-01-01

Background Adequate maternal thyroid function during pregnancy is necessary for normal fetal brain development, making pregnancy a critical window of vulnerability to thyroid disrupting insults. Sodium/iodide symporter (NIS) inhibitors, namely perchlorate, nitrate, and thiocyanate, have been shown individually to competitively inhibit uptake of iodine by the thyroid. Several epidemiologic studies examined the association between these individual exposures and thyroid function. Few studies have examined the effect of this chemical mixture on thyroid function during pregnancy. Objectives We examined the cross sectional association between urinary perchlorate, thiocyanate and nitrate concentrations and thyroid function among healthy pregnant women living in New York City using weighted quantile sum (WQS) regression. Methods We measured thyroid stimulating hormone (TSH) and free thyroxine (FreeT4) in blood samples; perchlorate, thiocyanate, nitrate and iodide in urine samples collected from 284 pregnant women at 12 (± 2.8) weeks gestation. We examined associations between urinary analyte concentrations and TSH or FreeT4 using linear regression or WQS adjusting for gestational age, urinary iodide and creatinine. Results Individual analyte concentrations in urine were significantly correlated (Spearman’s r 0.4–0.5, p < 0.001). Linear regression analyses did not suggest associations between individual concentrations and thyroid function. The WQS revealed a significant positive association between the weighted sum of urinary concentrations of the three analytes and increased TSH. Perchlorate had the largest weight in the index, indicating the largest contribution to the WQS. Conclusions Co-exposure to perchlorate, nitrate and thiocyanate may alter maternal thyroid function, specifically TSH, during pregnancy. PMID:26408806

Trimester-Specific Changes in Maternal Thyroid Hormone, Thyrotropin, and Thyroglobulin Concentrations During Gestation: Trends and Associations Across Trimesters in Iodine Sufficiency

PubMed Central

Soldin, O.P.; Tractenberg, R.E.; Hollowell, J.G.; Jonklaas, J.; Janicic, N.; Soldin, S.J.

2013-01-01

Objectives To describe the interrelationships of thyroid functions based on trimester-specific concentrations in healthy, iodine-sufficient pregnant women across trimesters, and postpartum. Methods Circulating total 3,5,3′-triidothyronine (T3) and thyroxine (T4) concentrations were determined simultaneously using liquid chromatography tandem mass-spectrometry (LC/MS/MS). Free thyroxine (FT4), thyroid-stimulating hormone (TSH), and thyroglobulin (Tg) were measured using immunoassay techniques. Linear mixed effects models and correlations were calculated to determine trends and associations, respectively, in concentrations. Results and conclusions Trimester-specific T3, FT4, TSH, and Tg concentrations were significantly different between the first and third trimesters (all p < 0.05); second and third trimester values were not significantly different for FT4, TSH, and Tg (all p > 0.25) although T3 was significantly higher in the third, relative to the second trimester. T4 was not significantly different at any trimester (all p > 0.80). With two exceptions, analyte concentrations tended not to be correlated at each trimester and at 1-year postpartum. One exception was that T3 and T4 tended to be associated (all p < 0.05) at all time points except the third trimester (ρ = 0.239, p > 0.05). T4 and FT4 concentrations tended to correlate positively during pregnancy (ρ 0.361–0.382, all p < 0.05) but not postpartum (ρ = 0.179, p > 0.05). Trends suggest that trimester-specific measurements of T3, FT4, Tg, and possibly TSH are warranted. PMID:15650363

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

PubMed Central

Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

2017-01-01

As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs. PMID:28098818

A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

PubMed

Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

2018-05-08

With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.

PubMed

Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

2016-09-12

In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).

Congenital hypothyroidism - Polish recommendations for therapy, treatment monitoring, and screening tests in special categories of neonates with increased risk of hypothyroidism.

PubMed

Kucharska, Anna Małgorzata; Beń-Skowronek, Iwona; Walczak, Mieczysław; Ołtarzewski, Mariusz; Szalecki, Mieczysław; Jackowska, Teresa; Lewiński, Andrzej; Bossowski, Artur

2016-01-01

Proper treatment of congenital hypothyroidism warrants normal intellectual and physical development. This paper introduces the principles of treatment of congenital hypothyroidism, the recommended levothyroxine dosage, and the aims of therapy with its justification. The principles of treatment, specialist care of the patient, and methods used to evaluate therapeutic effects are described. Based on these data, recommendations concerning treatment and its monitoring in patients with congenital hypothyroidism are formulated. The paper also highlights the importance of educating the patients and/or their caretakers as one of the basic components of an effective therapy. The interpretation of screening tests in preterm neonates is provided as well. In the current screening program in preterm children TSH was determined between days three and five of life and then after three weeks. During this time TSH values are frequently low because of the immaturity of the hypothalamic-pituitary axis. Due to the increased risk of primary and secondary hypothyroidism in preterm and low birth weight babies the determination of TSH and fT4 between days three and five of life is recommended, irrespective of the screening test. (Endokrynol Pol 2016; 67 (5): 536-547).

HopBase: a unified resource for Humulus genomics

PubMed Central

Hill, Steven T.; Sudarsanam, Ramcharan

2017-01-01

Abstract Hop (Humulus lupulus L. var lupulus) is a dioecious plant of worldwide significance, used primarily for bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop have led to additional interest from pharmacy and healthcare industries as well as livestock production as a natural antibiotic. Genomic research in hop has resulted a published draft genome and transcriptome assemblies. As research into the genomics of hop has gained interest, there is a critical need for centralized online genomic resources. To support the growing research community, we report the development of an online resource "HopBase.org." In addition to providing a gene annotation to the existing Shinsuwase draft genome, HopBase makes available genome assemblies and annotations for both the cultivar “Teamaker” and male hop accession number USDA 21422M. These genome assemblies, gene annotations, along with other common data, coupled with a genome browser and BLAST database enable the hop community to enter the genomic age. The HopBase genomic resource is accessible at http://hopbase.org and http://hopbase.cgrb.oregonstate.edu. PMID:28415075

A comparative study of different methods for calculating electronic transition rates

NASA Astrophysics Data System (ADS)

Kananenka, Alexei A.; Sun, Xiang; Schubert, Alexander; Dunietz, Barry D.; Geva, Eitan

2018-03-01

We present a comprehensive comparison of the following mixed quantum-classical methods for calculating electronic transition rates: (1) nonequilibrium Fermi's golden rule, (2) mixed quantum-classical Liouville method, (3) mean-field (Ehrenfest) mixed quantum-classical method, and (4) fewest switches surface-hopping method (in diabatic and adiabatic representations). The comparison is performed on the Garg-Onuchic-Ambegaokar benchmark charge-transfer model, over a broad range of temperatures and electronic coupling strengths, with different nonequilibrium initial states, in the normal and inverted regimes. Under weak to moderate electronic coupling, the nonequilibrium Fermi's golden rule rates are found to be in good agreement with the rates obtained via the mixed quantum-classical Liouville method that coincides with the fully quantum-mechanically exact results for the model system under study. Our results suggest that the nonequilibrium Fermi's golden rule can serve as an inexpensive yet accurate alternative to Ehrenfest and the fewest switches surface-hopping methods.

Associations between metabolic syndrome, serum thyrotropin, and thyroid antibodies status in postmenopausal women, and the role of interleukin-6.

PubMed

Siemińska, Lucyna; Wojciechowska, Celina; Walczak, Krzysztof; Borowski, Artur; Marek, Bogdan; Nowak, Mariusz; Kajdaniuk, Dariusz; Foltyn, Wanda; Kos-Kudła, Beata

2015-01-01

The prevalence of metabolic syndrome increases after menopause; however, the role of concomitant subclinical hypothyroidism has not been completely elucidated. The aim of the study was to identify associations between thyrotropin, immune status, inflammation, and metabolic syndrome in postmenopausal women. The specific goals were: to assess thyrotropin (TSH) and interleukin-6 (IL-6) concentrations in the serum of subclinical hypothyroid postmenopausal women with and without metabolic syndrome and compare them with euthyroid controls; to test whether immune status is related to metabolic syndrome in postmenopausal women and determine the role of IL-6; to examine the relationships between TSH and different features of metabolic syndrome: insulin resistance, waist circumferences, waist-to-hip ratio (WHR), BMI, metabolic parameters (triglycerides, total cholesterol and high-density lipoprotein cholesterol), and inflammatory cytokines (IL-6). Three hundred and seventy-two postmenopausal women were included in the study: 114 women had subclinical hypothyroidism (10.0 uIU/mL > TSH ≥ 4.5 uIU/mL, normal fT4), and 258 women were in euthyreosis (TSH 0.35-4.5 uIU/mL, normal fT4); both groups were matched by age. Anthropometric measurements were conducted (BMI, waist circumference, WHR) and blood pressure was measured. In all subjects the following were assessed in serum: lipid profile, glucose, insulin, TSH, fT4, thyroid antibodies (T-Abs) - TPO-Abs, TG-Abs, and IL-6 concentrations. The prevalence of metabolic syndrome was 49.12% in subclinical hypothyroid women and 46.89% in euthyroid women. However, the proportion of subjects with one or two abnormalities was significantly higher in the subclinical hypothyroid group (45.61%) than in the euthyroid group (32.17%). When we compared subclinical hypothyroid women with and without metabolic syndrome, subjects with metabolic syndrome had higher BMI, abdominal circumferences, WHR, and HOMA-I. They presented higher systolic and diastolic blood pressure. Serum concentrations of cholesterol, triglycerides, fasting glucose, IL-6, TSH, T-Abs were also higher and serum cHDL was lower. There were no significant differences in fT4 concentrations. A similar comparison was made for euthyroid women with and without metabolic syndrome. Higher BMI, waist circumference, WHR, HOMA-I, and systolic blood pressure were observed in subjects with metabolic syndrome. Serum concentrations of TSH, triglycerides, glucose, and IL-6 were also higher, but the concentration of cHDL was significantly lower. There were no significant differences in fT4, T-Abs, cholesterol levels, and diastolic pressure. When we compared euthyroid women T-Abs (+) and T-Abs (-), the prevalence of metabolic syndrome was similar (48.68% vs. 46.15%). There were no differences in BMI, waist circumference, WHR, lipid profile, glucose, and HOMA-I, fT4. However, thyroid autoimmunity was associated with elevated TSH and IL-6 levels. When we analysed subclinical hypothyroid women with and without thyroid autoimmunity, there were no significant differences in glucose and lipid profile. However, Hashimoto`s subjects were more obese, had higher waist circumference, WHR, HOMA-I, and higher prevalence of metabolic syndrome. Serum concentrations of TSH and IL-6 were also higher and fT4 was lower. Among all of the women, serum TSH concentration was significantly correlated with BMI, waist circumference, WHR, systolic blood pressure, cholesterol, triglycerides, and TPO-Abs. When the variables of subjects with upper quartile of TSH were compared with lower quartile of TSH, we found significantly higher BMI, waist circumference, WHR, increased concentration of IL-6, cholesterol, triglycerides, and T-Abs, and concentrations of cHDL and fT4 were lower. OR for metabolic syndrome in subjects with upper quartile TSH vs. lower quartile was 1.35 (95% confidence interval [CI] 1.10-1.60). Our study confirms that metabolic syndrome in both euthyroid and subclinical hypothyroid women is connected with obesity, visceral fat accumulation, and higher TSH and IL-6 concentrations. Immune thyroiditis is associated with higher TSH and IL-6 levels. Obese subclinical hypothyroid women with Hashimoto`s thyroditis have a higher prevalence of metabolic syndrome when compared with subclinical hypothyroid women without thyroid autoimmunity. It is possible that in the crosstalking between subclinical hypothyroidism and metabolic syndrome, enhanced proinflammatory cytokine release in the course of immunological thyroiditis plays a role.

Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).

PubMed

Stannard, Hayley J; Tulk, Melissa L; Old, Julie M

2017-03-01

Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine procedures, close montoring and quick action in response to signs of illness will ensure Tyzzer's disease outbreaks do not occur. Copyright © 2017 Elsevier B.V. All rights reserved.

Long-Term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice

PubMed Central

Sasaoka, Norio; Sakamoto, Megumi; Kanemori, Shoko; Kan, Michiru; Tsukano, Chihiro; Takemoto, Yoshiji; Kakizuka, Akira

2014-01-01

Coincident with the expanding population of aged people, the incidence of Alzheimer disease (AD) is rapidly increasing in most advanced countries. At present, no effective prophylactics are available. Among several pathological mechanisms proposed for AD, the “amyloid hypothesis” has been most widely accepted, in which accumulation or deposition of Aβ is considered to be the initial event. Thus, prevention of Aβ production would be an ideal strategy for the treatment or prevention of AD. Aβ is produced via the proteolytic cleavage of its precursor protein, APP (amyloid precursor protein), by two different enzymes, β and γ-secretases. Indeed, inhibitors against either or both enzymes have been developed and tested for clinical efficacy. Based on the “amyloid hypothesis”, we developed a luciferase-based screening method to monitor γ-secretase activity, screened more than 1,600 plant extracts, most of which have long been used in Chinese medicine, and observed that Hop extracts significantly inhibit Aβ production in cultured cells. A major component of the inhibitory activity was purified, and its chemical identity was determined by NMR to be Garcinielliptone HC. In vivo, oral administration of Hop extracts to AD model mice decreased Aβ depositions in the cerebral cortex of the parietal lobe, hippocampus, and artery walls (amyloid angiopathy) in the brains. In a Morris water maze test, AD model mice that had daily consumed Hop extracts in their drinking water showed significant mitigation of memory impairment at ages of 9 and 12 months. Moreover, in the open field test oral administration of Hop extracts also prevented an emotional disturbance that appeared in the AD mice at 18 months. Despite lifelong consumption of Hop extracts, no deleterious side effects were observed at any age. These results support the “amyloid hypothesis”, and indicate that Hop extract is a promising candidate for an effective prophylactic for AD. PMID:24489866

Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage.

PubMed

Haakensen, Monique; Vickers, David M; Ziola, Barry

2009-09-07

Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol). Use of antimicrobial compounds (e.g., hop-compounds, Penicillin) by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Lactic acid bacteria susceptibility test broth medium (LSM) used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

Data mining of molecular dynamics data reveals Li diffusion characteristics in garnet Li7La3Zr2O12

PubMed Central

Chen, Chi; Lu, Ziheng; Ciucci, Francesco

2017-01-01

Understanding Li diffusion in solid conductors is essential for the next generation Li batteries. Here we show that density-based clustering of the trajectories computed using molecular dynamics simulations helps elucidate the Li diffusion mechanism within the Li7La3Zr2O12 (LLZO) crystal lattice. This unsupervised learning method recognizes lattice sites, is able to give the site type, and can identify Li hopping events. Results show that, while the cubic LLZO has a much higher hopping rate compared to its tetragonal counterpart, most of the Li hops in the cubic LLZO do not contribute to the diffusivity due to the dominance of back-and-forth type jumps. The hopping analysis and local Li configuration statistics give evidence that Li diffusivity in cubic LLZO is limited by the low vacancy concentration. The hopping statistics also shows uncorrelated Poisson-like diffusion for Li in the cubic LLZO, and correlated diffusion for Li in the tetragonal LLZO in the temporal scale. Further analysis of the spatio-temporal correlation using site-to-site mutual information confirms the weak site dependence of Li diffusion in the cubic LLZO as the origin for the uncorrelated diffusion. This work puts forward a perspective on combining machine learning and information theory to interpret results of molecular dynamics simulations. PMID:28094317

Data mining of molecular dynamics data reveals Li diffusion characteristics in garnet Li7La3Zr2O12

NASA Astrophysics Data System (ADS)

Chen, Chi; Lu, Ziheng; Ciucci, Francesco

2017-01-01

Understanding Li diffusion in solid conductors is essential for the next generation Li batteries. Here we show that density-based clustering of the trajectories computed using molecular dynamics simulations helps elucidate the Li diffusion mechanism within the Li7La3Zr2O12 (LLZO) crystal lattice. This unsupervised learning method recognizes lattice sites, is able to give the site type, and can identify Li hopping events. Results show that, while the cubic LLZO has a much higher hopping rate compared to its tetragonal counterpart, most of the Li hops in the cubic LLZO do not contribute to the diffusivity due to the dominance of back-and-forth type jumps. The hopping analysis and local Li configuration statistics give evidence that Li diffusivity in cubic LLZO is limited by the low vacancy concentration. The hopping statistics also shows uncorrelated Poisson-like diffusion for Li in the cubic LLZO, and correlated diffusion for Li in the tetragonal LLZO in the temporal scale. Further analysis of the spatio-temporal correlation using site-to-site mutual information confirms the weak site dependence of Li diffusion in the cubic LLZO as the origin for the uncorrelated diffusion. This work puts forward a perspective on combining machine learning and information theory to interpret results of molecular dynamics simulations.

Experimental verification of hopping mechanism using permanent magnets for an asteroid rover at drop tower

NASA Astrophysics Data System (ADS)

Kurisu, Masamitsu; Yano, Hajime; Yoshimitsu, Tetsuo; Kubota, Takashi; Adachi, Tadashi; Kuroda, Yoji

Verification of the hopping mechanism using permanent magnets by microgravity experiments at ZARM drop tower will be presented in this report. The mechanism, which is called HMPM (Hopping Mechanism with Permanent Magnets) was developed for a small asteroid exploration rover to replace with conventional locomotion mechanism such as wheels and crawlers. The main part of HMPM consists of three permanent magnets which are two stationary magnets and one movable magnet aligned between them. HMPM itself hops by utilizing the impact force generated when the movable magnet sticks to one of the stationary magnets. The features of HMPM are that the large impact force can be generated in spite of low-power consumption, and that it can be easily miniaturized and modularized. On the other hand, the weak point of HMPM is that the performance of the mechanism cannot be controlled directly, since the performance is decided by its design. Therefore, it is significant to evaluate the performance of HMPM before it is mounted on a flight model of rover. On the microgravity experiments at the drop tower, an imitation rover with 0.8kg weight is tested to hop with the operation of a prototype HMPM mounted on the rover. The prototype module weighs only 0.03kg with dimension 0.033 m in width, 0.046 m in height, and 0.012 m in depth, except the drive circuit and power source. Experimental results show the availability of HMPM. Also, the hopping performance of HMPM which is evaluated from the motion of rover recorded by cameras equipped inside the dropping capsule is compared with the estimated performance derived from the theoretical model. From the investigation, validity of the evaluation method based on the theoretical model is discussed. In order that the potential ability of HMPM is fully derived, optimal design of HMPM will require the evaluation method. The experiments at ZARM drop tower were accomplished based on the agreement on the Hayabusa-2 project by DLR-JAXA. And we received technical and operation supports from ZARM. We express our gratitude to ZARM, DLR and JAXA.

