Science.gov

Sample records for human amylase genes

  1. Concerted evolution of human amylase genes

    SciTech Connect

    Gumucio, D.L.; Wiebauer, K.; Caldwell, R.M.; Samuelson, L.C.; Meisler, M.H.

    1988-03-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, the authors have identified two pancreatic amylase gene and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, duplications, gene conversion, and unequal crossover events have resulted in a very high level of sequence similarity among human amylase gene copies. To identify sequence elements involved in tissue-specific expression and hormonal regulation, the promoter regions of the human amylase genes were sequenced and compared with those of the corresponding mouse genes. The promoters of the human and mouse pancreatic amylase genes are highly homologous between nucleotide - 160 and the cap site. Two sequence elements througth to influence pancreas-specific expression of the rodent genes are present in the human genes. In contrast, similarity in the 5' lanking sequences of the salivary amylase genes is limited to several short sequence elements whose positions and orientations differ in the two species. Some of these sequence elements are also associated with other parotid-specific genes and may be involved in their tissue-specific expression. A glucocorticoid response element and a general enhancer element are closely associated in several of the amylase promoters.

  2. Copy number polymorphism of the salivary amylase gene: implications in human nutrition research.

    PubMed

    Santos, J L; Saus, E; Smalley, S V; Cataldo, L R; Alberti, G; Parada, J; Gratacòs, M; Estivill, X

    2012-01-01

    The salivary α-amylase is a calcium-binding enzyme that initiates starch digestion in the oral cavity. The α-amylase genes are located in a cluster on the chromosome that includes salivary amylase genes (AMY1), two pancreatic α-amylase genes (AMY2A and AMY2B) and a related pseudogene. The AMY1 genes show extensive copy number variation which is directly proportional to the salivary α-amylase content in saliva. The α-amylase amount in saliva is also influenced by other factors, such as hydration status, psychosocial stress level, and short-term dietary habits. It has been shown that the average copy number of AMY1 gene is higher in populations that evolved under high-starch diets versus low-starch diets, reflecting an intense positive selection imposed by diet on amylase copy number during evolution. In this context, a number of different aspects can be considered in evaluating the possible impact of copy number variation of the AMY1 gene on nutrition research, such as issues related to human diet gene evolution, action on starch digestion, effect on glycemic response after starch consumption, modulation of the action of α-amylases inhibitors, effect on taste perception and satiety, influence on psychosocial stress and relation to oral health.

  3. Selective sweep on human amylase genes postdates the split with Neanderthals

    PubMed Central

    Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K.; Armour, John A. L.; Kivisild, Toomas

    2016-01-01

    Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content. PMID:27853181

  4. Diet and the evolution of human amylase gene copy number variation

    PubMed Central

    Perry, George H.; Dominy, Nathaniel J.; Claw, Katrina G.; Lee, Arthur S.; Fiegler, Heike; Redon, Richard; Werner, John; Villanea, Fernando A.; Mountain, Joanna L.; Misra, Rajeev; Carter, Nigel P.; Lee, Charles; Stone, Anne C.

    2008-01-01

    Starch consumption is a prominent characteristic of agricultural societies and hunter-gatherers in arid environments. In contrast, rainforest and circum-arctic hunter-gatherers and some pastoralists consume much less starch1-3. This behavioral variation raises the possibility that different selective pressures have acted on amylase, the enzyme responsible for starch hydrolysis4. We found that salivary amylase gene (AMY1) copy number is correlated positively with salivary amylase protein levels, and that individuals from populations with high-starch diets have on average more AMY1 copies than those with traditionally low-starch diets. Comparisons with other loci in a subset of these populations suggest that the level of AMY1 copy number differentiation is unusual. This example of positive selection on a copy number variable gene is one of the first in the human genome. Higher AMY1 copy numbers and protein levels likely improve the digestion of starchy foods, and may buffer against the fitness-reducing effects of intestinal disease. PMID:17828263

  5. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    PubMed

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations.

  6. Exercise upregulates salivary amylase in humans (Review)

    PubMed Central

    KOIBUCHI, ERI; SUZUKI, YOSHIO

    2014-01-01

    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively investigated. The present review summarizes relevant studies published in the English and Japanese literature after 2006. A search of the PubMed and CiNii databases identified 54 articles, from which 15 original articles were selected. The findings described in these publications indicate that exercise consistently increases mean salivary α-amylase activities and concentrations, particularly at an intensity of >70% VO2max in healthy young individuals. Thus, these studies have confirmed that salivary α-amylase levels markedly increase in response to physical stress. Salivary α-amylase levels may therefore serve as an effective indicator in the non-invasive assessment of physical stress. PMID:24669232

  7. The potato amylase inhibitor gene SbAI regulates cold-induced sweetening in potato tubers by modulating amylase activity.

    PubMed

    Zhang, Huiling; Liu, Jun; Hou, Juan; Yao, Ying; Lin, Yuan; Ou, Yongbin; Song, Botao; Xie, Conghua

    2014-09-01

    Potato cold-induced sweetening (CIS) is critical for the postharvest quality of potato tubers. Starch degradation is considered to be one of the key pathways in the CIS process. However, the functions of the genes that encode enzymes related to starch degradation in CIS and the activity regulation of these enzymes have received less attention. A potato amylase inhibitor gene known as SbAI was cloned from the wild potato species Solanum berthaultii. This genetic transformation confirmed that in contrast to the SbAI suppression in CIS-resistant potatoes, overexpressing SbAI in CIS-sensitive potatoes resulted in less amylase activity and a lower rate of starch degradation accompanied by a lower reducing sugar (RS) content in cold-stored tubers. This finding suggested that the SbAI gene may play crucial roles in potato CIS by modulating the amylase activity. Further investigations indicated that pairwise protein-protein interactions occurred between SbAI and α-amylase StAmy23, β-amylases StBAM1 and StBAM9. SbAI could inhibit the activities of both α-amylase and β-amylase in potato tubers primarily by repressing StAmy23 and StBAM1, respectively. These findings provide the first evidence that SbAI is a key regulator of the amylases that confer starch degradation and RS accumulation in cold-stored potato tubers.

  8. Structural forms of the human amylase locus and their relationships to SNPs, haplotypes, and obesity

    PubMed Central

    Usher, Christina L; Handsaker, Robert E; Esko, Tõnu; Tuke, Marcus A; Weedon, Michael N; Hastie, Alex R; Cao, Han; Moon, Jennifer E; Kashin, Seva; Fuchsberger, Christian; Metspalu, Andres; Pato, Carlos N; Pato, Michele T; McCarthy, Mark I; Boehnke, Michael; Altshuler, David M; Frayling, Timothy M; Hirschhorn, Joel N; McCarroll, Steven A

    2016-01-01

    Hundreds of genes reside in structurally complex, poorly understood regions of the human genome1-3. One such region contains the three amylase genes (AMY2B, AMY2A, and AMY1) responsible for digesting starch into sugar. The copy number of AMY1 is reported to be the genome’s largest influence on obesity4, though genome-wide association studies for obesity have found this locus unremarkable. Using whole genome sequence analysis3,5, droplet digital PCR6, and genome mapping7, we identified eight common structural haplotypes of the amylase locus that suggest its mutational history. We found that AMY1 copy number in individuals’ genomes is generally even (rather than odd) and partially correlates to nearby SNPs, which do not associate with BMI. We measured amylase gene copy number in 1,000 obese or lean Estonians and in two other cohorts totaling ~3,500 individuals. We had 99% power to detect the lower bound of the reported effects on BMI4, yet found no association. PMID:26098870

  9. Structure of amylase-binding protein A of Streptococcus gordonii: a potential receptor for human salivary α-amylase enzyme.

    PubMed

    Sethi, Ashish; Mohanty, Biswaranjan; Ramasubbu, Narayanan; Gooley, Paul R

    2015-06-01

    Amylase-binding protein A (AbpA) of a number of oral streptococci is essential for the colonization of the dental pellicle. We have determined the solution structure of residues 24-195 of AbpA of Streptococcus gordonii and show a well-defined core of five helices in the region of 45-115 and 135-145. (13) Cα/β chemical shift and heteronuclear (15) N-{(1) H} NOE data are consistent with this fold and that the remainder of the protein is unstructured. The structure will inform future molecular experiments in defining the mechanism of human salivary α-amylase binding and biofilm formation by streptococci.

  10. Amylase and chitinase genes in Streptomyces lividans are regulated by reg1, a pleiotropic regulatory gene.

    PubMed Central

    Nguyen, J; Francou, F; Virolle, M J; Guérineau, M

    1997-01-01

    A regulatory gene, reg1, was identified in Streptomyces lividans. It encodes a 345-amino-acid protein (Reg1) which contains a helix-turn-helix DNA-binding motif in the N-terminal region. Reg1 exhibits similarity with the LacI/GalR family members over the entire sequence. It displays 95% identity with MalR (the repressor of malE in S. coelicolor), 65% identity with ORF-Sl (a putative regulatory gene of alpha-amylase of S. limosus), and 31% identity with CcpA (the carbon catabolite repressor in Bacillus subtilis). In S. lividans, the chromosomal disruption of reg1 affected the expression of several genes. The production of alpha-amylases of S. lividans and that of the alpha-amylase of S. limosus in S. lividans were enhanced in the reg1 mutant strains and relieved of carbon catabolite repression. As a result, the transcription level of the alpha-amylase of S. limosus was noticeably increased in the reg1 mutant strain. Moreover, the induction of chitinase production in S. lividans was relieved of carbon catabolite repression by glucose in the reg1 mutant strain, while the induction by chitin was lost. Therefore, reg1 can be regarded as a pleiotropic regulatory gene in S. lividans. PMID:9335287

  11. Structural relationship between the enzymatic and streptococcal binding sites of human salivary alpha-amylase.

    PubMed

    Scannapieco, F A; Bhandary, K; Ramasubbu, N; Levine, M J

    1990-12-31

    Previous studies have demonstrated that human salivary alpha-amylase specifically binds to the oral bacterium Streptococcus gordonii. This interaction is inhibited by substrates such as starch and maltotriose suggesting that bacterial binding may involve the enzymatic site of amylase. Experiments were performed to determine if amylase bound to the bacterial surface possessed enzymatic activity. It was found that over one-half of the bound amylase was enzymatically active. In addition, bacterial-bound amylase hydrolyzed starch to glucose which was then metabolized to lactic acid by the bacteria. In further studies, the role of amylase's histidine residues in streptococcal binding and enzymatic function was assessed after their selective modification with diethyl pyrocarbonate. DEP-modified amylase showed a marked reduction in both enzymatic and streptococcal binding activities. These effects were diminished when DEP modification occurred in the presence of maltotriose. DEP-modified amylase had a significantly altered secondary structure when compared with native enzyme or amylase modified in the presence of maltotriose. Collectively, these results suggest that human salivary alpha-amylase may possess multiple sites for bacterial binding and enzymatic activity which share structural similarities.

  12. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    DTIC Science & Technology

    1979-01-01

    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase secretion...as a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  13. Relationship among physiological quality, heterosis, and amylase gene expression in maize seeds.

    PubMed

    Oliveira, G E; Von Pinho, E V R; Andrade, T; Souza, J C; Caixeta, F; Ferreira, R A D C

    2015-07-31

    In this study, we analyzed heterosis, amylase enzyme gene expression, and the physiological quality of maize seeds with different genotypes and sizes, which were subjected to aging and not subjected to aging. We used seeds from 2 maize lines that differed with regard to physiological quality, the hybrid, and the reciprocal hybrid; they were classified into 2 sizes and were subjected to aging and not subjected to aging. Physiological quality was assessed by performing tests for germination, emergence, emergence speed index, and artificial aging. Expressions of the genes alpha amylase B73, alpha amylase (LOC542522), isoamylase mRNA clone 353244, and the endogenous controls ubiquitin and alcohol dehydrogenase in the seeds were studied using quantitative real-time-polymerase chain reaction. We observed heterosis for seed quality and for expression of amylase genes in the genotypes studied. We found no difference in seed quality between large and small seeds.

  14. An approach to remove alpha amylase for proteomic analysis of low abundance biomarkers in human saliva.

    PubMed

    Deutsch, Omer; Fleissig, Yoram; Zaks, Batia; Krief, Guy; Aframian, Doron J; Palmon, Aaron

    2008-11-01

    Proteomic characterization of human whole saliva for the identification of disease-specific biomarkers is guaranteed to be an easy-to-use and powerful diagnostic tool for defining the onset, progression and prognosis of human systemic diseases and, in particular, oral diseases. The high abundance of proteins, mainly alpha amylase, hampers the detection of low abundant proteins appearing in the disease state and therefore should be removed. In the present study a 2-DE was used to analyze human whole saliva following the removal of alpha amylase by affinity adsorption to potato starch. After alpha amylase removal whole saliva was analyzed by SDS-PAGE showing at least sixfold removal efficiency and by an alpha amylase activity assay showing 97% reduced activity. MS identification of the captured alpha amylase after elution demonstrated specific removal; 2-DE analysis showed the selective removal of alpha amylase and consequently increased gel resolution. MS identification of protein spots in the 60 kDa area revealed 15 proteins, which were masked before alpha amylase removal. In conclusion, treatment of human whole saliva with an alpha amylase removal device increases gel resolution and enables a higher protein sample for analysis.

  15. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  16. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G

    1991-01-01

    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  17. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  18. Screening, Gene Cloning, and Characterizations of an Acid-Stable α-Amylase.

    PubMed

    Liu, Xinyu; Jia, Wei; An, Yi; Cheng, Kun; Wang, Mingdao; Yang, Sen; Chen, Hongge

    2015-06-01

    Based on its α-amylase activity at pH 5.0 and optimal pH of the crude enzyme, a strain (named B-5) with acid α-amylase production was screened. The B-5 strain was identified as Bacillus amyloliquefaciens through morphological, physiological, and biochemical characteristics analysis, as well as 16S rDNA phylogenetic analysis. Its α-amylase gene of GenBank Accession No. GU318401 was cloned and expressed in Escherichia coli. The purified recombinant α-amylase AMY-Ba showed the optimal pH of 5.0, and was stable at a pH range of 4.0-6.0. When hydrolyzing soluble starch, amylose, and amylopectin, AMY-Ba released glucose and maltose as major end products. The α-amylase AMY-Ba in this work was a different type from the well-investigated J01542 (GenBank Accession No.)-type α-amylase from the same species. AMY-Ba exhibited notable adsorption and hydrolysis ability towards various raw starches. Structure analysis of AMY-Ba suggested the presence of a new starch-binding domain at its C-terminal region.

  19. Inhibitory effects of tannin on human salivary alpha-amylase.

    PubMed

    Kandra, Lili; Gyémánt, Gyöngyi; Zajácz, Agnes; Batta, Gyula

    2004-07-09

    Here, we first report on the effectiveness and specificity of tannin inhibition of 2-chloro-4-nitrophenyl-4-O-beta-d-galactopyranosylmaltoside hydrolysis that is catalyzed by human salivary alpha-amylase (HSA). Tannin was gallotannin in which quinic acid was esterified with 2-7 units of gallic acid. A number of studies establish that polyphenols-like tannins-may prevent oral diseases, e.g., dental caries. Kinetic analyses confirmed that the inhibition of hydrolysis is a mixed non-competitive type and only one molecule of tannin binds to the active site or the secondary site of the enzyme. Since Dixon plots were linear, product formation could be excluded from the enzyme-substrate-inhibitor complex (ESI). Kinetic constants calculated from secondary plots and non-linear regression are almost identical, thereby confirming the suggested model. Kinetic constants (K(EI) = 9.03 microgmL(-1), K(ESI) = 47.84 microgmL(-1)) show that tannin is as an effective inhibitor of HSA as acarbose and indicate a higher stability for the enzyme-inhibitor complex than ESI.

  20. Prevalence of the Amylase-Binding Protein A Gene (abpA) in Oral Streptococci

    PubMed Central

    Brown, Alan E.; Rogers, Jeffrey D.; Haase, Elaine M.; Zelasko, Peter M.; Scannapieco, Frank A.

    1999-01-01

    Salivary amylase binds specifically to a number of oral streptococcal species. This interaction may play an important role in dental plaque formation. Recently, a 585-bp gene was cloned and sequenced from Streptococcus gordonii Challis encoding a 20.5-kDa amylase-binding protein (AbpA). The goal of this study was to determine if related genes are present in other species of oral streptococci. Biotinylated abpA was used in Southern blot analysis to screen genomic DNA from several strains representing eight species of oral streptococci. This probe hybridized with a 4.0-kb HindIII restriction fragment from all 13 strains of S. gordonii tested. The probe did not appear to bind to any restriction fragments from other species of amylase-binding oral streptococci including Streptococcus mitis (with the exception of 1 of 14 strains), Streptococcus crista (3 strains), Streptococcus anginosus (1 strain), and Streptococcus parasanguinis (1 strain), or to non-amylase-binding oral streptococci including Streptococcus sanguinis (3 strains), Streptococcus oralis (4 strains), and Streptococcus mutans (1 strain). Primers homologous to sequences within the 3′ and 5′ ends of abpA yielded products of 400 bp following PCR of genomic DNA from the Southern blot-positive strains. Several of these PCR products were cloned and sequenced. The levels of similarity of these cloned products to the abpA of S. gordonii Challis ranged from 91 to 96%. These studies reveal that the abpA gene appears to be specific to S. gordonii and differs from genes encoding amylase-binding proteins from other species of amylase-binding streptococci. PMID:10565935

  1. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  2. MS characterization of multiple forms of alpha-amylase in human saliva.

    PubMed

    Hirtz, Christophe; Chevalier, François; Centeno, Delphine; Rofidal, Valerie; Egea, Jean-Christophe; Rossignol, Michel; Sommerer, Nicolas; Deville de Périère, Dominique

    2005-11-01

    Alpha-amylase is a major and well-characterized component of human saliva. Recent proteomic studies suggested that this protein could be observed in more than twenty spots on 2-D gels of salivary proteins. The aim of this work was to investigate this unexpected redundancy. 2-D gel electrophoresis was combined with systematic MALDI-TOF MS analysis. More than 140 protein spots identifying the alpha-amylase were shown to constitute a stable but very complex pattern. Careful analysis of mass spectra and simultaneous hierarchical clustering of the observed peptides and of the electrophoretic features of spots allowed one to define three major groups. A main class grouping 90 spots was shown to correspond to full length alpha-amylases that can be assumed to include isoforms and post-translationally modified forms, a subset of this class being demonstrated to be N-glycosylated. A second group included short alpha-amylases that are differently truncated in a non-random manner, very likely in the oral cavity. The last class grouped alpha-amylase forms showing both the N- and C-terminal sequences of the enzyme but displaying a molecular weight that was up to 50% lower than that of the native protein. It is speculated that the last group of alpha-amylase spots could correspond to proteins submitted to internal deletions prior to the secretion.

  3. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    PubMed Central

    Sapra, Gaurav; Vyas, Yogesh Kumar; Agarwal, Rahul; Aggarwal, Ashish; Chandrashekar, K T; Sharma, Kanika

    2013-01-01

    Background: Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice) on human salivary amylase activity and to compare it with other dentifrices. Materials and Methods: A total of 80 subjects of age 18-35 years were randomly selected and divided equally into 4 groups. Group 1 subjects were assigned to use Test Dentifrice (with S. calva root extract), while Group 2, Group 3, and Group 4 subjects were assigned to use Herbal Dentifrice (Arodent™), Synthetic Dentifrice (Colgate®), and Control Dentifrice respectively. Salivary amylase activity was determined by Bernfeld method in each group, before and after using the given dentifrices. Results: Maximum inhibition of salivary amylase activity was found in the group using test dentifrice as compared to others. Conclusion: The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations. PMID:24130585

  4. Cloning, Purification and Characterization of a Highly Thermostable Amylase Gene of Thermotoga petrophila into Escherichia coli.

    PubMed

    Zafar, Asma; Aftab, Muhammad Nauman; ud Din, Zia; Aftab, Saima; Iqbal, Irfana; ul Haq, Ikram

    2016-02-01

    A putative α-amylase gene of Thermotoga petrophila was cloned and expressed in Escherichia coli BL21 (DE3) using pET-21a (+), as an expression vector. The growth conditions were optimized for maximal expression of the α-amylase using various parameters, such as pH, temperature, time of induction and addition of an inducer. The optimum temperature and pH for the maximum expression of α-amylase were 22 °C and 7.0 pH units, respectively. Purification of the recombinant enzyme was carried out by heat treatment method, followed by ion exchange chromatography with 34.6-fold purification having specific activity of 126.31 U mg(-1) and a recovery of 56.25%. Molecular weight of the purified α-amylase, 70 kDa, was determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 100 °C temperature and at pH of 7.0. The enzyme activity was increased in the presence of metal ions especially Ca(+2) and decreased in the presence of EDTA indicating that the α-amylase was a metalloenzyme. However, addition of 1% Tween 20, Tween 80 and β-mercaptoethanol constrained the enzyme activity to 87, 96 and 89%, respectively. No considerable effect of organic solvents (ethanol, methanol, isopropanol, acetone and n-butanol) was observed on enzyme activity. With soluble starch as a substrate, the enzyme activity under optimized conditions was 73.8 U mg(-1). The α-amylase enzyme was active to hydrolyse starch forming maltose.

  5. Cell-associated alpha-amylases of butyrate-producing Firmicute bacteria from the human colon.

    PubMed

    Ramsay, Alan G; Scott, Karen P; Martin, Jenny C; Rincon, Marco T; Flint, Harry J

    2006-11-01

    Selected butyrate-producing bacteria from the human colon that are related to Roseburia spp. and Butyrivibrio fibrisolvens showed a good ability to utilize a variety of starches for growth when compared with the Gram-negative amylolytic anaerobe Bacteroides thetaiotaomicron. A major cell-associated amylase of high molecular mass (140-210 kDa) was detected in each strain by SDS-PAGE zymogram analysis, and genes corresponding to these enzymes were analysed for two representative strains. Amy13B from But. fibrisolvens 16/4 is a multi-domain enzyme of 144.6 kDa that includes a family 13 glycoside hydrolase domain, and duplicated family 26 carbohydrate-binding modules. Amy13A (182.4 kDa), from Roseburia inulinivorans A2-194, also includes a family 13 domain, which is preceded by two repeat units of approximately 116 aa rich in aromatic residues, an isoamylase N-terminal domain, a pullulanase-associated domain, and an additional unidentified domain. Both Amy13A and Amy13B have N-terminal signal peptides and C-terminal cell-wall sorting signals, including a modified LPXTG motif similar to that involved in interactions with the cell surface in other Gram-positive bacteria, a hydrophobic transmembrane segment, and a basic C terminus. The overexpressed family 13 domains showed an absolute requirement for Mg2+ or Ca2+ for activity, and functioned as 1,4-alpha-glucanohydrolases (alpha-amylases; EC 3.2.1.1). These major starch-degrading enzymes thus appear to be anchored to the cell wall in this important group of human gut bacteria.

