Science.gov

Sample records for human amylase genes

  1. Concerted evolution of human amylase genes

    SciTech Connect

    Gumucio, D.L.; Wiebauer, K.; Caldwell, R.M.; Samuelson, L.C.; Meisler, M.H.

    1988-03-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, the authors have identified two pancreatic amylase gene and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, duplications, gene conversion, and unequal crossover events have resulted in a very high level of sequence similarity among human amylase gene copies. To identify sequence elements involved in tissue-specific expression and hormonal regulation, the promoter regions of the human amylase genes were sequenced and compared with those of the corresponding mouse genes. The promoters of the human and mouse pancreatic amylase genes are highly homologous between nucleotide - 160 and the cap site. Two sequence elements througth to influence pancreas-specific expression of the rodent genes are present in the human genes. In contrast, similarity in the 5' lanking sequences of the salivary amylase genes is limited to several short sequence elements whose positions and orientations differ in the two species. Some of these sequence elements are also associated with other parotid-specific genes and may be involved in their tissue-specific expression. A glucocorticoid response element and a general enhancer element are closely associated in several of the amylase promoters.

  2. Expression of the human amylase genes: Recent origin of a salivary amylase promoter from an actin pseudogene

    SciTech Connect

    Samuelson, L.C.; Gumucio, D.L.; Meisler, M.H. ); Wiebauer, K. )

    1988-09-12

    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. The authors have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at a low level in liver, but not from the promoter used in pancreas. AMY1 transcripts were detected in parotid, but not in pancreas or liver. Unexpected fragments protected by liver RNA led to the discovery that the 5{prime} regions of the five human amylase genes contain a processed {gamma}-actin pseudogene. The promoter and start site for transcription of AMY1 are recently derived from the 3{prime} untranslated region of {gamma}-actin. In addition, insertion of an endogenous retrovirus has interrupted the {gamma}-actin pseudogene in four of the five amylase genes.

  3. Response of Fatty Acid Synthesis Genes to the Binding of Human Salivary Amylase by Streptococcus gordonii

    PubMed Central

    Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.

    2012-01-01

    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment. PMID:22247133

  4. Copy number polymorphism of the salivary amylase gene: implications in human nutrition research.

    PubMed

    Santos, J L; Saus, E; Smalley, S V; Cataldo, L R; Alberti, G; Parada, J; Gratacòs, M; Estivill, X

    2012-01-01

    The salivary α-amylase is a calcium-binding enzyme that initiates starch digestion in the oral cavity. The α-amylase genes are located in a cluster on the chromosome that includes salivary amylase genes (AMY1), two pancreatic α-amylase genes (AMY2A and AMY2B) and a related pseudogene. The AMY1 genes show extensive copy number variation which is directly proportional to the salivary α-amylase content in saliva. The α-amylase amount in saliva is also influenced by other factors, such as hydration status, psychosocial stress level, and short-term dietary habits. It has been shown that the average copy number of AMY1 gene is higher in populations that evolved under high-starch diets versus low-starch diets, reflecting an intense positive selection imposed by diet on amylase copy number during evolution. In this context, a number of different aspects can be considered in evaluating the possible impact of copy number variation of the AMY1 gene on nutrition research, such as issues related to human diet gene evolution, action on starch digestion, effect on glycemic response after starch consumption, modulation of the action of α-amylases inhibitors, effect on taste perception and satiety, influence on psychosocial stress and relation to oral health.

  5. Recurrent Rearrangements of Human Amylase Genes Create Multiple Independent CNV Series.

    PubMed

    Shwan, Nzar A A; Louzada, Sandra; Yang, Fengtang; Armour, John A L

    2017-05-01

    The human amylase gene cluster includes the human salivary (AMY1) and pancreatic amylase genes (AMY2A and AMY2B), and is a highly variable and dynamic region of the genome. Copy number variation (CNV) of AMY1 has been implicated in human dietary adaptation, and in population association with obesity, but neither of these findings has been independently replicated. Despite these functional implications, the structural genomic basis of CNV has only been defined in detail very recently. In this work, we use high-resolution analysis of copy number, and analysis of segregation in trios, to define new, independent allelic series of amylase CNVs in sub-Saharan Africans, including a series of higher-order expansions of a unit consisting of one copy each of AMY1, AMY2A, and AMY2B. We use fiber-FISH (fluorescence in situ hybridization) to define unexpected complexity in the accompanying rearrangements. These findings demonstrate recurrent involvement of the amylase gene region in genomic instability, involving at least five independent rearrangements of the pancreatic amylase genes (AMY2A and AMY2B). Structural features shared by fundamentally distinct lineages strongly suggest that the common ancestral state for the human amylase cluster contained more than one, and probably three, copies of AMY1. © 2017 WILEY PERIODICALS, INC.

  6. Selective sweep on human amylase genes postdates the split with Neanderthals

    PubMed Central

    Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K.; Armour, John A. L.; Kivisild, Toomas

    2016-01-01

    Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content. PMID:27853181

  7. Diet and the evolution of human amylase gene copy number variation

    PubMed Central

    Perry, George H.; Dominy, Nathaniel J.; Claw, Katrina G.; Lee, Arthur S.; Fiegler, Heike; Redon, Richard; Werner, John; Villanea, Fernando A.; Mountain, Joanna L.; Misra, Rajeev; Carter, Nigel P.; Lee, Charles; Stone, Anne C.

    2008-01-01

    Starch consumption is a prominent characteristic of agricultural societies and hunter-gatherers in arid environments. In contrast, rainforest and circum-arctic hunter-gatherers and some pastoralists consume much less starch1-3. This behavioral variation raises the possibility that different selective pressures have acted on amylase, the enzyme responsible for starch hydrolysis4. We found that salivary amylase gene (AMY1) copy number is correlated positively with salivary amylase protein levels, and that individuals from populations with high-starch diets have on average more AMY1 copies than those with traditionally low-starch diets. Comparisons with other loci in a subset of these populations suggest that the level of AMY1 copy number differentiation is unusual. This example of positive selection on a copy number variable gene is one of the first in the human genome. Higher AMY1 copy numbers and protein levels likely improve the digestion of starchy foods, and may buffer against the fitness-reducing effects of intestinal disease. PMID:17828263

  8. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    PubMed

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations.

  9. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes

    PubMed Central

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M.; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A.A.; Yang, Fengtang; Thomas, Mark G.; Armour, John A.L.

    2015-01-01

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. PMID:25788522

  10. Retroviral and psuedogene insertion sites reveal the lineage of human salivary and pancreatic amylase genes from a single gene during primate evolution

    SciTech Connect

    Samuelson, L.C.; Snow, C.M.; Meisler, M.H. . Dept. of Human Genetics); Wiebauer, K. )

    1990-06-01

    The authors have analyzed the junction regions of inserted elements within the human amylase gene complex. This complex contains five genes which are expressed at high levels either in the pancreas or in the parotid gland. The proximal 5{prime}-flanking regions of these genes contain two inserted elements. A {gamma}-actin pseudogene is located at a position 20 base pairs upstream of the first coding exon. All of the amylase genes contain this insert. The subsequent insertion of an endogenous retrovirus interrupted the {gamma}-actin pseudogene within its 3{prime}-untranslated region. Nucleotide sequence analysis of the inserted elements associated with each of the five human amylase genes has revealed a series of molecular events during the recent history of this gene family. The data indicate that the entire gene family was generated during primate evolution from one ancestral gene copy and that the retroviral insertion activated a cryptic promoter.

  11. Cloning and expression of a chicken alpha-amylase gene.

    PubMed

    Benkel, B F; Nguyen, T; Ahluwalia, N; Benkel, K I; Hickey, D A

    1997-06-19

    We have isolated and sequenced a genomic clone for a pancreatic alpha-amylase gene (amy) of the chicken (Gallus gallus). The gene is interrupted by nine introns, spans over 4 kb, and encodes a protein (AMY) of 512 aa that is 83% identical to the human pancreatic alpha-amylase enzyme. Southern blot analysis of chicken DNA revealed two distinct pancreatic amy loci. In addition, we have generated a cDNA from chicken pancreatic RNA corresponding to the coding sequence of the genomic clone. The cDNA was inserted into a yeast expression vector, and the resulting construct used to transform Saccharomyces cerevisiae cells. Transformed yeast cells synthesized and secreted active AMY enzyme, and the gel migration pattern of the alpha-amylase produced by the yeast cells was identical to that of the native chicken enzyme.

  12. Variation in the Number of Genes Coding for Salivary Amylase in the Bank Vole, CLETHRIONOMYS GLAREOLA

    PubMed Central

    Nielsen, Jørn Tønnes

    1977-01-01

    A Danish population of bank voles is polymorphic for three electrophoretically different salivary amylases, A, H and S, of which A is the most common. Both single-, double- and triple banded phenotypes were observed, and in several crosses two electrophoretic forms cosegregated. In addition to the qualitative variation, some individuals show consistent quantitative variation in the relative activities of their amylase bands. This variation has been qualified by spectrophotometrical measurements of the relative amounts of amylase protein in the various bands.—Seventy wild chromosomes were analyzed by determining the amounts of amylase they produced when heterozygous with a laboratory stock chromosome known to carry two closely linked amylase genes, both coding for a fourth electrophoretic variant, B. The amount of A-protein divided by half the amount of B-protein was used as an estimate of the number of A-genes on the tested chromosomes. The wild chromosomes fell into three clearly distinguishable classes: 9 clustered around a gene number estimate of one, 45 chromosomes yielded estimates around two genes, and the gene number estimate of the remaining 16 was close to three. The integer values of the gene number estimates and the cosegregation of electrophoretically different salivary amylases are consistent with the model that the population is polymorphic for chromosomes with either one, two, or three closely linked amylase genes. It is suggested that such gene number variation may be more common than generally recognized, and some other reported cases of quantitative enzyme variation, for instance that of human red cell acid phosphatase, are interpreted in terms of variation in the number of genes involved. PMID:320091

  13. Beta-amylase gene variability in introgressive wheat lines.

    PubMed

    Antonyuk, Maksym; Navalikhina, Anastasiia; Ternovska, Tamara

    2017-05-01

    Variability of the beta-amylase gene in bread wheat, artificial amphidiploids, and derived introgression wheat lines was analyzed. Variation in homeologous beta-amylase sequences caused by the presence of MITE (Miniature Inverted-Repeat Transposable Element) and its footprint has been identified in bread wheat. The previously unknown location of MITE in Triticum urartu and T. aestivum L. beta-amylase gene has been found. These species have a MITE sequence in the third intron of beta-amylase, as opposed to Aegilops comosa and a number of other Triticeae species, which have it in the fourth intron. These two MITEs from Ae. comosa and T. aestivum were shown to have low identity scores. Miosa, an artificial amphidiploid, which has the M genome from Ae. comosa was shown to lose the MITE sequences. This loss might be caused by genomic shock due to allopolyploidization.

  14. Exercise upregulates salivary amylase in humans (Review)

    PubMed Central

    KOIBUCHI, ERI; SUZUKI, YOSHIO

    2014-01-01

    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively investigated. The present review summarizes relevant studies published in the English and Japanese literature after 2006. A search of the PubMed and CiNii databases identified 54 articles, from which 15 original articles were selected. The findings described in these publications indicate that exercise consistently increases mean salivary α-amylase activities and concentrations, particularly at an intensity of >70% VO2max in healthy young individuals. Thus, these studies have confirmed that salivary α-amylase levels markedly increase in response to physical stress. Salivary α-amylase levels may therefore serve as an effective indicator in the non-invasive assessment of physical stress. PMID:24669232

  15. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes.

    PubMed

    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L

    2016-01-01

    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result.

  16. The potato amylase inhibitor gene SbAI regulates cold-induced sweetening in potato tubers by modulating amylase activity.

    PubMed

    Zhang, Huiling; Liu, Jun; Hou, Juan; Yao, Ying; Lin, Yuan; Ou, Yongbin; Song, Botao; Xie, Conghua

    2014-09-01

    Potato cold-induced sweetening (CIS) is critical for the postharvest quality of potato tubers. Starch degradation is considered to be one of the key pathways in the CIS process. However, the functions of the genes that encode enzymes related to starch degradation in CIS and the activity regulation of these enzymes have received less attention. A potato amylase inhibitor gene known as SbAI was cloned from the wild potato species Solanum berthaultii. This genetic transformation confirmed that in contrast to the SbAI suppression in CIS-resistant potatoes, overexpressing SbAI in CIS-sensitive potatoes resulted in less amylase activity and a lower rate of starch degradation accompanied by a lower reducing sugar (RS) content in cold-stored tubers. This finding suggested that the SbAI gene may play crucial roles in potato CIS by modulating the amylase activity. Further investigations indicated that pairwise protein-protein interactions occurred between SbAI and α-amylase StAmy23, β-amylases StBAM1 and StBAM9. SbAI could inhibit the activities of both α-amylase and β-amylase in potato tubers primarily by repressing StAmy23 and StBAM1, respectively. These findings provide the first evidence that SbAI is a key regulator of the amylases that confer starch degradation and RS accumulation in cold-stored potato tubers.

  17. Individual differences in AMY1 gene copy number, salivary α-amylase levels, and the perception of oral starch.

    PubMed

    Mandel, Abigail L; Peyrot des Gachons, Catherine; Plank, Kimberly L; Alarcon, Suzanne; Breslin, Paul A S

    2010-10-13

    The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of starch has proven difficult. Furthermore, the relationship between copy number variations (CNVs) in the AMY1 gene, which influence salivary amylase levels, and starch viscosity perception has not been explored. Here we demonstrate that saliva containing high levels of amylase has sufficient activity to rapidly hydrolyze a viscous starch solution in vitro. Furthermore, we show with time-intensity ratings, which track the digestion of starch during oral manipulation, that individuals with high amylase levels report faster and more significant decreases in perceived starch viscosity than people with low salivary amylase levels. Finally, we demonstrate that AMY1 CNVs predict an individual's amount and activity of salivary amylase and thereby, ultimately determine their perceived rate of oral starch viscosity thinning. By linking genetic variation and its consequent salivary enzymatic differences to the perceptual sequellae of these variations, we show that AMY1 copy number relates to salivary amylase concentration and enzymatic activity level, which, in turn, account for individual variation in the oral perception of starch viscosity. The profound individual differences in salivary amylase levels and salivary activity may contribute significantly to individual differences in dietary starch intake and, consequently, to overall nutritional status.

  18. Individual Differences in AMY1 Gene Copy Number, Salivary α-Amylase Levels, and the Perception of Oral Starch

    PubMed Central

    Mandel, Abigail L.; Peyrot des Gachons, Catherine; Plank, Kimberly L.; Alarcon, Suzanne; Breslin, Paul A. S.

    2010-01-01

    Background The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of starch has proven difficult. Furthermore, the relationship between copy number variations (CNVs) in the AMY1 gene, which influence salivary amylase levels, and starch viscosity perception has not been explored. Principal Findings Here we demonstrate that saliva containing high levels of amylase has sufficient activity to rapidly hydrolyze a viscous starch solution in vitro. Furthermore, we show with time-intensity ratings, which track the digestion of starch during oral manipulation, that individuals with high amylase levels report faster and more significant decreases in perceived starch viscosity than people with low salivary amylase levels. Finally, we demonstrate that AMY1 CNVs predict an individual's amount and activity of salivary amylase and thereby, ultimately determine their perceived rate of oral starch viscosity thinning. Conclusions By linking genetic variation and its consequent salivary enzymatic differences to the perceptual sequellae of these variations, we show that AMY1 copy number relates to salivary amylase concentration and enzymatic activity level, which, in turn, account for individual variation in the oral perception of starch viscosity. The profound individual differences in salivary amylase levels and salivary activity may contribute significantly to individual differences in dietary starch intake and, consequently, to overall nutritional status. PMID:20967220

  19. Sugar modulation of alpha-amylase genes under anoxia.

    PubMed

    Loreti, Elena; Yamaguchi, Junji; Alpi, Amedeo; Perata, Pierdomenico

    2003-01-01

    Tolerance to low oxygen availability is likely to be due to the interaction of several factors. Sugar availability is one of the elements required to support anaerobic metabolism. In cereal grains the availability of soluble sugars is limited, while starch is stored in large amounts. Degradation of starch under anoxia is therefore needed to avoid sugar starvation leading to rapid cell death. The striking difference in the ability to produce alpha-amylase when comparing the anoxia-tolerant rice (Oryza sativa L.) grains with grains of other cereals is not easily explained. Rice is able to respond to gibberellins under anoxia, but the response is too slow to explain the rapid production of alpha-amylase enzyme. In the present work we demonstrated that alpha-amylase production during the first 2 d after imbibition is mostly due to the activity of the Ramy3D gene, encoding for the G and H isoforms of alpha-amylase. The induction of Ramy3D transcription is likely to result from a low sugar content in the grains incubated under anoxia. The ability of rice embryos to sense sugars under anoxia is reported.

  20. Cloning and sequencing of the gene encoding thermophilic beta-amylase of Clostridium thermosulfurogenes.

    PubMed Central

    Kitamoto, N; Yamagata, H; Kato, T; Tsukagoshi, N; Udaka, S

    1988-01-01

    A gene coding for thermophilic beta-amylase of Clostridium thermosulfurogenes was cloned into Bacillus subtilis, and its nucleotide sequence was determined. The nucleotide sequence suggested that the thermophilic beta-amylase is translated from monocistronic mRNA as a secretory precursor with a signal peptide of 32 amino acid residues. The deduced amino acid sequence of the mature beta-amylase contained 519 residues with a molecular weight of 57,167. The amino acid sequence of the C. thermosulfurogenes beta-amylase showed 54, 32, and 32% homology with those of the Bacillus polymyxa, soybean, and barley beta-amylases, respectively. Twelve well-conserved regions were found among the amino acid sequences of the four beta-amylases. To elucidate the mechanism rendering the C. thermosulfurogenes beta-amylase thermophilic, its amino acid sequence was compared with that of the B. polymyxa beta-amylase. The C. thermosulfurogenes beta-amyulase contained more Cys residues and fewer hydrophilic amino acid residues than the B. polymyxa beta-amylase did. Several regions were found in the amino acid sequence of the C. thermosulfurogenes beta-amylase, where the hydrophobicity was remarkably high as compared with that of the corresponding regions of the B. polymyxa beta-amylase. PMID:2461360

  1. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    PubMed Central

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes. Images PMID:2464578

  2. Structural forms of the human amylase locus and their relationships to SNPs, haplotypes, and obesity

    PubMed Central

    Usher, Christina L; Handsaker, Robert E; Esko, Tõnu; Tuke, Marcus A; Weedon, Michael N; Hastie, Alex R; Cao, Han; Moon, Jennifer E; Kashin, Seva; Fuchsberger, Christian; Metspalu, Andres; Pato, Carlos N; Pato, Michele T; McCarthy, Mark I; Boehnke, Michael; Altshuler, David M; Frayling, Timothy M; Hirschhorn, Joel N; McCarroll, Steven A

    2016-01-01

    Hundreds of genes reside in structurally complex, poorly understood regions of the human genome1-3. One such region contains the three amylase genes (AMY2B, AMY2A, and AMY1) responsible for digesting starch into sugar. The copy number of AMY1 is reported to be the genome’s largest influence on obesity4, though genome-wide association studies for obesity have found this locus unremarkable. Using whole genome sequence analysis3,5, droplet digital PCR6, and genome mapping7, we identified eight common structural haplotypes of the amylase locus that suggest its mutational history. We found that AMY1 copy number in individuals’ genomes is generally even (rather than odd) and partially correlates to nearby SNPs, which do not associate with BMI. We measured amylase gene copy number in 1,000 obese or lean Estonians and in two other cohorts totaling ~3,500 individuals. We had 99% power to detect the lower bound of the reported effects on BMI4, yet found no association. PMID:26098870

  3. Structural forms of the human amylase locus and their relationships to SNPs, haplotypes and obesity.

    PubMed

    Usher, Christina L; Handsaker, Robert E; Esko, Tõnu; Tuke, Marcus A; Weedon, Michael N; Hastie, Alex R; Cao, Han; Moon, Jennifer E; Kashin, Seva; Fuchsberger, Christian; Metspalu, Andres; Pato, Carlos N; Pato, Michele T; McCarthy, Mark I; Boehnke, Michael; Altshuler, David M; Frayling, Timothy M; Hirschhorn, Joel N; McCarroll, Steven A

    2015-08-01

    Hundreds of genes reside in structurally complex, poorly understood regions of the human genome. One such region contains the three amylase genes (AMY2B, AMY2A and AMY1) responsible for digesting starch into sugar. Copy number of AMY1 is reported to be the largest genomic influence on obesity, although genome-wide association studies for obesity have found this locus unremarkable. Using whole-genome sequence analysis, droplet digital PCR and genome mapping, we identified eight common structural haplotypes of the amylase locus that suggest its mutational history. We found that the AMY1 copy number in an individual's genome is generally even (rather than odd) and partially correlates with nearby SNPs, which do not associate with body mass index (BMI). We measured amylase gene copy number in 1,000 obese or lean Estonians and in 2 other cohorts totaling ∼3,500 individuals. We had 99% power to detect the lower bound of the reported effects on BMI, yet found no association.

  4. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.

    PubMed Central

    Mielenz, J R

    1983-01-01

    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also contain a 5.4-kb HindIII fragment of DNA. Cloning experiments with the four plasmids yielded alpha-amylase-producing E. coli that contained the same 9.7-kb chimeric plasmid. Restriction endonuclease analysis and further recombinant DNA experiments identified a 26-kb plasmid that contains the gene for alpha-amylase. A spontaneous mutant of B. stearothermophilus unable to produce alpha-amylase was missing the 26-kb plasmid but contained a 20-kb plasmid. A 6-kb deletion within the region of the 5.4-kb HindIII fragment yielded the 20-kb plasmid unable to code for alpha-amylase. A nick-translated probe for the alpha-amylase coding region did not hybridize to either plasmid or total cellular DNA from this mutant strain of B. stearothermophilus. These results demonstrate the gene for alpha-amylase is located exclusively on a 26-kb plasmid in B. stearothermophilus with no genetic counterpart present on the chromosome. Images PMID:6193526

  5. Liver alpha-amylase gene expression as an early obesity biomarker.

    PubMed

    Mojbafan, Marzieh; Afsartala, Zohreh; Amoli, Mahsa M; Mahmoudi, Mahdi; Yaghmaei, Parichehreh; Larijani, Bagher; Ebrahim-Habibi, Azadeh

    2017-04-01

    Obesity is a major health problem worldwide, for which preventive and therapeutic means are still needed. Alpha-amylase is a digestive enzyme whose inhibition has been targeted as a potential anti-obesity strategy. However, alpha-amylase gene expression has not been particularly attended to, and in contrast with pancreatic and salivary amylases, fewer studies have focused on liver alpha-amylase. The present study aimed at investigating the expression of alpha-amylase gene in obese and normal mice at RNA and protein level as well as acarbose effect on this gene expression in hepatocyte cell culture. Control and case groups were fed by normal mouse pellet and high-fat diet respectively, during 8 weeks. After this period, serum biochemical parameters including glucose, cholesterol, triglycerides, AST, ALT and alpha-amylase were assayed. Liver alpha-amylase gene was analyzed by real time PCR, and liver enzyme was assayed with Bernfeld and ELISA methods Hepatocyte cell culture derived from both group were also treated by acarbose and alpha-amylase activity and gene expression was analyzed by above mentioned methods. All biochemical factors showed an increase in obese mice, but the increase in ALT and AST were not statistically significant. Alpha-amylase levels were also increased in obese mice, both at RNA and protein level, while a decrease was seen in obese mice derived hepatocytes after acarbose treatment. Elevated liver alpha-amylase levels may be indicative of initial stages of obesity and the use of acarbose could be considered as a treatment of obesity which could be potentially effective at multiple levels. Copyright © 2016. Published by Elsevier Urban & Partner Sp. z o.o.

  6. Amylase and chitinase genes in Streptomyces lividans are regulated by reg1, a pleiotropic regulatory gene.

    PubMed Central

    Nguyen, J; Francou, F; Virolle, M J; Guérineau, M

    1997-01-01

    A regulatory gene, reg1, was identified in Streptomyces lividans. It encodes a 345-amino-acid protein (Reg1) which contains a helix-turn-helix DNA-binding motif in the N-terminal region. Reg1 exhibits similarity with the LacI/GalR family members over the entire sequence. It displays 95% identity with MalR (the repressor of malE in S. coelicolor), 65% identity with ORF-Sl (a putative regulatory gene of alpha-amylase of S. limosus), and 31% identity with CcpA (the carbon catabolite repressor in Bacillus subtilis). In S. lividans, the chromosomal disruption of reg1 affected the expression of several genes. The production of alpha-amylases of S. lividans and that of the alpha-amylase of S. limosus in S. lividans were enhanced in the reg1 mutant strains and relieved of carbon catabolite repression. As a result, the transcription level of the alpha-amylase of S. limosus was noticeably increased in the reg1 mutant strain. Moreover, the induction of chitinase production in S. lividans was relieved of carbon catabolite repression by glucose in the reg1 mutant strain, while the induction by chitin was lost. Therefore, reg1 can be regarded as a pleiotropic regulatory gene in S. lividans. PMID:9335287

  7. Structural relationship between the enzymatic and streptococcal binding sites of human salivary alpha-amylase.

    PubMed

    Scannapieco, F A; Bhandary, K; Ramasubbu, N; Levine, M J

    1990-12-31

    Previous studies have demonstrated that human salivary alpha-amylase specifically binds to the oral bacterium Streptococcus gordonii. This interaction is inhibited by substrates such as starch and maltotriose suggesting that bacterial binding may involve the enzymatic site of amylase. Experiments were performed to determine if amylase bound to the bacterial surface possessed enzymatic activity. It was found that over one-half of the bound amylase was enzymatically active. In addition, bacterial-bound amylase hydrolyzed starch to glucose which was then metabolized to lactic acid by the bacteria. In further studies, the role of amylase's histidine residues in streptococcal binding and enzymatic function was assessed after their selective modification with diethyl pyrocarbonate. DEP-modified amylase showed a marked reduction in both enzymatic and streptococcal binding activities. These effects were diminished when DEP modification occurred in the presence of maltotriose. DEP-modified amylase had a significantly altered secondary structure when compared with native enzyme or amylase modified in the presence of maltotriose. Collectively, these results suggest that human salivary alpha-amylase may possess multiple sites for bacterial binding and enzymatic activity which share structural similarities.

  8. Genomic and functional characterization of coleopteran insect-specific α-amylase inhibitor gene from Amaranthus species.

    PubMed

    Bhide, Amey J; Channale, Sonal M; Yadav, Yashpal; Bhattacharjee, Kabita; Pawar, Pankaj K; Maheshwari, V L; Gupta, Vidya S; Ramasamy, Sureshkumar; Giri, Ashok P

    2017-06-01

    The smallest 32 amino acid α-amylase inhibitor from Amaranthus hypochondriacus (AAI) is reported. The complete gene of pre-protein (AhAI) encoding a 26 amino acid (aa) signal peptide followed by the 43 aa region and the previously identified 32 aa peptide was cloned successfully. Three cysteine residues and one disulfide bond conserved within known α-amylase inhibitors were present in AhAI. Identical genomic and open reading frame was found to be present in close relatives of A. hypochondriacus namely Amaranthus paniculatus, Achyranthes aspera and Celosia argentea. Interestingly, the 3'UTR of AhAI varied in these species. The highest expression of AhAI was observed in A. hypochondriacus inflorescence; however, it was not detected in the seed. We hypothesized that the inhibitor expressed in leaves and inflorescence might be transported to the seeds. Sub-cellular localization studies clearly indicated the involvement of AhAI signal peptide in extracellular secretion. Full length rAhAI showed differential inhibition against α-amylases from human, insects, fungi and bacteria. Particularly, α-amylases from Helicoverpa armigera (Lepidoptera) were not inhibited by AhAI while Tribolium castaneum and Callosobruchus chinensis (Coleoptera) α-amylases were completely inhibited. Molecular docking of AhAI revealed tighter interactions with active site residues of T. castaneum α-amylase compared to C. chinensis α-amylase, which could be the rationale behind the disparity in their IC50. Normal growth, development and adult emergence of C. chinensis were hampered after feeding on rAhAI. Altogether, the ability of AhAI to affect the growth of C. chinensis demonstrated its potential as an efficient bio-control agent, especially against stored grain pests.

  9. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    DTIC Science & Technology

    1979-01-01

    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase secretion...as a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  10. Relationship among physiological quality, heterosis, and amylase gene expression in maize seeds.

    PubMed

    Oliveira, G E; Von Pinho, E V R; Andrade, T; Souza, J C; Caixeta, F; Ferreira, R A D C

    2015-07-31

    In this study, we analyzed heterosis, amylase enzyme gene expression, and the physiological quality of maize seeds with different genotypes and sizes, which were subjected to aging and not subjected to aging. We used seeds from 2 maize lines that differed with regard to physiological quality, the hybrid, and the reciprocal hybrid; they were classified into 2 sizes and were subjected to aging and not subjected to aging. Physiological quality was assessed by performing tests for germination, emergence, emergence speed index, and artificial aging. Expressions of the genes alpha amylase B73, alpha amylase (LOC542522), isoamylase mRNA clone 353244, and the endogenous controls ubiquitin and alcohol dehydrogenase in the seeds were studied using quantitative real-time-polymerase chain reaction. We observed heterosis for seed quality and for expression of amylase genes in the genotypes studied. We found no difference in seed quality between large and small seeds.

  11. An approach to remove alpha amylase for proteomic analysis of low abundance biomarkers in human saliva.

    PubMed

    Deutsch, Omer; Fleissig, Yoram; Zaks, Batia; Krief, Guy; Aframian, Doron J; Palmon, Aaron

    2008-11-01

    Proteomic characterization of human whole saliva for the identification of disease-specific biomarkers is guaranteed to be an easy-to-use and powerful diagnostic tool for defining the onset, progression and prognosis of human systemic diseases and, in particular, oral diseases. The high abundance of proteins, mainly alpha amylase, hampers the detection of low abundant proteins appearing in the disease state and therefore should be removed. In the present study a 2-DE was used to analyze human whole saliva following the removal of alpha amylase by affinity adsorption to potato starch. After alpha amylase removal whole saliva was analyzed by SDS-PAGE showing at least sixfold removal efficiency and by an alpha amylase activity assay showing 97% reduced activity. MS identification of the captured alpha amylase after elution demonstrated specific removal; 2-DE analysis showed the selective removal of alpha amylase and consequently increased gel resolution. MS identification of protein spots in the 60 kDa area revealed 15 proteins, which were masked before alpha amylase removal. In conclusion, treatment of human whole saliva with an alpha amylase removal device increases gel resolution and enables a higher protein sample for analysis.

  12. Association among growth, food consumption-related traits and amylase gene polymorphism in the Pacific oyster Crassostrea gigas.

    PubMed

    Huvet, A; Jeffroy, F; Fabioux, C; Daniel, J Y; Quillien, V; Van Wormhoudt, A; Moal, J; Samain, J F; Boudry, P; Pouvreau, S

    2008-12-01

    To examine further a previously reported association between amylase gene polymorphism and growth in the Pacific oyster Crassostrea gigas, ecophysiological parameters and biochemical and molecular expression levels of alpha-amylase were studied in Pacific oysters of different amylase genotypes. Genotypes that previously displayed significantly different growth were found to be significantly different for ingestion and absorption efficiency. These estimated parameters, used in a dynamic energy budget model, showed that observed ingestion rates (unlike absorption efficiencies) allowed an accurate prediction of growth potential in these genotypes. The observed association between growth and amylase gene polymorphism is therefore more likely to be related to ingestion than to absorption efficiency. Additionally, relative mRNA levels of the two amylase cDNAs were also strongly associated with amylase gene polymorphism, possibly reflecting variation in an undefined regulatory region, although no corresponding variation was observed in specific amylase activity. Amylase gene sequences were determined for each genotype, showing the existence of only synonymous or functionally equivalent non-synonymous polymorphisms. The observed associations among growth, food consumption-related traits and amylase gene polymorphism are therefore more likely to be related to variation in the level of amylase gene expression than to functional enzymatic variants.

  13. Hormonal Regulation of alpha-Amylase Gene Transcription in Wild Oat (Avena fatua L.) Aleurone Protoplasts.

    PubMed

    Zwar, J A; Hooley, R

    1986-02-01

    The time of appearance and relative amounts of alpha-amylase mRNA in wild oat (Avena fatua L.) aleurone protoplasts incubated with 1 micromolar gibberellin A(4) (GA(4)) were closely correlated with the amounts of alpha-amylase enzyme secreted by the protoplasts. In the absence of GA(4), or when protoplasts were incubated with 25 micromolar abscisic acid (ABA) together with 1 micromolar GA(4) no alpha-amylase mRNA was detected and only very low levels of alpha-amylase were secreted. Nuclei were isolated in high yields (65-71%) from aleurone protoplasts and in an in vitro transcription system displayed characteristics of a faithful DNA-dependent RNA synthesizing system. The time course of incorporation of [(3)H]-UTP suggested that the RNA synthesized was mainly ;run off' transcription and therefore that the transcripts produced in vitro were those being synthesized in the protoplasts at the times when the nuclei were isolated. By hybridizing in vitro synthesized [(32)P]RNA to barley alpha-amylase cDNA and control filters we have estimated that 90 +/- 10 ppm of the transcripts synthesized by nuclei isolated from GA(4) treated protoplasts can be attributed to alpha-amylase sequences and that statistically insignificant amounts of these transcripts are obtained from control and GA(4) plus ABA treatments. The results suggest that GA(4) and ABA influence the transcription of alpha-amylase genes in aleurone protoplasts of wild oat.

  14. Short 5'-flanking regions of the Amy gene of Drosophila kikkawai affect amylase gene expression and respond to food environments.

    PubMed

    Inomata, Nobuyuki; Nakashima, Shuichi

    2008-04-15

    Evolution of the duplicated genes and regulation in gene expression is of great interest, especially in terms of adaptation. Molecular population genetic and evolutionary studies on the duplicated amylase genes of Drosophila species have suggested that their 5'-flanking (cis-regulatory) regions play an important role in evolution of these genes. For better understanding of evolution of the duplicated amylase genes and gene expression, we studied functional significance of the Amy1 gene of Drosophila kikkawai using in vitro deletion mutagenesis followed by P-element-mediated germline transformation. We found that a 1.6-kb of the 5'-flanking region can produce strikingly higher level of larval amylase activity on starch food compared with that on glucose food. We found two cis-regulatory elements, which increase larval amylase activity on starch food. We also found a larval cis-regulatory element, which responds to the food difference. This food-response element is necessary for the function of the element increasing larval activity on starch food. A 5-bp deletion in a putative GRE caused high amylase activity, indicating a cis-regulatory element decreasing amylase activity. These cis-regulatory elements identified in the 5'-flanking region could be the targets of natural selection.

  15. Structure of amylase-binding protein A of Streptococcus gordonii: a potential receptor for human salivary α-amylase enzyme.

    PubMed

    Sethi, Ashish; Mohanty, Biswaranjan; Ramasubbu, Narayanan; Gooley, Paul R

    2015-06-01

    Amylase-binding protein A (AbpA) of a number of oral streptococci is essential for the colonization of the dental pellicle. We have determined the solution structure of residues 24-195 of AbpA of Streptococcus gordonii and show a well-defined core of five helices in the region of 45-115 and 135-145. (13) Cα/β chemical shift and heteronuclear (15) N-{(1) H} NOE data are consistent with this fold and that the remainder of the protein is unstructured. The structure will inform future molecular experiments in defining the mechanism of human salivary α-amylase binding and biofilm formation by streptococci. © 2015 The Protein Society.

  16. Structure of amylase-binding protein A of Streptococcus gordonii: A potential receptor for human salivary α-amylase enzyme

    PubMed Central

    Sethi, Ashish; Mohanty, Biswaranjan; Ramasubbu, Narayanan; Gooley, Paul R

    2015-01-01

    Amylase-binding protein A (AbpA) of a number of oral streptococci is essential for the colonization of the dental pellicle. We have determined the solution structure of residues 24–195 of AbpA of Streptococcus gordonii and show a well-defined core of five helices in the region of 45–115 and 135–145. 13Cα/β chemical shift and heteronuclear 15N-{1H} NOE data are consistent with this fold and that the remainder of the protein is unstructured. The structure will inform future molecular experiments in defining the mechanism of human salivary α-amylase binding and biofilm formation by streptococci. PMID:25739638

  17. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  18. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G

    1991-01-01

    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  19. Screening, Gene Cloning, and Characterizations of an Acid-Stable α-Amylase.

    PubMed

    Liu, Xinyu; Jia, Wei; An, Yi; Cheng, Kun; Wang, Mingdao; Yang, Sen; Chen, Hongge

    2015-06-01

    Based on its α-amylase activity at pH 5.0 and optimal pH of the crude enzyme, a strain (named B-5) with acid α-amylase production was screened. The B-5 strain was identified as Bacillus amyloliquefaciens through morphological, physiological, and biochemical characteristics analysis, as well as 16S rDNA phylogenetic analysis. Its α-amylase gene of GenBank Accession No. GU318401 was cloned and expressed in Escherichia coli. The purified recombinant α-amylase AMY-Ba showed the optimal pH of 5.0, and was stable at a pH range of 4.0-6.0. When hydrolyzing soluble starch, amylose, and amylopectin, AMY-Ba released glucose and maltose as major end products. The α-amylase AMY-Ba in this work was a different type from the well-investigated J01542 (GenBank Accession No.)-type α-amylase from the same species. AMY-Ba exhibited notable adsorption and hydrolysis ability towards various raw starches. Structure analysis of AMY-Ba suggested the presence of a new starch-binding domain at its C-terminal region.

  20. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion

    USDA-ARS?s Scientific Manuscript database

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  1. Effect of anthranilic acid on the catabolite repression of a Drosophila amylase gene in E. coli

    SciTech Connect

    Stevens, S.M.; Moehring, J.M.; Chernin, M.I.

    1987-05-01

    A Drosophila pseudoobscura amylase pseudogene cloned in Escherichia coli is expressed at high levels. The expression of this pseudogene is repressed when glucose (0.5% final conc) is added to a starch minimal medium culture of E. coli cells that contain the amylase plasmid pAMY17F. Addition of anthranilic acid (7 mM final conc.) to catabolite repressed cells acts like adenosine 3',5' cyclic monophosphate (cAMP) by derepressing the amylase pseudogene at the promoter. This is consistent with the Metabolite Gene Regulation (MGR) model proposed by Kline et al. which suggests that small molecules can circumvent the necessity for cAMP. Catabolite repression of the amylase structural gene of D. pseudoobscura has been previously shown. This would suggest that the amylase pseudogene expression in E. coli is either from a Drosophila structural gene promoter co-cloned with the pseudogene or a catabolite repressible E. coli promoter placed in the proper orientation and reading frame during the rearrangement of pAMY17F.

  2. Inhibitory effects of tannin on human salivary alpha-amylase.

    PubMed

    Kandra, Lili; Gyémánt, Gyöngyi; Zajácz, Agnes; Batta, Gyula

    2004-07-09

    Here, we first report on the effectiveness and specificity of tannin inhibition of 2-chloro-4-nitrophenyl-4-O-beta-d-galactopyranosylmaltoside hydrolysis that is catalyzed by human salivary alpha-amylase (HSA). Tannin was gallotannin in which quinic acid was esterified with 2-7 units of gallic acid. A number of studies establish that polyphenols-like tannins-may prevent oral diseases, e.g., dental caries. Kinetic analyses confirmed that the inhibition of hydrolysis is a mixed non-competitive type and only one molecule of tannin binds to the active site or the secondary site of the enzyme. Since Dixon plots were linear, product formation could be excluded from the enzyme-substrate-inhibitor complex (ESI). Kinetic constants calculated from secondary plots and non-linear regression are almost identical, thereby confirming the suggested model. Kinetic constants (K(EI) = 9.03 microgmL(-1), K(ESI) = 47.84 microgmL(-1)) show that tannin is as an effective inhibitor of HSA as acarbose and indicate a higher stability for the enzyme-inhibitor complex than ESI.

  3. Prevalence of the Amylase-Binding Protein A Gene (abpA) in Oral Streptococci

    PubMed Central

    Brown, Alan E.; Rogers, Jeffrey D.; Haase, Elaine M.; Zelasko, Peter M.; Scannapieco, Frank A.

    1999-01-01

    Salivary amylase binds specifically to a number of oral streptococcal species. This interaction may play an important role in dental plaque formation. Recently, a 585-bp gene was cloned and sequenced from Streptococcus gordonii Challis encoding a 20.5-kDa amylase-binding protein (AbpA). The goal of this study was to determine if related genes are present in other species of oral streptococci. Biotinylated abpA was used in Southern blot analysis to screen genomic DNA from several strains representing eight species of oral streptococci. This probe hybridized with a 4.0-kb HindIII restriction fragment from all 13 strains of S. gordonii tested. The probe did not appear to bind to any restriction fragments from other species of amylase-binding oral streptococci including Streptococcus mitis (with the exception of 1 of 14 strains), Streptococcus crista (3 strains), Streptococcus anginosus (1 strain), and Streptococcus parasanguinis (1 strain), or to non-amylase-binding oral streptococci including Streptococcus sanguinis (3 strains), Streptococcus oralis (4 strains), and Streptococcus mutans (1 strain). Primers homologous to sequences within the 3′ and 5′ ends of abpA yielded products of 400 bp following PCR of genomic DNA from the Southern blot-positive strains. Several of these PCR products were cloned and sequenced. The levels of similarity of these cloned products to the abpA of S. gordonii Challis ranged from 91 to 96%. These studies reveal that the abpA gene appears to be specific to S. gordonii and differs from genes encoding amylase-binding proteins from other species of amylase-binding streptococci. PMID:10565935

  4. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  5. MS characterization of multiple forms of alpha-amylase in human saliva.

    PubMed

    Hirtz, Christophe; Chevalier, François; Centeno, Delphine; Rofidal, Valerie; Egea, Jean-Christophe; Rossignol, Michel; Sommerer, Nicolas; Deville de Périère, Dominique

    2005-11-01

    Alpha-amylase is a major and well-characterized component of human saliva. Recent proteomic studies suggested that this protein could be observed in more than twenty spots on 2-D gels of salivary proteins. The aim of this work was to investigate this unexpected redundancy. 2-D gel electrophoresis was combined with systematic MALDI-TOF MS analysis. More than 140 protein spots identifying the alpha-amylase were shown to constitute a stable but very complex pattern. Careful analysis of mass spectra and simultaneous hierarchical clustering of the observed peptides and of the electrophoretic features of spots allowed one to define three major groups. A main class grouping 90 spots was shown to correspond to full length alpha-amylases that can be assumed to include isoforms and post-translationally modified forms, a subset of this class being demonstrated to be N-glycosylated. A second group included short alpha-amylases that are differently truncated in a non-random manner, very likely in the oral cavity. The last class grouped alpha-amylase forms showing both the N- and C-terminal sequences of the enzyme but displaying a molecular weight that was up to 50% lower than that of the native protein. It is speculated that the last group of alpha-amylase spots could correspond to proteins submitted to internal deletions prior to the secretion.

  6. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    PubMed Central

    Sapra, Gaurav; Vyas, Yogesh Kumar; Agarwal, Rahul; Aggarwal, Ashish; Chandrashekar, K T; Sharma, Kanika

    2013-01-01

    Background: Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice) on human salivary amylase activity and to compare it with other dentifrices. Materials and Methods: A total of 80 subjects of age 18-35 years were randomly selected and divided equally into 4 groups. Group 1 subjects were assigned to use Test Dentifrice (with S. calva root extract), while Group 2, Group 3, and Group 4 subjects were assigned to use Herbal Dentifrice (Arodent™), Synthetic Dentifrice (Colgate®), and Control Dentifrice respectively. Salivary amylase activity was determined by Bernfeld method in each group, before and after using the given dentifrices. Results: Maximum inhibition of salivary amylase activity was found in the group using test dentifrice as compared to others. Conclusion: The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations. PMID:24130585

  7. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase.

    PubMed

    Sapra, Gaurav; Vyas, Yogesh Kumar; Agarwal, Rahul; Aggarwal, Ashish; Chandrashekar, K T; Sharma, Kanika

    2013-07-01

    Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice) on human salivary amylase activity and to compare it with other dentifrices. A total of 80 subjects of age 18-35 years were randomly selected and divided equally into 4 groups. Group 1 subjects were assigned to use Test Dentifrice (with S. calva root extract), while Group 2, Group 3, and Group 4 subjects were assigned to use Herbal Dentifrice (Arodent(™)), Synthetic Dentifrice (Colgate(®)), and Control Dentifrice respectively. Salivary amylase activity was determined by Bernfeld method in each group, before and after using the given dentifrices. Maximum inhibition of salivary amylase activity was found in the group using test dentifrice as compared to others. The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations.

  8. Cloning, Purification and Characterization of a Highly Thermostable Amylase Gene of Thermotoga petrophila into Escherichia coli.

    PubMed

    Zafar, Asma; Aftab, Muhammad Nauman; ud Din, Zia; Aftab, Saima; Iqbal, Irfana; ul Haq, Ikram

    2016-02-01

    A putative α-amylase gene of Thermotoga petrophila was cloned and expressed in Escherichia coli BL21 (DE3) using pET-21a (+), as an expression vector. The growth conditions were optimized for maximal expression of the α-amylase using various parameters, such as pH, temperature, time of induction and addition of an inducer. The optimum temperature and pH for the maximum expression of α-amylase were 22 °C and 7.0 pH units, respectively. Purification of the recombinant enzyme was carried out by heat treatment method, followed by ion exchange chromatography with 34.6-fold purification having specific activity of 126.31 U mg(-1) and a recovery of 56.25%. Molecular weight of the purified α-amylase, 70 kDa, was determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 100 °C temperature and at pH of 7.0. The enzyme activity was increased in the presence of metal ions especially Ca(+2) and decreased in the presence of EDTA indicating that the α-amylase was a metalloenzyme. However, addition of 1% Tween 20, Tween 80 and β-mercaptoethanol constrained the enzyme activity to 87, 96 and 89%, respectively. No considerable effect of organic solvents (ethanol, methanol, isopropanol, acetone and n-butanol) was observed on enzyme activity. With soluble starch as a substrate, the enzyme activity under optimized conditions was 73.8 U mg(-1). The α-amylase enzyme was active to hydrolyse starch forming maltose.

  9. Genetic regulation of tissue-specific expression of amylase structural genes in Drosophila melanogaster.

    PubMed Central

    Abraham, I; Doane, W W

    1978-01-01

    Laboratory strains of Drosophila melanogaster were screened for spatial variations in adult midgut alpha-amylase (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1) expression. No strain-specific differences were found anteriorly, but three patterns of activity were discerned in the posterior midgut: A, activity throughout most of the region; B, activity in the anterior part of the region; and C, little or no activity. Alleles of a control gene, map, are responsible for this tissue-specific regulation of activity; e.g., mapA homozygotes produce the A pattern and mapC homozygotes the C pattern. The map locus was placed at 2--80 +/- on the genetic map of chromosome 2R, about two crossover units distal to the Amy structural gene region for alpha-amylase. Electrophoretic studies showed that mapA is trans acting in mapA/mapC flies, allowing expression of amylase isozymes coded for by genes on the opposite chromosome. The map gene behaves as a temporal gene that is clearly separable from the tightly linked, duplicated Amy structural genes. Images PMID:100784

  10. Development of an amylolytic Lactobacillus plantarum silage strain expressing the Lactobacillus amylovorus alpha-amylase gene.

    PubMed Central

    Fitzsimons, A; Hols, P; Jore, J; Leer, R J; O'Connell, M; Delcour, J

    1994-01-01

    An amylolytic Lactobacillus plantarum silage strain with the starch-degrading ability displayed by Lactobacillus amylovorus was developed. An active fragment of the gene coding for alpha-amylase production in L. amylovorus was cloned and integrated into the chromosome of the competitive inoculant strain L. plantarum Lp80 at the cbh locus. The alpha-amylase gene fragment was also introduced into L. plantarum Lp80 on an autoreplicative plasmid. Both constructions were also performed in the laboratory strain L. plantarum NCIB8826. All four recombinant strains secreted levels of amylase ranging from 23 to 69 U/liter, compared with 47 U/liter for L. amylovorus. Secretion levels were higher in L. plantarum NCIB8826 than in L. plantarum Lp80 derivatives and were higher in recombinant strains containing autoreplicative plasmids than in the corresponding integrants. The L. plantarum Lp80 derivative containing the L. amylovorus alpha-amylase gene fragment integrated into the host chromosome secreted alpha-amylase to a level comparable to that of L. amylovorus and was stable over 50 generations of growth under nonselective conditions. It grew to a higher cell density than either the parent strain or L. amylovorus in MRS medium containing a mixture of starch and glucose as the fermentable carbohydrate source. This recombinant alpha-amylolytic L. plantarum strain would therefore seem to have considerable potential as a silage inoculant for crops such as alfalfa, in which water-soluble carbohydrate levels are frequently low but starch is present as an alternative carbohydrate source. Images PMID:7986030

  11. Cell-associated alpha-amylases of butyrate-producing Firmicute bacteria from the human colon.

    PubMed

    Ramsay, Alan G; Scott, Karen P; Martin, Jenny C; Rincon, Marco T; Flint, Harry J

    2006-11-01

    Selected butyrate-producing bacteria from the human colon that are related to Roseburia spp. and Butyrivibrio fibrisolvens showed a good ability to utilize a variety of starches for growth when compared with the Gram-negative amylolytic anaerobe Bacteroides thetaiotaomicron. A major cell-associated amylase of high molecular mass (140-210 kDa) was detected in each strain by SDS-PAGE zymogram analysis, and genes corresponding to these enzymes were analysed for two representative strains. Amy13B from But. fibrisolvens 16/4 is a multi-domain enzyme of 144.6 kDa that includes a family 13 glycoside hydrolase domain, and duplicated family 26 carbohydrate-binding modules. Amy13A (182.4 kDa), from Roseburia inulinivorans A2-194, also includes a family 13 domain, which is preceded by two repeat units of approximately 116 aa rich in aromatic residues, an isoamylase N-terminal domain, a pullulanase-associated domain, and an additional unidentified domain. Both Amy13A and Amy13B have N-terminal signal peptides and C-terminal cell-wall sorting signals, including a modified LPXTG motif similar to that involved in interactions with the cell surface in other Gram-positive bacteria, a hydrophobic transmembrane segment, and a basic C terminus. The overexpressed family 13 domains showed an absolute requirement for Mg2+ or Ca2+ for activity, and functioned as 1,4-alpha-glucanohydrolases (alpha-amylases; EC 3.2.1.1). These major starch-degrading enzymes thus appear to be anchored to the cell wall in this important group of human gut bacteria.

  12. Disruption of amylase genes by RNA interference affects reproduction in the Pacific oyster Crassostrea gigas.

    PubMed

    Huvet, Arnaud; Béguel, Jean-Philippe; Cavaleiro, Nathalia Pereira; Thomas, Yoann; Quillien, Virgile; Boudry, Pierre; Alunno-Bruscia, Marianne; Fabioux, Caroline

    2015-06-01

    Feeding strategies and digestive capacities can have important implications for variation in energetic pathways associated with ecological and economically important traits, such as growth or reproduction in bivalve species. Here, we investigated the role of amylase in the digestive processes of Crassostrea gigas, using in vivo RNA interference. This approach also allowed us to investigate the relationship between energy intake by feeding and gametogenesis in oysters. Double-stranded (ds)RNA designed to target the two α-amylase genes A and B was injected in vivo into the visceral mass of oysters at two doses. These treatments caused significant reductions in mean mRNA levels of the amylase genes: -50.7% and -59% mRNA A, and -71.9% and -70.6% mRNA B in 15 and 75 µg dsRNA-injected oysters, respectively, relative to controls. Interestingly, reproductive knock-down phenotypes were observed for both sexes at 48 days post-injection, with a significant reduction of the gonad area (-22.5% relative to controls) and germ cell under-proliferation revealed by histology. In response to the higher dose of dsRNA, we also observed reductions in amylase activity (-53%) and absorption efficiency (-5%). Based on these data, dynamic energy budget modeling showed that the limitation of energy intake by feeding that was induced by injection of amylase dsRNA was insufficient to affect gonadic development at the level observed in the present study. This finding suggests that other driving mechanisms, such as endogenous hormonal modulation, might significantly change energy allocation to reproduction, and increase the maintenance rate in oysters in response to dsRNA injection. © 2015. Published by The Company of Biologists Ltd.

  13. HPLC method for measurement of human salivary α-amylase inhibition by aqueous plant extracts.

    PubMed

    Takács, István; Takács, Ákos; Pósa, Anikó; Gyémánt, Gyöngyi

    2017-06-01

    Control of hyperglycemia is an important treatment in metabolic disorders such as type II diabetes and obesity. α-Amylase, as the first enzyme of glucose release from dietary polysaccharides, is a potential target to identify new sources of novel anti-obesity and anti-diabetic drugs. In this work, different herbal extracts as α-amylase inhibitors were studied by measuring the rate of the cleavage of a maltooligomer substrate 2-chloro-4-nitrophenyl-β-D-maltoheptoside. Measurement of chromophore containing products after reversed phase HPLC separation was used for α-amylase activity measurement. Rates of hydrolysis catalysed by human salivary α-amylase were determined in the presence and absence of lyophilised water extracts of eleven herbs. Remarkable bioactivities were found for extracts of Cinnamomum zeylanicum Blume (bark), Camellia sinensis L. (leaf), Ribes nigrum L. (leaf), Laurus nobilis L. (leaf), Vaccinium macrocarpon Aiton (fruit) and Syzygium aromaticum L. (bud). Determined IC50 values were in 0.017-41 μg/ml range for these six selected plant extracts. Our results confirm the applicability of this HPLC-based method for the quick and reliable comparison of plants as α-amylase inhibitors.

  14. Cloning and Expression Analysis of the Bombyx mori α-amylase Gene (Amy) from the Indigenous Thai Silkworm Strain, Nanglai

    PubMed Central

    Ngernyuang, Nipaporn; Kobayashi, Isao; Promboon, Amornrat; Ratanapo, Sunanta; Tamura, Toshiki; Ngernsiri, Lertluk

    2011-01-01

    α-Amylase is a common enzyme for hydrolyzing starch. In the silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), α-amylase is found in both digestive fluid and hemolymph. Here, the complete genomic sequence of the Amy gene encoding α-amylase from a local Thai silkworm, the Nanglai strain, was obtained. This gene was 7981 bp long with 9 exons. The full length Amy cDNA sequence was 1749 bp containing a 1503 bp open reading frame. The ORF encoded 500 amino acid residues. The deduced protein showed 81–54% identity to other insect α-amylases and more than 50% identity to mammalian enzymes. Southern blot analysis revealed that in the Nanglai strain Amy is a single-copy gene. RT- PCR showed that Amy was transcribed only in the foregut. Transgenic B. mori also showed that the Amy promoter activates expression of the transgene only in the foregut. PMID:21529256

  15. Potent human α-amylase inhibition by the β-defensin-like protein helianthamide

    DOE PAGES

    Tysoe, Christina; Williams, Leslie K.; Keyzers, Robert; ...

    2016-02-26

    Here, selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif.more » Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides.« less

  16. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide.

    PubMed

    Tysoe, Christina; Williams, Leslie K; Keyzers, Robert; Nguyen, Nham T; Tarling, Chris; Wicki, Jacqueline; Goddard-Borger, Ethan D; Aguda, Adeleke H; Perry, Suzanne; Foster, Leonard J; Andersen, Raymond J; Brayer, Gary D; Withers, Stephen G

    2016-03-23

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides.

  17. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide

    PubMed Central

    2016-01-01

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides. PMID:27066537

  18. Investigating the Hydrolysis of Starch Using "a"-Amylase Contained in Dishwashing Detergent and Human Saliva

    ERIC Educational Resources Information Center

    Munegumi, Toratane; Inutsuka, Masato; Hayafuji, Yukitaka

    2016-01-01

    Although saliva has commonly been used to teach about digestion by organisms, the phenomenon of digestion is actually caused by enzymes as catalytic substances. This activity explores the hydrolysis of starch by "a"-amylase in cleaning materials as well as a comparison with the similar reaction using human saliva. The fact that the…

  19. Investigating the Hydrolysis of Starch Using "a"-Amylase Contained in Dishwashing Detergent and Human Saliva

    ERIC Educational Resources Information Center

    Munegumi, Toratane; Inutsuka, Masato; Hayafuji, Yukitaka

    2016-01-01

    Although saliva has commonly been used to teach about digestion by organisms, the phenomenon of digestion is actually caused by enzymes as catalytic substances. This activity explores the hydrolysis of starch by "a"-amylase in cleaning materials as well as a comparison with the similar reaction using human saliva. The fact that the…

  20. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  1. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  2. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  3. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  4. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  5. Characterization, expression in Streptomyces lividans, and processing of the amylase of Streptomyces griseus IMRU 3570: two different amylases are derived from the same gene by an intracellular processing mechanism.

    PubMed Central

    Garcia-Gonzalez, M D; Martin, J F; Vigal, T; Liras, P

    1991-01-01

    Extracellular amylase in Streptomyces lividans was undetectable in starch-supplemented medium. However, S. lividans produced fivefold-higher levels of amylase than Streptomyces griseus IMRU 3570 when transformed with the S. griseus amy gene. Two major proteins of 57 and 50 kDa with amylase activity accumulated in the culture broths of the donor S. griseus and S. lividans transformed with the amy gene. Both proteins were also present in protoplast lysates in the same relative proportion; they gave a positive reaction with antibodies against the 57-kDa amylase. They did not differ in substrate specificity or enzyme kinetics. The two amylases were purified to homogeneity by a two-step procedure. Both proteins showed the same amino-terminal sequence of amino acids, suggesting that both proteins are derived from the same gene. The deduced signal peptide has 28 amino acids with two positively charged arginines near the amino-terminal end. When an internal NcoI fragment was removed from the amy gene, the resulting S. lividans transformants did not synthesize any of the two amylase proteins and showed no reaction in immunoblotting. Formation of the 50-kDa protein was observed when pure 57-kDa amylase was treated with supernatants of protoplast lysates but not when it was treated with membrane preparations, indicating that the native 57-kDa amylase could be processed intracellularly. Images PMID:1707411

  6. Cloning and nucleotide sequence of the gene coding for enzymatically active fragments of the Bacillus polymyxa beta-amylase.