Thyroxine Treatment With Softgel Capsule Formulation: Usefulness in Hypothyroid Patients Without Malabsorption.

PubMed

Trimboli, Pierpaolo; Virili, Camilla; Centanni, Marco; Giovanella, Luca

2018-01-01

Levothyroxine sodium (LT4) is the therapy of choice for hypothyroidism. In the last decade, new LT4 formulations, such as liquid and softgel capsules, became available. Even if some evidence has been reached in the efficacy of liquid LT4 in patients with suboptimal TSH on tablet LT4, the usefulness of softgel LT4 has been rarely studied. This study aimed at evaluating the effect of switching from tablet to softgel LT4 patients without increased need for LT4. TSH was used as proxy of LT4 bioavailability and effectiveness. During the period from April to August 2017, 19 patients on tablet LT4 treatment for hypothyroidism, mostly due to autoimmune thyroiditis, were enrolled. Subjects with causes of malabsorption or increased requirement of LT4 were previously excluded. Patients finally included were asked to switch from tablet to softgel LT4 formulation at unchanged dose and ingestion fashion (30 min before breakfast). TSH was measured with chemiluminescence immunoassays. According to exclusion and inclusion criteria, 19 patients were finally selected. One of these had headache 4 days later and come back to tablet LT4, and 18 of them (16W/2M; mean age = 55 years; BMI 22.7 kg/m 2 ) completed the study. They were treated with a median LT4 dose of 88 μg/day and showed a median TSH value of 3.33 mIU/L. The rate of cases with TSH ≤ 4.0 mIU/L was 61.1% (11/18 cases). When patients were re-evaluated after 3 months of softgel LT4, we observed that TSH reached levels under 4.0 mIU/L in 16/18 (88.9%) patients, TSH was lower in 11 cases, and in 6 out of 7 patients with pre-switch TSH values over the normal range. Overall, TSH values on softgel LT4 (median 1.90 mIU/L) was significantly lower from that observed during tablet LT4 ( p  = 0.0039). These data show that hypothyroid patients with no proven malabsorption may have an improved TSH following 3 months from the switch from tablet to softgel LT4 preparation at unchanged dose.

[Utility of congenital hypothyroidism screening in neonates for monitoring iodine deficit disorders in the Canary Islands (Spain)].

PubMed

Doménech Martínez, E; Barroso Guerrero, F

2003-04-01

Newborns in European cities where iodine intake is low have been demonstrated to present high frequencies of transitory hypothyroidism. Because the neonatal period is critical for cerebral development, this is a cause for concern. Published studies (WHO/UNICEF/ICCIDD) indicate that neonates with a thyroid-stimulating hormone (TSH) concentration of more than 5 mU/ml revealed by screening for congenital hypothyroidism present mild iodine deficiency. To analyze the utility of TSH values as an indicator of the prevalence of iodine deficiency in the general population. We prospectively evaluated 19 809 neonates, corresponding to all the neonates screened from May 2001 to April 2002 in the Canary Islands.TSH determination in whole blood dried on filter paper was performed using immunofluorescence (Delphia) in the Center for the Detection of Metabolic Disorders in the Canary Islands. The percentage of neonates in each island with TSH values of > 5 mU/l was calculated. Samples of cord blood were not used. A total of 19 809 infants were analyzed. Of these 1800 had values of TSH > 5 mU/L, representing 9.08 % of neonates. The mean age at blood extraction was 4.31 6 3.78 days (range: 0.5-40). The percentage of neonates with values of THS > 5 mU/L in each island was 13.1 % in Gran Canaria, 5.1 % in Lanzarote, 7.3 % in Fuerteventura, 6.0 % in Tenerife, 6.2 % in La Palma, 6.6 % in Gomera and 10.1 % in Hierro. In 77.5 % of neonates in Gran Canaria blood was extracted for screening within the first 72 hours of life and 15.2 % of these neonates had TSH concentrations of > 5 mU/L. In 22.5 % of neonates blood was extracted on the third day of life or later and 7.9 % of these neonates had TSH values of > 5 mU/L. In the Canary Islands, the percentage of neonates with iodine deficiency, according to elevated TSH levels detected screening for congenital hyperthyroidism, was small. The validity of TSH level as an indicator of the prevalence of iodine deficiency in the general population is influenced by the days of life at which the blood sample is taken.

Serum Spot 14 concentration is negatively associated with thyroid-stimulating hormone level

PubMed Central

Chen, Yen-Ting; Tseng, Fen-Yu; Chen, Pei-Lung; Chi, Yu-Chao; Han, Der-Sheng; Yang, Wei-Shiung

2016-01-01

Abstract Spot 14 (S14) is a protein involved in fatty acid synthesis and was shown to be induced by thyroid hormone in rat liver. However, the presence of S14 in human serum and its relations with thyroid function status have not been investigated. The objectives of this study were to compare serum S14 concentrations in patients with hyperthyroidism or euthyroidism and to evaluate the associations between serum S14 and free thyroxine (fT4) or thyroid-stimulating hormone (TSH) levels. We set up an immunoassay for human serum S14 concentrations and compared its levels between hyperthyroid and euthyroid subjects. Twenty-six hyperthyroid patients and 29 euthyroid individuals were recruited. Data of all patients were pooled for the analysis of the associations between the levels of S14 and fT4, TSH, or quartile of TSH. The hyperthyroid patients had significantly higher serum S14 levels than the euthyroid subjects (median [Q1, Q3]: 975 [669, 1612] ng/mL vs 436 [347, 638] ng/mL, P < 0.001). In univariate linear regression, the log-transformed S14 level (logS14) was positively associated with fT4 but negatively associated with creatinine (Cre), total cholesterol (T-C), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), and TSH. The positive associations between logS14 and fT4 and the negative associations between logS14 and Cre, TG, T-C, or TSH remained significant after adjustment with sex and age. These associations were prominent in females but not in males. The logS14 levels were negatively associated with the TSH levels grouped by quartile (ß = −0.3020, P < 0.001). The association between logS14 and TSH quartile persisted after adjustment with sex and age (ß = −0.2828, P = 0.001). In stepwise multivariate regression analysis, only TSH grouped by quartile remained significantly associated with logS14 level. We developed an ELISA to measure serum S14 levels in human. Female patients with hyperthyroidism had higher serum S14 levels than the female subjects with euthyroidism. The serum logS14 concentrations were negatively associated with TSH levels. Changes of serum S14 level in the whole thyroid function spectrum deserve further investigation. PMID:27749565

[Clinical, hematological, biochemical and endocrinological aspects of 32 dogs with hypothyroidism].

PubMed

Boretti, F S; Breyer-Haube, I; Kaspers, B; Reusch, C E

2003-04-01

During the years of 1996-2001, hypothyroidism was diagnosed at the clinic for small animal internal medicine, University of Zurich, in 32 dogs. Most of the dogs were large breeds. The most frequent clinical characteristics observed were exercise intolerance, obesity, dermatological, neurological and gastrointestinal signs. Predominant laboratory abnormalities were a low red blood cell count, increased concentration of cholesterol, triglycerides and fructosamin. 29 dogs had a T4 below the reference range (< 1.5 micrograms/dl), one dog had a T4 at the lower limit thereof (1.6 micrograms/dl). One dog had a T4 within the reference range (3.4 micrograms/dl), another had a very high T4 of 206.8 micrograms/dl; the results of the latter 2 dogs were interpreted as incorrectly increased T4 values due to in vitro interference with T4-autoantibodies. Diagnosis was confirmed in all of the dogs based on TSH-stimulation testing. Endogenous TSH (cTSH) measured parallelly, was elevated in only 60% of the dogs. In about 67% of the dogs, hypothyroidism was associated with thyroglobulin-autoantibodies. Canine hypothyroidism is a rather rare endocrine disorder in Switzerland. The TSH-stimulation test remains the gold standard in confirming the disease; a definitive diagnosis can be challenging for practitioners because bovine TSH, used for the TSH-stimulation test is not licensed for use in dogs. Since assessment of cTSH using current assays shows normal values in a high percentage of hypothyroid dogs, the diagnostic value is only limited. In most of the hypothyroid dogs T4 is decreased, with the presence of autoantibodies to T4, it can be normal or increased.

[Long term follow up of medical treatment of differentiated thyroid cancer].

PubMed

Jaffiol, C; Daures, J P; Nsakala, N; Guerenova, J; Baldet, L; Pujol, P; Vannereau, D; Bringer, J

1995-01-01

106 patients, 114 W, 27 M, were thyroidectomized for differentiated thyroid cancer (follicular 29.3%-papillary 54.3%) with different stages of gravity (NO: 48.2% - N1: 32.8% - N2: 19%). Neck dissection was used in cases of involved nodes. One or several doses of 131 I were given to 126 subjects, 106 patients were treated with LT4 (mean daily dose: 2.5 micrograms/kg BW). 23 patients presenting intolerance to LT4 with non suppressed TSH for 13 of them were treated by an association of TRIAC + LT4. The follow up included a yearly check up involving clinical examination, plasma Tg and TSH assessment, neck ultrasonography and X-ray of the chest. Therapy was stopped for 4 weeks in cases with Tg above its detectable value and a total body scan performed with Tg and TSH controls. The mean duration of follow up was 94.5 +/- 67.7 months and extended to more than 5 years for 61% of the patients. We observed 22 relapses of the tumor with 4 deaths. Age less then 45 years, appears as the best factor of prognosis. 2 groups of patients were compared to evaluate the incidence of TSH suppression on the relapse free survival (group 1 n = 30 with a TSH < or = 0.10 mU/l and group 2 n = 15 with a TSH always > 1 mU/l during the follow up). The relapse free survival was shorter in group 2 (p = 0.01). Association of TRIAC with LT4 leads to a reduction of the daily dose of LT4 (m = 25 micrograms/day) with a significant improvement of TSH suppression and clinical tolerance.(ABSTRACT TRUNCATED AT 250 WORDS)

Differential regulation of thyrotropin subunit apoprotein and carbohydrate biosynthesis by thyroid hormone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, T.; Weintraub, B.D.

1985-04-01

The regulation of TSH apoprotein and carbohydrate biosynthesis by thyroid hormone was studied by incubating pituitaries from normal and hypothyroid (3 weeks post-thyroidectomy) rats in medium containing (/sup 14/C)alanine and (/sup 3/H) glucosamine. After 6 h, samples were sequentially treated with anti-TSH beta to precipitate TSH and free TSH beta, anti-LH beta to clear the sample of LH and free LH beta, then anti-LH alpha to precipitate free alpha-subunit. Total proteins were acid precipitated. All precipitates were subjected to electrophoresis on sodium dodecyl sulfate-polyacrylamide gels, which were then sliced and assayed by scintillation spectrometry. In hypothyroid pituitaries plus medium, (/supmore » 14/C)alanine incorporation in combined and free beta-subunits was 26 times normal and considerably greater than the 3.4-fold increase seen in total protein; combined and free alpha-subunits showed no specific increase in apoprotein synthesis. (/sup 3/H)Glucosamine incorporation in combined alpha- and beta-subunits in hypothyroid samples was 13 and 21 times normal, respectively, and was greater than the 1.9-fold increase in total protein; free alpha-subunit showed no specific increase in carbohydrate synthesis. The glucosamine to alanine ratio, reflecting relative glycosylation of newly synthesized molecules, was increased in hypothyroidism for combined alpha-subunits, but not for combined beta-subunits, free alpha-subunits, or total proteins. In summary, short term hypothyroidism selectively stimulated TSH beta apoprotein synthesis and carbohydrate synthesis of combined alpha- and beta-subunits. Hypothyroidism also increased the relative glycosylation of combined alpha-subunit. Thus, thyroid hormone deficiency appears to alter the rate-limiting step in TSH assembly (i.e. beta-subunit synthesis) as well as the carbohydrate structure of TSH, which may play important roles in its biological function.« less

Comparison of conventional L-thyroxine withdrawal and moderate hypothyroidism in preparation for whole-body 131-I scan and thyroglobulin testing.

PubMed

Marturano, I; Russo, M; Spadaro, A; Latina, A; Malandrino, P; Regalbuto, C

2015-09-01

After thyroidectomy for thyroid cancer, patients often withdraw L-T4 for diagnostic or therapeutic purposes, showing signs and symptoms of hypothyroidism. A slighter hypothyroidism (reducing L-T4 to one-half) has been proposed to limit these inconveniences. We evaluated half-dose L-T4 protocol, in comparison to conventional L-T4 withdrawal, in terms of effectiveness and improvement of clinical and biochemical disorders. We randomized 55 thyroid cancer patients into two groups: 29 patients underwent 5 weeks of half-dose of previous L-T4 treatment (HD group); 26 patients replaced L-T4 with L-T3 for 3 weeks followed by 2 weeks of withdrawal (TW group). Clinical features (Zulewsky clinical score) and biochemical parameters (lipids, liver, and muscle enzymes) were evaluated in all patients at baseline and after 5 weeks. Total cholesterol, creatine kinase, lactate dehydrogenase, aspartate aminotransferase, and alanine aminotransferase increased at 5 weeks in both groups, but significantly more in TW, but no difference was found by clinical score. Patients who achieved the thyroid-stimulating hormone (TSH) target value (25 µU/ml) were 92.3% in TW group and 48.3% in HD group (p < 0.001). In the HD group, only basal TSH statistically correlated with the achievement of the TSH target. Receiver operating characteristic curves indicated that a basal TSH ≥0.52 μU/ml is required to reach an adequate TSH level. Half-dose L-T4 protocol, compared to conventional L-T4 withdrawal, is associated with less biochemical disorders but no significant clinical advantage. Therefore, the half-dose protocol reaches an adequate TSH target in 48.3% of patients and is not effective unless basal serum TSH is ≥0.52 μU/ml.

Association of Serum Thyrotropin with Anthropometric Markers of Obesity in the General Population.

PubMed

Tiller, Daniel; Ittermann, Till; Greiser, Karin H; Meisinger, Christa; Agger, Carsten; Hofman, Albert; Thuesen, Betina; Linneberg, Allan; Peeters, Robin; Franco, Oscar; Heier, Margit; Kluttig, Alexander; Werdan, Karl; Stricker, Bruno; Schipf, Sabine; Markus, Marcello; Dörr, Marcus; Völzke, Henry; Haerting, Johannes

2016-09-01

Except from associations study with body weight, there are few longitudinal data regarding the association between thyroid function and anthropometric measurements such as waist circumference, waist-to-hip ratio, or waist-to height ratio. This study aimed to investigate the association of thyrotropin (TSH) at baseline with changes in different anthropometric markers between baseline and follow-up in the general population. Data were used from four population-based longitudinal cohort studies and one population-based cross-sectional study. A total of 16,902 (8204 males) subjects aged 20-95 years from the general population were studied. Body mass index, waist circumference, waist-to-hip ratio, and waist-to-height ratio were measured. Multivariable median regression models were calculated adjusting for the following covariates: age, sex, baseline value of the respective anthropometric marker, smoking status, follow-up-time period, and study site. In cross-sectional analyses, serum TSH within the reference range was positively associated with waist circumference (β = 0.94 cm [confidence interval (CI) 0.56-1.32]) and waist-to-height-ratio (β = 0.029 [CI 0.017-0.042]). These associations were also present for the full range of TSH. In the longitudinal analyses, serum TSH at baseline was inversely associated with a five-year change of all considered anthropometric measures within the prior defined study-specific reference range, as well as in the full range of serum TSH. High TSH serum levels were positively associated with current anthropometric markers, even in the study-specific reference ranges. In contrast, high TSH serum levels were associated with decreased anthropometric markers over a time span of approximately five years. Further research is needed to determine possible clinical implications as well as public health consequences of these findings.

Vitamin D status in Egyptian euthyroid multinodular non-toxic goiter patients and its correlation with TSH levels.

PubMed

Aboelnaga, Mohamed M; Elshafei, Maha M; Elsayed, Eman

2016-10-01

Although the prevalence of MNG is widespread throughout the world, its pathogenesis is poorly understood, and the complex interactions of both genetic predisposition and the individuals' environment are likely. However, to the best of our knowledge, it remains unknown whether there is a relationship between vitamin D status and prevalence or pathogenesis of euthyroid MNG. Therefore, the goal of the present study was determination of vitamin D status in euthyroid MNG as well as exploration of the correlation between vitamin D status & TSH levels. A total of 77 patients diagnosed with euthyroid MNG and 50 subjects without goiter were matched according to age, weight and BMI as control group in this case control study. We found that patients with euthyroid MNG had statistically significant lower mean of [25(OH)D] (24.21±8.68ng/mL) in comparison with its mean in control subjects (28.37±10.91ng/mL, P value=0.019). The 28 sufficient vitamin D MNG patients had statistically significant lower level of TSH than 49 insufficient vitamin D MNG patients. Vitamin D and TSH levels correlate with vitamin D levels in MNG patients in Pearson correlation. Also 25 OH vitamin D was a significant independent predictor for TSH levels among euthyroid MNG patients in regression analysis. Patients with euthyroid MNG have lower levels of vitamin D and TSH levels correlate with vitamin D levels in euthyroid MNG patients. In addition, 25 OH vitamin D was a significant independent predictor for TSH levels among euthyroid MNG patients. We recommend hypovitaminosis D evaluation and correction in patients with MNG. Copyright © 2016 SEEN. Publicado por Elsevier España, S.L.U. All rights reserved.