  6. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide

    PubMed Central

    2016-01-01

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides. PMID:27066537

  7. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide.

    PubMed

    Tysoe, Christina; Williams, Leslie K; Keyzers, Robert; Nguyen, Nham T; Tarling, Chris; Wicki, Jacqueline; Goddard-Borger, Ethan D; Aguda, Adeleke H; Perry, Suzanne; Foster, Leonard J; Andersen, Raymond J; Brayer, Gary D; Withers, Stephen G

    2016-03-23

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides.

  8. Investigating the Hydrolysis of Starch Using "a"-Amylase Contained in Dishwashing Detergent and Human Saliva

    ERIC Educational Resources Information Center

    Munegumi, Toratane; Inutsuka, Masato; Hayafuji, Yukitaka

    2016-01-01

    Although saliva has commonly been used to teach about digestion by organisms, the phenomenon of digestion is actually caused by enzymes as catalytic substances. This activity explores the hydrolysis of starch by "a"-amylase in cleaning materials as well as a comparison with the similar reaction using human saliva. The fact that the…

  9. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  10. Construction of an amylolytic industrial strain of Saccharomyces cerevisiae containing the Schwanniomyces occidentalis alpha-amylase gene.

    PubMed

    Kang, Na-Young; Park, Jeong-Nam; Chin, Jong-Eon; Lee, Hwanghee Blaise; Im, Suhn-Young; Bai, Suk

    2003-11-01

    The gene encoding Schwanniomyces occidentalis alpha-amylase (AMY) was introduced into the chromosomal delta sequences of an industrial strain of Saccharomyces cerevisiae. To obtain a strain suitable for commercial use, an delta-integrative cassette devoid of bacterial DNA sequences was constructed that contains the AMY gene and aureobasidin A resistance gene (AUR1-C) as the selection marker. The AMY gene was expressed under the control of the alcohol dehydrogenase gene promoter (ADC1p). The alpha-amylase activity of Sacc. cerevisiae transformed with this integrative cassette was 6 times higher than that of Sch. occidentalis. The transformants (integrants) were mitotically stable after 100 generations in nonselective medium.

  11. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  12. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  13. Cloning and nucleotide sequence of the gene coding for enzymatically active fragments of the Bacillus polymyxa beta-amylase.

    PubMed

    Kawazu, T; Nakanishi, Y; Uozumi, N; Sasaki, T; Yamagata, H; Tsukagoshi, N; Udaka, S

    1987-04-01

    The gene encoding beta-amylase was cloned from Bacillus polymyxa 72 into Escherichia coli HB101 by inserting HindIII-generated DNA fragments into the HindIII site of pBR322. The 4.8-kilobase insert was shown to direct the synthesis of beta-amylase. A 1.8-kilobase AccI-AccI fragment of the donor strain DNA was sufficient for the beta-amylase synthesis. Homologous DNA was found by Southern blot analysis to be present only in B. polymyxa 72 and not in other bacteria such as E. coli or B. subtilis. B. polymyxa, as well as E. coli harboring the cloned DNA, was found to produce enzymatically active fragments of beta-amylases (70,000, 56,000, or 58,000, and 42,000 daltons), which were detected in situ by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Nucleotide sequence analysis of the cloned 3.1-kilobase DNA revealed that it contains one open reading frame of 2,808 nucleotides without a translational stop codon. The deduced amino acid sequence for these 2,808 nucleotides encoding a secretory precursor of the beta-amylase protein is 936 amino acids including a signal peptide of 33 or 35 residues at its amino-terminal end. The existence of a beta-amylase of larger than 100,000 daltons, which was predicted on the basis of the results of nucleotide sequence analysis of the gene, was confirmed by examining culture supernatants after various cultivation periods. It existed only transiently during cultivation, but the multiform beta-amylases described above existed for a long time. The large beta-amylase (approximately 160,000 daltons) existed for longer in the presence of a protease inhibitor such as chymostatin, suggesting that proteolytic cleavage is the cause of the formation of multiform beta-amylases.

  14. Efficient synthesis and secretion of a thermophilic alpha-amylase by protein-producing Bacillus brevis 47 carrying the Bacillus stearothermophilus amylase gene.

    PubMed Central

    Tsukagoshi, N; Iritani, S; Sasaki, T; Takemura, T; Ihara, H; Idota, Y; Yamagata, H; Udaka, S

    1985-01-01

    Bacillus subtilis and Bacillus brevis 47-5, carrying the Bacillus stearothermophilus alpha-amylase gene on pUB110 (pBAM101), synthesized the same alpha-amylase as the donor strain as determined by the enzyme's thermal stability and NH2-terminal amino acid sequence. Regardless of the host, the 34-amino acid signal peptide of the enzyme was processed at exactly the same site between two alanine residues. B. brevis 47-5(pBAM101) secreted the enzyme most efficiently of the hosts examined, 100, 15, and 5 times more than B. stearothermophilus, Escherichia coli HB101(pH1301), and B. subtilis 1A289(pBAM101), respectively. The efficient secretion of the enzyme in B. brevis 47-5(pBAM101) was suggested to be due to the unique properties of the cell wall of this organism. Images PMID:2999073

  15. Interaction mechanism between green tea extract and human α-amylase for reducing starch digestion.

    PubMed

    Miao, Ming; Jiang, Bo; Jiang, Huan; Zhang, Tao; Li, Xingfeng

    2015-11-01

    This study evaluated the inhibitory effects of the green tea extract on human pancreatic α-amylase activity and its molecular mechanism. The green tea extract was composed of epicatechin (59.2%), epigallocatechin gallate (14.6%) and epicatechin gallate (26.2%) as determined by HPLC analysis. Enzyme activity measurement showed that % inhibition and IC50 of the green tea extract (10%, based on starch) were 63.5% and 2.07 mg/ml, respectively. The Michaelis-Menten constant remained unchanged but the maximal velocity decreased from 0.43 (control) to 0.07 mg/(ml × min) (4 mg/ml of the green tea extract), indicating that the green tea extract was an effective inhibitor against α-amylase with a non-competitive mode. The fluorescence data revealed that the green tea extract bound with α-amylase to form a new complex with static quenching mechanism. Docking study showed the epicatechin gallate in the green tea extract presented stronger affinity than epigallocatechin gallate, with more number of amino acid residues involved in amylase binding with hydrogen bonds and Van der Waals forces. Thus, the green tea extract could be used to manipulate starch digestion for potential health benefits.

  16. Metabolism of glycosylated human salivary amylase: in vivo plasma clearance by rat hepatic endothelial cells and in vitro receptor mediated pinocytosis by rat macrophages

    SciTech Connect

    Niesen, T.E.; Alpers, D.H.; Stahl, P.D.; Rosenblum, J.L.

    1984-09-01

    Salivary-type amylase normally comprises about 60% of the amylase activity in human serum, but only a small fraction is a glycosylated isoenzyme (amylase A). In contrast, 1/3 of amylase in human saliva is glycosylated. Since glycosylation can affect circulatory clearance, we studied the clearance of amylase A in rats and its uptake by rat alveolar macrophages. Following intravenous injection, /sup 125/I-labeled amylase A disappeared rapidly from plasma (t 1/2 . 9 min) and accumulated in the liver. Simultaneous injection of mannose-albumin slowed its clearance to a rate comparable to that of /sup 125/I-labeled nonglycosylated salivary amylase (t 1/2 . 45 min). In contrast, galactose-albumin had no effect. Electron microscope autoradiography of the liver following injection of /sup 125/I-labeled amylase A revealed a localization of grains over the hepatic endothelial cells. In vitro studies indicated that amylase A is taken up by alveolar macrophages via receptor-mediated pinocytosis. Uptake was linear over time, saturable, and inhibited by mannan and mannose-albumin, but not by galactose-albumin. We conclude that amylase A, which is a naturally occurring human glycoprotein with at most three terminal L-fucose residues per molecule, is recognized in rats by a mannose receptor located on hepatic endothelial cells. We speculate that this receptor, by rapidly clearing circulating amylase A, may be responsible for the low level of amylase A in human serum.

  17. The Interaction of Genetic and Environmental Factors in the Control of Amylase Gene Expression in DROSOPHILA MELANOGASTER

    PubMed Central

    Benkel, Bernhard F.; Hickey, Donal A.

    1986-01-01

    A number of previous studies have established that amylase activity can vary between Drosophila strains which are maintained under identical laboratory conditions. In addition, we have recently shown that all strains examined so far are subject to glucose repression of amylase activity. In this study, we show that the degree of glucose repression can vary between strains. Moreover, the glucose repression effect is much more pronounced in larvae than in adult flies. Our results lead to the conclusion that the strain-specific differences in activity and the dietary effects are not independent phenomena. These results have implications for the interpretation of many studies on amylase activity variation, including those experiments which have been designed to link amylase activity variations with fitness differences in nature. A question that naturally arises concerns the molecular basis for these strain-specific variations in the degree of glucose repression of this eukaryotic gene. PMID:17246356

  18. Cloning, enhanced expression and characterization of an α-amylase gene from a wild strain in B. subtilis WB800.

    PubMed

    Chen, Jing; Chen, Xianghua; Dai, Jun; Xie, Guangrong; Yan, Luying; Lu, Lina; Chen, Jianhua

    2015-09-01

    A Bacillus strain with high productivity of α-amylase isolated from a starch farm was identified as Bacillus amyloliquefaciens. The α-amylase encoding gene amy1 was cloned into pMD18-T vector and amplified in E. coli DH5α. Shuttle vector pP43MNX was reconstructed to obtain vector pP43X for heterologous expression of the α-amylase in B. subtilis WB800. Recombinant enzyme was sufficiently purified by precipitation, gel filtration and anion exchange with a specific activity of 5566 U/mg. The α-amylase sequence contains an open reading frame of 1545 bp, which encodes a protein of 514 amino acid residues with a predicted molecular mass of 58.4 kDa. The enzyme exhibited maximal activity at pH 6.0 and 60 °C. Catalytic efficiency of the recombinant α-amylase was inhibited by Hg(2+), Pb(2+) and Cu(2+), but stimulated by Li(+), Mn(2+) and Ca(2+). The purified enzyme showed decreased activity toward detergents (SDS, Tween 20 and Triton X-100). Compared with production by the wild strain, there was a 1.48-fold increase in the productivity of α-amylase in recombinant B. subtilis WB800.

  19. α-Amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits α-amylases from the coffee berry borer pest

    PubMed Central

    2010-01-01

    Background Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei), is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an α-amylase inhibitor gene (α-AI1), which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. Results We transformed C. arabica with the α-amylase inhibitor-1 gene (α-AI1) from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L). The presence of the α-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against α-AI1 inhibitor showed a maximum α-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the α-AI1 protein against H. hampei α-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. Conclusions This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee. PMID:20565807

  20. Amylase - urine

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003607.htm Amylase - urine To use the sharing features on this ... is a test that measures the amount of amylase in urine. Amylase is an enzyme that helps ...

  1. Synthesis and processing in Escherichia coli of human leucocyte interferon fused with the signal sequence of Bacillus amyloliquefaciens a-amylase

    SciTech Connect

    Sorokin, A.V.; Avakov, A.S.; Bogush, V.G.; Kostrov, S.V.; Gaiga, G.Z.; Iomantas, Yu.V.; Abalakina, E.G.; Stepanov, A.I.; Strongin, A.Ya.; Kozlov, Yu.I.; Debabov, V.G.

    1985-11-01

    Earlier, the authors reported cloning of the alpha-amylase gene of B. amyloliquefaciens in B. subtilis and E. coli. Currently, the authors report results on the expression of the hybrid gene consisting of the DNA fragment coding for the leader part of B. amyloliquefaciens alpha-amylase and the structural part of the human interferon alpha-2 in E. coli cells. This gene contains an additional methionine codon at the 5'-terminal, which codes for the interferon structure (without its own signal peptide). The interferon gene was inserted into plasmid /sub p/TG 278 at the cleavage site of EcoRI. The structure of the plasmid thus obtained the signal peptide of amylase, five amino acids (Val-Gly-Glu-Phe-Met), and the structural part of the interferon. The E. coli C600 cells carrying plasmid pTGA6 were used to study interferon secretions. The interferon activity was determined radioimmunologically with the use of monoclonal anti-bodies NK2.

  2. Improved α-amylase production by Aspergillus oryzae after a double deletion of genes involved in carbon catabolite repression.

    PubMed

    Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2014-01-01

    In filamentous fungi, the expression of secretory glycoside hydrolase encoding genes, such as those for amylases, cellulases, and xylanases, is generally repressed in the presence of glucose. CreA and CreB have been observed to be regulating factors for carbon catabolite repression. In this study, we generated single and double deletion creA and/or creB mutants in Aspergillus oryzae. The α-amylase activities of each strain were compared under various culture conditions. For the wild-type strain, mRNA levels of α-amylase were markedly decreased in the later stage of submerged culture under inducing conditions, whereas this reduced expression was not observed for single creA and double creA/creB deletion mutants. In addition, α-amylase activity of the wild-type strain was reduced in submerged culture containing high concentrations of inducing sugars, whereas all constructed mutants showed higher α-amylase activities. In particular, the α-amylase activity of the double deletion mutant in a medium containing 5% starch was >10-fold higher than that of the wild-type strain under the same culture conditions. In solid-state cultures using wheat bran as a substrate, the α-amylase activities of single creA and double deletion mutants were >2-fold higher than that of the wild-type strain. These results suggested that deleting both creA and creB resulted in dramatic improvements in the production of secretory glycoside hydrolases in filamentous fungi.

  3. Codon Optimization Significantly Improves the Expression Level of α -Amylase Gene from Bacillus licheniformis in Pichia pastoris.

    PubMed

    Wang, Jian-Rong; Li, Yang-Yuan; Liu, Dan-Ni; Liu, Jing-Shan; Li, Peng; Chen, Li-Zhi; Xu, Shu-De

    2015-01-01

    α-Amylase as an important industrial enzyme has been widely used in starch processing, detergent, and paper industries. To improve expression efficiency of recombinant α-amylase from Bacillus licheniformis (B. licheniformis), the α-amylase gene from B. licheniformis was optimized according to the codon usage of Pichia pastoris (P. pastoris) and expressed in P. pastoris. Totally, the codons encoding 305 amino acids were optimized in which a total of 328 nucleotides were changed and the G+C content was increased from 47.6 to 49.2%. The recombinants were cultured in 96-deep-well microplates and screened by a new plate assay method. Compared with the wild-type gene, the optimized gene is expressed at a significantly higher level in P. pastoris after methanol induction for 168 h in 5- and 50-L bioreactor with the maximum activity of 8100 and 11000 U/mL, which was 2.31- and 2.62-fold higher than that by wild-type gene. The improved expression level makes the enzyme a good candidate for α-amylase production in industrial use.

  4. Gene cloning and characterization of a thermostable organic-tolerant α-amylase from Bacillus subtilis DR8806.

    PubMed

    Emtenani, Shamsi; Asoodeh, Ahmad; Emtenani, Shirin

    2015-01-01

    The gene encoding an extracellular α-amylase from Bacillus subtilis DR8806 was cloned into pET28a(+) vector and expressed in Escherichia coli BL21 (DE3). The recombinant enzyme with molecular mass of 76 kDa exhibited optimal activity at pH 5.0 and 70 °C with high stability in pH and temperature ranges of 4.0-9.0 and 45-75 °C. The enzyme showed a half-life of 125 min at 70 °C. The α-amylase activity enhanced in the presence of Na(+), K(+), and Ca(2+) ions, while Zn(2+), Pb(2+), and Hg(2+) ions inhibited the activity. The recombinant α-amylase exhibited high stability towards ioninc detergents sodium dodecyl sulfate (SDS) and cetyl trimethylammonium bromide (CTAB). Organic solvents in reaction media increased the α-amylase activity. TLC analysis showed that maltoriose and maltose were the major end products of enzymatic starch hydrolysis. Presenting various properties of recombinant α-amylase makes it well suited as a potential candidate for industrial usages.

  5. Ligase-independent cloning of amylase gene from a local Bacillus subtilis isolate and biochemical characterization of the purified enzyme.

    PubMed

    Tuzlakoglu Ozturk, Merve; Akbulut, Nagihan; Issever Ozturk, Saliha; Gumusel, Fusun

    2013-09-01

    Five hundred ninety-seven bacterial isolates from Turkish hot spring water sources were screened for their ability to produce extracellular α-amylase. Among them, a high enzyme-producing Bacillus subtilis isolate, A28, was selected, and its α-amylase gene was cloned and expressed in Escherichia coli by a ligase-independent method. α-Amylase from the recombinant strain was purified to homogeneity by Q-Sepharose anion exchange and Sephacryl S-100 gel filtration chromatographies. The final yield of the enzyme was about 22.5 % of the initial activity, with a 16.4-fold increase in specific activity compared with the culture lysate. The optimum temperature and pH of the enzyme were 70 °C and 6.0, respectively. The enzyme was highly active at acidic-neutral pH range of 4.5-7.0. The amy28 α-amylase retained 100 % of its activity after incubation at 50 °C for 90 min. Co(+2), Cu(2+), Fe(2+), Fe(3+), Ni(+2), and Zn(+2) caused significant inhibition in enzyme activity, which was not affected by Na(+), Mg(2+), Li(+), and Ba(2+). The activity was inhibited about 70 % upon treatment of the enzyme with 10 mM ethylenediaminetetraacetic acid. However, Ca(2+) ions known as high temperature stabilizer for other amylases did not stimulate the activity of the enzyme. Due to pH stability and thermostability of the recombinant amylase, this enzyme may be suitable in starch processing, brewing, and food industries.

  6. Glucosyl epi-cyclophellitol allows mechanism-based inactivation and structural analysis of human pancreatic α-amylase.

    PubMed

    Caner, Sami; Zhang, Xiaohua; Jiang, Jianbing; Chen, Hong-Ming; Nguyen, Nham T; Overkleeft, Hermen; Brayer, Gary D; Withers, Stephen G

    2016-04-01

    As part of a search for selective, mechanism-based covalent inhibitors of human pancreatic α-amylase we describe the chemoenzymatic synthesis of the disaccharide analog α-glucosyl epi-cyclophellitol, demonstrate its stoichiometric reaction with human pancreatic α-amylase and evaluate the time dependence of its inhibition. X-ray crystallographic analysis of the covalent derivative so formed confirms its reaction at the active site with formation of a covalent bond to the catalytic nucleophile D197. The structure illuminates the interactions with the active site and confirms OH4' on the nonreducing end sugar as a good site for attachment of fluorescent tags in generating probes for localization and quantitation of amylase in vivo.

  7. Characterization and gene cloning of a maltotriose-forming exo-amylase from Kitasatospora sp. MK-1785.

    PubMed

    Kamon, Masahiro; Sumitani, Jun-Ichi; Tani, Shuji; Kawaguchi, Takashi; Kamon, M; Sumitani, J; Tani, S; Kawaguchi, T

    2015-06-01

    A maltotriose-forming amylase (G3Amy) from Kitasatospora sp. MK-1785 was successfully isolated from a soil sample by inhibiting typical extracellular α-amylases using a proteinaceous α-amylase inhibitor. G3Amy was purified from the MK-1785 culture supernatant and characterized. G3Amy produced maltotriose as the principal product from starch and was categorized as an exo-α-amylase. G3Amy could also transfer maltotriose to phenolic and alcoholic compounds. Therefore, G3Amy can be useful for not only maltotriose manufacture but also maltooligosaccharide-glycoside synthesis. Further, the G3Amy gene was cloned and expressed in Escherichia coli cells. Analysis of its deduced amino acid sequence revealed that G3Amy consisted of an N-terminal GH13 catalytic domain and two C-terminal repeat starch-binding domains belonging to CBM20. It is suggested that natural G3Amy was subjected to proteolysis at N-terminal region of the anterior CBM20 in the C-terminal region. As with natural G3Amy, recombinant G3Amy could produce and transfer maltotriose from starch.

  8. Stability of human α-salivary amylase in aged forensic samples.

    PubMed

    Carboni, Ilaria; Rapi, Stefano; Ricci, Ugo

    2014-07-01

    The unequivocal tissue identification in forensic casework samples is a key step for crime scene reconstruction. Just knowing the origin of a fluid can sometimes be enough to either prove or disprove a fact in court. Despite the importance of this test, very few data are available in literature concerning human saliva identification in old forensic caseworks. In this work the stability of human α-amylase activity in aged samples is described by using three different methods integrated with DNA profiling techniques. This analytical protocol was successfully applied on 26-years old samples coming from anonymous threat letters sent to prosecutors who were working on "the Monster of Florence", a case of serial murders happened around Florence (Italy) between 1968 and 1985.

  9. Amylase Test

    MedlinePlus

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  10. Amylase - blood

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003464.htm Amylase - blood To use the sharing features on this page, please enable JavaScript. Amylase is an enzyme that helps digest carbohydrates. It ...

  11. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  12. Comparative and evolutionary analysis of α-amylase gene across monocots and dicots.

    PubMed

    Sethi, Sorabh; Saini, Johar S; Mohan, Amita; Brar, Navreet K; Verma, Shabda; Sarao, Navraj K; Gill, Kulvinder S

    2016-09-01

    α-amylase is an important enzyme involved in starch degradation to provide energy to the germinating seedling. The present study was conducted to reveal structural and functional evolution of this gene among higher plants. Discounting polyploidy, most plant species showed only a single copy of the gene making multiple isoforms in different tissues and developmental stages. Genomic length of the gene ranged from 1472 bp in wheat to 2369 bp in soybean, and the size variation was mainly due to differences in the number and size of introns. In spite of this variation, the intron phase distribution and insertion sites were mostly conserved. The predicted protein size ranged from 414 amino acid (aa) in soybean to 449aa in Brachypodium. Overall, the protein sequence similarity among orthologs ranged from 56.4 to 97.4 %. Key motifs and domains along with their relative distances were conserved among plants although several species, genera, and class specific motifs were identified. The glycosyl hydrolase superfamily domain length varied from 342aa in soybean to 384aa in maize and sorghum while length of the C-terminal β-sheet domain was highly conserved with 61aa in all monocots and Arabidopsis but was 59aa in soybean and Medicago. Compared to rice, 3D structure of the proteins showed 89.8 to 91.3 % similarity among the monocots and 72.7 to 75.8 % among the dicots. Sequence and relative location of the five key aa required for the ligand binding were highly conserved in all species except rice.