    PubMed Central

    Kawazu, T; Nakanishi, Y; Uozumi, N; Sasaki, T; Yamagata, H; Tsukagoshi, N; Udaka, S

    1987-01-01

    The gene encoding beta-amylase was cloned from Bacillus polymyxa 72 into Escherichia coli HB101 by inserting HindIII-generated DNA fragments into the HindIII site of pBR322. The 4.8-kilobase insert was shown to direct the synthesis of beta-amylase. A 1.8-kilobase AccI-AccI fragment of the donor strain DNA was sufficient for the beta-amylase synthesis. Homologous DNA was found by Southern blot analysis to be present only in B. polymyxa 72 and not in other bacteria such as E. coli or B. subtilis. B. polymyxa, as well as E. coli harboring the cloned DNA, was found to produce enzymatically active fragments of beta-amylases (70,000, 56,000, or 58,000, and 42,000 daltons), which were detected in situ by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Nucleotide sequence analysis of the cloned 3.1-kilobase DNA revealed that it contains one open reading frame of 2,808 nucleotides without a translational stop codon. The deduced amino acid sequence for these 2,808 nucleotides encoding a secretory precursor of the beta-amylase protein is 936 amino acids including a signal peptide of 33 or 35 residues at its amino-terminal end. The existence of a beta-amylase of larger than 100,000 daltons, which was predicted on the basis of the results of nucleotide sequence analysis of the gene, was confirmed by examining culture supernatants after various cultivation periods. It existed only transiently during cultivation, but the multiform beta-amylases described above existed for a long time. The large beta-amylase (approximately 160,000 daltons) existed for longer in the presence of a protease inhibitor such as chymostatin, suggesting that proteolytic cleavage is the cause of the formation of multiform beta-amylases. Images PMID:2435707

  7. Cloning and nucleotide sequence of the gene coding for enzymatically active fragments of the Bacillus polymyxa beta-amylase.

    PubMed

    Kawazu, T; Nakanishi, Y; Uozumi, N; Sasaki, T; Yamagata, H; Tsukagoshi, N; Udaka, S

    1987-04-01

    The gene encoding beta-amylase was cloned from Bacillus polymyxa 72 into Escherichia coli HB101 by inserting HindIII-generated DNA fragments into the HindIII site of pBR322. The 4.8-kilobase insert was shown to direct the synthesis of beta-amylase. A 1.8-kilobase AccI-AccI fragment of the donor strain DNA was sufficient for the beta-amylase synthesis. Homologous DNA was found by Southern blot analysis to be present only in B. polymyxa 72 and not in other bacteria such as E. coli or B. subtilis. B. polymyxa, as well as E. coli harboring the cloned DNA, was found to produce enzymatically active fragments of beta-amylases (70,000, 56,000, or 58,000, and 42,000 daltons), which were detected in situ by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Nucleotide sequence analysis of the cloned 3.1-kilobase DNA revealed that it contains one open reading frame of 2,808 nucleotides without a translational stop codon. The deduced amino acid sequence for these 2,808 nucleotides encoding a secretory precursor of the beta-amylase protein is 936 amino acids including a signal peptide of 33 or 35 residues at its amino-terminal end. The existence of a beta-amylase of larger than 100,000 daltons, which was predicted on the basis of the results of nucleotide sequence analysis of the gene, was confirmed by examining culture supernatants after various cultivation periods. It existed only transiently during cultivation, but the multiform beta-amylases described above existed for a long time. The large beta-amylase (approximately 160,000 daltons) existed for longer in the presence of a protease inhibitor such as chymostatin, suggesting that proteolytic cleavage is the cause of the formation of multiform beta-amylases.

  8. Evolutionary studies on an alpha-amylase gene segment in bats and other mammals.

    PubMed

    Redondo, Rodrigo A F; Santos, Fabrício R

    2006-01-01

    Comparative studies of salivary glands showed that they maybe related to the adaptive radiation of bats, especially in the family Phylostomidae. In this study we have been searching for a likely relationship between different feeding habits found in bats and possible adaptive changes in a coding segment of the alpha-amylase enzyme. We have also tested some hypothesis about the phylogenetic relationship of bats and other mammals. A 663 bp segment of the alpha-amylase gene, corresponding to the exon 4 and part of the intron c, was sequenced in nine bat species. The exon 4 was also sequenced in further ten mammalian species. The phylogenetic trees generated with different methods produced the same results. When the intron c and the exon 4 were independently analyzed, they showed distinct topologies involving the bat species Sturnira lilium, different from the traditional bat phylogeny. Phylogenetic analysis of bats, primates and rodents supports the Euarchontoglires-Laurasiatheria hypothesis about the relationship among these groups. Selection tests showed that the alpha-amylase exon 4 is under strong purifying selection, probably caused by functional constraints. The conflicting bat phylogenies could not be explained by evolutionary convergence due to adaptive forces, and the different topologies may be likely due to the retention of plesiomorphic characters or the independent acquisition by evolutionary parallelism.

  9. Efficient synthesis and secretion of a thermophilic alpha-amylase by protein-producing Bacillus brevis 47 carrying the Bacillus stearothermophilus amylase gene.

    PubMed Central

    Tsukagoshi, N; Iritani, S; Sasaki, T; Takemura, T; Ihara, H; Idota, Y; Yamagata, H; Udaka, S

    1985-01-01

    Bacillus subtilis and Bacillus brevis 47-5, carrying the Bacillus stearothermophilus alpha-amylase gene on pUB110 (pBAM101), synthesized the same alpha-amylase as the donor strain as determined by the enzyme's thermal stability and NH2-terminal amino acid sequence. Regardless of the host, the 34-amino acid signal peptide of the enzyme was processed at exactly the same site between two alanine residues. B. brevis 47-5(pBAM101) secreted the enzyme most efficiently of the hosts examined, 100, 15, and 5 times more than B. stearothermophilus, Escherichia coli HB101(pH1301), and B. subtilis 1A289(pBAM101), respectively. The efficient secretion of the enzyme in B. brevis 47-5(pBAM101) was suggested to be due to the unique properties of the cell wall of this organism. Images PMID:2999073

  10. Interaction mechanism between green tea extract and human α-amylase for reducing starch digestion.

    PubMed

    Miao, Ming; Jiang, Bo; Jiang, Huan; Zhang, Tao; Li, Xingfeng

    2015-11-01

    This study evaluated the inhibitory effects of the green tea extract on human pancreatic α-amylase activity and its molecular mechanism. The green tea extract was composed of epicatechin (59.2%), epigallocatechin gallate (14.6%) and epicatechin gallate (26.2%) as determined by HPLC analysis. Enzyme activity measurement showed that % inhibition and IC50 of the green tea extract (10%, based on starch) were 63.5% and 2.07 mg/ml, respectively. The Michaelis-Menten constant remained unchanged but the maximal velocity decreased from 0.43 (control) to 0.07 mg/(ml × min) (4 mg/ml of the green tea extract), indicating that the green tea extract was an effective inhibitor against α-amylase with a non-competitive mode. The fluorescence data revealed that the green tea extract bound with α-amylase to form a new complex with static quenching mechanism. Docking study showed the epicatechin gallate in the green tea extract presented stronger affinity than epigallocatechin gallate, with more number of amino acid residues involved in amylase binding with hydrogen bonds and Van der Waals forces. Thus, the green tea extract could be used to manipulate starch digestion for potential health benefits.

  11. Crystal structures of human pancreatic alpha-amylase in complex with carbohydrate and proteinaceous inhibitors.

    PubMed Central

    Nahoum, V; Roux, G; Anton, V; Rougé, P; Puigserver, A; Bischoff, H; Henrissat, B; Payan, F

    2000-01-01

    Crystal structures of human pancreatic alpha-amylase (HPA) in complex with naturally occurring inhibitors have been solved. The tetrasaccharide acarbose and a pseudo-pentasaccharide of the trestatin family produced identical continuous electron densities corresponding to a pentasaccharide species, spanning the -3 to +2 subsites of the enzyme, presumably resulting from transglycosylation. Binding of the acarviosine core linked to a glucose residue at subsites -1 to +2 appears to be a critical part of the interaction process between alpha-amylases and trestatin-derived inhibitors. Two crystal forms, obtained at different values of pH, for the complex of HPA with the protein inhibitor from Phaseolus vulgaris (alpha-amylase inhibitor) have been solved. The flexible loop typical of the mammalian alpha-amylases was shown to exist in two different conformations, suggesting that loop closure is pH-sensitive. Structural information is provided for the important inhibitor residue, Arg-74, which has not been observed previously in structural analyses. PMID:10657258

  12. Metabolism of glycosylated human salivary amylase: in vivo plasma clearance by rat hepatic endothelial cells and in vitro receptor mediated pinocytosis by rat macrophages

    SciTech Connect

    Niesen, T.E.; Alpers, D.H.; Stahl, P.D.; Rosenblum, J.L.

    1984-09-01

    Salivary-type amylase normally comprises about 60% of the amylase activity in human serum, but only a small fraction is a glycosylated isoenzyme (amylase A). In contrast, 1/3 of amylase in human saliva is glycosylated. Since glycosylation can affect circulatory clearance, we studied the clearance of amylase A in rats and its uptake by rat alveolar macrophages. Following intravenous injection, /sup 125/I-labeled amylase A disappeared rapidly from plasma (t 1/2 . 9 min) and accumulated in the liver. Simultaneous injection of mannose-albumin slowed its clearance to a rate comparable to that of /sup 125/I-labeled nonglycosylated salivary amylase (t 1/2 . 45 min). In contrast, galactose-albumin had no effect. Electron microscope autoradiography of the liver following injection of /sup 125/I-labeled amylase A revealed a localization of grains over the hepatic endothelial cells. In vitro studies indicated that amylase A is taken up by alveolar macrophages via receptor-mediated pinocytosis. Uptake was linear over time, saturable, and inhibited by mannan and mannose-albumin, but not by galactose-albumin. We conclude that amylase A, which is a naturally occurring human glycoprotein with at most three terminal L-fucose residues per molecule, is recognized in rats by a mannose receptor located on hepatic endothelial cells. We speculate that this receptor, by rapidly clearing circulating amylase A, may be responsible for the low level of amylase A in human serum.

  13. The Interaction of Genetic and Environmental Factors in the Control of Amylase Gene Expression in DROSOPHILA MELANOGASTER

    PubMed Central

    Benkel, Bernhard F.; Hickey, Donal A.

    1986-01-01

    A number of previous studies have established that amylase activity can vary between Drosophila strains which are maintained under identical laboratory conditions. In addition, we have recently shown that all strains examined so far are subject to glucose repression of amylase activity. In this study, we show that the degree of glucose repression can vary between strains. Moreover, the glucose repression effect is much more pronounced in larvae than in adult flies. Our results lead to the conclusion that the strain-specific differences in activity and the dietary effects are not independent phenomena. These results have implications for the interpretation of many studies on amylase activity variation, including those experiments which have been designed to link amylase activity variations with fitness differences in nature. A question that naturally arises concerns the molecular basis for these strain-specific variations in the degree of glucose repression of this eukaryotic gene. PMID:17246356

  14. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86

    PubMed Central

    2011-01-01

    Background Wheat grains accumulate a variety of low molecular weight proteins that are inhibitors of alpha-amylases and proteases and play an important protective role in the grain. These proteins have more balanced amino acid compositions than the major wheat gluten proteins and contribute important reserves for both seedling growth and human nutrition. The alpha-amylase/protease inhibitors also are of interest because they cause IgE-mediated occupational and food allergies and thereby impact human health. Results The complement of genes encoding alpha-amylase/protease inhibitors expressed in the US bread wheat Butte 86 was characterized by analysis of expressed sequence tags (ESTs). Coding sequences for 19 distinct proteins were identified. These included two monomeric (WMAI), four dimeric (WDAI), and six tetrameric (WTAI) inhibitors of exogenous alpha-amylases, two inhibitors of endogenous alpha-amylases (WASI), four putative trypsin inhibitors (CMx and WTI), and one putative chymotrypsin inhibitor (WCI). A number of the encoded proteins were identical or very similar to proteins in the NCBI database. Sequences not reported previously included variants of WTAI-CM3, three CMx inhibitors and WTI. Within the WDAI group, two different genes encoded the same mature protein. Based on numbers of ESTs, transcripts for WTAI-CM3 Bu-1, WMAI Bu-1 and WTAI-CM16 Bu-1 were most abundant in Butte 86 developing grain. Coding sequences for 16 of the inhibitors were unequivocally associated with specific proteins identified by tandem mass spectrometry (MS/MS) in a previous proteomic analysis of milled white flour from Butte 86. Proteins corresponding to WDAI Bu-1/Bu-2, WMAI Bu-1 and the WTAI subunits CM2 Bu-1, CM3 Bu-1 and CM16 Bu-1 were accumulated to the highest levels in flour. Conclusions Information on the spectrum of alpha-amylase/protease inhibitor genes and proteins expressed in a single wheat cultivar is central to understanding the importance of these proteins in both

  15. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86.

    PubMed

    Altenbach, Susan B; Vensel, William H; Dupont, Frances M

    2011-07-20

    Wheat grains accumulate a variety of low molecular weight proteins that are inhibitors of alpha-amylases and proteases and play an important protective role in the grain. These proteins have more balanced amino acid compositions than the major wheat gluten proteins and contribute important reserves for both seedling growth and human nutrition. The alpha-amylase/protease inhibitors also are of interest because they cause IgE-mediated occupational and food allergies and thereby impact human health. The complement of genes encoding alpha-amylase/protease inhibitors expressed in the US bread wheat Butte 86 was characterized by analysis of expressed sequence tags (ESTs). Coding sequences for 19 distinct proteins were identified. These included two monomeric (WMAI), four dimeric (WDAI), and six tetrameric (WTAI) inhibitors of exogenous alpha-amylases, two inhibitors of endogenous alpha-amylases (WASI), four putative trypsin inhibitors (CMx and WTI), and one putative chymotrypsin inhibitor (WCI). A number of the encoded proteins were identical or very similar to proteins in the NCBI database. Sequences not reported previously included variants of WTAI-CM3, three CMx inhibitors and WTI. Within the WDAI group, two different genes encoded the same mature protein. Based on numbers of ESTs, transcripts for WTAI-CM3 Bu-1, WMAI Bu-1 and WTAI-CM16 Bu-1 were most abundant in Butte 86 developing grain. Coding sequences for 16 of the inhibitors were unequivocally associated with specific proteins identified by tandem mass spectrometry (MS/MS) in a previous proteomic analysis of milled white flour from Butte 86. Proteins corresponding to WDAI Bu-1/Bu-2, WMAI Bu-1 and the WTAI subunits CM2 Bu-1, CM3 Bu-1 and CM16 Bu-1 were accumulated to the highest levels in flour. Information on the spectrum of alpha-amylase/protease inhibitor genes and proteins expressed in a single wheat cultivar is central to understanding the importance of these proteins in both plant defense mechanisms and

  16. Cloning, enhanced expression and characterization of an α-amylase gene from a wild strain in B. subtilis WB800.

    PubMed

    Chen, Jing; Chen, Xianghua; Dai, Jun; Xie, Guangrong; Yan, Luying; Lu, Lina; Chen, Jianhua

    2015-09-01

    A Bacillus strain with high productivity of α-amylase isolated from a starch farm was identified as Bacillus amyloliquefaciens. The α-amylase encoding gene amy1 was cloned into pMD18-T vector and amplified in E. coli DH5α. Shuttle vector pP43MNX was reconstructed to obtain vector pP43X for heterologous expression of the α-amylase in B. subtilis WB800. Recombinant enzyme was sufficiently purified by precipitation, gel filtration and anion exchange with a specific activity of 5566 U/mg. The α-amylase sequence contains an open reading frame of 1545 bp, which encodes a protein of 514 amino acid residues with a predicted molecular mass of 58.4 kDa. The enzyme exhibited maximal activity at pH 6.0 and 60 °C. Catalytic efficiency of the recombinant α-amylase was inhibited by Hg(2+), Pb(2+) and Cu(2+), but stimulated by Li(+), Mn(2+) and Ca(2+). The purified enzyme showed decreased activity toward detergents (SDS, Tween 20 and Triton X-100). Compared with production by the wild strain, there was a 1.48-fold increase in the productivity of α-amylase in recombinant B. subtilis WB800.

  17. α-Amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits α-amylases from the coffee berry borer pest

    PubMed Central

    2010-01-01

    Background Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei), is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an α-amylase inhibitor gene (α-AI1), which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. Results We transformed C. arabica with the α-amylase inhibitor-1 gene (α-AI1) from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L). The presence of the α-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against α-AI1 inhibitor showed a maximum α-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the α-AI1 protein against H. hampei α-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. Conclusions This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee. PMID:20565807

  18. Alpha-amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits alpha-amylases from the coffee berry borer pest.

    PubMed

    Barbosa, Aulus E A D; Albuquerque, Erika V S; Silva, Maria C M; Souza, Djair S L; Oliveira-Neto, Osmundo B; Valencia, Arnubio; Rocha, Thales L; Grossi-de-Sa, Maria F

    2010-06-17

    Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei), is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an alpha-amylase inhibitor gene (alpha-AI1), which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. We transformed C. arabica with the alpha-amylase inhibitor-1 gene (alpha-AI1) from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L). The presence of the alpha-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against alpha-AI1 inhibitor showed a maximum alpha-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the alpha-AI1 protein against H. hampei alpha-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee.

  19. Simultaneous expression of salivary and pancreatic amylase genes in cultured mouse hepatoma cells.

    PubMed Central

    Darlington, G J; Tsai, C C; Samuelson, L C; Gumucio, D L; Meisler, M H

    1986-01-01

    The tissue-specific expression of two types of mouse amylase genes does not overlap in vivo; the Amy-1 locus is transcribed in the parotid gland and the liver, while expression of Amy-2 is limited to the pancreas. We identified a mouse hepatoma cell line, Hepa 1-6, in which both amylase genes can be simultaneously expressed. Amy-1 is constitutively active in these cells and is inducible by dexamethasone at the level of mRNA. We demonstrated that the liver-specific promoter of Amy-1 is utilized by the dexamethasone-treated hepatoma cells, and that glucocorticoid consensus sequences are present upstream of this promoter. Amy-2 is not detectable constitutively, but can be activated if the cells are cultured in serum-free medium containing dexamethasone. Expression of Amy-2 in a nonpancreatic cell type has not previously been observed. We speculate that induction of Amy-1 and activation of Amy-2 may involve different regulatory mechanisms. Hepa 1-6 cells provide an experimental system for molecular analysis of these events. Images PMID:2431276

  20. Amylase - urine

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003607.htm Amylase - urine To use the sharing features on this ... is a test that measures the amount of amylase in urine. Amylase is an enzyme that helps ...

  1. Synthesis and processing in Escherichia coli of human leucocyte interferon fused with the signal sequence of Bacillus amyloliquefaciens a-amylase

    SciTech Connect

    Sorokin, A.V.; Avakov, A.S.; Bogush, V.G.; Kostrov, S.V.; Gaiga, G.Z.; Iomantas, Yu.V.; Abalakina, E.G.; Stepanov, A.I.; Strongin, A.Ya.; Kozlov, Yu.I.; Debabov, V.G.

    1985-11-01

    Earlier, the authors reported cloning of the alpha-amylase gene of B. amyloliquefaciens in B. subtilis and E. coli. Currently, the authors report results on the expression of the hybrid gene consisting of the DNA fragment coding for the leader part of B. amyloliquefaciens alpha-amylase and the structural part of the human interferon alpha-2 in E. coli cells. This gene contains an additional methionine codon at the 5'-terminal, which codes for the interferon structure (without its own signal peptide). The interferon gene was inserted into plasmid /sub p/TG 278 at the cleavage site of EcoRI. The structure of the plasmid thus obtained the signal peptide of amylase, five amino acids (Val-Gly-Glu-Phe-Met), and the structural part of the interferon. The E. coli C600 cells carrying plasmid pTGA6 were used to study interferon secretions. The interferon activity was determined radioimmunologically with the use of monoclonal anti-bodies NK2.

  2. Identification of RAPD Markers Linked to Digestive Amylase Genes using Near Isogenic Lines of the Silkworm, Bombyx mori

    PubMed Central

    Ashwath, S.K.; Sreekumar, S.; Toms, J.T.; Dandin, S.B.; Kamble, C.K.

    2010-01-01

    Digestive amylase has been identified as a useful marker for breeding in the silkwrom, Bombyx mori L (Lepidoptera: Bombycidae), due to its wide genetic divergence, its role in better digestibility and robustness. The low yielding indigenous B. mori breeds of tropics like India are characterized by high activity amylase genes controlled by Amy div or dv alleles, while the high yielding breeds of temperate origin are endowed with ‘null’ type (Amy dn) with low activity. For improving the digestibility and survival of temperate breeds of Japanese origin, Near Isogenic Lines (NILs) were developed introgressing the Amy div and dv alleles from the Donor Parents (DPs) into the genetic background of the Recurrent Parents (RPs) with ‘null’ type of amylase, which showed significant improvement in viability of the NILs. With the objective to know whether the amylase gene itself may confer higher survival by improving digestibility or some other closely linked genes flanking the amylase locus is responsible for better viability of the NILs, RAPD profiles among six B. mori breeds comprising of the DPs, RPs, and NILs developed through introgression of Amy div or dv alleles were analysed using 27 sets of RAPD primers. Out of the 27 primers, six (OPA01, OPA06, OPA09, OPA15, OPAH03, and OPAH05) showed RAPD products linked to the amylase genes of the DPs introgressed in the NILs, which were absent in their respective RPs. Three amplicons of 1584 bp, 1904 bp, and 1232 bp were specific to Amy div allele and one amplified product of 1776 bp was found to be linked with the Amy dv allele. Interestingly, two PCR products of 2628 and 1375 bp were associated with both Amy div and dv alleles. The results are discussed in light of further characterization of these amplified products leading to identification of DNA sequences that may be responsible for better digestibility and higher survival in B. mori. PMID:20673069

  3. Evaluation of Traditional Indian Antidiabetic Medicinal Plants for Human Pancreatic Amylase Inhibitory Effect In Vitro

    PubMed Central

    Ponnusamy, Sudha; Ravindran, Remya; Zinjarde, Smita; Bhargava, Shobha; Ravi Kumar, Ameeta

    2011-01-01

    Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post prandial hyperglycemia via control of starch breakdown. Eleven Ayurvedic Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evaluate their inhibitory potential on pancreatic α-amylase. Analysis of 91 extracts, showed that 10 exhibited strong Human Pancreatic Amylase (HPA) inhibitory potential. Of these, 6 extracts showed concentration dependent inhibition with IC50 values, namely, cold and hot water extracts from Ficus bengalensis bark (4.4 and 125 μgmL−1), Syzygium cumini seeds (42.1 and 4.1 μgmL−1), isopropanol extracts of Cinnamomum verum leaves (1.0 μgmL−1) and Curcuma longa rhizome (0.16 μgmL−1). The other 4 extracts exhibited concentration independent inhibition, namely, methanol extract of Bixa orellana leaves (49 μgmL−1), isopropanol extract from Murraya koenigii leaves (127 μgmL−1), acetone extracts from C. longa rhizome (7.4 μgmL−1) and Tribulus terrestris seeds (511 μgmL−1). Thus, the probable mechanism of action of the above fractions is due to their inhibitory action on HPA, thereby reducing the rate of starch hydrolysis leading to lowered glucose levels. Phytochemical analysis revealed the presence of alkaloids, proteins, tannins, cardiac glycosides, flavonoids, saponins and steroids as probable inhibitory compounds. PMID:20953430

  4. Improved α-amylase production by Aspergillus oryzae after a double deletion of genes involved in carbon catabolite repression.

    PubMed

    Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2014-01-01

    In filamentous fungi, the expression of secretory glycoside hydrolase encoding genes, such as those for amylases, cellulases, and xylanases, is generally repressed in the presence of glucose. CreA and CreB have been observed to be regulating factors for carbon catabolite repression. In this study, we generated single and double deletion creA and/or creB mutants in Aspergillus oryzae. The α-amylase activities of each strain were compared under various culture conditions. For the wild-type strain, mRNA levels of α-amylase were markedly decreased in the later stage of submerged culture under inducing conditions, whereas this reduced expression was not observed for single creA and double creA/creB deletion mutants. In addition, α-amylase activity of the wild-type strain was reduced in submerged culture containing high concentrations of inducing sugars, whereas all constructed mutants showed higher α-amylase activities. In particular, the α-amylase activity of the double deletion mutant in a medium containing 5% starch was >10-fold higher than that of the wild-type strain under the same culture conditions. In solid-state cultures using wheat bran as a substrate, the α-amylase activities of single creA and double deletion mutants were >2-fold higher than that of the wild-type strain. These results suggested that deleting both creA and creB resulted in dramatic improvements in the production of secretory glycoside hydrolases in filamentous fungi.

  5. Codon Optimization Significantly Improves the Expression Level of α -Amylase Gene from Bacillus licheniformis in Pichia pastoris.

    PubMed

    Wang, Jian-Rong; Li, Yang-Yuan; Liu, Dan-Ni; Liu, Jing-Shan; Li, Peng; Chen, Li-Zhi; Xu, Shu-De

    2015-01-01

    α-Amylase as an important industrial enzyme has been widely used in starch processing, detergent, and paper industries. To improve expression efficiency of recombinant α-amylase from Bacillus licheniformis (B. licheniformis), the α-amylase gene from B. licheniformis was optimized according to the codon usage of Pichia pastoris (P. pastoris) and expressed in P. pastoris. Totally, the codons encoding 305 amino acids were optimized in which a total of 328 nucleotides were changed and the G+C content was increased from 47.6 to 49.2%. The recombinants were cultured in 96-deep-well microplates and screened by a new plate assay method. Compared with the wild-type gene, the optimized gene is expressed at a significantly higher level in P. pastoris after methanol induction for 168 h in 5- and 50-L bioreactor with the maximum activity of 8100 and 11000 U/mL, which was 2.31- and 2.62-fold higher than that by wild-type gene. The improved expression level makes the enzyme a good candidate for α-amylase production in industrial use.

  6. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat Butte 86

    USDA-ARS?s Scientific Manuscript database

    The complement of genes encoding alpha-amylase/protease inhibitors expressed in Triticum aestivum cv. Butte 86 was characterized by transcript and proteomic analysis. Coding sequences for 18 distinct proteins were identified among a collection of expressed sequence tags (ESTs) from Butte 86 developi...

  7. Gene cloning and characterization of a thermostable organic-tolerant α-amylase from Bacillus subtilis DR8806.

    PubMed

    Emtenani, Shamsi; Asoodeh, Ahmad; Emtenani, Shirin

    2015-01-01

    The gene encoding an extracellular α-amylase from Bacillus subtilis DR8806 was cloned into pET28a(+) vector and expressed in Escherichia coli BL21 (DE3). The recombinant enzyme with molecular mass of 76 kDa exhibited optimal activity at pH 5.0 and 70 °C with high stability in pH and temperature ranges of 4.0-9.0 and 45-75 °C. The enzyme showed a half-life of 125 min at 70 °C. The α-amylase activity enhanced in the presence of Na(+), K(+), and Ca(2+) ions, while Zn(2+), Pb(2+), and Hg(2+) ions inhibited the activity. The recombinant α-amylase exhibited high stability towards ioninc detergents sodium dodecyl sulfate (SDS) and cetyl trimethylammonium bromide (CTAB). Organic solvents in reaction media increased the α-amylase activity. TLC analysis showed that maltoriose and maltose were the major end products of enzymatic starch hydrolysis. Presenting various properties of recombinant α-amylase makes it well suited as a potential candidate for industrial usages.

  8. Molecular evolution and diversity of dimeric alpha-amylase inhibitor gene in Kengyilia species (Triticeae: Poaceae).

    PubMed

    Zeng, Jian; Fan, Xing; Sha, Li-Na; Kang, Hou-Yang; Wang, Yi; Zhang, Hai-Qin; Zhou, Yong-Hong

    2013-10-25

    Kengyilia Yen et J. L. Yang is a group of allohexaploid species with StYP genomic constitutions in the wheat tribe. To investigate the evolution and diversity of dimeric alpha-amylase inhibitor genes in the Kengyilia, forty-five homoeologous DAAI gene sequences were isolated from sampled Kengyilia species and analyzed together with those of its close relatives. These results suggested that (1) Kengyilia species from Central Asia and the Qinghai-Tibetan Plateau had different origins from those of the geographically differentiated P genome; (2) the St and P genomes of Kengyilia were donated by Pseudoroegneria and Agropyron, respectively, and the Y genome had an independent origin and showed an affinity with the St genome; (3) purifying selection dominated the DAAI gene members and the St-DAAI gene was evolving at faster rate than the P- and Y-DAAI genes in Kengyilia; and (4) natural selection was the main factor on the codon usage pattern of the DAAI gene in Kengyilia.

  9. Ligase-independent cloning of amylase gene from a local Bacillus subtilis isolate and biochemical characterization of the purified enzyme.

    PubMed

    Tuzlakoglu Ozturk, Merve; Akbulut, Nagihan; Issever Ozturk, Saliha; Gumusel, Fusun

    2013-09-01

    Five hundred ninety-seven bacterial isolates from Turkish hot spring water sources were screened for their ability to produce extracellular α-amylase. Among them, a high enzyme-producing Bacillus subtilis isolate, A28, was selected, and its α-amylase gene was cloned and expressed in Escherichia coli by a ligase-independent method. α-Amylase from the recombinant strain was purified to homogeneity by Q-Sepharose anion exchange and Sephacryl S-100 gel filtration chromatographies. The final yield of the enzyme was about 22.5 % of the initial activity, with a 16.4-fold increase in specific activity compared with the culture lysate. The optimum temperature and pH of the enzyme were 70 °C and 6.0, respectively. The enzyme was highly active at acidic-neutral pH range of 4.5-7.0. The amy28 α-amylase retained 100 % of its activity after incubation at 50 °C for 90 min. Co(+2), Cu(2+), Fe(2+), Fe(3+), Ni(+2), and Zn(+2) caused significant inhibition in enzyme activity, which was not affected by Na(+), Mg(2+), Li(+), and Ba(2+). The activity was inhibited about 70 % upon treatment of the enzyme with 10 mM ethylenediaminetetraacetic acid. However, Ca(2+) ions known as high temperature stabilizer for other amylases did not stimulate the activity of the enzyme. Due to pH stability and thermostability of the recombinant amylase, this enzyme may be suitable in starch processing, brewing, and food industries.

  10. Glucosyl epi-cyclophellitol allows mechanism-based inactivation and structural analysis of human pancreatic α-amylase.

    PubMed

    Caner, Sami; Zhang, Xiaohua; Jiang, Jianbing; Chen, Hong-Ming; Nguyen, Nham T; Overkleeft, Hermen; Brayer, Gary D; Withers, Stephen G

    2016-04-01

    As part of a search for selective, mechanism-based covalent inhibitors of human pancreatic α-amylase we describe the chemoenzymatic synthesis of the disaccharide analog α-glucosyl epi-cyclophellitol, demonstrate its stoichiometric reaction with human pancreatic α-amylase and evaluate the time dependence of its inhibition. X-ray crystallographic analysis of the covalent derivative so formed confirms its reaction at the active site with formation of a covalent bond to the catalytic nucleophile D197. The structure illuminates the interactions with the active site and confirms OH4' on the nonreducing end sugar as a good site for attachment of fluorescent tags in generating probes for localization and quantitation of amylase in vivo.

  11. Characterization and gene cloning of a maltotriose-forming exo-amylase from Kitasatospora sp. MK-1785.

    PubMed

    Kamon, Masahiro; Sumitani, Jun-Ichi; Tani, Shuji; Kawaguchi, Takashi; Kamon, M; Sumitani, J; Tani, S; Kawaguchi, T

    2015-06-01

    A maltotriose-forming amylase (G3Amy) from Kitasatospora sp. MK-1785 was successfully isolated from a soil sample by inhibiting typical extracellular α-amylases using a proteinaceous α-amylase inhibitor. G3Amy was purified from the MK-1785 culture supernatant and characterized. G3Amy produced maltotriose as the principal product from starch and was categorized as an exo-α-amylase. G3Amy could also transfer maltotriose to phenolic and alcoholic compounds. Therefore, G3Amy can be useful for not only maltotriose manufacture but also maltooligosaccharide-glycoside synthesis. Further, the G3Amy gene was cloned and expressed in Escherichia coli cells. Analysis of its deduced amino acid sequence revealed that G3Amy consisted of an N-terminal GH13 catalytic domain and two C-terminal repeat starch-binding domains belonging to CBM20. It is suggested that natural G3Amy was subjected to proteolysis at N-terminal region of the anterior CBM20 in the C-terminal region. As with natural G3Amy, recombinant G3Amy could produce and transfer maltotriose from starch.

  12. Amylase Test

    MedlinePlus

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  13. Amylase - blood

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003464.htm Amylase - blood To use the sharing features on this page, please enable JavaScript. Amylase is an enzyme that helps digest carbohydrates. It ...

  14. Stability of human α-salivary amylase in aged forensic samples.

    PubMed

    Carboni, Ilaria; Rapi, Stefano; Ricci, Ugo

    2014-07-01

    The unequivocal tissue identification in forensic casework samples is a key step for crime scene reconstruction. Just knowing the origin of a fluid can sometimes be enough to either prove or disprove a fact in court. Despite the importance of this test, very few data are available in literature concerning human saliva identification in old forensic caseworks. In this work the stability of human α-amylase activity in aged samples is described by using three different methods integrated with DNA profiling techniques. This analytical protocol was successfully applied on 26-years old samples coming from anonymous threat letters sent to prosecutors who were working on "the Monster of Florence", a case of serial murders happened around Florence (Italy) between 1968 and 1985. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  16. Transcription Factor AREB2 Is Involved in Soluble Sugar Accumulation by Activating Sugar Transporter and Amylase Genes.

    PubMed

    Ma, Qi-Jun; Sun, Mei-Hong; Lu, Jing; Liu, Ya-Jing; Hu, Da-Gang; Hao, Yu-Jin

    2017-08-01

    Sugars play important roles in plant growth and development, crop yield and quality, as well as responses to abiotic stresses. Abscisic acid (ABA) is a multifunctional hormone. However, the exact mechanism by which ABA regulates sugar accumulation is largely unknown in plants. Here, we tested the expression profile of several sugar transporter and amylase genes in response to ABA treatment. MdSUT2 and MdAREB2 were isolated and genetically transformed into apple (Malus domestica) to investigate their roles in ABA-induced sugar accumulation. The MdAREB2 transcription factor was found to bind to the promoters of the sugar transporter and amylase genes and activate their expression. Both MdAREB2 and MdSUT2 transgenic plants produced more soluble sugars than controls. Furthermore, MdAREB2 promoted the accumulation of sucrose and soluble sugars in an MdSUT2-dependent manner. Our results demonstrate that the ABA-responsive transcription factor MdAREB2 directly activates the expression of amylase and sugar transporter genes to promote soluble sugar accumulation, suggesting a mechanism by which ABA regulates sugar accumulation in plants. © 2017 American Society of Plant Biologists. All Rights Reserved.

  17. Comparative and evolutionary analysis of α-amylase gene across monocots and dicots.

    PubMed

    Sethi, Sorabh; Saini, Johar S; Mohan, Amita; Brar, Navreet K; Verma, Shabda; Sarao, Navraj K; Gill, Kulvinder S

    2016-09-01

    α-amylase is an important enzyme involved in starch degradation to provide energy to the germinating seedling. The present study was conducted to reveal structural and functional evolution of this gene among higher plants. Discounting polyploidy, most plant species showed only a single copy of the gene making multiple isoforms in different tissues and developmental stages. Genomic length of the gene ranged from 1472 bp in wheat to 2369 bp in soybean, and the size variation was mainly due to differences in the number and size of introns. In spite of this variation, the intron phase distribution and insertion sites were mostly conserved. The predicted protein size ranged from 414 amino acid (aa) in soybean to 449aa in Brachypodium. Overall, the protein sequence similarity among orthologs ranged from 56.4 to 97.4 %. Key motifs and domains along with their relative distances were conserved among plants although several species, genera, and class specific motifs were identified. The glycosyl hydrolase superfamily domain length varied from 342aa in soybean to 384aa in maize and sorghum while length of the C-terminal β-sheet domain was highly conserved with 61aa in all monocots and Arabidopsis but was 59aa in soybean and Medicago. Compared to rice, 3D structure of the proteins showed 89.8 to 91.3 % similarity among the monocots and 72.7 to 75.8 % among the dicots. Sequence and relative location of the five key aa required for the ligand binding were highly conserved in all species except rice.

  18. The structure of human pancreatic alpha-amylase at 1.8 A resolution and comparisons with related enzymes.

    PubMed

    Brayer, G D; Luo, Y; Withers, S G

    1995-09-01

    The structure of human pancreatic alpha-amylase has been determined to 1.8 A resolution using X-ray diffraction techniques. This enzyme is found to be composed of three structural domains. The largest is Domain A (residues 1-99, 169-404), which forms a central eight-stranded parallel beta-barrel, to one end of which are located the active site residues Asp 197, Glu 233, and Asp 300. Also found in this vicinity is a bound chloride ion that forms ligand interactions to Arg 195, Asn 298, and Arg 337. Domain B is the smallest (residues 100-168) and serves to form a calcium binding site against the wall of the beta-barrel of Domain A. Protein groups making ligand interactions to this calcium include Asn 100, Arg 158, Asp 167, and His 201. Domain C (residues 405-496) is made up of anti-parallel beta-structure and is only loosely associated with Domains A and B. It is notable that the N-terminal glutamine residue of human pancreatic alpha-amylase undergoes a posttranslational modification to form a stable pyrrolidone derivative that may provide protection against other digestive enzymes. Structure-based comparisons of human pancreatic alpha-amylase with functionally related enzymes serve to emphasize three points. Firstly, despite this approach facilitating primary sequence alignments with respect to the numerous insertions and deletions present, overall there is only approximately 15% sequence homology between the mammalian and fungal alpha-amylases. Secondly, in contrast, these same studies indicate that significant structural homology is present and of the order of approximately 70%. Thirdly, the positioning of Domain C can vary considerably between alpha-amylases. In terms of the more closely related porcine enzyme, there are four regions of polypeptide chain (residues 237-250, 304-310, 346-354, and 458-461) with significantly different conformations from those in human pancreatic alpha-amylase. At least two of these could play a role in observed differential

  19. Salivary α-amylase exhibits antiproliferative effects in primary cell cultures of rat mammary epithelial cells and human breast cancer cells.

    PubMed

    Fedrowitz, Maren; Hass, Ralf; Bertram, Catharina; Löscher, Wolfgang

    2011-01-01

    Breast cancer is one of the most diagnosed cancers in females, frequently with fatal outcome, so that new strategies for modulating cell proliferation in the mammary tissue are urgently needed. There is some, as yet inconclusive evidence that α-amylase may constitute a novel candidate for affecting cellular growth. The present investigation aimed to examine if salivary α-amylase, an enzyme well known for the metabolism of starch and recently introduced as a stress marker, is able to exert antiproliferative effects on the growth of mammary gland epithelial cells. For this purpose, primary epithelial cultures of breast tissue from two different inbred rat strains, Fischer 344 (F344) and Lewis, as well as breast tumor cells of human origin were used. Treatment with human salivary α-amylase was performed once daily for 2 days followed by cell counting (trypan blue assay) to determine alterations in cell numbers. Cell senescence after α-amylase treatment was assessed by β-galactosidase assay. Endogenous α-amylase was detected in cells from F344 and Lewis by immunofluorescence. Salivary α-amylase treatment in vitro significantly decreased the proliferation of primary cells from F344 and Lewis rats in a concentration-dependent manner. Noticeably, the sensitivity towards α-amylase was significantly higher in Lewis cells with stronger impact on cell growth after 5 and 50 U/ml compared to F344 cells. An antiproliferative effect of α-amylase was also determined in mammary tumor cells of human origin, but this effect varied depending on the donor, age, and type of the cells. The results presented here indicate for the first time that salivary α-amylase affects cell growth in rat mammary epithelial cells and in breast tumor cells of human origin. Thus, α-amylase may be considered a novel, promising target for balancing cellular growth, which may provide an interesting tool for tumor prophylaxis and treatment.

  20. Oral Fusobacterium nucleatum subsp. polymorphum binds to human salivary α-amylase.

    PubMed

    Zulfiqar, M; Yamaguchi, T; Sato, S; Oho, T

    2013-12-01

    Fusobacterium nucleatum acts as an intermediate between early and late colonizers in the oral cavity. In this study, we showed that F. nucleatum subsp. polymorphum can bind to a salivary component with a molecular weight of approximately 110 kDa and identified the protein and another major factor of 55 kDa, as salivary α-amylase by time-of-flight mass spectrometry and immuno-reactions. Salivary α-amylase is present in both monomeric and dimeric forms and we found that formation of the dimer depends on copper ions. The F. nucleatum adhered to both monomeric and dimeric salivary α-amylases, but the numbers of bacteria bound to the dimeric form were more than those bound to the monomeric form. The degree of adherence of F. nucleatum to four α-amylases from different sources was almost the same, however its binding to β-amylase was considerably decreased. Among four α-amylase inhibitors tested, acarbose and type 1 and 3 inhibitors derived from wheat flour showed significant activity against the adhesion of F.nucleatum to monomeric and dimeric amylases, however voglibose had little effect. Moreover F. nucleatum cells inhibited the enzymatic activity of salivary α-amylase in a dose-dependent manner. These results suggest that F. nucleatum plays more important and positive role as an early colonizer for maturation of oral microbial colonization. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Salicylic acid inhibits gibberellin-induced alpha-amylase expression and seed germination via a pathway involving an abscisic-acid-inducible WRKY gene.

    PubMed

    Xie, Zhen; Zhang, Zhong-Lin; Hanzlik, Shane; Cook, Everett; Shen, Qingxi J

    2007-06-01

    It is well known that abscisic acid (ABA) antagonizes gibberellin (GA)-promoted seed germination. Recent circumstantial evidence suggests that salicylic acid (SA) also inhibits seed germination in maize and Arabidopsis. Our study shows that SA blocks barley seed germination in a dosage dependent manner. As an initial effort to addressing the mechanism controlling the crosstalk of SA, GA and ABA signaling in barley, we studied the regulation of alpha-amylases by SA and a WRKY gene whose expression is modulated by these hormones. Assays of alpha-amylase activity reveal that GA-induced alpha-amylase production in aleurone cells is inhibited by bioactive SA, but not its analogs, 3-hydroxybenzoic acid and 4-hydroxybenzoic acid. This inhibitory effect is unlikely due to repressing alpha-amylase secretion or inhibiting alpha-amylase enzyme activities. Northern blot analyses indicate that SA suppresses GA-induced expression of a barley low pI alpha-amylase gene (Amy32b). Because our previous data indicate that ABA-inducible and GA-suppressible WRKY genes inhibit the expression of alpha-amylase genes in rice, we studied the steady state mRNA levels of a barley WRKY gene, HvWRKY38. The expression of HvWRKY38 in barley aleurone cells is down-regulated by GA, but up-regulated by SA and ABA. However, the regulation of HvWRKY38 by SA appears to be different from that of ABA in term of the kinetics and levels of induction. Over-expression of HvWRKY38 in aleurone cells by particle bombardment blocks GA induction of the Amy32b promoter reporter construct (Amy32b-GUS). Therefore, HvWRKY38 might serve as a converging node of SA and ABA signal pathways involved in suppressing GA-induced seed germination.

  2. Gedunin and Azadiradione: Human Pancreatic Alpha-Amylase Inhibiting Limonoids from Neem (Azadirachta indica) as Anti-Diabetic Agents

    PubMed Central

    Zinjarde, Smita; Thulasiram, Hirekodathakallu; RaviKumar, Ameeta

    2015-01-01

    Human pancreatic α-amylase (HPA) inhibitors offer an effective strategy to lower postprandial hyperglycemia via control of starch breakdown. Limonoids from Azadirachta indica known for their therapeutic potential were screened for pancreatic α-amylase inhibition, a known anti-diabetic target. Studies were carried out to reveal their mode of action so as to justify their hypoglycemic potential. Of the nine limonoids isolated/semi-synthesized from A.indica and screened for α-amylase inhibition, azadiradione and exhibited potential inhibition with an IC50 value of 74.17 and 68.38 μM, respectively against HPA under in vitro conditions. Further screening on AR42J α-amylase secretory cell line for cytotoxicity and bioactivity revealed that azadiradione and gedunin exhibited cytotoxicity with IC50 of 11.1 and 13.4μM. Maximal secreted α-amylase inhibition of 41.8% and 53.4% was seen at 3.5 and 3.3μM, respectively. Michaelis-Menten kinetics suggested a mixed mode of inhibition with maltopentaose (Ki 42.2, 18.6 μM) and starch (Ki′ 75.8, 37.4 μM) as substrate with a stiochiometry of 1:1 for both azadiradione and gedunin, respectively. The molecular docking simulation indicated plausible π-alkyl and alkyl-alkyl interactions between the aromatic amino acids and inhibitors. Fluorescence and CD confirmed the involvement of tryptophan and tyrosine in ligand binding to HPA. Thermodynamic parameters suggested that binding is enthalpically and entropically driven with ΔG° of -21.25 kJ mol-1 and -21.16 kJ mol-1 for azadiradione and gedunin, respectively. Thus, the limonoids azadiradione and gedunin could bind and inactivate HPA (anti-diabetic target) and may prove to be lead drug candidates to reduce/control post-prandial hyperglycemia. PMID:26469405

  3. Gedunin and Azadiradione: Human Pancreatic Alpha-Amylase Inhibiting Limonoids from Neem (Azadirachta indica) as Anti-Diabetic Agents.

    PubMed

    Ponnusamy, Sudha; Haldar, Saikat; Mulani, Fayaj; Zinjarde, Smita; Thulasiram, Hirekodathakallu; RaviKumar, Ameeta

    2015-01-01

    Human pancreatic α-amylase (HPA) inhibitors offer an effective strategy to lower postprandial hyperglycemia via control of starch breakdown. Limonoids from Azadirachta indica known for their therapeutic potential were screened for pancreatic α-amylase inhibition, a known anti-diabetic target. Studies were carried out to reveal their mode of action so as to justify their hypoglycemic potential. Of the nine limonoids isolated/semi-synthesized from A.indica and screened for α-amylase inhibition, azadiradione and exhibited potential inhibition with an IC50 value of 74.17 and 68.38 μM, respectively against HPA under in vitro conditions. Further screening on AR42J α-amylase secretory cell line for cytotoxicity and bioactivity revealed that azadiradione and gedunin exhibited cytotoxicity with IC50 of 11.1 and 13.4μM. Maximal secreted α-amylase inhibition of 41.8% and 53.4% was seen at 3.5 and 3.3μM, respectively. Michaelis-Menten kinetics suggested a mixed mode of inhibition with maltopentaose (Ki 42.2, 18.6 μM) and starch (Ki' 75.8, 37.4 μM) as substrate with a stiochiometry of 1:1 for both azadiradione and gedunin, respectively. The molecular docking simulation indicated plausible π-alkyl and alkyl-alkyl interactions between the aromatic amino acids and inhibitors. Fluorescence and CD confirmed the involvement of tryptophan and tyrosine in ligand binding to HPA. Thermodynamic parameters suggested that binding is enthalpically and entropically driven with ΔG° of -21.25 kJ mol-1 and -21.16 kJ mol-1 for azadiradione and gedunin, respectively. Thus, the limonoids azadiradione and gedunin could bind and inactivate HPA (anti-diabetic target) and may prove to be lead drug candidates to reduce/control post-prandial hyperglycemia.

  4. Very stable high molecular mass multiprotein complex with DNase and amylase activities in human milk.

    PubMed

    Soboleva, Svetlana E; Dmitrenok, Pavel S; Verkhovod, Timofey D; Buneva, Valentina N; Sedykh, Sergey E; Nevinsky, Georgy A

    2015-01-01

    For breastfed infants, human milk is more than a source of nutrients; it furnishes a wide array of proteins, peptides, antibodies, and other components promoting neonatal growth and protecting infants from viral and bacterial infection. It has been proposed that most biological processes are performed by protein complexes. Therefore, identification and characterization of human milk components including protein complexes is important for understanding the function of milk. Using gel filtration, we have purified a stable high molecular mass (~1000 kDa) multiprotein complex (SPC) from 15 preparations of human milk. Light scattering and gel filtration showed that the SPC was stable in the presence of high concentrations of NaCl and MgCl2 but dissociated efficiently under the conditions that destroy immunocomplexes (2 M MgCl2 , 0.5 M NaCl, and 10 mM DTT). Such a stable complex is unlikely to be a casual associate of different proteins. The relative content of the individual SPCs varied from 6% to 25% of the total milk protein. According to electrophoretic and mass spectrometry analysis, all 15 SPCs contained lactoferrin (LF) and α-lactalbumin as major proteins, whereas human milk albumin and β-casein were present in moderate or minor amounts; a different content of IgGs and sIgAs was observed. All SPCs efficiently hydrolyzed Plasmid supercoiled DNA and maltoheptaose. Some freshly prepared SPC preparations contained not only intact LF but also small amounts of its fragments, which appeared in all SPCs during their prolonged storage; the fragments, similar to intact LF, possessed DNase and amylase activities. LF is found in human epithelial secretions, barrier body fluids, and in the secondary granules of leukocytes. LF is a protein of the acute phase response and nonspecific defense against different types of microbial and viral infections. Therefore, LF complexes with other proteins may be important for its functions not only in human milk.

  5. Construction of a Shuttle Vector for Heterologous Expression of a Novel Fungal α-Amylase Gene in Aspergillus oryzae.

    PubMed

    Yin, Yanchen; Mao, Youzhi; Yin, Xiaolie; Gao, Bei; Wei, Dongzhi

    2015-07-01

    The filamentous fungus Aspergillus oryzae is a well-known expression host used to express homologous and heterologous proteins in a number of industrial applications. To facilitate higher yields of proteins of interest, we constructed the pAsOP vector to express heterologous proteins in A. oryzae. pAsOP carries a selectable marker, pyrG, derived from Aspergillus nidulans, and a strong promoter and a terminator of the amyB gene derived from A. oryzae. pAsOP transformed A. oryzae efficiently via the PEG-CaCl2-mediated transformation method. As proof of concept, green fluorescent protein (GFP) was successfully expressed in A. oryzae transformed by pAsOP-GFP. Additionally, we identified a novel fungal α-amylase (PcAmy) gene from Penicillium sp. and cloned the gene into the vector. After transformation by pAsOPPcAmy, the α-amylase PcAmy from Penicillium sp. was successfully expressed in a heterologous host system for the first time. The α-amylase activity in the A. oryzae transformant was increased by 62.3% compared with the untransformed A. oryzae control. The PcAmy protein produced in the system had an optimum pH of 5.0 and optimum temperature of 30°C. As a cold-adapted enzyme, PcAmy shows potential value in industrial applications because of its high catalytic activity at low temperature. Furthermore, the expression vector reported in this study provides promising utility for further scientific research and biotechnological applications.

  6. Induction of Expression of Genes Coding for Sporamin and β-Amylase by Polygalacturonic Acid in Leaf-Petiole Cuttings of Sweet Potato 1

    PubMed Central

    Ohto, Masa-aki; Nakamura-Kito, Kyoko; Nakamura, Kenzo

    1992-01-01

    Sporamin and β-amylase are two major proteins of tuberous storage root of sweet potato (Ipomoea batatas) and their accumulation can be induced concomitantly with the accumulation of starch in leaves and petioles by sucrose (K Nakamura, M Ohto, N Yoshida, K Nakamura [1991] Plant Physiol 96: 902-909). Although mechanical wounding of leaves of sweet potato only occasionally induced the expression of sporamin and β-amylase genes, their expression could be reproducibly induced in leaf-petiole cuttings when these explants were dipped in a solution of polygalacturonic acid or chitosan at their cut edges. Polygalacturonic acid seemed to induce expression of the same genes coding for sporamin and β-amylase that are induced by sucrose. Because polygalacturonic acid and chitosan are known to mediate the induction of wound-inducible defense reactions, these results raise an interesting possibility that β-amylase, in addition to sporamin, may have some role in the defense reaction. Expression of sporamin and β-amylase genes could also be induced by abscisic acid, and this induction by abscisic acid, as well as induction by polygalacturonic acid or sucrose, was repressed by gibberellic acid. By contrast, methyl jasmonate did not cause the significant induction of either sporamin or β-amylase mRNAs. Induction of expression of sporamin and β-amylase genes by polygalacturonic acid or sucrose was inhibited by cycloheximide, suggesting that de novo synthesis of proteins is required for both of the induction processes. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5 PMID:16668901

  7. Gene cloning, heterologous expression, and characterization of a high maltose-producing α-amylase of Rhizopus oryzae.

    PubMed

    Li, Song; Zuo, Zhirui; Niu, Dandan; Singh, Suren; Permaul, Kugenthiren; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-07-01

    A putative α-amylase gene, designated as RoAmy, was cloned from Rhizopus oryzae. The deduced amino acid sequence showed the highest (42.8%) similarity to the α-amylase from Trichoderma viride. The RoAmy gene was successfully expressed in Pichia pastoris GS115 under the induction of methanol. The molecular weight of the purified RoAmy determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis was approximately 48 kDa. The optimal pH and temperature were 4-6 and 60 °C, respectively. The enzyme was stable at pH ranges of 4.5-6.5 and temperatures below 50 °C. Purified RoAmy had a K(m) and V(max) of 0.27 mg/ml and 0.068 mg/min, respectively, with a specific activity of 1,123 U/mg on soluble starch. Amylase activity was strongly inhibited by 5 mM Cu(2+) and 5 mM Fe(2+), whereas 5 mM Ca(2+) showed no significant effect. The RoAmy hydrolytic activity was the highest on wheat starch but showed only 55% activity on amylopectin relative to soluble corn starch, while the pullulanase activity was negligible. The main end products of the polysaccharides tested were glucose and maltose. Maltose reached a concentration of 74% (w/w) with potato starch as the substrate. The enzyme had an extremely high affinity (K(m) = 0.22 mM) to maltotriose. A high ratio of glucose/maltose of 1:4 was obtained when maltotriose was used at an initial concentration of 40 mM.

  8. Inhibition of human salivary alpha-amylase by glucopyranosylidene-spiro-thiohydantoin.

    PubMed

    Gyémánt, Gyöngyi; Kandra, Lili; Nagy, Veronika; Somsák, László

    2003-12-12

    This study is the first report on the effectiveness and specificity of glucopyranosylidene-spiro-thiohydantoin (G-TH) inhibitor on the 2-chloro-4-nitrophenyl-4-O-beta-D-galactopyranosyl-maltoside (GalG(2)CNP) hydrolysis catalysed by human salivary alpha-amylase (HSA). The inhibition of hydrolysis is a mixed-noncompetitive type. In any case, only one molecule of inhibitor binds to HSA. Since our substrate and inhibitor are small molecules the long enough active site facilitates accommodating both of them simultaneously. However, the product formation can be excluded from enzyme-substrate-inhibitor complex (ESI) since Dixon plots are linear. Kinetic constants calculated from secondary plots and nonlinear regression are almost entirely equal, confirming the fidelity of the suggested model. Kinetic constants (K(1i)=7.3mM, L(1i)=2.84 mM) show that G-TH is not such a potent inhibitor of HSA as acarbose and indicate higher stability for ESI than for enzyme-inhibitor complex.

  9. Establishing the catalytic mechanism of human pancreatic α-amylase with QM/MM methods.

    PubMed

    Pinto, Gaspar P; Brás, Natércia F; Perez, Marta A S; Fernandes, Pedro A; Russo, Nino; Ramos, Maria J; Toscano, Marirosa

    2015-06-09

    In this work, we studied the catalytic mechanism of human pancreatic α-amylase (HPA). Our goal was to determine the catalytic mechanism of HPA with atomic detail using computational methods. We demonstrated that the HPA catalytic mechanism consists of two steps, the first of which (glycosylation step) involves breaking the glycosidic bond to culminate in the formation of a covalent intermediate. The second (deglycosylation step) consists of the addition of a water molecule to release the enzyme/substrate covalent intermediate, completing the hydrolysis of the sugar. The active site was very open to the solvent. Our mechanism basically differs from the previously proposed mechanism by having two water molecules instead of only one near the active site that participate in the mechanism. We also demonstrate the relevant role of the three catalytic amino acids, two aspartate residues and a glutamate (D197, E233, and D300), during catalysis. It was also shown that the rate limiting step was glycosylation, and its activation energy was in agreement with experimental values obtained for HPA. The experimental activation energy was 14.4 kcal mol(-1), and the activation energy obtained computationally was 15.1 kcal mol(-1).

  10. Simple ITC method for activity and inhibition studies on human salivary α-amylase.

    PubMed

    Lehoczki, Gábor; Szabó, Kármen; Takács, István; Kandra, Lili; Gyémánt, Gyöngyi

    2016-12-01

    Isothermal titration calorimetry (ITC) has an increasing significance in enzyme kinetic studies owing to its general applicability and sensitivity. In the present work, we aimed at developing a simple ITC-based screening procedure for the measurement of human salivary α-amylase (HSA) activity. Reaction of two substrates was studied with three independent methods (ITC, HPLC and spectrophotometry). ITC experiments were made using free and chromophore-containing maltooligomers of different length as substrates. Detailed studies revealed that maltoheptaose or longer oligomers could model properly starch and the presence of aromatic chromophore group did not affect the KM values considerably. It is the first time, when ITC was used to investigate of HSA-catalysed hydrolysis of different substrates (2-chloro-4-nitrophenyl-4-O-α-D-galactopyranosyl-maltoside, maltoheptaose and starch) in the presence of acarbose inhibitor. All measured IC50 values are in micromolar range (0.9, 18.6 and 29.0 μM, respectively) and increased in parallel with the degree of polymerisation of substrates.

  11. Raw starch-degrading α-amylase from Bacillus aquimaris MKSC 6.2: isolation and expression of the gene, bioinformatics and biochemical characterization of the recombinant enzyme.

    PubMed

    Puspasari, F; Radjasa, O K; Noer, A S; Nurachman, Z; Syah, Y M; van der Maarel, M; Dijkhuizen, L; Janeček, S; Natalia, D

    2013-01-01

    The aims were to isolate a raw starch-degrading α-amylase gene baqA from Bacillus aquimaris MKSC 6.2, and to characterize the gene product through in silico study and its expression in Escherichia coli. A 1539 complete open reading frame of a starch-degrading α-amylase gene baqA from B. aquimaris MKSC 6·2 has been determined by employing PCR and inverse PCR techniques. Bioinformatics analysis revealed that B. aquimaris MKSC 6.2 α-amylase (BaqA) has no starch-binding domain, and together with a few putative α-amylases from bacilli may establish a novel GH13 subfamily most closely related to GH13_1. Two consecutive tryptophans (Trp201 and Trp202, BaqA numbering) were identified as a sequence fingerprint of this novel GH13 subfamily. Escherichia coli cells produced the recombinant BaqA protein as inclusion bodies. The refolded recombinant BaqA protein degraded raw cassava and corn starches, but exhibited no activity with soluble starch. A novel raw starch-degrading B. aquimaris MKSC 6.2 α-amylase BaqA is proposed to be a member of new GH13 subfamily. This study has contributed to the overall knowledge and understanding of amylolytic enzymes that are able to bind and digest raw starch directly. © 2012 The Society for Applied Microbiology.