Hyperfunctioning thyroid nodules in toxic multinodular goiter share activating thyrotropin receptor mutations with solitary toxic adenoma.

PubMed

Tonacchera, M; Chiovato, L; Pinchera, A; Agretti, P; Fiore, E; Cetani, F; Rocchi, R; Viacava, P; Miccoli, P; Vitti, P

1998-02-01

Toxic multinodular goiter is a cause of nonautoimmune hyperthyroidism and is believed to differ in its nature and pathogenesis from toxic adenoma. Gain-of-function mutations of the TSH receptor gene have been identified as a cause of toxic adenoma. The pathogenesis at the molecular level of hyperfunctioning nodules in toxic multinodular goiter has yet not been reported. Six patients with a single hot nodule within a multinodular goiter and 11 patients with toxic thyroid adenoma were enrolled in our study. At histology five hyperfunctioning nodules in multinodular goiters showed the features of adenomas, and one was identified as a hyperplastic nodule. The entire exon 10 of the TSH receptor gene was directly sequenced after PCR amplification from genomic DNA obtained from surgical specimens. Functional studies of mutated receptors were performed in COS-7 cells. Five out of 6 (83%) hyperfunctioning nodules within toxic multinodular goiters harbored a TSH receptor mutation. A TSH receptor mutation was also evident in the hyperfunctioning nodule that at histology had the features of noncapsulated hyperplastic nodule. Among toxic adenomas, 8 out of 11 (72%) nodules harbored a TSH receptor mutation. All the mutations were heterozygotic and somatic. Nonfunctioning nodules, whether adenomas or hyperplastic nodules present in association with hyperfunctioning nodules in the same multinodular goiters, had no TSH receptor mutation. All the mutations identified had constitutive activity as assessed by cAMP production after expression in COS-7 cells. Hyperfunctioning thyroid nodules in multinodular goiters recognize the same pathogenetic event (TSH receptor mutation) as toxic adenoma. Other mechanisms are implicated in the growth of nonfunctioning thyroid nodules coexistent in the same gland.

Thyroid Function and Premature Delivery in TPO Antibody-Negative Women: The Added Value of hCG.

PubMed

Korevaar, Tim I M; Steegers, Eric A P; Chaker, Layal; Medici, Marco; Jaddoe, Vincent W V; Visser, Theo J; de Rijke, Yolanda B; Peeters, Robin P

2017-09-01

Human chorionic gonadotropin (hCG) stimulates thyroid function during pregnancy. We recently showed that thyroid autoimmunity severely attenuated the thyroidal response to hCG stimulation and that this may underlie the higher risk of premature delivery in thyroperoxidase antibody (TPOAb)-positive women. We hypothesized that a lower thyroidal response to hCG stimulation in TPOAb-negative women is also associated with a higher risk of premature delivery and preterm premature rupture of membranes (pPROM). Thyrotropin (TSH), free thyroxine (FT4), and hCG concentrations were available in 5644 TPOAb-negative women from a prospective cohort. We tested for interaction between TSH or FT4 and hCG in linear regression models for duration of pregnancy and logistic regression models for premature delivery/pPROM. Accordingly, analyses were stratified per TSH percentile (TSH ≥ 85th percentile) and hCG per 10,000 IU/L. Women with high TSH and low hCG concentrations did not have a higher risk of premature delivery or pPROM, with protective effect estimates. In contrast, women with a high TSH concentration despite a high hCG concentration had twofold to 10-fold higher risk of premature delivery (Pdifference = 0.022) and an up to fourfold higher risk of pPROM (Pdifference = 0.079). hCG concentrations were not associated with premature delivery or pPROM. In TPOAb-negative women with high-normal TSH concentrations, only women with high hCG concentrations had a higher risk of premature delivery or pPROM. These results suggest a lower thyroidal response to hCG stimulation is also associated with premature delivery in TPOAb-negative women and that an additional measurement of hCG may improve thyroid-related risk assessments during pregnancy. Copyright © 2017 Endocrine Society

Free triiodothyronine/free thyroxine ratio rather than thyrotropin is more associated with metabolic parameters in healthy euthyroid adult subjects.

PubMed

Park, So Young; Park, Se Eun; Jung, Sang Won; Jin, Hyun Seok; Park, Ie Byung; Ahn, Song Vogue; Lee, Sihoon

2017-07-01

The interrelation between TSH, thyroid hormones and metabolic parameters is complex and has not been confirmed. This study aimed to determine the association of TSH and thyroid hormones in euthyroid subjects and the relationship between thyroid function and metabolic risk factors. Furthermore, this study examined whether thyroid function has predictive power for metabolic syndrome. This is a cross-sectional study that included subjects in a medical health check-up programme at a single institution. The study included 132 346 participants (66 991 men and 65 355 women) aged over 18 years who had TSH, free T4 (FT4) and free T3 (FT3) levels within the institutional reference ranges. Thyrotropin, FT4, FT3 and metabolic parameters including height, weight, waist circumference, blood pressure, serum levels of total cholesterol, triglyceride, high-density lipoprotein cholesterol, insulin and glucose were measured. There was a positive association between FT3/FT4 ratio and TSH in both men and women after adjusting for age, body mass index, smoking status and menopausal status (in women). The FT3/FT4 ratio and TSH were positively associated with risk of metabolic syndrome parameters including insulin resistance. The FT3/FT4 ratio had a greater predictive power than TSH for metabolic syndrome in both men and women. Thyrotropin levels were positively associated with FT3/FT4 ratio within the euthyroid range. The higher FT3/FT4 ratio is associated with increased risk of metabolic syndrome parameters and insulin resistance. FT3/FT4 ratio has a better predictive power for metabolic syndrome than TSH. © 2017 John Wiley & Sons Ltd.

Thyroid hormone independent associations between serum TSH levels and indicators of bone turnover in cured patients with differentiated thyroid carcinoma.

PubMed

Heemstra, Karen A; van der Deure, Wendy M; Peeters, Robin P; Hamdy, Neveen A; Stokkel, Marcel P; Corssmit, Eleonora P; Romijn, Johannes A; Visser, Theo J; Smit, Johannes W

2008-07-01

It has been proposed that TSH has thyroid hormone-independent effects on bone mineral density (BMD) and bone metabolism. This concept is still controversial and has not been studied in human subjects in detail. We addressed this question by studying relationships between serum TSH concentration and indicators of bone turnover, after controlling for triiodothyronine (T(3)), free thyroxine (FT(4)), and non-thyroid factors relevant to BMD and bone metabolism. We also studied the contribution of the TSH receptor (TSHR)-Asp727Glu polymorphism to these relationships. We performed a cross-sectional study with 148 patients, who had been thyroidectomized for differentiated thyroid carcinoma. We measured BMD of the femoral neck and lumbar spine. FT(4), T(3), TSH, bone-specific alkaline phosphatase, procollagen type 1 aminoterminal propeptide levels, C-cross-linking terminal telopeptide of type I collagen, and urinary N-telopeptide of collagen cross-links were measured. Genotypes of the TSHR-Asp727Glu polymorphism were determined by Taqman assay. We found a significant, inverse correlation between serum TSH levels and indicators of bone turnover, which was independent of serum FT(4) and T(3) levels as well as other parameters influencing bone metabolism. We found that carriers of the TSHR-Asp727Glu polymorphism had an 8.1% higher femoral neck BMD, which was, however, no longer significant after adjusting for body mass index. We conclude that in this group of patients, serum TSH was related to indicators of bone remodeling independently of thyroid hormone levels. This may point to a functional role of the TSHR in bone in humans. Further research into this mechanism needs to be performed.

Reference values for TSH may be inadequate to define hypothyroidism in persons with morbid obesity: Di@bet.es study.

PubMed

Valdés, Sergio; Maldonado-Araque, Cristina; Lago-Sampedro, Ana; Lillo-Muñoz, Juan Antonio; Garcia-Fuentes, Eduardo; Perez-Valero, Vidal; Gutiérrez-Repiso, Carolina; Garcia-Escobar, Eva; Goday, Albert; Urrutia, Inés; Peláez, Laura; Calle-Pascual, Alfonso; Bordiú, Elena; Castaño, Luis; Castell, Conxa; Delgado, Elias; Menéndez, Edelmiro; Franch-Nadal, Josep; Gaztambide, Sonia; Girbés, Joan; Ortega, Emilio; Vendrell, Joan; Chacón, Matilde R; Javier Chaves, F; Soriguer, Federico; Rojo-Martínez, Gemma

2017-04-01

To analyze the reference range of thyroid-stimulating hormone (TSH) in different BMI categories and its impact on the classification of hypothyroidism. The study included 3,928 individuals free of thyroid disease (without previous thyroid disease, no interfering medications, TSH <10 µUI/mL and thyroid peroxidase antibodies [TPO Abs] <50 IU/mL) who participated in a national, cross-sectional, population-based study and were representative of the adult population of Spain. Data gathered included clinical and demographic characteristics, physical examination, and blood and urine sampling. TSH, free thyroxine, free triiodothyronine, and TPO Ab were analyzed by electrochemiluminescence (E170, Roche Diagnostics, Basel, Switzerland). The reference range (p2.5-97.5) for TSH was estimated as 0.6 to 4.8 µUI/mL in the underweight category (BMI<20 kg/m 2 ), 0.6 to 5.5 µUI/mL in the normal-weight category (BMI 20-24.9 kg/m 2 ), 0.6 to 5.5 µUI/mL in the overweight category (BMI 25-29.9 kg/m 2 ), 0.5 to 5.9 µUI/mL in the obesity category (BMI 30-39.9 kg/m 2 ), and 0.7 to 7.5 µUI/mL in the morbid obesity category (BMI ≥40). By using the reference criteria for the normal-weight population, the prevalence of high TSH levels increased threefold in the morbid obesity category (P < 0.01). Persons with morbid obesity might be inappropriately classified if the standard ranges of normality of TSH for the normal-weight population are applied to them. © 2017 The Obesity Society.

Does the thyroid-stimulating hormone measured concurrently with first trimester biochemical screening tests predict adverse pregnancy outcomes occurring after 20 weeks gestation?

PubMed

Ong, Gregory S Y; Hadlow, Narelle C; Brown, Suzanne J; Lim, Ee Mun; Walsh, John P

2014-12-01

Maternal hypothyroidism in early pregnancy is associated with adverse outcomes, but not consistently across studies. First trimester screening for chromosomal anomalies is routine in many centers and provides an opportunity to test thyroid function. To determine if thyroid function tests performed with first trimester screening predicts adverse pregnancy outcomes. A cohort study of 2411 women in Western Australia with singleton pregnancies attending first trimester screening between 9 and 14 weeks gestation. We evaluated the association between TSH, free T4, free T3, thyroid antibodies, free beta human chorionic gonadotrophin (β-hCG) and pregnancy associated plasma protein A (PAPP-A) with a composite of adverse pregnancy events as the primary outcome. Secondary outcomes included placenta previa, placental abruption, pre-eclampsia, pregnancy loss after 20 weeks gestation, threatened preterm labor, preterm birth, small size for gestational age, neonatal death, and birth defects. TSH exceeded the 97.5th percentile for the first trimester (2.15 mU/L) in 133 (5.5%) women, including 22 (1%) with TSH above the nonpregnant reference range (4 mU/L) and 5 (0.2%) above 10 mU/L. Adverse outcomes occurred in 327 women (15%). TSH and free T4 did not differ significantly between women with or without adverse pregnancy events. On the multivariate analysis, neither maternal TSH >2.15 mU/L nor TSH as a continuous variable predicted primary or secondary outcomes. Testing maternal TSH as part of first trimester screening does not predict adverse pregnancy outcomes. This may be because in the community setting, mainly mild abnormalities in thyroid function are detected.

Maternal thyroid dysfunction during gestation, preterm delivery, and birthweight. The Infancia y Medio Ambiente Cohort, Spain.

PubMed

León, Gemma; Murcia, Mario; Rebagliato, Marisa; Álvarez-Pedrerol, Mar; Castilla, Ane M; Basterrechea, Mikel; Iñiguez, Carmen; Fernández-Somoano, Ana; Blarduni, Elizabeth; Foradada, Carles M; Tardón, Adonina; Vioque, Jesús

2015-03-01

Maternal clinical thyroid disorders can cause reproductive complications. However, the effects of mild thyroid dysfunctions are not yet well established. The aim was to evaluate the association of maternal thyroid function during the first half of pregnancy with birthweight and preterm delivery. We analysed data on 2170 pregnant women and their children from a prospective population-based cohort study in four Spanish areas. Mid-gestation maternal serum and urine samples were gathered to determine thyroid-stimulating hormone (TSH), free thyroxine (fT4 ), and urinary iodine concentration (UIC). Thyroid status was defined according to percentile distribution as: euthyroid (TSH and fT4 >5th and <95th percentiles); hypothyroxinaemia (fT4  < 5 th percentile and TSH normal), hypothyroidism (TSH > 95th percentile and fT4 normal or <5th percentile), hyperthyroxinaemia (fT4  > 95 th percentile and TSH normal), and hyperthyroidism (TSH < 5 th percentile and fT4 normal or >95th percentile). Response variables were birthweight, small and large for gestational age (SGA/LGA), and preterm delivery. An inverse association of fT4 and TSH with birthweight was found, the former remaining when restricted to euthyroid women. High fT4 levels were also associated with an increased risk of SGA [odds ratio, 95% confidence interval (CI) 1.28 (95% CI 1.08, 1.51)]. Mean birthweight was higher in the hypothyroxinaemic group (β = 109, P < 0.01). Iodine intake and UIC were not associated with birth outcomes. High maternal fT4 levels during the first half of pregnancy were related to lower birthweight and increased risk of SGA newborns, suggesting that maternal thyroid function may affect fetal growth, even within the normal range. © 2015 John Wiley & Sons Ltd.

Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

ERIC Educational Resources Information Center

Lindsey, Treva B.

2015-01-01

This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

Variable range hopping in ZnO films

NASA Astrophysics Data System (ADS)

Ali, Nasir; Ghosh, Subhasis

2018-04-01

We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

The widened use of exogenous stimulation with recombinant human TSH to treat metastatic thyroid carcinoma in Italy.

PubMed

Maffioli, L; Florimonte, L; Fugazzola, L; Banti, E; Bagnasco, M; Dottorini, M E; Perotti, G; Rubello, D; Seregni, E; Bombardieri, E; Testori, O

2012-10-01

Recently, in Italy, the reimbursement for the use of rhTSH in preparing patients for radiometabolic treatment of iodine-avid metastases from differentiated thyroid cancer has been made possible. Intramuscular administration of rhTSH increases the radioiodine uptake and thyroglobulin production by thyroid cells. In addition to the previous indications on the use of rhTSH (mainly: serum thyreoglobulin assay with or without 131I scintigraphy and ablation with 131I of remnants in low risk patients), the reimbursement is now allowed for the treatment with radioiodine of iodine-avid loco-regional and distant metastases, in subjects with inability to reach adequate TSH levels and/or severe clinical conditions which could be potentially worsened by other concurrent diseases (history of stroke or transient ischemic attack, severe cardiac disease, renal failure or major psychiatric disorders). The Italian Medicines Agency (AIFA) approved this use (and added this hormone in the special list of drugs regulated by the D.Lgs 648/96) on the basis of a series of scientific evidences, proposed by a "team of experts". In the present paper we illustrate the scientific background of the use of rhTSH (clinical usefulness, economic considerations, aspects related to a better quality of life) that allowed the modification of the reimbursement and how it was made possible in the Italian legislative context.

Increased thyrotropin binding in hyperfunctioning thyroid nodules.

PubMed

Müller-Gärtner, H W; Schneider, C; Bay, V; Tadt, A; Rehpenning, W; de Heer, K; Jessel, M

1987-08-01

The object of this study was to investigate TSH receptors in hyperfunctioning thyroid nodules (HFN). In HFN, obtained from seven patients, 125-I-TSH binding as determined by equilibrium binding analysis on particulate membrane preparations, was found to be significantly increased as compared with normal thyroid tissues (five patients; P less than 0.001). Scatchard analysis of TSH-binding revealed two kinds of binding sites for both normal thyroid tissue and HFN, and displayed significantly increased association constants of high- and low-affinity binding sites in HFN (Ka = 11.75 +/- 6.8 10(9) M-1, P less than 0.001 and Ka = 2.1 +/- 1.0 10(7) M-1, P less than 0.025; x +/- SEM) as compared with normal thyroid tissue (Ka = 0.25 +/- 0.06 10(9) M-1, Ka = 0.14 +/- 0.03 10(7) M-1; x +/- SEM). The capacity of the high-affinity binding sites in HFN was found to be decreased (1.8 +/- 1.1 pmol/mg protein, x +/- SEM) in comparison with normal thyroid tissue (4.26 +/- 1.27 pmol/mg protein; x +/- SEM). TSH-receptor autoradiography applied to cryostatic tissue sections confirmed increased TSH binding of the follicular epithelium in HFN. These data suggest that an increased affinity of TSH-receptor sites in HFN in iodine deficient areas may be an important event in thyroid autonomy.

Ophthalmic Graves's disease: natural history and detailed thyroid function studies.