  13. The structure of human pancreatic alpha-amylase at 1.8 A resolution and comparisons with related enzymes.

    PubMed

    Brayer, G D; Luo, Y; Withers, S G

    1995-09-01

    The structure of human pancreatic alpha-amylase has been determined to 1.8 A resolution using X-ray diffraction techniques. This enzyme is found to be composed of three structural domains. The largest is Domain A (residues 1-99, 169-404), which forms a central eight-stranded parallel beta-barrel, to one end of which are located the active site residues Asp 197, Glu 233, and Asp 300. Also found in this vicinity is a bound chloride ion that forms ligand interactions to Arg 195, Asn 298, and Arg 337. Domain B is the smallest (residues 100-168) and serves to form a calcium binding site against the wall of the beta-barrel of Domain A. Protein groups making ligand interactions to this calcium include Asn 100, Arg 158, Asp 167, and His 201. Domain C (residues 405-496) is made up of anti-parallel beta-structure and is only loosely associated with Domains A and B. It is notable that the N-terminal glutamine residue of human pancreatic alpha-amylase undergoes a posttranslational modification to form a stable pyrrolidone derivative that may provide protection against other digestive enzymes. Structure-based comparisons of human pancreatic alpha-amylase with functionally related enzymes serve to emphasize three points. Firstly, despite this approach facilitating primary sequence alignments with respect to the numerous insertions and deletions present, overall there is only approximately 15% sequence homology between the mammalian and fungal alpha-amylases. Secondly, in contrast, these same studies indicate that significant structural homology is present and of the order of approximately 70%. Thirdly, the positioning of Domain C can vary considerably between alpha-amylases. In terms of the more closely related porcine enzyme, there are four regions of polypeptide chain (residues 237-250, 304-310, 346-354, and 458-461) with significantly different conformations from those in human pancreatic alpha-amylase. At least two of these could play a role in observed differential

  14. Lactase persistence and augmented salivary alpha-amylase gene copy numbers might have been selected by the combined toxic effects of gluten and (food born) pathogens.

    PubMed

    Pruimboom, Leo; Fox, Tom; Muskiet, Frits A J

    2014-03-01

    Various positively selected adaptations to new nutrients have been identified. Lactase persistence is among the best known, conferring the ability for drinking milk at post weaning age. An augmented number of amylase gene (AMY1) copies, giving rise to higher salivary amylase activity, has been implicated in the consumption of starch-rich foods. Higher AMY1 copy numbers have been demonstrated in populations with recent histories of starchy-rich diets. It is however questionable whether the resulting polymorphisms have exerted positive selection only by providing easily available sources of macro and micronutrients. Humans have explored new environments more than any other animal. Novel environments challenge the host, but especially its immune system with new climatic conditions, food and especially pathogens. With the advent of the agricultural revolution and the concurrent domestication of cattle came new pathogens. We contend that specific new food ingredients (e.g., gluten) and novel pathogens drove selection for lactase persistence and higher AMY gene copy numbers. Both adaptations provide ample glucose for activating the sodium glucose-dependent co-transporter 1 (SGLT1), which is the principal glucose, sodium and water transporter in the gastro-intestinal tract. Their rapid uptake confers protection against potentially lethal dehydration, hyponatremia and ultimately multiple organ failure. Oral rehydration therapy aims at SGLT1 activity and is the current treatment of choice for chronic diarrhoea and vomiting. We hypothesize that lifelong lactase activity and rapid starch digestion should be looked at as the evolutionary covalent of oral rehydration therapy.

  15. Oral Fusobacterium nucleatum subsp. polymorphum binds to human salivary α-amylase.

    PubMed

    Zulfiqar, M; Yamaguchi, T; Sato, S; Oho, T

    2013-12-01

    Fusobacterium nucleatum acts as an intermediate between early and late colonizers in the oral cavity. In this study, we showed that F. nucleatum subsp. polymorphum can bind to a salivary component with a molecular weight of approximately 110 kDa and identified the protein and another major factor of 55 kDa, as salivary α-amylase by time-of-flight mass spectrometry and immuno-reactions. Salivary α-amylase is present in both monomeric and dimeric forms and we found that formation of the dimer depends on copper ions. The F. nucleatum adhered to both monomeric and dimeric salivary α-amylases, but the numbers of bacteria bound to the dimeric form were more than those bound to the monomeric form. The degree of adherence of F. nucleatum to four α-amylases from different sources was almost the same, however its binding to β-amylase was considerably decreased. Among four α-amylase inhibitors tested, acarbose and type 1 and 3 inhibitors derived from wheat flour showed significant activity against the adhesion of F.nucleatum to monomeric and dimeric amylases, however voglibose had little effect. Moreover F. nucleatum cells inhibited the enzymatic activity of salivary α-amylase in a dose-dependent manner. These results suggest that F. nucleatum plays more important and positive role as an early colonizer for maturation of oral microbial colonization.

  16. Very stable high molecular mass multiprotein complex with DNase and amylase activities in human milk.

    PubMed

    Soboleva, Svetlana E; Dmitrenok, Pavel S; Verkhovod, Timofey D; Buneva, Valentina N; Sedykh, Sergey E; Nevinsky, Georgy A

    2015-01-01

    For breastfed infants, human milk is more than a source of nutrients; it furnishes a wide array of proteins, peptides, antibodies, and other components promoting neonatal growth and protecting infants from viral and bacterial infection. It has been proposed that most biological processes are performed by protein complexes. Therefore, identification and characterization of human milk components including protein complexes is important for understanding the function of milk. Using gel filtration, we have purified a stable high molecular mass (~1000 kDa) multiprotein complex (SPC) from 15 preparations of human milk. Light scattering and gel filtration showed that the SPC was stable in the presence of high concentrations of NaCl and MgCl2 but dissociated efficiently under the conditions that destroy immunocomplexes (2 M MgCl2 , 0.5 M NaCl, and 10 mM DTT). Such a stable complex is unlikely to be a casual associate of different proteins. The relative content of the individual SPCs varied from 6% to 25% of the total milk protein. According to electrophoretic and mass spectrometry analysis, all 15 SPCs contained lactoferrin (LF) and α-lactalbumin as major proteins, whereas human milk albumin and β-casein were present in moderate or minor amounts; a different content of IgGs and sIgAs was observed. All SPCs efficiently hydrolyzed Plasmid supercoiled DNA and maltoheptaose. Some freshly prepared SPC preparations contained not only intact LF but also small amounts of its fragments, which appeared in all SPCs during their prolonged storage; the fragments, similar to intact LF, possessed DNase and amylase activities. LF is found in human epithelial secretions, barrier body fluids, and in the secondary granules of leukocytes. LF is a protein of the acute phase response and nonspecific defense against different types of microbial and viral infections. Therefore, LF complexes with other proteins may be important for its functions not only in human milk.

  17. Gedunin and Azadiradione: Human Pancreatic Alpha-Amylase Inhibiting Limonoids from Neem (Azadirachta indica) as Anti-Diabetic Agents

    PubMed Central

    Zinjarde, Smita; Thulasiram, Hirekodathakallu; RaviKumar, Ameeta

    2015-01-01

    Human pancreatic α-amylase (HPA) inhibitors offer an effective strategy to lower postprandial hyperglycemia via control of starch breakdown. Limonoids from Azadirachta indica known for their therapeutic potential were screened for pancreatic α-amylase inhibition, a known anti-diabetic target. Studies were carried out to reveal their mode of action so as to justify their hypoglycemic potential. Of the nine limonoids isolated/semi-synthesized from A.indica and screened for α-amylase inhibition, azadiradione and exhibited potential inhibition with an IC50 value of 74.17 and 68.38 μM, respectively against HPA under in vitro conditions. Further screening on AR42J α-amylase secretory cell line for cytotoxicity and bioactivity revealed that azadiradione and gedunin exhibited cytotoxicity with IC50 of 11.1 and 13.4μM. Maximal secreted α-amylase inhibition of 41.8% and 53.4% was seen at 3.5 and 3.3μM, respectively. Michaelis-Menten kinetics suggested a mixed mode of inhibition with maltopentaose (Ki 42.2, 18.6 μM) and starch (Ki′ 75.8, 37.4 μM) as substrate with a stiochiometry of 1:1 for both azadiradione and gedunin, respectively. The molecular docking simulation indicated plausible π-alkyl and alkyl-alkyl interactions between the aromatic amino acids and inhibitors. Fluorescence and CD confirmed the involvement of tryptophan and tyrosine in ligand binding to HPA. Thermodynamic parameters suggested that binding is enthalpically and entropically driven with ΔG° of -21.25 kJ mol-1 and -21.16 kJ mol-1 for azadiradione and gedunin, respectively. Thus, the limonoids azadiradione and gedunin could bind and inactivate HPA (anti-diabetic target) and may prove to be lead drug candidates to reduce/control post-prandial hyperglycemia. PMID:26469405

  18. The sensitivity and specificity of the RSID-saliva kit for the detection of human salivary amylase in the Forensic Science Laboratory, Dublin, Ireland.

    PubMed

    Casey, David G; Price, Judy

    2010-01-30

    We demonstrate here that the RSID-saliva test can be used as a test for human salivary alpha-amylase on samples routinely examined in forensic casework. We show that the RSID-saliva test detects salivary alpha-amylase at lower concentrations than the Phadebas Quantitative test, that the RSID-saliva test does not cross-react with forensically important human fluids and that the RSID-saliva test can be successfully integrated into the whole swab semen extraction method.

  19. Construction of a Shuttle Vector for Heterologous Expression of a Novel Fungal α-Amylase Gene in Aspergillus oryzae.

    PubMed

    Yin, Yanchen; Mao, Youzhi; Yin, Xiaolie; Gao, Bei; Wei, Dongzhi

    2015-07-01

    The filamentous fungus Aspergillus oryzae is a well-known expression host used to express homologous and heterologous proteins in a number of industrial applications. To facilitate higher yields of proteins of interest, we constructed the pAsOP vector to express heterologous proteins in A. oryzae. pAsOP carries a selectable marker, pyrG, derived from Aspergillus nidulans, and a strong promoter and a terminator of the amyB gene derived from A. oryzae. pAsOP transformed A. oryzae efficiently via the PEG-CaCl2-mediated transformation method. As proof of concept, green fluorescent protein (GFP) was successfully expressed in A. oryzae transformed by pAsOP-GFP. Additionally, we identified a novel fungal α-amylase (PcAmy) gene from Penicillium sp. and cloned the gene into the vector. After transformation by pAsOPPcAmy, the α-amylase PcAmy from Penicillium sp. was successfully expressed in a heterologous host system for the first time. The α-amylase activity in the A. oryzae transformant was increased by 62.3% compared with the untransformed A. oryzae control. The PcAmy protein produced in the system had an optimum pH of 5.0 and optimum temperature of 30°C. As a cold-adapted enzyme, PcAmy shows potential value in industrial applications because of its high catalytic activity at low temperature. Furthermore, the expression vector reported in this study provides promising utility for further scientific research and biotechnological applications.

  20. Induction of Expression of Genes Coding for Sporamin and β-Amylase by Polygalacturonic Acid in Leaf-Petiole Cuttings of Sweet Potato 1

    PubMed Central

    Ohto, Masa-aki; Nakamura-Kito, Kyoko; Nakamura, Kenzo

    1992-01-01

    Sporamin and β-amylase are two major proteins of tuberous storage root of sweet potato (Ipomoea batatas) and their accumulation can be induced concomitantly with the accumulation of starch in leaves and petioles by sucrose (K Nakamura, M Ohto, N Yoshida, K Nakamura [1991] Plant Physiol 96: 902-909). Although mechanical wounding of leaves of sweet potato only occasionally induced the expression of sporamin and β-amylase genes, their expression could be reproducibly induced in leaf-petiole cuttings when these explants were dipped in a solution of polygalacturonic acid or chitosan at their cut edges. Polygalacturonic acid seemed to induce expression of the same genes coding for sporamin and β-amylase that are induced by sucrose. Because polygalacturonic acid and chitosan are known to mediate the induction of wound-inducible defense reactions, these results raise an interesting possibility that β-amylase, in addition to sporamin, may have some role in the defense reaction. Expression of sporamin and β-amylase genes could also be induced by abscisic acid, and this induction by abscisic acid, as well as induction by polygalacturonic acid or sucrose, was repressed by gibberellic acid. By contrast, methyl jasmonate did not cause the significant induction of either sporamin or β-amylase mRNAs. Induction of expression of sporamin and β-amylase genes by polygalacturonic acid or sucrose was inhibited by cycloheximide, suggesting that de novo synthesis of proteins is required for both of the induction processes. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5 PMID:16668901

  1. Human gene therapy.

    PubMed

    Sandhu, J S; Keating, A; Hozumi, N

    1997-01-01

    Human gene therapy and its application for the treatment of human genetic disorders, such as cystic fibrosis, cancer, and other diseases, are discussed. Gene therapy is a technique in which a functioning gene is inserted into a human cell to correct a genetic error or to introduce a new function to the cell. Many methods, including retroviral vectors and non-viral vectors, have been developed for both ex vivo and in vivo gene transfer into cells. Vectors need to be developed that efficiently transfer genes to target cells, and promoter systems are required that regulate gene expression according to physiologic needs of the host cell. There are several safety and ethical issues related to manipulating the human genome that need to be resolved. Current gene therapy efforts focus on gene insertion into somatic cells only. Gene therapy has potential for the effective treatment of genetic disorders, and gene transfer techniques are being used for basic research, for example, in cancer, to examine the underlying mechanism of disease. There are still many technical obstacles to be overcome before human gene therapy can become a routine procedure. The current human genome project provides the sequences of a vast number of human genes, leading to the identification, characterization, and understanding of genes that are responsible for many human diseases.

  2. Simple ITC method for activity and inhibition studies on human salivary α-amylase.

    PubMed

    Lehoczki, Gábor; Szabó, Kármen; Takács, István; Kandra, Lili; Gyémánt, Gyöngyi

    2016-12-01

    Isothermal titration calorimetry (ITC) has an increasing significance in enzyme kinetic studies owing to its general applicability and sensitivity. In the present work, we aimed at developing a simple ITC-based screening procedure for the measurement of human salivary α-amylase (HSA) activity. Reaction of two substrates was studied with three independent methods (ITC, HPLC and spectrophotometry). ITC experiments were made using free and chromophore-containing maltooligomers of different length as substrates. Detailed studies revealed that maltoheptaose or longer oligomers could model properly starch and the presence of aromatic chromophore group did not affect the KM values considerably. It is the first time, when ITC was used to investigate of HSA-catalysed hydrolysis of different substrates (2-chloro-4-nitrophenyl-4-O-α-D-galactopyranosyl-maltoside, maltoheptaose and starch) in the presence of acarbose inhibitor. All measured IC50 values are in micromolar range (0.9, 18.6 and 29.0 μM, respectively) and increased in parallel with the degree of polymerisation of substrates.

  3. Establishing the catalytic mechanism of human pancreatic α-amylase with QM/MM methods.

    PubMed

    Pinto, Gaspar P; Brás, Natércia F; Perez, Marta A S; Fernandes, Pedro A; Russo, Nino; Ramos, Maria J; Toscano, Marirosa

    2015-06-09

    In this work, we studied the catalytic mechanism of human pancreatic α-amylase (HPA). Our goal was to determine the catalytic mechanism of HPA with atomic detail using computational methods. We demonstrated that the HPA catalytic mechanism consists of two steps, the first of which (glycosylation step) involves breaking the glycosidic bond to culminate in the formation of a covalent intermediate. The second (deglycosylation step) consists of the addition of a water molecule to release the enzyme/substrate covalent intermediate, completing the hydrolysis of the sugar. The active site was very open to the solvent. Our mechanism basically differs from the previously proposed mechanism by having two water molecules instead of only one near the active site that participate in the mechanism. We also demonstrate the relevant role of the three catalytic amino acids, two aspartate residues and a glutamate (D197, E233, and D300), during catalysis. It was also shown that the rate limiting step was glycosylation, and its activation energy was in agreement with experimental values obtained for HPA. The experimental activation energy was 14.4 kcal mol(-1), and the activation energy obtained computationally was 15.1 kcal mol(-1).

  4. Inhibition of human salivary alpha-amylase by glucopyranosylidene-spiro-thiohydantoin.

    PubMed

    Gyémánt, Gyöngyi; Kandra, Lili; Nagy, Veronika; Somsák, László

    2003-12-12

    This study is the first report on the effectiveness and specificity of glucopyranosylidene-spiro-thiohydantoin (G-TH) inhibitor on the 2-chloro-4-nitrophenyl-4-O-beta-D-galactopyranosyl-maltoside (GalG(2)CNP) hydrolysis catalysed by human salivary alpha-amylase (HSA). The inhibition of hydrolysis is a mixed-noncompetitive type. In any case, only one molecule of inhibitor binds to HSA. Since our substrate and inhibitor are small molecules the long enough active site facilitates accommodating both of them simultaneously. However, the product formation can be excluded from enzyme-substrate-inhibitor complex (ESI) since Dixon plots are linear. Kinetic constants calculated from secondary plots and nonlinear regression are almost entirely equal, confirming the fidelity of the suggested model. Kinetic constants (K(1i)=7.3mM, L(1i)=2.84 mM) show that G-TH is not such a potent inhibitor of HSA as acarbose and indicate higher stability for ESI than for enzyme-inhibitor complex.

  5. Gene cloning, heterologous expression, and characterization of a high maltose-producing α-amylase of Rhizopus oryzae.

    PubMed

    Li, Song; Zuo, Zhirui; Niu, Dandan; Singh, Suren; Permaul, Kugenthiren; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-07-01

    A putative α-amylase gene, designated as RoAmy, was cloned from Rhizopus oryzae. The deduced amino acid sequence showed the highest (42.8%) similarity to the α-amylase from Trichoderma viride. The RoAmy gene was successfully expressed in Pichia pastoris GS115 under the induction of methanol. The molecular weight of the purified RoAmy determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis was approximately 48 kDa. The optimal pH and temperature were 4-6 and 60 °C, respectively. The enzyme was stable at pH ranges of 4.5-6.5 and temperatures below 50 °C. Purified RoAmy had a K(m) and V(max) of 0.27 mg/ml and 0.068 mg/min, respectively, with a specific activity of 1,123 U/mg on soluble starch. Amylase activity was strongly inhibited by 5 mM Cu(2+) and 5 mM Fe(2+), whereas 5 mM Ca(2+) showed no significant effect. The RoAmy hydrolytic activity was the highest on wheat starch but showed only 55% activity on amylopectin relative to soluble corn starch, while the pullulanase activity was negligible. The main end products of the polysaccharides tested were glucose and maltose. Maltose reached a concentration of 74% (w/w) with potato starch as the substrate. The enzyme had an extremely high affinity (K(m) = 0.22 mM) to maltotriose. A high ratio of glucose/maltose of 1:4 was obtained when maltotriose was used at an initial concentration of 40 mM.

  6. Salivary alpha amylase activity in human beings of different age groups subjected to psychological stress.

    PubMed

    Sahu, Gopal K; Upadhyay, Seema; Panna, Shradha M

    2014-10-01

    Salivary alpha-amylase (sAA) has been proposed as a sensitive non-invasive biomarker for stress-induced changes in the body that reflect the activity of the sympathetic nervous system. Though several experiments have been conducted to determine the validity of this salivary component as a reliable stress marker in human subjects, the effect of stress induced changes on sAA level in different age groups is least studied. This article reports the activity of sAA in human subjects of different age groups subjected to psychological stress induced through stressful video clip. Differences in sAA level based on sex of different age groups under stress have also been studied. A total of 112 subjects consisting of both the male and female subjects, divided into two groups on basis of age were viewed a video clip of corneal transplant surgery as stressor. Activity of sAA from saliva samples of the stressed subjects were measured and compared with the activity of the samples collected from the subjects before viewing the clip. The age ranges of subjects were 18-25 and 40-60 years. The sAA level increased significantly in both the groups after viewing the stressful video. The increase was more pronounced in the younger subjects. The level of sAA was comparatively more in males than females in the respective groups. No significant change in sAA activity was observed after viewing the soothed video clip. Significant increase of sAA level in response to psychological stress suggests that it might act as a reliable sympathetic activity biochemical marker in different stages of human beings.

  7. Integrated expression of the α-amylase, dextranase and glutathione gene in an industrial brewer's yeast strain.

    PubMed

    Wang, Jin-Jing; Wang, Zhao-Yue; He, Xiu-Ping; Zhang, Bo-Run

    2012-01-01

    Genetic engineering is widely used to meliorate biological characteristics of industrial brewing yeast. But how to solve multiple problems at one time has become the bottle neck in the genetic modifications of industrial yeast strains. In a newly constructed strain TYRL21, dextranase gene was expressed in addition of α-amylase to make up α-amylase's shortcoming which can only hydrolyze α-1,4-glycosidic bond. Meanwhile, 18s rDNA repeated sequence was used as the homologous sequence for an effective and stable expression of LSD1 gene. As a result, TYRL21 consumed about twice much starch than the host strain. Moreover TYRL21 speeded up the fermentation which achieved the maximum cell number only within 3 days during EBC tube fermentation. Besides, flavor evaluation comparing TYRL21 and wild type brewing strain Y31 also confirmed TYRL21's better performances regarding its better saccharides utilization (83% less in residual saccharides), less off-flavor compounds (57% less in diacetyl, 39% less in acetaldehyde, 67% less in pentanedione), and improved stability index (increased by 49%) which correlated with sensory evaluation of final beer product.

  8. The roles of AMY1 copies and protein expression in human salivary α-amylase activity.

    PubMed

    Yang, Ze-Min; Lin, Jing; Chen, Long-Hui; Zhang, Min; Chen, Wei-Wen; Yang, Xiao-Rong

    2015-01-01

    Salivary α-amylase (sAA) activity has been extensively investigated in nutrition and psychology. But few studies were performed to assess the role played by sAA gene (AMY1) copies and protein expression in basal and stimulus-induced sAA activity. The sAA activity, amount and AMY1 copy number were determined from 184 saliva samples pre- and post-citric acid stimulation. Our findings showed that citric acid could induce significant increase in sAA activity, total sAA amount, and glycosylated sAA amount, among which the glycosylated sAA amount had the largest response. The correlation analysis showed that AMY1 copy number, total sAA amount and AMY1 copy number×total sAA amount had significantly positive and successively increasing correlations with sAA activity in unstimulated and stimulated saliva, respectively, and furthermore, we observed higher correlations in unstimulated saliva when compared with the corresponding correlations in stimulated saliva. We also observed significant correlations between glycosylated sAA amount and sAA activity in unstimulated and stimulated saliva, respectively. Interestingly, the correlations were higher in stimulated saliva than in unstimulated saliva, and the correlations between glycosylated sAA amount and sAA activity were higher than that of between total sAA amount and sAA activity in stimulated saliva. Moreover, total sAA amount ratio and glycosylated sAA amount ratio showed significantly positive correlation with sAA activity ratio. AMY1 copy number had no correlation with sAA activity ratio. These findings suggested that AMY1 copy number and sAA amount played crucial roles in sAA activity; however, the roles were attenuated after stimulation due to fortified release of glycosylated sAA.

  9. Characterization of recombinant β-amylases from Oryza sativa.

    PubMed

    Koide, Tomojiro; Ohnishi, Yasuo; Horinouchi, Sueharu

    2011-01-01

    Four putative β-amylase genes found in the Oryza sativa cDNA sequence database (KOME) were expressed in Escherichia coli. Recombinant proteins from two of these genes showed β-amylase activity. Similarly to β-amylases from other plants, the optimum pH of the recombinant rice β-amylases was about 5.5-6.0, but they exhibited inferior heat stability to soybean β-amylase.