  12. Salivary alpha amylase activity in human beings of different age groups subjected to psychological stress.

    PubMed

    Sahu, Gopal K; Upadhyay, Seema; Panna, Shradha M

    2014-10-01

    Salivary alpha-amylase (sAA) has been proposed as a sensitive non-invasive biomarker for stress-induced changes in the body that reflect the activity of the sympathetic nervous system. Though several experiments have been conducted to determine the validity of this salivary component as a reliable stress marker in human subjects, the effect of stress induced changes on sAA level in different age groups is least studied. This article reports the activity of sAA in human subjects of different age groups subjected to psychological stress induced through stressful video clip. Differences in sAA level based on sex of different age groups under stress have also been studied. A total of 112 subjects consisting of both the male and female subjects, divided into two groups on basis of age were viewed a video clip of corneal transplant surgery as stressor. Activity of sAA from saliva samples of the stressed subjects were measured and compared with the activity of the samples collected from the subjects before viewing the clip. The age ranges of subjects were 18-25 and 40-60 years. The sAA level increased significantly in both the groups after viewing the stressful video. The increase was more pronounced in the younger subjects. The level of sAA was comparatively more in males than females in the respective groups. No significant change in sAA activity was observed after viewing the soothed video clip. Significant increase of sAA level in response to psychological stress suggests that it might act as a reliable sympathetic activity biochemical marker in different stages of human beings.

  13. Integrated expression of the α-amylase, dextranase and glutathione gene in an industrial brewer's yeast strain.

    PubMed

    Wang, Jin-Jing; Wang, Zhao-Yue; He, Xiu-Ping; Zhang, Bo-Run

    2012-01-01

    Genetic engineering is widely used to meliorate biological characteristics of industrial brewing yeast. But how to solve multiple problems at one time has become the bottle neck in the genetic modifications of industrial yeast strains. In a newly constructed strain TYRL21, dextranase gene was expressed in addition of α-amylase to make up α-amylase's shortcoming which can only hydrolyze α-1,4-glycosidic bond. Meanwhile, 18s rDNA repeated sequence was used as the homologous sequence for an effective and stable expression of LSD1 gene. As a result, TYRL21 consumed about twice much starch than the host strain. Moreover TYRL21 speeded up the fermentation which achieved the maximum cell number only within 3 days during EBC tube fermentation. Besides, flavor evaluation comparing TYRL21 and wild type brewing strain Y31 also confirmed TYRL21's better performances regarding its better saccharides utilization (83% less in residual saccharides), less off-flavor compounds (57% less in diacetyl, 39% less in acetaldehyde, 67% less in pentanedione), and improved stability index (increased by 49%) which correlated with sensory evaluation of final beer product.

  14. Human gene therapy.

    PubMed

    Sandhu, J S; Keating, A; Hozumi, N

    1997-01-01

    Human gene therapy and its application for the treatment of human genetic disorders, such as cystic fibrosis, cancer, and other diseases, are discussed. Gene therapy is a technique in which a functioning gene is inserted into a human cell to correct a genetic error or to introduce a new function to the cell. Many methods, including retroviral vectors and non-viral vectors, have been developed for both ex vivo and in vivo gene transfer into cells. Vectors need to be developed that efficiently transfer genes to target cells, and promoter systems are required that regulate gene expression according to physiologic needs of the host cell. There are several safety and ethical issues related to manipulating the human genome that need to be resolved. Current gene therapy efforts focus on gene insertion into somatic cells only. Gene therapy has potential for the effective treatment of genetic disorders, and gene transfer techniques are being used for basic research, for example, in cancer, to examine the underlying mechanism of disease. There are still many technical obstacles to be overcome before human gene therapy can become a routine procedure. The current human genome project provides the sequences of a vast number of human genes, leading to the identification, characterization, and understanding of genes that are responsible for many human diseases.

  15. Beneficial effect of a high number of copies of salivary amylase AMY1 gene on obesity risk in Mexican children.

    PubMed

    Mejía-Benítez, María A; Bonnefond, Amélie; Yengo, Loïc; Huyvaert, Marlène; Dechaume, Aurélie; Peralta-Romero, Jesús; Klünder-Klünder, Miguel; García Mena, Jaime; El-Sayed Moustafa, Julia S; Falchi, Mario; Cruz, Miguel; Froguel, Philippe

    2015-02-01

    Childhood obesity is a major public health problem in Mexico, affecting one in every three children. Genome-wide association studies identified genetic variants associated with childhood obesity, but a large missing heritability remains to be elucidated. We have recently shown a strong association between a highly polymorphic copy number variant encompassing the salivary amylase gene (AMY1 also known as AMY1A) and obesity in European and Asian adults. In the present study, we aimed to evaluate the association between AMY1 copy number and obesity in Mexican children. We evaluated the number of AMY1 copies in 597 Mexican children (293 obese children and 304 normal weight controls) through highly sensitive digital PCR. The effect of AMY1 copy number on obesity status was assessed using a logistic regression model adjusted for age and sex. We identified a marked effect of AMY1 copy number on reduced risk of obesity (OR per estimated copy 0.84, with the number of copies ranging from one to 16 in this population; p = 4.25 × 10(-6)). The global association between AMY1 copy number and reduced risk of obesity seemed to be mostly driven by the contribution of the highest AMY1 copy number. Strikingly, all children with >10 AMY1 copies were normal weight controls. Salivary amylase initiates the digestion of dietary starch, which is highly consumed in Mexico. Our current study suggests putative benefits of high number of AMY1 copies (and related production of salivary amylase) on energy metabolism in Mexican children.

  16. Characterization of recombinant β-amylases from Oryza sativa.

    PubMed

    Koide, Tomojiro; Ohnishi, Yasuo; Horinouchi, Sueharu

    2011-01-01

    Four putative β-amylase genes found in the Oryza sativa cDNA sequence database (KOME) were expressed in Escherichia coli. Recombinant proteins from two of these genes showed β-amylase activity. Similarly to β-amylases from other plants, the optimum pH of the recombinant rice β-amylases was about 5.5-6.0, but they exhibited inferior heat stability to soybean β-amylase.

  17. Lactase persistence and augmented salivary alpha-amylase gene copy numbers might have been selected by the combined toxic effects of gluten and (food born) pathogens.

    PubMed

    Pruimboom, Leo; Fox, Tom; Muskiet, Frits A J

    2014-03-01

    Various positively selected adaptations to new nutrients have been identified. Lactase persistence is among the best known, conferring the ability for drinking milk at post weaning age. An augmented number of amylase gene (AMY1) copies, giving rise to higher salivary amylase activity, has been implicated in the consumption of starch-rich foods. Higher AMY1 copy numbers have been demonstrated in populations with recent histories of starchy-rich diets. It is however questionable whether the resulting polymorphisms have exerted positive selection only by providing easily available sources of macro and micronutrients. Humans have explored new environments more than any other animal. Novel environments challenge the host, but especially its immune system with new climatic conditions, food and especially pathogens. With the advent of the agricultural revolution and the concurrent domestication of cattle came new pathogens. We contend that specific new food ingredients (e.g., gluten) and novel pathogens drove selection for lactase persistence and higher AMY gene copy numbers. Both adaptations provide ample glucose for activating the sodium glucose-dependent co-transporter 1 (SGLT1), which is the principal glucose, sodium and water transporter in the gastro-intestinal tract. Their rapid uptake confers protection against potentially lethal dehydration, hyponatremia and ultimately multiple organ failure. Oral rehydration therapy aims at SGLT1 activity and is the current treatment of choice for chronic diarrhoea and vomiting. We hypothesize that lifelong lactase activity and rapid starch digestion should be looked at as the evolutionary covalent of oral rehydration therapy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. The roles of AMY1 copies and protein expression in human salivary α-amylase activity.

    PubMed

    Yang, Ze-Min; Lin, Jing; Chen, Long-Hui; Zhang, Min; Chen, Wei-Wen; Yang, Xiao-Rong

    2015-01-01

    Salivary α-amylase (sAA) activity has been extensively investigated in nutrition and psychology. But few studies were performed to assess the role played by sAA gene (AMY1) copies and protein expression in basal and stimulus-induced sAA activity. The sAA activity, amount and AMY1 copy number were determined from 184 saliva samples pre- and post-citric acid stimulation. Our findings showed that citric acid could induce significant increase in sAA activity, total sAA amount, and glycosylated sAA amount, among which the glycosylated sAA amount had the largest response. The correlation analysis showed that AMY1 copy number, total sAA amount and AMY1 copy number×total sAA amount had significantly positive and successively increasing correlations with sAA activity in unstimulated and stimulated saliva, respectively, and furthermore, we observed higher correlations in unstimulated saliva when compared with the corresponding correlations in stimulated saliva. We also observed significant correlations between glycosylated sAA amount and sAA activity in unstimulated and stimulated saliva, respectively. Interestingly, the correlations were higher in stimulated saliva than in unstimulated saliva, and the correlations between glycosylated sAA amount and sAA activity were higher than that of between total sAA amount and sAA activity in stimulated saliva. Moreover, total sAA amount ratio and glycosylated sAA amount ratio showed significantly positive correlation with sAA activity ratio. AMY1 copy number had no correlation with sAA activity ratio. These findings suggested that AMY1 copy number and sAA amount played crucial roles in sAA activity; however, the roles were attenuated after stimulation due to fortified release of glycosylated sAA. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Predicting the Peritoneal Absorption of Icodextrin in Rats and Humans Including the Effect of α-Amylase Activity in Dialysate.

    PubMed

    Akonur, Alp; Holmes, Clifford J; Leypoldt, John K

    2015-01-01

    Contrary to ultrafiltration, the three-pore model predictions of icodextrin absorption from the peritoneal cavity have not yet been reported likely, in part, due to difficulties in estimating the degradation of glucose-polymer chains by α-amylase activity in dialysate. We incorporated this degradation process in a modified three-pore model of peritoneal transport to predict ultrafiltration and icodextrin absorption simultaneously in rats and humans. Separate three-pore models were constructed for humans and rats. The model for humans was adapted from PD Adequest 2.0 including a clearance term out of the peritoneal cavity to account for the absorption of large molecules to the peritoneal tissues, and considering patients who routinely used icodextrin by establishing steady-state plasma concentrations. The model for rats employed a standard three-pore model in which human kinetic parameters were scaled for a rat based on differences in body weight. Both models described the icodextrin molecular weight (MW) distribution as five distinct MW fractions. First order kinetics was applied using degradation rate constants obtained from previous in-vitro measurements using gel permeation chromatography. Ultrafiltration and absorption were predicted during a 4-hour exchange in rats, and 9 and 14-hour exchanges in humans with slow to fast transport characteristics with and without the effect of amylase activity. In rats, the icodextrin MW profile shifted towards the low MW fractions due to complete disappearance of the MW fractions greater than 27.5 kDa. Including the effect of amylase activity (60 U/L) resulted in 21.1% increase in ultrafiltration (UF) (7.6 mL vs 6.0 mL) and 7.1% increase in icodextrin absorption (CHO) (62.5% with vs 58.1%). In humans, the shift in MW profile was less pronounced. The fast transport (H) patient absorbed more icodextrin than the slow transport (L) patient during both 14-hour (H: 47.9% vs L: 40.2%) and 9-hour (H: 37.4% vs L: 31.7%) exchanges

  20. Predicting the Peritoneal Absorption of Icodextrin in Rats and Humans Including the Effect of α-Amylase Activity in Dialysate

    PubMed Central

    Akonur, Alp; Holmes, Clifford J.; Leypoldt, John K.

    2015-01-01

    ♦ Background: Contrary to ultrafiltration, the three-pore model predictions of icodextrin absorption from the peritoneal cavity have not yet been reported likely, in part, due to difficulties in estimating the degradation of glucose-polymer chains by α-amylase activity in dialysate. We incorporated this degradation process in a modified three-pore model of peritoneal transport to predict ultrafiltration and icodextrin absorption simultaneously in rats and humans. ♦ Methods: Separate three-pore models were constructed for humans and rats. The model for humans was adapted from PD Adequest 2.0 including a clearance term out of the peritoneal cavity to account for the absorption of large molecules to the peritoneal tissues, and considering patients who routinely used icodextrin by establishing steady-state plasma concentrations. The model for rats employed a standard three-pore model in which human kinetic parameters were scaled for a rat based on differences in body weight. Both models described the icodextrin molecular weight (MW) distribution as five distinct MW fractions. First order kinetics was applied using degradation rate constants obtained from previous in-vitro measurements using gel permeation chromatography. Ultrafiltration and absorption were predicted during a 4-hour exchange in rats, and 9 and 14-hour exchanges in humans with slow to fast transport characteristics with and without the effect of amylase activity. ♦ Results: In rats, the icodextrin MW profile shifted towards the low MW fractions due to complete disappearance of the MW fractions greater than 27.5 kDa. Including the effect of amylase activity (60 U/L) resulted in 21.1% increase in ultrafiltration (UF) (7.6 mL vs 6.0 mL) and 7.1% increase in icodextrin absorption (CHO) (62.5% with vs 58.1%). In humans, the shift in MW profile was less pronounced. The fast transport (H) patient absorbed more icodextrin than the slow transport (L) patient during both 14-hour (H: 47.9% vs L: 40.2%) and 9

  1. Proteolytic enzymes and amylase induce cytokine production in human peripheral blood mononuclear cells in vitro.

    PubMed

    Desser, L; Rehberger, A; Paukovits, W

    1994-01-01

    In vitro treatment of human peripheral blood mononuclear cells (PBMNC) with proteolytic enzymes (bromelain, papain) and amylase leads to the production of large amounts of tumor necrosis factor-alpha (TNF-alpha), interleukin-1-beta (IL-1 beta), and interleukin-6 (IL-6) in a time and dose dependent manner. Increased TNF-alpha and IL-6 production was already found after 4-6 hours of incubation, and plateau levels were reached after 12-16 hours. Plateau levels up to 1500 pg TNF-alpha/ml/10(6) PBMNC, 13000 pg IL-1 beta/ml/10(6) PBMNC, and 23000 pg IL-6/ml/10(6) PBMNC were observed. Control cultures contained below 35 pg/ml/10(6) PBMNC of TNF-alpha, IL-1 beta or IL-6. In contrast to TNF-alpha which was undetectable after more than 24 hours, peak levels of IL-1 beta and IL-6 were still present at 24 hours. After incubation of the enzyme solution for some hours at 56 degrees C the cytokine inducing capacity disappeared. Neutralization experiments with inactivating antibodies, radioimmunoassay, and western blotting after electrophoretic separation showed that the TNF-like activity found in the lytic assay was due to TNF-alpha. Interferon-alpha (IFN-alpha) and Interferon-gamma (IFN-gamma), which had no effect alone, synergistically increased TNF-alpha production when applied together with the enzymes. A commercial mixture of these enzymes (Wobenzym), which was also investigated, showed a similar concentration and time dependence, as well as synergism with the interferons. A synergistic effect on TNF-alpha production was also found with the enzymes and phorbol ester (PMA).

  2. An alpha-amylase inhibitor gene from Phaseolus coccineus encodes a protein with potential for control of coffee berry borer (Hypothenemus hampei).

    PubMed

    de Azevedo Pereira, Railene; Nogueira Batista, João Aguiar; da Silva, Maria Cristina Mattar; Brilhante de Oliveira Neto, Osmundo; Zangrando Figueira, Edson Luiz; Valencia Jiménez, Arnubio; Grossi-de-Sa, Maria Fátima

    2006-09-01

    Plant alpha-amylase inhibitors are proteins found in several plants, and play a key role in natural defenses. In this study, a gene encoding an alpha-amylase inhibitor, named alphaAI-Pc1, was isolated from cotyledons of Phaseolus coccineus. This inhibitor has an enhanced primary structure to P. vulgaris alpha-amylase inhibitors (alpha-AI1 and alpha-AI2). The alphaAI-Pc1 gene, constructed with the PHA-L phytohemaglutinin promoter, was introduced into tobacco plants, with its expression in regenerated (T0) and progeny (T1) transformant plants monitored by PCR amplification, enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis, respectively. Seed protein extracts from selected transformants reacted positively with a polyclonal antibody raised against alphaAI-1, while no reaction was observed with untransformed tobacco plants. Immunological assays showed that the alphaAI-Pc1 gene product represented up to 0.05% of total soluble proteins in T0 plants seeds. Furthermore, recombinant alphaAI-Pc1 expressed in tobacco plants was able to inhibit 65% of digestive H. hampei alpha-amylases. The data herein suggest that the protein encoded by the alphaAI-Pc1 gene has potential to be introduced into coffee plants in order to increase their resistance to the coffee berry borer.

  3. The effect of oral stimulation on human parotid salivary flow rate and alpha-amylase secretion.

    PubMed

    Froehlich, D A; Pangborn, R M; Whitaker, J R

    1987-01-01

    Unilateral parotid saliva was collected from ten subjects following oral stimulation with water as baseline, and aqueous solutions of starch (2.5, 5.0, and 10%), sucrose (0.1, 0.2, and 0.4 M) sodium chloride (0.075, 0.15, and 0.30 M), and citric acid (0.005, 0.01, and 0.02 M). Salivary flow rate increased with increasing levels of each taste stimulus. At concentrations of equal taste intensity, citric acid evoked the highest flow rate, followed by sodium chloride and sucrose, while starch, in solution, had a minimal effect. Secretion rate patterns for total protein and alpha-amylase mirrored those of flow rate. The total protein and alpha-amylase concentrations of the saliva, and specific activity of alpha-amylase, were influenced by the type but not the concentration of stimulus, with citric acid stimulation resulting in the lowest concentrations and highest specific activity. Sodium ion (Na+) concentration generally increased with increasing stimulated flow rate, while K+, Ca++, and Mg++ concentrations remained relatively constant. Subjects with lower flow rates had a more concentrated saliva than those with high flow, except for Na+ concentration. Oral stimulation resulted in similar changes in protein and alpha-amylase secretion rates for the two groups.

  4. Using multiconformation continuum electrostatics to compare chloride binding motifs in alpha-amylase, human serum albumin, and Omp32.

    PubMed

    Song, Yifan; Gunner, M R

    2009-04-10

    Ions are a ubiquitous component of the cellular environment, transferring into cells through membrane-embedded proteins. Ions bind to proteins to regulate their charge and function. Here, using multiconformation continuum electrostatics (MCCE), we show that the changes of chloride binding to alpha-amylase, human serum albumin (HSA) and Omp32 with pH, and of alpha-amylase with mutation agree well with experimental data. The three proteins represent three different types of binding. In alpha-amylase, chloride is bound in a specific buried site. Chloride binding is strongly coupled to the protonation state of a nearby lysine. MCCE calculates an 11-fold change in chloride affinity between the wild-type alpha-amylase and the K300R mutant, in good agreement with the measured 10-fold change.Without considering the coupled protonation reaction, the calculated affinity change would be more than 10(6)-fold. In HSA, chlorides are distributed on the protein surface. Although HSA has a negative net charge, it binds more anions than cations. There are no highly occupied binding sites in HSA. Rather, there are many partially occupied sites near clusters of basic residues. The relative affinity of bound ions of different charges is shown to depend on the distribution of charged residues on the surface rather than the overall net charge of the protein. The calculated strong pH dependence of the number of chlorides bound and the anion selectivity agree with those of previous experiments. In Omp32, chlorides are stabilized in an anion-selective transmembrane channel in a pH-independent manner. The positive electrostatic potential in Omp32 results in about two chlorides and no cations bound in the transmembrane region of this anion-selective channel. The studies here show that with the ability to sample multiple binding sites and coupled protein protonation states, MCCE provides a powerful tool to analyze and predict ion binding. The calculations overestimate the affinity of surface

  5. Human HOX gene disorders.

    PubMed

    Quinonez, Shane C; Innis, Jeffrey W

    2014-01-01

    The Hox genes are an evolutionarily conserved family of genes, which encode a class of important transcription factors that function in numerous developmental processes. Following their initial discovery, a substantial amount of information has been gained regarding the roles Hox genes play in various physiologic and pathologic processes. These processes range from a central role in anterior-posterior patterning of the developing embryo to roles in oncogenesis that are yet to be fully elucidated. In vertebrates there are a total of 39 Hox genes divided into 4 separate clusters. Of these, mutations in 10 Hox genes have been found to cause human disorders with significant variation in their inheritance patterns, penetrance, expressivity and mechanism of pathogenesis. This review aims to describe the various phenotypes caused by germline mutation in these 10 Hox genes that cause a human phenotype, with specific emphasis paid to the genotypic and phenotypic differences between allelic disorders. As clinical whole exome and genome sequencing is increasingly utilized in the future, we predict that additional Hox gene mutations will likely be identified to cause distinct human phenotypes. As the known human phenotypes closely resemble gene-specific murine models, we also review the homozygous loss-of-function mouse phenotypes for the 29 Hox genes without a known human disease. This review will aid clinicians in identifying and caring for patients affected with a known Hox gene disorder and help recognize the potential for novel mutations in patients with phenotypes informed by mouse knockout studies.

  6. Activity of alpha-amylase inhibitors from Phaseolus coccineus on digestive alpha-amylases of the coffee berry borer.

    PubMed

    Valencia-Jiménez, Arnubio; Arboleda Valencia, Jorge W; Grossi-De-Sá, Maria Fátima

    2008-04-09

    Seeds of scarlet runner bean ( Phaseolus coccineus L.) were analyzed for alpha-amylase inhibitor (alpha-AI) activity. Through the use of polyclonal antibodies raised against pure alpha-AI-1 from common bean ( Phaseolus vulgaris L.), typical alpha-AlphaIota polypeptides (Mr 14-18 kDa) as well as a large polypeptide of Mr 32000 Da, usually referred to as "amylase inhibitor like", were detected. The inhibitor activity present in four accessions of P. coccineus was examined, both in semiquantitative zymograms allowing the separation of different isoforms and in quantitative assays against human salivary amylase, porcine pancreatic amylase, and coffee berry borer, Hypothenemus hampei Ferrari (Coleoptera: Scolytidae) amylase. Differential inhibition curves lead to the suggestion that the gene encoding one of the inhibitors in P. coccineus (in accession G35590) would be a good candidate for genetic engineering of coffee resistance toward the coffee berry borer. An in vitro proteolytic digestion treatment of pure alpha-AlphaIota-1 resulted in a rapid loss of the inhibitory activity, seriously affecting its natural capacity to interact with mammalian alpha-amylases.

  7. The sensitivity and specificity of the RSID-saliva kit for the detection of human salivary amylase in the Forensic Science Laboratory, Dublin, Ireland.

    PubMed

    Casey, David G; Price, Judy

    2010-01-30

    We demonstrate here that the RSID-saliva test can be used as a test for human salivary alpha-amylase on samples routinely examined in forensic casework. We show that the RSID-saliva test detects salivary alpha-amylase at lower concentrations than the Phadebas Quantitative test, that the RSID-saliva test does not cross-react with forensically important human fluids and that the RSID-saliva test can be successfully integrated into the whole swab semen extraction method. 2009 Elsevier Ireland Ltd. All rights reserved.

  8. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  9. Unique Organization of Extracellular Amylases into Amylosomes in the Resistant Starch-Utilizing Human Colonic Firmicutes Bacterium Ruminococcus bromii

    PubMed Central

    Ze, Xiaolei; Ben David, Yonit; Laverde-Gomez, Jenny A.; Dassa, Bareket; Sheridan, Paul O.; Duncan, Sylvia H.; Louis, Petra; Henrissat, Bernard; Juge, Nathalie; Koropatkin, Nicole M.; Bayer, Edward A.

    2015-01-01

    ABSTRACT Ruminococcus bromii is a dominant member of the human gut microbiota that plays a key role in releasing energy from dietary starches that escape digestion by host enzymes via its exceptional activity against particulate “resistant” starches. Genomic analysis of R. bromii shows that it is highly specialized, with 15 of its 21 glycoside hydrolases belonging to one family (GH13). We found that amylase activity in R. bromii is expressed constitutively, with the activity seen during growth with fructose as an energy source being similar to that seen with starch as an energy source. Six GH13 amylases that carry signal peptides were detected by proteomic analysis in R. bromii cultures. Four of these enzymes are among 26 R. bromii proteins predicted to carry dockerin modules, with one, Amy4, also carrying a cohesin module. Since cohesin-dockerin interactions are known to mediate the formation of protein complexes in cellulolytic ruminococci, the binding interactions of four cohesins and 11 dockerins from R. bromii were investigated after overexpressing them as recombinant fusion proteins. Dockerins possessed by the enzymes Amy4 and Amy9 are predicted to bind a cohesin present in protein scaffoldin 2 (Sca2), which resembles the ScaE cell wall-anchoring protein of a cellulolytic relative, R. flavefaciens. Further complexes are predicted between the dockerin-carrying amylases Amy4, Amy9, Amy10, and Amy12 and two other cohesin-carrying proteins, while Amy4 has the ability to autoaggregate, as its dockerin can recognize its own cohesin. This organization of starch-degrading enzymes is unprecedented and provides the first example of cohesin-dockerin interactions being involved in an amylolytic system, which we refer to as an “amylosome.” PMID:26419877

  10. Immunohistochemical and immunoelectron microscopic analyses of alpha-amylase isozymes in human intrahepatic biliary epithelium and hepatocytes.

    PubMed

    Terada, T; Kono, N; Nakanuma, Y

    1992-11-01

    The expression and localization of the pancreatic and salivary isozymes of alpha-amylase in the intrahepatic biliary epithelium and hepatocytes were examined by the immunohistochemical method with polyclonal and monoclonal antibodies in 45 normal autopsied human livers. Immunoelectron microscopic studies with the protein A-gold method were performed with the monoclonal antibodies (MAb) on seven of the livers. The intrahepatic biliary system was divided into large ducts, septal ducts, interlobular ducts, bile ductules, and peribiliary glands. Immunohistochemically, pancreatic isozyme was observed in the supranuclear cytoplasm of the epithelium of large ducts, septal ducts, and peribiliary glands in almost all livers. Interlobular ducts expressed pancreatic isozyme in only four (9%) livers. Bile ductules and hepatocytes were negative for pancreatic isozyme in all cases. Expression of salivary isozyme was observed in the supranuclear cytoplasm of the epithelium of large ducts, septal ducts, interlobular ducts, bile ductules, and peribiliary glands in almost all livers, although the expression in interlobular ducts and bile ductules was weak. Hepatocytes were weakly positive for salivary isozyme. Immunoelectron microscopy revealed that both pancreatic and salivary isozymes were located in the supranuclear cytoplasm of the epithelium of large ducts, septal ducts, and peribiliary glands, and that hepatocytes had no pancreatic isozyme but contained salivary isozyme. These data suggest that pancreatic and salivary isozymes of alpha-amylase are produced by the intrahepatic biliary epithelium and secreted into intrahepatic biliary lumens, and that they may play an important role in the physiology of the intrahepatic biliary tree and hepatic bile. It is also suggested that hepatocytes produce a small amount of salivary alpha-amylase that may be secreted into the biliary tree.

  11. A new nano-optical sensor thin film cadmium sulfide doped in sol-gel matrix for assessment of α-amylase activity in human saliva.

    PubMed

    Attia, M S; Zoulghena, H; Abdel-Mottaleb, M S A

    2014-02-21

    A novel, simple, sensitive and precise spectrofluorimetric method is developed for measuring the activity of the α-amylase enzyme in human saliva. The remarkable quenching of the luminescence intensity at 634 nm of nano CdS doped in a sol-gel matrix by various concentrations of maltose (produced from the reaction of the enzyme with the starch substrate) was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 4.8 × 10(-10) to 1.2 × 10(-5) mol L(-1) maltose with a correlation coefficient of 0.999 and a detection limit of 5.7 × 10(-11) mol L(-1). The method was used satisfactorily for assessment of the α-amylase activity in a number of human saliva samples collected from various healthy volunteers.

  12. Dietary starch intake modifies the relation between copy number variation in the salivary amylase gene and BMI.

    PubMed

    Rukh, Gull; Ericson, Ulrika; Andersson-Assarsson, Johanna; Orho-Melander, Marju; Sonestedt, Emily

    2017-07-01

    Background: Studies have shown conflicting associations between the salivary amylase gene (AMY1) copy number and obesity. Salivary amylase initiates starch digestion in the oral cavity; starch is a major source of energy in the diet.Objective: We investigated the association between AMY1 copy number and obesity traits, and the effect of the interaction between AMY1 copy number and starch intake on these obesity traits.Design: We first assessed the association between AMY1 copy number (genotyped by digital droplet polymerase chain reaction) and obesity traits in 4800 individuals without diabetes (mean age: 57 y; 60% female) from the Malmö Diet and Cancer Cohort. Then we analyzed interactions between AMY1 copy number and energy-adjusted starch intake (obtained by a modified diet history method) on body mass index (BMI) and body fat percentage.Results:AMY1 copy number was not associated with BMI (P = 0.80) or body fat percentage (P = 0.38). We observed a significant effect of the interaction between AMY1 copy number and starch intake on BMI (P-interaction = 0.007) and body fat percentage (P-interaction = 0.03). Upon stratification by dietary starch intake, BMI tended to decrease with increasing AMY1 copy numbers in the low-starch intake group (P = 0.07) and tended to increase with increasing AMY1 copy numbers in the high-starch intake group (P = 0.08). The lowest mean BMI was observed in the group of participants with a low AMY1 copy number and a high dietary intake of starch.Conclusions: Our findings suggest an effect of the interaction between starch intake and AMY1 copy number on obesity. Individuals with high starch intake but low genetic capacity to digest starch had the lowest BMI, potentially because larger amounts of undigested starch are transported through the gastrointestinal tract, contributing to fewer calories extracted from ingested starch. © 2017 American Society for Nutrition.

  13. Effects of polymorphisms in pepsinogen (PEP), amylase (AMY) and trypsin (TRY) genes on food habit domestication traits in mandarin fish.

    PubMed

    Yi, Tilin; Sun, Jian; Liang, Xufang; He, Shan; Li, Ling; Wen, Zhengyong; Shen, Dan

    2013-10-30

    Mandarin fish (Siniperca chuatsi) have a peculiar feeding habit of only accepting live fish prey and refusing dead prey and artificial diets. However, previous research has shown that some individuals accept dead prey after gradual domestication. Digestive enzymes are correlated with feeding habits in fish. In the current study, SNPs in the mandarin fish genes for pepsinogen (PEP), amylase (AMY), and trypsin (TRY) were evaluated for associations with feeding habits in domesticated mandarin fish by scanning their complete genomic sequence. In total, two SNPs were found in PEP, one was found in TRY, and none were found in AMY. The D1(CTCC) and D5(TTTT) diplotypes in the PEP gene tended to show strong effects on the feeding habits of domesticated fish (p < 0.01). The results indicate that PEP may be associated with the genetic mechanism for feeding habits in mandarin fish, and the D1(CTCC) and D5(TTTT) diplotypes in the PEP gene may be useful markers for selecting mandarin fish with appropriate feeding habits for domestication.

  14. Phylogenetic Distribution of Intron Positions in Alpha-Amylase Genes of Bilateria Suggests Numerous Gains and Losses

    PubMed Central

    Da Lage, Jean-Luc; Maczkowiak, Frédérique; Cariou, Marie-Louise

    2011-01-01

    Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that “resets” of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures. PMID:21611157

  15. Ixeris dentata-induced regulation of amylase synthesis and secretion in glucose-treated human salivary gland cells.

    PubMed

    Lee, Hwa-Young; Lee, Geum-Hwa; Kim, Hye-Kyung; Kim, Seung Hyun; Park, Kyung pyo; Chae, Han-Jung; Kim, Hyung-Ryong

    2013-12-01

    The endoplasmic reticulum (ER) is an organelle which controls synthesis of secretory and membrane proteins. Alterations in protein folding capacity, leading to ER stress, can be observed in patients with diabetes and related diseases such as xerostomia. The objectives of this study were to investigate the effects of Ixeris dentata (IXD) extract, which has been used for diabetes treatment, and compounds purified from IXD, 8-epidesacylcynaropicrin-3-O-beta-glucopyranoside (ID-57D), on amylase synthesis and secretion in human salivary gland (HSG) cells exposed to a high concentration of glucose. A high concentration of glucose in the experimental medium of cultured cells can model diabetes in vitro. IXD extracts and ID-57D increased oxidative folding-associated protein expression, including p-IRE-1α, PDI and ERO-1α, with the enhanced oxidative folding pattern seen in HSG cells transiently exposed to a high concentration of glucose. Moreover, the treatments reduced the ER stress response, such as the expression of GRP78, maintaining amylase synthesis and secretion in chronically glucose-exposed HSG cells. This study suggests the potential therapeutic value of IXD extract for the treatment of diabetes or its complications such as xerostomia. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Differential expression of salivary (Amy1) and pancreatic (Amy2) human amylase loci in prenatal and postnatal development.

    PubMed Central

    Tye, J G; Karn, R C; Merritt, A D

    1976-01-01

    The age-dependent development of alpha-amylase expression in utero and during the first two years of life is reported. Separation of salivary and pancreatic amylase isozymes in a discontinuous buffered sheet polyacrylamide electrophoretic system, with subsequent densitometry, provides a reliable semiquantitative method of estimating the proportions of salivary and pancreatic amylases in urine and amniotic fluid samples. In the newborn the predominant amylase isozymes seen in the urine are of salivary origin. As the child ages the level of amylase in the urine rises and an increase in the proportion of pancreatic amylase isozymes occurs. Amniotic fluids of late first and early second trimester pregnancies contain salivary isozymes. None of the amniotic fluid samples examined has pancreatic amylase isozymes. These data reflect a differential development of the expression of the two amylase approaches adult levels by 16 months of age. Conversely, the salivary (Amy1) locus is expressed as early as 18 weeks of gestation and remains relatively constant with but a small increase in salivary amylase (units/ml) activity during early development, as the total amylase activity approaches adult values. Images PMID:933119

  17. Improvement of cloned [alpha]-amylase gene expression in fed-batch culture of recombinant Saccharomyces cerevisiae by regulating both glucose and ethanol concentrations using a fuzzy controller

    SciTech Connect

    Shiba, Sumihisa; Nishida, Yoshio; Park, Y.S.; Iijima, Shinji; Kobayashi, Takeshi . Dept. of Biotechnology)

    1994-11-05

    The effect of ethanol concentration on cloned gene expression in recombinant Saccharomyces cerevisiae strain 20B-12 containing one of two plasmids, pNA3 and pNA7, was investigated in batch cultures. Plasmids pNA3 and pNA7 contain the [alpha]-amylase gene under the control of the SUC2 or PGK promoter, respectively. When the ethanol concentration was controlled at 2 to 5 g/L, the gene expressions were two times higher than those at 20 g/L ethanol. To increase the gene expression by maintaining both the ethanol and glucose concentrations at low levels, a fuzzy controller was developed. The concentrations of glucose and ethanol were controlled simultaneously at 0.15 and 2 g/L, respectively, in the production phase using the fuzzy controller in fed-batch culture. The synthesis of [alpha]-amylase was induced by the low glucose concentration and maintained at a high level of activity by regulating the ethanol concentration at 2 g/L. The secretory [alpha]-amylase activities of cells harboring plasmids pNA3 and pNA7 in fed-batch culture were 175 and 392 U/mL, and their maximal specific activities 7.7 and 12.4 U/mg dry cells, respectively. These values are two to three times higher in activity and three to four times higher in specific activity than those obtained when glucose only was controlled.

  18. Phylogenetic relationships of the sweetpotato in Ipomoea series Batatas (Convolvulaceae) based on nuclear beta-amylase gene sequences.

    PubMed

    Rajapakse, Sriyani; Nilmalgoda, Sasanda D; Molnar, Matthew; Ballard, Robert E; Austin, Daniel F; Bohac, Janice R

    2004-03-01

    Phylogenetic relationships of 13 accessions and a cultivar representing the sweetpotato, Ipomoea batatas (L.) Lam., and its wild progenitors, were investigated using the nucleotide sequence variation of a nuclear-encoded beta-amylase gene. A 1.1-1.3 kb fragment of the gene spanning two exons separated by a long intron was PCR-amplified, cloned, and sequenced. Exon sequences proved highly conservative, while intron sequences yielded large differences. Intron analyses grouped species in a phylogenetic context according to the presence of two genome types: A and B. These groups are consistent with results of previous analyses, save for the novel placement of I. tiliacea, among the A-genome species. Sequences specific to both A and B genome species have been identified. Exon sequences indicate that I. ramosissima and I. umbraticola are quite different from other A-genome species. Placement of I. littoralis is questionable; its intron is similar to other B-genome species, but its exons are quite different. Exon evolution indicates that the B-genome has evolved faster than the A-genome. Interspecific intron and exon variation indicates I. trifida, I. tabascana, and I. batatas form a monophyletic group.

  19. The roles of histidine residues at the starch-binding site in streptococcal-binding activities of human salivary amylase.

    PubMed

    Tseng, C C; Miyamoto, M; Ramalingam, K; Hemavathy, K C; Levine, M J; Ramasubbu, N

    1999-02-01

    Human salivary alpha-amylase participates in the initial digestion of starch and may be involved in the colonization of viridans streptococci in the mouth. To elucidate the role of histidine residues located near the starch-binding site on the streptococcal-binding activity, the wild type and three histidine mutants, H52A, H299A and H305A were constructed and expressed in a baculovirus system. While His52 is located near the non-reducing end of the starch-binding pocket (subsite S3/S4), the residues His299 and His305 are located near the subsites S1/S1'. For the wild type, the cDNA encoding the leader and secreted sequences of human salivary amylase was amplified by polymerase chain reaction from a human submandibular salivary-gland cDNA library, and subcloned into the baculovirus shuttle vector pVL1392 downstream of the polyhedrin promoter. Oligonucleotide-based, site-directed mutagenesis was used to generate the mutants expressed in the baculovirus system. Replacing His52 or His299 or His305 to Ala residue did not alter the bacterial-binding activity significantly, but these mutants did show differences in their catalytic activities. The mutant H52A showed negligible reduction in enzymatic activity compared to that of wild type for the hydrolysis of starch and oligosaccharides. In contrast, the H299A and H305A mutants showed a 12 to 13-fold reduction (90-92%) in starch-hydrolysing activity. In addition, the k(cat) for the hydrolysis of oligosaccharides by H299A decreased by as much as 11-fold for maltoheptaoside. This reduction was even higher (40-fold) for the hydrolysis of p-nitrophenyl maltoside, with a significant change in K(M). The mutant H305A, however, exhibited a reduction in k(cat) only, with no changes in the K(M) for the hydrolysis of oligosaccharides. The reduction in the k(cat) for the H305A mutant was almost 93% for maltoheptaoside hydrolysis. The pH activity profile for the H305A mutant was also significantly different from that of the wild type

  20. Evolution of the beta-amylase gene in the temperate grasses: Non-purifying selection, recombination, semiparalogy, homeology and phylogenetic signal.

    PubMed

    Minaya, Miguel; Díaz-Pérez, Antonio; Mason-Gamer, Roberta; Pimentel, Manuel; Catalán, Pilar

    2015-10-01

    Low-copy nuclear genes (LCNGs) have complex genetic architectures and evolutionary dynamics. However, unlike multicopy nuclear genes, LCNGs are rarely subject to gene conversion or concerted evolution, and they have higher mutation rates than organellar or nuclear ribosomal DNA markers, so they have great potential for improving the robustness of phylogenetic reconstructions at all taxonomic levels. In this study, our first objective is to evaluate the evolutionary dynamics of the LCNG β-amylase by testing for potential pseudogenization, paralogy, homeology, recombination, and phylogenetic incongruence within a broad representation of the main Pooideae lineages. Our second objective is to determine whether β-amylase shows sufficient phylogenetic signal to reconstruct the evolutionary history of the Pooid grasses. A multigenic (ITS, matK, ndhF, trnTL, and trnLF) tree of the study group provided a framework for assessing the β-amylase phylogeny. Eight accessions showed complete absence of selection, suggesting putative pseudogenic copies or other relaxed selection pressures; resolution of Vulpia alopecuros 2x clones indicated its potential (semi) paralogy; and homeologous copies of allopolyploid species Festuca simensis, F. fenas, and F. arundinacea tracked their Mediterranean origin. Two recombination events were found within early-diverged Pooideae lineages, and five within the PACCMAD clade. The unexpected phylogenetic relationships of 37 grass species (26% of the sampled species) highlight the frequent occurrence of non-treelike evolutionary events, so this LCNG should be used with caution as a phylogenetic marker. However, once the pitfalls are identified and removed, the phylogenetic reconstruction of the grasses based on the β-amylase exon+intron positions is optimal at all taxonomic levels.

  1. Unique Organization of Extracellular Amylases into Amylosomes in the Resistant Starch-Utilizing Human Colonic Firmicutes Bacterium Ruminococcus bromii.

    PubMed

    Ze, Xiaolei; Ben David, Yonit; Laverde-Gomez, Jenny A; Dassa, Bareket; Sheridan, Paul O; Duncan, Sylvia H; Louis, Petra; Henrissat, Bernard; Juge, Nathalie; Koropatkin, Nicole M; Bayer, Edward A; Flint, Harry J

    2015-09-29

    Ruminococcus bromii is a dominant member of the human gut microbiota that plays a key role in releasing energy from dietary starches that escape digestion by host enzymes via its exceptional activity against particulate "resistant" starches. Genomic analysis of R. bromii shows that it is highly specialized, with 15 of its 21 glycoside hydrolases belonging to one family (GH13). We found that amylase activity in R. bromii is expressed constitutively, with the activity seen during growth with fructose as an energy source being similar to that seen with starch as an energy source. Six GH13 amylases that carry signal peptides were detected by proteomic analysis in R. bromii cultures. Four of these enzymes are among 26 R. bromii proteins predicted to carry dockerin modules, with one, Amy4, also carrying a cohesin module. Since cohesin-dockerin interactions are known to mediate the formation of protein complexes in cellulolytic ruminococci, the binding interactions of four cohesins and 11 dockerins from R. bromii were investigated after overexpressing them as recombinant fusion proteins. Dockerins possessed by the enzymes Amy4 and Amy9 are predicted to bind a cohesin present in protein scaffoldin 2 (Sca2), which resembles the ScaE cell wall-anchoring protein of a cellulolytic relative, R. flavefaciens. Further complexes are predicted between the dockerin-carrying amylases Amy4, Amy9, Amy10, and Amy12 and two other cohesin-carrying proteins, while Amy4 has the ability to autoaggregate, as its dockerin can recognize its own cohesin. This organization of starch-degrading enzymes is unprecedented and provides the first example of cohesin-dockerin interactions being involved in an amylolytic system, which we refer to as an "amylosome." Fermentation of dietary nondigestible carbohydrates by the human colonic microbiota supplies much of the energy that supports microbial growth in the intestine. This activity has important consequences for health via modulation of

  2. Correlation between bacterial haemoglobin gene (vgb) and aeration: their effect on the growth and alpha-amylase activity in transformed Enterobacter aerogenes.

    PubMed

    Khleifat, K; Abboud, M M

    2003-01-01

    To evaluate the effects of bacterial haemoglobin on bacterial growth and alpha-amylase formation under different aeration conditions. Enterobacter aerogenes was transformed with the gene encoding Vitreoscilla (bacterial) haemoglobin, vgb. The growth kinetics and ability to synthesize alpha-amylase enzyme were investigated in this transformed Enterobacter strain as well as in two other Enterobacter control strains that do not harbour the vgb gene. Such comparison was made under variable aeration conditions, using the agitation rate as a measure of aeration. The expression of bacterial haemoglobin-supported cell growth determined as O.D.600 and cell viability in addition to the alpha-amylase production. These positive effects of bacterial haemoglobin were observed under both low and high aerations, but at different extents. In addition to improving cell growth under low aeration, the bacterial haemoglobin is able to promote bacterial cell tolerance during exposure to high oxygen tension. The expression of bacterial haemoglobin is advantageous in reducing the burden of certain toxic conditions such as high oxygen levels. It may have the same impact on some environmental toxic substances. This, haemoglobin biotechnology can be extended to induce enzymes of pollutants degradation or production of some useful industrial substances.

  3. Salivary Amylase: Digestion and Metabolic Syndrome.

    PubMed

    Peyrot des Gachons, Catherine; Breslin, Paul A S

    2016-10-01

    Salivary amylase is a glucose-polymer cleavage enzyme that is produced by the salivary glands. It comprises a small portion of the total amylase excreted, which is mostly made by the pancreas. Amylases digest starch into smaller molecules, ultimately yielding maltose, which in turn is cleaved into two glucose molecules by maltase. Starch comprises a significant portion of the typical human diet for most nationalities. Given that salivary amylase is such a small portion of total amylase, it is unclear why it exists and whether it conveys an evolutionary advantage when ingesting starch. This review will consider the impact of salivary amylase on oral perception, nutrient signaling, anticipatory metabolic reflexes, blood sugar, and its clinical implications for preventing metabolic syndrome and obesity.

  4. Purification and characterization of two alkaline, thermotolerant alpha-amylases from Bacillus halodurans 38C-2-1 and expression of the cloned gene in Escherichia coli.

    PubMed

    Murakami, Shuichiro; Nishimoto, Haruka; Toyama, Yosuke; Shimamoto, Etsuko; Takenaka, Shinji; Kaulpiboon, Jarunee; Prousoontorn, Manchumas; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Aoki, Kenji

    2007-10-01

    A newly isolated strain, 38C-2-1, produced alkaline and thermotolerant alpha-amylases and was identified as Bacillus halodurans. The enzymes were purified to homogeneity and named alpha-amylase I and II. These showed molecular masses of 105 and 75 kDa respectively and showed maximal activities at 50-60 degrees C and pH 10-11, and 42 and 38% relative activities at 30 degrees C. These results indicate that the enzymes are thermotolerant. The enzyme activity was not inhibited by a surfactant or a bleaching reagent used in detergents. A gene encoding alpha-amylase I was cloned and named amyI. Production of AmyI with a signal peptide repressed the growth of an Escherichia coli transformant. When enzyme production was induced by the addition of isopropyl beta-D(-)-thiogalactopyranoside in the late exponential growth phase, the highest enzyme yield was observed. It was 45-fold that of the parent strain 38C-2-1.

  5. [Patenting human genes].

    PubMed

    Brdicka, R

    2002-05-10

    The problem of patenting of human genes, which was discussed at the Workshop organized by OECD, has become very actual due to granted patents that concern testing of genetic disposition for breast cancer. Companies that had made large investments into this research clearly support patenting of their discoveries. But such patents can reduce general accessibility of genetic testing. Existing laws, and namely the Directive of the European Council unfortunately are not unambiguous and allow rather free explanation.

  6. Human Gene Therapy: Genes without Frontiers?

    ERIC Educational Resources Information Center

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  7. Human Gene Therapy: Genes without Frontiers?

    ERIC Educational Resources Information Center

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  8. Amylase activity is associated with AMY2B copy numbers in dog: implications for dog domestication, diet and diabetes

    PubMed Central

    Arendt, Maja; Fall, Tove; Lindblad-Toh, Kerstin; Axelsson, Erik

    2014-01-01

    High amylase activity in dogs is associated with a drastic increase in copy numbers of the gene coding for pancreatic amylase, AMY2B, that likely allowed dogs to thrive on a relatively starch-rich diet during early dog domestication. Although most dogs thus probably digest starch more efficiently than do wolves, AMY2B copy numbers vary widely within the dog population, and it is not clear how this variation affects the individual ability to handle starch nor how it affects dog health. In humans, copy numbers of the gene coding for salivary amylase, AMY1, correlate with both salivary amylase levels and enzyme activity, and high amylase activity is related to improved glycemic homeostasis and lower frequencies of metabolic syndrome. Here, we investigate the relationship between AMY2B copy numbers and serum amylase activity in dogs and show that amylase activity correlates with AMY2B copy numbers. We then describe how AMY2B copy numbers vary in individuals from 20 dog breeds and find strong breed-dependent patterns, indicating that the ability to digest starch varies both at the breed and individual level. Finally, to test whether AMY2B copy number is strongly associated with the risk of developing diabetes mellitus, we compare copy numbers in cases and controls as well as in breeds with varying diabetes susceptibility. Although we see no such association here, future studies using larger cohorts are needed before excluding a possible link between AMY2B and diabetes mellitus. PMID:24975239

  9. Molecular characterization of α-amylase from Staphylococcus aureus.

    PubMed

    Lakshmi, Hanumanthu Prasanna; Prasad, Uppu Venkateswara; Yeswanth, Sthanikam; Swarupa, Vimjam; Prasad, Osuru Hari; Narasu, Mangamoori Lakshmi; Sarma, Potukuchi Venkata Gurunadha Krishna

    2013-01-01

    Staphylococcus aureus is one of the prominent Gram positive human pathogen secretes many surface and secretary proteins including various enzymes and pathogenic factors that favour the successful colonization and infection of host tissue. α-amylase is one of the enzymes secreted by S. aureus which catalyses the breakdown of complex sugars to monosaccharides, which are required for colonization and survival of this pathogen in any anatomical locales. In the present study we have cloned, sequenced, expressed and characterized α-amylase gene from S. aureus ATCC12600. The recombinant enzyme has a molecular weight of 58kDa and the kinetics showed Vmax 0.0208±0.033 (mg/ml)/mg/min and Km 10.633±0.737mg/ml. The multiple sequence analysis showed α- amylase of S. aureus exhibited large differences with Bacillus subtilis and Streptococcus bovis. As the crystal structure of S. aureus α- amylase was unavailable, we used homology modelling method to build the structure. The built structure was validated by Ramachandran plot which showed 90% of the residues in the allowed region while no residue was found in the disallowed region and the built structure was close to the crystal structure with Z-Score: -6.85. The structural superimposition studies with α- amylases of Bacillus subtilis and Streptococcus bovis showed distinct differences with RMSD values of 18.158Åand 7.091Å respectively which correlated with enzyme kinetics, indicating α-amylase is different among these bacteria.

  10. Molecular characterization of α-amylase from Staphylococcus aureus

    PubMed Central

    Lakshmi, Hanumanthu Prasanna; Prasad, Uppu Venkateswara; Yeswanth, Sthanikam; Swarupa, Vimjam; Prasad, Osuru Hari; Narasu, Mangamoori Lakshmi; Sarma, Potukuchi Venkata Gurunadha Krishna

    2013-01-01

    Staphylococcus aureus is one of the prominent Gram positive human pathogen secretes many surface and secretary proteins including various enzymes and pathogenic factors that favour the successful colonization and infection of host tissue. α-amylase is one of the enzymes secreted by S. aureus which catalyses the breakdown of complex sugars to monosaccharides, which are required for colonization and survival of this pathogen in any anatomical locales. In the present study we have cloned, sequenced, expressed and characterized α-amylase gene from S. aureus ATCC12600. The recombinant enzyme has a molecular weight of 58kDa and the kinetics showed Vmax 0.0208±0.033 (mg/ml)/mg/min and Km 10.633±0.737mg/ml. The multiple sequence analysis showed α- amylase of S. aureus exhibited large differences with Bacillus subtilis and Streptococcus bovis. As the crystal structure of S. aureus α- amylase was unavailable, we used homology modelling method to build the structure. The built structure was validated by Ramachandran plot which showed 90% of the residues in the allowed region while no residue was found in the disallowed region and the built structure was close to the crystal structure with Z-Score: -6.85. The structural superimposition studies with α- amylases of Bacillus subtilis and Streptococcus bovis showed distinct differences with RMSD values of 18.158Åand 7.091Å respectively which correlated with enzyme kinetics, indicating α-amylase is different among these bacteria. PMID:23559746

  11. Differential expression of two ß-amylase genes (Bmy1 and Bmy2) in developing and mature barley grain

    USDA-ARS?s Scientific Manuscript database

    Barley (Hordeum vulgare L.) endosperm-specific (Bmy1) and ubiquitous (Bmy2) ß-amylase were studied during the late maturation phase of seed development in four genotypes. Sequencing of Bmy2 from genomic DNA revealed six polymorphisms in the introns and two synonymous SNPs in the coding region. Acc...

  12. Differential expression of two ß-amylase genes (Bmy1 and Bmy2) in developing and mature barley grain

    USDA-ARS?s Scientific Manuscript database

    Barley (Hordeum vulgare L.) endosperm-specific (Bmy1) and ubiquitous (Bmy2) ß-amylase were studied during the late maturation phase of seed development in four genotypes. Sequencing of Bmy2 from genomic DNA revealed six polymorphisms in the introns and two synonymous SNPs in the coding region. Acc...

  13. Modes of Action of Acarbose Hydrolysis and Transglycosylation Catalyzed by a Thermostable Maltogenic Amylase, the Gene for Which Was Cloned from a Thermus Strain

    PubMed Central

    Kim, Tae-Jip; Kim, Myo-Jeong; Kim, Byung-Cheon; Kim, Jae-Cherl; Cheong, Tae-Kyou; Kim, Jung-Wan; Park, Kwan-Hwa

    1999-01-01

    A maltogenic amylase gene was cloned in Escherichia coli from a gram-negative thermophilic bacterium, Thermus strain IM6501. The gene encoded an enzyme (ThMA) with a molecular mass of 68 kDa which was expressed by the expression vector p6xHis119. The optimal temperature of ThMA was 60°C, which was higher than those of other maltogenic amylases reported so far. Thermal inactivation kinetic analysis of ThMA indicated that it was stabilized in the presence of 10 mM EDTA. ThMA harbored both hydrolysis and transglycosylation activities. It hydrolyzed β-cyclodextrin and starch mainly to maltose and pullulan to panose. ThMA not only hydrolyzed acarbose, an amylase inhibitor, to glucose and pseudotrisaccharide (PTS) but also transferred PTS to 17 sugar acceptors, including glucose, fructose, maltose, cellobiose, etc. Structural analysis of acarbose transfer products by using methylation, thin-layer chromatography, high-performance ion chromatography, and nuclear magnetic resonance indicated that PTS was transferred primarily to the C-6 of the acceptors and at lower degrees to the C-3 and/or C-4. The transglycosylation of sugar to methyl-α-d-glucopyranoside by forming an α-(1,3)-glycosidic linkage was demonstrated for the first time by using acarbose and ThMA. Kinetic analysis of the acarbose transfer products showed that the C-4 transfer product formed most rapidly but readily hydrolyzed, while the C-6 transfer product was stable and accumulated in the reaction mixture as the main product. PMID:10103262

  14. Properties of Thermosensitive Extracellular α-Amylases of Bacillus subtilis

    PubMed Central

    Yamane, Kunio; Maruo, Bunji

    1974-01-01

    Enzymological properties of four thermosensitive α-amylases (M3, M9, M18, and M20) brought by different mutation sites in α-amylase structural gene of Bacillus subtilis were compared with those of the parental α-amylase NA64. Two thermosensitive α-amylases (M9 and M20) were altered not only in their thermosensitivity but also in their immunological properties, catalytic properties, molecular weights determined by the gel filtration on a Bio-Gel P-100 column, and others. The other two thermosensitive α-amylases (M3 and M18) were altered only in their thermosensitivity. Images PMID:4218234

  15. Antibiofilm activity of α-amylase from Bacillus subtilis S8-18 against biofilm forming human bacterial pathogens.

    PubMed

    Kalpana, Balu Jancy; Aarthy, Subramonian; Pandian, Shunmugiah Karutha

    2012-07-01

    The extracellular α-amylase enzyme from Bacillus subtilis S8-18 of marine origin was proved as an antibiofilm agent against methicillin-resistant Staphylococcus aureus (MRSA), a clinical strain isolated from pharyngitis patient, Vibrio cholerae also a clinical isolate from cholera patient and Pseudomonas aeruginosa ATCC10145. The spectrophotometric and microscopic investigations revealed the potential of α-amylase to inhibit biofilm formation in these pathogens. At its BIC level, the crude enzyme caused 51.81-73.07% of biofilm inhibition. Beyond the inhibition, the enzyme was also effective in degradation of preformed mature biofilm by disrupting the exopolysaccharide (EPS), an essential component in biofilm architecture. Furthermore, the enzyme purified to its homogeneity by chromatographic techniques was also effective in biofilm inhibition (43.83-61.68%) as well as in degradation of EPS. A commercial α-amylase enzyme from B. subtilis was also used for comparative purpose. Besides, the effect of various enzymes and temperature on the antibiofilm activity of amylase enzymes was also investigated. This study, for the first time, proved that α-amylase enzyme alone can be used to inhibit/disrupt the biofilms of V. cholerae and MRSA strains and beholds much promise in clinical applications.

  16. Intraspecies differences in cold hardiness, carbohydrate content and β-amylase gene expression of Vaccinium corymbosum during cold acclimation and deacclimation.

    PubMed

    Lee, Jun Hyung; Yu, Duk Jun; Kim, Su Jin; Choi, Doil; Lee, Hee Jae

    2012-12-01

    Changes in cold hardiness, carbohydrate content and β-amylase gene expression were monitored in the shoots of the highbush blueberry (Vaccinium corymbosum L.) cultivars 'Sharpblue' and 'Jersey' during cold acclimation (CA) and deacclimation (DA). The seasonal patterns were similar in both cultivars, but the levels of cold hardiness determined by electrolyte leakage analysis were significantly different; 'Jersey' was hardier than 'Sharpblue'. Cold hardiness was closely related to total soluble sugar content (r = -0.98** and -0.99** for 'Sharpblue' and 'Jersey', respectively). In 'Jersey', more soluble sugars accumulated during CA. Of the detected soluble sugars, glucose, fructose and raffinose contents were significantly associated with cold hardiness in both cultivars. Sucrose was abundant in both cultivars, and stachyose content changed significantly during CA and DA. However, they were not associated with cold hardiness. A sharp decrease in starch contents in the middle of CA coincided with β-amylase gene (VcBMY) expression, indicating the conversion of starch into soluble sugars. During CA, VcBMY was expressed up to twofold higher in 'Jersey' than in 'Sharpblue'. These results suggest that intraspecies differences in the cold hardiness of highbush blueberries are associated with total soluble sugar content, which is driven partly by differential expression of VcBMY.

  17. Genomic structure of the α-amylase gene in the pearl oyster Pinctada fucata and its expression in response to salinity and food concentration.

    PubMed

    Huang, Guiju; Guo, Yihui; Li, Lu; Fan, Sigang; Yu, Ziniu; Yu, Dahui

    2016-08-01

    Amylase is one of the most important digestive enzymes for phytophagous animals. In this study, the cDNA, genomic DNA, and promoter region of the α-amylase gene of the pearl oyster Pinctada fucata were cloned by using reverse transcription-polymerase chain reaction (RT-PCR), rapid amplification of cDNA ends, and genome-walking methods. The full-length cDNA sequence was 1704bp long and consisted of a 5'-untranslated region of 17bp, a 3'-untranslated region of 118bp, and a 1569-bp open reading frame encoding a 522-aa polypeptide with a 20-aa signal peptide. Sequence alignment revealed that P. fucata α-amylase (Pfamy) shared the highest identity (91.6%) with Pinctada maxima. The phylogenetic tree showed that it was closely related to P. maxima, based on the amino acid sequences. The genomic DNA was 10850bp and contained nine exons, eight introns, and a promoter region of 3932bp. Several transcriptional factors such as GATA-1, AP-1, and SP1 were predicted in the promoter region. Quantitative RT-PCR assay indicated that the relative expression level of Pfamy was significantly higher in the digestive gland than in other tissues (gonad, gills, muscle, and mantle) (P<0.001). The expression level at salinity 27‰ was significantly higher than that at other salinities (P<0.05). Expression reached a minimum when the algal food concentration was 16×10(4)cells/mL, which was significantly lower than the level observed at 8×10(4)cells/mL and 20×10(4) cells/mL (P<0.05). Our findings provide a genetic basis for further research on Pfamy activity and will facilitate studies on the growth mechanisms and genetic improvement of the pearl oyster P. fucata. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  19. Clinical applications of amylase: Novel perspectives.