PubMed Central

Teng, C S; Yeo, P P

1977-01-01

Of 27 patients with ophthalmic Graves's disease (OGD) who had been clinically euthyroid three years previously, one became clinically hyperthyroid and seven overtly hypothyroid. Improvement in eye signs was associated with a return to normal of thyroidal suppression by triiodothyronine (T3) and of the response of thyroid-stimulating hormone (TSH) to thyrotrophin-releasing hormone (TRH). Of a further 30 patients with OGD who had not been studied previously, three were overtly hypothyroid. Of the combined series, 46 patients were euthyroid, 18 (40%) of whom had an impaired or absent TSH response to TRH, and 3(6-7%) an exaggerated response. Eleven out of 37 patients (29-7%) had abnormal results in the T3 suppression test. There was a significant correlation between thyroidal suppression by T3 and the TSH response to TRH. Total serum concentrations of both T3 and thyroxine (T4) were closely correlated with T3 suppressibility and TRH responsiveness. Free T4 and T3 (fT3) concentrations were normal in all but three patients, in whom raised fT3 was accompanied by abnormal TSH responses and thyroidal suppression. The presence of normal free thyroid hormone concentrations in patients with impaired or absent TSH responses to TRH is interesting and challenges the concept that free thyroid hormones are the major controlling factors in the feedback control of TSH. PMID:576414

Thyroid aplasia in male sibling of heterozygotic twins born to the hyperthyroid mother treated with propylthiouracil during pregnancy (case report).

PubMed

Almarzouki, A A

2012-01-01

A 30-year-old pregnant female was diagnosed to have thyrotoxicosis (TSH= 0.005 µU/ml) at 13th week of gestation. Propylthiouracil (PTU; 200 mg daily) was prescribed to her and four weekly follow ups by the endocrinologist and obstetrician were ensured. At each examination TSH, FT4 and FT3 levels were normal and she became symptom free. Repeated ultrasound examination throughout the pregnancy did not reveal any fetal abnormality. The lady normally delivered heterozygotic twins. Umbilical cord blood of the baby boy twin showed a high TSH (541 µU/ml; reference range 0.270 - 4.20 μU/ml). He was started on thyroxine therapy (50 µg once daily). Ultrasound reported the absence of the thyroid gland. One month later TSH was within normal range and thyroxine dose was adjusted to 25 µg once daily. Repeated ultrasound confirmed the absence of thyroid gland. TSH was repeatedly normal. The boy is currently doing well on thyroxine replacement therapy. The other non-identical twin was a healthy girl with normal thyroid function tests and always thereafter. This case report suggested that PTU could be a hazardous drug to the fetus, since the mother gave birth to a baby with thyroid aplasia. PTU, Thyroid aplasia, Thyrotoxicosis, TSH.

Mathematical Modeling of the Pituitary–Thyroid Feedback Loop: Role of a TSH-T3-Shunt and Sensitivity Analysis

PubMed Central

Berberich, Julian; Dietrich, Johannes W.; Hoermann, Rudolf; Müller, Matthias A.

2018-01-01

Despite significant progress in assay technology, diagnosis of functional thyroid disorders may still be a challenge, as illustrated by the vague upper limit of the reference range for serum thyrotropin (TSH). Diagnostical problems also apply to subjects affected by syndrome T, i.e., those 10% of hypothyroid patients who continue to suffer from poor quality of life despite normal TSH concentrations under substitution therapy with levothyroxine (L-T4). In this paper, we extend a mathematical model of the pituitary–thyroid feedback loop in order to improve the understanding of thyroid hormone homeostasis. In particular, we incorporate a TSH-T3-shunt inside the thyroid, whose existence has recently been demonstrated in several clinical studies. The resulting extended model shows good accordance with various clinical observations, such as a circadian rhythm in free peripheral triiodothyronine (FT3). Furthermore, we perform a sensitivity analysis of the derived model, revealing the dependence of TSH and hormone concentrations on different system parameters. The results have implications for clinical interpretation of thyroid tests, e.g., in the differential diagnosis of subclinical hypothyroidism. PMID:29619006

Mathematical Modeling of the Pituitary-Thyroid Feedback Loop: Role of a TSH-T3-Shunt and Sensitivity Analysis.

PubMed

Berberich, Julian; Dietrich, Johannes W; Hoermann, Rudolf; Müller, Matthias A

2018-01-01

Despite significant progress in assay technology, diagnosis of functional thyroid disorders may still be a challenge, as illustrated by the vague upper limit of the reference range for serum thyrotropin ( TSH ). Diagnostical problems also apply to subjects affected by syndrome T, i.e., those 10% of hypothyroid patients who continue to suffer from poor quality of life despite normal TSH concentrations under substitution therapy with levothyroxine ( L - T 4 ). In this paper, we extend a mathematical model of the pituitary-thyroid feedback loop in order to improve the understanding of thyroid hormone homeostasis. In particular, we incorporate a TSH - T 3 -shunt inside the thyroid, whose existence has recently been demonstrated in several clinical studies. The resulting extended model shows good accordance with various clinical observations, such as a circadian rhythm in free peripheral triiodothyronine ( FT 3 ). Furthermore, we perform a sensitivity analysis of the derived model, revealing the dependence of TSH and hormone concentrations on different system parameters. The results have implications for clinical interpretation of thyroid tests, e.g., in the differential diagnosis of subclinical hypothyroidism.

Thyroid stimulation with recombinant human thyrotropin in healthy cats, cats with non-thyroidal illness and in cats with low serum thyroxin and azotaemia after treatment of hyperthyroidism.

PubMed

van Hoek, Ingrid M; Vandermeulen, Eva; Peremans, Kathelijne; Daminet, Sylvie

2010-02-01

This study investigated the recombinant human thyrotropin (rhTSH) stimulation test in healthy cats (group 1), cats with non-thyroidal illness (group 2) and cats with low serum total T(4) (TT(4)) and azotaemia after (131)I treatment (group 3). Serum TT(4) responses and thyroidal pertechnetate uptake after administration of 25 microg rhTSH IV were assessed. Baseline serum TT(4) was significantly lower in group 3 compared with group 1, but not between other group pairs. Serum TT(4) increased significantly in groups 1 and 2 but not in group 3 after rhTSH administration. Post-rhTSH serum TT(4) concentrations differed significantly between groups 1 and 3 and groups 2 and 3, but not between groups 1 and 2. Thyroid/salivary gland uptake ratio (T/S uptake ratio) differed only significantly between groups 1 and 3. Stimulation with rhTSH is valuable to differentiate euthyroidism from iatrogenic hypothyroidism in cats. Copyright 2009 ESFM and AAFP. Published by Elsevier Ltd. All rights reserved.

Thyrocyte-specific Gq/G11 deficiency impairs thyroid function and prevents goiter development.

PubMed

Kero, Jukka; Ahmed, Kashan; Wettschureck, Nina; Tunaru, Sorin; Wintermantel, Tim; Greiner, Erich; Schütz, Günther; Offermanns, Stefan

2007-09-01

The function of the adult thyroid is regulated by thyroid-stimulating hormone (TSH), which acts through a G protein-coupled receptor. Overactivation of the TSH receptor results in hyperthyroidism and goiter. The Gs-mediated stimulation of adenylyl cyclase-dependent cAMP formation has been regarded as the principal intracellular signaling mechanism mediating the action of TSH. Here we show that the Gq/G11-mediated signaling pathway plays an unexpected and essential role in the regulation of thyroid function. Mice lacking the alpha subunits of Gq and G11 specifically in thyroid epithelial cells showed severely reduced iodine organification and thyroid hormone secretion in response to TSH, and many developed hypothyroidism within months after birth. In addition, thyrocyte-specific Galphaq/Galpha11-deficient mice lacked the normal proliferative thyroid response to TSH or goitrogenic diet, indicating an essential role of this pathway in the adaptive growth of the thyroid gland. Our data suggest that Gq/G11 and their downstream effectors are promising targets to interfere with increased thyroid function and growth.

Thyrotropin-secreting pituitary adenomas: biological and molecular features, diagnosis and therapy.

PubMed

Losa, M; Fortunato, M; Molteni, L; Peretti, E; Mortini, P

2008-12-01

Central hyperthyroidism due to a thyrotropin (TSH)-secreting pituitary adenoma is a rare cause of hyperthyroidism, representing 0.5-1.0% of all pituitary adenomas. The etiopathogenesis of TSH-secreting-adenomas is unknown and no definite role for various oncogenes has been proven. Patients with TSH-secreting adenoma usually present with signs and symptoms of hyperthyroidism milder than those in patients with hyperthyroidism of thyroid origin, in addition to symptoms secondary to mass effects of the pituitary tumour. Mixed pituitary tumours co-secrete growth hormone and prolactin. The characteristic biochemical abnormalities are normal or high serum TSH concentrations in the presence of elevated total and/or free thyroid hormones concentrations. Measurement of markers of peripheral thyroid hormone action and dynamic tests may aid in the differential diagnosis with the syndrome of resistance to thyroid hormone. Neuroimaging is fundamental to visualize the pituitary tumor. Therapy of TSH-secreting adenomas can be accomplished by surgery, radiation therapies, and medical treatment with somatostatin analogs or dopamine agonists. Nowadays, and in contrast with the first reports on this rare disease, most patients are well controlled by current therapies.

[Subclinical hypothyroidism - laboratory finding or disease?].

PubMed

Voigtländer, Richard; Führer, Dagmar

2016-08-01

Subclinical hypothyroidism first of all is a laboratory finding, defined by elevated TSH and normal peripheral thyroxine concentrations. The first steps are to verify the condition and to clarify whether the patient has underlying thyroid disease or other comorbidities. Results of recent studies on subclinical hypothyroidism are reassuring. No consistent association has been demonstrated between mildly elevated TSH levels (5-10 mIU / l) and cardiovascular events, mortality, fracture risk or cognitive impairment. In contrast TSH levels between 5-10 mIU / l may even confer lower mortality in the elderly and may hence be protective. These data strongly suggest that the long-time controversy on definition of normal upper TSH levels should take a more conservative turn. Thus, diagnosis of subclinical hypothyroidism should be handled cautiously. Individualized treatment decision is recommended if TSH levels are only mildly elevated and less than 8-10 mIU / l. In case of autoimmune thyroiditis or previous thyroid therapy (surgery, radioiodine treatment) the risk of progression to overt hypothyroidism has to be considered and there is no doubt that the latter should be avoided. © Georg Thieme Verlag KG Stuttgart · New York.

Microarray analysis of thyroid stimulating hormone, insulin-like growth factor-1, and insulin-induced gene expression in FRTL-5 thyroid cells.

PubMed

Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Park, Young Joo; Cho, Bo Youn

2007-10-01

To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation.

Microarray Analysis of Thyroid Stimulating Hormone, Insulin-Like Growth Factor-1, and Insulin-Induced Gene Expression in FRTL-5 Thyroid Cells

PubMed Central

Lee, You Jin; Park, Do Joon; Shin, Chan Soo; Park, Kyong Soo; Kim, Seong Yeon; Lee, Hong Kyu; Cho, Bo Youn

2007-01-01

To determine which genes are regulated by thyroid stimulating hormone (thyrotropin, TSH), insulin and insulin-like growth factor-1 (IGF-1) in the rat thyroid, we used the microarray technology and observed the changes in gene expression. The expressions of genes for bone morphogenetic protein 6, the glucagon receptor, and cyclin D1 were increased by both TSH and IGF-1; for cytochrome P450, 2c37, the expression was decreased by both. Genes for cholecystokinin, glucuronidase, beta, demethyl-Q 7, and cytochrome c oxidase, subunit VIIIa, were up-regulated; the genes for ribosomal protein L37 and ribosomal protein L4 were down-regulated by TSH and insulin. However, there was no gene observed to be regulated by all three: TSH, IGF-1, and insulin molecules studied. These findings suggest that TSH, IGF-1, and insulin stimulate different signal pathways, which can interact with one another to regulate the proliferation of thyrocytes, and thereby provide additional influence on the process of cellular proliferation. PMID:17982240

Hypothyroidism due to Hashimoto's thyroiditis masked by anorexia nervosa.

PubMed

Smalls-Mantey, Adjoa; Steinglass, Joanna; Primack, Marshall; Clark-Hamilton, Jill; Bongiovi, Mary

2015-11-01

Anorexia nervosa (AN) is typically associated with altered thyroid function tests, notably a low total and free T3 , and lower, but within normal range, free T4 and TSH. A 16-year-old girl with a four-year history of AN presented with elevated TSH that fluctuated with changes in weight. TSH was within normal limits (1.7-3.64 mIU/L) following periods of weight loss and elevated with weight gain (5.9-21.66 mIU/L). Antithyroperoxidase antibodies were markedly elevated, suggesting chronic Hashimoto's thyroiditis. Of note, the elevated TSH that would be expected in Hashimoto's thyroiditis was blunted by weight loss associated with AN. Physicians should be aware that AN may contribute to masking thyroid abnormalities in Hashimoto's thyroiditis. © 2015 Wiley Periodicals, Inc.

The prevalence of affective disorder and in particular of a rapid cycling of bipolar disorder in patients with abnormal thyroid function tests.

PubMed

Oomen, H A; Schipperijn, A J; Drexhage, H A

1996-08-01

Cognitive and affective functioning is sensitive to changes in thyroid hormones. We have sought to determine: (1) the prevalence of thyroid function abnormalities in a psychiatric population on admission (as compared to the prevalence in a normal population), and (2) whether such thyroid function abnormalities are associated with the occurrence or development of cognitive and affective disorders. Serum was collected 2-3 weeks after hospitalization in 3 major clinics from 3756 psychiatric patients in 1987-1990, stored, and assayed in 1993 for the presence of antibodies against the TSH-receptor and thyroperoxidase (TPO-Ab) and for TSH levels. The psychiatric cohort was matched with a control population of healthy individuals living in the same area (n = 1877). The prevalence study was followed by a case-control study involving patients from one clinic that had routinely assigned a DSM-IIIR classification to its patients. Cases were those admissions with thyroid abnormalities and three subgroups of cases were randomly formed demonstrating either TSH less than 0.4 mU/l (n = 44) or over 4.0 mU/l (n = 44), or TPO-Ab positivity (n = 50). Cases were compared to random controls from the same psychiatric population, viz patients without thyroid abnormalities (n = 83). Comparison was with respect to their psychiatric follow-up diagnosis (the investigator was blinded to the thyroid test results). Prevalence study. The percentage of patients positive for TSH-receptor-Ab was 0.26 (9/3504), for TPO-Ab was 10.0 (331/3316) and outside the TSH range of 0.4-4.0 mU/l was 10.0 ((332/3316): 5.9% (198/3316) > 4.0 mU/l and 4.1% (134/3316) < 0.4 mU/l). Abnormal total thyroxine levels were found in only 9.8% of subjects with abnormal TSH, indicating the predominantly subclinical character of the thyroid alteration. In comparison, the healthy area controls over 55 years of age showed the same prevalence of positive TPO-antibodies and TSH under 0.4 mU/l, but a higher prevalence of TSH over 4.0 mU/l. CASE-CONTROL STUDY: In the case control analysis differences could not be noticed with regard to prevalences of dementia, schizophrenia or other psychiatric illnesses apart from the prevalence of affective disorders which were more prevalent in TPO-Ab positive patients and patients with a low serum TSH. Since prior use of lithium, carbamezapine, carbimazole and/or thyroxine could be a factor of importance in this association, analyses were also carried out excluding patients with such prior drug use. In these analyses affective disorders were still more prevalent in patients with a low serum TSH (particularly in males, 40% in cases vs 9% in controls, P < 0.05). The most significant association was however between TPO-antibody positivity (and in particular with high titre and/or with TSH > 4.0 mU/l) and a subgroup of the affective disorders, viz with a rapid cycling of bipolar disorder (18% in cases vs 0% in controls, P < 0.001). Though causal relations cannot be determined from this cross-sectional study, this admission survey found early forms of autoimmune thyroid disease, sometimes characterized only by TPO-Abs, highly significantly associated with rapid cycles of a bipolar disorder. It also found a weak association between subclinical hyperthyroidism (low serum TSH without TPO-Ab positivity) and affective disorder.

Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

ERIC Educational Resources Information Center

Kruse, Adam J.

2016-01-01

This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

ERIC Educational Resources Information Center

Soderman, Johan

2013-01-01

Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

Hip-hop as a resource for understanding the urban context

NASA Astrophysics Data System (ADS)

Brown, Bryan

2010-06-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

Allez Hop, a nationwide programme for the promotion of physical activity in Switzerland: what is the evidence for a population impact after one decade of implementation?

PubMed Central

Wanner, Miriam; Martin-Diener, Eva; Bauer, Georg F; Stamm, Hanspeter; Martin, Brian W

2011-01-01

Objectives To present evidence for a population impact of a national physical activity promotion programme after a decade of implementation. Methods The programme Allez Hop offered local physical activity courses (mainly walking and Nordic walking) once a week over 12 weeks. Data from a pretest posttest survey in 2005 course participants (N=2157 at baseline (of 4130, 52.2%), 1587 at first follow-up (73.6%); smaller subsample with second follow-up) and from repeated cross-sectional national surveys have been analysed regarding changes in physical activity behaviour. Results The total number of Allez Hop courses was 18 684 between 1997 and 2008. 89.2% of participants were women, the mean age was 48.5 years. The proportion meeting the physical activity recommendations was 31.7% at baseline, in participants with first follow-up data it increased from 33.1% to 42.3% (p<0.001). On the population level in the main user group of Allez Hop (middle-aged women) the proportion not engaging in any sport decreased from 50.1% (1997) to 47.2% (2002) and to 43.1% (2007) (p<0.01). Walking/hiking was the second most frequently performed sport (33.7%) in 2007, with the most remarkable increase since 2000 (+11.1%). Conclusions Allez Hop was successfully implemented for more than a decade, reached middle-aged women and a high proportion of insufficiently active individuals. Changes in participants' physical activity behaviour must be interpreted cautiously because of low response rates and short follow-up. However, indications for behavioural changes were observed at the population level, even though these data do not allow a causal link to Allez Hop. PMID:20542973

Functional performance testing in participants with functional ankle instability and in a healthy control group.