  10. An alpha-amylase inhibitor gene from Phaseolus coccineus encodes a protein with potential for control of coffee berry borer (Hypothenemus hampei).

    PubMed

    de Azevedo Pereira, Railene; Nogueira Batista, João Aguiar; da Silva, Maria Cristina Mattar; Brilhante de Oliveira Neto, Osmundo; Zangrando Figueira, Edson Luiz; Valencia Jiménez, Arnubio; Grossi-de-Sa, Maria Fátima

    2006-09-01

    Plant alpha-amylase inhibitors are proteins found in several plants, and play a key role in natural defenses. In this study, a gene encoding an alpha-amylase inhibitor, named alphaAI-Pc1, was isolated from cotyledons of Phaseolus coccineus. This inhibitor has an enhanced primary structure to P. vulgaris alpha-amylase inhibitors (alpha-AI1 and alpha-AI2). The alphaAI-Pc1 gene, constructed with the PHA-L phytohemaglutinin promoter, was introduced into tobacco plants, with its expression in regenerated (T0) and progeny (T1) transformant plants monitored by PCR amplification, enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis, respectively. Seed protein extracts from selected transformants reacted positively with a polyclonal antibody raised against alphaAI-1, while no reaction was observed with untransformed tobacco plants. Immunological assays showed that the alphaAI-Pc1 gene product represented up to 0.05% of total soluble proteins in T0 plants seeds. Furthermore, recombinant alphaAI-Pc1 expressed in tobacco plants was able to inhibit 65% of digestive H. hampei alpha-amylases. The data herein suggest that the protein encoded by the alphaAI-Pc1 gene has potential to be introduced into coffee plants in order to increase their resistance to the coffee berry borer.

  11. The effect of oral stimulation on human parotid salivary flow rate and alpha-amylase secretion.

    PubMed

    Froehlich, D A; Pangborn, R M; Whitaker, J R

    1987-01-01

    Unilateral parotid saliva was collected from ten subjects following oral stimulation with water as baseline, and aqueous solutions of starch (2.5, 5.0, and 10%), sucrose (0.1, 0.2, and 0.4 M) sodium chloride (0.075, 0.15, and 0.30 M), and citric acid (0.005, 0.01, and 0.02 M). Salivary flow rate increased with increasing levels of each taste stimulus. At concentrations of equal taste intensity, citric acid evoked the highest flow rate, followed by sodium chloride and sucrose, while starch, in solution, had a minimal effect. Secretion rate patterns for total protein and alpha-amylase mirrored those of flow rate. The total protein and alpha-amylase concentrations of the saliva, and specific activity of alpha-amylase, were influenced by the type but not the concentration of stimulus, with citric acid stimulation resulting in the lowest concentrations and highest specific activity. Sodium ion (Na+) concentration generally increased with increasing stimulated flow rate, while K+, Ca++, and Mg++ concentrations remained relatively constant. Subjects with lower flow rates had a more concentrated saliva than those with high flow, except for Na+ concentration. Oral stimulation resulted in similar changes in protein and alpha-amylase secretion rates for the two groups.

  12. Human HOX gene disorders.

    PubMed

    Quinonez, Shane C; Innis, Jeffrey W

    2014-01-01

    The Hox genes are an evolutionarily conserved family of genes, which encode a class of important transcription factors that function in numerous developmental processes. Following their initial discovery, a substantial amount of information has been gained regarding the roles Hox genes play in various physiologic and pathologic processes. These processes range from a central role in anterior-posterior patterning of the developing embryo to roles in oncogenesis that are yet to be fully elucidated. In vertebrates there are a total of 39 Hox genes divided into 4 separate clusters. Of these, mutations in 10 Hox genes have been found to cause human disorders with significant variation in their inheritance patterns, penetrance, expressivity and mechanism of pathogenesis. This review aims to describe the various phenotypes caused by germline mutation in these 10 Hox genes that cause a human phenotype, with specific emphasis paid to the genotypic and phenotypic differences between allelic disorders. As clinical whole exome and genome sequencing is increasingly utilized in the future, we predict that additional Hox gene mutations will likely be identified to cause distinct human phenotypes. As the known human phenotypes closely resemble gene-specific murine models, we also review the homozygous loss-of-function mouse phenotypes for the 29 Hox genes without a known human disease. This review will aid clinicians in identifying and caring for patients affected with a known Hox gene disorder and help recognize the potential for novel mutations in patients with phenotypes informed by mouse knockout studies.

  13. Activity of alpha-amylase inhibitors from Phaseolus coccineus on digestive alpha-amylases of the coffee berry borer.

    PubMed

    Valencia-Jiménez, Arnubio; Arboleda Valencia, Jorge W; Grossi-De-Sá, Maria Fátima

    2008-04-09

    Seeds of scarlet runner bean ( Phaseolus coccineus L.) were analyzed for alpha-amylase inhibitor (alpha-AI) activity. Through the use of polyclonal antibodies raised against pure alpha-AI-1 from common bean ( Phaseolus vulgaris L.), typical alpha-AlphaIota polypeptides (Mr 14-18 kDa) as well as a large polypeptide of Mr 32000 Da, usually referred to as "amylase inhibitor like", were detected. The inhibitor activity present in four accessions of P. coccineus was examined, both in semiquantitative zymograms allowing the separation of different isoforms and in quantitative assays against human salivary amylase, porcine pancreatic amylase, and coffee berry borer, Hypothenemus hampei Ferrari (Coleoptera: Scolytidae) amylase. Differential inhibition curves lead to the suggestion that the gene encoding one of the inhibitors in P. coccineus (in accession G35590) would be a good candidate for genetic engineering of coffee resistance toward the coffee berry borer. An in vitro proteolytic digestion treatment of pure alpha-AlphaIota-1 resulted in a rapid loss of the inhibitory activity, seriously affecting its natural capacity to interact with mammalian alpha-amylases.

  14. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  15. Unique Organization of Extracellular Amylases into Amylosomes in the Resistant Starch-Utilizing Human Colonic Firmicutes Bacterium Ruminococcus bromii

    PubMed Central

    Ze, Xiaolei; Ben David, Yonit; Laverde-Gomez, Jenny A.; Dassa, Bareket; Sheridan, Paul O.; Duncan, Sylvia H.; Louis, Petra; Henrissat, Bernard; Juge, Nathalie; Koropatkin, Nicole M.; Bayer, Edward A.

    2015-01-01

    ABSTRACT Ruminococcus bromii is a dominant member of the human gut microbiota that plays a key role in releasing energy from dietary starches that escape digestion by host enzymes via its exceptional activity against particulate “resistant” starches. Genomic analysis of R. bromii shows that it is highly specialized, with 15 of its 21 glycoside hydrolases belonging to one family (GH13). We found that amylase activity in R. bromii is expressed constitutively, with the activity seen during growth with fructose as an energy source being similar to that seen with starch as an energy source. Six GH13 amylases that carry signal peptides were detected by proteomic analysis in R. bromii cultures. Four of these enzymes are among 26 R. bromii proteins predicted to carry dockerin modules, with one, Amy4, also carrying a cohesin module. Since cohesin-dockerin interactions are known to mediate the formation of protein complexes in cellulolytic ruminococci, the binding interactions of four cohesins and 11 dockerins from R. bromii were investigated after overexpressing them as recombinant fusion proteins. Dockerins possessed by the enzymes Amy4 and Amy9 are predicted to bind a cohesin present in protein scaffoldin 2 (Sca2), which resembles the ScaE cell wall-anchoring protein of a cellulolytic relative, R. flavefaciens. Further complexes are predicted between the dockerin-carrying amylases Amy4, Amy9, Amy10, and Amy12 and two other cohesin-carrying proteins, while Amy4 has the ability to autoaggregate, as its dockerin can recognize its own cohesin. This organization of starch-degrading enzymes is unprecedented and provides the first example of cohesin-dockerin interactions being involved in an amylolytic system, which we refer to as an “amylosome.” PMID:26419877

  16. A new nano-optical sensor thin film cadmium sulfide doped in sol-gel matrix for assessment of α-amylase activity in human saliva.

    PubMed

    Attia, M S; Zoulghena, H; Abdel-Mottaleb, M S A

    2014-02-21

    A novel, simple, sensitive and precise spectrofluorimetric method is developed for measuring the activity of the α-amylase enzyme in human saliva. The remarkable quenching of the luminescence intensity at 634 nm of nano CdS doped in a sol-gel matrix by various concentrations of maltose (produced from the reaction of the enzyme with the starch substrate) was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 4.8 × 10(-10) to 1.2 × 10(-5) mol L(-1) maltose with a correlation coefficient of 0.999 and a detection limit of 5.7 × 10(-11) mol L(-1). The method was used satisfactorily for assessment of the α-amylase activity in a number of human saliva samples collected from various healthy volunteers.

  17. Effects of polymorphisms in pepsinogen (PEP), amylase (AMY) and trypsin (TRY) genes on food habit domestication traits in mandarin fish.

    PubMed

    Yi, Tilin; Sun, Jian; Liang, Xufang; He, Shan; Li, Ling; Wen, Zhengyong; Shen, Dan

    2013-10-30

    Mandarin fish (Siniperca chuatsi) have a peculiar feeding habit of only accepting live fish prey and refusing dead prey and artificial diets. However, previous research has shown that some individuals accept dead prey after gradual domestication. Digestive enzymes are correlated with feeding habits in fish. In the current study, SNPs in the mandarin fish genes for pepsinogen (PEP), amylase (AMY), and trypsin (TRY) were evaluated for associations with feeding habits in domesticated mandarin fish by scanning their complete genomic sequence. In total, two SNPs were found in PEP, one was found in TRY, and none were found in AMY. The D1(CTCC) and D5(TTTT) diplotypes in the PEP gene tended to show strong effects on the feeding habits of domesticated fish (p < 0.01). The results indicate that PEP may be associated with the genetic mechanism for feeding habits in mandarin fish, and the D1(CTCC) and D5(TTTT) diplotypes in the PEP gene may be useful markers for selecting mandarin fish with appropriate feeding habits for domestication.

  18. Phylogenetic Distribution of Intron Positions in Alpha-Amylase Genes of Bilateria Suggests Numerous Gains and Losses

    PubMed Central

    Da Lage, Jean-Luc; Maczkowiak, Frédérique; Cariou, Marie-Louise

    2011-01-01

    Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that “resets” of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures. PMID:21611157

  19. Improvement of cloned [alpha]-amylase gene expression in fed-batch culture of recombinant Saccharomyces cerevisiae by regulating both glucose and ethanol concentrations using a fuzzy controller

    SciTech Connect

    Shiba, Sumihisa; Nishida, Yoshio; Park, Y.S.; Iijima, Shinji; Kobayashi, Takeshi . Dept. of Biotechnology)

    1994-11-05

    The effect of ethanol concentration on cloned gene expression in recombinant Saccharomyces cerevisiae strain 20B-12 containing one of two plasmids, pNA3 and pNA7, was investigated in batch cultures. Plasmids pNA3 and pNA7 contain the [alpha]-amylase gene under the control of the SUC2 or PGK promoter, respectively. When the ethanol concentration was controlled at 2 to 5 g/L, the gene expressions were two times higher than those at 20 g/L ethanol. To increase the gene expression by maintaining both the ethanol and glucose concentrations at low levels, a fuzzy controller was developed. The concentrations of glucose and ethanol were controlled simultaneously at 0.15 and 2 g/L, respectively, in the production phase using the fuzzy controller in fed-batch culture. The synthesis of [alpha]-amylase was induced by the low glucose concentration and maintained at a high level of activity by regulating the ethanol concentration at 2 g/L. The secretory [alpha]-amylase activities of cells harboring plasmids pNA3 and pNA7 in fed-batch culture were 175 and 392 U/mL, and their maximal specific activities 7.7 and 12.4 U/mg dry cells, respectively. These values are two to three times higher in activity and three to four times higher in specific activity than those obtained when glucose only was controlled.

  20. The roles of histidine residues at the starch-binding site in streptococcal-binding activities of human salivary amylase.

    PubMed

    Tseng, C C; Miyamoto, M; Ramalingam, K; Hemavathy, K C; Levine, M J; Ramasubbu, N

    1999-02-01

    Human salivary alpha-amylase participates in the initial digestion of starch and may be involved in the colonization of viridans streptococci in the mouth. To elucidate the role of histidine residues located near the starch-binding site on the streptococcal-binding activity, the wild type and three histidine mutants, H52A, H299A and H305A were constructed and expressed in a baculovirus system. While His52 is located near the non-reducing end of the starch-binding pocket (subsite S3/S4), the residues His299 and His305 are located near the subsites S1/S1'. For the wild type, the cDNA encoding the leader and secreted sequences of human salivary amylase was amplified by polymerase chain reaction from a human submandibular salivary-gland cDNA library, and subcloned into the baculovirus shuttle vector pVL1392 downstream of the polyhedrin promoter. Oligonucleotide-based, site-directed mutagenesis was used to generate the mutants expressed in the baculovirus system. Replacing His52 or His299 or His305 to Ala residue did not alter the bacterial-binding activity significantly, but these mutants did show differences in their catalytic activities. The mutant H52A showed negligible reduction in enzymatic activity compared to that of wild type for the hydrolysis of starch and oligosaccharides. In contrast, the H299A and H305A mutants showed a 12 to 13-fold reduction (90-92%) in starch-hydrolysing activity. In addition, the k(cat) for the hydrolysis of oligosaccharides by H299A decreased by as much as 11-fold for maltoheptaoside. This reduction was even higher (40-fold) for the hydrolysis of p-nitrophenyl maltoside, with a significant change in K(M). The mutant H305A, however, exhibited a reduction in k(cat) only, with no changes in the K(M) for the hydrolysis of oligosaccharides. The reduction in the k(cat) for the H305A mutant was almost 93% for maltoheptaoside hydrolysis. The pH activity profile for the H305A mutant was also significantly different from that of the wild type

  1. Evolution of the beta-amylase gene in the temperate grasses: Non-purifying selection, recombination, semiparalogy, homeology and phylogenetic signal.

    PubMed

    Minaya, Miguel; Díaz-Pérez, Antonio; Mason-Gamer, Roberta; Pimentel, Manuel; Catalán, Pilar

    2015-10-01

    Low-copy nuclear genes (LCNGs) have complex genetic architectures and evolutionary dynamics. However, unlike multicopy nuclear genes, LCNGs are rarely subject to gene conversion or concerted evolution, and they have higher mutation rates than organellar or nuclear ribosomal DNA markers, so they have great potential for improving the robustness of phylogenetic reconstructions at all taxonomic levels. In this study, our first objective is to evaluate the evolutionary dynamics of the LCNG β-amylase by testing for potential pseudogenization, paralogy, homeology, recombination, and phylogenetic incongruence within a broad representation of the main Pooideae lineages. Our second objective is to determine whether β-amylase shows sufficient phylogenetic signal to reconstruct the evolutionary history of the Pooid grasses. A multigenic (ITS, matK, ndhF, trnTL, and trnLF) tree of the study group provided a framework for assessing the β-amylase phylogeny. Eight accessions showed complete absence of selection, suggesting putative pseudogenic copies or other relaxed selection pressures; resolution of Vulpia alopecuros 2x clones indicated its potential (semi) paralogy; and homeologous copies of allopolyploid species Festuca simensis, F. fenas, and F. arundinacea tracked their Mediterranean origin. Two recombination events were found within early-diverged Pooideae lineages, and five within the PACCMAD clade. The unexpected phylogenetic relationships of 37 grass species (26% of the sampled species) highlight the frequent occurrence of non-treelike evolutionary events, so this LCNG should be used with caution as a phylogenetic marker. However, once the pitfalls are identified and removed, the phylogenetic reconstruction of the grasses based on the β-amylase exon+intron positions is optimal at all taxonomic levels.

  2. [Patenting human genes].

    PubMed

    Brdicka, R

    2002-05-10

    The problem of patenting of human genes, which was discussed at the Workshop organized by OECD, has become very actual due to granted patents that concern testing of genetic disposition for breast cancer. Companies that had made large investments into this research clearly support patenting of their discoveries. But such patents can reduce general accessibility of genetic testing. Existing laws, and namely the Directive of the European Council unfortunately are not unambiguous and allow rather free explanation.

  3. Purification and characterization of two alkaline, thermotolerant alpha-amylases from Bacillus halodurans 38C-2-1 and expression of the cloned gene in Escherichia coli.

    PubMed

    Murakami, Shuichiro; Nishimoto, Haruka; Toyama, Yosuke; Shimamoto, Etsuko; Takenaka, Shinji; Kaulpiboon, Jarunee; Prousoontorn, Manchumas; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Aoki, Kenji

    2007-10-01

    A newly isolated strain, 38C-2-1, produced alkaline and thermotolerant alpha-amylases and was identified as Bacillus halodurans. The enzymes were purified to homogeneity and named alpha-amylase I and II. These showed molecular masses of 105 and 75 kDa respectively and showed maximal activities at 50-60 degrees C and pH 10-11, and 42 and 38% relative activities at 30 degrees C. These results indicate that the enzymes are thermotolerant. The enzyme activity was not inhibited by a surfactant or a bleaching reagent used in detergents. A gene encoding alpha-amylase I was cloned and named amyI. Production of AmyI with a signal peptide repressed the growth of an Escherichia coli transformant. When enzyme production was induced by the addition of isopropyl beta-D(-)-thiogalactopyranoside in the late exponential growth phase, the highest enzyme yield was observed. It was 45-fold that of the parent strain 38C-2-1.

  4. Human Gene Therapy: Genes without Frontiers?

    ERIC Educational Resources Information Center

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  5. Differential expression of two ß-amylase genes (Bmy1 and Bmy2) in developing and mature barley grain

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Barley (Hordeum vulgare L.) endosperm-specific (Bmy1) and ubiquitous (Bmy2) ß-amylase were studied during the late maturation phase of seed development in four genotypes. Sequencing of Bmy2 from genomic DNA revealed six polymorphisms in the introns and two synonymous SNPs in the coding region. Acc...

  6. Molecular characterization of α-amylase from Staphylococcus aureus.

    PubMed

    Lakshmi, Hanumanthu Prasanna; Prasad, Uppu Venkateswara; Yeswanth, Sthanikam; Swarupa, Vimjam; Prasad, Osuru Hari; Narasu, Mangamoori Lakshmi; Sarma, Potukuchi Venkata Gurunadha Krishna

    2013-01-01

    Staphylococcus aureus is one of the prominent Gram positive human pathogen secretes many surface and secretary proteins including various enzymes and pathogenic factors that favour the successful colonization and infection of host tissue. α-amylase is one of the enzymes secreted by S. aureus which catalyses the breakdown of complex sugars to monosaccharides, which are required for colonization and survival of this pathogen in any anatomical locales. In the present study we have cloned, sequenced, expressed and characterized α-amylase gene from S. aureus ATCC12600. The recombinant enzyme has a molecular weight of 58kDa and the kinetics showed Vmax 0.0208±0.033 (mg/ml)/mg/min and Km 10.633±0.737mg/ml. The multiple sequence analysis showed α- amylase of S. aureus exhibited large differences with Bacillus subtilis and Streptococcus bovis. As the crystal structure of S. aureus α- amylase was unavailable, we used homology modelling method to build the structure. The built structure was validated by Ramachandran plot which showed 90% of the residues in the allowed region while no residue was found in the disallowed region and the built structure was close to the crystal structure with Z-Score: -6.85. The structural superimposition studies with α- amylases of Bacillus subtilis and Streptococcus bovis showed distinct differences with RMSD values of 18.158Åand 7.091Å respectively which correlated with enzyme kinetics, indicating α-amylase is different among these bacteria.

  7. Intraspecies differences in cold hardiness, carbohydrate content and β-amylase gene expression of Vaccinium corymbosum during cold acclimation and deacclimation.

    PubMed

    Lee, Jun Hyung; Yu, Duk Jun; Kim, Su Jin; Choi, Doil; Lee, Hee Jae

    2012-12-01

    Changes in cold hardiness, carbohydrate content and β-amylase gene expression were monitored in the shoots of the highbush blueberry (Vaccinium corymbosum L.) cultivars 'Sharpblue' and 'Jersey' during cold acclimation (CA) and deacclimation (DA). The seasonal patterns were similar in both cultivars, but the levels of cold hardiness determined by electrolyte leakage analysis were significantly different; 'Jersey' was hardier than 'Sharpblue'. Cold hardiness was closely related to total soluble sugar content (r = -0.98** and -0.99** for 'Sharpblue' and 'Jersey', respectively). In 'Jersey', more soluble sugars accumulated during CA. Of the detected soluble sugars, glucose, fructose and raffinose contents were significantly associated with cold hardiness in both cultivars. Sucrose was abundant in both cultivars, and stachyose content changed significantly during CA and DA. However, they were not associated with cold hardiness. A sharp decrease in starch contents in the middle of CA coincided with β-amylase gene (VcBMY) expression, indicating the conversion of starch into soluble sugars. During CA, VcBMY was expressed up to twofold higher in 'Jersey' than in 'Sharpblue'. These results suggest that intraspecies differences in the cold hardiness of highbush blueberries are associated with total soluble sugar content, which is driven partly by differential expression of VcBMY.

  8. Genomic structure of the α-amylase gene in the pearl oyster Pinctada fucata and its expression in response to salinity and food concentration.

    PubMed

    Huang, Guiju; Guo, Yihui; Li, Lu; Fan, Sigang; Yu, Ziniu; Yu, Dahui

    2016-08-01

    Amylase is one of the most important digestive enzymes for phytophagous animals. In this study, the cDNA, genomic DNA, and promoter region of the α-amylase gene of the pearl oyster Pinctada fucata were cloned by using reverse transcription-polymerase chain reaction (RT-PCR), rapid amplification of cDNA ends, and genome-walking methods. The full-length cDNA sequence was 1704bp long and consisted of a 5'-untranslated region of 17bp, a 3'-untranslated region of 118bp, and a 1569-bp open reading frame encoding a 522-aa polypeptide with a 20-aa signal peptide. Sequence alignment revealed that P. fucata α-amylase (Pfamy) shared the highest identity (91.6%) with Pinctada maxima. The phylogenetic tree showed that it was closely related to P. maxima, based on the amino acid sequences. The genomic DNA was 10850bp and contained nine exons, eight introns, and a promoter region of 3932bp. Several transcriptional factors such as GATA-1, AP-1, and SP1 were predicted in the promoter region. Quantitative RT-PCR assay indicated that the relative expression level of Pfamy was significantly higher in the digestive gland than in other tissues (gonad, gills, muscle, and mantle) (P<0.001). The expression level at salinity 27‰ was significantly higher than that at other salinities (P<0.05). Expression reached a minimum when the algal food concentration was 16×10(4)cells/mL, which was significantly lower than the level observed at 8×10(4)cells/mL and 20×10(4) cells/mL (P<0.05). Our findings provide a genetic basis for further research on Pfamy activity and will facilitate studies on the growth mechanisms and genetic improvement of the pearl oyster P. fucata.