    PubMed

    Azzopardi, Ernest; Lloyd, Catherine; Teixeira, Sofia Rodrigues; Conlan, R Steven; Whitaker, Iain S

    2016-07-01

    Amylase was the first enzyme to be characterized, and for the previous 200 years, its clinical role has been restricted to a diagnostic aid. Recent interface research has led to a substantial expansion of its role into novel, viable diagnostic, and therapeutic applications to cancer, infection, and wound healing. This review provides a concise "state-of-the-art" overview of the genetics, structure, distribution, and localization of amylase in humans. A first-generation literature search was performed with the MeSH search string "Amylase AND (diagnost∗ OR therapeut$)" on OVIDSP and PUBMED platforms. A second-generation search was then performed by forward and backward referencing on Web of Knowledge™ and manual indexing, limited to the English Language. "State of the Art" in amylase genetics, structure, function distribution, localisation and detection of amylase in humans is provided. To the 4 classic patterns of hyperamylasemia (pancreatic, salivary, macroamylasemia, and combinations) a fifth, the localized targeting of amylase to specific foci of infection, is proposed. The implications are directed at novel therapeutic and diagnostic clinical applications of amylase such as the novel therapeutic drug classes capable of targeted delivery and "smart release" in areas of clinical need. Future directions of research in areas of high clinical benefit are reported. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  20. Loss-of-Function Mutations of the Rice GAMYB Gene Impair α-Amylase Expression in Aleurone and Flower Development

    PubMed Central

    Kaneko, Miyuki; Inukai, Yoshiaki; Ueguchi-Tanaka, Miyako; Itoh, Hironori; Izawa, Takeshi; Kobayashi, Yuhko; Hattori, Tsukaho; Miyao, Akio; Hirochika, Hirohiko; Ashikari, Motoyuki; Matsuoka, Makoto

    2004-01-01

    GAMYB was first isolated as a positive transcriptional regulator of gibberellin (GA)-dependent α-amylase expression in barley aleurone cells, and its molecular and biochemical properties have been well characterized. However, the role of GAMYB elsewhere in the plant is not well understood. To investigate the molecular function of GAMYB outside of the aleurone cells, we isolated loss-of-function mutants from a panel of rice mutants produced by the insertion of a retrotransposon, Tos17. Through PCR screening using primers for rice GAMYB (OsGAMYB) and Tos17, we isolated three independent mutant alleles that contained Tos17 inserted in the exon region. No α-amylase expression in the endosperm was induced in these mutants in response to GA treatment, indicating that the Tos17 insertion had knocked out OsGAMYB function. We found no significant defects in the growth and development of the mutants at the vegetative stage. After the phase transition to the reproductive stage, however, shortened internodes and defects in floral organ development, especially a defect in pollen development, were observed. On the other hand, no difference was detected in flowering time. High-level OsGAMYB expression was detected in the aleurone cells, inflorescence shoot apical region, stamen primordia, and tapetum cells of the anther, but only low-level expression occurred in organs at the vegetative stage or in the elongating stem. These results demonstrate that, in addition to its role in the induction of α-amylase in aleurone, OsGAMYB also is important for floral organ development and essential for pollen development. PMID:14688295

  1. Method for using a yeast alpha-amylase promoter

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  2. Expression of β-Amylase from Alfalfa Taproots1

    PubMed Central

    Gana, Joyce A.; Kalengamaliro, Newton E.; Cunningham, Suzanne M.; Volenec, Jeffrey J.

    1998-01-01

    Alfalfa (Medicago sativa L.) roots contain large quantities of β-amylase, but little is known about its role in vivo. We studied this by isolating a β-amylase cDNA and by examining signals that affect its expression. The β-amylase cDNA encoded a 55.95-kD polypeptide with a deduced amino acid sequence showing high similarity to other plant β-amylases. Starch concentrations, β-amylase activities, and β-amylase mRNA levels were measured in roots of alfalfa after defoliation, in suspension-cultured cells incubated in sucrose-rich or -deprived media, and in roots of cold-acclimated germ plasms. Starch levels, β-amylase activities, and β-amylase transcripts were reduced significantly in roots of defoliated plants and in sucrose-deprived cell cultures. β-Amylase transcript was high in roots of intact plants but could not be detected 2 to 8 d after defoliation. β-Amylase transcript levels increased in roots between September and October and then declined 10-fold in November and December after shoots were killed by frost. Alfalfa roots contain greater β-amylase transcript levels compared with roots of sweetclover (Melilotus officinalis L.), red clover (Trifolium pratense L.), and birdsfoot trefoil (Lotus corniculatus L.). Southern analysis indicated that β-amylase is present as a multigene family in alfalfa. Our results show no clear association between β-amylase activity or transcript abundance and starch hydrolysis in alfalfa roots. The great abundance of β-amylase and its unexpected patterns of gene expression and protein accumulation support our current belief that this protein serves a storage function in roots of this perennial species. PMID:9847126

  3. Genes, Environment, and Human Behavior.

    ERIC Educational Resources Information Center

    Bloom, Mark V.; Cutter, Mary Ann; Davidson, Ronald; Dougherty, Michael J.; Drexler, Edward; Gelernter, Joel; McCullough, Laurence B.; McInerney, Joseph D.; Murray, Jeffrey C.; Vogler, George P.; Zola, John

    This curriculum module explores genes, environment, and human behavior. This book provides materials to teach about the nature and methods of studying human behavior, raise some of the ethical and public policy dilemmas emerging from the Human Genome Project, and provide professional development for teachers. An extensive Teacher Background…

  4. Genes, Environment, and Human Behavior.

    ERIC Educational Resources Information Center

    Bloom, Mark V.; Cutter, Mary Ann; Davidson, Ronald; Dougherty, Michael J.; Drexler, Edward; Gelernter, Joel; McCullough, Laurence B.; McInerney, Joseph D.; Murray, Jeffrey C.; Vogler, George P.; Zola, John

    This curriculum module explores genes, environment, and human behavior. This book provides materials to teach about the nature and methods of studying human behavior, raise some of the ethical and public policy dilemmas emerging from the Human Genome Project, and provide professional development for teachers. An extensive Teacher Background…

  5. Purification and identification of amylases released by the human pathogen Trichomonas vaginalis that are active towards glycogen.

    PubMed

    Smith, Ronald W; Brittingham, Andrew; Wilson, Wayne A

    The parasitic protist Trichomonas vaginalis is the causative agent of the sexually transmitted infection trichomoniasis. In the laboratory, T. vaginalis is typically cultured in a serum-containing medium with maltose or glucose as the carbon source. The nature of the carbohydrates used by the organism in the environment of its host is unclear. However, the vagina contains substantial amounts of glycogen, which is believed to provide a growth substrate for the vaginal microbiota. We have shown previously that T. vaginalis releases glucosidases that are active towards glycogen into its environment. Here we purify and identifying these glucosidases. Using ammonium sulfate precipitation and precipitation with ethanol/glycogen, we purified glucosidase activity from conditioned growth medium, achieving over 300-fold enrichment. Maltose was released when glycogen was incubated with the glucosidase preparation, indicating that a β-amylase was present. However, after prolonged incubation, small quantities of larger products including maltotriose were obtained. Liquid chromatography and tandem mass spectrometry showed that the glucosidase preparation contained three proteins, the major component being a putative β-amylase encoded by the TVAG_080000 open reading frame. Lesser amounts of two putative α-amylases, encoded by the TVAG_178580 and TVAG_205920 open reading frames, were also present. We cloned and expressed the TVAG_080000 open reading frame and found that the recombinant protein was capable of digesting glycogen, releasing exclusively maltose. We conclude that T. vaginalis releases a variety of amylases into its growth environment and is well equipped to utilize the glycogen found in the vagina as a source of essential carbohydrates. Copyright © 2016. Published by Elsevier B.V.

  6. Advances in microbial amylases.

    PubMed

    Pandey, A; Nigam, P; Soccol, C R; Soccol, V T; Singh, D; Mohan, R

    2000-04-01

    This review makes a comprehensive survey of microbial amylases, i.e. alpha-amylase, beta-amylase and glucoamylase. Amylases are among the most important enzymes and are of great significance in present-day biotechnology. Although they can be derived from several sources, such as plants, animals and micro-organisms, the enzymes from microbial sources generally meet industrial demands. Microbial amylases could be potentially useful in the pharmaceutical and fine-chemical industries if enzymes with suitable properties could be prepared. With the advent of new frontiers in biotechnology, the spectrum of amylase application has widened in many other fields, such as clinical, medicinal and analytical chemistries, as well as their widespread application in starch saccharification and in the textile, food, brewing and distilling industries. In this review, after a brief description of the sources of amylases, we discuss the molecular biology of amylases, describing structures, cloning, sequences, and protoplast fusion and mutagenesis. This is followed by sections on their production and finally the properties of various amylases.

  7. Discovering Bisdemethoxycurcumin from Curcuma longa rhizome as a potent small molecule inhibitor of human pancreatic α-amylase, a target for type-2 diabetes.

    PubMed

    Ponnusamy, Sudha; Zinjarde, Smita; Bhargava, Shobha; Rajamohanan, P R; Ravikumar, Ameeta

    2012-12-15

    Curcuma longa rhizome is used extensively in culinary preparations in Far East and South-East Asia. Health benefits of curcuminoids from C. longa as antioxidants, anti-cancer and anti-inflammatory molecules have been well documented. We report here for the first time that Bisdemethoxycurcumin (BDMC) from C. longa, acts as an inhibitor to inactivate human pancreatic α-amylase, a therapeutic target for oral hypoglycemic agents in type-2 diabetes. Bioactivity guided isolation of rhizome isopropanol extract led to the identification by HPLC and NMR of BDMC as a lead small molecule inhibitor of porcine and human pancreatic α-amylase with an IC(50) value of 0.026 and 0.025 mM, respectively. Kinetic analysis revealed that using starch as the substrate, HPA exhibited an uncompetitive mode of inhibition with an apparent K(i) of 3.0 μM. The study gains importance as BDMC could be a good drug candidate in development of new inhibitors of HPA and of functional foods for controlling starch digestion in order to reduce post-prandial hyperglycemia.

  8. Analysis on evolutionary relationship of amylases from archaea, bacteria and eukaryota.

    PubMed

    Yan, Shaomin; Wu, Guang

    2016-02-01

    Amylase is one of the earliest characterized enzymes and has many applications in clinical and industrial settings. In biotechnological industries, the amylase activity is enhanced through modifying amylase structure and through cloning and expressing targeted amylases in different species. It is important to understand how engineered amylases can survive from generation to generation. This study used phylogenetic and statistical approaches to explore general patterns of amylases evolution, including 3118 α-amylases and 280 β-amylases from archaea, eukaryota and bacteria with fully documented taxonomic lineage. First, the phylogenetic tree was created to analyze the evolution of amylases with focus on individual amylases used in biofuel industry. Second, the average pairwise p-distance was computed for each kingdom, phylum, class, order, family and genus, and its diversity implies multi-time and multi-clan evolution. Finally, the variance was further partitioned into inter-clan variance and intra-clan variance for each taxonomic group, and they represent horizontal and vertical gene transfer. Theoretically, the results show a full picture on the evolution of amylases in manners of vertical and horizontal gene transfer, and multi-time and multi-clan evolution as well. Practically, this study provides the information on the surviving chance of desired amylase in a given taxonomic group, which may potentially enhance the successful rate of cloning and expression of amylase gene in different species.

  9. Broker Genes in Human Disease

    PubMed Central

    Cai, James J.; Borenstein, Elhanan; Petrov, Dmitri A.

    2010-01-01

    Genes that underlie human disease are important subjects of systems biology research. In the present study, we demonstrate that Mendelian and complex disease genes have distinct and consistent protein–protein interaction (PPI) properties. We show that five different network properties can be reduced to two independent metrics when applied to the human PPI network. These two metrics largely coincide with the degree (number of connections) and the clustering coefficient (the number of connections among the neighbors of a particular protein). We demonstrate that disease genes have simultaneously unusually high degree and unusually low clustering coefficient. Such genes can be described as brokers in that they connect many proteins that would not be connected otherwise. We show that these results are robust to the effect of gene age and inspection bias variation. Notably, genes identified in genome-wide association study (GWAS) have network patterns that are almost indistinguishable from the network patterns of nondisease genes and significantly different from the network patterns of complex disease genes identified through non-GWAS means. This suggests either that GWAS focused on a distinct set of diseases associated with an unusual set of genes or that mapping of GWAS-identified single nucleotide polymorphisms onto the causally affected neighboring genes is error prone. PMID:20937604

  10. Isolation and characterization of a proteinaceous α-amylase inhibitor AAI-CC5 from Streptomyces sp. CC5, and its gene cloning and expression.

    PubMed

    Sun, Zhibin; Lu, Weihao; Liu, Pingping; Wang, Hui; Huang, Yan; Zhao, Yuguo; Kong, Yi; Cui, Zhongli

    2015-02-01

    An α-amylase inhibitor producing Streptomyces sp. strain CC5 was isolated from soil. A proteinaceous α-amylase inhibitor AAI-CC5 was purified from strain CC5. AAI-CC5 specifically inhibited mammalian α-amylases. The molecular weight of the inhibitor was determined to be 8,212 Da by MALDI-TOF Mass Spectrum. The N-terminal 15 amino acid residues of the purified AAI-CC5 were DTGSPAPECVEYFQS, which is dissimilar to other reported proteinaceous α-amylase inhibitors. AAI-CC5 is a pH insensitive and heat-stable protein, and cannot be hydrolysed by trypsin. AAI-CC5 was cloned and expressed in Escherichia coli BL21 (DE3) with a hexa-histidine tag on the C terminal. AAI-CC5 shared 82 % identity with Parvulustat. The recombinant α-amylase inhibitor was purified to homogeneity by one-step affinity chromatography using Ni(2+)-NTA resin with molecular mass of 9,404 Da. Steady state kinetics studies of α-amylase and the inhibitor revealed an irreversible, non-competitive inhibition mechanism with IC50 and Ki value of 6.43 ×1 10(-11) and 4.45 × 10(-11) M respectively. These results suggest this novel α-amylase inhibitor possessed powerful inhibitory activity for α-amylase, and it may be a candidate in research of diabetes therapy and obesity treatment.

  11. Human Lacrimal Gland Gene Expression

    PubMed Central

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian

    2017-01-01

    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151

  12. Effect of tetracycline administration on serum amylase activity in calves.

    PubMed

    Zendehbad, Bamdad; Alipour, Adeleh; Zendehbad, Hussein

    2013-01-01

    Tetracycline and related compounds are used extensively as broad spectrum antibiotics in the treatment of bacterial infections in ruminants. Tetracycline may cause acute pancreatitis which may result in increased serum amylase activity. However, it has been shown that administration of oxytetracycline in human results in decrease serum amylase activity. In this study changes in serum amylase activity were measured in 20 clinically healthy calves following intravenous injection of oxytetracycline hydrochloride at 10 mg/kg of body weight. Blood samples were collected at 30, 60, and 120 minutes after oxytetracycline injection. Serum amylase activity was measured using the amyloclastic assay. The activity of serum amylase was increased significantly (P < 0.05) at 30 (40.5%), 60 (35.1%), and 120 (39.3%) minutes after oxytetracycline hydrochloride administration. To the authors' knowledge this is the first study on the acute effect of tetracycline administration on serum amylase activity in calves.

  13. Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes

    SciTech Connect

    Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

    1999-12-20

    Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

  14. PtrBAM1, a β-amylase-coding gene of Poncirus trifoliata, is a CBF regulon member with function in cold tolerance by modulating soluble sugar levels.

    PubMed

    Peng, Ting; Zhu, Xiaofang; Duan, Nian; Liu, Ji-Hong

    2014-12-01

    β-Amylase (BAM) catalyses starch breakdown to generate maltose, which can be incorporated into sugar metabolism. However, the role of BAM genes in cold tolerance is less characterized. In this study, we report the isolation and functional characterization of a chloroplast-localizing BAM-encoding gene PtrBAM1 from Poncirus trifoliata. PtrBAM1 was induced by cold, dehydration and salt, but repressed by maltose. Overexpression of PtrBAM1 in tobacco (Nicotiana nudicaulis) increased BAM activity, promoted starch degradation and enhanced the contents of maltose and soluble sugars, whereas opposite changes were observed when PtrBAM1 homolog in lemon (Citrus lemon) was knocked down. The tobacco overexpressing lines exhibited enhanced tolerance to cold at chilling or freezing temperatures. Under cold stress, higher BAM activity and greater accumulation of maltose and soluble sugars were observed in the overexpressing lines when compared with the wild-type or empty vector transformants. Bioinformatics analysis demonstrated that PtrBAM1 promoter contained a CBF-recognizing element. Yeast one-hybrid assay demonstrated that PtrCBF could interact with the promoter fragment containing the element. Taken together, these results demonstrate that PtrBAM1 is a member of CBF regulon and plays an important role in cold tolerance by modulating the levels of soluble sugars acting as osmolytes or antioxidants.

  15. Transcriptional gene silencing in humans

    PubMed Central

    Weinberg, Marc S.; Morris, Kevin V.

    2016-01-01

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  16. Comparing the evolutionary conservation between human essential genes, human orthologs of mouse essential genes and human housekeeping genes.

    PubMed

    Lv, Wenhua; Zheng, Jiajia; Luan, Meiwei; Shi, Miao; Zhu, Hongjie; Zhang, Mingming; Lv, Hongchao; Shang, Zhenwei; Duan, Lian; Zhang, Ruijie; Jiang, Yongshuai

    2015-11-01

    Human housekeeping genes are often confused with essential human genes, and several studies regard both types of genes as having the same level of evolutionary conservation. However, this is not necessarily the case. To clarify this, we compared the differences between human housekeeping genes and essential human genes with respect to four aspects: the evolutionary rate (dN/dS), protein sequence identity, single-nucleotide polymorphism (SNP) density and level of linkage disequilibrium (LD). The results showed that housekeeping genes had lower evolutionary rates, higher sequence identities, lower SNP densities and higher levels of LD compared with essential genes. Together, these findings indicate that housekeeping and essential genes are two distinct types of genes, and that housekeeping genes have a higher level of evolutionary conservation. Therefore, we suggest that researchers should pay careful attention to the distinctions between housekeeping genes and essential genes. Moreover, it is still controversial whether we should substitute human orthologs of mouse essential genes for human essential genes. Therefore, we compared the evolutionary features between human orthologs of mouse essential genes and human housekeeping genes and we got inconsistent results in long-term and short-term evolutionary characteristics implying the irrationality of simply replacing human essential genes with human orthologs of mouse essential genes.

  17. Amylase activity is associated with AMY2B copy numbers in dog: implications for dog domestication, diet and diabetes.

    PubMed

    Arendt, Maja; Fall, Tove; Lindblad-Toh, Kerstin; Axelsson, Erik

    2014-10-01

    High amylase activity in dogs is associated with a drastic increase in copy numbers of the gene coding for pancreatic amylase, AMY2B, that likely allowed dogs to thrive on a relatively starch-rich diet during early dog domestication. Although most dogs thus probably digest starch more efficiently than do wolves, AMY2B copy numbers vary widely within the dog population, and it is not clear how this variation affects the individual ability to handle starch nor how it affects dog health. In humans, copy numbers of the gene coding for salivary amylase, AMY1, correlate with both salivary amylase levels and enzyme activity, and high amylase activity is related to improved glycemic homeostasis and lower frequencies of metabolic syndrome. Here, we investigate the relationship between AMY2B copy numbers and serum amylase activity in dogs and show that amylase activity correlates with AMY2B copy numbers. We then describe how AMY2B copy numbers vary in individuals from 20 dog breeds and find strong breed-dependent patterns, indicating that the ability to digest starch varies both at the breed and individual level. Finally, to test whether AMY2B copy number is strongly associated with the risk of developing diabetes mellitus, we compare copy numbers in cases and controls as well as in breeds with varying diabetes susceptibility. Although we see no such association here, future studies using larger cohorts are needed before excluding a possible link between AMY2B and diabetes mellitus. © 2014 The Authors. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.

  18. The human crystallin gene families

    PubMed Central

    2012-01-01

    Crystallins are the abundant, long-lived proteins of the eye lens. The major human crystallins belong to two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins. During evolution, other proteins have sometimes been recruited as crystallins to modify the properties of the lens. In the developing human lens, the enzyme betaine-homocysteine methyltransferase serves such a role. Evolutionary modification has also resulted in loss of expression of some human crystallin genes or of specific splice forms. Crystallin organization is essential for lens transparency and mutations; even minor changes to surface residues can cause cataract and loss of vision. PMID:23199295

  19. Effects of a new microbial α-amylase inhibitor protein on Helicoverpa armigera larvae.

    PubMed

    Zeng, Fanrong; Wang, Xiaojing; Cui, Jinjie; Ma, Yan; Li, Qiannan

    2013-03-06

    A new microbial α-amylase inhibitor gene was cloned and characterized. The encoded, recombinant, α-amylase inhibitor protein was induced and expressed by isopropyl β-d-1-thiogalactopyranoside (IPTG) in Escherichia coli M15 cells. The effects of the α-amylase inhibitor protein on Helicoverpa armigera larvae were studied. Compared to the control, the weight of H. armigera larvae fed the diet with recombinant α-amylase inhibitor protein added at a concentration of 20 μg/g was reduced by 49.8%. The total soluble protein of H. armigera larvae fed the diet with the α-amylase inhibitor protein added was also reduced by 36.8% compared to the control. The recombinant α-amylase inhibitor protein showed inhibition activity against α-amylase of H. armigera. These results suggested that this α-amylase inhibitor protein may be a promising bioinsecticide candidate for controlling H. armigera.

  20. Human germline gene therapy reconsidered.

    PubMed

    Resnik, D B; Langer, P J

    2001-07-20

    This paper reevaluates the notion of human germline gene therapy (HGLGT) in light of developments in biomedicine, biotechnology, and ethical and policy analysis. The essay makes the following key points. First, because the distinction among "therapy," "prevention," and "enhancement" is not clear in human genetics, "gene therapy" is an inadequate descriptor of the process and goals of germline genetic alterations. The alternate use of the phrase "human germline genome modification" (HGLGM) could avoid a misleading label. Second, procedures that could be construed as genetic "enhancement" may not be as morally problematic as some have supposed, once one understands that the boundaries between therapy, prevention, and enhancement are not obvious in genetic medicine. Third, HGLGM might be the medically and morally most appropriate way of avoiding the birth of a child with a genetic disease in only a small range of cases. Fourth, there are still many ethical and scientific problems relating to the safety and efficacy of HGLGM.

  1. Electrophoretically unique amylases in rat livers: phylogenic and ontogenic study on the mammalian liver.

    PubMed

    Koyama, Iwao; Komine, Shin-Ichi; Hokari, Shigeru; Matsunaga, Toshiyuki; Nakamura, Koh-Ich; Komoda, Tsugikazu

    2002-09-01

    Liver amylase activity in rodents was assayed with Blue Starch as substrate, and found to be higher than in humans or pigs. Based on the result of concanavalin A affinity chromatography, we found that the sugar moieties of amylase molecules increased in parallel with amylase activity in the tested mammals. However, the amounts of amylase proteins determined by Western bloting with anti-human salivary-type antibody as the probe, were similar to the levels in mammalian livers. Moreover, a similar expression of amylase mRNA was also detected in the mammalian livers by a reverse transcriptional-polymerase chain reaction using primers specific for the human salivary and/or pancreatic amylase complementary DNA (cDNA) sequences. The amylase was detected at the catalytic activity, protein molecule and mRNA levels in rat liver at all ages from fetus to adult. Salivary-type liver amylase activity increased up to one week after birth, and was maintained at the adult level thereafter. However, based on the results of the electrophoretic mobility test, livers with accelerated amylase activity, e.g., at 2-4 weeks after birth or during liver regeneration after partial hepatectomy, were also found to express an amylase electrophoretical identical to pancreatic-type amylase in addition to salivary-type activity. These results suggest that the liver may express an etopic amylase in a certain condition.

  2. Influence of amylase assay technique on renal clearance of amylase-creatinine ratio.

    PubMed

    Levitt, M D; Johnson, S G; Ellis, C J; Engel, R R

    1977-06-01

    The influence of amylase assay technique on the renal amylase/creatinine clearance measurement was determined by analysis of serum and urine specimens obtained from 10 normal subjects. CAm/CCr averaged 2.19 +/- 0.18% with a saccharogenic technique, 1.52 +/- 0.2% with an iodometric technique, and 0.80 +/- 0.08% with a chromogenic technique. Each of these values differed significantly (P less than 0.05) from the other two. Recovery studies were carried out by adding partially purified human salivary or pancreatic amylase to human newborn serum or urine (which contain minimal endogenous amylase). Equal amylase activity was recovered from serum and urine by the saccharogenic technique whereas recovery from urine was less than 50% of that from serum using the iodometric and chromogenic techniques. The accuracy of the chromogenic technique is markedly improved by the addition of albumin to the urine assay system. Although it appears that only the saccharogenic method provides an accurate estimate of CAm/CCr, each assay technique distinguished the elevated CAm/CCr of patients with pancreatitis from the normal range established for that technique. Accurate clinical interpretation of CAm/CCr measurment requires knowledge of the amylase assay technique used.

  3. Action pattern of human pancreatic and salivary alpha-amylase on 1,4-alpha-D-nitrophenylmaltooligosaccharides. 1,4-alpha-D-nitrophenylmaltooligosaccharides as substrates of alpha-amylse, I.

    PubMed

    Wallenfels, K; Laule, G; Meltzer, B

    1982-08-01

    High performance liquid chromatography (HPLC) was used to monitor the purity of the substrates and to establish the patterns of hydrolysis of ortho- and para-nitrophenylmaltooligosaccharides (2-7 glucose residues) catalysed by human pancreatic and salivary alpha-amylase. Separation of the reaction products from the remaining substrate was performed on a TSK-G-2000 PW or a RP18 column. By measuring the quantitative distribution of products, and assuming a 5-subsite model for the active site of alpha-amylase, differential activities for the hydrolysis of the different glycosidic bonds in the 2 series of substrates were deduced. A highly sensitive coupled continuous assay system is based on the formation of phenyloligosaccharides with 1-4 glucose residues by the action of the amylase under test, coupled to hydrolysis of these products by yeast alpha-glucosidase. The most suitable test substrates were shown to be para-nitrophenyl-alpha-D-maltotetraoside and -pentaoside. Direct production of nitrophenol from ortho-nitrophenyl-alpha-D-maltotrioside is recommended for the measurement of the alpha-amylase activity of pancreatic and salivary gland secretions and extracts.

  4. Genetic Variation in Amount of Salivary Amylase in the Bank Vole, CLETHRIONOMYS GLAREOLA

    PubMed Central

    Hjorth, J. Peter; Meisler, Miriam; Nielsen, J. Tønnes

    1979-01-01

    Several investigated bank vole populations are polymorphic for the number of salivary amylase loci, and individual chromosomes may carry one, two or three linked amylase structural genes. In the present study, we have used bank vole stocks homozygous for different chromosomes to investigate the relationship between amylase production and gene number. By measuring the amylase activity in parotid glands and the percentage of amylase protein in saliva, we have been able to demonstrate that the amount of salivary amylase is directly proportional to the proposed gene number. The paper also describes the allele, AmySu, which codes for a heat-labile salivary amylase. The relative amounts of the heat-labile isozyme have been determined in different heterozygotes containing this allele, and these results also support the multiple locus model. Finally, a stock devoid of salivary amylase activity was established. Animals from this strain have, however, a protein in the parotid glands and in saliva that is very similar to amylase in molecular weight, amino acid composition and in its binding to glycogen and cyclohepta-amylose. In genetic crosses, the protein segregates as an amylase allele. Therefore, this protein, encoded by the functionally null allele AmyN, may represent an incorrectly processed amylase precursor. PMID:94023

  5. Modeling of cooked starch digestion process using recombinant human pancreatic α-amylase and maltase-glucoamylase for in vitro evaluation of α-glucosidase inhibitors.

    PubMed

    Cao, Xiaofang; Zhang, Chen; Dong, Yangyang; Geng, Peng; Bai, Fang; Bai, Gang

    2015-09-23

    In human, digestion of cooked starch mainly involves breaking down of α-amylase to α-limit dextrins and small linear malto-oligosaccharides, which are in turn hydrolyzed to glucose by the gut mucosal maltase-glucoamylase (MGAM). Human pancreatic α-amylase (HPA), amino- and carboxyl-terminal portions of MGAM (ntMGAM and ctMGAM) catalyze the hydrolysis of α-D-(1,4) glycosidic linkages in starch, playing a crucial role in the production of glucose in the human lumen. Accordingly, these enzymes are effective drug targets for the treatments of type 2 diabetes and obesity. In this study, a Plackett-Burman based statistical screening procedure was adopted to determine the most critical factors affecting cooked starch digestion by the combination of HPA, ctMGAM and ntMGAM. Six factors were tested and experimental results showed that pH and temperature were the major influencing factors, with optimal pH and temperature at 6.0 and 50 °C, respectively. Surprisingly, ntMGAM had no significant contribution to the glucose production from starch digestion compared to the HPA and ctMGAM. The optimal proportion of HPA and ctMGAM in a starch digestion system was further determined by response surface methodology. Results showed a maximum starch digestion (88.05%) within 0.5 h when used HPA:ctMGAM=1:9 (U). The inhibitory effects of various inhibitors on the cooked starch digestion by HPA1/ctMGAM9 were evaluated by determining their half maximal inhibitory concentration (IC50) values. Acarviostatin II03 showed the highest inhibitory activity, with 67 times higher potency than acarbose. Moreover, acarviostatin II03 could significantly depress postprandial blood glucose levels in mice, better than that by acarbose. These findings suggest that our in vitro enzymatic system can simulate in vivo starch digestion process, and thus can be used to screen and evaluate α-glucosidase inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Syntenic conservation of HSP70 genes in cattle and humans

    SciTech Connect

    Grosz, M.D.; Womack, J.E.; Skow, L.C. )

    1992-12-01

    A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digested DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.

  7. SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules

    SciTech Connect

    Koropatkin, Nicole M.; Smith, Thomas J.

    2010-09-21

    SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  8. SusG: a unique cell-membrane-associated alpha-amylase from a prominent human gut symbiont targets complex starch molecules.

    PubMed

    Koropatkin, Nicole M; Smith, Thomas J

    2010-02-10

    SusG is an alpha-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  9. Activities of Human Gene Nomenclature Committee

    SciTech Connect

    2002-07-16

    The objective of this project, shared between NIH and DOE, has been and remains to enable the medical genetics communities to use common names for genes that are discovered by different gene hunting groups, in different species. This effort provides consistent gene nomenclature and approved gene symbols to the community at large. This contributes to a uniform and consistent understanding of genomes, particularly the human as well as functional genomics based on comparisons between homologous genes in related species (human and mice).

  10. Construction of human naive antibody gene libraries.

    PubMed

    Hust, Michael; Frenzel, André; Meyer, Torsten; Schirrmann, Thomas; Dübel, Stefan

    2012-01-01

    Human antibodies are valuable tools for proteome research and diagnostics. Furthermore, antibodies are a rapidly growing class of therapeutic agents, mainly for inflammation and cancer therapy. The first therapeutic antibodies are of murine origin and were chimerized or humanized. The later-developed antibodies are fully human antibodies. Here, two technologies are competing the hybridoma technology using transgenic mice with human antibody gene loci and antibody phage display. The starting point for the selection of human antibodies against any target is the construction of an antibody phage display gene library.In this review we describe the construction of human naive and immune antibody gene libraries for antibody phage display.

  11. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  12. Genetic and Biochemical Studies on Cell-Bound α-Amylase in Bacillus subtilis Marburg

    PubMed Central

    Nagata, Yoshiho; Yamaguchi, Kazuo; Maruo, Bunji

    1974-01-01

    A small but significant amount of α-amylase activity was detected in the cells of Bacillus subtilis Marburg. The cell-associated activity was almost constant regardless of the level of extracellular α-amylase activity. The cell-bound amylase activity could be separated into three components, upon Sephadex G-75 chromatography, referred to as components A, B, and C. Component C showed the same properties as the extracellular α-amylases so far examined. Component A had a molecular weight greater than 70,000, as judged from the elution position on Sephadex G-75, and became smaller upon treatment with trypsin but was still larger than that of component C. An α-amylase mutant that lacked extracellular α-amylase completely because of a mutation within the structural gene of the enzyme was found to lose all three cell-bound amylase components simultaneously. These data suggest strongly that the cell-bound amylase components are precursors of the extracellular α-amylase and that the α-amylase of this organism is produced under the direction of the same gene whether the enzyme is within or outside the cell. PMID:4212029

  13. GeneCards Version 3: the human gene integrator.

    PubMed

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-08-05

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73,000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards' unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene's functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database

  14. Salivary amylase - The enzyme of unspecialized euryphagous animals.

    PubMed

    Boehlke, Carolin; Zierau, Oliver; Hannig, Christian

    2015-08-01

    Alpha-amylase (EC 3.2.1.1) is the most abundant enzyme in the saliva of man and of several vertebrates. In humans, salivary amylase is mainly formed in the parotid gland; its activity is of high inter-individual and intra-individual variability. The physiological functions of α-amylase have not yet been explored completely. It is well known that the enzyme cleaves the α-(1,4)-glycosidic bonds of polysaccharides. Furthermore it plays an important role in initial bioadhesion in man, facilitating carbohydrate metabolism and bacterial adherence at the tooth surface and therewith caries initiation. Nevertheless, it is still a matter of interest why humans have such high amounts of salivary amylase. The review presents an evolutionary approach by considering salivary amylase in the animal kingdom with special focus on mammalians divided into the three main nutritional types carnivores, herbivores, and omnivores; it was postulated that for most mammalian animals salivary α-amylase is essential. The enzyme has been detected in saliva of some herbivores and many omnivorous animals, but not in pure carnivores. Focusing on ruminants, negligible levels or an absence of α-amylase was determined. Presence and activity probably differ depending on the species-specific diet. Animals feeding on unripe fruits, seeds, roots and bulbs exhibit higher activity of salivary α-amylase than species consuming ripe fruits, insects, and vertebrates. In contrast to carnivores and most herbivores, omnivores have considerable amounts of amylase in their saliva. Though, the starch-digesting enzyme has been investigated well, the physiological function of amylase in saliva has not yet been explored completely. It can be hypothesized that nutritional habits affect expression of enzymes in the saliva of animals. It has to be verified, whether α-amylase is genetically or epigenetically determined. As a consequence of the development of agriculture, and following dietary changes, amylase can be

  15. GeneCards Version 3: the human gene integrator

    PubMed Central

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-01-01

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73 000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards’ unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene’s functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite

  16. Detergent-compatible bacterial amylases.

    PubMed

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  17. Gene Conversion in Human Genetic Disease

    PubMed Central

    Chen, Jian-Min; Férec, Claude; Cooper, David N.

    2010-01-01

    Gene conversion is a specific type of homologous recombination that involves the unidirectional transfer of genetic material from a ‘donor’ sequence to a highly homologous ‘acceptor’. We have recently reviewed the molecular mechanisms underlying gene conversion, explored the key part that this process has played in fashioning extant human genes, and performed a meta-analysis of gene-conversion events known to have caused human genetic disease. Here we shall briefly summarize some of the latest developments in the study of pathogenic gene conversion events, including (i) the emerging idea of minimal efficient sequence homology (MESH) for homologous recombination, (ii) the local DNA sequence features that appear to predispose to gene conversion, (iii) a mechanistic comparison of gene conversion and transient hypermutability, and (iv) recently reported examples of pathogenic gene conversion events. PMID:24710102

  18. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    SciTech Connect

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. )

    1989-09-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  19. Cloning and starch degradation profile of maltotriose-producing amylases from Streptomyces species.

    PubMed

    Kashiwagi, Norimasa; Miyake, Michiru; Hirose, Shuichi; Sota, Masahiro; Ogino, Chiaki; Kondo, Akihiko

    2014-11-01

    The end products from starch hydrolysis by amylases have important applications in various industries. Here, two amylases derived from two Streptomyces species that hydrolyze soluble starch from potato produced maltotriose as the primary maltooligosaccharide product. The genes, annotated as putative glycoside hydrolases, were cloned and expressed in Streptomyces lividans. These amylases displayed hydrolysis activity from pH 3 to 9.5 and were not affected by Ca(2+.) Optimal production of maltotriose was between 20 and 30 °C at pH 6.5. At the optimal temperature, both amylases produced maltotriose-rich end products rather than either maltose or maltotetraose.

  20. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  1. Acyclic peptide inhibitors of amylases.

    PubMed

    Pohl, Nicola

    2005-12-01

    In this issue of Chemistry and Biology, a library screening approach reveals a linear octapeptide inhibitor of alpha-amylases reached by de novo design . The selected molecule shares characteristics with naturally occurring protein inhibitors -- a result that suggests general rules for the design of peptide-based amylase inhibitors may be achievable.

  2. Characterization of the human jumonji gene.

    PubMed

    Bergé-Lefranc, J L; Jay, P; Massacrier, A; Cau, P; Mattei, M G; Bauer, S; Marsollier, C; Berta, P; Fontes, M

    1996-10-01

    While constructing a cDNA library of human embryos, we have isolated a clone homologous to jumonji, a mouse gene required for neural tube formation. We have determined the complete coding sequence of the human homologue (JMJ) and deduced the amino acid sequence of the putative protein. We show here that human and mouse jumonji putative proteins are homologous and present 90% identity. During human embryogenesis, JMJ mRNAs are predominantly expressed in neurons and particularly in dorsal root ganglion cells. They are also expressed in neurons of human adult cerebral cortex. In view of these observations, we propose JMJ as a candidate gene for developmental defects of the central nervous system in the human. The human JMJ gene maps at position 6p24-6p23.

  3. A Catholic perspective on human gene therapy.

    PubMed

    Cassidy, Joseph D; Pellegrino, Edmund D

    1993-03-01

    The questions of changes in the human genetic program have been debated by world legislatures, churches, and scientific communities. Papal teachings emphasize a global respect for each patient and the sacred dignity of all human beings. We outline six moral principles proposed as Catholic Christian perspective applicable to a bioethical evaluation of advances in human gene transfer.

  4. Alpha-amylases of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant amylase inhibitors.

    PubMed

    Valencia, A; Bustillo, A E; Ossa, G E; Chrispeels, M J

    2000-03-01

    The adult coffee berry borer (Hypothenemus hampei Ferrari [Coleoptera: Scolytidae]), a major insect pest of coffee, has two major digestive alpha-amylases that can be separated by isoelectric focusing. The alpha-amylase activity has a broad pH optimum between 4.0 and 7.0. Using pH indicators, the pH of the midgut was determined to be between 4.5 and 5.2. At pH 5.0, the coffee berry borer alpha-amylase activity is inhibited substantially (80%) by relatively low levels of the amylase inhibitor (alphaAI-1) from the common bean, Phaseolus vulgaris L., and much less so by the amylase inhibitor from Amaranthus. We used an in-gel zymogram assay to demonstrate that seed extracts can be screened to find suitable inhibitors of amylases. The prospect of using the genes that encode these inhibitors to make coffee resistant to the coffee berry borer via genetic engineering is discussed.

  5. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  6. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  7. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.

    PubMed

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D

    2013-04-01

    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed.

  8. Gene Insertion Into Genomic Safe Harbors for Human Gene Therapy

    PubMed Central

    Papapetrou, Eirini P; Schambach, Axel

    2016-01-01

    Genomic safe harbors (GSHs) are sites in the genome able to accommodate the integration of new genetic material in a manner that ensures that the newly inserted genetic elements: (i) function predictably and (ii) do not cause alterations of the host genome posing a risk to the host cell or organism. GSHs are thus ideal sites for transgene insertion whose use can empower functional genetics studies in basic research and therapeutic applications in human gene therapy. Currently, no fully validated GSHs exist in the human genome. Here, we review our formerly proposed GSH criteria and discuss additional considerations on extending these criteria, on strategies for the identification and validation of GSHs, as well as future prospects on GSH targeting for therapeutic applications. In view of recent advances in genome biology, gene targeting technologies, and regenerative medicine, gene insertion into GSHs can potentially catalyze nearly all applications in human gene therapy. PMID:26867951

  9. [Advances of alkaline amylase production and applications].

    PubMed

    Yang, Haiquan; Liu, Long; Li, Jianghua; Du, Guocheng; Chen, Jian

    2012-04-01

    Alkaline amylase is one of alkaline enzymes with optimum pH in the alkaline range, and it could keep stability and efficiently hydrolyze starch under alkaline conditions. Alkaline amylase finds wide applications in textile, detergent, pharmaceutical, food and other fields. Alkaline amylases could be produced by alkaliphilic microorganisms. In this work, the advances of alkaline amylase production and applications were reviewed.

  10. Genome editing for human gene therapy.

    PubMed

    Meissner, Torsten B; Mandal, Pankaj K; Ferreira, Leonardo M R; Rossi, Derrick J; Cowan, Chad A

    2014-01-01

    The rapid advancement of genome-editing techniques holds much promise for the field of human gene therapy. From bacteria to model organisms and human cells, genome editing tools such as zinc-finger nucleases (ZNFs), TALENs, and CRISPR/Cas9 have been successfully used to manipulate the respective genomes with unprecedented precision. With regard to human gene therapy, it is of great interest to test the feasibility of genome editing in primary human hematopoietic cells that could potentially be used to treat a variety of human genetic disorders such as hemoglobinopathies, primary immunodeficiencies, and cancer. In this chapter, we explore the use of the CRISPR/Cas9 system for the efficient ablation of genes in two clinically relevant primary human cell types, CD4+ T cells and CD34+ hematopoietic stem and progenitor cells. By using two guide RNAs directed at a single locus, we achieve highly efficient and predictable deletions that ablate gene function. The use of a Cas9-2A-GFP fusion protein allows FACS-based enrichment of the transfected cells. The ease of designing, constructing, and testing guide RNAs makes this dual guide strategy an attractive approach for the efficient deletion of clinically relevant genes in primary human hematopoietic stem and effector cells and enables the use of CRISPR/Cas9 for gene therapy.

  11. A gene map of the human genome.

    PubMed

    Schuler, G D; Boguski, M S; Stewart, E A; Stein, L D; Gyapay, G; Rice, K; White, R E; Rodriguez-Tomé, P; Aggarwal, A; Bajorek, E; Bentolila, S; Birren, B B; Butler, A; Castle, A B; Chiannilkulchai, N; Chu, A; Clee, C; Cowles, S; Day, P J; Dibling, T; Drouot, N; Dunham, I; Duprat, S; East, C; Edwards, C; Fan, J B; Fang, N; Fizames, C; Garrett, C; Green, L; Hadley, D; Harris, M; Harrison, P; Brady, S; Hicks, A; Holloway, E; Hui, L; Hussain, S; Louis-Dit-Sully, C; Ma, J; MacGilvery, A; Mader, C; Maratukulam, A; Matise, T C; McKusick, K B; Morissette, J; Mungall, A; Muselet, D; Nusbaum, H C; Page, D C; Peck, A; Perkins, S; Piercy, M; Qin, F; Quackenbush, J; Ranby, S; Reif, T; Rozen, S; Sanders, C; She, X; Silva, J; Slonim, D K; Soderlund, C; Sun, W L; Tabar, P; Thangarajah, T; Vega-Czarny, N; Vollrath, D; Voyticky, S; Wilmer, T; Wu, X; Adams, M D; Auffray, C; Walter, N A; Brandon, R; Dehejia, A; Goodfellow, P N; Houlgatte, R; Hudson, J R; Ide, S E; Iorio, K R; Lee, W Y; Seki, N; Nagase, T; Ishikawa, K; Nomura, N; Phillips, C; Polymeropoulos, M H; Sandusky, M; Schmitt, K; Berry, R; Swanson, K; Torres, R; Venter, J C; Sikela, J M; Beckmann, J S; Weissenbach, J; Myers, R M; Cox, D R; James, M R; Bentley, D; Deloukas, P; Lander, E S; Hudson, T J

    1996-10-25

    The human genome is thought to harbor 50,000 to 100,000 genes, of which about half have been sampled to date in the form of expressed sequence tags. An international consortium was organized to develop and map gene-based sequence tagged site markers on a set of two radiation hybrid panels and a yeast artificial chromosome library. More than 16,000 human genes have been mapped relative to a framework map that contains about 1000 polymorphic genetic markers. The gene map unifies the existing genetic and physical maps with the nucleotide and protein sequence databases in a fashion that should speed the discovery of genes underlying inherited human disease. The integrated resource is available through a site on the World Wide Web at http://www.ncbi.nlm.nih.gov/SCIENCE96/.

  12. Paper-based α-amylase detector for point-of-care diagnostics.

    PubMed

    Dutta, Satarupa; Mandal, Nilanjan; Bandyopadhyay, Dipankar

    2016-04-15

    We report the fabrication of a paper-sensor for quantitative detection of α-amylase activity in human blood serum. Pieces of filter papers were coated with starch-iodine solution leading to an intense blue coloration on the surface. Dispensing α-amylase solution on the starch-iodine coated paper reduced the intensity of the color because of starch-hydrolysis catalyzed by amylase. The variation in the intensity of the color with the concentration of amylase was estimated in three stages: (i) initially, the paper-surface was illuminated with a light emitting diode, (ii) then, the transmitted (reflected) rays emitted through (from) the paper were collected on a photoresistor, and (iii) the variations in the electrical resistance of the photoresistor were correlated with the amylase concentration in analyte. The resistance of photoresistor decreased monotonically with an increase in amylase concentration because the intensity of the reflected (transmitted) rays collected from (through) the paper increased with reduction in the color intensity on the paper surface. Since a specific bio-reaction was employed to detect the activity of amylase, the sensor was found to be equally efficient in detecting unknown quantities of amylase in human blood serum. The reported sensor has shown the potential to graduate into a point-of-care detection tool for α-amylase.

  13. [Some enzymatic activities of the amniotic fluid in human beings (LAP, GGTP, SGOT, SGPT, acid and alkaline phosphatases, 5' nucleotidase, amylase, beta-glucuronidase and aldolase)].

    PubMed

    Galerne, D; Baudon, J; Bruhat, M; Dastugue, G

    1973-10-01

    Quantitative analyses of 10 enzymes (LAP, GGTP, SGOT, SGPT. acid and alkaline phosphatases, 5' nucleotidase, amylase. beta-glucuronidase and aldolase) in a series of 50 samples of amniotic fluid gave widely-scattered results. In some cases, it was possible to relate high enzymatic activity to a pathological condition, in other cases, the amniotic fluid examined seemed to come from normal, full-term or almost full-term pregnancies without particular signs.

  14. Exon structure of the human dystrophin gene

    SciTech Connect

    Roberts, R.G.; Coffey, A.J.; Bobrow, M.; Bentley, D.R.

    1993-05-01

    Application of a novel vectorette PCR approach to defining intron-exon boundaries has permitted completion of analysis of the exon structure of the largest and most complex known human gene. The authors present here a summary of the exon structure of the entire human dystrophin gene, together with the sizes of genomic HindIII fragments recognized by each exon, and (where available) GenBank accession numbers for adjacent intron sequences. 20 refs., 1 tab.

  15. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  16. Isolation of Mutants Defective in α-Amylase from Bacillus subtilis: Genetic Analyses

    PubMed Central

    Yamaguchi, Kazuo; Nagata, Yoshiho; Maruo, Bunji

    1974-01-01

    The rate of α-amylase (EC 3.2.1.1) synthesis in Bacillus subtilis is regulated by a gene, amyR, located near a structural gene, amyE, for the enzyme. To construct a fine map of the amyR-amyE region, we isolated 28 mutants defective in α-amylase activity. Eleven mutants out of 28 showed no α-amylase activity, whereas the other 17 showed less α-amylase activity than the parent. Out of 17 partially positive α-amylase mutants, 10 produced temperature-sensitive enzymes, and 4 produced immunologically altered enzymes, two of which are concurrently temperature-sensitive, and 5 produced smaller amounts of α-amylases which are indistinguishable from normal enzyme in their temperature sensitivity and immunological properties. Two out of 11 α-amylase-negative mutants produced material that cross-reacted with anti-amylase serum, and 3 mutants carried suppressible mutations by the suppressor described by Okubo. Mapping data indicate that all 28 mutation sites are located in the amyE region, and none of the groups of the mutants mentioned above contains lesions that are clustered in a single region of amyE. The amyR gene seems most likely to adjoin the terminal region of amyE. PMID:4212116

  17. Human specific loss of olfactory receptor genes

    PubMed Central

    Gilad, Yoav; Man, Orna; Pääbo, Svante; Lancet, Doron

    2003-01-01

    Olfactory receptor (OR) genes constitute the basis for the sense of smell and are encoded by the largest mammalian gene superfamily of >1,000 genes. In humans, >60% of these are pseudogenes. In contrast, the mouse OR repertoire, although of roughly equal size, contains only ≈20% pseudogenes. We asked whether the high fraction of nonfunctional OR genes is specific to humans or is a common feature of all primates. To this end, we have compared the sequences of 50 human OR coding regions, regardless of their functional annotations, to those of their putative orthologs in chimpanzees, gorillas, orangutans, and rhesus macaques. We found that humans have accumulated mutations that disrupt OR coding regions roughly 4-fold faster than any other species sampled. As a consequence, the fraction of OR pseudogenes in humans is almost twice as high as in the non-human primates, suggesting a human-specific process of OR gene disruption, likely due to a reduced chemosensory dependence relative to apes. PMID:12612342

  18. False-positive results with amylase testing of citrus fruits.

    PubMed

    Ricci, Ugo; Carboni, Ilaria; Torricelli, Francesca

    2014-09-01

    In a case of robbery in which the criminals passed through the garden adorned with calamondin trees (Citrus madurensis), the investigators found in the grass six calamondin fruits, some undamaged, while others apparently bitten. The fruits were collected and sent to the laboratory for DNA analysis to verify the presence of saliva and robbers' DNA profile. A specific immunochromatographic strip test for saliva confirmed the presence of human salivary α-amylase, but similar positive results were also observed for intact calamondin and other citrus fruits. Further analysis with a specific automated amylase test confirmed the absence of amylase activity. DNA quantification and typing using a specific forensic kit revealed no human DNA presence in any fruits. This case report demonstrates for the first time the occurrence of false positives when human saliva is sought on citrus fruits. © 2014 American Academy of Forensic Sciences.

  19. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus

    PubMed Central

    Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  20. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    PubMed

    Rodríguez-Viera, Leandro; Perera, Erick; Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  1. [Immune response genes products in human physiology].

    PubMed

    Khaitov, R M; Alekseev, L P

    2012-09-01

    Current data on physiological role of human immune response genes' proteomic products (antigens) are discussed. The antigens are specified by a very high level of diversity that mediates a wide specter ofphysiological functions. They actually provide integrity and biological stability of human as species. These data reveal new ideas on many pathological processes as well as drafts new approaches for prophylaxis and treatment.

  2. Organization of the human myoglobin gene.

    PubMed Central

    Weller, P; Jeffreys, A J; Wilson, V; Blanchetot, A

    1984-01-01

    Cross-hybridization of the grey seal myoglobin gene to human DNA detected a single human myoglobin gene plus an extensive family of sequences apparently related to the central exon of this gene. The functional human gene is 10.4 kb long and has a haemoglobin-like three exon/two intron structure with long non-coding regions similar to its seal homologue. At least 300 bp of 5'-flanking region are closely homologous between the two genes, with the exception of a divergent purine-rich region 68-114 bp upstream of the cap site. A diverged tandem repetitive sequence based on (GGAT)165 is located 1100-1750 bp upstream from the gene; internal homology units within this sequence suggest sequence homogenization by gene microconversions. A second 33-bp tandem repeat element in the first intron is flanked by a 9-bp direct repeat, shares homology with other tandem repetitive elements in the human genome and may represent a novel form of transposable element. Images Fig. 2. PMID:6571704

  3. Expression of polarity genes in human cancer.

    PubMed

    Lin, Wan-Hsin; Asmann, Yan W; Anastasiadis, Panos Z

    2015-01-01

    Polarity protein complexes are crucial for epithelial apical-basal polarity and directed cell migration. Since alterations of these processes are common in cancer, polarity proteins have been proposed to function as tumor suppressors or oncogenic promoters. Here, we review the current understanding of polarity protein functions in epithelial homeostasis, as well as tumor formation and progression. As most previous studies focused on the function of single polarity proteins in simplified model systems, we used a genomics approach to systematically examine and identify the expression profiles of polarity genes in human cancer. The expression profiles of polarity genes were distinct in different human tissues and classified cancer types. Additionally, polarity expression profiles correlated with disease progression and aggressiveness, as well as with identified cancer types, where specific polarity genes were commonly altered. In the case of Scribble, gene expression analysis indicated its common amplification and upregulation in human cancer, suggesting a tumor promoting function.

  4. Expression of Polarity Genes in Human Cancer

    PubMed Central

    Lin, Wan-Hsin; Asmann, Yan W; Anastasiadis, Panos Z

    2015-01-01

    Polarity protein complexes are crucial for epithelial apical–basal polarity and directed cell migration. Since alterations of these processes are common in cancer, polarity proteins have been proposed to function as tumor suppressors or oncogenic promoters. Here, we review the current understanding of polarity protein functions in epithelial homeostasis, as well as tumor formation and progression. As most previous studies focused on the function of single polarity proteins in simplified model systems, we used a genomics approach to systematically examine and identify the expression profiles of polarity genes in human cancer. The expression profiles of polarity genes were distinct in different human tissues and classified cancer types. Additionally, polarity expression profiles correlated with disease progression and aggressiveness, as well as with identified cancer types, where specific polarity genes were commonly altered. In the case of Scribble, gene expression analysis indicated its common amplification and upregulation in human cancer, suggesting a tumor promoting function. PMID:25991909

  5. Establishment of a novel, eco-friendly transgenic pig model using porcine pancreatic amylase promoter-driven fungal cellulase transgenes.

    PubMed

    Lin, Y S; Yang, C C; Hsu, C C; Hsu, J T; Wu, S C; Lin, C J; Cheng, W T K

    2015-02-01

    Competition between humans and livestock for cereal and legume grains makes it challenging to provide economical feeds to livestock animals. Recent increases in corn and soybean prices have had a significant impact on the cost of feed for pig producers. The utilization of byproducts and alternative ingredients in pig diets has the potential to reduce feed costs. Moreover, unlike ruminants, pigs have limited ability to utilize diets with high fiber content because they lack endogenous enzymes capable of breaking down nonstarch polysaccharides into simple sugars. Here, we investigated the feasibility of a transgenic strategy in which expression of the fungal cellulase transgene was driven by the porcine pancreatic amylase promoter in pigs. A 2,488 bp 5'-flanking region of the porcine pancreatic amylase gene was cloned by the genomic walking technique, and its structural features were characterized. Using GFP as a reporter, we found that this region contained promoter activity and had the potential to control heterologous gene expression. Transgenic pigs were generated by pronuclear microinjection. Founders and offspring were identified by PCR and Southern blot analyses. Cellulase mRNA and protein showed tissue-specific expression in the pancreas of F1 generation pigs. Cellulolytic enzyme activity was also identified in the pancreas of transgenic pigs. These results demonstrated the establishment of a tissue-specific promoter of the porcine pancreatic amylase gene. Transgenic pigs expressing exogenous cellulase may represent a way to increase the intake of low-cost, fiber-rich feeds.

  6. Gene therapy for human genetic disease?

    PubMed

    Friedmann, T; Roblin, R

    1972-03-03

    In our view, gene therapy may ameliorate some human genetic diseases in the future. For this reason, we believe that research directed at the development of techniques for gene therapy should continue. For the foreseeable future, however, we oppose any further attempts at gene therapy in human patients because (i) our understanding of such basic processes as gene regulation and genetic recombination in human cells is inadequate; (ii) our understanding of the details of the relation between the molecular defect and the disease state is rudimentary for essentially all genetic diseases; and (iii) we have no information on the short-range and long-term side effects of gene therapy. We therefore propose that a sustained effort be made to formulate a complete set of ethicoscientific criteria to guide the development and clinical application of gene therapy techniques. Such an endeavor could go a long way toward ensuring that gene therapy is used in humans only in those instances where it will prove beneficial, and toward preventing its misuse through premature application. Two recent papers have provided new demonstrations of directed genetic modification of mammalian cells. Munyon et al. (44) restored the ability to synthesize the enzyme thymidine kinase to thymidine kinase-deficient mouse cells by infection with ultraviolet-irradiated herpes simplex virus. In their experiments the DNA from herpes simplex virus, which contains a gene coding for thymidine kinase, may have formed a hereditable association with the mouse cells. Merril et al. (45) reported that treatment of fibroblasts from patients with galactosemia with exogenous DNA caused increased activity of a missing enzyme, alpha-D-galactose-l-phosphate uridyltransferase. They also provided some evidence that the change persisted after subculturing the treated cells. If this latter report can be confirmed, the feasibility of directed genetic modification of human cells would be clearly demonstrated, considerably

  7. Amylase expression in taste receptor cells of rat circumvallate papillae.

    PubMed

    Merigo, Flavia; Benati, Donatella; Cecchini, Maria Paola; Cristofoletti, Mirko; Osculati, Francesco; Sbarbati, Andrea

    2009-06-01

    The chemical composition of the luminal content is now accepted to have a profound influence on the performance of chemosensory receptors. Gustatory and intestinal chemoreceptors have in common their expression of molecules involved in taste sensing and signal transduction pathways. The recent finding that enterocytes of the duodenal epithelium are capable of expressing luminal pancreatic amylase suggests that taste cells of the gustatory epithelium might, in the same way, express salivary amylase in the oral cavity. Therefore, we investigated amylase expression in rat circumvallate papillae by using analyses involving immunohistochemistry, Western blot, and reverse transcription with the polymerase chain reaction. In addition, we used double-labeling confocal laser microscopy to compare amylase immunolabeling with that of the following markers: protein gene product 9.5 (PGP 9.5) and chromogranin A (CgA) for endocrine cells, alpha-gustducin and phospholipase C beta 2 (PLC beta 2) as taste-signaling molecules, and cystic fibrosis transmembrane regulator (CFTR) and Clara-cell-specific secretory protein of 10-kDa (CC10) as secretory markers. The results showed that amylase was present in some taste bud cells; its immunoreactivity was observed in subsets of cells that expressed CgA, alpha-gustducin, PLC beta 2, CFTR, or CC10. PGP 9.5 immunoreactivity was never colocalized with amylase. The data suggest that amylase-positive cells constitute an additional subset of taste receptor cells also associated with chemoreceptorial and/or secretory molecules, confirming the occurrence of various pathways in taste buds.