PubMed

Buchanan, Amanda S; Docherty, Carrie L; Schrader, John

2008-01-01

Functional ankle instability (FAI) affects a large part of the population. Inconsistent findings have been reported regarding the existence of functional performance deficits in individuals with FAI. To examine functional performance in participants with FAI compared with participants in a control group during 2 hopping tests. Case-control study. Athletic training research laboratory. There were 40 college-aged individuals who participated in our study: 20 with FAI and 20 without FAI. We defined FAI as history of an ankle sprain and residual episodes of "giving way." Participants completed 2 functional performance tests (FPTs): the single-limb hopping and the single-limb hurdle tests. Time to complete each test was recorded. Following each FPT, participants were asked if their ankles felt unstable during the test. We found no difference between participants in the FAI and control groups for the hopping or hurdle tests (P > .05). When asked if their ankles felt unstable during the FPTs, approximately half of the participants in the FAI group and none of the participants in the control group reported a feeling of instability. Subsequently, a secondary analysis of variance was calculated with participants grouped into 3 categories: control participants, FAI participants reporting instability symptoms during FPT (FAI-S), and FAI participants not reporting instability symptoms during FPT (FAI-NS). Results revealed a difference among the 3 groups for the single-limb hopping test (P < .01). Post hoc analysis revealed a difference between the FAI-S participants and both the control and the FAI-NS participants. No difference was identified for the single-limb hurdle test (P = .41). The FAI-S participants had performance deficits during the single-limb hopping test. Therefore, clinicians could use this simple hopping test as an additional method to determine the presence of FAI.

Nonadiabatic dynamics of photo-induced proton-coupled electron transfer reactions via ring-polymer surface hopping

NASA Astrophysics Data System (ADS)

Shakib, Farnaz; Huo, Pengfei

Photo-induced proton-coupled electron transfer reactions (PCET) are at the heart of energy conversion reactions in photocatalysis. Here, we apply the recently developed ring-polymer surface-hopping (RPSH) approach to simulate the nonadiabatic dynamics of photo-induced PCET. The RPSH method incorporates ring-polymer (RP) quantization of the proton into the fewest-switches surface-hopping (FSSH) approach. Using two diabatic electronic states, corresponding to the electron donor and acceptor states, we model photo-induced PCET with the proton described by a classical isomorphism RP. From the RPSH method, we obtain numerical results that are comparable to those obtained when the proton is treated quantum mechanically. This accuracy stems from incorporating exact quantum statistics, such as proton tunnelling, into approximate quantum dynamics. Additionally, RPSH offers the numerical accuracy along with the computational efficiency. Namely, compared to the FSSH approach in vibronic representation, there is no need to calculate a massive number of vibronic states explicitly. This approach opens up the possibility to accurately and efficiently simulate photo-induced PCET with multiple transferring protons or electrons.

Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿

PubMed Central

Behr, Jürgen; Vogel, Rudi F.

2010-01-01

In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of hop inhibition, these investigations provide general insight on the role of electrophysiology and ion homeostasis in bacterial stress responses to membrane-active drugs. PMID:19880646

Effect of endotoxin and radio-detoxified endotoxin on the serum T4 level of rats and response of their thyroid gland to exogenous TSH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bertok, L.; Nagy, S.U.

Experiments were performed to demonstrate that, while the shock-inducing dose of parent (toxic) endotoxin significantly decreases the serum T4 level of rats and inhibits the T4 response given to exogenous thyroid stimulating hormone (TSH), the radio-detoxified (/sup 60/Co-gamma, 150 kGy) endotoxin preparation does not inhibit the response to exogenous TSH. It also decreases serum T4 level to a lesser extent than untreated endotoxin.

Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

ERIC Educational Resources Information Center

Petchauer, Emery

2015-01-01

One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

Genetic Variants Associated with Serum Thyroid Stimulating Hormone (TSH) Levels in European Americans and African Americans from the eMERGE Network

PubMed Central

Malinowski, Jennifer R.; Denny, Joshua C.; Bielinski, Suzette J.; Basford, Melissa A.; Bradford, Yuki; Peissig, Peggy L.; Carrell, David; Crosslin, David R.; Pathak, Jyotishman; Rasmussen, Luke; Pacheco, Jennifer; Kho, Abel; Newton, Katherine M.; Li, Rongling; Kullo, Iftikhar J.; Chute, Christopher G.; Chisholm, Rex L.; Jarvik, Gail P.; Larson, Eric B.; McCarty, Catherine A.; Masys, Daniel R.; Roden, Dan M.; de Andrade, Mariza; Ritchie, Marylyn D.; Crawford, Dana C.

2014-01-01

Thyroid stimulating hormone (TSH) hormone levels are normally tightly regulated within an individual; thus, relatively small variations may indicate thyroid disease. Genome-wide association studies (GWAS) have identified variants in PDE8B and FOXE1 that are associated with TSH levels. However, prior studies lacked racial/ethnic diversity, limiting the generalization of these findings to individuals of non-European ethnicities. The Electronic Medical Records and Genomics (eMERGE) Network is a collaboration across institutions with biobanks linked to electronic medical records (EMRs). The eMERGE Network uses EMR-derived phenotypes to perform GWAS in diverse populations for a variety of phenotypes. In this report, we identified serum TSH levels from 4,501 European American and 351 African American euthyroid individuals in the eMERGE Network with existing GWAS data. Tests of association were performed using linear regression and adjusted for age, sex, body mass index (BMI), and principal components, assuming an additive genetic model. Our results replicate the known association of PDE8B with serum TSH levels in European Americans (rs2046045 p = 1.85×10−17, β = 0.09). FOXE1 variants, associated with hypothyroidism, were not genome-wide significant (rs10759944: p = 1.08×10−6, β = −0.05). No SNPs reached genome-wide significance in African Americans. However, multiple known associations with TSH levels in European ancestry were nominally significant in African Americans, including PDE8B (rs2046045 p = 0.03, β = −0.09), VEGFA (rs11755845 p = 0.01, β = −0.13), and NFIA (rs334699 p = 1.50×10−3, β = −0.17). We found little evidence that SNPs previously associated with other thyroid-related disorders were associated with serum TSH levels in this study. These results support the previously reported association between PDE8B and serum TSH levels in European Americans and emphasize the need for additional genetic studies in more diverse populations. PMID:25436638

Genetic variants associated with serum thyroid stimulating hormone (TSH) levels in European Americans and African Americans from the eMERGE Network.

PubMed

Malinowski, Jennifer R; Denny, Joshua C; Bielinski, Suzette J; Basford, Melissa A; Bradford, Yuki; Peissig, Peggy L; Carrell, David; Crosslin, David R; Pathak, Jyotishman; Rasmussen, Luke; Pacheco, Jennifer; Kho, Abel; Newton, Katherine M; Li, Rongling; Kullo, Iftikhar J; Chute, Christopher G; Chisholm, Rex L; Jarvik, Gail P; Larson, Eric B; McCarty, Catherine A; Masys, Daniel R; Roden, Dan M; de Andrade, Mariza; Ritchie, Marylyn D; Crawford, Dana C

2014-01-01

Thyroid stimulating hormone (TSH) hormone levels are normally tightly regulated within an individual; thus, relatively small variations may indicate thyroid disease. Genome-wide association studies (GWAS) have identified variants in PDE8B and FOXE1 that are associated with TSH levels. However, prior studies lacked racial/ethnic diversity, limiting the generalization of these findings to individuals of non-European ethnicities. The Electronic Medical Records and Genomics (eMERGE) Network is a collaboration across institutions with biobanks linked to electronic medical records (EMRs). The eMERGE Network uses EMR-derived phenotypes to perform GWAS in diverse populations for a variety of phenotypes. In this report, we identified serum TSH levels from 4,501 European American and 351 African American euthyroid individuals in the eMERGE Network with existing GWAS data. Tests of association were performed using linear regression and adjusted for age, sex, body mass index (BMI), and principal components, assuming an additive genetic model. Our results replicate the known association of PDE8B with serum TSH levels in European Americans (rs2046045 p = 1.85×10-17, β = 0.09). FOXE1 variants, associated with hypothyroidism, were not genome-wide significant (rs10759944: p = 1.08×10-6, β = -0.05). No SNPs reached genome-wide significance in African Americans. However, multiple known associations with TSH levels in European ancestry were nominally significant in African Americans, including PDE8B (rs2046045 p = 0.03, β = -0.09), VEGFA (rs11755845 p = 0.01, β = -0.13), and NFIA (rs334699 p = 1.50×10-3, β = -0.17). We found little evidence that SNPs previously associated with other thyroid-related disorders were associated with serum TSH levels in this study. These results support the previously reported association between PDE8B and serum TSH levels in European Americans and emphasize the need for additional genetic studies in more diverse populations.

High-Speed On-Board Data Processing for Science Instruments: HOPS

NASA Technical Reports Server (NTRS)

Beyon, Jeffrey

2015-01-01

The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

Sufficient Amounts of Functional HOP2/MND1 Complex Promote Interhomolog DNA Repair but Are Dispensable for Intersister DNA Repair during Meiosis in Arabidopsis[W

PubMed Central

Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde

2013-01-01

During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313

The Thr92Ala 5′ Type 2 Deiodinase Gene Polymorphism Is Associated with a Delayed Triiodothyronine Secretion in Response to the Thyrotropin-Releasing Hormone–Stimulation Test: A Pharmacogenomic Study

PubMed Central

Butler, Peter W.; Smith, Sheila M.; Linderman, Joyce D.; Brychta, Robert J.; Alberobello, Anna Teresa; Dubaz, Ornella M.; Luzon, Javier A.; Skarulis, Monica C.; Cochran, Craig S.; Wesley, Robert A.; Pucino, Frank

2010-01-01

Background The common Thr92Ala D2 polymorphism has been associated with changes in pituitary–thyroid axis homeostasis, but published results are conflicting. To investigate the effects of the Thr92Ala polymorphism on intrathyroidal thyroxine (T4) to triiodothyronine (T3) conversion, we designed prospective pharmacogenomic intervention aimed to detect differences in T3 levels after thyrotropin (TSH)-releasing hormone (TRH)–mediated TSH stimulation of the thyroid gland. Methods Eighty-three healthy volunteers were screened and genotyped for the Thr92Ala polymorphism. Fifteen volunteers of each genotype (Thr/Thr, Thr/Ala, and Ala/Ala) underwent a 500 mcg intravenous TRH stimulation test with serial measurements of serum total T3 (TT3), free T4, and TSH over 180 minutes. Results No differences in baseline thyroid hormone levels were seen among the study groups. Compared to the Thr/Thr group, the Ala/Ala group showed a significantly lower TRH-stimulated increase in serum TT3 at 60 minutes (12.07 ± 2.67 vs. 21.07 ± 2.86 ng/dL, p = 0.029). Thr/Ala subjects showed an intermediate response. Compared to Thr/Thr subjects, the Ala/Ala group showed a blunted rate of rise in serum TT3 as measured by mean time to 50% maximum delta serum TT3 (88.42 ± 6.84 vs. 69.56 ± 6.06 minutes, p = 0.028). Subjects attained similar maximal (180 minutes) TRH-stimulated TT3 levels. TRH-stimulated TSH and free T4 levels were not significantly different among the three genotype groups. Conclusions The commonly occurring Thr92Ala D2 variant is associated with a decreased rate of acute TSH-stimulated T3 release from the thyroid consistent with a decrease in intrathyroidal deiodination. These data provide a proof of concept that the Thr92Ala polymorphism is associated with subtle changes in thyroid hormone homeostasis. PMID:21054208

Iodine deficiency in pregnant women at first trimester in Ankara.

PubMed

Koyuncu, Kazibe; Turgay, Batuhan; Söylemez, Feride

2018-04-27

Iodine deficiency in pregnant woman in Ankara was shown in previous studies. We aimed to conduct a study in a tertiary center to investigate for the need for iodine replacement in our population. This was a single tertiary center, non-interventional, retrospective, cross-sectional study. Data were retrieved retrospectively from 440 women who had been in first trimester in gestational age. Maternal iodine status, TSH levels, T4 levels were examined. Urinary iodine concentration (UIC) was calculated based on Sandell-Kolthoff reaction which is a colorimetric method. We excluded patients with previous thyroid disease or current thyroid disease. Thyroid hormones and TSH were measured by chemiluminescence immunoassays. Iodine deficiency prevalence (UI <150 μg/L) was 84.7% in first trimester of pregnancy in our population. The median UIC was 81.6 (1-450) μg/L, indicating iodine insufficiency. All the patients declared iodized salt use. None of the patients were taking iodine replacement. The mean TSH level was 1.53±1.27 mIU/l, (0.01 mIU/l-14.74 mIU/l) and mean T4 levels was 12.51±5.01 mIU/l, (7.09 mIU/l, -23.7 mIU/l,). TSH levels of 56 patients were higher than 2.5 mIU/l. According to these results 12.72% of the patients had subclinical hypothyroidism based on serum TSH and Free T4 levels. Isolated hypothyroxinemia was present in one patient. Our study demonstrated that pregnant women still suffer from iodine deficiency in Ankara despite of mandatory iodine salt use. Iodized salt use does not provide enough iodine supplement especially in pregnant women. Iodine supplementation is shown to enhance neurological development and psychomotor performance. We suggest that iodine should be a part of routine laboratory evaluation at the first prenatal visit for its importance in early pregnancy. Also, iodized salt use education should be provided to the women to eradicate iodine deficiency. Iodine supplements should be recommended to all pregnant women in addition to iodized salt.

Hopping Robot with Wheels

NASA Technical Reports Server (NTRS)

Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

2003-01-01

A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

ABCG2 Polymorphism rs2231142 and hypothyroidism in metastatic renal cell carcinoma patients treated with sunitinib.

PubMed

Werbrouck, Emilie; Bastin, Julie; Lambrechts, Diether; Verbiest, Annelies; Van Brussel, Thomas; Lerut, Evelyne; Machiels, Jean-Pascal; Verschaeve, Vincent; Richard, Vincent; Debruyne, Philip R; Decallonne, Brigitte; Schöffski, Patrick; Bechter, Oliver; Wolter, Pascal; Beuselinck, Benoit

2018-05-23

Background and aim Vascular endothelial growth factor receptor tyrosine kinase inhibitors (VEGFR-TKIs) cause significant adverse events including thyroid dysfunction, mainly hypothyroidism, in a considerable proportion of patients. In a series of metastatic renal cell carcinoma (mRCC) patients treated with sunitinib, we aimed to study the correlation between hypothyroidism and single nucleotide polymorphisms (SNPs) in genes involved in sunitinib pharmacokinetics and pharmacodynamics. Patients and methods We included 79 mRCC patients who started sunitinib between November 2005 and March 2016. Serum thyroid function markers were collected at start and during sunitinib therapy. Germ-line DNA genotyping for 16 SNPs in 8 candidate genes was performed. Endpoints were time to increase in thyroid stimulating hormone (TSH) and time to decrease in T4 or free T4 (FT4) on day 1 and day 28 of each sunitinib cycle. Results Patients with the ABCG2 rs2231142 CC-genotype had a significantly longer time-to-TSH-increase on day 1 (11 vs. 5 cycles; p = 0.0011), and time-to-T4/FT4-decrease on day 1 (not reached vs. 10 cycles; p = 0.013) and day 28 (28 vs. 7 cycles; p = 0.03) compared to CA-carriers. Patients with the CYP3A5 rs776746 GG-genotype had a significantly longer time-to-TSH-increase at day 1 compared to GA-patients: 11 vs. 5 cycles (p = 0.0071). Significant associations were also found between PDGFRA rs35597368 and rs1800812 and time-to-TSH-increase at day 28. Conclusion Polymorphism rs2231142 in the efflux pump ABCG2 is associated with hypothyroidism in mRCC patients treated with sunitinib.

Lipid profile and thyroid hormone status in the last trimester of pregnancy in single-humped camels (Camelus dromedarius).

PubMed

Omidi, Arash; Sajedi, Zhila; Montazer Torbati, Mohammad Bagher; Ansari Nik, Hossein

2014-04-01

Changes in lipid metabolism have been shown to occur during pregnancy. The thyroid hormones affect lipid metabolism. The present study was carried out to find out whether the last trimester of pregnancy affects thyroid hormones, thyroid-stimulating hormone (TSH), lipid, and lipoprotein profile in healthy dromedary camels. Twenty clinical healthy dromedary camels aged between 4-5 years were divided into two equal groups: (1) pregnant camels in their last trimester of pregnancy and (2) non-pregnant age-matched controls. Thyroid function tests were carried out by measuring serum levels of TSH, free thyroxin (fT4), total thyroxin (T4), free triiodothyronine (fT3), and total triiodothyronine (T3) by commercially available radio immunoassay kits. Total cholesterol (TC), triglyceride (TG), and high-density lipoprotein (HDL) cholesterol were analyzed using enzymatic/spectrophotometric methods while low-density lipoprotein (LDL) cholesterol, very low-density lipoprotein (VLDL), and total lipid (TL) were calculated using Friedewald's and Raylander's formula, respectively. Serum levels of TSH and thyroid hormones except fT4 did not show any significant difference between pregnant and non-pregnant camels. fT4 level was lower in the pregnant camels (P < 0.05). Serum levels of total cholesterol, triglyceride, total lipid, LDL cholesterol, HDL cholesterol, and VLDL did not show significant difference between pregnant and non-pregnant camels. All of these variables in pregnant camels were higher than non-pregnant. Based on the results of this study, the fetus load may not alter the thyroid status of the camel and the concentrations of thyroid hormones were not correlated with TSH and lipid profile levels in the healthy pregnant camels.