  9. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  10. Genes, Environment, and Human Behavior.

    ERIC Educational Resources Information Center

    Bloom, Mark V.; Cutter, Mary Ann; Davidson, Ronald; Dougherty, Michael J.; Drexler, Edward; Gelernter, Joel; McCullough, Laurence B.; McInerney, Joseph D.; Murray, Jeffrey C.; Vogler, George P.; Zola, John

    This curriculum module explores genes, environment, and human behavior. This book provides materials to teach about the nature and methods of studying human behavior, raise some of the ethical and public policy dilemmas emerging from the Human Genome Project, and provide professional development for teachers. An extensive Teacher Background…

  11. Loss-of-Function Mutations of the Rice GAMYB Gene Impair α-Amylase Expression in Aleurone and Flower Development

    PubMed Central

    Kaneko, Miyuki; Inukai, Yoshiaki; Ueguchi-Tanaka, Miyako; Itoh, Hironori; Izawa, Takeshi; Kobayashi, Yuhko; Hattori, Tsukaho; Miyao, Akio; Hirochika, Hirohiko; Ashikari, Motoyuki; Matsuoka, Makoto

    2004-01-01

    GAMYB was first isolated as a positive transcriptional regulator of gibberellin (GA)-dependent α-amylase expression in barley aleurone cells, and its molecular and biochemical properties have been well characterized. However, the role of GAMYB elsewhere in the plant is not well understood. To investigate the molecular function of GAMYB outside of the aleurone cells, we isolated loss-of-function mutants from a panel of rice mutants produced by the insertion of a retrotransposon, Tos17. Through PCR screening using primers for rice GAMYB (OsGAMYB) and Tos17, we isolated three independent mutant alleles that contained Tos17 inserted in the exon region. No α-amylase expression in the endosperm was induced in these mutants in response to GA treatment, indicating that the Tos17 insertion had knocked out OsGAMYB function. We found no significant defects in the growth and development of the mutants at the vegetative stage. After the phase transition to the reproductive stage, however, shortened internodes and defects in floral organ development, especially a defect in pollen development, were observed. On the other hand, no difference was detected in flowering time. High-level OsGAMYB expression was detected in the aleurone cells, inflorescence shoot apical region, stamen primordia, and tapetum cells of the anther, but only low-level expression occurred in organs at the vegetative stage or in the elongating stem. These results demonstrate that, in addition to its role in the induction of α-amylase in aleurone, OsGAMYB also is important for floral organ development and essential for pollen development. PMID:14688295

  12. Method for using a yeast alpha-amylase promoter

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  13. Expression of β-Amylase from Alfalfa Taproots1

    PubMed Central

    Gana, Joyce A.; Kalengamaliro, Newton E.; Cunningham, Suzanne M.; Volenec, Jeffrey J.

    1998-01-01

    Alfalfa (Medicago sativa L.) roots contain large quantities of β-amylase, but little is known about its role in vivo. We studied this by isolating a β-amylase cDNA and by examining signals that affect its expression. The β-amylase cDNA encoded a 55.95-kD polypeptide with a deduced amino acid sequence showing high similarity to other plant β-amylases. Starch concentrations, β-amylase activities, and β-amylase mRNA levels were measured in roots of alfalfa after defoliation, in suspension-cultured cells incubated in sucrose-rich or -deprived media, and in roots of cold-acclimated germ plasms. Starch levels, β-amylase activities, and β-amylase transcripts were reduced significantly in roots of defoliated plants and in sucrose-deprived cell cultures. β-Amylase transcript was high in roots of intact plants but could not be detected 2 to 8 d after defoliation. β-Amylase transcript levels increased in roots between September and October and then declined 10-fold in November and December after shoots were killed by frost. Alfalfa roots contain greater β-amylase transcript levels compared with roots of sweetclover (Melilotus officinalis L.), red clover (Trifolium pratense L.), and birdsfoot trefoil (Lotus corniculatus L.). Southern analysis indicated that β-amylase is present as a multigene family in alfalfa. Our results show no clear association between β-amylase activity or transcript abundance and starch hydrolysis in alfalfa roots. The great abundance of β-amylase and its unexpected patterns of gene expression and protein accumulation support our current belief that this protein serves a storage function in roots of this perennial species. PMID:9847126

  14. Purification and identification of amylases released by the human pathogen Trichomonas vaginalis that are active towards glycogen.

    PubMed

    Smith, Ronald W; Brittingham, Andrew; Wilson, Wayne A

    The parasitic protist Trichomonas vaginalis is the causative agent of the sexually transmitted infection trichomoniasis. In the laboratory, T. vaginalis is typically cultured in a serum-containing medium with maltose or glucose as the carbon source. The nature of the carbohydrates used by the organism in the environment of its host is unclear. However, the vagina contains substantial amounts of glycogen, which is believed to provide a growth substrate for the vaginal microbiota. We have shown previously that T. vaginalis releases glucosidases that are active towards glycogen into its environment. Here we purify and identifying these glucosidases. Using ammonium sulfate precipitation and precipitation with ethanol/glycogen, we purified glucosidase activity from conditioned growth medium, achieving over 300-fold enrichment. Maltose was released when glycogen was incubated with the glucosidase preparation, indicating that a β-amylase was present. However, after prolonged incubation, small quantities of larger products including maltotriose were obtained. Liquid chromatography and tandem mass spectrometry showed that the glucosidase preparation contained three proteins, the major component being a putative β-amylase encoded by the TVAG_080000 open reading frame. Lesser amounts of two putative α-amylases, encoded by the TVAG_178580 and TVAG_205920 open reading frames, were also present. We cloned and expressed the TVAG_080000 open reading frame and found that the recombinant protein was capable of digesting glycogen, releasing exclusively maltose. We conclude that T. vaginalis releases a variety of amylases into its growth environment and is well equipped to utilize the glycogen found in the vagina as a source of essential carbohydrates.

  15. Discovering Bisdemethoxycurcumin from Curcuma longa rhizome as a potent small molecule inhibitor of human pancreatic α-amylase, a target for type-2 diabetes.

    PubMed

    Ponnusamy, Sudha; Zinjarde, Smita; Bhargava, Shobha; Rajamohanan, P R; Ravikumar, Ameeta

    2012-12-15

    Curcuma longa rhizome is used extensively in culinary preparations in Far East and South-East Asia. Health benefits of curcuminoids from C. longa as antioxidants, anti-cancer and anti-inflammatory molecules have been well documented. We report here for the first time that Bisdemethoxycurcumin (BDMC) from C. longa, acts as an inhibitor to inactivate human pancreatic α-amylase, a therapeutic target for oral hypoglycemic agents in type-2 diabetes. Bioactivity guided isolation of rhizome isopropanol extract led to the identification by HPLC and NMR of BDMC as a lead small molecule inhibitor of porcine and human pancreatic α-amylase with an IC(50) value of 0.026 and 0.025 mM, respectively. Kinetic analysis revealed that using starch as the substrate, HPA exhibited an uncompetitive mode of inhibition with an apparent K(i) of 3.0 μM. The study gains importance as BDMC could be a good drug candidate in development of new inhibitors of HPA and of functional foods for controlling starch digestion in order to reduce post-prandial hyperglycemia.

  16. Advances in microbial amylases.

    PubMed

    Pandey, A; Nigam, P; Soccol, C R; Soccol, V T; Singh, D; Mohan, R

    2000-04-01

    This review makes a comprehensive survey of microbial amylases, i.e. alpha-amylase, beta-amylase and glucoamylase. Amylases are among the most important enzymes and are of great significance in present-day biotechnology. Although they can be derived from several sources, such as plants, animals and micro-organisms, the enzymes from microbial sources generally meet industrial demands. Microbial amylases could be potentially useful in the pharmaceutical and fine-chemical industries if enzymes with suitable properties could be prepared. With the advent of new frontiers in biotechnology, the spectrum of amylase application has widened in many other fields, such as clinical, medicinal and analytical chemistries, as well as their widespread application in starch saccharification and in the textile, food, brewing and distilling industries. In this review, after a brief description of the sources of amylases, we discuss the molecular biology of amylases, describing structures, cloning, sequences, and protoplast fusion and mutagenesis. This is followed by sections on their production and finally the properties of various amylases.

  17. Human Lacrimal Gland Gene Expression

    PubMed Central

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian

    2017-01-01

    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151

  18. Analysis on evolutionary relationship of amylases from archaea, bacteria and eukaryota.

    PubMed

    Yan, Shaomin; Wu, Guang

    2016-02-01

    Amylase is one of the earliest characterized enzymes and has many applications in clinical and industrial settings. In biotechnological industries, the amylase activity is enhanced through modifying amylase structure and through cloning and expressing targeted amylases in different species. It is important to understand how engineered amylases can survive from generation to generation. This study used phylogenetic and statistical approaches to explore general patterns of amylases evolution, including 3118 α-amylases and 280 β-amylases from archaea, eukaryota and bacteria with fully documented taxonomic lineage. First, the phylogenetic tree was created to analyze the evolution of amylases with focus on individual amylases used in biofuel industry. Second, the average pairwise p-distance was computed for each kingdom, phylum, class, order, family and genus, and its diversity implies multi-time and multi-clan evolution. Finally, the variance was further partitioned into inter-clan variance and intra-clan variance for each taxonomic group, and they represent horizontal and vertical gene transfer. Theoretically, the results show a full picture on the evolution of amylases in manners of vertical and horizontal gene transfer, and multi-time and multi-clan evolution as well. Practically, this study provides the information on the surviving chance of desired amylase in a given taxonomic group, which may potentially enhance the successful rate of cloning and expression of amylase gene in different species.

  19. Isolation and characterization of a proteinaceous α-amylase inhibitor AAI-CC5 from Streptomyces sp. CC5, and its gene cloning and expression.

    PubMed

    Sun, Zhibin; Lu, Weihao; Liu, Pingping; Wang, Hui; Huang, Yan; Zhao, Yuguo; Kong, Yi; Cui, Zhongli

    2015-02-01

    An α-amylase inhibitor producing Streptomyces sp. strain CC5 was isolated from soil. A proteinaceous α-amylase inhibitor AAI-CC5 was purified from strain CC5. AAI-CC5 specifically inhibited mammalian α-amylases. The molecular weight of the inhibitor was determined to be 8,212 Da by MALDI-TOF Mass Spectrum. The N-terminal 15 amino acid residues of the purified AAI-CC5 were DTGSPAPECVEYFQS, which is dissimilar to other reported proteinaceous α-amylase inhibitors. AAI-CC5 is a pH insensitive and heat-stable protein, and cannot be hydrolysed by trypsin. AAI-CC5 was cloned and expressed in Escherichia coli BL21 (DE3) with a hexa-histidine tag on the C terminal. AAI-CC5 shared 82 % identity with Parvulustat. The recombinant α-amylase inhibitor was purified to homogeneity by one-step affinity chromatography using Ni(2+)-NTA resin with molecular mass of 9,404 Da. Steady state kinetics studies of α-amylase and the inhibitor revealed an irreversible, non-competitive inhibition mechanism with IC50 and Ki value of 6.43 ×1 10(-11) and 4.45 × 10(-11) M respectively. These results suggest this novel α-amylase inhibitor possessed powerful inhibitory activity for α-amylase, and it may be a candidate in research of diabetes therapy and obesity treatment.

  20. Transcriptional gene silencing in humans

    PubMed Central

    Weinberg, Marc S.; Morris, Kevin V.

    2016-01-01

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  1. Comparing the evolutionary conservation between human essential genes, human orthologs of mouse essential genes and human housekeeping genes.

    PubMed

    Lv, Wenhua; Zheng, Jiajia; Luan, Meiwei; Shi, Miao; Zhu, Hongjie; Zhang, Mingming; Lv, Hongchao; Shang, Zhenwei; Duan, Lian; Zhang, Ruijie; Jiang, Yongshuai

    2015-11-01

    Human housekeeping genes are often confused with essential human genes, and several studies regard both types of genes as having the same level of evolutionary conservation. However, this is not necessarily the case. To clarify this, we compared the differences between human housekeeping genes and essential human genes with respect to four aspects: the evolutionary rate (dN/dS), protein sequence identity, single-nucleotide polymorphism (SNP) density and level of linkage disequilibrium (LD). The results showed that housekeeping genes had lower evolutionary rates, higher sequence identities, lower SNP densities and higher levels of LD compared with essential genes. Together, these findings indicate that housekeeping and essential genes are two distinct types of genes, and that housekeeping genes have a higher level of evolutionary conservation. Therefore, we suggest that researchers should pay careful attention to the distinctions between housekeeping genes and essential genes. Moreover, it is still controversial whether we should substitute human orthologs of mouse essential genes for human essential genes. Therefore, we compared the evolutionary features between human orthologs of mouse essential genes and human housekeeping genes and we got inconsistent results in long-term and short-term evolutionary characteristics implying the irrationality of simply replacing human essential genes with human orthologs of mouse essential genes.

  2. Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes

    SciTech Connect

    Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

    1999-12-20

    Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

  3. PtrBAM1, a β-amylase-coding gene of Poncirus trifoliata, is a CBF regulon member with function in cold tolerance by modulating soluble sugar levels.

    PubMed

    Peng, Ting; Zhu, Xiaofang; Duan, Nian; Liu, Ji-Hong

    2014-12-01

    β-Amylase (BAM) catalyses starch breakdown to generate maltose, which can be incorporated into sugar metabolism. However, the role of BAM genes in cold tolerance is less characterized. In this study, we report the isolation and functional characterization of a chloroplast-localizing BAM-encoding gene PtrBAM1 from Poncirus trifoliata. PtrBAM1 was induced by cold, dehydration and salt, but repressed by maltose. Overexpression of PtrBAM1 in tobacco (Nicotiana nudicaulis) increased BAM activity, promoted starch degradation and enhanced the contents of maltose and soluble sugars, whereas opposite changes were observed when PtrBAM1 homolog in lemon (Citrus lemon) was knocked down. The tobacco overexpressing lines exhibited enhanced tolerance to cold at chilling or freezing temperatures. Under cold stress, higher BAM activity and greater accumulation of maltose and soluble sugars were observed in the overexpressing lines when compared with the wild-type or empty vector transformants. Bioinformatics analysis demonstrated that PtrBAM1 promoter contained a CBF-recognizing element. Yeast one-hybrid assay demonstrated that PtrCBF could interact with the promoter fragment containing the element. Taken together, these results demonstrate that PtrBAM1 is a member of CBF regulon and plays an important role in cold tolerance by modulating the levels of soluble sugars acting as osmolytes or antioxidants.

  4. The human crystallin gene families

    PubMed Central

    2012-01-01

    Crystallins are the abundant, long-lived proteins of the eye lens. The major human crystallins belong to two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins. During evolution, other proteins have sometimes been recruited as crystallins to modify the properties of the lens. In the developing human lens, the enzyme betaine-homocysteine methyltransferase serves such a role. Evolutionary modification has also resulted in loss of expression of some human crystallin genes or of specific splice forms. Crystallin organization is essential for lens transparency and mutations; even minor changes to surface residues can cause cataract and loss of vision. PMID:23199295

  5. Human germline gene therapy reconsidered.

    PubMed

    Resnik, D B; Langer, P J

    2001-07-20

    This paper reevaluates the notion of human germline gene therapy (HGLGT) in light of developments in biomedicine, biotechnology, and ethical and policy analysis. The essay makes the following key points. First, because the distinction among "therapy," "prevention," and "enhancement" is not clear in human genetics, "gene therapy" is an inadequate descriptor of the process and goals of germline genetic alterations. The alternate use of the phrase "human germline genome modification" (HGLGM) could avoid a misleading label. Second, procedures that could be construed as genetic "enhancement" may not be as morally problematic as some have supposed, once one understands that the boundaries between therapy, prevention, and enhancement are not obvious in genetic medicine. Third, HGLGM might be the medically and morally most appropriate way of avoiding the birth of a child with a genetic disease in only a small range of cases. Fourth, there are still many ethical and scientific problems relating to the safety and efficacy of HGLGM.

  6. Effects of a new microbial α-amylase inhibitor protein on Helicoverpa armigera larvae.

    PubMed

    Zeng, Fanrong; Wang, Xiaojing; Cui, Jinjie; Ma, Yan; Li, Qiannan

    2013-03-06

    A new microbial α-amylase inhibitor gene was cloned and characterized. The encoded, recombinant, α-amylase inhibitor protein was induced and expressed by isopropyl β-d-1-thiogalactopyranoside (IPTG) in Escherichia coli M15 cells. The effects of the α-amylase inhibitor protein on Helicoverpa armigera larvae were studied. Compared to the control, the weight of H. armigera larvae fed the diet with recombinant α-amylase inhibitor protein added at a concentration of 20 μg/g was reduced by 49.8%. The total soluble protein of H. armigera larvae fed the diet with the α-amylase inhibitor protein added was also reduced by 36.8% compared to the control. The recombinant α-amylase inhibitor protein showed inhibition activity against α-amylase of H. armigera. These results suggested that this α-amylase inhibitor protein may be a promising bioinsecticide candidate for controlling H. armigera.

  7. Electrophoretically unique amylases in rat livers: phylogenic and ontogenic study on the mammalian liver.

    PubMed

    Koyama, Iwao; Komine, Shin-Ichi; Hokari, Shigeru; Matsunaga, Toshiyuki; Nakamura, Koh-Ich; Komoda, Tsugikazu

    2002-09-01

    Liver amylase activity in rodents was assayed with Blue Starch as substrate, and found to be higher than in humans or pigs. Based on the result of concanavalin A affinity chromatography, we found that the sugar moieties of amylase molecules increased in parallel with amylase activity in the tested mammals. However, the amounts of amylase proteins determined by Western bloting with anti-human salivary-type antibody as the probe, were similar to the levels in mammalian livers. Moreover, a similar expression of amylase mRNA was also detected in the mammalian livers by a reverse transcriptional-polymerase chain reaction using primers specific for the human salivary and/or pancreatic amylase complementary DNA (cDNA) sequences. The amylase was detected at the catalytic activity, protein molecule and mRNA levels in rat liver at all ages from fetus to adult. Salivary-type liver amylase activity increased up to one week after birth, and was maintained at the adult level thereafter. However, based on the results of the electrophoretic mobility test, livers with accelerated amylase activity, e.g., at 2-4 weeks after birth or during liver regeneration after partial hepatectomy, were also found to express an amylase electrophoretical identical to pancreatic-type amylase in addition to salivary-type activity. These results suggest that the liver may express an etopic amylase in a certain condition.

  8. Action pattern of human pancreatic and salivary alpha-amylase on 1,4-alpha-D-nitrophenylmaltooligosaccharides. 1,4-alpha-D-nitrophenylmaltooligosaccharides as substrates of alpha-amylse, I.

    PubMed

    Wallenfels, K; Laule, G; Meltzer, B

    1982-08-01

    High performance liquid chromatography (HPLC) was used to monitor the purity of the substrates and to establish the patterns of hydrolysis of ortho- and para-nitrophenylmaltooligosaccharides (2-7 glucose residues) catalysed by human pancreatic and salivary alpha-amylase. Separation of the reaction products from the remaining substrate was performed on a TSK-G-2000 PW or a RP18 column. By measuring the quantitative distribution of products, and assuming a 5-subsite model for the active site of alpha-amylase, differential activities for the hydrolysis of the different glycosidic bonds in the 2 series of substrates were deduced. A highly sensitive coupled continuous assay system is based on the formation of phenyloligosaccharides with 1-4 glucose residues by the action of the amylase under test, coupled to hydrolysis of these products by yeast alpha-glucosidase. The most suitable test substrates were shown to be para-nitrophenyl-alpha-D-maltotetraoside and -pentaoside. Direct production of nitrophenol from ortho-nitrophenyl-alpha-D-maltotrioside is recommended for the measurement of the alpha-amylase activity of pancreatic and salivary gland secretions and extracts.

  9. Modeling of cooked starch digestion process using recombinant human pancreatic α-amylase and maltase-glucoamylase for in vitro evaluation of α-glucosidase inhibitors.

    PubMed

    Cao, Xiaofang; Zhang, Chen; Dong, Yangyang; Geng, Peng; Bai, Fang; Bai, Gang

    2015-09-23

    In human, digestion of cooked starch mainly involves breaking down of α-amylase to α-limit dextrins and small linear malto-oligosaccharides, which are in turn hydrolyzed to glucose by the gut mucosal maltase-glucoamylase (MGAM). Human pancreatic α-amylase (HPA), amino- and carboxyl-terminal portions of MGAM (ntMGAM and ctMGAM) catalyze the hydrolysis of α-D-(1,4) glycosidic linkages in starch, playing a crucial role in the production of glucose in the human lumen. Accordingly, these enzymes are effective drug targets for the treatments of type 2 diabetes and obesity. In this study, a Plackett-Burman based statistical screening procedure was adopted to determine the most critical factors affecting cooked starch digestion by the combination of HPA, ctMGAM and ntMGAM. Six factors were tested and experimental results showed that pH and temperature were the major influencing factors, with optimal pH and temperature at 6.0 and 50 °C, respectively. Surprisingly, ntMGAM had no significant contribution to the glucose production from starch digestion compared to the HPA and ctMGAM. The optimal proportion of HPA and ctMGAM in a starch digestion system was further determined by response surface methodology. Results showed a maximum starch digestion (88.05%) within 0.5 h when used HPA:ctMGAM=1:9 (U). The inhibitory effects of various inhibitors on the cooked starch digestion by HPA1/ctMGAM9 were evaluated by determining their half maximal inhibitory concentration (IC50) values. Acarviostatin II03 showed the highest inhibitory activity, with 67 times higher potency than acarbose. Moreover, acarviostatin II03 could significantly depress postprandial blood glucose levels in mice, better than that by acarbose. These findings suggest that our in vitro enzymatic system can simulate in vivo starch digestion process, and thus can be used to screen and evaluate α-glucosidase inhibitors.

  10. Syntenic conservation of HSP70 genes in cattle and humans

    SciTech Connect

    Grosz, M.D.; Womack, J.E.; Skow, L.C. )

    1992-12-01

    A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digested DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.

  11. Activities of Human Gene Nomenclature Committee

    SciTech Connect

    2002-07-16

    The objective of this project, shared between NIH and DOE, has been and remains to enable the medical genetics communities to use common names for genes that are discovered by different gene hunting groups, in different species. This effort provides consistent gene nomenclature and approved gene symbols to the community at large. This contributes to a uniform and consistent understanding of genomes, particularly the human as well as functional genomics based on comparisons between homologous genes in related species (human and mice).

  12. SusG: a unique cell-membrane-associated alpha-amylase from a prominent human gut symbiont targets complex starch molecules.

    PubMed

    Koropatkin, Nicole M; Smith, Thomas J

    2010-02-10

    SusG is an alpha-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  13. SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules

    SciTech Connect

    Koropatkin, Nicole M.; Smith, Thomas J.