  8. The retinoblastoma gene in human pituitary tumors

    SciTech Connect

    Cryns, V.L.; Arnold, A.; Alexander, J.M.; Klibanski, A. )

    1993-09-01

    Functional inactivation of the retinoblastoma (RB) tumor suppressor gene is important in the pathogenesis of many human tumors. Recently, the frequent occurrence of pituitary tumors was reported in mice genetically engineered to have one defective RB allele, a genetic background analogous to that of patients with familial retinoblastoma. The molecular pathogenesis of human pituitary tumors is largely unknown, and the potential role of RB gene inactivation in these neoplasms has not been examined. Consequently, the authors studied 20 human pituitary tumors (12 clinically nonfunctioning tumors, 4 somatotroph adenomas, 2 prolactinomas, and 2 corticotrophy adenomas) for tumor-specific allelic loss of the RB gene using a highly informative polymorphic locus within the gene. Control leukocyte DNA samples from 18 of these 20 patients were heterozygous at this locus, permitting genetic evaluation of their paired tumor specimens. In contrast to the pituitary tumors in the mouse model, none of these 18 human tumors exhibited RB allelic loss. These findings indicate that RB gene inactivation probably does not play an important role in the pathogenesis of common types of human pituitary tumors. 24 refs., 1 fig.

  9. Starch supplementation modulates amylase enzymatic properties and amylase B mRNA level in the digestive gland of the Pacific oyster Crassostrea gigas.

    PubMed

    Huvet, A; Jeffroy, F; Daniel, J Y; Quéré, C; Le Souchu, P; Van Wormhoudt, A; Boudry, P; Moal, J; Samain, J F

    2012-09-01

    In the oyster Crassostrea gigas consumption-related traits, amylase properties and growth were found to be linked through genotypes that differed for polymorphism in the two amylase genes AMYA and AMYB. Modulation of AMYA mRNA level had already been observed in response to food availability, whereas the functional role of AMYB was still unknown. To improve knowledge about the regulation of amylase expression in C. gigas and the respective roles of the two genes, we made an assay of amylase expression at mRNA and enzymatic levels in the digestive gland of oysters that had received dietary supplements of starch. After 18 days, a significant increase of translatable mRNA for AMYB was observed, with a correlated increase in Michaelis-Menten constant Km values and a decrease in total amylase activity. This modulation is the first evidence of observable functioning of AMYB in digestive processes. Amylase B is suggested to display a higher Km than amylase A, offering a means of adapting to high substrate concentrations. The highest starch supplement level (10 mgL(-1)) induced alteration in oyster physiology. The 1 mgL(-1) treatment should be tested as a practical food supplement that could lead to growth benefits for oysters. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Human DNA repair and recombination genes

    SciTech Connect

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs.

  11. The organization of the human HPRT gene.

    PubMed Central

    Kim, S H; Moores, J C; David, D; Respess, J G; Jolly, D J; Friedmann, T

    1986-01-01

    The organization of the X-linked gene for human hypoxanthine phosphoribosyltransferase (HPRT, EC 2.4.2.8.) has been determined by a combination of restriction endonuclease mapping, heteroduplex analysis and DNA sequence analysis of overlapping genomic clones. The entire gene is 42 kilobases in length and split into 9 exons. The sizes of the 7 internal exons and the exon-intron boundaries are identical to those of mouse HPRT gene. The 5' end of the gene lacks the prototypical 5' transcriptional regulatory sequence elements but contains extremely GC-rich sequences and five GC hexanucleotide motifs (5'-GGCGGG-3'). These structural features are very similar to those found in the mouse HPRT gene and to some of the regulatory signals common to a class of constitutively expressed "housekeeping" genes. Several transcriptional start sites have been identified by nuclease protection studies. Extensive sequence homology between the mouse and human genes is found in the 3' non-coding portion of the gene. Images PMID:3008106

  12. [EDAS, databases of alternatively spliced human genes].

    PubMed

    Nurtdinov, R N; Neverov, A D; Mal'ko, D B; Kosmodem'ianskiĭ, I A; Ermakova, E O; Ramenskiĭ, V E; Mironov, A A; Gel'fand, M S

    2006-01-01

    EDAS, a database of alternatively spliced human genes, contains data on the alignment of proteins, mRNAs, and EST. It contains information on all exons and introns observed, as well as elementary alternatives formed from them. The database makes it possible to filter the output data by changing the cut-off threshold by the significance level. The database is accessible at http://www.gene-bee.msu.ru/edas/.

  13. Advances in gene technology: Human genetic disorders

    SciTech Connect

    Scott, W.A.; Ahmad, F.; Black, S.; Schultz, J.; Whelan, W.J.

    1984-01-01

    This book discusses the papers presented at the conference on the subject of ''advances in Gene technology: Human genetic disorders''. Molecular biology of various carcinomas and inheritance of metabolic diseases is discussed and technology advancement in diagnosis of hereditary diseases is described. Some of the titles discussed are-Immunoglobulin genes translocation and diagnosis; hemophilia; oncogenes; oncogenic transformations; experimental data on mice, hamsters, birds carcinomas and sarcomas.

  14. Biochemical characterization of the alpha-amylase inhibitor in mungbeans and its application in inhibiting the growth of Callosobruchus maculatus.

    PubMed

    Wisessing, Anussorn; Engkagul, Arunee; Wongpiyasatid, Arunee; Choowongkomon, Kiattawee

    2010-02-24

    The insect Callosobruchus maculatus causes considerable damage to harvested mungbean seeds every year, which leads to commercial losses. However, recent studies have revealed that mungbean seeds contain alpha-amylase inhibitors that can inhibit the protein C. maculatus, preventing growth and development of the insect larvae in the seed, thus preventing further damage. For this reason, the use of alpha-amylase inhibitors to interfere with the pest's digestion process has become an interesting alternative biocontrolling agent. In this study, we have isolated and purified the alpha-amylase inhibitor from mungbean seeds (KPS1) using ammonium sulfate precipitation, gel filtration chromatography and reversed phase HPLC. We found that the alpha-amylase inhibitor, isolated as a monomer, had a molecular weight of 27 kDa. The alpha-amylase inhibitor was purified 750-fold with a final yield of 0.4 mg of protein per 30 g of mungbean seeds. Its specific activity was determined at 14.5 U (mg of protein)(-1). Interestingly, we found that the isolated alpha-amylase inhibitor inhibits C. maculatus alpha-amylase but not human salivary alpha-amylase. After preincubation of the enzyme with the inhibitor, the mungbean alpha-amylase inhibitor inhibited C. maculatus alpha-amylase activity by decreasing V(max) while increasing the K(m) constant, indicating that the mungbean alpha-amylase is a mix noncompetitive inhibitor. The in vivo effect of alpha-amylase inhibitor on the mortality of C. maculatus shows that the alpha-amylase inhibitor acts on C. maculatus during the development stage, by reducing carbohydrate digestion necessary for growth and development, rather than during the end laying/hatching stage. Our results suggest that mungbean alpha-amylase inhibitor could be a useful future biocontrolling agent.

  15. Genes of periodontopathogens expressed during human disease.

    PubMed

    Song, Yo-Han; Kozarov, Emil V; Walters, Sheila M; Cao, Sam Linsen; Handfield, Martin; Hillman, Jeffrey D; Progulske-Fox, Ann

    2002-12-01

    Since many bacterial genes are environmentally regulated, the screening for virulence-associated factors using classical genetic and molecular biology approaches can be biased under laboratory growth conditions of a given pathogen, because the required conditions for expression of many virulence factors may not occur during in vitro growth. Thus, technologies have been developed during the past several years to identify genes that are expressed during disease using animal models of human disease. However, animal models are not always truly representative of human disease, and with many pathogens, there is no appropriate animal model. A new technology, in vivo-induced antigen technology (IVIAT) was thus engineered and tested in our laboratory to screen for genes of pathogenic organisms induced specifically in humans, without the use of animal or artificial models of infection. This technology uses pooled sera from patients to probe for genes expressed exclusively in vivo (or ivi, in vivo-induced genes). IVIAT was originally designed for the study of Actinobacillus actinomycetemcomitans pathogenesis, but we have now extended it to other oral pathogens including Porphyromonas gingivalis. One hundred seventy-one thousand (171,000) clones from P. gingivalis strain W83 were screened and 144 were confirmed positive. Over 300,000 A. actinomycetemcomitans clones were probed, and 116 were confirmed positive using a quantitative blot assay. MAT has proven useful in identifying previously unknown in vivo-induced genes that are likely involved in virulence and are thus excellent candidates for use in diagnostic : and therapeutic strategies, including vaccine design.

  16. Allelic selection of human IL-2 gene.

    PubMed

    Matesanz, F; Delgado, C; Fresno, M; Alcina, A

    2000-12-01

    The allelic expression of mouse IL-2 cannot be definitely extrapolated to what might happen in humans. Therefore, we investigated the regulation of allelic expression of the IL-2 gene in non-genetically manipulated human T lymphocytes by following natural allelic polymorphisms. We found a phenotypically silent punctual change in the human IL-2 at position 114 after the first nucleotide of the initiation codon, which represents a dimorphic polymorphism at the first exon of the IL-2 gene. This allowed the study by single-cell PCR of the regulation of the human IL-2 allelic expression in heterozygous CD4(+) T cells, which was found to be tightly controlled monoallelically. These findings may be used as a suitable marker for monitoring the IL-2 allelic contribution to effector activities and in immune responses against different infections or in pathological situations.

  17. The morality of human gene patents.

    PubMed

    Resnik, David B

    1997-03-01

    This paper discusses the morality of patenting human genes and genetic technologies. After examining arguments on different sides of the issue, the paper concludes that there are, at present, no compelling reasons to prohibit the extension of current patent laws to the realm of human genetics. However, since advances in genetics are likely to have profound social implications, the most prudent course of action demands a continual reexamination of genetics laws and policies in light of ongoing developments in science and technology.

  18. Mango starch degradation. II. The binding of alpha-amylase and beta-amylase to the starch granule.

    PubMed

    Peroni, Fernanda Helena Gonçalves; Koike, Claudia; Louro, Ricardo Pereira; Purgatto, Eduardo; do Nascimento, João Roberto Oliveira; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2008-08-27

    During mango ripening, soluble sugars that account for mango sweetening are accumulated through carbon supplied by both photosynthesis and starch degradation. The cultivar Keitt has a characteristic dependence on sugar accumulation during starch degradation, which takes place during ripening, only a few days after detachment from the tree. Most knowledge about starch degradation is based on seeds and leaves currently used as models. However, information about the mango fruit is scarce. This work presents the evaluation of alpha- and beta-amylases in the starch granule surface during fruit development and ripening. Extractable proteins were assayed for amylase activity and detected by immunofluorescence microscopy and correlated to gene expression. The results suggest that both amylases are involved in starch degradation during mango ripening, probably under the dependence of another signal triggered by the detachment from the mother-plant.

  19. What drives codon choices in human genes?

    PubMed

    Karlin, S; Mrázek, J

    1996-10-04

    Synonymous codon usage is based and the bias seems to be different in different organisms. Factors with proposed roles in causing codon bias include degree and timing of gene expression, codon-anticodon interactions, transcription and translation rate and fidelity, codon context, and global and local G + C content. We offer a new perspective and new methods for elucidating codon choices applied especially to the human genome. We present data supporting the thesis that codon choices for human genes are largely a consequence of two factors: (1) amino acid constraints, (2) maintaining DNA structures dependent on base-step conformational tendencies consistent with the organism's genome signature that is determined by genome-wide processes of DNA modification, replication and repair. The related codon signature defined as the dinucleotide relative abundances at the distinct codon positions (1,2), (2,3), and (3,4) (4 = 1 of the next codon) accommodates both the global genome signature and amino acid constraints. In human genes, codon positions (2,3) and (3,4) containing the silent site have similar codon signatures reflecting DNA symmetry. Strong CG and TA dinucleotide underrepresentation is observed at all codon positions as well as in non-coding regions. Estimates of synonymous codon usage based on codon signatures are in excellent agreement with the actual codon usage in human and general vertebrate genes. These properties are largely independent of the isochore compartment (G + C content), gene size, and transcriptional and translational constraints. We hypothesize that major influences on codon usage in human genes result from residue preferences and diresidue associations in proteins coupled to biases on the DNA level, related to replication and repair processes and/or DNA structural requirements.

  20. Chromosomal localization of the human fibromodulin gene

    SciTech Connect

    Roughley, P.J.; Sztrolovics, R.; Grover, J.

    1994-09-01

    The identification and mapping of genes is a fundamental step in understanding inherited diseases. This study reports the chromosomal localization of the human gene encoding fibromodulin, a collagen-binding proteoglycan which exhibits a wide distribution in connective tissue extracellular matrices. Attempts to localize the gene utilizing a probe covering the published coding region of the human fibromodulin cDNA were unsuccessful. Thus, in order to obtain an alternate probe, the 3{prime}-untranslated region of the cDNA was cloned utilizing the 3{prime}-RACE protocol. Southern blot analysis of human genomic DNA with probes covering either the coding sequence or the 3{prime}-untranslated region revealed simple patterns, indicative of a single-copy gene. Fluorescence in situ hybridization analysis with the 3{prime}-untranslated region probe resulted in hybridization at two chromosomal regions. The majority of signals were observed at 1q32, but some signals were also observed at 9q34.1. The localization of the fibromodulin gene to chromosome 1 was confirmed by the polymerase chain reaction analysis of genomic DNA from a panel of somatic cell hybrid lines. In addition to allowing the gene localization, cloning of the 3{prime}-untranslated region demonstrates that the human fibromodulin cDNA possesses an insert of approximately 160 base pairs which is not present in the published bovine sequence. The human sequence also possesses a single polyadenylation signal, yielding a 3 kb mRNA which was observed in Northern blotting experiments. These results now provide the necessary information to evaluate the potential role of fibromodulin in genetic disorders of connective tissues.

  1. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    NASA Astrophysics Data System (ADS)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  2. A novel electrochemical method to determine α-amylase activity.

    PubMed

    Zhang, Juan; Cui, Junhui; Liu, Ying; Chen, Yangyang; Li, Genxi

    2014-07-07

    In this paper, we report a novel electrochemical method that can be developed as a biosensor for simple and direct determination of α-amylase activity. The method is based on the hydrolysis of maltopentaose, the substrate of the enzyme, which is immobilized on the surface of a gold electrode, and the induced charge changes of the substrate-modified electrode. Specifically, the substrate maltopentaose is immobilized onto a gold electrode surface via a simple and direct immobilization technique that involves a one-step and site-specific attachment of unmodified maltopentaose to the hydrazide-derivatized surface. So, by analyzing the electrochemical signal obtained from the electro-active molecule [Ru(NH3)5Cl](2+) during the hydrolysis of maltopentaose, the determination of α-amylase activity is achieved. Under optimized conditions, α-amylase activity can be assayed with a detection limit of 0.022 U mL(-1). The biosensor exhibits a rapid response, good stability and anti-interference ability. Furthermore, the biosensor has also been successfully applied to detect α-amylase in human serum, which shows acceptable accuracy compared to the currently used clinical method. The proposed method in this work may also have potential application of α-amylase determination in real blood samples, diagnostics and food production in the future.

  3. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation

    PubMed Central

    Nakajima, Kei

    2016-01-01

    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations (CNVs) in the salivary amylase gene (AMY1), which range more broadly than the pancreatic amylase gene (AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent (minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance (major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome. PMID:27022442

  4. Efficient production of optically pure D-lactic acid from raw corn starch by using a genetically modified L-lactate dehydrogenase gene-deficient and alpha-amylase-secreting Lactobacillus plantarum strain.

    PubMed

    Okano, Kenji; Zhang, Qiao; Shinkawa, Satoru; Yoshida, Shogo; Tanaka, Tsutomu; Fukuda, Hideki; Kondo, Akihiko

    2009-01-01

    In order to achieve direct and efficient fermentation of optically pure D-lactic acid from raw corn starch, we constructed L-lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum and introduced a plasmid encoding Streptococcus bovis 148 alpha-amylase (AmyA). The resulting strain produced only D-lactic acid from glucose and successfully expressed amyA. With the aid of secreting AmyA, direct D-lactic acid fermentation from raw corn starch was accomplished. After 48 h of fermentation, 73.2 g/liter of lactic acid was produced with a high yield (0.85 g per g of consumed sugar) and an optical purity of 99.6%. Moreover, a strain replacing the ldhL1 gene with an amyA-secreting expression cassette was constructed. Using this strain, direct D-lactic acid fermentation from raw corn starch was accomplished in the absence of selective pressure by antibiotics. This is the first report of direct D-lactic acid fermentation from raw starch.

  5. Marine Microbial Amylases: Properties and Applications.

    PubMed

    Suriya, J; Bharathiraja, S; Krishnan, M; Manivasagan, P; Kim, S-K

    Amylases are crucial enzymes which hydrolyze internal glycosidic linkages in starch and produce as primary products dextrins and oligosaccharides. Amylases are classified into α-amylase, β-amylase, and glucoamylase based on their three-dimensional structures, reaction mechanisms, and amino acid sequences. Amylases have innumerable applications in clinical, medical, and analytical chemistries as well as in food, detergent, textile, brewing, and distilling industries. Amylases can be produced from plants, animals, and microbial sources. Due to the advantages in microbial production, it meets commercial needs. The pervasive nature, easy production, and wide range of applications make amylase an industrially pivotal enzyme. This chapter will focus on amylases found in marine microorganisms, their potential industrial applications, and how these enzymes can be improved to the required bioprocessing conditions. © 2016 Elsevier Inc. All rights reserved.

  6. Mutational analysis of the human MAOA gene

    SciTech Connect

    Tivol, E.A.; Shalish, C.; Schuback, D.E.; Breakefield, X.O.; Hsu, Yun-Pung

    1996-02-16

    The monoamine oxidases (MAO-A and MAO-B) are the enzymes primarily responsible for the degradation of amine neurotransmitters, such as dopamine, norepinephrine, and serotonin. Wide variations in activity of these isozymes have been reported in control humans. The MAOA and MAOB genes are located next to each other in the p11.3-11.4 region of the human X chromosome. Our recent documentation of an MAO-A-deficiency state, apparently associated with impulsive aggressive behavior in males, has focused attention on genetic variations in the MAOA gene. In the present study, variations in the coding sequence of the MAOA gene were evaluated by RT-PCR, SSCP, and sequencing of mRNA or genomic DNA in 40 control males with >100-fold variations in MAOA activity, as measured in cultured skin fibroblasts. Remarkable conservation of the coding sequence was found, with only 5 polymorphisms observed. All but one of these were in the third codon position and thus did not alter the deduced amino acid sequence. The one amino acid alteration observed, lys{r_arrow}arg, was neutral and should not affect the structure of the protein. This study demonstrates high conservation of coding sequence in the human MAOA gene in control males, and provides primer sets which can be used to search genomic DNA for mutations in this gene in males with neuropsychiatric conditions. 47 refs., 1 fig., 2 tabs.

  7. Gene targeting in primary human trophoblasts

    PubMed Central

    Rosario, Fredrick J; Sadovsky, Yoel; Jansson, Thomas

    2012-01-01

    Studies in primary human trophoblasts provide critical insights into placental function in normal and complicated pregnancies. Mechanistic studies in these cells require experimental tools to modulate gene expression. Lipid-based methods to transfect primary trophoblasts are fairly simple to use and allow for the efficient delivery of nucleic acids, but potential toxic effects limit these methods. Viral vectors are versatile transfection tools of native trophoblastic or foreign cDNAs, providing high transfection efficiency, low toxicity and stable DNA integration into the trophoblast genome. RNA interference (RNAi), using small interfering RNA (siRNA) or microRNA, constitutes a powerful approach to silence trophoblast genes. However, off-target effects, such as regulation of unintended complementary transcripts, inflammatory responses and saturation of the endogenous RNAi machinery, are significant concerns. Strategies to minimize off-target effects include using multiple individual siRNAs, elimination of pro-inflammatory sequences in the siRNA construct and chemical modification of a nucleotide in the guide strand or of the ribose moiety. Tools for efficient gene targeting in primary human trophoblasts are currently available, albeit not yet extensively validated. These methods are critical for exploring the function of human trophoblast genes and may provide a foundation for the future application of gene therapy that targets placental trophoblasts. PMID:22831880

  8. Human pigmentation genes under environmental selection

    PubMed Central

    2012-01-01

    Genome-wide association studies and comparative genomics have established major loci and specific polymorphisms affecting human skin, hair and eye color. Environmental changes have had an impact on selected pigmentation genes as populations have expanded into different regions of the globe. PMID:23110848

  9. Structural basis for the inhibition of mammalian and insect alpha-amylases by plant protein inhibitors.

    PubMed

    Payan, Françoise

    2004-02-12

    Alpha-amylases are ubiquitous proteins which play an important role in the carbohydrate metabolism of microorganisms, animals and plants. Living organisms use protein inhibitors as a major tool to regulate the glycolytic activity of alpha-amylases. Most of the inhibitors for which three-dimensional (3-D) structures are available are directed against mammalian and insect alpha-amylases, interacting with the active sites in a substrate-like manner. In this review, we discuss the detailed inhibitory mechanism of these enzymes in light of the recent determination of the 3-D structures of pig pancreatic, human pancreatic, and yellow mealworm alpha-amylases in complex with plant protein inhibitors. In most cases, the mechanism of inhibition occurs through the direct blockage of the active center at several subsites of the enzyme. Inhibitors exhibiting "dual" activity against mammalian and insect alpha-amylases establish contacts of the same type in alternative ways.

  10. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862...

  11. Mapping genes to human chromosome 19

    SciTech Connect

    Connolly, Sarah

    1996-05-01

    For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. These localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.

  12. Application of microbial α-amylase in industry – A review

    PubMed Central

    de Souza, Paula Monteiro; de Oliveira Magalhães, Pérola

    2010-01-01

    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:24031565

  13. Human gene therapy and slippery slope arguments.

    PubMed Central

    McGleenan, T

    1995-01-01

    Any suggestion of altering the genetic makeup of human beings through gene therapy is quite likely to provoke a response involving some reference to a 'slippery slope'. In this article the author examines the topography of two different types of slippery slope argument, the logical slippery slope and the rhetorical slippery slope argument. The logical form of the argument suggests that if we permit somatic cell gene therapy then we are committed to accepting germ line gene therapy in the future because there is no logically sustainable distinction between them. The rhetorical form posits that allowing somatic cell therapy now will be taking the first step on a slippery slope which will ultimately lead to the type of genocide perpetrated by the Nazis. The author tests the validity of these lines of argument against the facts of human gene therapy and concludes that because of their dependence on probabilities that cannot be empirically proven they should be largely disregarded in the much more important debate on moral line-drawing in gene therapy. PMID:8778459

  14. Structure of the human annexin VI gene

    SciTech Connect

    Smith, P.D.; Moss, S.E.; Davies, A.; Crumpton, M.J.

    1994-03-29

    The authors report the structure of the human annexin VI gene and compare the intron-exon organization with the known structures of the human annexin I and II genes. The gene is {approximately}60 kbp long and contains 26 exons. Consistent with the published annexin VI cDNA sequence, the genomic sequence at the 3{prime} end does not contain a canonical polyadenylation signal. The genomic sequence upstream of the transcription start site contains TATAA and CAAT motifs. The spatial organization of the exons does not reveal any obvious similarities between the two halves of the annexin VI gene. Comparison of the intron-exon boundary positions of the annexin VI gene with those of annexins I and II reveals that within the repeated domains the break points are perfectly conserved except for exon 8, which is one codon smaller in annexin II. The corresponding point in the second half of annexin VI is represented by two exons, exons 20 and 21. The latter exon is alternatively spliced, giving rise to two annexin VI isoforms that differ with respect to a 6-amino acid insertion at the start of repeat 7. 32 refs., 6 figs.

  15. Human embryonic stem cells and gene therapy.

    PubMed

    Strulovici, Yael; Leopold, Philip L; O'Connor, Timothy P; Pergolizzi, Robert G; Crystal, Ronald G

    2007-05-01

    Human embryonic stem cells (hESCs) theoretically represent an unlimited supply of normal differentiated cells to engineer diseased tissues to regain normal function. However, before hESCs can be useful as human therapeutics, technologies must be developed to provide them with the specific signals required to differentiate in a controlled fashion, to regulate and/or shut down the growth of hESCs and their progeny once they have been transferred to the recipient, and to circumvent the recognition of non-autologous hESC-derived cells as foreign. In the context that gene therapy technologies represent strategies to deliver biological signals to address all of these challenges, this review sets out a framework for combined gene transfer/hESC therapies. We discuss how hESCs are derived, characterized, and differentiated into specific cell lineages, and we summarize the characteristics of the 500 hESC lines reported to date. The successes and failures of gene transfer to hESCs are reviewed for both non-viral and viral vectors, as are the challenges to successful use of gene transfer in developing hESC therapy. We also consider gene transfer as a means of facilitating growth and isolation of genetically modified hESCs and as a mechanism for mitigating adverse effects associated with administration of hESCs or their derivatives. Finally, we evaluate the challenges that are likely to be encountered in translating the promise of hESCs to the clinic.

  16. Human gene therapy and slippery slope arguments.

    PubMed

    McGleenan, T

    1995-12-01

    Any suggestion of altering the genetic makeup of human beings through gene therapy is quite likely to provoke a response involving some reference to a 'slippery slope'. In this article the author examines the topography of two different types of slippery slope argument, the logical slippery slope and the rhetorical slippery slope argument. The logical form of the argument suggests that if we permit somatic cell gene therapy then we are committed to accepting germ line gene therapy in the future because there is no logically sustainable distinction between them. The rhetorical form posits that allowing somatic cell therapy now will be taking the first step on a slippery slope which will ultimately lead to the type of genocide perpetrated by the Nazis. The author tests the validity of these lines of argument against the facts of human gene therapy and concludes that because of their dependence on probabilities that cannot be empirically proven they should be largely disregarded in the much more important debate on moral line-drawing in gene therapy.

  17. Where do animal alpha-amylases come from? An interkingdom trip.

    PubMed

    Da Lage, Jean-Luc; Danchin, Etienne G J; Casane, Didier

    2007-08-21

    Alpha-amylases are widely found in eukaryotes and prokaryotes. Few amino acids are conserved among these organisms, but at an intra-kingdom level, conserved protein domains exist. In animals, numerous conserved stretches are considered as typical of animal alpha-amylases. Searching databases, we found no animal-type alpha-amylases outside the Bilateria. Instead, we found in the sponge Reniera sp. and in the sea anemone Nematostella vectensis, alpha-amylases whose most similar cognate was that of the amoeba Dictyostelium discoideum. We found that this "Dictyo-type" alpha-amylase was shared not only by these non-Bilaterian animals, but also by other Amoebozoa, Choanoflagellates, and Fungi. This suggested that the Dictyo-type alpha-amylase was present in the last common ancestor of Unikonts. The additional presence of the Dictyo-type in some Ciliates and Excavates, suggests that horizontal gene transfers may have occurred among Eukaryotes. We have also detected putative interkingdom transfers of amylase genes, which obscured the historical reconstitution. Several alternative scenarii are discussed.

  18. Variation in Amylase Haplotypes among Congenic Lines of the House Mouse

    PubMed Central

    Nielsen, J. Tonnes

    1982-01-01

    Pancreatic amylase in the mouse displays considerable quantitative genetic variation. Agar gel electrophoresis reveals that homozygous animals have either one form of the enzyme, type A, or two forms, type AB. Only few animals have been found that contradict this statement, namely among Mus musculus castaneus from Thailand, which has a single-banded B type. Double-banded homozygous specimens of various origins have different relative proportions of the two isoenzymes. By measuring the A:B ratios in such animals, a number of distinct haplotypes or amylase complexes, determining ratios ranging from 61% A:39% B to 12% A:88% B, have been recognized. These complexes differ also with respect to the total amount of amylase produced. If the reference stock C3H/As is given the value 1, then other haplotypes have values ranging from 1.0 to 0.27. Nineteen amylase haplotypes have been established in congenic lines on a C3H/As background. Some of these lines contain at least four active pancreatic amylase structural genes and breeding experiments have demonstrated that the genetic elements regulating total amylase production and relative proportions of the isoenzymes are located within the amylase complex, cis-acting, and very closely linked to the structural genes. PMID:6184261

  19. Genes of human longevity: an endless quest?

    PubMed

    Capri, Miriam; Santoro, Aurelia; Garagnani, Paolo; Bacalini, Maria Giulia; Pirazzini, Chiara; Olivieri, Fabiola; Procopio, Antonio; Salvioli, Stefano; Franceschi, Claudio

    2014-01-01

    Human longevity is a complex trait in which genetics, epigenetics, environmental and stochasticity differently contribute. To disentangle the complexity, our studies on genetics of longevity were, at the beginning, mainly focused on the extreme phenotypes, i.e. centenarians who escaped the major age-related diseases compared with cross sectional cohorts. Recently, we implemented this model by studying centenarians' offspring and offspring of non-long lived parents. In association, during studies on many candidate genes SNPs, positively or negatively correlated with longevity have been identified. The results obtained on Insulin-like Growth Factor 1 Receptor (IGF1R) polymorphisms showed a correlation between specific genetic variants combinations and the low plasma level of IGF1 in centenarians, suggesting an impact of the IGF-I/insulin pathway on human longevity. This pathway together with mammalian target of rapamycin (mTOR) will be reviewed as being the most promising for longevity. Further, we will summarise the role of apolipoprotein E (APOE) variants in human longevity since the results of the large European project GEHA (Genetics of Healthy Aging) indicate APOE among the chromosomal loci associated with longevity. On the other hand, the identification of longevity-related genes does not explain the mechanisms of healthy aging and longevity rather pose questions on epigenetic contribution, gene regulation and the interactions with essential genomes, i.e. mitochondrial DNA and microbiota. To fully disentangle what appears to be an endless quest, all the components of the complexity of human longevity genetics are taken into account.

  20. Dynamics of the Streptococcus gordonii Transcriptome in Response to Medium, Salivary α-Amylase, and Starch

    PubMed Central

    Haase, Elaine M.; Feng, Xianghui; Pan, Jiachuan; Miecznikowski, Jeffrey C.

    2015-01-01

    Streptococcus gordonii, a primary colonizer of the tooth surface, interacts with salivary α-amylase via amylase-binding protein A (AbpA). This enzyme hydrolyzes starch to glucose, maltose, and maltodextrins that can be utilized by various oral bacteria for nutrition. Microarray studies demonstrated that AbpA modulates gene expression in response to amylase, suggesting that the amylase-streptococcal interaction may function in ways other than nutrition. The goal of this study was to explore the role of AbpA in gene regulation through comparative transcriptional profiling of wild-type KS1 and AbpA− mutant KS1ΩabpA under various environmental conditions. A portion of the total RNA isolated from mid-log-phase cells grown in 5% CO2 in (i) complex medium with or without amylase, (ii) defined medium (DM) containing 0.8% glucose with/without amylase, and (iii) DM containing 0.2% glucose and amylase with or without starch was reverse transcribed to cDNA and the rest used for RNA sequencing. Changes in the expression of selected genes were validated by quantitative reverse transcription-PCR. Maltodextrin-associated genes, fatty acid synthesis genes and competence genes were differentially expressed in a medium-dependent manner. Genes in another cluster containing a putative histidine kinase/response regulator, peptide methionine sulfoxide reductase, thioredoxin protein, lipoprotein, and cytochrome c-type protein were downregulated in KS1ΩabpA under all of the environmental conditions tested. Thus, AbpA appears to modulate genes associated with maltodextrin utilization/transport and fatty acid synthesis. Importantly, in all growth conditions AbpA was associated with increased expression of a potential two-component signaling system associated with genes involved in reducing oxidative stress, suggesting a role in signal transduction and stress tolerance. PMID:26025889

  1. Widespread Inducible Transcription Downstream of Human Genes

    PubMed Central

    Vilborg, Anna; Passarelli, Maria C.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.

    2015-01-01

    Summary Pervasive transcription of the human genome generates RNAs whose mode of formation and functions are largely uncharacterized. Here, we combine RNA-Seq with detailed mechanistic studies to describe a transcript type derived from protein-coding genes. The resulting RNAs, which we call DoGs for downstream of gene containing transcripts, possess long non-coding regions (often >45 kb) and remain chromatin bound. DoGs are inducible by osmotic stress through an IP3 receptor signaling-dependent pathway, indicating active regulation. DoG levels are increased by decreased termination of the upstream transcript, a previously undescribed mechanism for rapid transcript induction. Relative depletion of polyA signals in DoG regions correlates with increased levels of DoGs after osmotic stress. We detect DoG transcription in several human cell lines and provide evidence for thousands of DoGs genome-wide. PMID:26190259

  2. Regulation of gene expression in human tendinopathy

    PubMed Central

    2011-01-01

    Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics. PMID:21539748

  3. Genes after the human genome project.

    PubMed

    Baetu, Tudor M

    2012-03-01

    While the Human Genome Nomenclature Committee (HGNC) concept of the gene can accommodate a wide variety of genomic sequences contributing to phenotypic outcomes, it fails to specify how sequences should be grouped when dealing with complex loci consisting of adjacent/overlapping sequences contributing to the same phenotype, distant sequences shown to contribute to the same gene product, and partially overlapping sequences identified by different techniques. The purpose of this paper is to review recently proposed concepts of the gene and critically assess how well they succeed in addressing the above problems while preserving the degree of generality achieved by the HGNC concept. I conclude that a dynamic interplay between mapping and syntax-based concepts is required in order to satisfy these desiderata. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. The human RHOX gene cluster: target genes and functional analysis of gene variants in infertile men.

    PubMed

    Borgmann, Jennifer; Tüttelmann, Frank; Dworniczak, Bernd; Röpke, Albrecht; Song, Hye-Won; Kliesch, Sabine; Wilkinson, Miles F; Laurentino, Sandra; Gromoll, Jörg

    2016-09-15

    The X-linked reproductive homeobox (RHOX) gene cluster encodes transcription factors preferentially expressed in reproductive tissues. This gene cluster has important roles in male fertility based on phenotypic defects of Rhox-mutant mice and the finding that aberrant RHOX promoter methylation is strongly associated with abnormal human sperm parameters. However, little is known about the molecular mechanism of RHOX function in humans. Using gene expression profiling, we identified genes regulated by members of the human RHOX gene cluster. Some genes were uniquely regulated by RHOXF1 or RHOXF2/2B, while others were regulated by both of these transcription factors. Several of these regulated genes encode proteins involved in processes relevant to spermatogenesis; e.g. stress protection and cell survival. One of the target genes of RHOXF2/2B is RHOXF1, suggesting cross-regulation to enhance transcriptional responses. The potential role of RHOX in human infertility was addressed by sequencing all RHOX exons in a group of 250 patients with severe oligozoospermia. This revealed two mutations in RHOXF1 (c.515G > A and c.522C > T) and four in RHOXF2/2B (-73C > G, c.202G > A, c.411C > T and c.679G > A), of which only one (c.202G > A) was found in a control group of men with normal sperm concentration. Functional analysis demonstrated that c.202G > A and c.679G > A significantly impaired the ability of RHOXF2/2B to regulate downstream genes. Molecular modelling suggested that these mutations alter RHOXF2/F2B protein conformation. By combining clinical data with in vitro functional analysis, we demonstrate how the X-linked RHOX gene cluster may function in normal human spermatogenesis and we provide evidence that it is impaired in human male fertility.

  5. Determining the relationship of acute stress, anxiety, and salivary alpha-amylase level with performance of student nurse anesthetists during human-based anesthesia simulator training.

    PubMed

    McKay, Kelly A Chiffer; Buen, John E; Bohan, Kevin J; Maye, John P

    2010-08-01

    Managing stress for student nurse anesthetists represents a multifaceted educational concern for anesthesia educators. Our purpose was to determine the relationship between physiologic measures of stress and performance of student nurse anesthetists during anesthesia simulator training. Following institutional review board approval, 78 students were enrolled from a nurse anesthesia program. A prospective descriptive design was used to compare baseline, acute, and recovery measurements of stress with performance scores of students during an induction and intubation sequence in a patient simulator. Performance scores were stratified into low-, moderate-, and high-performing groups based on scores received from trained observers. A statistically significant difference in physiologic measures of stress was detected between baseline and acute levels of salivary a-amylase (P = .017), heart rate (P = .003), and anxiety levels (P = .001). No significant differences were found when measures of stress were compared with performance of low, moderate, or high performers. This investigation revealed remarkable findings regarding the relationship between stress and student performance. Analysis of the descriptive statistics and means of each group suggests that low performers have increased stress and perform poorly, whereas high performers have increased stress and perform superbly, and moderate performers have modest stress and perform moderately.

  6. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  7. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  8. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  9. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  10. The future of human gene therapy.

    PubMed

    Rubanyi, G M

    2001-06-01

    Human gene therapy (HGT) is defined as the transfer of nucleic acids (DNA) to somatic cells of a patient which results in a therapeutic effect, by either correcting genetic defects or by overexpressing proteins that are therapeutically useful. In the past, both the professional and the lay community had high (sometimes unreasonably high) expectations from HGT because of the early promise of treating or preventing diseases effectively and safely by this new technology. Although the theoretical advantages of HGT are undisputable, so far HGT has not delivered the promised results: convincing clinical efficacy could not be demonstrated yet in most of the trials conducted so far, while safety concerns were raised recently as the consequence of the "Gelsinger Case" in Philadelphia. This situation resulted from the by now well-recognized disparity between theory and practice. In other words, the existing technologies could not meet the practical needs of clinically successful HGT so far. However, over the past years, significant progress was made in various enabling technologies, in the molecular understanding of diseases and the manufacturing of vectors. HGT is a complex process, involving multiple steps in the human body (delivery to organs, tissue targeting, cellular trafficking, regulation of gene expression level and duration, biological activity of therapeutic protein, safety of the vector and gene product, to name just a few) most of which are not completely understood. The prerequisite of successful HGT include therapeutically suitable genes (with a proven role in pathophysiology of the disease), appropriate gene delivery systems (e.g., viral and non-viral vectors), proof of principle of efficacy and safety in appropriate preclinical models and suitable manufacturing and analytical processes to provide well-defined HGT products for clinical investigations. The most promising areas for gene therapy today are hemophilias, for monogenic diseases, and cardiovascular

  11. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  12. The human T cell receptor alpha variable (TRAV) genes.

    PubMed

    Scaviner, D; Lefranc, M P

    2000-01-01

    'Human T Cell Receptor Alpha Variable (TRAV) Genes', the eighth report of the 'IMGT Locus in Focus' section, comprises four tables: (1) 'Number of human germline TRAV genes at 14q11 and potential repertoire'; (2) 'Human germline TRAV genes at 14q11'; (3) 'Human TRAV allele table', and (4) 'Correspondence between the different human TRAV gene nomenclatures'. These tables are available at the IMGT Marie-Paule page of IMGT, the international ImMunoGeneTics database (http://imgt.cines.fr:8104) created by Marie-Paule Lefranc, Université Montpellier II, CNRS, France. Copyright 2000 S. Karger AG, Basel

  13. Salt-dependent thermo-reversible α-amylase: cloning and characterization of halophilic α-amylase from moderately halophilic bacterium, Kocuria varians.

    PubMed

    Yamaguchi, Rui; Tokunaga, Hiroko; Ishibashi, Matsujiro; Arakawa, Tsutomu; Tokunaga, Masao

    2011-02-01

    A moderately halophilic bacterium, Kocuria varians, was found to produce active α-amylase (K. varians α-amylase (KVA)). We have observed at least six different forms of α-amylase secreted by this bacterium into the culture medium. Characterization of these KVA forms and cloning of the corresponding gene revealed that KVA comprises pre-pro-precursor form of α-amylase catalytic domain followed by the tandem repeats, which show high similarity to each other and to the starch binding domain (SBD) of other α-amylases. The observed six forms were most likely derived by various processing of the protein product. Recombinant KVA protein was successfully expressed in Escherichia coli as a fusion protein and was purified with affinity chromatography after cleavage from fusion partner. The highly acidic amino acid composition of KVA and the highly negative electrostatic potential surface map of the modeled structure strongly suggested its halophilic nature. Indeed, KVA showed distinct salt- and time-dependent thermal reversibility: when α-amylase was heat denatured at 85°C for 3 min in the presence of 2 M NaCl, the activity was recovered upon incubation on ice (50% recovery after 15 min incubation). Conversely, KVA denatured in 0.1 M NaCl was not refolded at all, even after prolonged incubation. KVA activity was inhibited by proteinaceous α-amylase inhibitor from Streptomyces nitrosporeus, which had been implicated to inhibit only animal α-amylases. KVA with putative SBD regions was found to digest raw starch.

  14. Dietary Methanol Regulates Human Gene Activity

    PubMed Central

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  15. Salivary alpha-amylase: role in dental plaque and caries formation.

    PubMed

    Scannapieco, F A; Torres, G; Levine, M J

    1993-01-01

    Salivary alpha-amylase, one of the most plentiful components in human saliva, has at least three distinct biological functions. The enzymatic activity of alpha-amylase undoubtedly plays a role in carbohydrate digestion. Amylase in solution binds with high affinity to a selected group of oral streptococci, a function that may contribute to bacterial clearance and nutrition. The fact that alpha-amylase is also found in acquired enamel pellicle suggests a role in the adhesion of alpha-amylase-binding bacteria. All of these biological activities seem to depend on an intact enzyme conformation. Binding of alpha-amylase to bacteria and teeth may have important implications for dental plaque and caries formation. alpha-Amylase bound to bacteria in plaque may facilitate dietary starch hydrolysis to provide additional glucose for metabolism by plaque microorganisms in close proximity to the tooth surface. The resulting lactic acid produced may be added to the pool of acid in plaque to contribute to tooth demineralization.

  16. Effects of alpha-amylase on in vitro growth of Legionella pneumophila.

    PubMed Central

    Bortner, C A; Miller, R D; Arnold, R R

    1983-01-01

    Sterile parotid saliva inhibited growth of Legionella pneumophila on solid media, and the salivary component involved in this inhibition has been shown to be amylase. Disk diffusion and well plate assays were used to study possible mechanisms for this effect. The amylolytic activity of saliva copurified with inhibitory activity, and both activities were sensitive to proteinase K digestion and heat treatment. In addition, purified alpha-amylase from several sources (bacteria, fungi, porcine pancreas, and human saliva) exhibited similar activity. Incorporation of charcoal or bovine serum albumin into media blocked inhibition by amylase. Replacement of Bacto-Agar with Noble agar (both from Difco Laboratories) prevented growth inhibition in the absence of starch. However, when corn starch was present with Noble agar, amylase-induced growth inhibition occurred. Purification of starch by washing with methanol eliminated some toxic component. The toxic component from starch could be recovered from the methanol wash and inhibited growth of L. pneumophila in the absence of amylase activity. The results suggest that toxic substances exist in media components which may be unmasked during salivary amylase digestion of starch. This effect may explain, in part, the difficulty in recovery of the organism from clinical specimens containing amylase. PMID:6190756

  17. Testing the ability of rhodanine and 2, 4-thiazolidinedione to interact with the human pancreatic alpha-amylase: electron-density descriptors complement molecular docking, QM, and QM/MM dynamics calculations.

    PubMed

    Devi, Rajendran Niranjana; Khrenova, Maria G; Israel, Samuel; Anzline, Chellam; Astakhov, Andrey A; Tsirelson, Vladimir G

    2017-09-01

    A combined molecular docking, QM, and QM/MM dynamics modeling complemented with electron-density based descriptors computed at the B3LYP/6-311G++(d,p) level of theory have been carried out in order to understand the ability of the drugs rhodanine (RD) and 2,4-thiazolidinedione (TZD) in the effective treatment of type 2 diabetes mellitus. The global HOMO/LUMO descriptors provided just a very rough estimate of the chemical reactivity of both molecules, while the features of electron density studied in terms of its Laplacian and electrostatic potential allowed identifying the local electron rich/poor sites which were associated with the regions of electrophilic/nucleophilic attacks in RD and TZD. These results were thoroughly checked using the novel physically-grounded functional descriptors such as the phase-space Fisher information density and the internal kinetic electronic pressure density, which confirmed the information on bonding and lone electron pair details. The molecular docking, QM, and QM/MM dynamics analyses revealed the detailed picture of interactions of the drugs with the amino acid residues of the active site of the human pancreatic alpha-amylase protein (hPAA). The main difference in behavior of RD and TZD molecules is related to the hydrogen bond between the NH group of the ligand and Asp197. In hPAA complex with RD the proton from the NH group, which carries large positive charge (~ +0.45 e), spontaneously transfers to the carboxyl group of Asp197 and stays there, while in complex with TZD this proton frequently changes its position with the more preferable formation of covalent bond with the N atom. Upon deprotonation of the ligand, its hydrogen bonds with Arg195 and His299 become stronger. This process influences the binding with the difference of the binding constants of RD and TZD about 200 times with the higher value corresponding to the RD molecule. Thus, the cumulative results lead to the conclusion that rhodanine would have a higher

  18. Stochastic models for human gene mapping

    SciTech Connect

    Goradia, T.M.

    1992-01-01

    This thesis examines a variety of gene mapping experiments and recommends, on the basis of stochastic and combinatorial analysis, improved experimental designs. Somatic cell hybrid panels can localize genes to particular chromosomes or chromosomal regions. Although the redundancy within randomly generated panels may be beneficial, probability calculations reveal their inefficiency. Equally good panels with far fewer clones can be constructed by choosing clones from pre-existing collection of clones. The method of simulated annealing is suggested for judiciously selecting small, informative panels from larger existing collections of clones. A more difficult exercise is mapping a gene relative to syntenic genes on the basis of genetic distance. Traditional methods of pedigree analysis are able to accomplish this to a great extent. Automatic genotype elimination algorithms for a single locus play a central role in making likelihood computations on human pedigree data feasible. A simple algorithm that is fully efficient in pedigrees without loops is presented. This algorithm can be easily coded and is instrumental in reducing computing times for pedigree analysis. Alternative methods are needed for high-resolution gene mapping. Three-locus sperm typing and its implications for the estimation of recombination fractions and for locus ordering are examined. Comparisons are made among some sequential stopping rules for three-locus order assignment. Poissonization and other stochastic methods are used for approximating the mean stopping times and error probabilities. A trisection strategy for ordering a new locus relative to an existing set of loci is proposed. When used in conjunction with Bayesian methods, this trisection strategy has attractive optimality properties. The genetic distance between the [sup G][gamma] globin locus and the parathyroid hormone locus is verified by a probabilistic model that accounts for the major sources of laboratory error.

  19. Rethinking the starch digestion hypothesis for AMY1 copy number variation in humans.

    PubMed

    Fernández, Catalina I; Wiley, Andrea S

    2017-08-01

    Alpha-amylase exists across taxonomic kingdoms with a deep evolutionary history of gene duplications that resulted in several α-amylase paralogs. Copy number variation (CNV) in the salivary α-amylase gene (AMY1) exists in many taxa, but among primates, humans appear to have higher average AMY1 copies than nonhuman primates. Additionally, AMY1 CNV in humans has been associated with starch content of diets, and one known function of α-amylase is its involvement in starch digestion. Thus high AMY1 CNV is considered to result from selection favoring more efficient starch digestion in the Homo lineage. Here, we present several lines of evidence that challenge the hypothesis that increased AMY1 CNV is an adaptation to starch consumption. We observe that α- amylase plays a very limited role in starch digestion, with additional steps required for starch digestion and glucose metabolism. Specifically, we note that α-amylase hydrolysis only produces a minute amount of free glucose with further enzymatic digestion and glucose absorption being rate-limiting steps for glucose availability. Indeed α-amylase is nonessential for starch digestion since sucrase-isomaltase and maltase-glucoamylase can hydrolyze whole starch granules while releasing glucose. While higher AMY1 CN and CNV among human populations may result from natural selection, existing evidence does not support starch digestion as the major selective force. We report that in humans α-amylase is expressed in several other tissues where it may have potential roles of evolutionary significance. © 2017 Wiley Periodicals, Inc.

  20. Chromosomal localization of the human elastin gene.

    PubMed Central

    Emanuel, B S; Cannizzaro, L; Ornstein-Goldstein, N; Indik, Z K; Yoon, K; May, M; Oliver, L; Boyd, C; Rosenbloom, J

    1985-01-01

    mRNA isolated from fetal human aorta was used to synthesize cDNA that was cloned into the PstI site of pBR322. The recombinant clones were screened with an authentic sheep elastin cDNA, and one human clone that hybridized strongly was isolated and characterized. The 421-base pair (bp) insert of this human clone was sequenced by the dideoxy method, and the DNA sequence showed strong homology to the nontranslated portion of the sheep elastin cDNA. This result unequivocally identified the human clone, designated pcHEL1, as an elastin clone. Plasmid pcHEL1 labeled with [3H] nucleotides was used in in situ hybridization experiments utilizing normal metaphase chromosomes and also with cells carrying a balanced translocation between chromosomes 1 and 2: 46,XY,t(1;2)(p36;q31). The results strongly suggest that the elastin gene is localized to the q31----qter region of chromosome 2. Images Fig. 2 Fig. 4 PMID:3840328

  1. Characterization of a Hydrophobic Amylase Inhibitor from Corn (Zea mays) Seeds with Activity Against Amylase from Fusarium verticillioides.

    PubMed

    Figueira, Edson L Z; Hirooka, Elisa Y; Mendiola-Olaya, Elizabeth; Blanco-Labra, Alejandro

    2003-08-01

    ABSTRACT A hydrophobic 19.7-kDa amylase inhibitor (AI) was purified from corn kernels by 95% ethanol extraction and anionic exchange chromatography. The AI has an isoelectric point of 3.6 and was very stable at different pH values and high temperatures, maintaining 47.6% activity after heating to 94 degrees C for 60 min. Amino acid analysis indicated high valine, leucine, glycine, alanine, and glutamic acid/glutamine content, and especially high valine content (41.2 mol%). This inhibitor is not a glycoprotein. It required 30-min preincubation to maximize complex enzyme-inhibitor formation when the amylase from Fusarium verticillioides was tested. The optimal pH of interaction was 6.5. It showed broad-spectrum activity including the following amylases: human saliva, porcine pancreas, F. verticillioides, as well as those from some insects of agricultural importance (Acanthoscelides obtectus, Zabrotes subfasciatus, Sitophilus zeamais, and Prostephanus truncatus). This novel hydrophobic protein not only inhibited the amylase from F. verticillioides but also decreased the conidia germination. Thus, this protein represents an approach to decrease the production of fumonisin in corn, either by using it as a molecular marker to detect fungal resistance or through genetic engineering.

  2. A glycoprotein α-amylase inhibitor from Withania somnifera differentially inhibits various α-amylases and affects the growth and development of Tribolium castaneum.

    PubMed

    Kasar, Sainath S; Marathe, Kiran R; Bhide, Amey J; Herwade, Abhijeet P; Giri, Ashok P; Maheshwari, Vijay L; Pawar, Pankaj K

    2017-07-01

    Identification and characterisation of plant defensive molecules enrich our resources to design crop protection strategies. In particular, plant-derived proteinaceous inhibitor(s) of insect digestive enzymes appear to be a safe, sustainable and attractive option. A glycoprotein having non-competitive α-amylase inhibitory activity with a molecular weight of 8.3 kDa was isolated and purified from seeds of Withania somnifera α-amylase inhibitor (WSAI). Its mass spectrometry analysis revealed 59% sequence coverage with Wrightide II-type α-amylase inhibitor from Wrightia religiosa. A dose-dependent inhibition of α-amylases from Aspergillus oryzae, Bacillus subtilis, Helicoverpa armigera and Tribolium castaneum was recorded. Interestingly, WSAI did not inhibit human salivary α-amylase significantly. When adults of T. castaneum were fed with WSAI (1.6 mg g(-1) ), decrease in consumption, growth and efficiency of conversion of ingested food was evident, along with over fourfold increases in feeding deterrence index. A decline in larval residual α-amylase activity after feeding of WSAI resulted in a reduction in longevity of T. castaneum. The study reflects the significance of WSAI in affecting the overall growth and development of T. castaneum. Pre- and post-harvest pest resistive capability makes WSAI a potential candidate for insect pest management. Further, the effectiveness of this inhibitor could be explored either in formulations or through a transgenic approach. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  3. Characterization of two coleopteran α-amylases and molecular insights into their differential inhibition by synthetic α-amylase inhibitor, acarbose.

    PubMed

    Channale, Sonal M; Bhide, Amey J; Yadav, Yashpal; Kashyap, Garima; Pawar, Pankaj K; Maheshwari, V L; Ramasamy, Sureshkumar; Giri, Ashok P

    2016-07-01

    Post-harvest insect infestation of stored grains makes them unfit for human consumption and leads to severe economic loss. Here, we report functional and structural characterization of two coleopteran α-amylases viz. Callosobruchus chinensis α-amylase (CcAmy) and Tribolium castaneum α-amylase (TcAmy) along with their interactions with proteinaceous and non-proteinaceous α-amylase inhibitors. Secondary structural alignment of CcAmy and TcAmy with other coleopteran α-amylases revealed conserved motifs, active sites, di-sulfide bonds and two point mutations at spatially conserved substrate or inhibitor-binding sites. Homology modeling and molecular docking showed structural differences between these two enzymes. Both the enzymes had similar optimum pH values but differed in their optimum temperature. Overall, pattern of enzyme stabilities were similar under various temperature and pH conditions. Further, CcAmy and TcAmy differed in their substrate affinity and catalytic efficiency towards starch and amylopectin. HPLC analysis detected common amylolytic products like maltose and malto-triose while glucose and malto-tetrose were unique in CcAmy and TcAmy catalyzed reactions respectively. At very low concentrations, wheat α-amylase inhibitor was found to be superior over the acarbose as far as complete inhibition of amylolytic activities of CcAmy and TcAmy was concerned. Mechanism underlying differential amylolytic reaction inhibition by acarbose was discussed.

  4. Gene expression profiling of human ovarian tumours

    PubMed Central

    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; LiVolsi, V A; Johnson, S W

    2006-01-01

    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT–PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers. PMID:16969345

  5. Gene expression profiling of human ovarian tumours.

    PubMed

    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; Livolsi, V A; Johnson, S W

    2006-10-23

    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT-PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers.

  6. Structure of the human retinoblastoma gene

    SciTech Connect

    Hong, F.D.; Huang, Hueijen S.; To, Hoang; Young, Lihjiuan S.; Oro, A.; Bookstein, R.; Lee, E.Y.H.P.; Lee, Wenhwa )

    1989-07-01

    Complete inactivation of the human retinoblastoma gene (RB) is believed to be an essential step in tumorigenesis of several different cancers. To provide a framework for understanding inactivation mechanisms, the structure of RB was delineated. The RB transcript is encoded in 27 exons dispersed over about 200 kilobases (kb) of genomic DNA. The length of individual exons ranges from 31 to 1,889 base pairs (bp). The largest intron spans >60 kb and the smallest one has only 80 bp. Deletion of exons 13-17 is frequently observed in various types of tumors, including retinoblastoma, breast cancer, and osteosarcoma, and the presence of a potential hot spot for recombination in the region is predicted. A putative leucine-zipper motif is exclusively encoded by exon 20. The detailed RB structure presented should prove useful in defining potential functional domains of its encoded protein. Transcription of RB is initiated at multiple positions and the sequences surrounding the initiation sites have a high G+C content. A typical upstream TATA box is not present. Localization of the RB promoter region was accomplished by utilizing a heterologous expression system containing a bacterial chloramphenicol acetyltransferase gene. Deletion analysis revealed that a region as small as 70 bp is sufficient for RB promoter activity, similar to other previously characterized G+C-rich gene promoters. Several direct repeats and possible stem-and-loop structures are found in the promoter region.

  7. Characterization of Aspergillus nidulans α-glucan synthesis: roles for two synthases and two amylases.

    PubMed

    He, Xiaoxiao; Li, Shengnan; Kaminskyj, Susan G W

    2014-02-01

    Cell walls are essential for fungal survival and growth. Fungal walls are ∼ 90% carbohydrate, mostly types not found in humans, making them promising targets for anti-fungal drug development. Echinocandins, which inhibit the essential β-glucan synthase, are already clinically available. In contrast, α-glucan, another abundant fungal cell wall component has attracted relatively little research attention because it is not essential for most fungi. Aspergillus nidulans has two α-glucan synthases (AgsA and AgsB) and two α-amylases (AmyD and AmyG), all of which affect α-glucan synthesis. Gene deletion showed that AgsB was the major synthase. In addition, AmyG promoted α-glucan synthesis whereas AmyD had a repressive effect. The lack of α-glucan had no phenotypic impact on solid medium, but reduced conidial adhesion during germination in shaken liquid. Moreover, α-glucan level correlated with resistance to Calcofluor White. Intriguingly, overexpression of agsA could compensate for the loss of agsB at the α-glucan level, but not for phenotypic defects. Thus, products of AgsA and AgsB have different roles in the cell wall, consistent with agsA being mainly expressed at conidiation. These results suggest that α-glucan contributes to drug sensitivity and conidia adhesion in A. nidulans, and is differentially regulated by two synthases and two amylases.

  8. Monoallelic expression of the human FOXP2 speech gene.

    PubMed

    Adegbola, Abidemi A; Cox, Gerald F; Bradshaw, Elizabeth M; Hafler, David A; Gimelbrant, Alexander; Chess, Andrew

    2015-06-02

    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations.

  9. Monoallelic expression of the human FOXP2 speech gene

    PubMed Central

    Adegbola, Abidemi A.; Cox, Gerald F.; Bradshaw, Elizabeth M.; Hafler, David A.; Gimelbrant, Alexander; Chess, Andrew

    2015-01-01

    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations. PMID:25422445

  10. Human salivary α-amylase (EC.3.2.1.1) activity and periodic acid and schiff reactive (PAS) staining: A useful tool to study polysaccharides at an undergraduate level.