Systematic network coding for two-hop lossy transmissions

NASA Astrophysics Data System (ADS)

Li, Ye; Blostein, Steven; Chan, Wai-Yip

2015-12-01

In this paper, we consider network transmissions over a single or multiple parallel two-hop lossy paths. These scenarios occur in applications such as sensor networks or WiFi offloading. Random linear network coding (RLNC), where previously received packets are re-encoded at intermediate nodes and forwarded, is known to be a capacity-achieving approach for these networks. However, a major drawback of RLNC is its high encoding and decoding complexity. In this work, a systematic network coding method is proposed. We show through both analysis and simulation that the proposed method achieves higher end-to-end rate as well as lower computational cost than RLNC for finite field sizes and finite-sized packet transmissions.

Disruption of prion protein-HOP engagement impairs glioblastoma growth and cognitive decline and improves overall survival.

PubMed

Lopes, M H; Santos, T G; Rodrigues, B R; Queiroz-Hazarbassanov, N; Cunha, I W; Wasilewska-Sampaio, A P; Costa-Silva, B; Marchi, F A; Bleggi-Torres, L F; Sanematsu, P I; Suzuki, S H; Oba-Shinjo, S M; Marie, S K N; Toulmin, E; Hill, A F; Martins, V R

2015-06-01

Glioblastomas (GBMs) are resistant to current therapy protocols and identification of molecules that target these tumors is crucial. Interaction of secreted heat-shock protein 70 (Hsp70)-Hsp90-organizing protein (HOP) with cellular prion protein (PrP(C)) triggers a large number of trophic effects in the nervous system. We found that both PrP(C) and HOP are highly expressed in human GBM samples relative to non-tumoral tissue or astrocytoma grades I-III. High levels of PrP(C) and HOP were associated with greater GBM proliferation and lower patient survival. HOP-PrP(C) binding increased GBM proliferation in vitro via phosphatidylinositide 3-kinase and extracellular-signal-regulated kinase pathways, and a HOP peptide mimicking the PrP(C) binding site (HOP230-245) abrogates this effect. PrP(C) knockdown impaired tumor growth and increased survival of mice with tumors. In mice, intratumor delivery of HOP230-245 peptide impaired proliferation and promoted apoptosis of GBM cells. In addition, treatment with HOP230-245 peptide inhibited tumor growth, maintained cognitive performance and improved survival. Thus, together, the present results indicate that interfering with PrP(C)-HOP engagement is a promising approach for GBM therapy.

Thyrotropin secreting pituitary adenoma accompanying a silent somatotropinoma.

PubMed

Berker, Dilek; Isik, Serhat; Aydin, Yusuf; Tutuncu, Yasemin; Akdemir, Gokhan; Ozcan, Hatice Nursun; Guler, Serdar

2011-01-01

Thyroid stimulating hormone (TSH) secreting pituitary adenomas are rare tumors manifested as hyperthyroidism with goiter in the presence of elevated TSH. We present a case with pituitary adenoma secreting both TSH and growth hormone (GH) with the prominent clinical findings of hyperthyroidism but without clinical findings of acromegaly. Pituitary magnetic resonance imaging revealed a macroadenoma. Transsphenoidal surgery was performed twice. The immunohistochemical staining showed that tumor cells were strongly reactive to GH and relatively mildly reactive to TSH. Control pituitary imaging revealed a residual macroadenoma, and long acting octreotide treatment was administered. After two years of the treatment, tumor size remained the same while thyroid function tests and insulin-like growth factor 1 (IGF-I) values returned to normal ranges. In conclusion, we always recommend hormonal examinations for all patients who have pituitary adenoma without signs and symptoms of acromegaly.

Peginterferon Lambda-1a Is Associated with a Low Incidence of Autoimmune Thyroid Disease in Chronic Hepatitis C.

PubMed

Fredlund, Paul; Hillson, Jan; Gray, Todd; Shemanski, Lynn; Dimitrova, Dessislava; Srinivasan, Subasree

2015-11-01

Peginterferon alfa (alfa) increases the risk of autoimmune disease. Peginterferon lambda-1a (Lambda) acts through a receptor with a more liver-specific distribution compared to the alfa receptor. In a phase-2b study, 525 treatment-naive patients with chronic hepatitis C virus (HCV) infection received ribavirin and Lambda interferon (120, 180, or 240 μg) or alfa interferon (180 μg) for 24 (genotypes 2 and 3) or 48 (genotypes 1 and 4) weeks. Retrospective analysis found that adverse events of MedDRA-coded thyroid dysfunction and abnormal levels of thyroid-stimulating hormone (TSH) were significantly more frequent with alfa versus Lambda (12% versus 2.6% and 15.2% versus 3.4%, respectively, both P<0.0001). Most Lambda recipients with abnormal TSH had levels below the lower limit of normal; the frequency of low and high TSH was similar in alfa recipients with abnormal TSH. Blinded review by an endocrinologist found that new-onset primary hypothyroidism or painless thyroiditis was less frequent with Lambda versus alfa (0.5% and 1.8% versus 5.3% and 7.5%, respectively, P<0.0001). Most TSH elevations reflected new-onset hypothyroidism requiring treatment, while most markedly suppressed TSH values reflected probable painless thyroiditis and resolved without sequelae. In conclusion, HCV-infected patients treated with Lambda/ribavirin experienced fewer adverse events of thyroid dysfunction compared with patients treated with alfa/ribavirin.

Thyroid disorders and the prevalence of antithyroid antibodies in Shiraz population.

PubMed

Karimi, Fariba; Kalantarhormozi, Mohammad Reza; Dabbaghmanesh, Mohammad Hossein; Ranjbar Omrani, Gholamhossein

2014-05-01

Thyroid dysfunction is a common health problem affecting millions of patients worldwide. Autoimmune thyroid disorders are among the most common autoimmune disorders. In this population-based study, we assessed the prevalence of abnormal thyroid function, antithyroid antibodies and the probable relationship between them in Shiraz, southern Iran. Serum thyrotropin (TSH) was determined in 981 subjects (66.8% female and 33.2% male; mean age: 39.1 ± 14.3 years), who were selected with stratified random sampling. Because of the preponderance of females over males, we performed the statistical analyses using sex-weighted data (50% for each sex). Also, antithyroid peroxidase antibodies (TPOAb), and antithyroglobulin antibodies (TgAb) were measured in two random subgroups of 376 and 537 patients respectively). Thyromegaly detected on physical examination. In this cross-sectional study, 8.1% of participants had elevated serum TSH level and 3.4% had low serum TSH level. A statistically significant relationship was found between gender and thyromegaly and TSH values. Positive TPOAb and positive TgAb were detected in 17% and 5.1% of participants respectively. In addition, a significant relationship was observed between elevated TSH levels and positive results for both antibodies. Detectable levels of thyroid antibodies correlated with female sex, while no correlation was observed between detectable levels of thyroid antibodies and thyromegaly. Thyroid disorders, especially elevated TSH level, are common. It seems that autoimmune mechanisms are strongly involved in the etiology of hypothyroidism in this area.

Do Thyroxine and Thyroid-Stimulating Hormone Levels Reflect Urinary Iodine Concentrations?

PubMed Central

Soldin, Offie P.; Tractenberg, Rochelle E.; Pezzullo, John C.

2013-01-01

The toxicity of environmental chemicals such as nitrates, thiocynates, and perchlorates, some therapeutics, and dietary goitrogens can lower thyroidal iodine uptake and result in hypothyroidism and goiter. Iodine sufficiency, essential for normal thyroid hormone synthesis, is critical during gestation to assure that sufficient thyroxine (T4) and iodine reach the developing fetus. Spot urinary iodide (UI) measurements are used globally to indicate and monitor iodine sufficiency of populations. In individuals, however, UI are not routinely measured; instead, normal serum thyroid-stimulating hormone (TSH) and T4 concentrations serve as surrogate indicators of iodine sufficiency as well as thyroidal health. Our objective was to examine the relationship between UI concentrations and serum T4 and TSH concentrations in individuals in an ‘‘iodine-sufficient population.’’ Using a cross-sectional sample of the US population (n = 7628) from the National Health and Nutrition Examination Survey (NHANES III; 1988–1994) database, we examined the relationship among UI, T4, and TSH in pregnant and nonpregnant women and in men (15–44 years). There was a lack of relationship between UI (or UI/Cr) concentrations and serum T4 or TSH concentrations. Therefore, TSH and T4 are not appropriate markers of UI concentrations in this population. Monitoring the status of iodine nutrition of individuals in the United States may be important because serum TSH and T4 concentrations do not indicate low iodine status. PMID:15795649

Request of thyroid function tests from Primary Care in Spain.

PubMed

Salinas, Maria; López-Garrigós, Maite; Pomares, Francisco J; Flores, Emilio; Uris, Joaquín; Leiva-Salinas, Carlos

2016-01-01

Laboratory tests are crucial for diagnosis and monitoring of thyroid disorders. It is therefore necessary to study the pattern and variability in requests of thyroid function tests. The study objectives were to compare the inter-regional variability in the request of laboratory thyroid tests by general practitioners (GPs) in Spain, and to investigate the potential economic savings if the goals set for some suitability indicators were reached. Test requests per 1,000 inhabitants and test ratios (free thyroxine (FT4)/thyrotropin (TSH), free triiodothyronine (FT3)/TSH, thyroglobulin antibody (TgAb)/peroxidase antibody (TPOAb)) were compared between the different areas, according to their setting, location, and management. The resulting savings if each department achieved the goals for indicator (0.25 for FT4/TSH, 0.1 for FT3/TSH) were estimated. Seventy-six laboratories covering a population of 17,679,195 inhabitants participated in the study. TSH was requested significantly less in urban-rural areas, and the requests for FT3/1,000 inhabitants, FT3/TSH, and TgAb/TPOAb were higher in departments with private management. The savings generated if specifications for the ratios of related tests were met would be 937,260.5 €. The high variability reported in requests for thyroid function and autoimmunity tests in Spain suggests the need for implementing strategies to improve use of such tests. Copyright © 2015 SEEN. Published by Elsevier España, S.L.U. All rights reserved.

Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy.

PubMed

Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L

2016-12-01

Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD 0-200ms , and the knee extension moment was positively associated with RTD 0-200ms . At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD 0-200ms , and RTD 0-peak torque . Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance.

Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network

NASA Astrophysics Data System (ADS)

Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue

2006-09-01

In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.

Model for using hip-hop music for small group HIV/AIDS prevention counseling with African American adolescents and young adults.

PubMed

Stephens, T; Braithwaite, R L; Taylor, S E

1998-10-01

Currently little attention has been directed, with the exception of peer education efforts, to constructively develop new and innovative ways to promote HIV/AIDS primary prevention among African American (AA) adolescents and young adults. With this in mind, the aim of this conceptual effort is to present a HIV/AIDS preventive counseling protocol developed for use with AA young adults that makes use of hip-hop music, a form of music popularized by young AAs. The author contend that an increased understanding of the relationships that many AA young adults have with hip-hop music may be used by disease prevention personnel to educate these populations about protective factors for HIV. Making use of hip-hop music is one strategy for integrating counseling in prevention and health maintenance. The overall implications of using hip-hop music in health promotion are unlimited. First, this method makes use of cultural relevant materials to address the educational and health needs of the target community. Second, it is grounded in an approach that serves to stimulate cooperative learning based on peer developed content. Moreover, the use of this medium can be applied to other health promotion activities such as violence/harm reduction and substance abuse prevention, upon reviews of songs for appropriate content. The authors contend that such an approach holds heuristic value in dealing with HIV/AIDS prevention among AA young adults. Additional testing of the intervention is warranted in the refinement of this innovative intervention.

Increased avidity for Dpp/BMP2 maintains the proliferation of progenitors-like cells in the Drosophila eye.

PubMed

Neto, Marta; Aguilar-Hidalgo, Daniel; Casares, Fernando

2016-10-01

During organ development, the progenitor state is transient, and depends on specific combinations of transcription factors and extracellular signals. Not surprisingly, abnormal maintenance of progenitor transcription factors may lead to tissue overgrowth, and the concurrence of signals from the local environment is often critical to trigger this overgrowth. Therefore, identifying specific combinations of transcription factors/signals promoting -or opposing- proliferation in progenitors is essential to understand normal development and disease. We have investigated this issue using the Drosophila eye as model. Transcription factors hth and tsh are transiently expressed in eye progenitors causing the expansion of the progenitor pool. However, if their co-expression is maintained experimentally, cell proliferation continues and differentiation is halted. Here we show that Hth+Tsh-induced tissue overgrowth requires the BMP2 Dpp and the abnormal hyperactivation of its pathway. Rather than using autocrine Dpp expression, Hth+Tsh cells increase their avidity for Dpp, produced locally, by upregulating extracellular matrix components. During normal development, Dpp represses hth and tsh ensuring that the progenitor state is transient. However, cells in which Hth+Tsh expression is forcibly maintained use Dpp to enhance their proliferation. Copyright © 2016 Elsevier Inc. All rights reserved.

CREB3L1-mediated functional and structural adaptation of the secretory pathway in hormone-stimulated thyroid cells.

PubMed

García, Iris A; Torres Demichelis, Vanina; Viale, Diego L; Di Giusto, Pablo; Ezhova, Yulia; Polishchuk, Roman S; Sampieri, Luciana; Martinez, Hernán; Sztul, Elizabeth; Alvarez, Cecilia

2017-12-15

Many secretory cells increase the synthesis and secretion of cargo proteins in response to specific stimuli. How cells couple increased cargo load with a coordinate rise in secretory capacity to ensure efficient transport is not well understood. We used thyroid cells stimulated with thyrotropin (TSH) to demonstrate a coordinate increase in the production of thyroid-specific cargo proteins and ER-Golgi transport factors, and a parallel expansion of the Golgi complex. TSH also increased expression of the CREB3L1 transcription factor, which alone caused amplified transport factor levels and Golgi enlargement. Furthermore, CREB3L1 potentiated the TSH-induced increase in Golgi volume. A dominant-negative CREB3L1 construct hampered the ability of TSH to induce Golgi expansion, implying that this transcription factor contributes to Golgi expansion. Our findings support a model in which CREB3L1 acts as a downstream effector of TSH to regulate the expression of cargo proteins, and simultaneously increases the synthesis of transport factors and the expansion of the Golgi to synchronize the rise in cargo load with the amplified capacity of the secretory pathway. © 2017. Published by The Company of Biologists Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahren, B.

The thyroid gland is known to harbor cholinergic and VIPergic nerves. In the present study, the influences of cholinergic stimulation by carbachol, cholinergic blockade by methylatropine and stimulation with various VIP sequences on basal, TSH-induced and VIP-induced thyroid hormone secretion were investigated in vivo in mice. The mice were pretreated with /sup 125/I and thyroxine; the subsequent release of /sup 125/I is an estimation of thyroid hormone secretion. It was found that basal radioiodine secretion was inhibited by both carbachol and methylatropine. Furthermore, TSH-induced radioiodine secretion was inhibited already by a low dose of carbachol. Moreover, a high dose ofmore » carbachol could inhibit VIP-induced radioiodine secretion. Methylatropine did not influence TSH- or VIP-stimulated radioiodine secretion, but counteracted the inhibitory action of carbachol on TSH- and VIP-induced radioiodine release. In addition, contrary to VIP, six various synthesized VIP fragments had no effect on basal or stimulated radioiodine release. It is concluded that basal thyroid hormone secretion is inhibited by both cholinergic activation and blockade. Furthermore, TSH-induced thyroid hormone secretion is more sensitive to inhibition with cholinergic stimulation than is VIP-induced thyroid hormone secretion. In addition, the VIP stimulation of thyroid hormone secretion seems to require the full VIP sequence.« less

Gestational hypothyroidism: development of mild hypothyroidism in early pregnancy in previously euthyroid women.

PubMed

Hammond, Karen R; Cataldo, Nicholas A; Hubbard, Janice A; Malizia, Beth A; Steinkampf, Michael P

2015-06-01

To determine the proportion of euthyroid women attending a fertility practice who develop hypothyroidism in very early pregnancy (gestational hypothyroidism [GHT]), and to examine the association of GHT with exogenous gonadotropin treatment. Retrospective cohort study. A private reproductive medicine practice. All healthy women (N = 94) with infertility or recurrent pregnancy loss, TSH level <2.5 mIU/L, negative thyroid peroxidase antibodies at initial evaluation, and not taking thyroid medication, who conceived during an 18-month period. Usual fertility care; 30 women who had received exogenous gonadotropins. Serum TSH level at the time of pregnancy detection. Gestational hypothyroidism (TSH ≥ 2.5 mIU/L) developed in 23 of 94 women (24%). The mean increase in serum TSH level from initial evaluation to early pregnancy was 0.45 ± 0.08 [SE] mIU/L. There was a trend toward the association of GHT with use of exogenous gonadotropins. Gestational hypothyroidism was positively associated with initial prepregnancy TSH level. Euthyroid women may develop mild hypothyroidism in early pregnancy, especially after exogenous gonadotropin treatment. Appropriate vigilance will allow for timely levothyroxine treatment. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Hop crop wild relatives

USDA-ARS?s Scientific Manuscript database

The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...

The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.

PubMed

Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David

2016-08-15

Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.

Time synchronization of a frequency-hopped MFSK communication system

NASA Technical Reports Server (NTRS)

Simon, M. K.; Polydoros, A.; Huth, G. K.

1981-01-01

In a frequency-hopped (FH) multiple-frequency-shift-keyed (MFSK) communication system, frequency hopping causes the necessary frequency transitions for time synchronization estimation rather than the data sequence as in the conventional (nonfrequency-hopped) system. Making use of this observation, this paper presents a fine synchronization (i.e., time errors of less than a hop duration) technique for estimation of FH timing. The performance degradation due to imperfect FH time synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of hops used in the FH timing estimate.

Hop/STI1 modulates retinal proliferation and cell death independent of PrP{sup C}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.

Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP{sup C}). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP{sup C} dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 ({alpha}-STI1) blocked both ganglion cell and NBL cell deathmore » independent of PrP{sup C}. cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while {alpha}-STI1 increased proliferation in the developing retina, both independent of PrP{sup C}. We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP{sup C}.« less

[Models of the organization of neonatal screening].

PubMed

Cassio, A; Piazzi, S; Colli, C; Balsamo, A; Bozza, D; Salardi, S; Sprovieri, G; Cacciari, E

1994-01-01

The authors evaluate the different organizational strategies of a congenital hypothyroidism screening program. Positive and negative aspects of laboratory screening tests (TSH only, T4-supplemental TSH, TSH and T4), organization strategies (centralization or decentralization), recall and first follow-up criteria are examined. The authors consider that the necessity for an early diagnostic confirmation can be associated with a precise etiologic diagnosis and an evaluation of the prenatal severity of congenital hypothyroidism factors. Some European and North-American experiences are compared with the activity of a regional Italian screening center.

Higher Thyroid-Stimulating Hormone, Triiodothyronine and Thyroxine Values Are Associated with Better Outcome in Acute Liver Failure

PubMed Central

Sowa, Jan-Peter; Manka, Paul; Katsounas, Antonios; Syn, Wing-Kin; Führer, Dagmar; Gieseler, Robert K.; Bechmann, Lars P.; Gerken, Guido; Moeller, Lars C.; Canbay, Ali

2015-01-01

Introduction Changes in thyroid hormone levels, mostly as non-thyroidal illness syndrome (NTIS), have been described in many diseases. However, the relationship between acute liver failure (ALF) and thyroid hormone levels has not yet been clarified. The present study evaluates potential correlations of select thyroid functional parameters with ALF. Methods 84 consecutively recruited ALF patients were grouped according to the outcome of ALF (spontaneous recovery: SR; transplantation or death: NSR). TSH, free thyroxine (fT4), free triiodothyronine (fT3), T4, and T3 were determined. Results More than 50% of patients with ALF presented with abnormal thyroid parameters. These patients had greater risk for an adverse outcome than euthyroid patients. SR patients had significantly higher TSH, T4, and T3 concentrations than NSR patients. Albumin concentrations were significantly higher in SR than in NSR. In vitro T3 treatment was not able to rescue primary human hepatocytes from acetaminophen induced changes in mRNA expression. Conclusions In patients with ALF, TSH and total thyroid hormone levels differed significantly between SR patients and NSR patients. This might be related to diminished liver-derived transport proteins, such as albumin, in more severe forms of ALF. Thyroid parameters may serve as additional indicators of ALF severity. PMID:26147961

Inhomogeneous atomic Bose-Fermi mixtures in cubic lattices.

PubMed

Cramer, M; Eisert, J; Illuminati, F

2004-11-05

We determine the ground state properties of inhomogeneous mixtures of bosons and fermions in cubic lattices and parabolic confining potentials. For finite hopping we determine the domain boundaries between Mott-insulator plateaux and hopping-dominated regions for lattices of arbitrary dimension within mean-field and perturbation theory. The results are compared with a new numerical method that is based on a Gutzwiller variational approach for the bosons and an exact treatment for the fermions. The findings can be applied as a guideline for future experiments with trapped atomic Bose-Fermi mixtures in optical lattices.

Research on the frequency hopping bistatic sonar system

NASA Astrophysics Data System (ADS)

Liang, Guo-long; Zhang, Yao; Zhang, Guang-pu; Liu, Kai

2011-10-01

A new model for bistatic sonar system is established, in which frequency hopping (FH) signals are used for targets detection according to some rules. This model can decrease the time between adjacent signals and obtain more information in a unit time. The receiving system will receive and process the signals of different frequency respectively, according the FH pattern, for detecting and locating targets. This method can helps yield more stable and accurate outputs, using the characteristic of the FH signals, increase the ability of anti-detection and anti partial-band jamming.

Generalized Kondo lattice model and its spin-polaron realization by the projection method for cuprates

NASA Astrophysics Data System (ADS)

Valkov, V. V.; Dzebisashvili, D. M.; Barabanov, A. F.

2017-05-01

The spin-fermion model, which is an effective low-energy realization of the three-band Emery model after passing to the Wannier representation for the px and py orbitals of the subsystem of oxygen ions, reduces to the generalized Kondo lattice model. A specific feature of this model is the existence of spin-correlated hoppings of the current carriers between distant cells. Numerical calculations of the spectrum of spin-electron excitations highlight the important role of the long-range spin-correlated hoppings.

The 1963 Hip-Hop Machine: Hip-Hop Pedagogy as Composition.

ERIC Educational Resources Information Center

Rice, Jeff

2003-01-01

Proposes an alternative invention strategy for research-based argumentative writing. Investigates the coincidental usage of the term "whatever" in hip-hop, theory, and composition studies. Presents a "whatever-pedagogy" identified as "hip-hop pedagogy," a writing practice that models itself after digital sampling's…

Research on synchronization technology of frequency hopping communication system

NASA Astrophysics Data System (ADS)

Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

2018-05-01

Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

ERIC Educational Resources Information Center

Brown, Bryan

2010-01-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

Chemical transformations of characteristic hop secondary metabolites in relation to beer properties and the brewing process: a review.

PubMed

Steenackers, Bart; De Cooman, Luc; De Vos, Dirk

2015-04-01

The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.

Neonatal hypothyroid screening in monitoring of iodine deficiency and iodine supplementation in Poland.

PubMed

Ołtarzewski, M; Szymborski, J

2003-01-01

Neonatal hypothyroid screening in Poland is standardised and all newborns screening data are registered in central data base in the National Institute of Mother and Child. About 400,000 newborns are screened per year for hypothyroidism (TSH) and phenylketonuria (PKU). Unfortunately, obstetric clinics still use antiseptics that contain iodine. According to our data 71% of clinics used iodine in 1998 (58% iodine tincture and 13% povidone iodine) and 58.2% (35.4 iodine tincture and 13% povidone iodine) in the year 2000. Presence of iodine resulted in over 3 times increase of a percentage of TSH levels over cut off, increasing the number of false positives in the hypothyroid screening. Analysis of TSH distribution for iodine containing and iodine free hospitals gave totally different estimation of iodine deficiency according to WHO criteria. In the group of iodine free hospitals 24 regions were classified as not deficient, 9 regions were borderline with a fraction of TSH levels over 5 mlU/l of 3-5%. 10 regions could not be analysed because all hospitals declared use of iodine. In the second group all regions were iodine deficient. TSH distribution since 1994 shows significant decrease of percentage of TSH levels over cut off from 2.23% in 1994 to 0.16 in 1997 and to 0.12 in 2000. These changes are most probably connected with successive introduction of iodine supplementation which became obligatory in 1997 and suggest that iodine supplementation covers iodine requirements during pregnancy. Iodine deficiency and iodine supplementation in Poland can be studied using TSH blood spot newborn screening results in correlation with data on interfering factors and in reference to modified criteria for the analytical test and the population. To reduce false positive rate in neonatal hypothyroid screening iodine containing antiseptics, particularly iodine tincture, should be withdrawn from all obstetrics clinics in Poland.

Induction of thyroiditis in mice with thyrotropin receptor lacking serologically dominant regions

PubMed Central

Wang, S H; Carayanniotis, G; Zhang, Y; Gupta, M; Mcgregor, A M; Banga, J P

1998-01-01

Grave's disease (GD) is characterized by pathogenic autoantibodies to the human thyrotropin receptor (hTSH-R), and is frequently associated with a lymphocytic infiltrate of the thyroid gland. In attempts to establish a murine model of GD, we and others have previously shown that immunization of mice with recombinant preparations of the hTSH-R ectodomain induces high titres of specific antibodies, which, however, are not pathogenic, nor is the response accompanied by the development of thyroiditis. Since earlier reports identified the serological immunodominant determinants within the N- and C-terminal regions of hTSH-R ectodomain, we reasoned that immunization of mice with truncated fragments of ectodomain lacking these dominant regions might result in skewing of the response to other determinants of the molecule, with consequent induction of immunopathological features present in GD. We show here that multiple challenge of BALB/c mice with an amino acid fragment of residues 43–282 generates antibodies directed at hTSH-R peptides 37–56, 157–176, 217–236 and 232–251. This reactivity pattern is distinct from that induced previously with the whole ectodomain of hTSH-R in BALB/c animals. Thyroid function remained unaffected in these mice, suggesting that pathogenic antibodies were not being induced. Interestingly, some animals developed lymphocytic infiltration of the thyroid gland, clearly indicating the presence of pathogenic T cell determinants within the 43–282 fragment. Challenge with the related fragment 43–316 produced the same pattern of serological response to the synthetic peptides as fragment 43–282, but was not accompanied by thyroiditis. The results demonstrate: (i) the presence of thyroiditogenic determinants within hTSH-R, and (ii) that these pathogenic determinants are likely to be cryptic, as their effect is exhibited only when the hierarchy of immunodominance within hTSH-R is drastically altered. PMID:9697994

Use of basal and TRH-stimulated plasma growth hormone concentrations to differentiate between primary hypothyroidism and nonthyroidal illness in dogs.

PubMed

Pijnacker, Tera; Kooistra, Hans S; Vermeulen, Cathelijne F; van der Vinne, Merel; Prins, Marrit; Galac, Sara; Mol, Jan A

2018-05-07

A low plasma total thyroxine (TT 4 ) concentration in combination with a plasma TSH concentration within reference range does not distinguish between hypothyroidism and nonthyroidal illness (NTI) in dogs. Hypothyroidism is associated with TSH-releasing hormone (TRH)-induced increased release of growth hormone (GH). Basal and TRH-induced plasma GH concentrations can be used to distinguish hypothyroid dogs from NTI dogs. Twenty-one dogs with signs consistent with hypothyroidism, a low plasma TT 4 concentration, and a plasma TSH concentration within reference interval. Case control study. Thyroid scintigraphy was performed to classify dogs as having hypothyroidism or NTI. All dogs underwent a TRH stimulation test with measurement of plasma concentrations of GH and TSH before and 30 and 45 minutes after IV administration of TRH. Eleven of the dogs were classified as hypothyroid and 10 as having NTI. Basal plasma GH concentration in the hypothyroid dogs (3.2 μg/l; range, 2.0 to 12.5 μg/l) was significantly higher (p<0.001) than that in the NTI dogs (.73 μg/l; range, .45 to 2.3 μg/l), with minimal overlap, and increased (p=.009) after TRH administration in hypothyroid dogs, whereas it did not change in NTI dogs. At T=45, plasma GH concentrations in hypothyroid dogs and NTI dogs did not overlap. The plasma TSH concentration did not change significantly after TRH administration in hypothyroid dogs, whereas it increased (p<.001) in NTI dogs. At T=45, there was no overlap in percentage TSH increase from baseline between hypothyroid dogs. Measurement of basal plasma GH concentration and concentrations of GH and TSH after TRH stimulation can distinguish between hypothyroidism and NTI in dogs. Copyright © 2018 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Follicular thyroid carcinoma with metastases to the pituitary causing pituitary insufficiency.

PubMed

Vianello, Federica; Mazzarotto, Renzo; Taccaliti, Augusto; Lora, Ornella; Basso, Michela; Servodio, Oscar; Mian, Caterina; Sotti, Guido

2011-08-01

Pituitary metastases are found in about 1% of all pituitary resections. They often derive from breast, lung, and gastroenteric tract adenocarcinomas, very rarely from thyroid carcinoma. Presenting symptoms of thyroid carcinoma metastatic to the pituitary gland are usually chiasmatic with central neurological impairment due to space-occupying expansion in the parasellar region. Hypopituitarism is more often associated with papillary and medullary rather than follicular thyroid carcinoma (FTC). Here we describe a patient with pituitary metastasis from FTC who had hypopituitarism with thyrotropin (TSH) deficiency. A 61-year-old woman, who presented with visual deficits and pain to the right orbit, was found on magnetic resonance imaging to have a large mass involving the pituitary gland. She was found to have pituitary insufficiency based on corticotropin-releasing hormone and TSH-releasing hormone testing. Transnasopharyngeal biopsy of the mass revealed metastases from FTC. After total thyroidectomy, which confirmed widely invasive FTC, the patient underwent external beam radiation therapy of the metastases for progressive neurological symptoms and an increase in orbit pain. Since endogenous TSH production was insufficient, we used recombinant human TSH (rhTSH) as preparation for a series of radioiodine treatments. rhTSH administration, followed by 7.4 GBq of (131)I, was repeated seven times over a 10-year period. This was associated with a marked decrease in serum thyroglobulin levels accompanied by substantial clinical improvement, but after 7 years disease progression occurred. Seven patients with pituitary metastases from FTC have been reported. In all cases, some neurological signs and symptoms related to mass effect were reported, but no pituitary insufficiency was described. This may be the first case of FTC with metastases to the pituitary causing hypopituitarism. It seems likely that management of such cases could be limited to biopsy to confirm thyroid carcinoma, rather than more extensive surgery, and that this could be followed by multiple treatments with rhTSH followed by (131)I.

Influence of thyroid peroxidase antibodies on TSH levels of pregnant women and maternal-fetal complications.

PubMed

Fernández Martínez, Paula; Aguado García, Rocío; Barajas Galindo, David Emilio; Hernández Moreno, Ana; Alejo Ramos, Mirian; García Arias, Sara; Ballesteros Pomar, María D; Cano Rodríguez, Isidoro Manuel

2018-06-14

During pregnancy, thyroid peroxidase (TPO) antibodies may increase the risk of developing subclinical hypothyroidism (SCH). Both conditions appear to be associated to maternal-fetal complications. The objectives of this study were to analyze if a relationship exists between TSH and TPO levels during pregnancy and the potential effects on gestational and perinatal complications, and to assess whether detectable, but not positive, TPO levels have an impact on development of gestational SCH. A prospective study was conducted at the Leon Health Area (CAULE), where universal screening for gestational thyroid dysfunction is performed between weeks 7-13 of pregnancy. Data on TSH and TPO levels and gestational and perinatal complications were collected for all 2016 deliveries. Positive TPO antibodies were defined as values≥35IU/mL. In a previous study, a TSH level>3.72mU/L was established as the cut-off value for gestational SCH. Records corresponding to 1,980 deliveries at CAULE, 21 abortions, and 18 deliveries outside the hospital were analyzed. Of the 1,670 pregnant women screened (84.34%), 142 (8.50%) had positive TPO antibodies and their presence was associated to diagnosis of SCH (P<0.01) and to significantly higher mean TSH levels (3.51mU/L vs. 2.46mU/L, P=0.03). There were no significant differences in gestational or neonatal complications. In the group with undetectable TPO antibodies (<10lU/mL), the mean TSH levels was slightly lower than in the group with TPO values ranging from 10-35 IU/mL, but the difference was not significant (P=0.89). Presence of positive TPO antibodies is associated to higher TSH levels and higher risk of gestational SCH, but does not increase the rate of maternal-fetal complications. Copyright © 2018 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

Thyroid-stimulating hormone and free thyroxine levels in persons with HFE C282Y homozygosity, a common hemochromatosis genotype: the HEIRS study.

PubMed

Barton, James C; Leiendecker-Foster, Catherine; Reboussin, David M; Adams, Paul C; Acton, Ronald T; Eckfeldt, John H

2008-08-01

Relationships of thyroid and iron measures in large cohorts are unreported. We evaluated thyroid-stimulating hormone (TSH) and free thyroxine (T4) in white participants of the primary care-based Hemochromatosis and Iron Overload Screening (HEIRS) Study. We measured serum TSH and free T4 in 176 HFE C282Y homozygotes without previous hemochromatosis diagnoses and in 312 controls without HFE C282Y or H63D who had normal serum iron measures and were matched to C282Y homozygotes for Field Center, age group, and initial screening date. We defined hypothyroidism as having TSH >5.00 mIU/L and free T4 <0.70 ng/dL, and hyperthyroidism as having TSH <0.400 mIU/L and free T4 >1.85 ng/dL. Multivariate analyses were performed using age, sex, Field Center, log(10) serum ferritin (SF), HFE genotype, log(10) TSH, and log(10) free T4. Prevalences of hypothyroidism in C282Y homozygotes and controls were 1.7% and 1.3%, respectively, and of hyperthyroidism 0% and 1.0%, respectively. Corresponding prevalences did not differ significantly. Correlations of log(10) SF with log(10) free T4 were positive (p = 0.2368, C282Y homozygotes; p = 0.0492, controls). Independent predictors of log(10) free T4 were log(10) TSH (negative association) and age (positive association); positive predictors of log(10) SF were age, male sex, and C282Y homozygosity. Proportions of C282Y homozygotes and controls who took medications to supplement or suppress thyroid function did not differ significantly. Prevalences of hypothyroidism and hyperthyroidism are similar in C282Y homozygotes without previous hemochromatosis diagnoses and controls. In controls, there is a significant positive association of SF with free T4. We conclude that there is no rationale for routine measurement of TSH or free T4 levels in hemochromatosis or iron overload screening programs.

Five-Year Follow-Up for Women With Subclinical Hypothyroidism in Pregnancy

PubMed Central

Shields, Beverley M.; Knight, Bridget A.; Hill, Anita V.; Hattersley, Andrew T.