    2010-09-21

    SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

  14. GeneCards Version 3: the human gene integrator.

    PubMed

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-08-05

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73,000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards' unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene's functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database

  15. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  16. Gene Conversion in Human Genetic Disease

    PubMed Central

    Chen, Jian-Min; Férec, Claude; Cooper, David N.

    2010-01-01

    Gene conversion is a specific type of homologous recombination that involves the unidirectional transfer of genetic material from a ‘donor’ sequence to a highly homologous ‘acceptor’. We have recently reviewed the molecular mechanisms underlying gene conversion, explored the key part that this process has played in fashioning extant human genes, and performed a meta-analysis of gene-conversion events known to have caused human genetic disease. Here we shall briefly summarize some of the latest developments in the study of pathogenic gene conversion events, including (i) the emerging idea of minimal efficient sequence homology (MESH) for homologous recombination, (ii) the local DNA sequence features that appear to predispose to gene conversion, (iii) a mechanistic comparison of gene conversion and transient hypermutability, and (iv) recently reported examples of pathogenic gene conversion events. PMID:24710102

  17. Detergent-compatible bacterial amylases.

    PubMed

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  18. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  19. A Catholic perspective on human gene therapy.

    PubMed

    Cassidy, Joseph D; Pellegrino, Edmund D

    1993-03-01

    The questions of changes in the human genetic program have been debated by world legislatures, churches, and scientific communities. Papal teachings emphasize a global respect for each patient and the sacred dignity of all human beings. We outline six moral principles proposed as Catholic Christian perspective applicable to a bioethical evaluation of advances in human gene transfer.

  20. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    SciTech Connect

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. )

    1989-09-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  1. Gene Insertion Into Genomic Safe Harbors for Human Gene Therapy

    PubMed Central

    Papapetrou, Eirini P; Schambach, Axel

    2016-01-01

    Genomic safe harbors (GSHs) are sites in the genome able to accommodate the integration of new genetic material in a manner that ensures that the newly inserted genetic elements: (i) function predictably and (ii) do not cause alterations of the host genome posing a risk to the host cell or organism. GSHs are thus ideal sites for transgene insertion whose use can empower functional genetics studies in basic research and therapeutic applications in human gene therapy. Currently, no fully validated GSHs exist in the human genome. Here, we review our formerly proposed GSH criteria and discuss additional considerations on extending these criteria, on strategies for the identification and validation of GSHs, as well as future prospects on GSH targeting for therapeutic applications. In view of recent advances in genome biology, gene targeting technologies, and regenerative medicine, gene insertion into GSHs can potentially catalyze nearly all applications in human gene therapy. PMID:26867951

  2. Cloning and starch degradation profile of maltotriose-producing amylases from Streptomyces species.

    PubMed

    Kashiwagi, Norimasa; Miyake, Michiru; Hirose, Shuichi; Sota, Masahiro; Ogino, Chiaki; Kondo, Akihiko

    2014-11-01

    The end products from starch hydrolysis by amylases have important applications in various industries. Here, two amylases derived from two Streptomyces species that hydrolyze soluble starch from potato produced maltotriose as the primary maltooligosaccharide product. The genes, annotated as putative glycoside hydrolases, were cloned and expressed in Streptomyces lividans. These amylases displayed hydrolysis activity from pH 3 to 9.5 and were not affected by Ca(2+.) Optimal production of maltotriose was between 20 and 30 °C at pH 6.5. At the optimal temperature, both amylases produced maltotriose-rich end products rather than either maltose or maltotetraose.

  3. Genome editing for human gene therapy.

    PubMed

    Meissner, Torsten B; Mandal, Pankaj K; Ferreira, Leonardo M R; Rossi, Derrick J; Cowan, Chad A

    2014-01-01

    The rapid advancement of genome-editing techniques holds much promise for the field of human gene therapy. From bacteria to model organisms and human cells, genome editing tools such as zinc-finger nucleases (ZNFs), TALENs, and CRISPR/Cas9 have been successfully used to manipulate the respective genomes with unprecedented precision. With regard to human gene therapy, it is of great interest to test the feasibility of genome editing in primary human hematopoietic cells that could potentially be used to treat a variety of human genetic disorders such as hemoglobinopathies, primary immunodeficiencies, and cancer. In this chapter, we explore the use of the CRISPR/Cas9 system for the efficient ablation of genes in two clinically relevant primary human cell types, CD4+ T cells and CD34+ hematopoietic stem and progenitor cells. By using two guide RNAs directed at a single locus, we achieve highly efficient and predictable deletions that ablate gene function. The use of a Cas9-2A-GFP fusion protein allows FACS-based enrichment of the transfected cells. The ease of designing, constructing, and testing guide RNAs makes this dual guide strategy an attractive approach for the efficient deletion of clinically relevant genes in primary human hematopoietic stem and effector cells and enables the use of CRISPR/Cas9 for gene therapy.

  4. Acyclic peptide inhibitors of amylases.

    PubMed

    Pohl, Nicola

    2005-12-01

    In this issue of Chemistry and Biology, a library screening approach reveals a linear octapeptide inhibitor of alpha-amylases reached by de novo design . The selected molecule shares characteristics with naturally occurring protein inhibitors -- a result that suggests general rules for the design of peptide-based amylase inhibitors may be achievable.

  5. A gene map of the human genome.

    PubMed

    Schuler, G D; Boguski, M S; Stewart, E A; Stein, L D; Gyapay, G; Rice, K; White, R E; Rodriguez-Tomé, P; Aggarwal, A; Bajorek, E; Bentolila, S; Birren, B B; Butler, A; Castle, A B; Chiannilkulchai, N; Chu, A; Clee, C; Cowles, S; Day, P J; Dibling, T; Drouot, N; Dunham, I; Duprat, S; East, C; Edwards, C; Fan, J B; Fang, N; Fizames, C; Garrett, C; Green, L; Hadley, D; Harris, M; Harrison, P; Brady, S; Hicks, A; Holloway, E; Hui, L; Hussain, S; Louis-Dit-Sully, C; Ma, J; MacGilvery, A; Mader, C; Maratukulam, A; Matise, T C; McKusick, K B; Morissette, J; Mungall, A; Muselet, D; Nusbaum, H C; Page, D C; Peck, A; Perkins, S; Piercy, M; Qin, F; Quackenbush, J; Ranby, S; Reif, T; Rozen, S; Sanders, C; She, X; Silva, J; Slonim, D K; Soderlund, C; Sun, W L; Tabar, P; Thangarajah, T; Vega-Czarny, N; Vollrath, D; Voyticky, S; Wilmer, T; Wu, X; Adams, M D; Auffray, C; Walter, N A; Brandon, R; Dehejia, A; Goodfellow, P N; Houlgatte, R; Hudson, J R; Ide, S E; Iorio, K R; Lee, W Y; Seki, N; Nagase, T; Ishikawa, K; Nomura, N; Phillips, C; Polymeropoulos, M H; Sandusky, M; Schmitt, K; Berry, R; Swanson, K; Torres, R; Venter, J C; Sikela, J M; Beckmann, J S; Weissenbach, J; Myers, R M; Cox, D R; James, M R; Bentley, D; Deloukas, P; Lander, E S; Hudson, T J

    1996-10-25

    The human genome is thought to harbor 50,000 to 100,000 genes, of which about half have been sampled to date in the form of expressed sequence tags. An international consortium was organized to develop and map gene-based sequence tagged site markers on a set of two radiation hybrid panels and a yeast artificial chromosome library. More than 16,000 human genes have been mapped relative to a framework map that contains about 1000 polymorphic genetic markers. The gene map unifies the existing genetic and physical maps with the nucleotide and protein sequence databases in a fashion that should speed the discovery of genes underlying inherited human disease. The integrated resource is available through a site on the World Wide Web at http://www.ncbi.nlm.nih.gov/SCIENCE96/.

  6. Exon structure of the human dystrophin gene

    SciTech Connect

    Roberts, R.G.; Coffey, A.J.; Bobrow, M.; Bentley, D.R.

    1993-05-01

    Application of a novel vectorette PCR approach to defining intron-exon boundaries has permitted completion of analysis of the exon structure of the largest and most complex known human gene. The authors present here a summary of the exon structure of the entire human dystrophin gene, together with the sizes of genomic HindIII fragments recognized by each exon, and (where available) GenBank accession numbers for adjacent intron sequences. 20 refs., 1 tab.

  7. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  8. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  9. Probing the role of aromatic residues at the secondary saccharide binding sites of human salivary α-amylase in substrate hydrolysis and bacterial binding

    PubMed Central

    Ragunath, Chandran; Manuel, Suba G.A.; Venkataraman, Venkat; Sait, Hameetha B.R.; Kasinathan, Chinnasamy; Ramasubbu, Narayanan

    2008-01-01

    SUMMARY Human salivary α-amylase (HSAmy) has three distinct functions relevant to oral health: 1) hydrolysis of starch; 2) binding to hydroxyapatite; and 3) binding to bacteria (e.g. viridans streptococci). Although the active site of HSAmy for starch hydrolysis is well characterized, the regions responsible for the bacterial binding are yet to be defined. Since HSAmy possesses several secondary saccharide-binding sites in which aromatic residues are prominently located, we hypothesized that one or more of the secondary saccharide binding sites harboring the aromatic residues may play an important role in bacterial binding. To test this hypothesis, the aromatic residues at five secondary binding sites were mutated to alanine to generate six mutants representing either single (W203A, Y276A and W284A), double (Y276A/W284A and W316A/W388A) or multiple (HSAmy-ar; W134A/W203A/Y276A/W284A/W316A/W388A) mutations. The crystal structure of HSAmy-ar was determined at a resolution of 1.5 Å as an acarbose complex and compared with the existing wild type acarbose complex. The wild type and the mutant enzymes were characterized for their abilities to exhibit enzyme activity, starch binding, hydroxyapatite and bacterial binding activities. Our results clearly showed that 1) mutation of aromatic residues does not alter the overall conformation of the molecule; 2) the single or double mutants showed either moderate or minimal changes in both starch and bacterial binding activities activity whereas the HSAmy-ar showed significant reduction in these activities; 3) the starch hydrolytic activity was reduced 10-fold in HSAmy-ar; 4) oligosaccharide hydrolytic activity was reduced in all the mutants but the action pattern was similar to that of the wild type enzyme; and 5) the hydroxyaptite binding was unaffected in HSAmy-ar. These results clearly show that the aromatic residues at the secondary saccharide binding sites in HSAmy play a critical role in bacterial binding and starch

  10. Alpha-amylases of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant amylase inhibitors.

    PubMed

    Valencia, A; Bustillo, A E; Ossa, G E; Chrispeels, M J

    2000-03-01

    The adult coffee berry borer (Hypothenemus hampei Ferrari [Coleoptera: Scolytidae]), a major insect pest of coffee, has two major digestive alpha-amylases that can be separated by isoelectric focusing. The alpha-amylase activity has a broad pH optimum between 4.0 and 7.0. Using pH indicators, the pH of the midgut was determined to be between 4.5 and 5.2. At pH 5.0, the coffee berry borer alpha-amylase activity is inhibited substantially (80%) by relatively low levels of the amylase inhibitor (alphaAI-1) from the common bean, Phaseolus vulgaris L., and much less so by the amylase inhibitor from Amaranthus. We used an in-gel zymogram assay to demonstrate that seed extracts can be screened to find suitable inhibitors of amylases. The prospect of using the genes that encode these inhibitors to make coffee resistant to the coffee berry borer via genetic engineering is discussed.

  11. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.

    PubMed

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D

    2013-04-01

    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed.

  12. [Some enzymatic activities of the amniotic fluid in human beings (LAP, GGTP, SGOT, SGPT, acid and alkaline phosphatases, 5' nucleotidase, amylase, beta-glucuronidase and aldolase)].

    PubMed

    Galerne, D; Baudon, J; Bruhat, M; Dastugue, G

    1973-10-01

    Quantitative analyses of 10 enzymes (LAP, GGTP, SGOT, SGPT. acid and alkaline phosphatases, 5' nucleotidase, amylase. beta-glucuronidase and aldolase) in a series of 50 samples of amniotic fluid gave widely-scattered results. In some cases, it was possible to relate high enzymatic activity to a pathological condition, in other cases, the amniotic fluid examined seemed to come from normal, full-term or almost full-term pregnancies without particular signs.

  13. [Immune response genes products in human physiology].

    PubMed

    Khaitov, R M; Alekseev, L P

    2012-09-01

    Current data on physiological role of human immune response genes' proteomic products (antigens) are discussed. The antigens are specified by a very high level of diversity that mediates a wide specter ofphysiological functions. They actually provide integrity and biological stability of human as species. These data reveal new ideas on many pathological processes as well as drafts new approaches for prophylaxis and treatment.

  14. Organization of the human myoglobin gene.

    PubMed Central

    Weller, P; Jeffreys, A J; Wilson, V; Blanchetot, A

    1984-01-01

    Cross-hybridization of the grey seal myoglobin gene to human DNA detected a single human myoglobin gene plus an extensive family of sequences apparently related to the central exon of this gene. The functional human gene is 10.4 kb long and has a haemoglobin-like three exon/two intron structure with long non-coding regions similar to its seal homologue. At least 300 bp of 5'-flanking region are closely homologous between the two genes, with the exception of a divergent purine-rich region 68-114 bp upstream of the cap site. A diverged tandem repetitive sequence based on (GGAT)165 is located 1100-1750 bp upstream from the gene; internal homology units within this sequence suggest sequence homogenization by gene microconversions. A second 33-bp tandem repeat element in the first intron is flanked by a 9-bp direct repeat, shares homology with other tandem repetitive elements in the human genome and may represent a novel form of transposable element. Images Fig. 2. PMID:6571704

  15. Expression of polarity genes in human cancer.

    PubMed

    Lin, Wan-Hsin; Asmann, Yan W; Anastasiadis, Panos Z

    2015-01-01

    Polarity protein complexes are crucial for epithelial apical-basal polarity and directed cell migration. Since alterations of these processes are common in cancer, polarity proteins have been proposed to function as tumor suppressors or oncogenic promoters. Here, we review the current understanding of polarity protein functions in epithelial homeostasis, as well as tumor formation and progression. As most previous studies focused on the function of single polarity proteins in simplified model systems, we used a genomics approach to systematically examine and identify the expression profiles of polarity genes in human cancer. The expression profiles of polarity genes were distinct in different human tissues and classified cancer types. Additionally, polarity expression profiles correlated with disease progression and aggressiveness, as well as with identified cancer types, where specific polarity genes were commonly altered. In the case of Scribble, gene expression analysis indicated its common amplification and upregulation in human cancer, suggesting a tumor promoting function.

  16. Paper-based α-amylase detector for point-of-care diagnostics.

    PubMed

    Dutta, Satarupa; Mandal, Nilanjan; Bandyopadhyay, Dipankar

    2016-04-15

    We report the fabrication of a paper-sensor for quantitative detection of α-amylase activity in human blood serum. Pieces of filter papers were coated with starch-iodine solution leading to an intense blue coloration on the surface. Dispensing α-amylase solution on the starch-iodine coated paper reduced the intensity of the color because of starch-hydrolysis catalyzed by amylase. The variation in the intensity of the color with the concentration of amylase was estimated in three stages: (i) initially, the paper-surface was illuminated with a light emitting diode, (ii) then, the transmitted (reflected) rays emitted through (from) the paper were collected on a photoresistor, and (iii) the variations in the electrical resistance of the photoresistor were correlated with the amylase concentration in analyte. The resistance of photoresistor decreased monotonically with an increase in amylase concentration because the intensity of the reflected (transmitted) rays collected from (through) the paper increased with reduction in the color intensity on the paper surface. Since a specific bio-reaction was employed to detect the activity of amylase, the sensor was found to be equally efficient in detecting unknown quantities of amylase in human blood serum. The reported sensor has shown the potential to graduate into a point-of-care detection tool for α-amylase.

  17. Gene therapy for human genetic disease?

    PubMed

    Friedmann, T; Roblin, R

    1972-03-03

    In our view, gene therapy may ameliorate some human genetic diseases in the future. For this reason, we believe that research directed at the development of techniques for gene therapy should continue. For the foreseeable future, however, we oppose any further attempts at gene therapy in human patients because (i) our understanding of such basic processes as gene regulation and genetic recombination in human cells is inadequate; (ii) our understanding of the details of the relation between the molecular defect and the disease state is rudimentary for essentially all genetic diseases; and (iii) we have no information on the short-range and long-term side effects of gene therapy. We therefore propose that a sustained effort be made to formulate a complete set of ethicoscientific criteria to guide the development and clinical application of gene therapy techniques. Such an endeavor could go a long way toward ensuring that gene therapy is used in humans only in those instances where it will prove beneficial, and toward preventing its misuse through premature application. Two recent papers have provided new demonstrations of directed genetic modification of mammalian cells. Munyon et al. (44) restored the ability to synthesize the enzyme thymidine kinase to thymidine kinase-deficient mouse cells by infection with ultraviolet-irradiated herpes simplex virus. In their experiments the DNA from herpes simplex virus, which contains a gene coding for thymidine kinase, may have formed a hereditable association with the mouse cells. Merril et al. (45) reported that treatment of fibroblasts from patients with galactosemia with exogenous DNA caused increased activity of a missing enzyme, alpha-D-galactose-l-phosphate uridyltransferase. They also provided some evidence that the change persisted after subculturing the treated cells. If this latter report can be confirmed, the feasibility of directed genetic modification of human cells would be clearly demonstrated, considerably

  18. Isolation of Mutants Defective in α-Amylase from Bacillus subtilis: Genetic Analyses

    PubMed Central

    Yamaguchi, Kazuo; Nagata, Yoshiho; Maruo, Bunji

    1974-01-01

    The rate of α-amylase (EC 3.2.1.1) synthesis in Bacillus subtilis is regulated by a gene, amyR, located near a structural gene, amyE, for the enzyme. To construct a fine map of the amyR-amyE region, we isolated 28 mutants defective in α-amylase activity. Eleven mutants out of 28 showed no α-amylase activity, whereas the other 17 showed less α-amylase activity than the parent. Out of 17 partially positive α-amylase mutants, 10 produced temperature-sensitive enzymes, and 4 produced immunologically altered enzymes, two of which are concurrently temperature-sensitive, and 5 produced smaller amounts of α-amylases which are indistinguishable from normal enzyme in their temperature sensitivity and immunological properties. Two out of 11 α-amylase-negative mutants produced material that cross-reacted with anti-amylase serum, and 3 mutants carried suppressible mutations by the suppressor described by Okubo. Mapping data indicate that all 28 mutation sites are located in the amyE region, and none of the groups of the mutants mentioned above contains lesions that are clustered in a single region of amyE. The amyR gene seems most likely to adjoin the terminal region of amyE. PMID:4212116

  19. False-positive results with amylase testing of citrus fruits.

    PubMed

    Ricci, Ugo; Carboni, Ilaria; Torricelli, Francesca

    2014-09-01

    In a case of robbery in which the criminals passed through the garden adorned with calamondin trees (Citrus madurensis), the investigators found in the grass six calamondin fruits, some undamaged, while others apparently bitten. The fruits were collected and sent to the laboratory for DNA analysis to verify the presence of saliva and robbers' DNA profile. A specific immunochromatographic strip test for saliva confirmed the presence of human salivary α-amylase, but similar positive results were also observed for intact calamondin and other citrus fruits. Further analysis with a specific automated amylase test confirmed the absence of amylase activity. DNA quantification and typing using a specific forensic kit revealed no human DNA presence in any fruits. This case report demonstrates for the first time the occurrence of false positives when human saliva is sought on citrus fruits.

  20. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    PubMed

    Rodríguez-Viera, Leandro; Perera, Erick; Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  1. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus

    PubMed Central

    Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  2. The retinoblastoma gene in human pituitary tumors

    SciTech Connect

    Cryns, V.L.; Arnold, A.; Alexander, J.M.; Klibanski, A. )

    1993-09-01

    Functional inactivation of the retinoblastoma (RB) tumor suppressor gene is important in the pathogenesis of many human tumors. Recently, the frequent occurrence of pituitary tumors was reported in mice genetically engineered to have one defective RB allele, a genetic background analogous to that of patients with familial retinoblastoma. The molecular pathogenesis of human pituitary tumors is largely unknown, and the potential role of RB gene inactivation in these neoplasms has not been examined. Consequently, the authors studied 20 human pituitary tumors (12 clinically nonfunctioning tumors, 4 somatotroph adenomas, 2 prolactinomas, and 2 corticotrophy adenomas) for tumor-specific allelic loss of the RB gene using a highly informative polymorphic locus within the gene. Control leukocyte DNA samples from 18 of these 20 patients were heterozygous at this locus, permitting genetic evaluation of their paired tumor specimens. In contrast to the pituitary tumors in the mouse model, none of these 18 human tumors exhibited RB allelic loss. These findings indicate that RB gene inactivation probably does not play an important role in the pathogenesis of common types of human pituitary tumors. 24 refs., 1 fig.

  3. Human DNA repair and recombination genes

    SciTech Connect

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs.

  4. Establishment of a novel, eco-friendly transgenic pig model using porcine pancreatic amylase promoter-driven fungal cellulase transgenes.

    PubMed

    Lin, Y S; Yang, C C; Hsu, C C; Hsu, J T; Wu, S C; Lin, C J; Cheng, W T K

    2015-02-01

    Competition between humans and livestock for cereal and legume grains makes it challenging to provide economical feeds to livestock animals. Recent increases in corn and soybean prices have had a significant impact on the cost of feed for pig producers. The utilization of byproducts and alternative ingredients in pig diets has the potential to reduce feed costs. Moreover, unlike ruminants, pigs have limited ability to utilize diets with high fiber content because they lack endogenous enzymes capable of breaking down nonstarch polysaccharides into simple sugars. Here, we investigated the feasibility of a transgenic strategy in which expression of the fungal cellulase transgene was driven by the porcine pancreatic amylase promoter in pigs. A 2,488 bp 5'-flanking region of the porcine pancreatic amylase gene was cloned by the genomic walking technique, and its structural features were characterized. Using GFP as a reporter, we found that this region contained promoter activity and had the potential to control heterologous gene expression. Transgenic pigs were generated by pronuclear microinjection. Founders and offspring were identified by PCR and Southern blot analyses. Cellulase mRNA and protein showed tissue-specific expression in the pancreas of F1 generation pigs. Cellulolytic enzyme activity was also identified in the pancreas of transgenic pigs. These results demonstrated the establishment of a tissue-specific promoter of the porcine pancreatic amylase gene. Transgenic pigs expressing exogenous cellulase may represent a way to increase the intake of low-cost, fiber-rich feeds.