    PubMed

    Fernandes, Ruben; Correia, Rossana; Fonte, Rosália; Prudêncio, Cristina

    2006-07-01

    Health science education is presently in discussion throughout Europe due to the Bologna Declaration. Teaching basic sciences such as biochemistry in a health sciences context, namely in allied heath education, can be a challenging task since the students of preclinical health sciences are not often convinced that basic sciences are clinically valuable (J. R. Rudland, S. C. Rennie (2003) The determination of the relevance of basic sciences learning objectives to clinical practice using a questionnaire survey, Med. Educ. (Oxf.) 37, 962-965; E. C. Wragg (2003) How can we determine the relevance of basic sciences learning objectives to clinical practice?, Med. Educ. (Oxf.) 37, 948-949). Thus, nowadays teachers are compelled to use their imagination to be able to elaborate laboratory sessions aiming for the understanding of theoretical concepts that are also clinically related: in other words, basic concepts and skills that underlie the competencies demanded of the future health professional. In the present work, we describe a set of laboratory sessions implemented in the discipline of biochemistry, belonging to the first year of several courses of allied health professionals, which can also be implemented in other health sciences courses. These sessions focus on the characteristics and properties of carbohydrates. The exercises we propose include two different laboratory practical sessions based on a histopathological routine technique known as periodic acid and Schiff reactive that is currently used to detect sugar metabolic and tumor diseases (J. M. T. Rivera, C. T. López, B. C. Segui (2001) Bioquímica Estructural: Conceptos y Tests, Tebar Flores, Madrid). The methodology described enables the demonstration of some biochemical properties of polysaccharides, namely animal and vegetable, and the catalytic activity of the human salivary α-amylase (EC.3.2.1.1) enzyme. A further comparison between α-amylase activity in vitro and in situ is also possible by the

  11. Classification and nomenclature of all human homeobox genes

    PubMed Central

    Holland, Peter WH; Booth, H Anne F; Bruford, Elspeth A

    2007-01-01

    Background The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes. We describe 300 human homeobox loci, which we divide into 235 probable functional genes and 65 probable pseudogenes. These totals include 3 genes with partial homeoboxes and 13 pseudogenes that lack homeoboxes but are clearly derived from homeobox genes. These figures exclude the repetitive DUX1 to DUX5 homeobox sequences of which we identified 35 probable pseudogenes, with many more expected in heterochromatic regions. Nomenclature is established for approximately 40 formerly unnamed loci, reflecting their evolutionary relationships to other loci in human and other species, and nomenclature revisions are proposed for around 30 other loci. We use a classification that recognizes 11 homeobox gene 'classes' subdivided into 102 homeobox gene 'families'. Conclusion We have conducted a comprehensive survey of homeobox genes and pseudogenes in the human genome, described many new loci, and revised the classification and nomenclature of homeobox genes. The classification scheme may be widely applicable to homeobox genes in other animal genomes and will facilitate comparative genomics of this important gene superclass. PMID:17963489

  12. The hyperthermophilic α-amylase from Thermococcus sp. HJ21 does not require exogenous calcium for thermostability because of high-binding affinity to calcium.

    PubMed

    Cheng, Huaixu; Luo, Zhidan; Lu, Mingsheng; Gao, Song; Wang, Shujun

    2017-05-01

    The hyperthermophilic α-amylase from Thermococcus sp. HJ21 does not require exogenous calcium ions for thermostability, and is a promising alternative to commercially available α-amylases to increase the efficiency of industrial processes like the liquefaction of starch. We analyzed the amino acid sequence of this α-amylase by sequence alignments and structural modeling, and found that this α-amylase closely resembles the α-amylase from Pyrococcus woesei. The gene of this α-amylase was cloned in Escherichia coli and the recombinant α-amylase was overexpressed and purified with a combined renaturation-purification procedure. We confirmed thermostability and exogenous calcium ion independency of the recombinant α-amylase and further investigated the mechanism of the independency using biochemical approaches. The results suggested that the α-amylase has a high calcium ion binding affinity that traps a calcium ion that would not dissociate at high temperatures, providing a direct explanation as to why the addition of calcium ions is not required for thermostability. Understanding of the mechanism offers a strong base on which to further engineer properties of this α-amylase for better potential applications in industrial processes.

  13. State-of-the-art human gene therapy: part I. Gene delivery technologies.

    PubMed

    Wang, Dan; Gao, Guangping

    2014-01-01

    Safe and effective gene delivery is a prerequisite for successful gene therapy. In the early age of human gene therapy, setbacks due to problematic gene delivery vehicles plagued the exciting therapeutic outcome. However, gene delivery technologies rapidly evolved ever since. With the advancement of gene delivery techniques, gene therapy clinical trials surged during the past decade. As the first gene therapy product (Glybera) has obtained regulatory approval and reached clinic, human gene therapy finally realized the promise that genes can be medicines. The diverse gene delivery techniques available today have laid the foundation for gene therapy applications in treating a wide range of human diseases. Some of the most urgent unmet medical needs, such as cancer and pandemic infectious diseases, have been tackled by gene therapy strategies with promising results. Furthermore, combining gene transfer with other breakthroughs in biomedical research and novel biotechnologies opened new avenues for gene therapy. Such innovative therapeutic strategies are unthinkable until now, and are expected to be revolutionary. In part I of this review, we introduced recent development of non-viral and viral gene delivery technology platforms. As cell-based gene therapy blossomed, we also summarized the diverse types of cells and vectors employed in ex vivo gene transfer. Finally, challenges in current gene delivery technologies for human use were discussed.

  14. Injury, inflammation and the emergence of human specific genes

    DTIC Science & Technology

    2016-07-12

    investigated. Neuro- scientists posit that human -specific genes were selected to regulate traits that are uniquely human : size of the human brain ...and variable representation of primate- and human -specific protein-coding sequences in brain development.3 We, therefore, considered the possibility...Landback P, Vibranovski M, Long M. New genes expressed in human brains : implications for annotating evolv- ing genomes. Bioessays 2012; 34: 982–91. 4

  15. Design, synthesis and α-amylase inhibitory activity of novel chromone derivatives.

    PubMed

    Valentina, Parthiban; Ilango, Kaliappan; Chander, Subhash; Murugesan, Sankaranarayanan

    2017-10-01

    Quercetin is one of the naturally occurring polyphenol flavonoid predominantly known for antidiabetic activity. In the present study, by considering the structural requirements, twenty two novel chromone derivatives (5-26) as α-amylase inhibitor were designed and subsequently in silico evaluated for drug likeness behavior. Designed compounds were synthesized, characterized by spectral analysis and finally evaluated for the inhibition of α-amylase activity by in vitro assay. Tested compounds exhibited significant to weak activity with IC50 range of 12-125µM. Among the tested compounds, analogues 5, 8, 12, 13, 15, 17 and 22 exhibited significant human α-amylase inhibitory activity with IC50 values <25µM, which can be further explored as anti-hyperglycemic agents. Putative binding mode of the significant and least active α-amylase inhibitors with the target enzyme was also explored by the docking studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Structural and functional characterization of recombinant medaka fish alpha-amylase expressed in yeast Pichia pastoris.

    PubMed

    Mizutani, Kimihiko; Toyoda, Mayuko; Otake, Yuichiro; Yoshioka, Soshi; Takahashi, Nobuyuki; Mikami, Bunzo

    2012-08-01

    The medaka fish α-amylase was expressed and purified. The expression systems were constructed using methylotrophic yeast Pichia pastoris, and the recombinant proteins were secreted into the culture medium. Purified recombinant α-amylase exhibited starch hydrolysis activity. The optimal pH, denaturation temperature, and K(M) and V(max) values were determined; chloride ions were essential for enzyme activity. The purified protein was also crystallized and examined by X-ray crystallography. The structure has the (α/β)(8) barrel fold, as do other known α-amylases, and the overall structure is very similar to the structure of vertebrate (human and pig) α-amylases. A novel expression plasmid was developed. Using this plasmid, high-throughput construction of an expression system by homologous recombination in P. pastoris cells, previously reported for membrane proteins, was successfully applied to the secretory protein.

  17. Comparative genomics and evolution of the amylase-binding proteins of oral streptococci.

    PubMed

    Haase, Elaine M; Kou, Yurong; Sabharwal, Amarpreet; Liao, Yu-Chieh; Lan, Tianying; Lindqvist, Charlotte; Scannapieco, Frank A

    2017-04-20

    Successful commensal bacteria have evolved to maintain colonization in challenging environments. The oral viridans streptococci are pioneer colonizers of dental plaque biofilm. Some of these bacteria have adapted to life in the oral cavity by binding salivary α-amylase, which hydrolyzes dietary starch, thus providing a source of nutrition. Oral streptococcal species bind α-amylase by expressing a variety of amylase-binding proteins (ABPs). Here we determine the genotypic basis of amylase binding where proteins of diverse size and function share a common phenotype. ABPs were detected in culture supernatants of 27 of 59 strains representing 13 oral Streptococcus species screened using the amylase-ligand binding assay. N-terminal sequences from ABPs of diverse size were obtained from 18 strains representing six oral streptococcal species. Genome sequencing and BLAST searches using N-terminal sequences, protein size, and key words identified the gene associated with each ABP. Among the sequenced ABPs, 14 matched amylase-binding protein A (AbpA), 6 matched amylase-binding protein B (AbpB), and 11 unique ABPs were identified as peptidoglycan-binding, glutamine ABC-type transporter, hypothetical, or choline-binding proteins. Alignment and phylogenetic analyses performed to ascertain evolutionary relationships revealed that ABPs cluster into at least six distinct, unrelated families (AbpA, AbpB, and four novel ABPs) with no phylogenetic evidence that one group evolved from another, and no single ancestral gene found within each group. AbpA-like sequences can be divided into five subgroups based on the N-terminal sequences. Comparative genomics focusing on the abpA gene locus provides evidence of horizontal gene transfer. The acquisition of an ABP by oral streptococci provides an interesting example of adaptive evolution.

  18. Immunochemical Studies on α-Amylase III. Immunochemical Relationships Among Amylases from Various Microorganisms1

    PubMed Central

    Sirisinha, Stitaya; Allen, Peter Z.

    1965-01-01

    Sirishinha, Stitaya (University of Rochester School of Medicine and Dentistry, Rochester, N.Y.), and Peter Z. Allen. Immunochemical studies on α-amylase. III. Immunochemical relationships among amylases from various microorganisms. J. Bacteriol. 90:1120–1128. 1965.—Immunochemical relationships among amylases obtained from a selected group of microorganisms were examined, and a cross-reaction was detected between the α-amylases of Bacillus stearothermophilus and B. subtilis. Immunodiffusion and quantitative precipitin studies, as well as cross-neutralization tests, indicate that B. stearothermophilus α-amylase reacts with a portion of antibody present in antisera to crystalline B. subtilis α-amylase. Amylases from these two species thus have some aspects of structure in common. Limited data obtained by immunodiffusion suggest that groupings which confer cross-reactivity to the B. stearothermophilus enzyme are lost after exposure to mercaptoethanol in the presence of ethylenediamine-tetraacetate, followed by treatment with iodoacetamide. With the antisera employed and within the concentration range examined, no immunochemical cross-reaction was observed among amylases from Aspergillus oryzae, B. subtilis, B. polymyxa, B. macerans, Pseudomonas saccharophila, and Euglena sanguinis. Immunoelectrophoresis of partially purified B. stearothermophilus α-amylase by use of antiserum to the crude enzyme, together with localization of amylase activity in immunoelectrophoretic plates, suggests that B. stearothermophilus α-amylase is antigenic in the rabbit. Images PMID:5847799

  19. Integrable alpha-amylase plasmid for generating random transcriptional fusions in Bacillus subtilis.

    PubMed Central

    O'Kane, C; Stephens, M A; McConnell, D

    1986-01-01

    An integrable plasmid, pOK4, which replicated independently in Escherichia coli was constructed for generating transcriptional fusions in vivo in Bacillus DNA. It did not replicate independently in Bacillus subtilis, but it could be made to integrate into the chromosome of B. subtilis if sequences homologous to chromosomal sequences were inserted into it. It had a selectable marker for chloramphenicol resistance and carried unique sites for EcoRI and SmaI just to the 5' side of a promoterless alpha-amylase gene from Bacillus licheniformis. When B. subtilis DNA fragments were ligated into one of these sites and the ligation mixture was used to transform an alpha-amylase-negative B. subtilis strain, chloramphenicol-resistant transformants could be isolated conveniently. Many of these were alpha-amylase positive, owing to the fusion of the plasmid amylase gene to chromosomal operons. In principle, because integration need not be mutagenic, it is possible to obtain fusions to any chromosomal operon. The site of each integration can be mapped, and the flanking sequences can be cloned into E. coli. The alpha-amylase gene can be used to detect regulated genes. We used it as an indicator to detect operons which are DNA-damage-inducible (din), and we identified insertions in both SP beta and PBSX prophages. Images PMID:3096966

  20. Amylase activity in substrate deficiency aerobic granules.

    PubMed

    Lee, Chuen-Chi; Lee, Duu-Jong; Lai, Juin-Yih

    2009-01-01

    Immunohistochemical staining was applied together with the multicolor fluorescent scheme to demonstrate the amylase activity for polysaccharide hydrolysis in stored or starved aerobic granules that are in substrate deficiency. If sufficient nutrients were present, alpha-amylase and beta-amylase were found close to the surface layer of the original granules. Following storage or starvation during which most external nutrients were depleted, the alpha-amylase and beta-amylase were distributed over the entire granule interior, suggesting endogenous respiration at the core of the granule. In particular, the fluorescent intensities of alpha-amylase and beta-amylase were enriched 5-20 microm from the edge of the internal cavity, suggesting the strong correlation between polysaccharide hydrolysis and the formation of interior cavities. The secreted amylase was located near the living cells, suggesting that the polysaccharide hydrolysis is restricted to local environment that occurs near the functional strains. Internal hydrolysis within the core, for the case of both proteins and polysaccharides should correspond in principle to the loss of granule stability.

  1. [The polymorphism of alpha-amylase].

    PubMed

    Baltova, S; Popov, K; Kynchev, V

    1990-01-01

    Individual phenotypes, phenotypic and genetic frequencies of alpha-amylase enzyme were determined by means of population genetic study. The results of this study revealed absence of genetic linkage between alpha-amylase phenotypes, haptoglobins and serum factor G1m(1) of gammaglobulin system (Gm).

  2. Widespread of horizontal gene transfer in the human genome.

    PubMed

    Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun

    2017-04-04

    A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. From the pair-wise alignments between human genome and 53 vertebrate genomes, 1,467 human genome regions (2.6 M bases) from all chromosomes were found to be more conserved with non-mammals than with most mammals. These human genome regions involve 642 known genes, which are enriched with ion binding. Compared to known horizontal gene transfer regions in the human genome, there were few overlapping regions, which indicated horizontal gene transfer is more common than we expected in the human genome. Horizontal gene transfer impacts hundreds of human genes and this study provided insight into potential mechanisms of HGT in the human genome.

  3. Comprehensive comparative homeobox gene annotation in human and mouse

    PubMed Central

    Wilming, Laurens G.; Boychenko, Veronika; Harrow, Jennifer L.

    2015-01-01

    Homeobox genes are a group of genes coding for transcription factors with a DNA-binding helix-turn-helix structure called a homeodomain and which play a crucial role in pattern formation during embryogenesis. Many homeobox genes are located in clusters and some of these, most notably the HOX genes, are known to have antisense or opposite strand long non-coding RNA (lncRNA) genes that play a regulatory role. Because automated annotation of both gene clusters and non-coding genes is fraught with difficulty (over-prediction, under-prediction, inaccurate transcript structures), we set out to manually annotate all homeobox genes in the mouse and human genomes. This includes all supported splice variants, pseudogenes and both antisense and flanking lncRNAs. One of the areas where manual annotation has a significant advantage is the annotation of duplicated gene clusters. After comprehensive annotation of all homeobox genes and their antisense genes in human and in mouse, we found some discrepancies with the current gene set in RefSeq regarding exact gene structures and coding versus pseudogene locus biotype. We also identified previously un-annotated pseudogenes in the DUX, Rhox and Obox gene clusters, which helped us re-evaluate and update the gene nomenclature in these regions. We found that human homeobox genes are enriched in antisense lncRNA loci, some of which are known to play a role in gene or gene cluster regulation, compared to their mouse orthologues. Of the annotated set of 241 human protein-coding homeobox genes, 98 have an antisense locus (41%) while of the 277 orthologous mouse genes, only 62 protein coding gene have an antisense locus (22%), based on publicly available transcriptional evidence. PMID:26412852

  4. Comprehensive comparative homeobox gene annotation in human and mouse.

    PubMed

    Wilming, Laurens G; Boychenko, Veronika; Harrow, Jennifer L

    2015-01-01

    Homeobox genes are a group of genes coding for transcription factors with a DNA-binding helix-turn-helix structure called a homeodomain and which play a crucial role in pattern formation during embryogenesis. Many homeobox genes are located in clusters and some of these, most notably the HOX genes, are known to have antisense or opposite strand long non-coding RNA (lncRNA) genes that play a regulatory role. Because automated annotation of both gene clusters and non-coding genes is fraught with difficulty (over-prediction, under-prediction, inaccurate transcript structures), we set out to manually annotate all homeobox genes in the mouse and human genomes. This includes all supported splice variants, pseudogenes and both antisense and flanking lncRNAs. One of the areas where manual annotation has a significant advantage is the annotation of duplicated gene clusters. After comprehensive annotation of all homeobox genes and their antisense genes in human and in mouse, we found some discrepancies with the current gene set in RefSeq regarding exact gene structures and coding versus pseudogene locus biotype. We also identified previously un-annotated pseudogenes in the DUX, Rhox and Obox gene clusters, which helped us re-evaluate and update the gene nomenclature in these regions. We found that human homeobox genes are enriched in antisense lncRNA loci, some of which are known to play a role in gene or gene cluster regulation, compared to their mouse orthologues. Of the annotated set of 241 human protein-coding homeobox genes, 98 have an antisense locus (41%) while of the 277 orthologous mouse genes, only 62 protein coding gene have an antisense locus (22%), based on publicly available transcriptional evidence.

  5. Nuclear actin activates human transcription factor genes including the OCT4 gene.

    PubMed

    Yamazaki, Shota; Yamamoto, Koji; Tokunaga, Makio; Sakata-Sogawa, Kumiko; Harata, Masahiko

    2015-01-01

    RNA microarray analyses revealed that nuclear actin activated many human transcription factor genes including OCT4, which is required for gene reprogramming. Oct4 is known to be activated by nuclear actin in Xenopus oocytes. Our findings imply that this process of OCT4 activation is conserved in vertebrates and among cell types and could be used for gene reprogramming of human cells.

  6. Cloning and Characterization of Cold-Adapted α-Amylase from Antarctic Arthrobacter agilis.

    PubMed

    Kim, Su-Mi; Park, Hyun; Choi, Jong-Il

    2017-03-01

    In this study, the gene encoding an α-amylase from a psychrophilic Arthrobacter agilis PAMC 27388 strain was cloned into a pET-28a(+) vector and heterologously expressed in Escherichia coli BL21(DE3). The recombinant α-amylase with a molecular mass of about 80 kDa was purified by using Ni(2+)-NTA affinity chromatography. This recombinant α-amylase exhibited optimal activity at pH 3.0 and 30 °C and was highly stable at varying temperatures (30-60 °C) and within the pH range of 4.0-8.0. Furthermore, α-amylase activity was enhanced in the presence of FeCl3 (1 mM) and β-mercaptoethanol (5 mM), while CoCl2 (1 mM), ammonium persulfate (5 mM), SDS (10 %), Triton X-100 (10 %), and urea (1 %) inhibited the enzymatic activity. Importantly, the presence of Ca(2+) ions and phenylmethylsulfonyl fluoride (PMSF) did not affect enzymatic activity. Thin layer chromatography (TLC) analysis showed that recombinant A. agilis α-amylase hydrolyzed starch, maltotetraose, and maltotriose, producing maltose as the major end product. These results make recombinant A. agilis α-amylase an attractive potential candidate for industrial applications in the textile, paper, detergent, and pharmaceutical industries.

  7. Analysis of human disease genes in the context of gene essentiality.

    PubMed

    Park, Donghyun; Park, Jungsun; Park, Seung Gu; Park, Taesung; Choi, Sun Shim

    2008-12-01

    The characteristics of human disease genes were investigated through a comparative analysis with mouse mutant phenotype data. Mouse orthologs with mutations that resulted in discernible phenotypes were separated from mutations with no phenotypic defect, listing 'phenotype' and 'no phenotype' genes. First, we showed that phenotype genes are more likely to be disease genes compared to no phenotype genes. Phenotype genes were further divided into 'embryonic lethal', 'postnatal lethal', and 'non-lethal phenotype' groups. Interestingly, embryonic lethal genes, the most essential genes in mouse, were less likely to be disease genes than postnatal lethal genes. These findings indicate that some extremely essential genes are less likely to be disease genes, although human disease genes tend to display characteristics of essential genes. We also showed that, in lethal groups, non-disease genes tend to evolve slower than disease genes indicating a strong purifying selection on non-disease genes in this group. In addition, phenotype and no phenotype groups showed differing types of disease mutations. Disease genes in the no phenotype group displayed a higher frequency of regulatory mutations while those in the phenotype group had more frequent coding mutations, indicating that the types of disease mutations vary depending on gene essentiality. Furthermore, missense disease mutations in no phenotype genes were found to be more radical amino acid substitutions than those in phenotype genes.

  8. Defining the Role of Essential Genes in Human Disease

    PubMed Central

    Robertson, David L.; Hentges, Kathryn E.

    2011-01-01

    A greater understanding of the causes of human disease can come from identifying characteristics that are specific to disease genes. However, a full understanding of the contribution of essential genes to human disease is lacking, due to the premise that these genes tend to cause developmental abnormalities rather than adult disease. We tested the hypothesis that human orthologs of mouse essential genes are associated with a variety of human diseases, rather than only those related to miscarriage and birth defects. We segregated human disease genes according to whether the knockout phenotype of their mouse ortholog was lethal or viable, defining those with orthologs producing lethal knockouts as essential disease genes. We show that the human orthologs of mouse essential genes are associated with a wide spectrum of diseases affecting diverse physiological systems. Notably, human disease genes with essential mouse orthologs are over-represented among disease genes associated with cancer, suggesting links between adult cellular abnormalities and developmental functions. The proteins encoded by essential genes are highly connected in protein-protein interaction networks, which we find correlates with an over-representation of nuclear proteins amongst essential disease genes. Disease genes associated with essential orthologs also are more likely than those with non-essential orthologs to contribute to disease through an autosomal dominant inheritance pattern, suggesting that these diseases may actually result from semi-dominant mutant alleles. Overall, we have described attributes found in disease genes according to the essentiality status of their mouse orthologs. These findings demonstrate that disease genes do occupy highly connected positions in protein-protein interaction networks, and that due to the complexity of disease-associated alleles, essential genes cannot be ignored as candidates for causing diverse human diseases. PMID:22096564

  9. Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.

    PubMed

    Holmes, Roger S; Wright, Matthew W; Laulederkind, Stanley J F; Cox, Laura A; Hosokawa, Masakiyo; Imai, Teruko; Ishibashi, Shun; Lehner, Richard; Miyazaki, Masao; Perkins, Everett J; Potter, Phillip M; Redinbo, Matthew R; Robert, Jacques; Satoh, Tetsuo; Yamashita, Tetsuro; Yan, Bingfan; Yokoi, Tsuyoshi; Zechner, Rudolf; Maltais, Lois J

    2010-10-01

    Mammalian carboxylesterase (CES or Ces) genes encode enzymes that participate in xenobiotic, drug, and lipid metabolism in the body and are members of at least five gene families. Tandem duplications have added more genes for some families, particularly for mouse and rat genomes, which has caused confusion in naming rodent Ces genes. This article describes a new nomenclature system for human, mouse, and rat carboxylesterase genes that identifies homolog gene families and allocates a unique name for each gene. The guidelines of human, mouse, and rat gene nomenclature committees were followed and "CES" (human) and "Ces" (mouse and rat) root symbols were used followed by the family number (e.g., human CES1). Where multiple genes were identified for a family or where a clash occurred with an existing gene name, a letter was added (e.g., human CES4A; mouse and rat Ces1a) that reflected gene relatedness among rodent species (e.g., mouse and rat Ces1a). Pseudogenes were named by adding "P" and a number to the human gene name (e.g., human CES1P1) or by using a new letter followed by ps for mouse and rat Ces pseudogenes (e.g., Ces2d-ps). Gene transcript isoforms were named by adding the GenBank accession ID to the gene symbol (e.g., human CES1_AB119995 or mouse Ces1e_BC019208). This nomenclature improves our understanding of human, mouse, and rat CES/Ces gene families and facilitates research into the structure, function, and evolution of these gene families. It also serves as a model for naming CES genes from other mammalian species.

  10. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris

    PubMed Central

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL−1 at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg−1. The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0–8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t 1/2) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification. PMID:26090417

  11. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris.

    PubMed

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL(-1) at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg(-1). The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0-8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t₁/₂) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification.

  12. Selective abortion and gene therapy: reflections on human limits.

    PubMed

    Post, S G

    1991-01-01

    The potential impact of the Human Genome Project on selective abortion is considered here, as is human gene therapy. Themes of emphasis are broadly humanistic: human suffering, contingency, and perfection. The chief concerns of the article lie with selective abortion for less than serious reasons, and with the importance of avoiding efforts to "enhance" human beings by gene transfer methods. The style is widely interdisciplinary.

  13. Attenuated acute salivary α-amylase responses to gustatory stimulation with citric acid in thin children.

    PubMed

    Chen, Long Hui; Yang, Ze Min; Chen, Wei Wen; Lin, Jing; Zhang, Min; Yang, Xiao Rong; Zhao, Ling Bo

    2015-04-14

    Salivary α-amylase (sAA) is responsible for the 'pre-digestion' of starch in the oral cavity and accounts for up to 50 % of salivary protein in human saliva. An accumulating body of literature suggests that sAA is of nutritional importance; however, it is still not clear how sAA is related to individual's nutritional status. Although copy number variations (CNV) of the salivary amylase gene (AMY1) are associated with variation in sAA levels, a significant amount of sAA variation is not explained by AMY1 CNV. To measure sAA responses to gustatory stimulation with citric acid, we used sAA ratio (the ratio of stimulated sAA levels to those of resting sAA) and investigated acute sAA responses to citric acid in children with normal (Normal-BMI, n 22) and low (Low-BMI, n 21) BMI. The AMY1 gene copy number was determined by quantitative PCR. We, for the first time, demonstrated attenuated acute sAA responses (decreased sAA ratio) to gustatory stimulation in Low-BMI (thinness grade 3) children compared with the Normal-BMI children, which suggest that sAA responses to gustatory stimulation may be of nutritional importance. However, child's nutritional status was not directly related to their resting or stimulated sAA levels, and it was not associated with AMY1 gene copy number. Finally, AMY1 CNV might influence, but did not eventually determine, sAA levels in children.

  14. Heterologous expression, biochemical characterization, and overproduction of alkaline α-amylase from Bacillus alcalophilus in Bacillus subtilis

    PubMed Central

    2011-01-01

    Background Alkaline α-amylases have potential applications for hydrolyzing starch under high pH conditions in the starch and textile industries and as ingredients in detergents for automatic dishwashers and laundries. While the alkaline α-amylase gains increased industrial interest, the yield of alkaline α-amylases from wild-type microbes is low, and the combination of genetic engineering and process optimization is necessary to achieve the overproduction of alkaline α-amylase. Results The alkaline α-amylase gene from Bacillus alcalophilus JN21 (CCTCC NO. M 2011229) was cloned and expressed in Bacillus subtilis strain WB600 with vector pMA5. The recombinant alkaline α-amylase was stable at pH from 7.0 to 11.0 and temperature below 40°C. The optimum pH and temperature of alkaline α-amylase was 9.0 and 50°C, respectively. Using soluble starch as the substrate, the Km and Vmax of alkaline α-amylase were 9.64 g/L and 0.80 g/(L·min), respectively. The effects of medium compositions (starch, peptone, and soybean meal) and temperature on the recombinant production of alkaline α-amylase in B. subtilis were investigated. Under the optimal conditions (starch concentration 0.6% (w/v), peptone concentration 1.45% (w/v), soybean meal concentration 1.3% (w/v), and temperature 37°C), the highest yield of alkaline α-amylase reached 415 U/mL. The yield of alkaline α-amylase in a 3-L fermentor reached 441 U/mL, which was 79 times that of native alkaline α-amylase from B. alcalophilus JN21. Conclusions This is the first report concerning the heterologous expression of alkaline α-amylase in B. subtilis, and the obtained results make it feasible to achieve the industrial production of alkaline α-amylase with the recombinant B. subtilis. PMID:21978209

  15. An ideal substrate for the measurement of pancreatic amylase?

    PubMed

    Lorentz, Klaus

    2002-08-01

    The advanced knowledge on substrate cleavage by human alpha-amylases promotes the development of chromogenic maltotriosides exclusively cleaved at the aglycone bond. Three essentials are required for this type of binding at the active site of the enzyme: (i) A minimal hydrophobic modification at the ultimate glucose unit to exclude the condensation of reaction products, (ii) a non-ionic substituent in the 2-position of the phenolic chromophore, and (iii) pertinent effectors to accomodate the aglycone at subsite +1. The novel substrate 2-chloro-4-nitrophenyl-alpha-D-maltotrioside (acG3-CNP) is presented as an example together with measurement conditions which allow a direct, sensitive and specific measurement of pancreatic amylase without stoichiometric calculations.

  16. Expression profiling the human septin gene family.

    PubMed

    Hall, Peter A; Jung, Kenneth; Hillan, Kenneth J; Russell, S E Hilary

    2005-07-01

    The septins are an evolutionarily conserved family of GTP-binding proteins involved in diverse processes including vesicle trafficking, apoptosis, remodelling of the cytoskeleton, infection, neurodegeneration, and neoplasia. The present paper reports a comprehensive study of septin gene expression by DNA microarray methods in 10 360 samples of normal, diseased, and tumour tissues. A novel septin, SEPT13, has been identified and is shown to be related to SEPT7. It is shown that SEPT13 and the other known human septins are expressed in all tissue types but some show high expression in lymphoid (SEPT1, 6, 9, and 12) or brain tissues (SEPT2, 3, 4, 5, 7, 8, and 11). For a given septin, some isoforms are highly expressed in the brain and others are not. For example, SEPT8_v2 and v1, 1* and 3 are highly expressed in the brain and cluster with SEPT2, 3, 4, 5, 7, and 11. However, a probe set specific for SEPT8_v1 with low brain expression clusters away from this set. Similarly, SEPT4 has lymphoid and non-lymphoid forms; SEPT2 has lymphoid and central nervous system (CNS) forms; and SEPT6 and SEPT9 are elevated in lymphoid tissues but both have forms that cluster away from the lymphoid forms. Perturbation of septin expression was widespread in disease and tumours of the various tissues examined, particularly for conditions of the CNS, where alterations in all 13 septin genes were identified. This analysis provides a comprehensive catalogue of the septin family in health and disease. It is a key step in understanding the role of septins in physiological and pathological states and provides insight into the complexity of septin biology. Copyright 2005 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  17. Isolation and characterization of the human Gs alpha gene.

    PubMed Central

    Kozasa, T; Itoh, H; Tsukamoto, T; Kaziro, Y

    1988-01-01

    The gene for Gs alpha (the alpha subunit of the guanine nucleotide-binding protein Gs) was isolated from human genomic libraries using rat Gs alpha cDNA as a probe. Comparison of the nucleotide sequence of the human gene with that of the rat cDNA revealed that the human Gs alpha gene spans approximately equal to 20 kilobases and is composed of 13 exons and 12 introns. Genomic Southern blot analysis suggests that the human haploid genome contains a single Gs alpha gene. Previous reports indicated the presence of multiple species of Gs alpha cDNA. The structure of the human Gs alpha gene suggests that four types of Gs alpha mRNAs may be generated from a single Gs alpha gene by alternate use of exon 3 and/or of two 3' splice sites of intron 3, where an unusual splice junction sequence (TG) instead of the consensus (AG) is used. S1 nuclease mapping analysis of human Gs alpha mRNA identified multiple transcriptional initiation sites. The promoter region of the human Gs alpha gene has extremely high G + C content (85%). It contains 4 "GC" boxes, but no typical "TATA" or "CAAT" box sequence. In the 5' flanking region, there are several blocks of sequences that are similar to the sequences of the 5' flanking region of the human c-Ki-ras2 gene. Images PMID:3127824

  18. Characterization of thermostable β-amylase isozymes from Lactobacillus fermentum.

    PubMed

    Kocabay, Samet; Çetinkaya, Serap; Akkaya, Birnur; Yenidünya, Ali Fazil

    2016-12-01

    A strain of Lactobacillus fermentum producing two isozymes of a 20kDa β-amylase was isolated from the faecal sample of a newborn. The starin was identified by sequencing its 16S rRNA gene. The two β-amylase isozymes were resolved and visualized by two dimensional protein gel electrophoresis (2-D gel electrophoresis). Some of the physical and biochemical properties of the enzymes were characterized. The β-amylase displayed two optimum pH s, 5.0 and 10.0 and two optimum temperatures, 45°C and 37°C, respectively. The isozymes hydrolyzed different substrates: glycogen at pH 5.0, and corn starch at pH 10.0. The activity did not require Ca(2+), though the activity at pH 10.0 was enhanced in the presence of 5.0mM and 10.0mM CaCl2, 110% and 130%, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. The nucleotide sequence of the human beta-globin gene.

    PubMed

    Lawn, R M; Efstratiadis, A; O'Connell, C; Maniatis, T

    1980-10-01

    We report the complete nucleotide sequence of the human beta-globin gene. The purpose of this study is to obtain information necessary to study the evolutionary relationships between members of the human beta-like globin gene family and to provide the basis for comparing normal beta-globin genes with those obtained from the DNA of individuals with genetic defects in hemoglobin expression.

  20. Evolutionary conservation and disease gene association of the human genes composing pseudogenes.

    PubMed

    Sen, Kamalika; Ghosh, Tapash Chandra

    2012-06-15

    Pseudogenes, the 'genomic fossils' present portrayal of evolutionary history of human genome. The human genes configuring pseudogenes are also now coming forth as important resources in the study of human protein evolution. In this communication, we explored evolutionary conservation of the genes forming pseudogenes over the genes lacking any pseudogene and delving deeper, we probed an evolutionary rate difference between the disease genes in the two groups. We illustrated this differential evolutionary pattern by gene expressivity, number of regulatory miRNA targeting per gene, abundance of protein complex forming genes and lesser percentage of protein intrinsic disorderness. Furthermore, pseudogenes are observed to harbor sequence variations, over their entirety, those become degenerative disease-causing mutations though the disease involvement of their progenitors is still unexplored. Here, we unveiled an immense association of disease genes in the genes casting pseudogenes in human. We interpreted the issue by disease associated miRNA targeting, genes containing polymorphisms in miRNA target sites, abundance of genes having disease causing non-synonymous mutations, disease gene specific network properties, presence of genes having repeat regions, affluence of dosage sensitive genes and the presence of intrinsically unstructured protein regions.

  1. Does human gene therapy raise new ethical questions?

    PubMed

    Tauer, C A

    1990-01-01

    Consideration of the ethics of human gene therapy does not seem to raise questions that have never been asked before. However, particularly when gene therapy is extended to modification of the germ cells, several ethical issues take on an added importance or significance. These issues are: (i) possible moral limitations on tampering with "human nature"; (ii) the extent of our responsibility to future generations; (iii) the appropriate use of early human embryos in genetic research. Furthermore, standard norms in clinical and research ethics require careful application to trials of human gene therapy, even if only somatic rather than germ-line improvements are sought.

  2. Human monogenic disease genes have frequently functionally redundant paralogs.

    PubMed

    Chen, Wei-Hua; Zhao, Xing-Ming; van Noort, Vera; Bork, Peer

    2013-01-01

    Mendelian disorders are often caused by mutations in genes that are not lethal but induce functional distortions leading to diseases. Here we study the extent of gene duplicates that might compensate genes causing monogenic diseases. We provide evidence for pervasive functional redundancy of human monogenic disease genes (MDs) by duplicates by manifesting 1) genes involved in human genetic disorders are enriched in duplicates and 2) duplicated disease genes tend to have higher functional similarities with their closest paralogs in contrast to duplicated non-disease genes of similar age. We propose that functional compensation by duplication of genes masks the phenotypic effects of deleterious mutations and reduces the probability of purging the defective genes from the human population; this functional compensation could be further enhanced by higher purification selection between disease genes and their duplicates as well as their orthologous counterpart compared to non-disease genes. However, due to the intrinsic expression stochasticity among individuals, the deleterious mutations could still be present as genetic diseases in some subpopulations where the duplicate copies are expressed at low abundances. Consequently the defective genes are linked to genetic disorders while they continue propagating within the population. Our results provide insight into the molecular basis underlying the spreading of duplicated disease genes.

  3. Human Monogenic Disease Genes Have Frequently Functionally Redundant Paralogs

    PubMed Central

    van Noort, Vera; Bork, Peer

    2013-01-01

    Mendelian disorders are often caused by mutations in genes that are not lethal but induce functional distortions leading to diseases. Here we study the extent of gene duplicates that might compensate genes causing monogenic diseases. We provide evidence for pervasive functional redundancy of human monogenic disease genes (MDs) by duplicates by manifesting 1) genes involved in human genetic disorders are enriched in duplicates and 2) duplicated disease genes tend to have higher functional similarities with their closest paralogs in contrast to duplicated non-disease genes of similar age. We propose that functional compensation by duplication of genes masks the phenotypic effects of deleterious mutations and reduces the probability of purging the defective genes from the human population; this functional compensation could be further enhanced by higher purification selection between disease genes and their duplicates as well as their orthologous counterpart compared to non-disease genes. However, due to the intrinsic expression stochasticity among individuals, the deleterious mutations could still be present as genetic diseases in some subpopulations where the duplicate copies are expressed at low abundances. Consequently the defective genes are linked to genetic disorders while they continue propagating within the population. Our results provide insight into the molecular basis underlying the spreading of duplicated disease genes. PMID:23696728

  4. Biotechnological Processes in Microbial Amylase Production

    PubMed Central

    Arshad, M. K. Md; Lakshmipriya, Thangavel; Hashim, Uda; Chinni, Suresh V.

    2017-01-01

    Amylase is an important and indispensable enzyme that plays a pivotal role in the field of biotechnology. It is produced mainly from microbial sources and is used in many industries. Industrial sectors with top-down and bottom-up approaches are currently focusing on improving microbial amylase production levels by implementing bioengineering technologies. The further support of energy consumption studies, such as those on thermodynamics, pinch technology, and environment-friendly technologies, has hastened the large-scale production of the enzyme. Herein, the importance of microbial (bacteria and fungi) amylase is discussed along with its production methods from the laboratory to industrial scales. PMID:28280725

  5. Human gene therapy: a brief overview of the genetic revolution.

    PubMed

    Misra, Sanjukta

    2013-02-01

    Advances in biotechnology have brought gene therapy to the forefront of medical research. The prelude to successful gene therapy i.e. the efficient transfer and expression of a variety of human gene into target cells has already been accomplished in several systems. Safe methods have been devised to do this, using several viral and no-viral vectors. Two main approaches emerged: in vivo modification and ex vivo modification. Retrovirus, adenovirus, adeno-associated virus are suitable for gene therapeutic approaches which are based on permanent expression of the therapeutic gene. Non-viral vectors are far less efficient than viral vectors, but they have advantages due to their low immunogenicity and their large capacity for therapeutic DNA. To improve the function of non-viral vectors, the addition of viral functions such as receptor mediated uptake and nuclear translocation of DNA may finally lead to the development of an artificial virus. Gene transfer protocols have been approved for human use in inherited diseases, cancers and acquired disorders. In 1990, the first successful clinical trial of gene therapy was initiated for adenosine deaminase deficiency. Since then, the number of clinical protocols initiated worldwide has increased exponentially. Although preliminary results of these trials are somewhat disappointing, but human gene therapy dreams of treating diseases by replacing or supplementing the product of defective or introducing novel therapeutic genes. So definitely human gene therapy is an effective addition to the arsenal of approaches to many human therapies in the 21st century.

  6. Isolation of a novel amylase and lipase-producing Pseudomonas luteola strain: study of amylase production conditions

    PubMed Central

    2014-01-01

    An amylase and lipase producing bacterium (strain C2) was enriched and isolated from soil regularly contaminated with olive washing wastewater in Sfax, Tunisia. Cell was aerobic, mesophilic, Gram-negative, motile, non-sporulating bacterium, capable of growing optimally at pH 7 and 30°C and tolerated maximally 10% (W/V) NaCl. The predominant fatty acids were found to be C18:1ω7c (32.8%), C16:1ω7c (27.3%) and C16:0 (23.1%). Phylogenetic analysis of the 16S rRNA gene revealed that this strain belonging to the genus Pseudomonas. Strain C2 was found to be closely related to Pseudomonas luteola with more than 99% of similarity. Amylase optimization extraction was carried out using Box Behnken Design (BBD). Its maximal activity was found when the pH and temperature ranged from 5.5 to 6.5 and from 33 to 37°C, respectively. Under these conditions, amylase activity was found to be about 9.48 U/ml. PMID:24405763

  7. Comparison of the canine and human olfactory receptor gene repertoires

    PubMed Central

    Quignon, Pascale; Kirkness, Ewen; Cadieu, Edouard; Touleimat, Nizar; Guyon, Richard; Renier, Corinne; Hitte, Christophe; André, Catherine; Fraser, Claire; Galibert, Francis

    2003-01-01

    Background Olfactory receptors (ORs), the first dedicated molecules with which odorants physically interact to arouse an olfactory sensation, constitute the largest gene family in vertebrates, including around 900 genes in human and 1,500 in the mouse. Whereas dogs, like many other mammals, have a much keener olfactory potential than humans, only 21 canine OR genes have been described to date. Results In this study, 817 novel canine OR sequences were identified, and 640 have been characterized. Of the 661 characterized OR sequences, representing half of the canine repertoire, 18% are predicted to be pseudogenes, compared with 63% in human and 20% in mouse. Phylogenetic analysis of 403 canine OR sequences identified 51 families, and radiation-hybrid mapping of 562 showed that they are distributed on 24 dog chromosomes, in 37 distinct regions. Most of these regions constitute clusters of 2 to 124 closely linked genes. The two largest clusters (124 and 109 OR genes) are located on canine chromosomes 18 and 21. They are orthologous to human clusters located on human chromosomes 11q11-q13 and HSA11p15, containing 174 and 115 ORs respectively. Conclusions This study shows a strongly conserved genomic distribution of OR genes between dog and human, suggesting that OR genes evolved from a common mammalian ancestral repertoire by successive duplications. In addition, the dog repertoire appears to have expanded relative to that of humans, leading to the emergence of specific canine OR genes. PMID:14659017

  8. Ribosomal protein gene mapping and human chromosomal disorders

    SciTech Connect

    Kenmochi, N.; Goodman, N.; Page, D.C.

    1994-09-01

    In Drosophila, the Minute phenotype (reduced body size, diminished viability and fertility, and short, thin bristles) results from heterozygous deficiencies (deletions) at any one of 50 loci scattered about the genome. A handful of these Minute loci have been molecularly characterized, and all have been found to encode ribosomal proteins. Thus, the Minute phenotype appears to result from reduced protein synthetic capacity in flies with one rather than two copies of a given ribosomal protein (rp) gene. We are pursuing the possibility that similar reductions in protein synthetic capacity--again resulting from rp gene deficiencies--might underlie phenotypes associated with certain chromosomal disorders in humans. We and our colleagues have reported findings consistent with a role for RPS4 deficiency in the etiology of certain features of Turner syndrome, a complex human disorder classically associated with an XO karyotype. We are intrigued by the possibility that deficiencies of other human rp genes might cause phenotypic abnormalities similar to those seen in Turner syndrome--just as deficiencies of any of a number of Drosophila rp genes cause the Minute phenotype. We must first learn the chromosomal map position of each of the estimated 83 human rp genes. The task of mapping the functional (intron-containing) rp genes is complicated by the existence of processed pseudogenes elsewhere in the genome. To date, we have assigned (or confirmed the previous assignment of) 38 rp genes to individual human chromosomes by PCR analysis of human-rodent somatic cell hybrids containing subsets of human chromosomes, with all but four chromosomes carrying at least one rp gene. We have also identified more than 100 large-insert human YAC (yeast artificial chromosome) clones that contain individual rp genes. Such screening of YAC libraries will result in precise positioning of the rp genes on the emerging physical map of the human genome.

  9. Purification, sequencing, and biochemical characterization of a novel calcium-independent α-amylase AmyTVE from Thermoactinomyces vulgaris.

    PubMed

    El-Sayed, Ahmed K A; Abou Dobara, Mohamed I; El-Fallal, Amira A; Omar, Noha F

    2013-06-01

    α-Amylase from Thermoactinomyces vulgaris was highly purified 48.9-fold by ammonium sulfate precipitation, gel filtration on Sephadex G-50 column, and ion exchange chromatography column of DEAE-cellulose. The molecular weight of the enzyme was estimated to be 135 and 145 kDa by SDS-PAGE. Its high molecular weight is due to high glycosylation. The purified amylase exhibited maximal activity at pH 6.0 to 7.0 and was stable in the range of pH 4.0 to 9.0. The optimum temperature for its activity was 50 °C. The enzyme half-life time was 120 min at 50 °C, suggesting intermediate temperature stable α-amylase. The enzyme was sensitive to different metal ions, including NaCl, CoCl(2), and CaCl(2), and to different concentrations of EDTA. The enzyme activity was inhibited in the presence of 1 mM CaCl(2), suggesting that it is a calcium-independent α-amylase. The TLC showed that the amylase hydrolyzed starch to produce large maltooligosaccharides as the main products. A 1.1-kb DNA fragment of the putative α-amylase gene (amy TVE) from T. vulgaris was amplified by using two specific newly designed primers. Sequencing analysis showed 56.2 % similarity to other Thermoactinomyces α-amylases with two conserved active sites confirming its function.

  10. Dynamic changes in gene expression during human trophoblast differentiation.

    PubMed

    Handwerger, Stuart; Aronow, Bruce

    2003-01-01

    The genetic program that directs human placental differentiation is poorly understood. In a recent study, we used DNA microarray analyses to determine genes that are dynamically regulated during human placental development in an in vitro model system in which highly purified cytotrophoblast cells aggregate spontaneously and fuse to form a multinucleated syncytium that expresses placental lactogen, human chorionic gonadotropin, and other proteins normally expressed by fully differentiated syncytiotrophoblast cells. Of the 6918 genes present on the Incyte Human GEM V microarray that we analyzed over a 9-day period, 141 were induced and 256 were downregulated by more than 2-fold. The dynamically regulated genes fell into nine distinct kinetic patterns of induction or repression, as detected by the K-means algorithm. Classifying the genes according to functional characteristics, the regulated genes could be divided into six overall categories: cell and tissue structural dynamics, cell cycle and apoptosis, intercellular communication, metabolism, regulation of gene expression, and expressed sequence tags and function unknown. Gene expression changes within key functional categories were tightly coupled to the morphological changes that occurred during trophoblast differentiation. Within several key gene categories (e.g., cell and tissue structure), many genes were strongly activated, while others with related function were strongly repressed. These findings suggest that trophoblast differentiation is augmented by "categorical reprogramming" in which the ability of induced genes to function is enhanced by diminished synthesis of other genes within the same category. We also observed categorical reprogramming in human decidual fibroblasts decidualized in vitro in response to progesterone, estradiol, and cyclic AMP. While there was little overlap between genes that are dynamically regulated during trophoblast differentiation versus decidualization, many of the categories

  11. Gibberellic acid induces α-amylase expression in adipose-derived stem cells.

    PubMed

    Kasamatsu, Atsushi; Iyoda, Manabu; Usukura, Katsuya; Sakamoto, Yosuke; Ogawara, Katsunori; Shiiba, Masashi; Tanzawa, Hideki; Uzawa, Katsuhiro

    2012-08-01

    Salivary α-amylase is the most important enzyme for oral digestion of dietary starch. Therefore, regeneration of the salivary glands via a tissue engineering approach is clearly required for patients with salivary gland dysfunction. Early during seed germination, the embryo synthesizes gibberellic acid (GA3), a plant hormone that activates the synthesis and secretion of α-amylase. The purpose of this study was to explore an approach for differentiation of stem cells into salivary glands using GA3. We isolated adipose-derived stem cells (ASCs), which are positive for mesenchymal stem cell markers (CD73, CD90 and CD105) and possess pluripotency to osteoblasts, adipocytes and neural cells, from human buccal fat pads, which are a readily available source for dentists and oral surgeons. In addition, we investigated the cytotoxicity of GA3 for human ASCs. GA3 neither affects cell morphology nor cell viability in a dose- or time-dependent manner. ASCs were incubated with GA3 to assess mRNA and protein expression of α-amylase by reverse transcriptase-polymerase chain reaction and western blot analyses. α-amylase mRNA expression on 21 days after treatment with GA3 (1 mM) was seven times greater than that in resting condition (Day 0). While we did not detect α-amylase bands on Day 0, α-amylase protein was detectable 7 days after treatment with GA3, reaching a maximal level on Day 21. Our results indicated that GA3 can increase cellular α-amylase expression and that our induction method would be useful for therapeutic application for salivary gland regeneration.

  12. Loss of gene function and evolution of human phenotypes

    PubMed Central

    Oh, Hye Ji; Choi, Dongjin; Goh, Chul Jun; Hahn, Yoonsoo

    2015-01-01

    Humans have acquired many distinct evolutionary traits after the human-chimpanzee divergence. These phenotypes have resulted from genetic changes that occurred in the human genome and were retained by natural selection. Comparative primate genome analyses reveal that loss-of-function mutations are common in the human genome. Some of these gene inactivation events were revealed to be associated with the emergence of advantageous phenotypes and were therefore positively selected and fixed in modern humans (the “less-ismore” hypothesis). Representative cases of human gene inactivation and their functional implications are presented in this review. Functional studies of additional inactive genes will provide insight into the molecular mechanisms underlying acquisition of various human-specific traits. [BMB Reports 2015; 48(7): 373-379] PMID:25887751

  13. Loss of gene function and evolution of human phenotypes.

    PubMed

    Oh, Hye Ji; Choi, Dongjin; Goh, Chul Jun; Hahn, Yoonsoo

    2015-07-01

    Humans have acquired many distinct evolutionary traits after the human-chimpanzee divergence. These phenotypes have resulted from genetic changes that occurred in the human genome and were retained by natural selection. Comparative primate genome analyses reveal that loss-of-function mutations are common in the human genome. Some of these gene inactivation events were revealed to be associated with the emergence of advantageous phenotypes and were therefore positively selected and fixed in modern humans (the "less-ismore" hypothesis). Representative cases of human gene inactivation and their functional implications are presented in this review. Functional studies of additional inactive genes will provide insight into the molecular mechanisms underlying acquisition of various human-specific traits.

  14. Network properties of human disease genes with pleiotropic effects

    PubMed Central

    2010-01-01

    Background The ability of a gene to cause a disease is known to be associated with the topological position of its protein product in the molecular interaction network. Pleiotropy, in human genetic diseases, refers to the ability of different mutations within the same gene to cause different pathological effects. Here, we hypothesized that the ability of human disease genes to cause pleiotropic effects would be associated with their network properties. Results Shared genes, with pleiotropic effects, were more central than specific genes that were associated with one disease, in the protein interaction network. Furthermore, shared genes associated with phenotypically divergent diseases (phenodiv genes) were more central than those associated with phenotypically similar diseases. Shared genes had a higher number of disease gene interactors compared to specific genes, implying higher likelihood of finding a novel disease gene in their network neighborhood. Shared genes had a relatively restricted tissue co-expression with interactors, contrary to specific genes. This could be a function of shared genes leading to pleiotropy. Essential and phenodiv genes had comparable connectivities and hence we investigated for differences in network attributes conferring lethality and pleiotropy, respectively. Essential and phenodiv genes were found to be intra-modular and inter-modular hubs with the former being highly co-expressed with their interactors contrary to the latter. Essential genes were predominantly nuclear proteins with transcriptional regulation activities while phenodiv genes were cytoplasmic proteins involved in signal transduction. Conclusion The properties of a disease gene in molecular interaction network determine its role in manifesting different and divergent diseases. PMID:20525321

  15. Different level of population differentiation among human genes.

    PubMed

    Wu, Dong-Dong; Zhang, Ya-Ping

    2011-01-14

    During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Our analysis demonstrates different level of population differentiation among human populations for different gene groups.

  16. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  17. Differential Heat Stabilities of Bacillus Amylases

    PubMed Central

    Bliesmer, Barry O.; Hartman, Paul A.

    1973-01-01

    Seventeen cultures representing eight strains of Bacillus coagulans and twelve cultures representing eight strains of Bacillus stearothermophilus did not yield a culture that would produce amylase at both 37 and 55 C. PMID:4688668

  18. Differences in Gene Expression between Mouse and Human for Dynamically Regulated Genes in Early Embryo

    PubMed Central

    Madissoon, Elo; Töhönen, Virpi; Vesterlund, Liselotte; Katayama, Shintaro; Unneberg, Per; Inzunza, Jose; Hovatta, Outi; Kere, Juha

    2014-01-01

    Infertility is a worldwide concern that can be treated with in vitro fertilization (IVF). Improvements in IVF and infertility treatment depend largely on better understanding of the molecular mechanisms for human preimplantation development. Several large-scale studies have been conducted to identify gene expression patterns for the first five days of human development, and many functional studies utilize mouse as a model system. We have identified genes of possible importance for this time period by analyzing human microarray data and available data from online databases. We selected 70 candidate genes for human preimplantation development and investigated their expression in the early mouse development from oocyte to the 8-cell stage. Maternally loaded genes expectedly decreased in expression during development both in human and mouse. We discovered that 25 significantly upregulated genes after fertilization in human included 13 genes whose orthologs in mouse behaved differently and mimicked the expression profile of maternally expressed genes. Our findings highlight many significant differences in gene expression patterns during mouse and human preimplantation development. We also describe four cancer-testis antigen families that are also highly expressed in human embryos: PRAME, SSX, GAGE and MAGEA. PMID:25089626

  19. Differences in gene expression between mouse and human for dynamically regulated genes in early embryo.

    PubMed

    Madissoon, Elo; Töhönen, Virpi; Vesterlund, Liselotte; Katayama, Shintaro; Unneberg, Per; Inzunza, Jose; Hovatta, Outi; Kere, Juha

    2014-01-01

    Infertility is a worldwide concern that can be treated with in vitro fertilization (IVF). Improvements in IVF and infertility treatment depend largely on better understanding of the molecular mechanisms for human preimplantation development. Several large-scale studies have been conducted to identify gene expression patterns for the first five days of human development, and many functional studies utilize mouse as a model system. We have identified genes of possible importance for this time period by analyzing human microarray data and available data from online databases. We selected 70 candidate genes for human preimplantation development and investigated their expression in the early mouse development from oocyte to the 8-cell stage. Maternally loaded genes expectedly decreased in expression during development both in human and mouse. We discovered that 25 significantly upregulated genes after fertilization in human included 13 genes whose orthologs in mouse behaved differently and mimicked the expression profile of maternally expressed genes. Our findings highlight many significant differences in gene expression patterns during mouse and human preimplantation development. We also describe four cancer-testis antigen families that are also highly expressed in human embryos: PRAME, SSX, GAGE and MAGEA.

  20. De Novo Origin of Human Protein-Coding Genes

    PubMed Central

    Wu, Dong-Dong; Irwin, David M.; Zhang, Ya-Ping

    2011-01-01

    The de novo origin of a new protein-coding gene from non-coding DNA is considered to be a very rare occurrence in genomes. Here we identify 60 new protein-coding genes that originated de novo on the human lineage since divergence from the chimpanzee. The functionality of these genes is supported by both transcriptional and proteomic evidence. RNA–seq data indicate that these genes have their highest expression levels in the cerebral cortex and testes, which might suggest that these genes contribute to phenotypic traits that are unique to humans, such as improved cognitive ability. Our results are inconsistent with the traditional view that the de novo origin of new genes is very rare, thus there should be greater appreciation of the importance of the de novo origination of genes. PMID:22102831

  1. Chromosomal localization of the human diazepam binding inhibitor gene

    SciTech Connect

    DeBernardi, M.A.; Crowe, R.R.; Mocchetti, I.; Shows, T.B.; Eddy, R.L.; Costa, E.

    1988-09-01

    The authors have used in situ chromosome hybridization and human-mouse somatic cell hybrids to map the gene(s) for human diazepam binding inhibitor (DBI), an endogenous putative modulator of the /gamma/-aminobutyric acid receptor acting at the allosteric regulatory center of this receptor that includes the benzodiazepine recognition site. In 784 chromosome spreads hybridized with human DBI cDNA, the distribution of 1,476 labeled sites revealed a significant clustering of autoradiographic grains (11.3% of total label) on the long arm of chromosome 2 (2q). Furthermore, 63.5% of the grains found on 2q were located on 2q12-21, suggesting regional mapping of DBI gene(s) to this segment. Secondary hybridization signals were frequently observed on other chromosomes and they were statistically significant mainly for chromosomes 5, 6, 11, and 14. In addition, DNA from 32 human-mouse cell hybrids was digested with BamHI and probed with human DBI cDNA. A 3.5-kilobase band, which probably represents the human DBI gene, was assigned to chromosome 2. Four higher molecular weight bands, also detected in BamHI digests, could not be unequivocally assigned. A chromosome 2 location was excluded for the 27-, 13-, and 10-kilobase bands. These results assign a human DBI gene to chromosome 2 (2q12-21) and indicate that three of the four homologous sequences detected by the human DBI probe are located on three other chromosomes.

  2. Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes

    SciTech Connect

    Kim, J.M.; Khan, T.A.; Moore, K.W. ); Brannan, C.I.; Copeland, N.G.; Jenkins, N.A. )

    1992-06-01

    The nucleotide sequence of a 7.2-kb segment containing the mouse IL-10 (mIL-10) gene was determined. Comparison to the mIL-10 cDNA sequence revealed the presence of five exons that span [approximately]5.1 kb of genomic DNA. The noncoding regions of the mIL-10 gene contain sequences that have been associated with transcriptional regulation of several cytokine genes. The mIL-10 gene was mapped to mouse chromosome 1 and the human IL-10 gene was also mapped to human chromosome 1. 35 refs., 4 figs., 3 tabs.

  3. Shaping individuality: human inheritable germ line gene modification.

    PubMed

    Salvi, M

    2001-01-01

    In this paper I deal with ethical factors surrounding germline gene therapy. Such implications include intergenerational responsibility, human dignity, moral status of embryos and so on. I will explore the relevance of the above mentioned issues to discuss the ethical implication of human germline gene therapy (HGLT). We will see that most of arguments claimed by bioethicists do not provide valid reason to oppose HGLT. I will propose an alternative view, based on personal identity issues, to discuss the ethics of human inheritable gene modification.

  4. Patenting human genes: when economic interests trump logic and ethics.

    PubMed

    Kluge, Eike-Henner W

    2003-06-01

    To date, over 5,000 applications have been filed with United States Patent Office for patents on human genes. More than 1,500 of these applications have been granted. Other jurisdictions are experiencing a similar rush to mine and protect genomic gold. This paper argues that although many jurisdictions allow the patenting of human genes, this is ethically indefensible and amounts to an unjustified appropriation of a general human heritage. Economic and legal arguments in favour of patenting are considered and rejected. Reference is made to the Wellcome Trust Consortium's initiative and the Merck Gene Index Project, which place patented genetic information into the public domain.