2013-01-01

Context: Increasing numbers of women are being treated with l-thyroxine in pregnancy for mild thyroid dysfunction because of its association with impaired neuropsychological development in their offspring and other adverse obstetric outcomes. However, there are limited data to indicate whether treatment should be continued outside of pregnancy. Objectives: We aimed to determine whether subclinical hypothyroidism and maternal hypothyroxinemia resolve postdelivery. Design, Setting, and Participants: A total of 523 pregnant healthy women with no known thyroid disorders were recruited during routine antenatal care and provided blood samples at 28 weeks of pregnancy and at a mean of 4.9 years postpregnancy. Main Outcome Measures: TSH, free T4, free T3, and thyroid peroxidase antibody levels were measured in serum taken in pregnancy and at follow-up. Results: Subclinical hypothyroidism in pregnancy (TSH >3 mIU/L) was present in 65 of 523 (12.4%) women. Of these, 49 (75.4%) women had normal thyroid function postpregnancy; 16 of 65 (24.6%) had persistent high TSH (TSH >4.5 mIU/L postpregnancy) with 3 women receiving l-thyroxine treatment. A total of 44 of 523 (8.4%) women had isolated maternal hypothyroxinemia in pregnancy (free T4 <10th centile and TSH ≤3 mIU/L). Only 2 of 44 (4.5%) had TSH >4.5 mIU/L outside pregnancy. Of the women with subclinical hypothyroidism in pregnancy with antibody measurements available, those with thyroid peroxidase antibodies in pregnancy were more likely to have persistently elevated TSH or be receiving l-thyroxine replacement after pregnancy (6 of 7 [86%] vs 10 of 57 [18%], P < .001). Conclusions: The majority of cases of subclinical hypothyroidism in pregnancy are transient, so treatment with l-thyroxine in these patients should be reviewed because it may not be warranted after pregnancy. PMID:24217906

Definition of reference ranges for free T4, TSH, and thyroglobulin levels in healthy subjects of the Jaén Health District.

PubMed

Olmedo Carrillo, Pablo; Santiago Fernández, Piedad; García Fuentes, Eduardo; Ureña Fernández, Tomás; Gutiérrez Alcántara, Carmen; Sánchez-Malo, Carolina; Gassó Campos, Manuela; Martínez Ramírez, María José

2017-10-01

The treatment guidelines for thyroid dysfunction recommend defining reference ranges for thyroid hormones in each area through assessment of local population data considering the iodine nutritional status. The aim of this study was to define the reference ranges of free thyroxine (FT4), TSH, and thyroglobulin levels in a general population from Jaen, an area of southern Spain with an adequate iodine nutritional status, and whether they were associated with urinary iodine levels. A cross-sectional study was conducted in 1,003 subjects of the general population of the Jaen Health District. Levels of urinary iodine, FT4, TSH, thyroglobulin, and thyroid peroxidase (TPO) antibodies were measured according to age and sex. Median and mean urinary iodine levels were 110.59μg/L and 130.11μg/L respectively. Median TSH level was 1.83μIU/mL (p2.5=0.56μIU/mL, p97.5=4.66μIU/mL). Median FT4 level was 0.84ng/dL (p2.5=0.62ng/dL, p97.5=1.18ng/dL). TPO antibodies were detected in 5.7% of subjects. There was no correlation between urinary iodine levels and FT4, TSH or TPO antibodies. Subjects with positive TPO antibodies had higher TSH levels (3.34μIU/L versus 2.14μIU/mL, P=.001; odds ratio=2.42). Urinary iodine levels in Jaen are optimal according to World Health Organization standards. Reference ranges of FT4, TSH, and thyroglobulin do not differ from those reported in the literature and are no associated to urinary iodine levels. The prevalence of positive TPO antibodies was similar to that reported in other Spanish areas. Copyright © 2017 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

Thyroid function tests in patients taking thyroid medication in Germany: Results from the population-based Study of Health in Pomerania (SHIP).

PubMed

Hannemann, Anke; Friedrich, Nele; Haring, Robin; Krebs, Alexander; Völzke, Henry; Alte, Dietrich; Nauck, Matthias; Kohlmann, Thomas; Schober, Hans-Christof; Hoffmann, Wolfgang; Wallaschofski, Henri

2010-08-16

Studies from iodine-sufficient areas have shown that a high proportion of patients taking medication for thyroid diseases have thyroid stimulating hormone (TSH) levels outside the reference range. Next to patient compliance, inadequate dosing adjustment resulting in under- and over-treatment of thyroid disease is a major cause of poor therapy outcomes. Using thyroid function tests, we aim to measure the proportions of subjects, who are under- or over-treated with thyroid medication in a previously iodine-deficient area. Data from 266 subjects participating in the population-based Study of Health in Pomerania (SHIP) were analysed. All subjects were taking thyroid medication. Serum TSH levels were measured using immunochemiluminescent procedures. TSH levels of < 0.27 or > 2.15 mIU/L in subjects younger than 50 years and < 0.19 or > 2.09 mIU/L in subjects 50 years and older, were defined as decreased or elevated, according to the established reference range for the specific study area. Our analysis revealed that 56 of 190 (29.5%) subjects treated with thyroxine had TSH levels outside the reference range (10.0% elevated, 19.5% decreased). Of the 31 subjects taking antithyroid drugs, 12 (38.7%) had TSH levels outside the reference range (9.7% elevated, 29.0% decreased). These proportions were lower in the 45 subjects receiving iodine supplementation (2.2% elevated, 8.9% decreased). Among the 3,974 SHIP participants not taking thyroid medication, TSH levels outside the reference range (2.8% elevated, 5.9% decreased) were less frequent. In concordance with previous studies in iodine-sufficient areas, our results indicate that a considerable number of patients taking thyroid medication are either under- or over-treated. Improved monitoring of these patients' TSH levels, compared to the local reference range, is recommended.

High-Speed On-Board Data Processing Platform for LIDAR Projects at NASA Langley Research Center

NASA Astrophysics Data System (ADS)

Beyon, J.; Ng, T. K.; Davis, M. J.; Adams, J. K.; Lin, B.

2015-12-01

The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 - April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

Analysis of Current Thyroid Function Testing Practices

DTIC Science & Technology

2017-10-18

electric medical record (EMR). TFTs of interest were: TSH, FT4, thyroid panel )TSH + FT4), FT3, total thyroxine (T$), and total triiodothyronine (T3). These were also categorized based on the presence or absence of hypothyroidism .

Hip-Hopping across China: Intercultural Formulations of Local Identities

ERIC Educational Resources Information Center

Barrett, Catrice

2012-01-01

The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

Revolutionizing Environmental Education through Indigenous Hip Hop Culture

ERIC Educational Resources Information Center

Gorlewski, Julie; Porfilio, Brad J.

2012-01-01

Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

Evaluation of thyroid function in dogs suffering from recurrent flank alopecia.

PubMed Central

Daminet, S; Paradis, M

2000-01-01

Thyroid function was assessed in euthyroid dogs (n = 20), dogs suffering from canine recurrent flank alopecia (CRFA, n = 18), and hypothyroid dogs (n = 21). Blood samples obtained from all dogs in each group were assayed for total thyroxine (TT4), thyrotropin (TSH), and thyroglobulin autoantibody (TgAA) serum concentrations. Total T4 and TSH serum concentrations were significantly decreased and increased, respectively, in the hypothyroid group compared with the other 2 groups. No significant differences in TT4 and TSH serum values were found between the euthyroid and CRFA groups. Thyroglobulin autoantibodies were detected in 10, 11.1, and 61.9% of euthyroid dogs, dogs with CRFA, and hypothyroid dogs, respectively. In conclusion, dogs suffering from CRFA have a normal thyroid function, and the determination of TT4 and TSH serum concentrations allows differentiation of these dogs from dogs with hypothyroidism, in most cases. Occasionally, the 2 diseases can be concomitant. PMID:10992988

Overview of Hypothyroidism in Pregnancy.

PubMed

Kroopnick, Jeffrey M; Kim, Caroline S

2016-11-01

Overt hypothyroidism in pregnancy, defined as an elevated serum thyroid-stimulating hormone (TSH) and reduced serum free thyroxine or a TSH >10 mIU/L, is known to have adverse effects on pregnancy. Subclinical hypothyroidism is typically defined as an elevated TSH and normal FT4 levels. There remains much controversy on the benefit of starting levothyroxine for mothers diagnosed with subclinical hypothyroidism. Recent studies are redefining the normal range for TSH in pregnancy, and the data on whether treatment of subclinical hypothyroidism improves outcomes for the mother and fetus are unclear. One confounding variable is the presence of thyroid peroxidase antibodies, as it may be a surrogate marker for other autoimmune disorders detrimental to pregnancy. If levothyroxine treatment is initiated, the dosing and monitoring strategy is different from nonpregnant individuals. Randomized clinical trials are underway that may better elucidate whether treatment of subclinical hypothyroidism is warranted. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Hyperthyroidism due to inappropriate secretion of thyroid-stimulating hormone: diagnosis and management.

PubMed

Hermus, A; Ross, H; van Liessum, P; Naber, A; Smals, A; Kloppenborg, P

1991-06-01

The case histories of three patients with hyperthyroidism due to overproduction of thyroid-stimulating hormone (TSH) by the pituitary gland are described. In the first patient treatment with the T3-metabolite 3,5,3'-triiodothyroacetic acid (TRIAC) led to complete clinical and biochemical normalization. In the second patient treatment with the dopaminergic agonist bromocriptine led to a temporal amelioration of hyperthyroidism. In the third patient, who was the only one with a proven pituitary adenoma, hypersecretion of TSH could be controlled by administration of the somatostatin analogue octreotide. It is emphasized that patients with this disorder should preferably not be treated with thyrostatic drugs, radioactive iodine or thyroid surgery. The success rate of these treatment modalities is lower than normal, they may lead to an increase of goiter size, and they potentially may promote growth or development of a TSH-producing adenoma. Treatment should be aimed at diminishing TSH hypersecretion.

Serum lipids in hypothyroidism: Our experience.

PubMed

Prakash, Archana; Lal, Ashok Kumar

2006-09-01

In order to determine whether the screening of lipid profile is justified in patients with hypothyroidism we estimated serum lipids in cases having different levels of serum TSH. 60 patients of hypothyroidism in the age group of 20 to 60 yrs were studied for thyroid profile over a period of one year. On the basis of serum TSH level the cases were divided into three groups: In the first group TSH concentration was 8.8±2.99 μlU/ml, 95% confidence interval (Cl) 8.8±1.07, whereas serum total cholesterol and LDL-chol levels were 196±37.22 and 126±29.17 mg/dl respectively. The statistical analysis of these two groups showed a significant correlation between raised TSH levels and serum total cholesterol and LDL-chol (P<0.05 & P<0.01) respectively. We conclude that hypothyrodism is associated with changes in lipid profile.

[Hypothyreodism. From the latent functional disorder up to coma].

PubMed

Hintze, G; Derwahl, M

2010-05-01

An autoimmune thyroiditis represents the main reason of hypothyroidism, defined as a lack of thyroid hormone. This autoimmune process results in destruction of functioning thyroid follicles. While subclinical or latent hypothyroidism is defined on the basis of laboratory values (an elevation of TSH with normal peripheral hormone levels), the typical signs and symptoms are associated with hypothyroidism. In about 80% of cases antibodies against thyroid peroxidase can be measured, but only in about 40-50% of cases antibodies against thyroglobulin are detectable. If hypothyrodism has been diagnosed, substitution with levothyroxine should be initiated, with the therapeutic goal to decrease TSH level to the lower normal range. In cases of subclinical hypothyroidism, levothyroxine medication should be started in patients with a high TSH value, positive antibodies and/or the typical ultrasound of autoimmune thyroiditis. However, substitution with levothyroxine in any case of elevated TSH values should be avoided.

[Effect of selenium on serum TGAb, TMAb, FT3, FT4 and TSH of rats with excessive intake of iodine].

PubMed

Chi, Haiyan; Zhou, Yuping; Li, Li

2012-07-01

To investigate the effect of selenium on the TGAb, TMAb, FT3, FT4 and TSH level of rats with excessive intake of iodine. Wistar rats were divided into three groups by random:normal control, high iodine group and high iodine plus selenium group. Rats in the high iodine plus selenium group were lavaged with sodium selenite for 10 weeks. The levels of serum TGAb, TMAb, FT3, FT4 and TSH were tested at different time of the experiment. There were no significant change on levels of FT3, FT4 and TSH (P > 0.05). The levels of TGAb and TMAb in the high iodine group were increased slowly (P < 0.05), but no significant change was observed in the high iodine plus selenium group. Excessive intake of iodine might induce goiter, and selenium might have antagonistic effect on it.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Dong; Heidelberger, Philip; Sugawara, Yutaka

An apparatus and method for extending the scalability and improving the partitionability of networks that contain all-to-all links for transporting packet traffic from a source endpoint to a destination endpoint with low per-endpoint (per-server) cost and a small number of hops. An all-to-all wiring in the baseline topology is decomposed into smaller all-to-all components in which each smaller all-to-all connection is replaced with star topology by using global switches. Stacking multiple copies of the star topology baseline network creates a multi-planed switching topology for transporting packet traffic. Point-to-point unified stacking method using global switch wiring methods connects multiple planes ofmore » a baseline topology by using the global switches to create a large network size with a low number of hops, i.e., low network latency. Grouped unified stacking method increases the scalability (network size) of a stacked topology.« less

[Relationship between hypothyroidism and cholesterol out of the records of 1756 patients].

PubMed

Sampaolo, Guido; Campanella, Nando; Catozzo, Vania; Ferretti, Maurizio; Vichi, Giovanna; Morosini, Pierpaolo

2014-02-01

Subclinical hypothyroidism (SH) is settled whenever high levels of serum thyroid-stimulating hormone (TSH) are detected, whereas free thyroid hormone levels are within the normal range. Benefits and risks of therapy for SH have been debated for 2 decades. However, consensus has not yet been achieved. Besides preventing the progression to overt hypothyroidism, the decision of undertaking replacement therapy in SH is made mainly by basing on the risk of metabolic (dyslypidemia) and subsequent cardiovascular complications. A series, made up of 1756 patients (mean age 42,8±16,8, range 0,5-94) and filed from 1984 to 2013, was studied retrospectively. 169 patients were affected by clinical (overt) hypothyroidism (IC: TSH >40). 1587 patients were affected by SH, out of whom 1121 were mild (TSH <10) and 466 medium (TSH ≥ 10 ≤40). The series of patients was properly followed-up. The mean follow-up time was 6 years. In all patients TSH, Ft4, and total cholesterol were evaluated basally and after appropriate (TSH normalized) medical therapy. By medical replacement treatment, clinical hypothyroidism (CI) related hypercholesterolemia decreased significantly in 28%. In SH, the baseline serum cholesterol levels were wide. However, replacement treatment did not reduce such levels. No major cardiovascular accident occurred to any patient over the follow-up period. Hypercholesterolemia is certainly due to CI, therapy reduces cholesterol levels that not always fall below 200 mg/dl and this condition persists over time. SH is not characterized by hypercholesterolemia. Cholesterol levels in these patients are variable equal to the normal people and can not be reduced with thyroxine.

Adequate thyroid-stimulating hormone levels after levothyroxine discontinuation in the follow-up of patients with well-differentiated thyroid carcinoma.

PubMed

Sánchez, Reyna; Espinosa-de-los-Monteros, Ana Laura; Mendoza, Victoria; Brea, Eduardo; Hernández, Irma; Sosa, Ernesto; Mercado, Moisés

2002-01-01

In the follow-up of patients with well-differentiated thyroid carcinomas (WTC), a thyroid-stimulating hormone (TSH) >or=30 micro U/mL is generally accepted as adequate to perform whole body scans (WBS), determine thyroglobulin (Tg), and administer radioiodine therapeutically. These patients, inevitably rendered hypothyroid, are traditionally switched to T3 for 3-4 weeks prior to withdrawing all thyroid hormones for an additional 2-3 weeks. Neither TSH and Tg elevation dynamics nor WBS characteristics after simply interrupting L-T4 treatment without T3 administration have been evaluated. TSH, total T4 and T3, as well as FT4 were measured weekly after discontinuing L-T4 in 21 subjects (group I) and after thyroidectomy in 10 subjects (group II). WBS and Tg determination was performed upon achievement of TSH >or=30 micro U/mL. By the second week, 42% of group I patients and 70% of group II patients had TSH >or=30 micro U/mL. By the third week, 90% in group I and 100% in group II had achieved this target. Group I patients who needed 4 weeks to increase TSH received a greater cumulative radioiodine dose and had higher Tg levels. Positive WBS were found in eight cases and the incidence of a negative WBS with elevated Tg was significantly higher when evaluation occurred at the second week of L-T4 withdrawal compared to the fourth week. L-T4 interruption is a reasonable alternative to temporary T3 in preparation for radioiodine scanning and treatment.

Relational Stability in the Expression of Normality, Variation, and Control of Thyroid Function

PubMed Central

Hoermann, Rudolf; Midgley, John E. M.; Larisch, Rolf; Dietrich, Johannes W.

2016-01-01

Thyroid hormone concentrations only become sufficient to maintain a euthyroid state through appropriate stimulation by pituitary thyroid-stimulating hormone (TSH). In such a dynamic system under constant high pressure, guarding against overstimulation becomes vital. Therefore, several defensive mechanisms protect against accidental overstimulation, such as plasma protein binding, conversion of T4 into the more active T3, active transmembrane transport, counter-regulatory activities of reverse T3 and thyronamines, and negative hypothalamic–pituitary–thyroid feedback control of TSH. TSH has gained a dominant but misguided role in interpreting thyroid function testing in assuming that its exceptional sensitivity thereby translates into superior diagnostic performance. However, TSH-dependent thyroid disease classification is heavily influenced by statistical analytic techniques such as uni- or multivariate-defined normality. This demands a separation of its conjoint roles as a sensitive screening test and accurate diagnostic tool. Homeostatic equilibria (set points) in healthy subjects are less variable and do not follow a pattern of random variation, rather indicating signs of early and progressive homeostatic control across the euthyroid range. In the event of imminent thyroid failure with a reduced FT4 output per unit TSH, conversion efficiency increases in order to maintain FT3 stability. In such situations, T3 stability takes priority over set point maintenance. This suggests a concept of relational stability. These findings have important implications for both TSH reference limits and treatment targets for patients on levothyroxine. The use of archival markers is proposed to facilitate the homeostatic interpretation of all parameters. PMID:27872610