  5. The organization of the human HPRT gene.

    PubMed Central

    Kim, S H; Moores, J C; David, D; Respess, J G; Jolly, D J; Friedmann, T

    1986-01-01

    The organization of the X-linked gene for human hypoxanthine phosphoribosyltransferase (HPRT, EC 2.4.2.8.) has been determined by a combination of restriction endonuclease mapping, heteroduplex analysis and DNA sequence analysis of overlapping genomic clones. The entire gene is 42 kilobases in length and split into 9 exons. The sizes of the 7 internal exons and the exon-intron boundaries are identical to those of mouse HPRT gene. The 5' end of the gene lacks the prototypical 5' transcriptional regulatory sequence elements but contains extremely GC-rich sequences and five GC hexanucleotide motifs (5'-GGCGGG-3'). These structural features are very similar to those found in the mouse HPRT gene and to some of the regulatory signals common to a class of constitutively expressed "housekeeping" genes. Several transcriptional start sites have been identified by nuclease protection studies. Extensive sequence homology between the mouse and human genes is found in the 3' non-coding portion of the gene. Images PMID:3008106

  6. [EDAS, databases of alternatively spliced human genes].

    PubMed

    Nurtdinov, R N; Neverov, A D; Mal'ko, D B; Kosmodem'ianskiĭ, I A; Ermakova, E O; Ramenskiĭ, V E; Mironov, A A; Gel'fand, M S

    2006-01-01

    EDAS, a database of alternatively spliced human genes, contains data on the alignment of proteins, mRNAs, and EST. It contains information on all exons and introns observed, as well as elementary alternatives formed from them. The database makes it possible to filter the output data by changing the cut-off threshold by the significance level. The database is accessible at http://www.gene-bee.msu.ru/edas/.

  7. Advances in gene technology: Human genetic disorders

    SciTech Connect

    Scott, W.A.; Ahmad, F.; Black, S.; Schultz, J.; Whelan, W.J.

    1984-01-01

    This book discusses the papers presented at the conference on the subject of ''advances in Gene technology: Human genetic disorders''. Molecular biology of various carcinomas and inheritance of metabolic diseases is discussed and technology advancement in diagnosis of hereditary diseases is described. Some of the titles discussed are-Immunoglobulin genes translocation and diagnosis; hemophilia; oncogenes; oncogenic transformations; experimental data on mice, hamsters, birds carcinomas and sarcomas.

  8. Allelic selection of human IL-2 gene.

    PubMed

    Matesanz, F; Delgado, C; Fresno, M; Alcina, A

    2000-12-01

    The allelic expression of mouse IL-2 cannot be definitely extrapolated to what might happen in humans. Therefore, we investigated the regulation of allelic expression of the IL-2 gene in non-genetically manipulated human T lymphocytes by following natural allelic polymorphisms. We found a phenotypically silent punctual change in the human IL-2 at position 114 after the first nucleotide of the initiation codon, which represents a dimorphic polymorphism at the first exon of the IL-2 gene. This allowed the study by single-cell PCR of the regulation of the human IL-2 allelic expression in heterozygous CD4(+) T cells, which was found to be tightly controlled monoallelically. These findings may be used as a suitable marker for monitoring the IL-2 allelic contribution to effector activities and in immune responses against different infections or in pathological situations.

  9. What drives codon choices in human genes?

    PubMed

    Karlin, S; Mrázek, J

    1996-10-04

    Synonymous codon usage is based and the bias seems to be different in different organisms. Factors with proposed roles in causing codon bias include degree and timing of gene expression, codon-anticodon interactions, transcription and translation rate and fidelity, codon context, and global and local G + C content. We offer a new perspective and new methods for elucidating codon choices applied especially to the human genome. We present data supporting the thesis that codon choices for human genes are largely a consequence of two factors: (1) amino acid constraints, (2) maintaining DNA structures dependent on base-step conformational tendencies consistent with the organism's genome signature that is determined by genome-wide processes of DNA modification, replication and repair. The related codon signature defined as the dinucleotide relative abundances at the distinct codon positions (1,2), (2,3), and (3,4) (4 = 1 of the next codon) accommodates both the global genome signature and amino acid constraints. In human genes, codon positions (2,3) and (3,4) containing the silent site have similar codon signatures reflecting DNA symmetry. Strong CG and TA dinucleotide underrepresentation is observed at all codon positions as well as in non-coding regions. Estimates of synonymous codon usage based on codon signatures are in excellent agreement with the actual codon usage in human and general vertebrate genes. These properties are largely independent of the isochore compartment (G + C content), gene size, and transcriptional and translational constraints. We hypothesize that major influences on codon usage in human genes result from residue preferences and diresidue associations in proteins coupled to biases on the DNA level, related to replication and repair processes and/or DNA structural requirements.

  10. Mutational analysis of the human MAOA gene

    SciTech Connect

    Tivol, E.A.; Shalish, C.; Schuback, D.E.; Breakefield, X.O.; Hsu, Yun-Pung

    1996-02-16

    The monoamine oxidases (MAO-A and MAO-B) are the enzymes primarily responsible for the degradation of amine neurotransmitters, such as dopamine, norepinephrine, and serotonin. Wide variations in activity of these isozymes have been reported in control humans. The MAOA and MAOB genes are located next to each other in the p11.3-11.4 region of the human X chromosome. Our recent documentation of an MAO-A-deficiency state, apparently associated with impulsive aggressive behavior in males, has focused attention on genetic variations in the MAOA gene. In the present study, variations in the coding sequence of the MAOA gene were evaluated by RT-PCR, SSCP, and sequencing of mRNA or genomic DNA in 40 control males with >100-fold variations in MAOA activity, as measured in cultured skin fibroblasts. Remarkable conservation of the coding sequence was found, with only 5 polymorphisms observed. All but one of these were in the third codon position and thus did not alter the deduced amino acid sequence. The one amino acid alteration observed, lys{r_arrow}arg, was neutral and should not affect the structure of the protein. This study demonstrates high conservation of coding sequence in the human MAOA gene in control males, and provides primer sets which can be used to search genomic DNA for mutations in this gene in males with neuropsychiatric conditions. 47 refs., 1 fig., 2 tabs.

  11. Gene targeting in primary human trophoblasts

    PubMed Central

    Rosario, Fredrick J; Sadovsky, Yoel; Jansson, Thomas

    2012-01-01

    Studies in primary human trophoblasts provide critical insights into placental function in normal and complicated pregnancies. Mechanistic studies in these cells require experimental tools to modulate gene expression. Lipid-based methods to transfect primary trophoblasts are fairly simple to use and allow for the efficient delivery of nucleic acids, but potential toxic effects limit these methods. Viral vectors are versatile transfection tools of native trophoblastic or foreign cDNAs, providing high transfection efficiency, low toxicity and stable DNA integration into the trophoblast genome. RNA interference (RNAi), using small interfering RNA (siRNA) or microRNA, constitutes a powerful approach to silence trophoblast genes. However, off-target effects, such as regulation of unintended complementary transcripts, inflammatory responses and saturation of the endogenous RNAi machinery, are significant concerns. Strategies to minimize off-target effects include using multiple individual siRNAs, elimination of pro-inflammatory sequences in the siRNA construct and chemical modification of a nucleotide in the guide strand or of the ribose moiety. Tools for efficient gene targeting in primary human trophoblasts are currently available, albeit not yet extensively validated. These methods are critical for exploring the function of human trophoblast genes and may provide a foundation for the future application of gene therapy that targets placental trophoblasts. PMID:22831880

  12. Gene Therapy of Human Breast Cancer

    DTIC Science & Technology

    1996-10-01

    anticoagulation are ineligible. Study Design. Patients will undergo surgical removal of metastatic disease under local anesthesia in order to provide...tolerate this treatment . Gene Therapy of Human Breast Cancer - Appendix F 1 1 . Patients who require anticoagulation are not eligible. 12 . There i...pregnancy, or lactation, or any significant uncontrolled medical or pyschiatric illness. Patients wh� require corticosteroids or anticoagulation are

  13. Human pigmentation genes under environmental selection

    PubMed Central

    2012-01-01

    Genome-wide association studies and comparative genomics have established major loci and specific polymorphisms affecting human skin, hair and eye color. Environmental changes have had an impact on selected pigmentation genes as populations have expanded into different regions of the globe. PMID:23110848

  14. Biochemical characterization of the alpha-amylase inhibitor in mungbeans and its application in inhibiting the growth of Callosobruchus maculatus.

    PubMed

    Wisessing, Anussorn; Engkagul, Arunee; Wongpiyasatid, Arunee; Choowongkomon, Kiattawee

    2010-02-24

    The insect Callosobruchus maculatus causes considerable damage to harvested mungbean seeds every year, which leads to commercial losses. However, recent studies have revealed that mungbean seeds contain alpha-amylase inhibitors that can inhibit the protein C. maculatus, preventing growth and development of the insect larvae in the seed, thus preventing further damage. For this reason, the use of alpha-amylase inhibitors to interfere with the pest's digestion process has become an interesting alternative biocontrolling agent. In this study, we have isolated and purified the alpha-amylase inhibitor from mungbean seeds (KPS1) using ammonium sulfate precipitation, gel filtration chromatography and reversed phase HPLC. We found that the alpha-amylase inhibitor, isolated as a monomer, had a molecular weight of 27 kDa. The alpha-amylase inhibitor was purified 750-fold with a final yield of 0.4 mg of protein per 30 g of mungbean seeds. Its specific activity was determined at 14.5 U (mg of protein)(-1). Interestingly, we found that the isolated alpha-amylase inhibitor inhibits C. maculatus alpha-amylase but not human salivary alpha-amylase. After preincubation of the enzyme with the inhibitor, the mungbean alpha-amylase inhibitor inhibited C. maculatus alpha-amylase activity by decreasing V(max) while increasing the K(m) constant, indicating that the mungbean alpha-amylase is a mix noncompetitive inhibitor. The in vivo effect of alpha-amylase inhibitor on the mortality of C. maculatus shows that the alpha-amylase inhibitor acts on C. maculatus during the development stage, by reducing carbohydrate digestion necessary for growth and development, rather than during the end laying/hatching stage. Our results suggest that mungbean alpha-amylase inhibitor could be a useful future biocontrolling agent.

  15. Mango starch degradation. II. The binding of alpha-amylase and beta-amylase to the starch granule.

    PubMed

    Peroni, Fernanda Helena Gonçalves; Koike, Claudia; Louro, Ricardo Pereira; Purgatto, Eduardo; do Nascimento, João Roberto Oliveira; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2008-08-27

    During mango ripening, soluble sugars that account for mango sweetening are accumulated through carbon supplied by both photosynthesis and starch degradation. The cultivar Keitt has a characteristic dependence on sugar accumulation during starch degradation, which takes place during ripening, only a few days after detachment from the tree. Most knowledge about starch degradation is based on seeds and leaves currently used as models. However, information about the mango fruit is scarce. This work presents the evaluation of alpha- and beta-amylases in the starch granule surface during fruit development and ripening. Extractable proteins were assayed for amylase activity and detected by immunofluorescence microscopy and correlated to gene expression. The results suggest that both amylases are involved in starch degradation during mango ripening, probably under the dependence of another signal triggered by the detachment from the mother-plant.

  16. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    NASA Astrophysics Data System (ADS)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  17. Efficient production of optically pure D-lactic acid from raw corn starch by using a genetically modified L-lactate dehydrogenase gene-deficient and alpha-amylase-secreting Lactobacillus plantarum strain.

    PubMed

    Okano, Kenji; Zhang, Qiao; Shinkawa, Satoru; Yoshida, Shogo; Tanaka, Tsutomu; Fukuda, Hideki; Kondo, Akihiko

    2009-01-01

    In order to achieve direct and efficient fermentation of optically pure D-lactic acid from raw corn starch, we constructed L-lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum and introduced a plasmid encoding Streptococcus bovis 148 alpha-amylase (AmyA). The resulting strain produced only D-lactic acid from glucose and successfully expressed amyA. With the aid of secreting AmyA, direct D-lactic acid fermentation from raw corn starch was accomplished. After 48 h of fermentation, 73.2 g/liter of lactic acid was produced with a high yield (0.85 g per g of consumed sugar) and an optical purity of 99.6%. Moreover, a strain replacing the ldhL1 gene with an amyA-secreting expression cassette was constructed. Using this strain, direct D-lactic acid fermentation from raw corn starch was accomplished in the absence of selective pressure by antibiotics. This is the first report of direct D-lactic acid fermentation from raw starch.

  18. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation

    PubMed Central

    Nakajima, Kei

    2016-01-01

    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations (CNVs) in the salivary amylase gene (AMY1), which range more broadly than the pancreatic amylase gene (AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent (minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance (major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome. PMID:27022442

  19. Human gene therapy and slippery slope arguments.

    PubMed Central

    McGleenan, T

    1995-01-01

    Any suggestion of altering the genetic makeup of human beings through gene therapy is quite likely to provoke a response involving some reference to a 'slippery slope'. In this article the author examines the topography of two different types of slippery slope argument, the logical slippery slope and the rhetorical slippery slope argument. The logical form of the argument suggests that if we permit somatic cell gene therapy then we are committed to accepting germ line gene therapy in the future because there is no logically sustainable distinction between them. The rhetorical form posits that allowing somatic cell therapy now will be taking the first step on a slippery slope which will ultimately lead to the type of genocide perpetrated by the Nazis. The author tests the validity of these lines of argument against the facts of human gene therapy and concludes that because of their dependence on probabilities that cannot be empirically proven they should be largely disregarded in the much more important debate on moral line-drawing in gene therapy. PMID:8778459

  20. Structure of the human annexin VI gene

    SciTech Connect

    Smith, P.D.; Moss, S.E.; Davies, A.; Crumpton, M.J.

    1994-03-29

    The authors report the structure of the human annexin VI gene and compare the intron-exon organization with the known structures of the human annexin I and II genes. The gene is {approximately}60 kbp long and contains 26 exons. Consistent with the published annexin VI cDNA sequence, the genomic sequence at the 3{prime} end does not contain a canonical polyadenylation signal. The genomic sequence upstream of the transcription start site contains TATAA and CAAT motifs. The spatial organization of the exons does not reveal any obvious similarities between the two halves of the annexin VI gene. Comparison of the intron-exon boundary positions of the annexin VI gene with those of annexins I and II reveals that within the repeated domains the break points are perfectly conserved except for exon 8, which is one codon smaller in annexin II. The corresponding point in the second half of annexin VI is represented by two exons, exons 20 and 21. The latter exon is alternatively spliced, giving rise to two annexin VI isoforms that differ with respect to a 6-amino acid insertion at the start of repeat 7. 32 refs., 6 figs.

  1. Marine Microbial Amylases: Properties and Applications.

    PubMed

    Suriya, J; Bharathiraja, S; Krishnan, M; Manivasagan, P; Kim, S-K

    2016-01-01

    Amylases are crucial enzymes which hydrolyze internal glycosidic linkages in starch and produce as primary products dextrins and oligosaccharides. Amylases are classified into α-amylase, β-amylase, and glucoamylase based on their three-dimensional structures, reaction mechanisms, and amino acid sequences. Amylases have innumerable applications in clinical, medical, and analytical chemistries as well as in food, detergent, textile, brewing, and distilling industries. Amylases can be produced from plants, animals, and microbial sources. Due to the advantages in microbial production, it meets commercial needs. The pervasive nature, easy production, and wide range of applications make amylase an industrially pivotal enzyme. This chapter will focus on amylases found in marine microorganisms, their potential industrial applications, and how these enzymes can be improved to the required bioprocessing conditions.

  2. Genes of human longevity: an endless quest?

    PubMed

    Capri, Miriam; Santoro, Aurelia; Garagnani, Paolo; Bacalini, Maria Giulia; Pirazzini, Chiara; Olivieri, Fabiola; Procopio, Antonio; Salvioli, Stefano; Franceschi, Claudio

    2014-01-01

    Human longevity is a complex trait in which genetics, epigenetics, environmental and stochasticity differently contribute. To disentangle the complexity, our studies on genetics of longevity were, at the beginning, mainly focused on the extreme phenotypes, i.e. centenarians who escaped the major age-related diseases compared with cross sectional cohorts. Recently, we implemented this model by studying centenarians' offspring and offspring of non-long lived parents. In association, during studies on many candidate genes SNPs, positively or negatively correlated with longevity have been identified. The results obtained on Insulin-like Growth Factor 1 Receptor (IGF1R) polymorphisms showed a correlation between specific genetic variants combinations and the low plasma level of IGF1 in centenarians, suggesting an impact of the IGF-I/insulin pathway on human longevity. This pathway together with mammalian target of rapamycin (mTOR) will be reviewed as being the most promising for longevity. Further, we will summarise the role of apolipoprotein E (APOE) variants in human longevity since the results of the large European project GEHA (Genetics of Healthy Aging) indicate APOE among the chromosomal loci associated with longevity. On the other hand, the identification of longevity-related genes does not explain the mechanisms of healthy aging and longevity rather pose questions on epigenetic contribution, gene regulation and the interactions with essential genomes, i.e. mitochondrial DNA and microbiota. To fully disentangle what appears to be an endless quest, all the components of the complexity of human longevity genetics are taken into account.

  3. Structural basis for the inhibition of mammalian and insect alpha-amylases by plant protein inhibitors.

    PubMed

    Payan, Françoise

    2004-02-12

    Alpha-amylases are ubiquitous proteins which play an important role in the carbohydrate metabolism of microorganisms, animals and plants. Living organisms use protein inhibitors as a major tool to regulate the glycolytic activity of alpha-amylases. Most of the inhibitors for which three-dimensional (3-D) structures are available are directed against mammalian and insect alpha-amylases, interacting with the active sites in a substrate-like manner. In this review, we discuss the detailed inhibitory mechanism of these enzymes in light of the recent determination of the 3-D structures of pig pancreatic, human pancreatic, and yellow mealworm alpha-amylases in complex with plant protein inhibitors. In most cases, the mechanism of inhibition occurs through the direct blockage of the active center at several subsites of the enzyme. Inhibitors exhibiting "dual" activity against mammalian and insect alpha-amylases establish contacts of the same type in alternative ways.

  4. Application of microbial α-amylase in industry – A review

    PubMed Central

    de Souza, Paula Monteiro; de Oliveira Magalhães, Pérola

    2010-01-01

    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:24031565

  5. Widespread Inducible Transcription Downstream of Human Genes

    PubMed Central

    Vilborg, Anna; Passarelli, Maria C.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.

    2015-01-01

    Summary Pervasive transcription of the human genome generates RNAs whose mode of formation and functions are largely uncharacterized. Here, we combine RNA-Seq with detailed mechanistic studies to describe a transcript type derived from protein-coding genes. The resulting RNAs, which we call DoGs for downstream of gene containing transcripts, possess long non-coding regions (often >45 kb) and remain chromatin bound. DoGs are inducible by osmotic stress through an IP3 receptor signaling-dependent pathway, indicating active regulation. DoG levels are increased by decreased termination of the upstream transcript, a previously undescribed mechanism for rapid transcript induction. Relative depletion of polyA signals in DoG regions correlates with increased levels of DoGs after osmotic stress. We detect DoG transcription in several human cell lines and provide evidence for thousands of DoGs genome-wide. PMID:26190259

  6. Genes after the human genome project.

    PubMed

    Baetu, Tudor M

    2012-03-01

    While the Human Genome Nomenclature Committee (HGNC) concept of the gene can accommodate a wide variety of genomic sequences contributing to phenotypic outcomes, it fails to specify how sequences should be grouped when dealing with complex loci consisting of adjacent/overlapping sequences contributing to the same phenotype, distant sequences shown to contribute to the same gene product, and partially overlapping sequences identified by different techniques. The purpose of this paper is to review recently proposed concepts of the gene and critically assess how well they succeed in addressing the above problems while preserving the degree of generality achieved by the HGNC concept. I conclude that a dynamic interplay between mapping and syntax-based concepts is required in order to satisfy these desiderata.

  7. The human RHOX gene cluster: target genes and functional analysis of gene variants in infertile men.

    PubMed

    Borgmann, Jennifer; Tüttelmann, Frank; Dworniczak, Bernd; Röpke, Albrecht; Song, Hye-Won; Kliesch, Sabine; Wilkinson, Miles F; Laurentino, Sandra; Gromoll, Jörg

    2016-09-15

    The X-linked reproductive homeobox (RHOX) gene cluster encodes transcription factors preferentially expressed in reproductive tissues. This gene cluster has important roles in male fertility based on phenotypic defects of Rhox-mutant mice and the finding that aberrant RHOX promoter methylation is strongly associated with abnormal human sperm parameters. However, little is known about the molecular mechanism of RHOX function in humans. Using gene expression profiling, we identified genes regulated by members of the human RHOX gene cluster. Some genes were uniquely regulated by RHOXF1 or RHOXF2/2B, while others were regulated by both of these transcription factors. Several of these regulated genes encode proteins involved in processes relevant to spermatogenesis; e.g. stress protection and cell survival. One of the target genes of RHOXF2/2B is RHOXF1, suggesting cross-regulation to enhance transcriptional responses. The potential role of RHOX in human infertility was addressed by sequencing all RHOX exons in a group of 250 patients with severe oligozoospermia. This revealed two mutations in RHOXF1 (c.515G > A and c.522C > T) and four in RHOXF2/2B (-73C > G, c.202G > A, c.411C > T and c.679G > A), of which only one (c.202G > A) was found in a control group of men with normal sperm concentration. Functional analysis demonstrated that c.202G > A and c.679G > A significantly impaired the ability of RHOXF2/2B to regulate downstream genes. Molecular modelling suggested that these mutations alter RHOXF2/F2B protein conformation. By combining clinical data with in vitro functional analysis, we demonstrate how the X-linked RHOX gene cluster may function in normal human spermatogenesis and we provide evidence that it is impaired in human male fertility.

  8. Where do animal alpha-amylases come from? An interkingdom trip.

    PubMed

    Da Lage, Jean-Luc; Danchin, Etienne G J; Casane, Didier

    2007-08-21

    Alpha-amylases are widely found in eukaryotes and prokaryotes. Few amino acids are conserved among these organisms, but at an intra-kingdom level, conserved protein domains exist. In animals, numerous conserved stretches are considered as typical of animal alpha-amylases. Searching databases, we found no animal-type alpha-amylases outside the Bilateria. Instead, we found in the sponge Reniera sp. and in the sea anemone Nematostella vectensis, alpha-amylases whose most similar cognate was that of the amoeba Dictyostelium discoideum. We found that this "Dictyo-type" alpha-amylase was shared not only by these non-Bilaterian animals, but also by other Amoebozoa, Choanoflagellates, and Fungi. This suggested that the Dictyo-type alpha-amylase was present in the last common ancestor of Unikonts. The additional presence of the Dictyo-type in some Ciliates and Excavates, suggests that horizontal gene transfers may have occurred among Eukaryotes. We have also detected putative interkingdom transfers of amylase genes, which obscured the historical reconstitution. Several alternative scenarii are discussed.