  5. Pancreatic Amylase Is an Environmental Signal for Regulation of Biofilm Formation and Host Interaction in Campylobacter jejuni

    PubMed Central

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A.; Nair, Sean P.; Sadiq, Sohaib; Williams, Lisa K.; Trantham, Emma K.; Stephenson, Holly; Wren, Brendan W.; Bajaj-Elliott, Mona; Cogan, Tristan A.; Laws, Andrew P.; Wade, Jim; Dorrell, Nick

    2015-01-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism. PMID:26438798

  6. Pancreatic amylase is an environmental signal for regulation of biofilm formation and host interaction in Campylobacter jejuni.

    PubMed

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A; Nair, Sean P; Sadiq, Sohaib; Williams, Lisa K; Trantham, Emma K; Stephenson, Holly; Wren, Brendan W; Bajaj-Elliott, Mona; Cogan, Tristan A; Laws, Andrew P; Wade, Jim; Dorrell, Nick; Allan, Elaine

    2015-12-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Polyaniline-graphene based α-amylase biosensor with a linear dynamic range in excess of 6 orders of magnitude.

    PubMed

    Teixeira, Sofia Rodrigues; Lloyd, Catherine; Yao, Seydou; Andrea Salvatore Gazze; Whitaker, Iain S; Francis, Lewis; Conlan, R Steven; Azzopardi, Ernest

    2016-11-15

    α-amylase is an established marker for diagnosis of pancreatic and salivary disease, and recent research has seen a substantial expansion of its use in therapeutic and diagnostic applications for infection, cancer and wound healing. The lack of bedside monitoring devices for α-amylase detection has hitherto restricted the clinical progress of such applications. We have developed a highly sensitive α-amylase immunosensor platform, produced via in situ electropolymerization of aniline onto a screen-printed graphene support (SPE). Covalently binding an α-amylase specific antibody to a polyaniline (PANI) layer and controlling device assembly using electrochemical impedance spectroscopy (EIS), we have achieved a highly linear response against α-amylase concentration. Each stage of the assembly was characterized using a suite of high-resolution topographical, chemical and mechanical techniques. Quantitative, highly sensitive detection was demonstrated using an artificially spiked human blood plasma samples. The device has a remarkably wide limit of quantification (0.025-1000IU/L) compared to α-amylase assays in current clinical use. With potential for simple scale up to volume manufacturing though standard semiconductor production techniques and subsequently clinical application, this biosensor will enable clinical benefit through early disease detection, and better informed administration of correct therapeutic dose of drugs used to treat α-amylase related diseases.

  8. CdTe/CdSe quantum dots improve the binding affinities between α-amylase and polyphenols.

    PubMed

    Ni, Xiaoling

    2012-03-01

    People exposed to engineered nanomaterials have potential health risks associated. Human α-amylase is one of the key enzymes in the digestive system. There are few reports about the influence of quantum dots (QDs) on the digestive enzymes and their inhibition system. This work focused on the toxic effect of CdTe/CdSe QDs on the interactions between α-amylase and its natural inhibitors. Thirty-six dietary polyphenols, natural α-amylase inhibitors from food, were studied for their affinities for α-amylase in the absence and presence of CdTe/CdSe QDs by a fluorescence quenching method. The magnitudes of apparent binding constants of polyphenols for α-amylase were almost in the range of 10(5)-10(7) L mol(-1) in the presence of CdTe/CdSe QDs, which were higher than the magnitudes of apparent binding constants in the absence of CdTe/CdSe QDs (10(4)-10(6) L mol(-1)). CdTe/CdSe QDs obviously improved the affinities of dietary polyphenols for α-amylase up to 389.04 times. It is possible that the binding interaction between polyphenols and α-amylase in the presence of CdTe/CdSe QDs was mainly caused by electrostatic interactions. QDs significantly influence the digestive enzymes and their inhibition system.

  9. Evolution of Brain Active Gene Promoters in Human Lineage Towards the Increased Plasticity of Gene Regulation.

    PubMed

    Gunbin, Konstantin V; Ponomarenko, Mikhail P; Suslov, Valentin V; Gusev, Fedor; Fedonin, Gennady G; Rogaev, Evgeny I

    2017-02-24

    Adaptability to a variety of environmental conditions is a prominent feature of Homo sapiens. We hypothesize that this feature can be explained by evolutionary changes in gene promoters active in the brain prefrontal cortex leading to a more flexible gene regulation network. The genotype-dependent range of gene expression can be broader in humans than in other higher primates. Thus, we searched for specific signatures of evolutionary changes in promoter architectures of multiple hominid genes, including the genes active in human cortical neurons that may indicate an increase of variability of gene expression rather than just changes in the level of expression, such as downregulation or upregulation of the genes. We performed a whole-genome search for genetic-based alterations that may impact gene regulation "flexibility" in a process of hominids evolution, such as (i) CpG dinucleotide content, (ii) predicted nucleosome-DNA dissociation constant, and (iii) predicted affinities for TATA-binding protein (TBP) in gene promoters. We tested all putative promoter regions across the human genome and especially gene promoters in active chromatin state in neurons of prefrontal cortex, the brain region critical for abstract thinking and social and behavioral adaptation. Our data imply that the origin of modern man has been associated with an increase of flexibility of promoter-driven gene regulation in brain. In contrast, after splitting from the ancestral lineages of H. sapiens, the evolution of ape species is characterized by reduced flexibility of gene promoter functioning, underlying reduced variability of the gene expression.

  10. Human brain evolution: from gene discovery to phenotype discovery.

    PubMed

    Preuss, Todd M

    2012-06-26

    The rise of comparative genomics and related technologies has added important new dimensions to the study of human evolution. Our knowledge of the genes that underwent expression changes or were targets of positive selection in human evolution is rapidly increasing, as is our knowledge of gene duplications, translocations, and deletions. It is now clear that the genetic differences between humans and chimpanzees are far more extensive than previously thought; their genomes are not 98% or 99% identical. Despite the rapid growth in our understanding of the evolution of the human genome, our understanding of the relationship between genetic changes and phenotypic changes is tenuous. This is true even for the most intensively studied gene, FOXP2, which underwent positive selection in the human terminal lineage and is thought to have played an important role in the evolution of human speech and language. In part, the difficulty of connecting genes to phenotypes reflects our generally poor knowledge of human phenotypic specializations, as well as the difficulty of interpreting the consequences of genetic changes in species that are not amenable to invasive research. On the positive side, investigations of FOXP2, along with genomewide surveys of gene-expression changes and selection-driven sequence changes, offer the opportunity for "phenotype discovery," providing clues to human phenotypic specializations that were previously unsuspected. What is more, at least some of the specializations that have been proposed are amenable to testing with noninvasive experimental techniques appropriate for the study of humans and apes.

  11. [Structural organization of the human p53 gene. I. Molecular cloning of the human p53 gene].

    PubMed

    Bukhman, V L; Ninkina, N N; Chumakov, P M; Khilenkova, M A; Samarina, O P

    1987-09-01

    Human p53 gene was cloned from the normal human placenta DNA and DNA from the strain of human kidney carcinoma transplanted into nude mice. Representative gene library from tumor strain of human kidney carcinoma and library of 15 kb EcoRI fragments of DNA from normal human placenta were constructed. Maniatis gene library was also used. Five clones were isolated from kidney carcinoma library; they covered 27 kb and included full-length p53 gene of 19.5 kb and flanking sequences. From normal placenta libraries three overlapped clones were obtained. Restriction map of cloned sequences was constructed and polarity of the p53 gene determined. The first intron of the gene is large (10.4 kb); polymorphic BglII site was observed in this intron, which allows to discriminate between allelic genes. One of these (BglII-) is ten times more abundant that the other (BglII+). Both allelic genes are able to synthesize the 2.8 kb p53 gene.

  12. Mucin gene expression in human middle ear epithelium.

    PubMed

    Kerschner, Joseph Edward

    2007-09-01

    To investigate the expression of recently identified human mucin genes in human middle ear epithelial (MEE) specimens from in vivo middle ear (ME) tissue and to compare this mucin gene expression with mucin gene expression in an immortalized cell culture in vitro source of human MEE. Human MEE was harvested as in vivo specimens, and human MEE cell cultures were established for in vitro experimentation. RNA was extracted from MEE and primers designed for reverse-transcription polymerase chain reaction to assess for mucin gene MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC11, MUC12, MUC13, MUC15, MUC16, MUC18, MUC19, and MUC20 expression. Mucin gene expression in the in vivo and in vitro ME tissue was compared against tissues with known expression of the mucin genes in question. Mucin genes MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC7, MUC8, MUC9, MUC11, MUC13, MUC15, MUC16, MUC18, MUC19, and MUC20 were identified and expressed in both the in vivo and in vitro samples of MEE. Mucin genes MUC6, MUC12, and MUC17 were not identified in either tissue samples. Many of the mucin genes that have been recently identified are expressed in human MEE. These genes are expressed in a similar manner in both in vivo and in vitro models. Understanding the mechanisms in which these genes regulate the physiology and pathophysiology of MEE will provide a more thorough understanding of the molecular mechanics of the MEE and disease conditions such as otitis media.

  13. Toward a Reference Gene Catalog of Human Primary Monocytes.

    PubMed

    Mirsafian, Hoda; Ripen, Adiratna Mat; Manaharan, Thamilvaani; Mohamad, Saharuddin Bin; Merican, Amir Feisal

    2016-11-01

    Transcriptome analyses based on high-throughput RNA sequencing (RNA-Seq) provide powerful and quantitative characterization of cell types and in-depth understanding of biological systems in health and disease. In this study, we present a comprehensive transcriptome profile of human primary monocytes, a crucial component of the innate immune system. We performed deep RNA-Seq of monocytes from six healthy subjects and integrated our data with 10 other publicly available RNA-Seq datasets of human monocytes. A total of 1.9 billion reads were generated, which allowed us to capture most of the genes transcribed in human monocytes, including 11,994 protein-coding genes, 5558 noncoding genes (including long noncoding RNAs, precursor miRNAs, and others), 2819 pseudogenes, and 7034 putative novel transcripts. In addition, we profiled the expression pattern of 1155 transcription factors (TFs) in human monocytes, which are the main molecules in controlling the gene transcription. An interaction network was constructed among the top expressed TFs and their targeted genes, which revealed the potential key regulatory genes in biological function of human monocytes. The gene catalog of human primary monocytes provided in this study offers significant promise and future potential clinical applications in the fields of precision medicine, systems diagnostics, immunogenomics, and the development of innovative biomarkers and therapeutic monitoring strategies.

  14. Structure and in vitro transcription of human globin genes.

    PubMed

    Proudfoot, N J; Shander, M H; Manley, J L; Gefter, M L; Maniatis, T

    1980-09-19

    The alpha-like and beta-like subunits of human hemoglobin are encoded by a small family of genes that are differentially expressed during development. Through the use of molecular cloning procedures, each member of this gene family has been isolated and extensively characterized. Although the alpha-like and beta-like globin genes are located on different chromosomes, both sets of genes are arranged in closely linked clusters. In both clusters, each of the genes is transcribed from the same DNA strand, and the genes are arranged in the order of their expressions during development. Structural comparisons of immediately adjacent genes within each cluster have provided evidence for the occurrence of gene duplication and correction during evolution and have led to the discovery of pseudogenes, genes that have acquired numerous mutations that prevent their normal expression. Recently, in vivo and in vitro systems for studying the expression of cloned eukaryotic genes have been developed as a means of identifying DNA sequences that are necessary for normal gene function. This article describes the application of an in vitro transcription procedure to the study of human globin gene expression.

  15. Integrating human omics data to prioritize candidate genes

    PubMed Central

    2013-01-01

    Background The identification of genes involved in human complex diseases remains a great challenge in computational systems biology. Although methods have been developed to use disease phenotypic similarities with a protein-protein interaction network for the prioritization of candidate genes, other valuable omics data sources have been largely overlooked in these methods. Methods With this understanding, we proposed a method called BRIDGE to prioritize candidate genes by integrating disease phenotypic similarities with such omics data as protein-protein interactions, gene sequence similarities, gene expression patterns, gene ontology annotations, and gene pathway memberships. BRIDGE utilizes a multiple regression model with lasso penalty to automatically weight different data sources and is capable of discovering genes associated with diseases whose genetic bases are completely unknown. Results We conducted large-scale cross-validation experiments and demonstrated that more than 60% known disease genes can be ranked top one by BRIDGE in simulated linkage intervals, suggesting the superior performance of this method. We further performed two comprehensive case studies by applying BRIDGE to predict novel genes and transcriptional networks involved in obesity and type II diabetes. Conclusion The proposed method provides an effective and scalable way for integrating multi omics data to infer disease genes. Further applications of BRIDGE will be benefit to providing novel disease genes and underlying mechanisms of human diseases. PMID:24344781

  16. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  17. Genic insights from integrated human proteomics in GeneCards.

    PubMed

    Fishilevich, Simon; Zimmerman, Shahar; Kohn, Asher; Iny Stein, Tsippi; Olender, Tsviya; Kolker, Eugene; Safran, Marilyn; Lancet, Doron

    2016-01-01

    GeneCards is a one-stop shop for searchable human gene annotations (http://www.genecards.org/). Data are automatically mined from ∼120 sources and presented in an integrated web card for every human gene. We report the application of recent advances in proteomics to enhance gene annotation and classification in GeneCards. First, we constructed the Human Integrated Protein Expression Database (HIPED), a unified database of protein abundance in human tissues, based on the publically available mass spectrometry (MS)-based proteomics sources ProteomicsDB, Multi-Omics Profiling Expression Database, Protein Abundance Across Organisms and The MaxQuant DataBase. The integrated database, residing within GeneCards, compares favourably with its individual sources, covering nearly 90% of human protein-coding genes. For gene annotation and comparisons, we first defined a protein expression vector for each gene, based on normalized abundances in 69 normal human tissues. This vector is portrayed in the GeneCards expression section as a bar graph, allowing visual inspection and comparison. These data are juxtaposed with transcriptome bar graphs. Using the protein expression vectors, we further defined a pairwise metric that helps assess expression-based pairwise proximity. This new metric for finding functional partners complements eight others, including sharing of pathways, gene ontology (GO) terms and domains, implemented in the GeneCards Suite. In parallel, we calculated proteome-based differential expression, highlighting a subset of tissues that overexpress a gene and subserving gene classification. This textual annotation allows users of VarElect, the suite's next-generation phenotyper, to more effectively discover causative disease variants. Finally, we define the protein-RNA expression ratio and correlation as yet another attribute of every gene in each tissue, adding further annotative information. The results constitute a significant enhancement of several Gene

  18. Genic insights from integrated human proteomics in GeneCards

    PubMed Central

    Fishilevich, Simon; Zimmerman, Shahar; Kohn, Asher; Iny Stein, Tsippi; Olender, Tsviya; Kolker, Eugene; Safran, Marilyn; Lancet, Doron

    2016-01-01

    GeneCards is a one-stop shop for searchable human gene annotations (http://www.genecards.org/). Data are automatically mined from ∼120 sources and presented in an integrated web card for every human gene. We report the application of recent advances in proteomics to enhance gene annotation and classification in GeneCards. First, we constructed the Human Integrated Protein Expression Database (HIPED), a unified database of protein abundance in human tissues, based on the publically available mass spectrometry (MS)-based proteomics sources ProteomicsDB, Multi-Omics Profiling Expression Database, Protein Abundance Across Organisms and The MaxQuant DataBase. The integrated database, residing within GeneCards, compares favourably with its individual sources, covering nearly 90% of human protein-coding genes. For gene annotation and comparisons, we first defined a protein expression vector for each gene, based on normalized abundances in 69 normal human tissues. This vector is portrayed in the GeneCards expression section as a bar graph, allowing visual inspection and comparison. These data are juxtaposed with transcriptome bar graphs. Using the protein expression vectors, we further defined a pairwise metric that helps assess expression-based pairwise proximity. This new metric for finding functional partners complements eight others, including sharing of pathways, gene ontology (GO) terms and domains, implemented in the GeneCards Suite. In parallel, we calculated proteome-based differential expression, highlighting a subset of tissues that overexpress a gene and subserving gene classification. This textual annotation allows users of VarElect, the suite’s next-generation phenotyper, to more effectively discover causative disease variants. Finally, we define the protein–RNA expression ratio and correlation as yet another attribute of every gene in each tissue, adding further annotative information. The results constitute a significant enhancement of several Gene

  19. Cellular functions of genetically imprinted genes in human and mouse as annotated in the gene ontology.

    PubMed

    Hamed, Mohamed; Ismael, Siba; Paulsen, Martina; Helms, Volkhard

    2012-01-01

    By analyzing the cellular functions of genetically imprinted genes as annotated in the Gene Ontology for human and mouse, we found that imprinted genes are often involved in developmental, transport and regulatory processes. In the human, paternally expressed genes are enriched in GO terms related to the development of organs and of anatomical structures. In the mouse, maternally expressed genes regulate cation transport as well as G-protein signaling processes. Furthermore, we investigated if imprinted genes are regulated by common transcription factors. We identified 25 TF families that showed an enrichment of binding sites in the set of imprinted genes in human and 40 TF families in mouse. In general, maternally and paternally expressed genes are not regulated by different transcription factors. The genes Nnat, Klf14, Blcap, Gnas and Ube3a contribute most to the enrichment of TF families. In the mouse, genes that are maternally expressed in placenta are enriched for AP1 binding sites. In the human, we found that these genes possessed binding sites for both, AP1 and SP1.

  20. Cellular Functions of Genetically Imprinted Genes in Human and Mouse as Annotated in the Gene Ontology

    PubMed Central

    Hamed, Mohamed; Ismael, Siba; Paulsen, Martina; Helms, Volkhard

    2012-01-01

    By analyzing the cellular functions of genetically imprinted genes as annotated in the Gene Ontology for human and mouse, we found that imprinted genes are often involved in developmental, transport and regulatory processes. In the human, paternally expressed genes are enriched in GO terms related to the development of organs and of anatomical structures. In the mouse, maternally expressed genes regulate cation transport as well as G-protein signaling processes. Furthermore, we investigated if imprinted genes are regulated by common transcription factors. We identified 25 TF families that showed an enrichment of binding sites in the set of imprinted genes in human and 40 TF families in mouse. In general, maternally and paternally expressed genes are not regulated by different transcription factors. The genes Nnat, Klf14, Blcap, Gnas and Ube3a contribute most to the enrichment of TF families. In the mouse, genes that are maternally expressed in placenta are enriched for AP1 binding sites. In the human, we found that these genes possessed binding sites for both, AP1 and SP1. PMID:23226257

  1. Identifying gene expression modules that define human cell fates.

    PubMed

    Germanguz, I; Listgarten, J; Cinkornpumin, J; Solomon, A; Gaeta, X; Lowry, W E

    2016-05-01

    Using a compendium of cell-state-specific gene expression data, we identified genes that uniquely define cell states, including those thought to represent various developmental stages. Our analysis sheds light on human cell fate through the identification of core genes that are altered over several developmental milestones, and across regional specification. Here we present cell-type specific gene expression data for 17 distinct cell states and demonstrate that these modules of genes can in fact define cell fate. Lastly, we introduce a web-based database to disseminate the results. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Attenuation of Porphyromonas gingivalis oral infection by α-amylase and pentamidine.

    PubMed

    Li, Ying; Miao, Yu-Song; Fu, Yun; Li, Xi-Ting; Yu, Shao-Jie

    2015-08-01

    The Porphyromonas gingivalis bacterium is one of the most influential pathogens in oral infections. In the current study, the antimicrobial activity of α-amylase and pentamidine against Porphyromonas gingivalis was evaluated. Their in vitro inhibitory activity was investigated with the agar overlay technique, and the minimal inhibitory and bactericidal concentrations were determined. Using the bactericidal concentration, the antimicrobial actions of the inhibitors were investigated. In the present study, multiple techniques were utilized, including scanning electron microscopy (SEM), general structural analysis and differential gene expression analysis. The results obtained from SEM and bactericidal analysis indicated a notable observation; the pentamidine and α-amylase treatment destroyed the structure of the bacterial cell membranes, which led to cell death. These results were used to further explore these inhibitors and the mechanisms by which they act. Downregulated expression levels were observed for a number of genes coding for hemagglutinins and gingipains, and various genes involved in hemin uptake, chromosome replication and energy production. However, the expression levels of genes associated with iron storage and oxidative stress were upregulated by α-amylase and pentamidine. A greater effect was noted in response to pentamidine treatment. The results of the present study demonstrate promising therapeutic potential for α-amylases and pentamidine. These molecules have the potential to be used to develop novel drugs and broaden the availability of pharmacological tools for the attenuation of oral infections caused by Porphyromonas gingivalis.

  3. State-of-the-art human gene therapy: part II. Gene therapy strategies and clinical applications.

    PubMed

    Wang, Dan; Gao, Guangping

    2014-09-01

    In Part I of this Review (Wang and Gao, 2014), we introduced recent advances in gene delivery technologies and explained how they have powered some of the current human gene therapy applications. In Part II, we expand the discussion on gene therapy applications, focusing on some of the most exciting clinical uses. To help readers to grasp the essence and to better organize the diverse applications, we categorize them under four gene therapy strategies: (1) gene replacement therapy for monogenic diseases, (2) gene addition for complex disorders and infectious diseases, (3) gene expression alteration targeting RNA, and (4) gene editing to introduce targeted changes in host genome. Human gene therapy started with the simple idea that replacing a faulty gene with a functional copy can cure a disease. It has been a long and bumpy road to finally translate this seemingly straightforward concept into reality. As many disease mechanisms unraveled, gene therapists have employed a gene addition strategy backed by a deep knowledge of what goes wrong in diseases and how to harness host cellular machinery to battle against diseases. Breakthroughs in other biotechnologies, such as RNA interference and genome editing by chimeric nucleases, have the potential to be integrated into gene therapy. Although clinical trials utilizing these new technologies are currently sparse, these innovations are expected to greatly broaden the scope of gene therapy in the near future.

  4. STATE-OF-THE-ART HUMAN GENE THERAPY: PART II. GENE THERAPY STRATEGIES AND APPLICATIONS

    PubMed Central

    Wang, Dan; Gao, Guangping

    2015-01-01

    In Part I of this Review, we introduced recent advances in gene delivery technologies and explained how they have powered some of the current human gene therapy applications. In Part II, we expand the discussion on gene therapy applications, focusing on some of the most exciting clinical uses. To help readers to grasp the essence and to better organize the diverse applications, we categorize them under four gene therapy strategies: (1) gene replacement therapy for monogenic diseases, (2) gene addition for complex disorders and infectious diseases, (3) gene expression alteration targeting RNA, and (4) gene editing to introduce targeted changes in host genome. Human gene therapy started with the simple idea that replacing a faulty gene with a functional copy can cure a disease. It has been a long and bumpy road to finally translate this seemingly straightforward concept into reality. As many disease mechanisms unraveled, gene therapists have employed a gene addition strategy backed by a deep knowledge of what goes wrong in diseases and how to harness host cellular machinery to battle against diseases. Breakthroughs in other biotechnologies, such as RNA interference and genome editing by chimeric nucleases, have the potential to be integrated into gene therapy. Although clinical trials utilizing these new technologies are currently sparse, these innovations are expected to greatly broaden the scope of gene therapy in the near future. PMID:25227756

  5. Salivary amylase and stress during stressful environment: three Mars analog mission crews study.

    PubMed

    Rai, Balwant; Kaur, Jasdeep; Foing, Bernard H

    2012-06-14

    After the establishment of the space age physicians, human factors engineers, neurologist and psychologists and their special attention to work on people's capability to meet up the physical, psychological, neuroscience and interpersonal strains of working in space, it has been regarded as an issue that seeks urgent consideration. Not study was conducted on effect of simulated Mars analog environment on stress and salivary amylase. So, this study aimed to confirm whether salivary amylase is act as stress biomarker in crew members who took part in Mars analog mission in an isolated and stressful environment. The 18 crew members were selected who took part in Mars Analog Research Station, Utah. Salivary amylase was measured using a biosensor of salivary amylase monitor and State-Trait Anxiety Inventory score at pre-extravehicular activity, post-extravehicular activity and on before mission. The state and trait anxiety scores at pre-extravehicular activity for each commander were elevated as compared to after extravehicular activity. There were significant differences in the state and trait anxiety scores between before extravehicular activity and after extravehicular activity of Commander and other members, also there were significant differences in values of before-extravehicular activity between commanders and other members. There were significant differences in values of salivary amylase at before extravehicular activity and after extravehicular activity between commander group and other members. There was significant correlation between salivary amylase and state and trait anxiety scores in all groups. Measuring salivary amylase level could be useful for stress assessment of crew members and population working in a stressful and isolated environment. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. Correlation between salivary alpha-amylase and stress-related anxiety.

    PubMed

    Rashkova, Maya R; Ribagin, Lora S; Toneva, Nina G

    2012-01-01

    Salivary alpha-amylase is a useful biomarker that can be used in assessing human psychobiological and social behavioural processes. Studying it opens up possibilities for the creation of novel concepts concerning the interaction of biological and social processes and their impact on health and behaviour. The levels of salivary alpha-amylase and situation anxiety self-assessment using Spielberger test were measured twice in 30 individuals aged 21.37 +/- 0.96 yrs (18 females and 12 males): once during stressful situation (prior to examination) and, again a month later, in stress-free environment (during a training session). Salivary alpha-amylase was measured using kinetic reaction kit Salimetrics LLC--USA. The mean level of salivary alpha-amylase measured during the first measurement 156.0 +/- 93.33 U/ml. During the second measurement in the absence of intense stress, the levels were two times lower - 74.03 +/- 58.06 U/ml and the differences were statistically significant (P < 0.001). We found a statistically significant correlation between the levels of salivary alpha-amylase in both measurements (P < 0.01). The correlation coefficient was r = 0.472 (P < 0.01). The adapted version of the State-Trait Anxiety Inventory score (STAI) created by Spielberger is appropriate for assessment of stress-related anxiety in young individuals. Salivary alpha-amylase may be used as a biomarker for objective evaluation of the psychosomatic state of individuals in a stressful environment. The combination of psychological test and objective indicator such as salivary alpha-amylase is an excellent tool for objective evaluation of individual's state in stressful environment. Similar tests may be used in assessment of patients' behaviours at dental treatment that may be considered a stressor in most patients.

  7. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.

    PubMed

    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S

    2005-01-01

    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities.

  8. A novel alpha-amylase from the cyanobacterium Nostoc sp. PCC 7119.

    PubMed

    Reyes-Sosa, Francisco M; Molina-Heredia, Fernando P; De la Rosa, Miguel A

    2010-03-01

    Little information is yet available on the alpha-amylases of cyanobacteria. Here, the presence of an alpha-amylase in the cyanobacterium Nostoc sp. PCC 7119 is first demonstrated. A gene (amy1) encoding a cytoplasmic alpha-amylase (Amy1) protein has been identified, cloned, and overexpressed in Escherichia coli cells. The recombinant protein is a 56.7-kDa monomer, which has been purified to electrophoretic homogeneity by affinity chromatography. The substrate specificity and end product analyses confirm that it is a calcium-dependent alpha-amylase enzyme, which exhibits its maximum activity at 31 degrees C and at pH between 6.5 and 7.5. The Amy1 protein breaks down mainly starch, is also able to cleave glycogen and dextrin, and exhibits no activity against xylan or pullulan. So the enzyme cannot efficiently attack the maltodextrins with degrees of polymerization below that of maltooctaose. Maltotriose, maltose, and maltotetraose are the major products of the enzymatic reaction with starch as substrate. The enzyme shows a very high turnover number against soluble potato starch (3,420 +/- 270 s(-1)), as compared with other alpha-amylases reported in the literature. The high catalytic efficiency and relatively low optimum temperature of the Nostoc Amy1 protein make this previously unexplored group of cyanobacterial enzymes of great interest for further physiological studies and industrial applications.

  9. A Limited Number of Globin Genes in Human DNA

    PubMed Central

    Gambino, Roberto; Kacian, Daniel; O'Donnell, Joyce; Ramirez, Francesco; Marks, Paul A.; Bank, Arthur

    1974-01-01

    The number of globin genes in human cells was determined by hybridizing DNA from human spleens to 3H-labeled DNA complementary to human globin mRNA. Assuming the rates of reannealing of complementary DNA and cellular DNA are similar, the extent of hybridization of complementary DNA at various ratios of cellular DNA to complementary DNA indicate that there are fewer than 10 globin gene copies per haploid human genome. An alternative analysis of the data, which introduces no assumptions concerning the relative rates of reaction of complementary DNA and cellular DNA, indicates fewer than 20 globin gene copies are present. DNA isolated from the spleen of a patient with β+ thalassemia contained a number of globin gene copies similar to that of normal DNA. PMID:4530276

  10. A physical map of 30,000 human genes.

    PubMed

    Deloukas, P; Schuler, G D; Gyapay, G; Beasley, E M; Soderlund, C; Rodriguez-Tomé, P; Hui, L; Matise, T C; McKusick, K B; Beckmann, J S; Bentolila, S; Bihoreau, M; Birren, B B; Browne, J; Butler, A; Castle, A B; Chiannilkulchai, N; Clee, C; Day, P J; Dehejia, A; Dibling, T; Drouot, N; Duprat, S; Fizames, C; Fox, S; Gelling, S; Green, L; Harrison, P; Hocking, R; Holloway, E; Hunt, S; Keil, S; Lijnzaad, P; Louis-Dit-Sully, C; Ma, J; Mendis, A; Miller, J; Morissette, J; Muselet, D; Nusbaum, H C; Peck, A; Rozen, S; Simon, D; Slonim, D K; Staples, R; Stein, L D; Stewart, E A; Suchard, M A; Thangarajah, T; Vega-Czarny, N; Webber, C; Wu, X; Hudson, J; Auffray, C; Nomura, N; Sikela, J M; Polymeropoulos, M H; James, M R; Lander, E S; Hudson, T J; Myers, R M; Cox, D R; Weissenbach, J; Boguski, M S; Bentley, D R

    1998-10-23

    A map of 30,181 human gene-based markers was assembled and integrated with the current genetic map by radiation hybrid mapping. The new gene map contains nearly twice as many genes as the previous release, includes most genes that encode proteins of known function, and is twofold to threefold more accurate than the previous version. A redesigned, more informative and functional World Wide Web site (www.ncbi.nlm.nih.gov/genemap) provides the mapping information and associated data and annotations. This resource constitutes an important infrastructure and tool for the study of complex genetic traits, the positional cloning of disease genes, the cross-referencing of mammalian genomes, and validated human transcribed sequences for large-scale studies of gene expression.

  11. Pancreatic α-Amylase Controls Glucose Assimilation by Duodenal Retrieval through N-Glycan-specific Binding, Endocytosis, and Degradation*

    PubMed Central

    Date, Kimie; Satoh, Ayano; Iida, Kaoruko; Ogawa, Haruko

    2015-01-01

    α-Amylase, a major pancreatic protein and starch hydrolase, is essential for energy acquisition. Mammalian pancreatic α-amylase binds specifically to glycoprotein N-glycans in the brush-border membrane to activate starch digestion, whereas it significantly inhibits glucose uptake by Na+/glucose cotransporter 1 (SGLT1) at high concentrations (Asanuma-Date, K., Hirano, Y., Le, N., Sano, K., Kawasaki, N., Hashii, N., Hiruta, Y., Nakayama, K., Umemura, M., Ishikawa, K., Sakagami, H., and Ogawa, H. (2012) Functional regulation of sugar assimilation by N-glycan-specific interaction of pancreatic α-amylase with glycoproteins of duodenal brush border membrane. J. Biol. Chem. 287, 23104–23118). However, how the inhibition is stopped was unknown. Here, we show a new mechanism for the regulation of intestinal glucose absorption. Immunohistochemistry revealed that α-amylase in the duodena of non-fasted, but not fasted, pigs was internalized from the pancreatic fluid and immunostained. We demonstrated that after N-glycan binding, pancreatic α-amylase underwent internalization into lysosomes in a process that was inhibited by α-mannoside. The internalized α-amylase was degraded, showing low enzymatic activity and molecular weight at the basolateral membrane. In a human intestinal Caco-2 cell line, Alexa Fluor 488-labeled pancreatic α-amylase bound to the cytomembrane was transported to lysosomes through the endocytic pathway and then disappeared, suggesting degradation. Our findings indicate that N-glycan recognition by α-amylase protects enterocytes against a sudden increase in glucose concentration and restores glucose uptake by gradual internalization, which homeostatically controls the postprandial blood glucose level. The internalization of α-amylase may also enhance the supply of amino acids required for the high turnover of small intestine epithelial cells. This study provides novel and significant insights into the control of blood sugar during the absorption

  12. Pancreatic α-Amylase Controls Glucose Assimilation by Duodenal Retrieval through N-Glycan-specific Binding, Endocytosis, and Degradation.

    PubMed

    Date, Kimie; Satoh, Ayano; Iida, Kaoruko; Ogawa, Haruko

    2015-07-10

    α-Amylase, a major pancreatic protein and starch hydrolase, is essential for energy acquisition. Mammalian pancreatic α-amylase binds specifically to glycoprotein N-glycans in the brush-border membrane to activate starch digestion, whereas it significantly inhibits glucose uptake by Na(+)/glucose cotransporter 1 (SGLT1) at high concentrations (Asanuma-Date, K., Hirano, Y., Le, N., Sano, K., Kawasaki, N., Hashii, N., Hiruta, Y., Nakayama, K., Umemura, M., Ishikawa, K., Sakagami, H., and Ogawa, H. (2012) Functional regulation of sugar assimilation by N-glycan-specific interaction of pancreatic α-amylase with glycoproteins of duodenal brush border membrane. J. Biol. Chem. 287, 23104-23118). However, how the inhibition is stopped was unknown. Here, we show a new mechanism for the regulation of intestinal glucose absorption. Immunohistochemistry revealed that α-amylase in the duodena of non-fasted, but not fasted, pigs was internalized from the pancreatic fluid and immunostained. We demonstrated that after N-glycan binding, pancreatic α-amylase underwent internalization into lysosomes in a process that was inhibited by α-mannoside. The internalized α-amylase was degraded, showing low enzymatic activity and molecular weight at the basolateral membrane. In a human intestinal Caco-2 cell line, Alexa Fluor 488-labeled pancreatic α-amylase bound to the cytomembrane was transported to lysosomes through the endocytic pathway and then disappeared, suggesting degradation. Our findings indicate that N-glycan recognition by α-amylase protects enterocytes against a sudden increase in glucose concentration and restores glucose uptake by gradual internalization, which homeostatically controls the postprandial blood glucose level. The internalization of α-amylase may also enhance the supply of amino acids required for the high turnover of small intestine epithelial cells. This study provides novel and significant insights into the control of blood sugar during the absorption

  13. Discovery and characterization of pseudocyclic cystine-knot α-amylase inhibitors with high resistance to heat and proteolytic degradation.

    PubMed

    Nguyen, Phuong Q T; Wang, Shujing; Kumar, Akshita; Yap, Li J; Luu, Thuy T; Lescar, Julien; Tam, James P

    2014-10-01

    Obesity and type 2 diabetes are chronic metabolic diseases, and those affected could benefit from the use of α-amylase inhibitors to manage starch intake. The pseudocyclics, wrightides Wr-AI1 to Wr-AI3, isolated from an Apocynaceae plant show promise for further development as orally active α-amylase inhibitors. These linear peptides retain the stability known for cystine-knot peptides in the presence of harsh treatment. They are resistant to heat treatment and endopeptidase and exopeptidase degradation, which is characteristic of cyclic cystine-knot peptides. Our NMR and crystallography analysis also showed that wrightides, which are currently the smallest proteinaceous α-amylase inhibitors reported, contain the backbone-twisting cis-proline, which is preceded by a nonaromatic residue rather than a conventional aromatic residue. The modeled structure and a molecular dynamics study of Wr-AI1 in complex with yellow mealworm α-amylase suggested that, despite having a similar structure and cystine-knot fold, the knottin-type α-amylase inhibitors may bind to insect α-amylase via a different set of interactions. Finally, we showed that the precursors of pseudocyclic cystine-knot α-amylase inhibitors and their biosynthesis in plants follow a secretory protein synthesis pathway. Together, our findings provide insights for the use of the pseudocyclic α-amylase inhibitors as useful leads for the development of orally active peptidyl bioactives, as well as an alternative scaffold for cyclic peptides for engineering metabolically stable human α-amylase inhibitors.

  14. Identification of human HK genes and gene expression regulation study in cancer from transcriptomics data analysis.

    PubMed

    Chen, Meili; Xiao, Jingfa; Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer.

  15. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    PubMed Central

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  16. Some aspects of the mechanism of complexation of red kidney bean alpha-amylase inhibitor and alpha-amylase.

    PubMed

    Wilcox, E R; Whitaker, J R

    1984-04-10

    Bovine pancreatic alpha-amylase binds 1 mol of acarbose (a carbohydrate alpha-amylase inhibitor) per mol at the active site and also binds acarbose nonspecifically. The red kidney bean alpha-amylase inhibitor-bovine pancreatic alpha-amylase complex retained nonspecific binding for acarbose only. Binding of p-nitrophenyl alpha-D-maltoside to the final complex of red kidney bean alpha-amylase inhibitor and bovine pancreatic alpha-amylase has a beta Ks (Ks') value that is 3.4-fold greater than the Ks (16 mM) of alpha-amylase for p-nitrophenyl alpha-D-maltoside alone. The initial complex of alpha-amylase and inhibitor apparently hydrolyzes this substrate as rapidly as alpha-amylase alone. The complex retains affinity for substrates and competitive inhibitors, which, when present in high concentrations, cause dissociation of the complex. Maltose (0.5 M), a competitive inhibitor of alpha-amylase, caused dissociation of the red kidney bean alpha-amylase inhibitor--alpha-amylase complex. Interaction between red kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor and porcine pancreatic alpha-amylase proceeds through two steps. The first step has a Keq of 3.1 X 10(-5) M. The second step (unimolecular; first order) has a forward rate constant of 3.05 min-1 at pH 6.9 and 30 degrees C. alpha-Amylase inhibitor combines with alpha-amylase, in the presence of p-nitrophenyl alpha-D-maltoside, noncompetitively. On the basis of the data presented, it is likely that alpha-amylase is inactivated by the alpha-amylase inhibitor through a conformational change. A kinetic model, in the presence and absence of substrate, is described for noncompetitive, slow, tight-binding inhibitors that proceed through two steps.

  17. Evolutionary and Topological Properties of Genes and Community Structures in Human Gene Regulatory Networks.

    PubMed

    Szedlak, Anthony; Smith, Nicholas; Liu, Li; Paternostro, Giovanni; Piermarocchi, Carlo

    2016-06-01

    The diverse, specialized genes present in today's lifeforms evolved from a common core of ancient, elementary genes. However, these genes did not evolve individually: gene expression is controlled by a complex network of interactions, and alterations in one gene may drive reciprocal changes in its proteins' binding partners. Like many complex networks, these gene regulatory networks (GRNs) are composed of communities, or clusters of genes with relatively high connectivity. A deep understanding of the relationship between the evolutionary history of single genes and the topological properties of the underlying GRN is integral to evolutionary genetics. Here, we show that the topological properties of an acute myeloid leukemia GRN and a general human GRN are strongly coupled with its genes' evolutionary properties. Slowly evolving ("cold"), old genes tend to interact with each other, as do rapidly evolving ("hot"), young genes. This naturally causes genes to segregate into community structures with relatively homogeneous evolutionary histories. We argue that gene duplication placed old, cold genes and communities at the center of the networks, and young, hot genes and communities at the periphery. We demonstrate this with single-node centrality measures and two new measures of efficiency, the set efficiency and the interset efficiency. We conclude that these methods for studying the relationships between a GRN's community structures and its genes' evolutionary properties provide new perspectives for understanding evolutionary genetics.

  18. Human DJ-1-specific Transcriptional Activation of Tyrosine Hydroxylase Gene*

    PubMed Central

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M. M.

    2010-01-01

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-l-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice. PMID:20938049

  19. Human DJ-1-specific transcriptional activation of tyrosine hydroxylase gene.

    PubMed

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M M

    2010-12-17

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-L-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice.

  20. Genetic effects on gene expression across human tissues.

    PubMed

    Battle, Alexis; Brown, Christopher D; Engelhardt, Barbara E; Montgomery, Stephen B

    2017-10-11

    Characterization of the molecular function of the human genome and its variation across individuals is essential for identifying the cellular mechanisms that underlie human genetic traits and diseases. The Genotype-Tissue Expression (GTEx) project aims to characterize variation in gene expression levels across individuals and diverse tissues of the human body, many of which are not easily accessible. Here we describe genetic effects on gene expression levels across 44 human tissues. We find that local genetic variation affects gene expression levels for the majority of genes, and we further identify inter-chromosomal genetic effects for 93 genes and 112 loci. On the basis of the identified genetic effects, we characterize patterns of tissue specificity, compare local and distal effects, and evaluate the functional properties of the genetic effects. We also demonstrate that multi-tissue, multi-individual data can be used to identify genes and pathways affected by human disease-associated variation, enabling a mechanistic interpretation of gene regulation and the genetic basis of disease.

  1. Chromosomal localization of the human hexabrachion (tenascin) gene and evidence for recent reduplication within the gene.

    PubMed

    Gulcher, J R; Alexakos, M J; Le Beau, M M; Lemons, R S; Stefansson, K

    1990-04-01

    Using analysis of rodent-human somatic cell hybrids as well as in situ hybridization of hexabrachion cDNA probes to normal human metaphase chromosomes, we have localized the human hexabrachion gene to chromosome 9, bands q32-q34. We also put forward the hypothesis that there has been a recent reduplication of a small segment of the human hexabrachion gene. We support this hypothesis by comparison of codon usage in this segment of the gene to codon usage in the remainder of the gene. This hypothesis is also supported by comparison of the sequence of human hexabrachion to that of the chicken hexabrachion. In addition, the latter comparison shows that the reduplication most likely occurred after the divergence of mammalian and avian species.

  2. Human Studies of Angiogenic Gene Therapy

    PubMed Central

    Gupta, Rajesh; Tongers, Jörn; Losordo, Douglas W.

    2009-01-01

    Despite significant advances in medical, interventional, and surgical therapy for coronary and peripheral arterial disease, the burden of these illnesses remains high. To address this unmet need, the science of therapeutic angiogenesis has been evolving for almost two decades. Early pre-clinical studies and phase I clinical trials achieved promising results with growth factors administered as recombinant proteins or as single-agent gene therapies, and data accumulated through 10 years of clinical trials indicate that gene therapy has an acceptable safety profile. However, more rigorous phase II and phase III clinical trials have failed to unequivocally demonstrate that angiogenic agents are beneficial under the conditions and in the patients studied to date. Investigators have worked to understand the biology of the vascular system and to incorporate their findings into new treatments for patients with ischemic disease. Recent gene- and cell-therapy trials have demonstrated the bioactivity of several new agents and treatment strategies. Collectively, these observations have renewed interest in the mechanisms of angiogenesis and deepened our understanding of the complexity of vascular regeneration. Gene therapy that incorporates multiple growth factors, approaches that combine cell and gene therapy, and the administration of "master switch" agents that activate numerous downstream pathways are among the credible and plausible steps forward. In this review, we will examine the clinical development of angiogenic therapy, summarize several of the lessons learned during the conduct of these trials, and suggest how this prior experience may guide the conduct of future preclinical investigations and clinical trials. PMID:19815827

  3. Gene Expression Patterns in Human Liver Cancers

    PubMed Central

    Chen, Xin; Cheung, Siu Tim; So, Samuel; Fan, Sheung Tat; Barry, Christopher; Higgins, John; Lai, Kin-Man; Ji, Jiafu; Dudoit, Sandrine; Ng, Irene O.L.; van de Rijn, Matt; Botstein, David; Brown, Patrick O.

    2002-01-01

    Hepatocellular carcinoma (HCC) is a leading cause of death worldwide. Using cDNA microarrays to characterize patterns of gene expression in HCC, we found consistent differences between the expression patterns in HCC compared with those seen in nontumor liver tissues. The expression patterns in HCC were also readily distinguished from those associated with tumors metastatic to liver. The global gene expression patterns intrinsic to each tumor were sufficiently distinctive that multiple tumor nodules from the same patient could usually be recognized and distinguished from all the others in the large sample set on the basis of their gene expression patterns alone. The distinctive gene expression patterns are characteristic of the tumors and not the patient; the expression programs seen in clonally independent tumor nodules in the same patient were no more similar than those in tumors from different patients. Moreover, clonally related tumor masses that showed distinct expression profiles were also distinguished by genotypic differences. Some features of the gene expression patterns were associated with specific phenotypic and genotypic characteristics of the tumors, including growth rate, vascular invasion, and p53 overexpression. PMID:12058060

  4. Regulation of core clock genes in human islets.

    PubMed

    Stamenkovic, Jelena A; Olsson, Anders H; Nagorny, Cecilia L; Malmgren, Siri; Dekker-Nitert, Marloes; Ling, Charlotte; Mulder, Hindrik

    2012-07-01

    Nearly all mammalian cells express a set of genes known as clock genes. These regulate the circadian rhythm of cellular processes by means of negative and positive autoregulatory feedback loops of transcription and translation. Recent genomewide association studies have demonstrated an association between a polymorphism near the circadian clock gene CRY2 and elevated fasting glucose. To determine whether clock genes could play a pathogenetic role in the disease, we examined messenger RNA (mRNA) expression of core clock genes in human islets from donors with or without type 2 diabetes mellitus. Microarray and quantitative real-time polymerase chain reaction analyses were used to assess expression of the core clock genes CLOCK, BMAL-1, PER1 to 3, and CRY1 and 2 in human islets. Insulin secretion and insulin content in human islets were measured by radioimmunoassay. The mRNA levels of PER2, PER3, and CRY2 were significantly lower in islets from donors with type 2 diabetes mellitus. To investigate the functional relevance of these clock genes, we correlated their expression to insulin content and glycated hemoglobin levels: mRNA levels of PER2 (ρ = 0.33, P = .012), PER3 (ρ = 0.30, P = .023), and CRY2 (ρ = 0.37, P = .0047) correlated positively with insulin content. Of these genes, expression of PER3 and CRY2 correlated negatively with glycated hemoglobin levels (ρ = -0.44, P = .0012; ρ = -0.28, P = .042). Furthermore, in an in vitro model mimicking pathogenetic conditions, the PER3 mRNA level was reduced in human islets exposed to 16.7 mmol/L glucose per 1 mmol/L palmitate for 48 hours (P = .003). Core clock genes are regulated in human islets. The data suggest that perturbations of circadian clock components may contribute to islet pathophysiology in human type 2 diabetes mellitus. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Complementation of Yeast Genes with Human Genes as an Experimental Platform for Functional Testing of Human Genetic Variants.

    PubMed

    Hamza, Akil; Tammpere, Erik; Kofoed, Megan; Keong, Christelle; Chiang, Jennifer; Giaever, Guri; Nislow, Corey; Hieter, Philip

    2015-11-01

    While the pace of discovery of human genetic variants in tumors, patients, and diverse populations has rapidly accelerated, deciphering their functional consequence has become rate-limiting. Using cross-species complementation, model organisms like the budding yeast, Saccharomyces cerevisiae, can be utilized to fill this gap and serve as a platform for testing human genetic variants. To this end, we performed two parallel screens, a one-to-one complementation screen for essential yeast genes implicated in chromosome instability and a pool-to-pool screen that queried all possible essential yeast genes for rescue of lethality by all possible human homologs. Our work identified 65 human cDNAs that can replace the null allele of essential yeast genes, including the nonorthologous pair yRFT1/hSEC61A1. We chose four human cDNAs (hLIG1, hSSRP1, hPPP1CA, and hPPP1CC) for which their yeast gene counterparts function in chromosome stability and assayed in yeast 35 tumor-specific missense mutations for growth defects and sensitivity to DNA-damaging agents. This resulted in a set of human-yeast gene complementation pairs that allow human genetic variants to be readily characterized in yeast, and a prioritized list of somatic mutations that could contribute to chromosome instability in human tumors. These data establish the utility of this cross-species experimental approach. Copyright © 2015 by the Genetics Society of America.

  6. Evaluation of reference genes for gene expression studies in human brown adipose tissue.

    PubMed

    Taube, Magdalena; Andersson-Assarsson, Johanna C; Lindberg, Kristin; Pereira, Maria J; Gäbel, Markus; Svensson, Maria K; Eriksson, Jan W; Svensson, Per-Arne

    2015-01-01

    Human brown adipose tissue (BAT) has during the last 5 year been subjected to an increasing research interest, due to its putative function as a target for future obesity treatments. The most commonly used method for molecular studies of human BAT is the quantitative polymerase chain reaction (qPCR). This method requires normalization to a reference gene (genes with uniform expression under different experimental conditions, e.g. similar expression levels between human BAT and WAT), but so far no evaluation of reference genes for human BAT has been performed. Two different microarray datasets with samples containing human BAT were used to search for genes with low variability in expression levels. Seven genes (FAM96B, GNB1, GNB2, HUWE1, PSMB2, RING1 and TPT1) identified by microarray analysis, and 8 commonly used reference genes (18S, B2M, GAPDH, LRP10, PPIA, RPLP0, UBC, and YWHAZ) were selected and further analyzed by quantitative PCR in both BAT containing perirenal adipose tissue and subcutaneous adipose tissue. Results were analyzed using 2 different algorithms (Normfinder and geNorm). Most of the commonly used reference genes displayed acceptably low variability (geNorm M-values <0.5) in the samples analyzed, but the novel reference genes identified by microarray displayed an even lower variability (M-values <0.25). Our data suggests that PSMB2, GNB2 and GNB1 are suitable novel reference genes for qPCR analysis of human BAT and we recommend that they are included in future gene expression studies of human BAT.

  7. Cloning of a novel thermostable glucoamylase from thermophilic fungus Rhizomucor pusillus and high-level co-expression with α-amylase in Pichia pastoris.

    PubMed

    He, Zhenggui; Zhang, Lujia; Mao, Youzhi; Gu, Jingchao; Pan, Qi; Zhou, Sixing; Gao, Bei; Wei, Dongzhi

    2014-12-24

    Fungal amylase, mainly constitute of fungal α-amylase and glucoamylase, are utilized in a broad range of industries, such as starch hydrolysis, food and brewing. Although various amylases have been found in fungi, the amylases from Aspergillus dominate the commercial application. One of main problems exist with regard to these commercial use of amylases is relatively low thermal and acid stability. In order to maximize the efficiency of starch process, developing fungal amylases with increased thermostability and acid stability has been attracting researchers' interest continually. Besides, synergetic action of glucoamylase and α-amylase could facilitate the degradation of starch. And co-expressing glucoamylase with α-amylase in one host could avoid the need to ferment repeatedly and improves cost-effectiveness of the process. A novel fungal glucoamylase (RpGla) gene encoding a putative protein of 512 amino acid residues was cloned from Rhizomucor pusillus. BLAST analysis revealed that RpGla shared highest identity of 51% with the Rhizopus oryzae glucoamylase (ABB77799.1). The fungal glucoamylase RpGla was expressed in Pichia pastoris (KM71/9KGla) with maximum activity of 1237 U ml(-1). The optimum pH and temperature of RpGla were pH 4.0 and 70 °C, respectively. Fungal α-amylase (RpAmy) gene was also cloned from R. pusillus and transformed into KM71/9KGla, resulted in recombinant yeast KM71/9KGla-ZαAmy harboring the RpGla and RpAmy genes simultaneously. The maximum saccharogenic activity of KM71/9KGla-ZαAmy was 2218 U ml(-1), which improved 79% compared to KM71/9KGla. Soluble starch hydrolyzed by purified RpGla achieved 43% glucose and 34% maltose. Higher productivity was achieved with a final yield of 48% glucose and 47% maltose catalyzed by purified enzyme preparation produced by KM71/9KGla-ZαAmy. A novel fungal glucoamylase and fungal α-amylase genes were cloned from Rhizomucor pusillus. The two enzymes showed good thermostability and acid stability

  8. Restoration of Mitochondrial Gene Expression Using a Cloned Human Gene in Chinese Hamster Lung Cell Mutant

    PubMed Central

    Sherif, Zaki A; Broome, Carolyn W

    2015-01-01

    Background Gal−32 is a Chinese hamster lung cell nuclear mutant that is unable to grow in galactose due to a defect in mitochondrial protein synthesis. Since the product of the Gal−32 gene was unknown, it was imperative to use phenotypic complementation to clone a human gene that corrected the Gal−32 mutation. Results Recessive Gal−32 cells were co-transformed with pSV2-neo plasmid DNA and recombinant DNA from a human genomic library containing the dominant human Gal+ gene and a chloramphenicol-resistance (camr) gene present in the pSV13 vector. Primary transformants were selected by growth in galactose and the neomycin analog G418. In order to rescue the human Gal+ gene, a genomic library was constructed with primary transformant DNA and the pCV108 cosmid vector. The camr gene was used to identify clones with the nearby human sequences. DNA from two camr, Alu-hybridizing clones was able to transform the recessive Gal−32 cells to the Gal+ phenotype and to restore mitochondrial protein synthesis. Conclusion These data demonstrate the isolation of two pCV108-transformant recombinant clones containing a human gene that complements the Chinese hamster Gal−32 mutation and restores galactose metabolism. PMID:26052559

  9. Patenting human genes and stem cells.

    PubMed

    Martin-Rendon, Enca; Blake, Derek J

    2007-01-01

    Cell lines and genetically modified single cell organisms have been considered patentable subjects for the last two decades. However, despite the technical patentability of genes and stem cell lines, social and legal controversy concerning their 'ownership' has surrounded stem cell research in recent years. Some granted patents on stem cells with extremely broad claims are casting a shadow over the commercialization of these cells as therapeutics. However, in spite of those early patents, the number of patent applications related to stem cells is growing exponentially. Both embryonic and adult stem cells have the ability to differentiate into several cell lineages in an organism as a result of specific genetic programs that direct their commitment and cell fate. Genes that control the pluripotency of stem cells have been recently identified and the genetic manipulation of these cells is becoming more efficient with the advance of new technologies. This review summarizes some of the recent published patents on pluripotency genes, gene transfer into stem cells and genetic reprogramming and takes the hematopoietic and embryonic stem cell as model systems.

  10. Organization of the human CD9 gene

    SciTech Connect

    Rubinstein, E.; Benoit, P.; Billard, M.; Plaisance, S.; Prenant, M.; Boucheix, C. ); Uzan, G. )

    1993-04-01

    The CD9 antigen was originally described as a 24-kDa molecule present on B-lineage-derived acute lymphoblastic leukemia cells and developing B lymphocytes. Platelets also express a large amount of CD9 antigen and can be activated by CD9 antibodies. The authors report here the structure of the CD9 gene, which is composed of 8 exons spanning more than 20 kb. There is no TATA or CAAT box in the 5[prime]-flanking domain of the CD9 gene, but a 120-bp region extremely rich in C and G (88%) contains several Sp1 binding sites and a consensus site for the binding of zinc-finger proteins of the Krox/EGR family. The CD9 antigen belongs to a new cell surface protein family. The organization of its gene closely resembles the organization of the genes for two other members of this protein family, TAPA1 and CD63, which share with CD9 respectively 45 and 25% identity at the amino acid level. 55 refs., 5 figs.

  11. Identification of Haemophilus ducreyi genes expressed during human infection.

    PubMed

    Bauer, Margaret E; Fortney, Kate R; Harrison, Alistair; Janowicz, Diane M; Munson, Robert S; Spinola, Stanley M

    2008-04-01

    To identify Haemophilus ducreyi transcripts that are expressed during human infection, we used selective capture of transcribed sequences (SCOTS) with RNA isolated from pustules obtained from three volunteers infected with H. ducreyi, and with RNA isolated from broth-grown bacteria used to infect volunteers. With SCOTS, competitive hybridization of tissue-derived and broth-derived sequences identifies genes that may be preferentially expressed in vivo. Among the three tissue specimens, we identified 531 genes expressed in vivo. Southern blot analysis of 60 genes from each tissue showed that 87 % of the identified genes hybridized better with cDNA derived from tissue specimens than with cDNA derived from broth-grown bacteria. RT-PCR on nine additional pustules confirmed in vivo expression of 10 of 11 selected genes in other volunteers. Of the 531 genes, 139 were identified in at least two volunteers. These 139 genes fell into several functional categories, including biosynthesis and metabolism, regulation, and cellular processes, such as transcription, translation, cell division, DNA replication and repair, and transport. Detection of genes involved in anaerobic and aerobic respiration indicated that H. ducreyi likely encounters both microenvironments within the pustule. Other genes detected suggest an increase in DNA damage and stress in vivo. Genes involved in virulence in other bacterial pathogens and 32 genes encoding hypothetical proteins were identified, and may represent novel virulence factors. We identified three genes, lspA1, lspA2 and tadA, known to be required for virulence in humans. This is the first study to broadly define transcripts expressed by H. ducreyi in humans.

  12. Human decorin gene: Intron-exon junctions and chromosomal localization

    SciTech Connect

    Vetter, U.; Young, M.F.; Fisher, L.W. ); Vogel, W.; Just, W. )

    1993-01-01

    All of the protein-encoding exons and the 3[prime]flanking region of the human decorin gene have been cloned an partially sequenced. The locations of the intron-exon junctions within the coding portion of the gene were identical to those found for the homologous human gene, biglycan. The sizes of the introns in the decorin gene, however, were substantially larger than those of the same introns of the biglycan gene. Portions of introns 1, 2, and 3 as well as exon 1 were not found during our extensive screening process. The 5[prime] end of intron 2 was found to have an AG-rich region followed immediately by a CT-rich region. Furthermore, the 5[prime] end of intron 3 was very rich in thymidine, whereas the 3[prime] end of intron 7 was rich in adenosine. Several cDNA clones constructed from cultured human bone cell mRNA were found to contain a different sequence at the 5[prime] end compared to that previously published for mRNA from a human embryonic fibroblast cell line. We were also unable to find the alternate 3[prime] flanking region of the previously published cDNA sequence. We have mapped the human decorin gene by in situ methods to chromosome 12q2l.3. 30 refs., 3 figs., 1 tab.

  13. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  14. Patenting genes. J. Craig Venter and the Human Genome Project.

    PubMed

    Rowe, P M

    1995-04-01

    He often begins to answer before you have finished asking your question, but his replies are to the point. He speaks with emotion about the people he hopes to help, particularly children with fatal genetic diseases. 'I prefer to do something: the outcome of doing nothing is perfectly clear', he says. He began sequencing human genes while others were discussing how and when to do so. His methods have been called inelegant, redundant, wasteful, and too 'industrial'. Will his method fail to detect some infrequently transcribed genes? That's all right with him. He is not concerned with finding all the human genes, but rather with the fastest possible route to a useful catalog of most human genes.

  15. Immunohistochemical analysis of amylase isoenzymes in thyroid cancer.

    PubMed Central

    Higashiyama, M; Doi, S; Tomita, N; Monden, T; Murotani, M; Kawasaki, Y; Kobayashi, T; Shimano, T; Ogawa, M; Takai, S

    1991-01-01

    The expression of amylase in various histological types of thyroid cancer was studied by an immunohistochemical technique, using a polyclonal antiamylase antiserum and two monoclonal antibodies specific for salivary and pancreatic-type amylases, respectively. Amylase was expressed in 21 of 24 (88%) thyroid cancers by polyclonal antiserum analysis. Analysis by monoclonal antibodies, however, showed that only 13 (54%) cases and three (13%) cases contained salivary-type and pancreatic-type amylases, respectively. Moreover, immunoreactivity for pancreatic-type amylase was detected only in medullary carcinoma; other histological types were positive for salivary-type amylase. These results show that thyroid cancer frequently expresses amylase, and suggest that the differences between amylase isoenzymes in thyroid cancer may correlate with those found between cellular origin of tumour. Images PMID:1713922

  16. Characterization of the DNA polymerase gene of human herpesvirus 6.

    PubMed Central

    Teo, I A; Griffin, B E; Jones, M D

    1991-01-01

    The construction of a recombinant bacteriophage lambda library containing overlapping clones covering 155 kbp of the 161-kbp genome of the Ugandan U1102 isolate of human herpesvirus 6 (HHV-6) is described. The use of degenerate-primer polymerase chain reaction allowed the isolation of a DNA probe for the DNA polymerase gene of HHV-6, which was subsequently used to isolate and position the pol gene on the physical map of the viral genome. A 4.4-kbp EcoRI DNA restriction fragment containing the pol gene was isolated and sequenced. The open reading frames flanking the pol gene code for the HHV-6 glycoprotein B gene and the human cytomegalovirus UL53 homolog. This arrangement is different from that seen in the alpha and gamma herpesvirus families, lending further support to the notion that HHV-6 is a member of the beta herpesvirus group. Images PMID:1651403

  17. An In Vitro and In Vivo Study of the α-Amylase Activity of Phaseolamin

    PubMed Central

    de Gouveia, Neire Moura; Alves, Fernanda Vieira; Furtado, Fabiana Barcelos; Scherer, Danielli Luana; Mundim, Antonio Vicente

    2014-01-01

    Abstract We evaluated the polypeptide profiles, inhibition of human salivary α-amylase activity, and hemagglutination properties of a commercial phaseolamin sample. We also performed an in vivo assay to investigate the effects of a commercial phaseolamin treatment (100, 500, or 1500 mg/kg) over 20 days on the glycemia, body weight, and serum biochemical parameters (total cholesterol, triglycerides, alanine aminotransferase, and aspartate aminotransferase) of nondiabetic and streptozotocin-induced diabetic rats. The in vitro evaluation showed defined protein profiles, low hemagglutination activity, and high α-amylase inhibition. None of the experimental groups treated with phaseolamin or acarbose showed decreases in body weight. Our data demonstrate that phaseolamin inhibits amylase activity in vitro, reduces blood glucose levels, decreases or attenuates some of the renal and hepatic effects of diabetes in streptozotocin-induced rats, and could therefore have therapeutic potential in the treatment or prevention of the complications of diabetes. PMID:24650210

  18. Human blood group genes 2004: chromosomal locations and cloning strategies.

    PubMed

    Lögdberg, Lennart; Reid, Marion E; Lamont, Ryan E; Zelinski, Teresa

    2005-01-01

    Of the 29 human blood group system genes, 27 have been localized to 14 autosomes and 2 have been assigned to the X chromosome. It is remarkable that 28 of the 29 system genes have now been localized to a single cytogenetic band on a specific chromosome. In this review, we summarize the chromosomal locations and cloning strategies used for those genes encoding blood group systems. We highlight such information about the 3 most recently defined blood group systems (I, GLOB, and GIL). In addition, we provide new information about 2 older blood group systems (SC and RAPH) whose polymorphisms have been defined in cloned genes.

  19. Evolutionary and Topological Properties of Genes and Community Structures in Human Gene Regulatory Networks

    PubMed Central

    Szedlak, Anthony; Smith, Nicholas; Liu, Li; Paternostro, Giovanni; Piermarocchi, Carlo

    2016-01-01

    The diverse, specialized genes present in today’s lifeforms evolved from a common core of ancient, elementary genes. However, these genes did not evolve individually: gene expression is controlled by a complex network of interactions, and alterations in one gene may drive reciprocal changes in its proteins’ binding partners. Like many complex networks, these gene regulatory networks (GRNs) are composed of communities, or clusters of genes with relatively high connectivity. A deep understanding of the relationship between the evolutionary history of single genes and the topological properties of the underlying GRN is integral to evolutionary genetics. Here, we show that the topological properties of an acute myeloid leukemia GRN and a general human GRN are strongly coupled with its genes’ evolutionary properties. Slowly evolving (“cold”), old genes tend to interact with each other, as do rapidly evolving (“hot”), young genes. This naturally causes genes to segregate into community structures with relatively homogeneous evolutionary histories. We argue that gene duplication placed old, cold genes and communities at the center of the networks, and young, hot genes and communities at the periphery. We demonstrate this with single-node centrality measures and two new measures of efficiency, the set efficiency and the interset efficiency. We conclude that these methods for studying the relationships between a GRN’s community structures and its genes’ evolutionary properties provide new perspectives for understanding evolutionary genetics. PMID:27359334

  20. CRISPR RNA-guided activation of endogenous human genes.

    PubMed

    Maeder, Morgan L; Linder, Samantha J; Cascio, Vincent M; Fu, Yanfang; Ho, Quan H; Joung, J Keith

    2013-10-01

    Short guide RNAs (gRNAs) can direct catalytically inactive CRISPR-associated 9 nuclease (dCas9) to repress endogenous genes in bacteria and human cells. Here we show that single or multiple gRNAs can direct dCas9 fused to a VP64 transcriptional activation domain to increase expression of endogenous human genes. This proof-of-principle work shows that clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems can target heterologous effector domains to endogenous sites in human cells.

  1. Raw starch conversion by Saccharomyces cerevisiae expressing Aspergillus tubingensis amylases

    PubMed Central

    2013-01-01

    Background Starch is one of the most abundant organic polysaccharides available for the production of bio-ethanol as an alternative transport fuel. Cost-effective utilisation of starch requires consolidated bioprocessing (CBP) where a single microorganism can produce the enzymes required for hydrolysis of starch, and also convert the glucose monomers to ethanol. Results The Aspergillus tubingensis T8.4 α-amylase (amyA) and glucoamylase (glaA) genes were cloned and expressed in the laboratory strain Saccharomyces cerevisiae Y294 and the semi-industrial strain, S. cerevisiae Mnuα1. The recombinant AmyA and GlaA displayed protein sizes of 110–150 kDa and 90 kDa, respectively, suggesting significant glycosylation in S. cerevisiae. The Mnuα1[AmyA-GlaA] and Y294[AmyA-GlaA] strains were able to utilise 20 g l-1 raw corn starch as sole carbohydrate source, with ethanol titers of 9.03 and 6.67 g l-1 (0.038 and 0.028 g l-1 h-1), respectively, after 10 days. With a substrate load of 200 g l-1 raw corn starch, Mnuα1[AmyA-GlaA] yielded 70.07 g l-1 ethanol (0.58 g l-1 h-1) after 120 h of fermentation, whereas Y294[AmyA-GlaA] was less efficient at 43.33 g l-1 ethanol (0.36 g l-1 h-1). Conclusions In a semi-industrial amylolytic S. cerevisiae strain expressing the A. tubingensis α-amylase and glucoamylase genes, 200 g l-1 raw starch was completely hydrolysed (saccharified) in 120 hours with 74% converted to released sugars plus fermentation products and the remainder presumably to biomass. The single-step conversion of raw starch represents significant progress towards the realisation of CBP without the need for any heat pretreatment. Furthermore, the amylases were produced and secreted by the host strain, thus circumventing the need for exogenous amylases. PMID:24286270

  2. Isolating human DNA repair genes using rodent-cell mutants

    SciTech Connect

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-03-23

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab.

  3. Complete structural characterisation of the human aryl hydrocarbon receptor gene

    PubMed Central

    Bennett, P; Ramsden, D B; Williams, A C

    1996-01-01

    Aims—To clone and characterise the complete structural gene for the human aryl hydrocarbon receptor (AhR). This gene, located on chromosome 7, encodes a cytosolic receptor protein which, upon activation by various xenobiotic ligands, translocates to the nucleus, where it acts as a specific transcription factor. Methods—Primers, based on the AhR cDNA sequence, were used in conjunction with recently developed long range PCR techniques to amplify contiguous sections of the cognate gene. The amplicons produced were then cloned and characterised. A cDNA probe was also used to screen a human P1 library. Results—Using the cDNA primers, DNA fragments which mapped the entire coding region of the gene were amplified and cloned. All but one of these fragments were amplified directly from human genomic DNA. The remaining fragment was amplified using DNA prepared from a P1 clone as the PCR template. This P1 clone, obtained by screening a human P1 library, also contained the entire Ah locus. Characterisation of amplified and cloned DNA fragments provided sufficient information for the construction of a complete structural map of the gene. This also included 150 base pairs of nucleotide sequence data at all intronic termini. Conclusions—These data indicate that the human AhR gene is about 50 kilobases long and contains 11 exons. The overall intron/exon structure of the human gene is homologous to that of the previously characterised mouse gene; however, it is probably some 20 kilobases larger. These results demonstrate the need for further characterisation and provide the data to facilitate this. Images PMID:16696038

  4. Human cancers overexpress genes that are specific to a variety of normal human tissues

    PubMed Central

    Lotem, Joseph; Netanely, Dvir; Domany, Eytan; Sachs, Leo

    2005-01-01

    We have analyzed gene expression data from three different kinds of samples: normal human tissues, human cancer cell lines, and leukemic cells from lymphoid and myeloid leukemia pediatric patients. We have searched for genes that are overexpressed in human cancer and also show specific patterns of tissue-dependent expression in normal tissues. Using the expression data of the normal tissues, we identified 4,346 genes with a high variability of expression and clustered these genes according to their relative expression level. Of 91 stable clusters obtained, 24 clusters included genes preferentially expressed either only in hematopoietic tissues or in hematopoietic and one to two other tissues; 28 clusters included genes preferentially expressed in various nonhematopoietic tissues such as neuronal, testis, liver, kidney, muscle, lung, pancreas, and placenta. Analysis of the expression levels of these two groups of genes in the human cancer cell lines and leukemias identified genes that were highly expressed in cancer cells but not in their normal counterparts and, thus, were overexpressed in the cancers. The different cancer cell lines and leukemias varied in the number and identity of these overexpressed genes. The results indicate that many genes that are overexpressed in human cancer cells are specific to a variety of normal tissues, including normal tissues other than those from which the cancer originated. It is suggested that this general property of cancer cells plays a major role in determining the behavior of the cancers, including their metastatic potential. PMID:16339305

  5. Novel Primary Immunodeficiency Candidate Genes Predicted by the Human Gene Connectome

    PubMed Central

    Itan, Yuval; Casanova, Jean-Laurent

    2015-01-01

    Germline genetic mutations underlie various primary immunodeficiency (PID) diseases. Patients with rare PID diseases (like most non-PID patients and healthy individuals) carry, on average, 20,000 rare and common coding variants detected by high-throughput sequencing. It is thus a major challenge to select only a few candidate disease-causing variants for experimental testing. One of the tools commonly used in the pipeline for estimating a potential PID-candidate gene is to test whether the specific gene is included in the list of genes that were already experimentally validated as PID-causing in previous studies. However, this approach is limited because it cannot detect the PID-causing mutation(s) in the many PID patients carrying causal mutations of as yet unidentified PID-causing genes. In this study, we expanded in silico the list of potential PID-causing candidate genes from 229 to 3,110. We first identified the top 1% of human genes predicted by the human genes connectome to be biologically close to the 229 known PID genes. We then further narrowed down the list of genes by retaining only the most biologically relevant genes, with functionally enriched gene ontology biological categories similar to those for the known PID genes. We validated this prediction by showing that 17 of the 21 novel PID genes published since the last IUIS classification fall into this group of 3,110 genes (p < 10−7). The resulting new extended list of 3,110 predicted PID genes should be useful for the discovery of novel PID genes in patients. PMID:25883595

  6. Novel primary immunodeficiency candidate genes predicted by the human gene connectome.

    PubMed

    Itan, Yuval; Casanova, Jean-Laurent

    2015-01-01

    Germline genetic mutations underlie various primary immunodeficiency (PID) diseases. Patients with rare PID diseases (like most non-PID patients and healthy individuals) carry, on average, 20,000 rare and common coding variants detected by high-throughput sequencing. It is thus a major challenge to select only a few candidate disease-causing variants for experimental testing. One of the tools commonly used in the pipeline for estimating a potential PID-candidate gene is to test whether the specific gene is included in the list of genes that were already experimentally validated as PID-causing in previous studies. However, this approach is limited because it cannot detect the PID-causing mutation(s) in the many PID patients carrying causal mutations of as yet unidentified PID-causing genes. In this study, we expanded in silico the list of potential PID-causing candidate genes from 229 to 3,110. We first identified the top 1% of human genes predicted by the human genes connectome to be biologically close to the 229 known PID genes. We then further narrowed down the list of genes by retaining only the most biologically relevant genes, with functionally enriched gene ontology biological categories similar to those for the known PID genes. We validated this prediction by showing that 17 of the 21 novel PID genes published since the last IUIS classification fall into this group of 3,110 genes (p < 10(-7)). The resulting new extended list of 3,110 predicted PID genes should be useful for the discovery of novel PID genes in patients.

  7. Taking the Starch out of Oral Biofilm Formation: Molecular Basis and Functional Significance of Salivary α-Amylase Binding to Oral Streptococci

    PubMed Central

    Nikitkova, Anna E.; Haase, Elaine M.

    2013-01-01

    α-Amylase-binding streptococci (ABS) are a heterogeneous group of commensal oral bacterial species that comprise a significant proportion of dental plaque microfloras. Salivary α-amylase, one of the most abundant proteins in human saliva, binds to the surface of these bacteria via specific surface-exposed α-amylase-binding proteins. The functional significance of α-amylase-binding proteins in oral colonization by streptococci is important for understanding how salivary components influence oral biofilm formation by these important dental plaque species. This review summarizes the results of an extensive series of studies that have sought to define the molecular basis for α-amylase binding to the surface of the bacterium as well as the biological significance of this phenomenon in dental plaque biofilm formation. PMID:23144140

  8. Genes Expressed in Human Tumor Endothelium

    NASA Astrophysics Data System (ADS)

    St. Croix, Brad; Rago, Carlo; Velculescu, Victor; Traverso, Giovanni; Romans, Katharine E.; Montgomery, Elizabeth; Lal, Anita; Riggins, Gregory J.; Lengauer, Christoph; Vogelstein, Bert; Kinzler, Kenneth W.

    2000-08-01

    To gain a molecular understanding of tumor angiogenesis, we compared gene expression patterns of endothelial cells derived from blood vessels of normal and malignant colorectal tissues. Of over 170 transcripts predominantly expressed in the endothelium, 79 were differentially expressed, including 46 that were specifically elevated in tumor-associated endothelium. Several of these genes encode extracellular matrix proteins, but most are of unknown function. Most of these tumor endothelial markers were expressed in a wide range of tumor types, as well as in normal vessels associated with wound healing and corpus luteum formation. These studies demonstrate that tumor and normal endothelium are distinct at the molecular level, a finding that may have significant implications for the development of anti-angiogenic therapies.

  9. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false α-Amylase enzyme preparation from Bacillus stearothermophilus. 184.1012 Section 184.1012 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DIRECT FOOD SUBSTANCES AFFIRMED AS GENERALLY RECOGNIZED AS SAFE Listing of...

  10. Gene encoding human Ro-associated autoantigen Y5 RNA.

    PubMed Central

    Maraia, R; Sakulich, A L; Brinkmann, E; Green, E D

    1996-01-01

    Ro ribonucleoproteins are composed of Y RNAs and the Ro 60 kDa protein. While the Ro 60 kDa protein is implicated in an RNA discard pathway that recognizes 3'-extended 5S rRNAs, the function of Y RNAs remains unknown [O'Brien,C.A. and Wolin,S.L. (1995) Genes Dev. 8,2891-2903]. Y5 RNA occupies a large fraction of Ro 60 kDa protein in human Ro RNPs, contains an atypical 3'-extension not found on other Y RNAs, and constitutes an RNA antigen in certain autoimmune patients [Boulanger et al. (1995) Clin. Exp. Immunol. 99, 29-36]. An overabundance of Y RNA retroposed pseudogenes has previously complicated the isolation of mammalian Y RNA genes. The source gene for Y5 RNA was isolated from human DNA as well as from Galago senegalis DNA. Authenticity of the hY5 RNA gene was demonstrated in vivo and its activity was compared with the hY4 RNA gene that also uses a type 3 promoter for RNA polymerase III. The hY5 RNA gene was subsequently found to reside within a few hundred thousand base pairs of other Y RNA genes and the linear order of the four human Y RNA genes on chromosome 7q36 was determined. Phylogenetic comparative analyses of promoter and RNA structure indicate that the Y5 RNA gene has been subjected to positive selection during primate evolution. Consistent with the proposal of O'Brien and Harley [O'Brian,C.A. and Wolin,S.L. (1992) Gene 116, 285-289], analysis of flanking sequences suggest that the hY5 RNA gene may have originated as a retroposon. PMID:8836182

  11. An atlas of gene expression and gene co-regulation in the human retina

    PubMed Central

    Pinelli, Michele; Carissimo, Annamaria; Cutillo, Luisa; Lai, Ching-Hung; Mutarelli, Margherita; Moretti, Maria Nicoletta; Singh, Marwah Veer; Karali, Marianthi; Carrella, Diego; Pizzo, Mariateresa; Russo, Francesco; Ferrari, Stefano; Ponzin, Diego; Angelini, Claudia; Banfi, Sandro; di Bernardo, Diego

    2016-01-01

    The human retina is a specialized tissue involved in light stimulus transduction. Despite its unique biology, an accurate reference transcriptome is still missing. Here, we performed gene expression analysis (RNA-seq) of 50 retinal samples from non-visually impaired post-mortem donors. We identified novel transcripts with high confidence (Observed Transcriptome (ObsT)) and quantified the expression level of known transcripts (Reference Transcriptome (RefT)). The ObsT included 77 623 transcripts (23 960 genes) covering 137 Mb (35 Mb new transcribed genome). Most of the transcripts (92%) were multi-exonic: 81% with known isoforms, 16% with new isoforms and 3% belonging to new genes. The RefT included 13 792 genes across 94 521 known transcripts. Mitochondrial genes were among the most highly expressed, accounting for about 10% of the reads. Of all the protein-coding genes in Gencode, 65% are expressed in the retina. We exploited inter-individual variability in gene expression to infer a gene co-expression network and to identify genes specifically expressed in photoreceptor cells. We experimentally validated the photoreceptors localization of three genes in human retina that had not been previously reported. RNA-seq data and the gene co-expression network are available online (http://retina.tigem.it). PMID:27235414

  12. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase.

    PubMed

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua

    2015-10-01

    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Gene × Smoking Interactions on Human Brain Gene Expression: Finding Common Mechanisms in Adolescents and Adults

    ERIC Educational Resources Information Center

    Wolock, Samuel L.; Yates, Andrew; Petrill, Stephen A.; Bohland, Jason W.; Blair, Clancy; Li, Ning; Machiraju, Raghu; Huang, Kun; Bartlett, Christopher W.

    2013-01-01

    Background: Numerous studies have examined gene × environment interactions (G × E) in cognitive and behavioral domains. However, these studies have been limited in that they have not been able to directly assess differential patterns of gene expression in the human brain. Here, we assessed G × E interactions using two publically available datasets…

  14. Gene × Smoking Interactions on Human Brain Gene Expression: Finding Common Mechanisms in Adolescents and Adults

    ERIC Educational Resources Information Center

    Wolock, Samuel L.; Yates, Andrew; Petrill, Stephen A.; Bohland, Jason W.; Blair, Clancy; Li, Ning; Machiraju, Raghu; Huang, Kun; Bartlett, Christopher W.

    2013-01-01

    Background: Numerous studies have examined gene × environment interactions (G × E) in cognitive and behavioral domains. However, these studies have been limited in that they have not been able to directly assess differential patterns of gene expression in the human brain. Here, we assessed G × E interactions using two publically available datasets…

  15. Human gene correlation analysis (HGCA): a tool for the identification of transcriptionally co-expressed genes.

    PubMed

    Michalopoulos, Ioannis; Pavlopoulos, Georgios A; Malatras, Apostolos; Karelas, Alexandros; Kostadima, Myrto-Areti; Schneider, Reinhard; Kossida, Sophia

    2012-06-06

    Bioinformatics and high-throughput technologies such as microarray studies allow the measure of the expression levels of large numbers of genes simultaneously, thus helping us to understand the molecular mechanisms of various biological processes in a cell. We calculate the Pearson Correlation Coefficient (r-value) between probe set signal values from Affymetrix Human Genome Microarray samples and cluster the human genes according to the r-value correlation matrix using the Neighbour Joining (NJ) clustering method. A hyper-geometric distribution is applied on the text annotations of the probe sets to quantify the term overrepresentations. The aim of the tool is the identification of closely correlated genes for a given gene of interest and/or the prediction of its biological function, which is based on the annotations of the respective gene cluster. Human Gene Correlation Analysis (HGCA) is a tool to classify human genes according to their coexpression levels and to identify overrepresented annotation terms in correlated gene groups. It is available at: http://biobank-informatics.bioacademy.gr/coexpression/.

  16. [Microbe amylases: characteristic, properties and practical use].

    PubMed

    Kubrak, O I; Lushchak, V I

    2007-01-01

    Current data concerning structure, properties and methods of purification ofmicrobial amylolytic enzymes are summarized in this paper. A short characteristic of the main methods of amylase activity measuring is presented, the advantages and disadvantages of each method are shown. It is proposed that novel techniques of enzyme immobilization stabilize the structure of amylases and allow their multiple uses. Scientific interest to amylases is analyzed that is explained by a number of their unique properties such as thermostability and pH-tolerance. Authors have demonstrated some examples of the practical using ofamylases in different fields of industry: textile, paper, food industries, brewing and wine-making. The prospects of their possible using in detergent preparing for laundries and dishwashers are presented. It is supposed that future investigations in this trend for isolating new amrnylases from native producers will be developed.

  17. Enhancer Complexes Located Downstream of Both Human Immunoglobulin Cα Genes

    PubMed Central

    Mills, Frederick C.; Harindranath, Nagaradona; Mitchell, Mary; Max, Edward E.

    1997-01-01

    To investigate regulation of human immunoglobulin heavy chain expression, we have cloned DNA downstream from the two humangenes, corresponding to the position in the mouse IgH cluster of a locus control region (LCR) that includes an enhancer which regulates isotype switching. Within 25 kb downstream of both the human immunoglobulin Cα1 and Cα2 genes we identified several segments of DNA which display B lymphoid–specific DNase I hypersensitivity as well as enhancer activity in transient transfections. The corresponding sequences downstream from each of the two humangenes are nearly identical to each other. These enhancers are also homologous to three regions which lie in similar positions downstream from the murine Cα gene and form the murine LCR. The strongest enhancers in both mouse and human have been designated HS12. Within a 135-bp core homology region, the human HS12 enhancers are ∼90% identical to the murine homolog and include several motifs previously demonstrated to be important for function of the murine enhancer; additional segments of high sequence conservation suggest the possibility of previously unrecognized functional motifs. On the other hand, certain functional elements in the murine enhancer, including a B cell–specific activator protein site, do not appear to be conserved in human HS12. The human homologs of the murine enhancers designated HS3 and HS4 show lower overall sequence conservation, but for at least two of the functional motifs in the murine HS4 (a κB site and an octamer motif  ) the human HS4 homologs are exactly conserved. An additional hypersensitivity site between human HS3 and HS12 in each human locus displays no enhancer activity on its own, but includes a region of high sequence conservation with mouse, suggesting the possibility of another novel functional element. PMID:9294139

  18. Gene assignment, expression, and homology of human tropomodulin

    SciTech Connect

    Sung, L.A.; Fan, Y.S.; Lin, C.C.

    1996-05-15

    Tropomodulin is a newly characterized pointed end capping protein for actin filaments. It binds specifically to the N terminus of tropomyosin and blocks the elongation and depolymerization of tropomyosin-coated actin filaments. A 1.9-kb human tropomodulin cDNA clone was used to map its gene by fluorescence in situ hybridization. The tropomodulin gene was assigned to human chromosome 9q22.2-q22.3, a region that is also known to contain several other genes and disease loci and is proximal to the loci for gelsolin and {alpha}-fodrin. The gene for tropomodulin is expressed in major human tissues at different levels in the following order: heart and skeletal muscle much greater than that in placenta, liver, and kidney. Human tropomodulin and a 64-kDa autoantigen in Graves disease ({sub 1}D) are related: tropomodulin has 42 and 41% identity with the Graves protein in the N-terminal (69 residue) and C-terminal (194 residue) regions, respectively. The insertion of several homologous repeats in the midsection of the Graves protein, together with the extension of a proline-rich C terminus, accounts for the differences in length between the Graves protein (572 residues) and tropomodulin (359 residues). The significant sequence identity indicates that these two genes are evolved from a common ancestral gene. 22 refs., 4 figs.

  19. P gene as an inherited biomarker of human eye color.

    PubMed

    Rebbeck, Timothy R; Kanetsky, Peter A; Walker, Amy H; Holmes, Robin; Halpern, Allan C; Schuchter, Lynn M; Elder, David E; Guerry, DuPont

    2002-08-01

    Human pigmentation, including eye color, has been associated with skin cancer risk. The P gene is the human homologue to the mouse pink-eye dilution locus and is responsible for oculocutaneous albinism type 2 and other phenotypes that confer eye hypopigmentation. The P gene is located on chromosome 15q11.2-q12, which is also the location of a putative eye pigmentation gene (EYCL3) inferred to exist by linkage analysis. Therefore, the P gene is a strong candidate for determination of human eye color. Using a sample of 629 normally pigmented individuals, we found that individuals were less likely to have blue or gray eyes if they had P gene variants Arg305Trp (P = 0.002), Arg419Gln (P = 0.001), or the combination of both variants (P = 0.003). These results suggest that P gene, in part, determines normal phenotypic variation in human eye color and may therefore represent an inherited biomarker of cutaneous cancer risk.

  20. The d4 gene family in the human genome

    SciTech Connect

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.

    1996-08-15

    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at low stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.

  1. Novel mechanism of conjoined gene formation in the human genome.

    PubMed

    Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

    2012-03-01

    Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

  2. Replication timing-related and gene body-specific methylation of active human genes.

    PubMed

    Aran, Dvir; Toperoff, Gidon; Rosenberg, Michael; Hellman, Asaf

    2011-02-15

    Understanding how the epigenetic blueprint of the genome shapes human phenotypes requires systematic evaluation of the complex interplay between gene activity and the different layers of the epigenome. Utilizing microarray-based techniques, we explored the relationships between DNA methylation, DNA replication timing and gene expression levels across a variety of human tissues and cell lines. The analyses revealed unequal methylation levels among early- and late-replicating fractions of the genome: late-replicating DNA was hypomethylated compared with early-replicating DNA. Moreover, late-replicating regions were gradually demethylated with cell divisions, whereas the methylation of early-replicating regions was better maintained. As active genes concentrate at early-replicating regions, they are overall hypermethylated relative to inactive genes. Accordingly, we show that the previously reported positive correlation between gene-body methylation (methylation of the transcribed portion of genes) and gene expression is restricted to proliferative tissues and cell lines, whereas in tissues containing few proliferating cells, active and inactive genes have similar methylation levels. We further show that active gene bodies are hypermethylated not only compared with inactive gene bodies, but also compared with their flanking sequences. This specific hypermethylation of the active gene bodies is severely disrupted in cells of an immunodeficiency, centromeric region instability, facial anomalies (ICF) syndrome patient bearing mutated DNA methyltransferase 3B (DNMT3B). Our data show that a high methylation level is preferentially maintained in active gene bodies through independent cellular processes. Rather than serving as a distinctive mark between active and inactive genes, gene-body methylation appears to serve a vital, currently unknown function in active genes.

  3. Characterization of human septic sera induced gene expression modulation in human myocytes

    PubMed Central

    Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem

    2009-01-01

    To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886

  4. Crowdsourcing the Moral Limits of Human Gene Editing?

    PubMed

    Juengst, Eric T

    2017-05-01

    In 2015, a flourish of "alarums and excursions" by the scientific community propelled CRISPR/Cas9 and other new gene-editing techniques into public attention. At issue were two kinds of potential gene-editing experiments in humans: those making inheritable germ-line modifications and those designed to enhance human traits beyond what is necessary for health and healing. The scientific consensus seemed to be that while research to develop safe and effective human gene editing should continue, society's moral uncertainties about these two kinds of experiments needed to be better resolved before clinical trials of either type should be attempted. In the United States, the National Academies of Science, Engineering and Medicine (NASEM) convened the Committee on Human Gene Editing: Scientific, Medical and Ethical Considerations to pursue that resolution. The committee's 2017 consensus report has been widely interpreted as "opening the door" to inheritable human genetic modification and holding a line against enhancement interventions. But on a close reading it does neither. There are two reasons for this eccentric conclusion, both of which depend upon the strength of the committee's commitment to engaging diverse public voices in the gene-editing policy-making process. © 2017 The Hastings Center.

  5. Characteristics and clustering of human ribosomal protein genes

    PubMed Central

    Ishii, Kyota; Washio, Takanori; Uechi, Tamayo; Yoshihama, Maki; Kenmochi, Naoya; Tomita, Masaru

    2006-01-01

    Background The ribosome is a central player in the translation system, which in mammals consists of four RNA species and 79 ribosomal proteins (RPs). The control mechanisms of gene expression and the functions of RPs are believed to be identical. Most RP genes have common promoters and were therefore assumed to have a unified gene expression control mechanism. Results We systematically analyzed the homogeneity and heterogeneity of RP genes on the basis of their expression profiles, promoter structures, encoded amino acid compositions, and codon compositions. The results revealed that (1) most RP genes are coordinately expressed at the mRNA level, with higher signals in the spleen, lymph node dissection (LND), and fetal brain. However, 17 genes, including the P protein genes (RPLP0, RPLP1, RPLP2), are expressed in a tissue-specific manner. (2) Most promoters have GC boxes and possible binding sites for nuclear respiratory factor 2, Yin and Yang 1, and/or activator protein 1. However, they do not have canonical TATA boxes. (3) Analysis of the amino acid composition of the encoded proteins indicated a high lysine and arginine content. (4) The major RP genes exhibit a characteristic synonymous codon composition with high rates of G or C in the third-codon position and a high content of AAG, CAG, ATC, GAG, CAC, and CTG. Conclusion Eleven of the RP genes are still identified as being unique and did not exhibit at least some of the above characteristics, indicating that they may have unknown functions not present in other RP genes. Furthermore, we found sequences conserved between human and mouse genes around the transcription start sites and in the intronic regions. This study suggests certain overall trends and characteristic features of human RP genes. PMID:16504170

  6. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    NASA Astrophysics Data System (ADS)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  7. Identification of a new oat β-amylase by functional proteomics.

    PubMed

    Ben Halima, Nihed; Khemakhem, Bassem; Fendri, Imen; Ogata, Hiroyuki; Baril, Patrick; Pichon, Chantal; Abdelkafi, Slim

    2016-01-01

    Oat (Avena sativa L.) seed extracts exhibited a high degree of catalytic activity including amylase activities. Proteins in the oat seed extracts were optimized for their amylolytic activities. Oat extract with amylolytic activity was separated by SDS-PAGE and a major protein band with an apparent molecular mass of 53 kDa was subjected to tryptic digestion. The generated amino acid sequences were analyzed by liquid chromatography–tandem mass spectrometry (LC/ESI/MS/MS) and database searches. These sequences were used to identify a partial cDNA from expressed sequence tags (ESTs) of A. sativa L. Based upon EST sequences, a predicted full-length gene was identified, with an open reading frame of 1464 bp encoding a protein of 488 amino acid residues (AsBAMY), with a theoretical molecular mass of 55 kDa identified as a β-amylase belonging to the plant β-amylase family. Primary structure of oat β-amylase (AsBAMY) protein indicated high similarity with other β-amylase from other cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare), and rye (Secale cereale) with two conserved Glu residues (E184 and E378) assigned as the “putative” catalytic residues which would act as an acid and base pair in the catalytic process. In addition, a 3D-model of AsBAMY was built from known X-ray structures and sequence alignments. A similar core (β/α)8-barrel architecture was found in AsBAMY like the other cereal β-amylases with a specific location of the active site in a pocket-like cavity structure made at one end of this core (β/α)8-barrel domain suggesting an accessibility of the non-reducing end of the substrate and thus confirming the results of AsBAMY exo-acting hydrolase.

  8. Redox regulation of a novel plastid-targeted beta-amylase of Arabidopsis.

    PubMed

    Sparla, Francesca; Costa, Alex; Lo Schiavo, Fiorella; Pupillo, Paolo; Trost, Paolo

    2006-07-01

    Nine genes of Arabidopsis (Arabidopsis thaliana) encode for beta-amylase isozymes. Six members of the family are predicted to be extrachloroplastic isozymes and three contain predicted plastid transit peptides. Among the latter, chloroplast-targeted beta-amylase (At4g17090) and thioredoxin-regulated beta-amylase (TR-BAMY; At3g23920; this work) are experimentally demonstrated to be targeted to plastids. Recombinant TR-BAMY was catalytically active only when expressed as a mature protein, i.e. with no transit peptide. Mature TR-BAMY was a monomer of 60 kD, hydrolyzing soluble starch with optimal activity between pH 6.0 and 8.0. The activity of recombinant TR-BAMY was strictly dependent on redox potential with an Em,7.0 of -302 +/- 14 mV. Thioredoxins f1, m1, and y1 of Arabidopsis were all able to mediate the reductive activation of oxidized TR-BAMY. Site-specific mutants showed that TR-BAMY oxidative inhibition depended on the formation of a disulfide bridge between Cys-32 and Cys-470. Consistent with TR-BAMY redox dependency, total beta-amylase activity in Arabidopsis chloroplasts was partially redox regulated and required reducing conditions for full activation. In Arabidopsis, TR-BAMY transcripts were detected in leaves, roots, flowers, pollen, and seeds. TR-BAMY may be the only beta-amylase of nonphotosynthetic plastids suggesting a redox regulation of starch metabolism in these organelles. In leaves, where chloroplast-targeted beta-amylase is involved in physiological degradation of starch in the dark, TR-BAMY is proposed to participate to a redox-regulated pathway of starch degradation under specific stress conditions.

  9. microRNA and gene networks in human laryngeal cancer.

    PubMed

    Zhang, Fengyu; Xu, Zhiwen; Wang, Kunhao; Sun, Linlin; Liu, Genghe; Han, Baixu

    2015-12-01

    Genes and microRNAs (miRNAs) are considered to be key biological factors in human carcinogenesis. To date, considerable data have been obtained regarding genes and miRNAs in cancer; however, the regulatory mechanisms associated with the genes and miRNAs in cancer have yet to be fully elucidated. The aim of the present study was to use the key genes and miRNAs associated with laryngeal cancer (LC) to construct three regulatory networks (differentially expressed, LC-related and global). A network topology of the development of LC, involving 10 differentially expressed miRNAs and 55 differentially expressed genes, was obtained. These genes exhibited multiple identities, including target genes of miRNA, transcription factors (TFs) and host genes. The key regulatory interactions were determined by comparing the similarities and differences among the three networks. The nodes and pathways in LC, as well as the association between each pair of factors within the networks, such as TFs and miRNA, miRNA and target genes and miRNA and its host gene, were discussed. The mechanisms of LC involved certain key pathways featuring self-adaptation regulation and nodes without direct predecessors or successors. The findings of the present study have further elucidated the pathogenesis of LC and are likely to be beneficial for future research into LC.

  10. microRNA and gene networks in human laryngeal cancer

    PubMed Central

    ZHANG, FENGYU; XU, ZHIWEN; WANG, KUNHAO; SUN, LINLIN; LIU, GENGHE; HAN, BAIXU

    2015-01-01

    Genes and microRNAs (miRNAs) are considered to be key biological factors in human carcinogenesis. To date, considerable data have been obtained regarding genes and miRNAs in cancer; however, the regulatory mechanisms associated with the genes and miRNAs in cancer have yet to be fully elucidated. The aim of the present study was to use the key genes and miRNAs associated with laryngeal cancer (LC) to construct three regulatory networks (differentially expressed, LC-related and global). A network topology of the development of LC, involving 10 differentially expressed miRNAs and 55 differentially expressed genes, was obtained. These genes exhibited multiple identities, including target genes of miRNA, transcription factors (TFs) and host genes. The key regulatory interactions were determined by comparing the similarities and differences among the three networks. The nodes and pathways in LC, as well as the association between each pair of factors within the networks, such as TFs and miRNA, miRNA and target genes and miRNA and its host gene, were discussed. The mechanisms of LC involved certain key pathways featuring self-adaptation regulation and nodes without direct predecessors or successors. The findings of the present study have further elucidated the pathogenesis of LC and are likely to be beneficial for future research into LC. PMID:26668624

  11. Coordinate regulation of HOX genes in human hematopoietic cells

    SciTech Connect

    Magli, M.C.; Barba, P.; Celetti, A.; De Vita, G.; Cillo, C.; Boncinelli, E. )

    1991-07-15

    Hematopoiesis is a continuous process in which precursor cells proliferate and differentiate throughout life. However, the molecular mechanisms that govern this process are not clearly defined. Homeobox-containing genes, encoding DNA-binding homeodomains. are a network of genes highly conserved throughout evolution. They are organized in clusters expressed in the developing embryo with a positional hierarchy. The authors have analyzed expression of the four human HOX loci in erythroleukemic, promyelocytic, and monocytic cell lines to investigate whether the physical organization of human HOX genes reflects a regulatory hierarchy involved in the differentiation process of hematopoietic cells. The results demonstrate that cells representing various stages of hematopoietic differentiation display differential patterns of HOX gene expression and that HOX genes are coordinately switched on or off in blocks that may include entire loci. The entire HOX4 locus is silent in all lines analyzed and almost all the HOX2 genes are active in erythroleukemic cells and turned off in myeloid-restricted cells. The observations provide information about the regulation of HOX genes and suggest that the coordinate regulation of these genes may play an important role in lineage determination during early steps of hematopoiesis.

  12. Identification and characterization of essential genes in the human genome

    PubMed Central

    Wang, Tim; Birsoy, Kıvanç; Hughes, Nicholas W.; Krupczak, Kevin M.; Post, Yorick; Wei, Jenny J.; Lander, Eric S.; Sabatini, David M.

    2015-01-01

    Large-scale genetic analysis of lethal phenotypes has elucidated the molecular underpinnings of many biological processes. Using the bacterial clustered regularly interspaced short palindromic repeats (CRISPR) system, we constructed a genome-wide single-guide RNA (sgRNA) library to screen for genes required for proliferation and survival in a human cancer cell line. Our screen revealed the set of cell-essential genes, which was validated by an orthogonal gene-trap-based screen and comparison with yeast gene knockouts. This set is enriched for genes that encode components of fundamental pathways, are expressed at high levels, and contain few inactivating polymorphisms in the human population. We also uncovered a large group of uncharacterized genes involved in RNA processing, a number of whose products localize to the nucleolus. Lastly, screens in additional cell lines showed a high degree of overlap in gene essentiality, but also revealed differences specific to each cell line and cancer type that reflect the developmental origin, oncogenic drivers, paralogous gene expression pattern, and chromosomal structure of each line. These results demonstrate the power of CRISPR-based screens and suggest a general strategy for identifying liabilities in cancer cells. PMID:26472758

  13. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-05-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  14. Human Intellectual Disability Genes Form Conserved Functional Modules in Drosophila

    PubMed Central

    Oortveld, Merel A. W.; Keerthikumar, Shivakumar; Oti, Martin; Nijhof, Bonnie; Fernandes, Ana Clara; Kochinke, Korinna; Castells-Nobau, Anna; van Engelen, Eva; Ellenkamp, Thijs; Eshuis, Lilian; Galy, Anne; van Bokhoven, Hans; Habermann, Bianca; Brunner, Han G.; Zweier, Christiane; Verstreken, Patrik; Huynen, Martijn A.; Schenck, Annette

    2013-01-01

    Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules. PMID:24204314

  15. Origins of De Novo Genes in Human and Chimpanzee.

    PubMed

    Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M Mar

    2015-12-01

    The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species--human, chimpanzee, macaque, and mouse--and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins.

  16. Origins of De Novo Genes in Human and Chimpanzee

    PubMed Central

    Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M.Mar

    2015-01-01

    The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species—human, chimpanzee, macaque, and mouse—and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins. PMID:26720152

  17. Chromosomal localization of the human vesicular amine transporter genes

    SciTech Connect

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. )

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  18. Cloning and characterization of two new thermostable and alkalitolerant α-amylases from the Anoxybacillus species that produce high levels of maltose.

    PubMed

    Chai, Yen Yen; Rahman, Raja Noor Zaliha Raja Abd; Illias, Rosli Md; Goh, Kian Mau

    2012-05-01

    Two genes that encode α-amylases from two Anoxybacillus species were cloned and expressed in Escherichia coli. The genes are 1,518 bp long and encode 506 amino acids. Both sequences are 98% similar but are distinct from other well-known α-amylases. Both of the recombinant enzymes, ASKA and ADTA, were purified using an α-CD-Sepharose column. They exhibited an optimum activity at 60°C and pH 8. Both amylases were stable at pH 6-10. At 60°C in the absence of Ca²⁺, negligible reduction in activity for up to 48 h was observed. The activity half-life at 65°C was 48 and 3 h for ASKA and ADTA, respectively. In the presence of Ca²⁺ ions, both amylases were highly stable for at least 48 h and had less than a 10% decrease in activity at 70°C. Both enzymes exhibited similar end-product profiles, and the predominant yield was maltose (69%) from starch hydrolysis. To the best of our knowledge, most α-amylases that produce high levels of maltose are active at an acidic to neutral pH. This is the first report of two thermostable, alkalitolerant recombinant α-amylases from Anoxybacillus that produce high levels of maltose and have an atypical protein sequence compared with known α-amylases.

  19. Update of the human and mouse SERPIN gene superfamily

    PubMed Central

    2013-01-01

    The serpin family comprises a structurally similar, yet functionally diverse, set of proteins. Named originally for their function as serine proteinase inhibitors, many of its members are not inhibitors but rather chaperones, involved in storage, transport, and other roles. Serpins are found in genomes of all kingdoms, with 36 human protein-coding genes and five pseudogenes. The mouse has 60 Serpin functional genes, many of which are orthologous to human SERPIN genes and some of which have expanded into multiple paralogous genes. Serpins are found in tissues throughout the body; whereas most are extracellular, there is a class of intracellular serpins. Serpins appear to have roles in inflammation, immune function, tumorigenesis, blood clotting, dementia, and cancer metastasis. Further characterization of these proteins will likely reveal potential biomarkers and therapeutic targets for disease. PMID:24172014

  20. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    PubMed

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P < 0.005), as predicted by computer-based simulations. Conversely, RELN 5'UTR sequences boost reporter gene expression above control levels in neuronal SN56 and N2A cell lines, but 12- and 13-repeat alleles still yield 50-60% less luciferase activity compared to the more common 8- and 10-repeat alleles (P < 0.0001). RELN "long" GGC alleles significantly blunt gene expression and may, through this effect, confer vulnerability to human disorders, such as schizophrenia and autism.

  1. [Gene therapy for human hearing loss: challenges and promises].

    PubMed

    Meyer, Anaïs; Petit, Christine; Safieddine, Saaid

    2013-10-01

    Thanks to the advances accomplished in human genomics during the last twenty years, major progress has been made towards understanding the pathogenesis of various forms of congenital or acquired deafness. The identification of deafness genes, which are potential therapeutic targets, and generation and functional characterization of murine models for human deafness forms have advanced the knowledge of the molecular physiology of auditory sensory cells. These milestones have opened the way for the development of new therapeutic strategies, alternatives to conventional prostheses, hearing amplification for mild-to-severe hearing loss, or cochlear implantation for severe-to-profound deafness. In this review, we first summarize the progress made over the last decade in using gene therapy and antisense RNA delivery, including the development of new methods for cochlear gene transfer. We then discuss the potential of gene therapy for curing acquired or inherited deafness and the major obstacles that must be overcome before clinical application can be considered.

  2. Two tandemly located promoters, artificially constructed, are active in a Bacillus subtilis alpha-amylase secretion vector.

    PubMed

    Furusato, T; Takano, J; Jigami, Y; Tanaka, H; Yamane, K

    1986-04-01

    An 85 bp DNA fragment, the nucleotide sequence of which had 84% homology with the sequence for the promoter, ribosome binding site and NH2-terminal five amino acids of the Bacillus amyloliquefaciens alpha-amylase gene, was chemically synthesized. In order to analyze the promoter activity of a Bacillus subtilis alpha-amylase secretion vector, the fragment was inserted between the promoter and signal peptide-coding region of Bacillus subtilis alpha-amylase gene. Both promoters, tandemly repeated, functioned in transcribing the B. subtilis alpha-amylase signal peptide-coding region followed by the Escherichia coli beta-lactamase structural gene. The transcription initiation sites were determined by the primer extension method. The extracellular production of beta-lactamase was stimulated by two promoters as compared with that by the plasmids containing either promoter region alone. The change of two amino acids in the NH2-terminal region of the B. subtilis alpha-amylase signal peptide had no effect on the secretion of beta-lactamase from B. subtilis cells.

  3. Mapping of UV photoproducts along the human P53 gene

    SciTech Connect

    Tornaletti, S.; Rozek, D.; Pfeifer, G.P.

    1994-12-31

    Methods to detect DNA adducts at the DNA sequence level in mammalian cells have been developed, and it is now possible to relate adduct frequency and repair efficiency with mutations at certain nucleotide positions in human cancer-relevant genes. Mutations in the p53 tumor suppressor gene have been found in a large proportion of human skin cancers. These mutations are predominantly C to T transitions and CC to TT double transition mutations, two types of base alterations specifically induced by UV light. In order to find possible correlations between adduct distribution and mutations at specific p53 sequences, we have mapped at single-base resolution the distribution of cyclobutane dimers (CBD) and (6-4) photoproducts along the p53 gene in UV-irradiated human skin fibroblasts by ligation-mediated polymerase chain reaction (LMPCR).

  4. A model for gene therapy of human hereditary lymphedema

    PubMed Central

    Karkkainen, Marika J.; Saaristo, Anne; Jussila, Lotta; Karila, Kaisa A.; Lawrence, Elizabeth C.; Pajusola, Katri; Bueler, Hansruedi; Eichmann, Anne; Kauppinen, Risto; Kettunen, Mikko I.; Ylä-Herttuala, Seppo; Finegold, David N.; Ferrell, Robert E.; Alitalo, Kari

    2001-01-01

    Primary human lymphedema (Milroy's disease), characterized by a chronic and disfiguring swelling of the extremities, is associated with heterozygous inactivating missense mutations of the gene encoding vascular endothelial growth factor C/D receptor (VEGFR-3). Here, we describe a mouse model and a possible treatment for primary lymphedema. Like the human patients, the lymphedema (Chy) mice have an inactivating Vegfr3 mutation in their germ line, and swelling of the limbs because of hypoplastic cutaneous, but not visceral, lymphatic vessels. Neuropilin (NRP)-2 bound VEGF-C and was expressed in the visceral, but not in the cutaneous, lymphatic endothelia, suggesting that it may participate in the pathogenesis of lymphedema. By using virus-mediated VEGF-C gene therapy, we were able to generate functional lymphatic vessels in the lymphedema mice. Our results suggest that growth factor gene therapy is applicable to human lymphedema and provide a paradigm for other diseases associated with mutant receptors. PMID:11592985

  5. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.

    1989-05-01

    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  6. Chromosome locations of human EMX and OTX genes

    SciTech Connect

    Kastury, K.; Druck, T.; Huebner, K.

    1994-07-01

    The authors have determined the chromosomal localization of four human homeobox-containing genes, EMX1, EMX2, OTX1, and OTX2, related to Drosophila genes expressed in the developing head of the fly. Murine homologs of these genes are expressed in specific nested domains in the developing rostral brain of midgestation embryos. DNAs from a panel of 19 rodent-human hybrids, each carrying one or a few human chromosomes such that most human chromosomes regions were presented, were tested for the presence of the four gene loci by filter hybridization to radiolabeled probes. Regional chromosomal localization was determined by similarly testing DNAs from hybrid mapping panels for each of the candidate chromosomes. Finally, fluorescence in situ hybridization of cosmid clones for these loci refined the locations, two of which were in the vicinity of previously mapped orphan homeobox genes and two of which were near each other. OTX2, the earliest and most widely expressed gene, maps to chromosome region 14q21-q22; the OTX1 locus maps to 2p13; EMX2 maps to 10q26.1; and EMX1, the most narrowly and lately expressed, maps to 2p14-p13. Thus, these homeobox-containing genes involved in brain development are not linked to any of the four HOX clusters on 7p15-p14, 17q21-q22, 12q12-q13, and 2q31. However, the OTX1 and EMX1 loci may be closely linked on or near 2p13, prompting speculation that a clustered gene structure could have functional significance, as is presumably the case for the HOX clusters. 33 refs., 2 figs.

  7. Human gene transfer: Characterization of human tumor-infiltrating lymphocytes as vehicles for retroviral-mediated gene transfer in man

    SciTech Connect

    Kasid, A.; Morecki, S.; Aebersold, P.; Cornetta, K.; Culver, K.; Freeman, S.; Director, E.; Lotze, M.T.; Blaese, R.M.; Anderson, W.F.; Rosenberg, S.A. )

    1990-01-01

    Tumor-infiltrating lymphocytes (TILs) are cells generated from tumor suspensions cultured in interleukin 2 that can mediate cancer regression when adoptively transferred into mice or humans. Since TILs proliferate rapidly in vitro, recirculate, and preferentially localize at the tumor site in vivo, they provide an attractive model for delivery of exogenous genetic material into man. To determine whether efficient gene transfer into TILs is feasible. The authors transduced human TILs with the bacterial gene for neomycin-resistance (Neo{sup R}) using the retroviral vector N2. The transduced TIL populations were stable and polyclonal with respect to the intact Neo{sup R} gene integration and expressed high levels of neomycin phosphotransferase activity. The Neo{sup R} gene insertion did not alter the in vitro growth pattern and interleukin 2 dependence of the transduced TILs. Analyses of T-cell receptor gene rearrangement for {beta}- and {gamma}-chain genes revealed the oligoclonal nature of the TIL populations with no major change in the DNA rearrangement patterns or the levels of mRNA expression of the {beta} and {gamma} chains following transduction and selection of TILs in the neomycin analog G418. Human TILs expressed mRNA for tumor necrosis factors ({alpha} and {beta}) and interleukin 2 receptor P55. This pattern of cytokine-mRNA expression was not significantly altered following the transduction of TILs. The studies demonstrate the feasibility of TILs as suitable cellular vehicles for the introduction of therapeutic genes into patients receiving autologous TILs.

  8. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.

    PubMed

    Narang, Vipin; Ramli, Muhamad Azfar; Singhal, Amit; Kumar, Pavanish; de Libero, Gennaro; Poidinger, Michael; Monterola, Christopher

    2015-01-01

    Human gene regulatory networks (GRN) can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs). Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data) accompanying this manuscript.

  9. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks

    PubMed Central

    Singhal, Amit; Kumar, Pavanish; de Libero, Gennaro; Poidinger, Michael; Monterola, Christopher

    2015-01-01

    Human gene regulatory networks (GRN) can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs). Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data) accompanying this manuscript. PMID:26393364

  10. Gene expression in the aging human brain: an overview.

    PubMed

    Mohan, Adith; Mather, Karen A; Thalamuthu, Anbupalam; Baune, Bernhard T; Sachdev, Perminder S

    2016-03-01

    The review aims to provide a summary of recent developments in the study of gene expression in the aging human brain. Profiling differentially expressed genes or 'transcripts' in the human brain over the course of normal aging has provided valuable insights into the biological pathways that appear activated or suppressed in late life. Genes mediating neuroinflammation and immune system activation in particular, show significant age-related upregulation creating a state of vulnerability to neurodegenerative and neuropsychiatric disease in the aging brain. Cellular ionic dyshomeostasis and age-related decline in a host of molecular influences on synaptic efficacy may underlie neurocognitive decline in later life. Critically, these investigations have also shed light on the mobilization of protective genetic responses within the aging human brain that help determine health and disease trajectories in older age. There is growing interest in the study of pre and posttranscriptional regulators of gene expression, and the role of noncoding RNAs in particular, as mediators of the phenotypic diversity that characterizes human brain aging. Gene expression studies in healthy brain aging offer an opportunity to unravel the intricately regulated cellular underpinnings of neurocognitive aging as well as disease risk and resiliency in late life. In doing so, new avenues for early intervention in age-related neurodegenerative disease could be investigated with potentially significant implications for the development of disease-modifying therapies.

  11. The gene for human glutaredoxin (GLRX) is localized to human chromosome 5q14

    SciTech Connect

    Padilla, C.A.; Holmgren, A.; Bajalica, S.; Lagercrantz, J.

    1996-03-05

    Glutaredoxin is a small protein (12 kDa) catalyzing glutathione-dependent disulfide oxidoreduction reactions in a coupled system with NADPH, GSH, and glutathione reductase. A cDNA encoding the human glutaredoxin gene (HGMW-approved symbol GLRX) has recently been isolated and cloned from a human fetal spleen cDNA library. The screening of a human fetal spleen cDNA library. The screening of a human genomic library in Charon 4A led to the identification of three genomic clones. Using fluorescence in situ hybridization to metaphase chromosomes with one genomic clone as a probe, the human glutaredoxin gene was localized to chromosomal region 5q14. This localization at chromosome 5 was in agreement with the somatic cell hybrid analysis, using DNA from a human-hamster and a human-mouse hybrid panel and using a human glutaredoxin cDNA as a probe. 13 refs., 2 figs.

  12. Genomic organization of the human lysosomal acid lipase gene (LIPA)

    SciTech Connect

    Aslandis, C.; Klima, H.; Lackner, K.J.; Schmitz, G. )

    1994-03-15

    Defects in the human lysosomal acid lipase gene are responsible for cholesteryl ester storage disease (CESD) and Wolman disease. Exon skipping as the cause for CESD has been demonstrated. The authors present here a summary of the exon structure of the entire human lysosomal acid lipase gene consisting of 10 exons, together with the sizes of genomic EcoRI and SacI fragments hybridizing to each exon. In addition, the DNA sequence of the putative promoter region is presented. The EMBL accession numbers for adjacent intron sequences are given. 7 refs., 2 figs., 1 tab.

  13. IGD: a resource for intronless genes in the human genome.

    PubMed

    Louhichi, Amel; Fourati, Ahmed; Rebaï, Ahmed

    2011-11-15

    Intronless genes (IGs) fraction varies between 2.7 and 97.7% in eukaryotic genomes. Although many databases on exons and introns exist, there was no curated database for such genes which allowed their study in a concerted manner. Such a database would be useful to identify the functional features and the distribution of these genes across the genome. Here, a new database of IGs in eukaryotes based on GenBank data was described. This database, called IGD (Intronless Gene Database), is a collection of gene sequences that were annotated and curated. The current version of IGD contains 687 human intronless genes with their protein and CDS sequences. Some features of the entries are given in this paper. Data was extracted from GenBank release 183 using a Perl script. Data extraction was followed by a manual curation step. Intronless genes were then analyzed based on their RefSeq annotation and Gene Ontology functional class. IGD represents a useful resource for retrieval and in silico study of intronless genes. IGD is available at http://www.bioinfo-cbs.org/igd with comprehensive help and FAQ pages that illustrate the main uses of this resource.

  14. Evolution and organization of the human protein C gene.

    PubMed Central

    Plutzky, J; Hoskins, J A; Long, G L; Crabtree, G R

    1986-01-01

    We have isolated overlapping phage genomic clones covering an area of 21 kilobases that encodes the human protein C gene. The gene is at least 11.2 kilobases long and is made up of nine exons and eight introns. Two regions homologous to epidermal growth factor and transforming growth factor are encoded by amino acids 46-91 and 92-136 and are precisely delimited by introns, as is a similar sequence in the genes for coagulation factor IX and tissue plasminogen activator. When homologous amino acids of factor IX and protein C are aligned, the positions of all eight introns correspond precisely, suggesting that these genes are the product of a relatively recent gene duplication. Nevertheless, the two genes are sufficiently distantly related that no nucleic acid homology remains in the intronic regions and that the size of the introns varies dramatically between the two genes. The similarity of the genes for factor IX and protein C suggests that they may be the most closely related members of the serine protease gene family involved in coagulation and fibrinolysis. Images PMID:3511471

  15. Identifying new human oocyte marker genes: a microarray approach.

    PubMed

    Gasca, Stéphan; Pellestor, Franck; Assou, Saïd; Loup, Vanessa; Anahory, Tal; Dechaud, Hervé; De Vos, John; Hamamah, Samir

    2007-02-01

    The efficacy of classical IVF techniques is still impaired by poor implantation and pregnancy rates after embryo transfer. This is mainly due to a lack of reliable criteria for the selection of embryos with sufficient development potential. Several studies have provided evidence that some gene expression levels could be used as objective markers of oocyte and embryo competence and capacity to sustain a successful pregnancy. These analyses usually use reverse transcription-polymerase chain reaction to look at small sets of pre-selected genes. However, microarray approaches allow the identification of a wider range of cellular marker genes which could include additional and perhaps more suitable genes that could serve as embryo selection markers. Microarray screenings of around 30,000 genes on U133P Affymetrix gene chips made it possible to establish the expression profile of these genes as well as other related genes in human oocytes and cumulus cells. This study identifies new potential regulators and marker genes such as BARD1, RBL2, RBBP7, BUB3 or BUB1B, which are involved in oocyte maturation.

  16. Aptamer-guided gene targeting in yeast and human cells

    PubMed Central

    Ruff, Patrick; Koh, Kyung Duk; Keskin, Havva; Pai, Rekha B.; Storici, Francesca

    2014-01-01

    Gene targeting is a genetic technique to modify an endogenous DNA sequence in its genomic location via homologous recombination (HR) and is useful both for functional analysis and gene therapy applications. HR is inefficient in most organisms and cell types, including mammalian cells, often limiting the effectiveness of gene targeting. Therefore, increasing HR efficiency remains a major challenge to DNA editing. Here, we present a new concept for gene correction based on the