  9. Variation in Amylase Haplotypes among Congenic Lines of the House Mouse

    PubMed Central

    Nielsen, J. Tonnes

    1982-01-01

    Pancreatic amylase in the mouse displays considerable quantitative genetic variation. Agar gel electrophoresis reveals that homozygous animals have either one form of the enzyme, type A, or two forms, type AB. Only few animals have been found that contradict this statement, namely among Mus musculus castaneus from Thailand, which has a single-banded B type. Double-banded homozygous specimens of various origins have different relative proportions of the two isoenzymes. By measuring the A:B ratios in such animals, a number of distinct haplotypes or amylase complexes, determining ratios ranging from 61% A:39% B to 12% A:88% B, have been recognized. These complexes differ also with respect to the total amount of amylase produced. If the reference stock C3H/As is given the value 1, then other haplotypes have values ranging from 1.0 to 0.27. Nineteen amylase haplotypes have been established in congenic lines on a C3H/As background. Some of these lines contain at least four active pancreatic amylase structural genes and breeding experiments have demonstrated that the genetic elements regulating total amylase production and relative proportions of the isoenzymes are located within the amylase complex, cis-acting, and very closely linked to the structural genes. PMID:6184261

  10. The future of human gene therapy.

    PubMed

    Rubanyi, G M

    2001-06-01

    Human gene therapy (HGT) is defined as the transfer of nucleic acids (DNA) to somatic cells of a patient which results in a therapeutic effect, by either correcting genetic defects or by overexpressing proteins that are therapeutically useful. In the past, both the professional and the lay community had high (sometimes unreasonably high) expectations from HGT because of the early promise of treating or preventing diseases effectively and safely by this new technology. Although the theoretical advantages of HGT are undisputable, so far HGT has not delivered the promised results: convincing clinical efficacy could not be demonstrated yet in most of the trials conducted so far, while safety concerns were raised recently as the consequence of the "Gelsinger Case" in Philadelphia. This situation resulted from the by now well-recognized disparity between theory and practice. In other words, the existing technologies could not meet the practical needs of clinically successful HGT so far. However, over the past years, significant progress was made in various enabling technologies, in the molecular understanding of diseases and the manufacturing of vectors. HGT is a complex process, involving multiple steps in the human body (delivery to organs, tissue targeting, cellular trafficking, regulation of gene expression level and duration, biological activity of therapeutic protein, safety of the vector and gene product, to name just a few) most of which are not completely understood. The prerequisite of successful HGT include therapeutically suitable genes (with a proven role in pathophysiology of the disease), appropriate gene delivery systems (e.g., viral and non-viral vectors), proof of principle of efficacy and safety in appropriate preclinical models and suitable manufacturing and analytical processes to provide well-defined HGT products for clinical investigations. The most promising areas for gene therapy today are hemophilias, for monogenic diseases, and cardiovascular

  11. Determining the relationship of acute stress, anxiety, and salivary alpha-amylase level with performance of student nurse anesthetists during human-based anesthesia simulator training.

    PubMed

    McKay, Kelly A Chiffer; Buen, John E; Bohan, Kevin J; Maye, John P

    2010-08-01

    Managing stress for student nurse anesthetists represents a multifaceted educational concern for anesthesia educators. Our purpose was to determine the relationship between physiologic measures of stress and performance of student nurse anesthetists during anesthesia simulator training. Following institutional review board approval, 78 students were enrolled from a nurse anesthesia program. A prospective descriptive design was used to compare baseline, acute, and recovery measurements of stress with performance scores of students during an induction and intubation sequence in a patient simulator. Performance scores were stratified into low-, moderate-, and high-performing groups based on scores received from trained observers. A statistically significant difference in physiologic measures of stress was detected between baseline and acute levels of salivary a-amylase (P = .017), heart rate (P = .003), and anxiety levels (P = .001). No significant differences were found when measures of stress were compared with performance of low, moderate, or high performers. This investigation revealed remarkable findings regarding the relationship between stress and student performance. Analysis of the descriptive statistics and means of each group suggests that low performers have increased stress and perform poorly, whereas high performers have increased stress and perform superbly, and moderate performers have modest stress and perform moderately.

  12. Dietary Methanol Regulates Human Gene Activity

    PubMed Central

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  13. Stochastic models for human gene mapping

    SciTech Connect

    Goradia, T.M.

    1992-01-01

    This thesis examines a variety of gene mapping experiments and recommends, on the basis of stochastic and combinatorial analysis, improved experimental designs. Somatic cell hybrid panels can localize genes to particular chromosomes or chromosomal regions. Although the redundancy within randomly generated panels may be beneficial, probability calculations reveal their inefficiency. Equally good panels with far fewer clones can be constructed by choosing clones from pre-existing collection of clones. The method of simulated annealing is suggested for judiciously selecting small, informative panels from larger existing collections of clones. A more difficult exercise is mapping a gene relative to syntenic genes on the basis of genetic distance. Traditional methods of pedigree analysis are able to accomplish this to a great extent. Automatic genotype elimination algorithms for a single locus play a central role in making likelihood computations on human pedigree data feasible. A simple algorithm that is fully efficient in pedigrees without loops is presented. This algorithm can be easily coded and is instrumental in reducing computing times for pedigree analysis. Alternative methods are needed for high-resolution gene mapping. Three-locus sperm typing and its implications for the estimation of recombination fractions and for locus ordering are examined. Comparisons are made among some sequential stopping rules for three-locus order assignment. Poissonization and other stochastic methods are used for approximating the mean stopping times and error probabilities. A trisection strategy for ordering a new locus relative to an existing set of loci is proposed. When used in conjunction with Bayesian methods, this trisection strategy has attractive optimality properties. The genetic distance between the [sup G][gamma] globin locus and the parathyroid hormone locus is verified by a probabilistic model that accounts for the major sources of laboratory error.

  14. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  15. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  16. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  17. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  18. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  19. Chromosomal localization of the human elastin gene.

    PubMed Central

    Emanuel, B S; Cannizzaro, L; Ornstein-Goldstein, N; Indik, Z K; Yoon, K; May, M; Oliver, L; Boyd, C; Rosenbloom, J

    1985-01-01

    mRNA isolated from fetal human aorta was used to synthesize cDNA that was cloned into the PstI site of pBR322. The recombinant clones were screened with an authentic sheep elastin cDNA, and one human clone that hybridized strongly was isolated and characterized. The 421-base pair (bp) insert of this human clone was sequenced by the dideoxy method, and the DNA sequence showed strong homology to the nontranslated portion of the sheep elastin cDNA. This result unequivocally identified the human clone, designated pcHEL1, as an elastin clone. Plasmid pcHEL1 labeled with [3H] nucleotides was used in in situ hybridization experiments utilizing normal metaphase chromosomes and also with cells carrying a balanced translocation between chromosomes 1 and 2: 46,XY,t(1;2)(p36;q31). The results strongly suggest that the elastin gene is localized to the q31----qter region of chromosome 2. Images Fig. 2 Fig. 4 PMID:3840328

  20. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  1. Gene expression profiling of human ovarian tumours

    PubMed Central

    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; LiVolsi, V A; Johnson, S W

    2006-01-01

    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT–PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers. PMID:16969345

  2. Gene expression profiling of human ovarian tumours.

    PubMed

    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; Livolsi, V A; Johnson, S W

    2006-10-23

    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT-PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers.

  3. Salt-dependent thermo-reversible α-amylase: cloning and characterization of halophilic α-amylase from moderately halophilic bacterium, Kocuria varians.

    PubMed

    Yamaguchi, Rui; Tokunaga, Hiroko; Ishibashi, Matsujiro; Arakawa, Tsutomu; Tokunaga, Masao

    2011-02-01

    A moderately halophilic bacterium, Kocuria varians, was found to produce active α-amylase (K. varians α-amylase (KVA)). We have observed at least six different forms of α-amylase secreted by this bacterium into the culture medium. Characterization of these KVA forms and cloning of the corresponding gene revealed that KVA comprises pre-pro-precursor form of α-amylase catalytic domain followed by the tandem repeats, which show high similarity to each other and to the starch binding domain (SBD) of other α-amylases. The observed six forms were most likely derived by various processing of the protein product. Recombinant KVA protein was successfully expressed in Escherichia coli as a fusion protein and was purified with affinity chromatography after cleavage from fusion partner. The highly acidic amino acid composition of KVA and the highly negative electrostatic potential surface map of the modeled structure strongly suggested its halophilic nature. Indeed, KVA showed distinct salt- and time-dependent thermal reversibility: when α-amylase was heat denatured at 85°C for 3 min in the presence of 2 M NaCl, the activity was recovered upon incubation on ice (50% recovery after 15 min incubation). Conversely, KVA denatured in 0.1 M NaCl was not refolded at all, even after prolonged incubation. KVA activity was inhibited by proteinaceous α-amylase inhibitor from Streptomyces nitrosporeus, which had been implicated to inhibit only animal α-amylases. KVA with putative SBD regions was found to digest raw starch.

  4. Salivary alpha-amylase: role in dental plaque and caries formation.

    PubMed

    Scannapieco, F A; Torres, G; Levine, M J

    1993-01-01

    Salivary alpha-amylase, one of the most plentiful components in human saliva, has at least three distinct biological functions. The enzymatic activity of alpha-amylase undoubtedly plays a role in carbohydrate digestion. Amylase in solution binds with high affinity to a selected group of oral streptococci, a function that may contribute to bacterial clearance and nutrition. The fact that alpha-amylase is also found in acquired enamel pellicle suggests a role in the adhesion of alpha-amylase-binding bacteria. All of these biological activities seem to depend on an intact enzyme conformation. Binding of alpha-amylase to bacteria and teeth may have important implications for dental plaque and caries formation. alpha-Amylase bound to bacteria in plaque may facilitate dietary starch hydrolysis to provide additional glucose for metabolism by plaque microorganisms in close proximity to the tooth surface. The resulting lactic acid produced may be added to the pool of acid in plaque to contribute to tooth demineralization.

  5. Monoallelic expression of the human FOXP2 speech gene

    PubMed Central

    Adegbola, Abidemi A.; Cox, Gerald F.; Bradshaw, Elizabeth M.; Hafler, David A.; Gimelbrant, Alexander; Chess, Andrew

    2015-01-01

    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations. PMID:25422445

  6. Monoallelic expression of the human FOXP2 speech gene.

    PubMed

    Adegbola, Abidemi A; Cox, Gerald F; Bradshaw, Elizabeth M; Hafler, David A; Gimelbrant, Alexander; Chess, Andrew

    2015-06-02

    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations.

  7. Classification and nomenclature of all human homeobox genes

    PubMed Central

    Holland, Peter WH; Booth, H Anne F; Bruford, Elspeth A

    2007-01-01

    Background The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes. We describe 300 human homeobox loci, which we divide into 235 probable functional genes and 65 probable pseudogenes. These totals include 3 genes with partial homeoboxes and 13 pseudogenes that lack homeoboxes but are clearly derived from homeobox genes. These figures exclude the repetitive DUX1 to DUX5 homeobox sequences of which we identified 35 probable pseudogenes, with many more expected in heterochromatic regions. Nomenclature is established for approximately 40 formerly unnamed loci, reflecting their evolutionary relationships to other loci in human and other species, and nomenclature revisions are proposed for around 30 other loci. We use a classification that recognizes 11 homeobox gene 'classes' subdivided into 102 homeobox gene 'families'. Conclusion We have conducted a comprehensive survey of homeobox genes and pseudogenes in the human genome, described many new loci, and revised the classification and nomenclature of homeobox genes. The classification scheme may be widely applicable to homeobox genes in other animal genomes and will facilitate comparative genomics of this important gene superclass. PMID:17963489

  8. Encapsulation of amylase in colloidosomes.

    PubMed

    Keen, Polly H R; Slater, Nigel K H; Routh, Alexander F

    2014-03-04

    Aqueous core colloidosomes encapsulating the enzyme amylase were manufactured with a shell comprising polymer latex particles of diameter 153 nm. The colloidosomes were sealed with calcium carbonate by precipitation between an inner phase of Na2CO3 and an outer phase of CaCl2. This seal allowed the retention of small molecules, such as dyes, as well as larger enzyme molecules, for several months. The encapsulated material could be released by dissolution of the CaCO3 with acid, upon a large dilution in water, or by applying a sufficient shear. The degree of release could be controlled since the greater the mass of CaCO3 precipitated onto the colloidosome shell, the greater the dilution or shear required to achieve release. The calcium carbonate seal protected encapsulated amylase from the detrimental effects of components in a liquid laundry detergent for several months so that, on triggered release, the enzyme retained its high activity.

  9. State-of-the-art human gene therapy: part I. Gene delivery technologies.

    PubMed

    Wang, Dan; Gao, Guangping

    2014-01-01

    Safe and effective gene delivery is a prerequisite for successful gene therapy. In the early age of human gene therapy, setbacks due to problematic gene delivery vehicles plagued the exciting therapeutic outcome. However, gene delivery technologies rapidly evolved ever since. With the advancement of gene delivery techniques, gene therapy clinical trials surged during the past decade. As the first gene therapy product (Glybera) has obtained regulatory approval and reached clinic, human gene therapy finally realized the promise that genes can be medicines. The diverse gene delivery techniques available today have laid the foundation for gene therapy applications in treating a wide range of human diseases. Some of the most urgent unmet medical needs, such as cancer and pandemic infectious diseases, have been tackled by gene therapy strategies with promising results. Furthermore, combining gene transfer with other breakthroughs in biomedical research and novel biotechnologies opened new avenues for gene therapy. Such innovative therapeutic strategies are unthinkable until now, and are expected to be revolutionary. In part I of this review, we introduced recent development of non-viral and viral gene delivery technology platforms. As cell-based gene therapy blossomed, we also summarized the diverse types of cells and vectors employed in ex vivo gene transfer. Finally, challenges in current gene delivery technologies for human use were discussed.

  10. Characterization of a Hydrophobic Amylase Inhibitor from Corn (Zea mays) Seeds with Activity Against Amylase from Fusarium verticillioides.

    PubMed

    Figueira, Edson L Z; Hirooka, Elisa Y; Mendiola-Olaya, Elizabeth; Blanco-Labra, Alejandro

    2003-08-01

    ABSTRACT A hydrophobic 19.7-kDa amylase inhibitor (AI) was purified from corn kernels by 95% ethanol extraction and anionic exchange chromatography. The AI has an isoelectric point of 3.6 and was very stable at different pH values and high temperatures, maintaining 47.6% activity after heating to 94 degrees C for 60 min. Amino acid analysis indicated high valine, leucine, glycine, alanine, and glutamic acid/glutamine content, and especially high valine content (41.2 mol%). This inhibitor is not a glycoprotein. It required 30-min preincubation to maximize complex enzyme-inhibitor formation when the amylase from Fusarium verticillioides was tested. The optimal pH of interaction was 6.5. It showed broad-spectrum activity including the following amylases: human saliva, porcine pancreas, F. verticillioides, as well as those from some insects of agricultural importance (Acanthoscelides obtectus, Zabrotes subfasciatus, Sitophilus zeamais, and Prostephanus truncatus). This novel hydrophobic protein not only inhibited the amylase from F. verticillioides but also decreased the conidia germination. Thus, this protein represents an approach to decrease the production of fumonisin in corn, either by using it as a molecular marker to detect fungal resistance or through genetic engineering.

  11. Characterization of two coleopteran α-amylases and molecular insights into their differential inhibition by synthetic α-amylase inhibitor, acarbose.

    PubMed

    Channale, Sonal M; Bhide, Amey J; Yadav, Yashpal; Kashyap, Garima; Pawar, Pankaj K; Maheshwari, V L; Ramasamy, Sureshkumar; Giri, Ashok P

    2016-07-01

    Post-harvest insect infestation of stored grains makes them unfit for human consumption and leads to severe economic loss. Here, we report functional and structural characterization of two coleopteran α-amylases viz. Callosobruchus chinensis α-amylase (CcAmy) and Tribolium castaneum α-amylase (TcAmy) along with their interactions with proteinaceous and non-proteinaceous α-amylase inhibitors. Secondary structural alignment of CcAmy and TcAmy with other coleopteran α-amylases revealed conserved motifs, active sites, di-sulfide bonds and two point mutations at spatially conserved substrate or inhibitor-binding sites. Homology modeling and molecular docking showed structural differences between these two enzymes. Both the enzymes had similar optimum pH values but differed in their optimum temperature. Overall, pattern of enzyme stabilities were similar under various temperature and pH conditions. Further, CcAmy and TcAmy differed in their substrate affinity and catalytic efficiency towards starch and amylopectin. HPLC analysis detected common amylolytic products like maltose and malto-triose while glucose and malto-tetrose were unique in CcAmy and TcAmy catalyzed reactions respectively. At very low concentrations, wheat α-amylase inhibitor was found to be superior over the acarbose as far as complete inhibition of amylolytic activities of CcAmy and TcAmy was concerned. Mechanism underlying differential amylolytic reaction inhibition by acarbose was discussed.

  12. Characterization of Aspergillus nidulans α-glucan synthesis: roles for two synthases and two amylases.

    PubMed

    He, Xiaoxiao; Li, Shengnan; Kaminskyj, Susan G W

    2014-02-01

    Cell walls are essential for fungal survival and growth. Fungal walls are ∼ 90% carbohydrate, mostly types not found in humans, making them promising targets for anti-fungal drug development. Echinocandins, which inhibit the essential β-glucan synthase, are already clinically available. In contrast, α-glucan, another abundant fungal cell wall component has attracted relatively little research attention because it is not essential for most fungi. Aspergillus nidulans has two α-glucan synthases (AgsA and AgsB) and two α-amylases (AmyD and AmyG), all of which affect α-glucan synthesis. Gene deletion showed that AgsB was the major synthase. In addition, AmyG promoted α-glucan synthesis whereas AmyD had a repressive effect. The lack of α-glucan had no phenotypic impact on solid medium, but reduced conidial adhesion during germination in shaken liquid. Moreover, α-glucan level correlated with resistance to Calcofluor White. Intriguingly, overexpression of agsA could compensate for the loss of agsB at the α-glucan level, but not for phenotypic defects. Thus, products of AgsA and AgsB have different roles in the cell wall, consistent with agsA being mainly expressed at conidiation. These results suggest that α-glucan contributes to drug sensitivity and conidia adhesion in A. nidulans, and is differentially regulated by two synthases and two amylases.

  13. Human salivary α-amylase (EC.3.2.1.1) activity and periodic acid and schiff reactive (PAS) staining: A useful tool to study polysaccharides at an undergraduate level.

    PubMed

    Fernandes, Ruben; Correia, Rossana; Fonte, Rosália; Prudêncio, Cristina

    2006-07-01

    Health science education is presently in discussion throughout Europe due to the Bologna Declaration. Teaching basic sciences such as biochemistry in a health sciences context, namely in allied heath education, can be a challenging task since the students of preclinical health sciences are not often convinced that basic sciences are clinically valuable (J. R. Rudland, S. C. Rennie (2003) The determination of the relevance of basic sciences learning objectives to clinical practice using a questionnaire survey, Med. Educ. (Oxf.) 37, 962-965; E. C. Wragg (2003) How can we determine the relevance of basic sciences learning objectives to clinical practice?, Med. Educ. (Oxf.) 37, 948-949). Thus, nowadays teachers are compelled to use their imagination to be able to elaborate laboratory sessions aiming for the understanding of theoretical concepts that are also clinically related: in other words, basic concepts and skills that underlie the competencies demanded of the future health professional. In the present work, we describe a set of laboratory sessions implemented in the discipline of biochemistry, belonging to the first year of several courses of allied health professionals, which can also be implemented in other health sciences courses. These sessions focus on the characteristics and properties of carbohydrates. The exercises we propose include two different laboratory practical sessions based on a histopathological routine technique known as periodic acid and Schiff reactive that is currently used to detect sugar metabolic and tumor diseases (J. M. T. Rivera, C. T. López, B. C. Segui (2001) Bioquímica Estructural: Conceptos y Tests, Tebar Flores, Madrid). The methodology described enables the demonstration of some biochemical properties of polysaccharides, namely animal and vegetable, and the catalytic activity of the human salivary α-amylase (EC.3.2.1.1) enzyme. A further comparison between α-amylase activity in vitro and in situ is also possible by the

  14. Comprehensive comparative homeobox gene annotation in human and mouse.

    PubMed

    Wilming, Laurens G; Boychenko, Veronika; Harrow, Jennifer L

    2015-01-01

    Homeobox genes are a group of genes coding for transcription factors with a DNA-binding helix-turn-helix structure called a homeodomain and which play a crucial role in pattern formation during embryogenesis. Many homeobox genes are located in clusters and some of these, most notably the HOX genes, are known to have antisense or opposite strand long non-coding RNA (lncRNA) genes that play a regulatory role. Because automated annotation of both gene clusters and non-coding genes is fraught with difficulty (over-prediction, under-prediction, inaccurate transcript structures), we set out to manually annotate all homeobox genes in the mouse and human genomes. This includes all supported splice variants, pseudogenes and both antisense and flanking lncRNAs. One of the areas where manual annotation has a significant advantage is the annotation of duplicated gene clusters. After comprehensive annotation of all homeobox genes and their antisense genes in human and in mouse, we found some discrepancies with the current gene set in RefSeq regarding exact gene structures and coding versus pseudogene locus biotype. We also identified previously un-annotated pseudogenes in the DUX, Rhox and Obox gene clusters, which helped us re-evaluate and update the gene nomenclature in these regions. We found that human homeobox genes are enriched in antisense lncRNA loci, some of which are known to play a role in gene or gene cluster regulation, compared to their mouse orthologues. Of the annotated set of 241 human protein-coding homeobox genes, 98 have an antisense locus (41%) while of the 277 orthologous mouse genes, only 62 protein coding gene have an antisense locus (22%), based on publicly available transcriptional evidence.

  15. Comprehensive comparative homeobox gene annotation in human and mouse

    PubMed Central

    Wilming, Laurens G.; Boychenko, Veronika; Harrow, Jennifer L.

    2015-01-01

    Homeobox genes are a group of genes coding for transcription factors with a DNA-binding helix-turn-helix structure called a homeodomain and which play a crucial role in pattern formation during embryogenesis. Many homeobox genes are located in clusters and some of these, most notably the HOX genes, are known to have antisense or opposite strand long non-coding RNA (lncRNA) genes that play a regulatory role. Because automated annotation of both gene clusters and non-coding genes is fraught with difficulty (over-prediction, under-prediction, inaccurate transcript structures), we set out to manually annotate all homeobox genes in the mouse and human genomes. This includes all supported splice variants, pseudogenes and both antisense and flanking lncRNAs. One of the areas where manual annotation has a significant advantage is the annotation of duplicated gene clusters. After comprehensive annotation of all homeobox genes and their antisense genes in human and in mouse, we found some discrepancies with the current gene set in RefSeq regarding exact gene structures and coding versus pseudogene locus biotype. We also identified previously un-annotated pseudogenes in the DUX, Rhox and Obox gene clusters, which helped us re-evaluate and update the gene nomenclature in these regions. We found that human homeobox genes are enriched in antisense lncRNA loci, some of which are known to play a role in gene or gene cluster regulation, compared to their mouse orthologues. Of the annotated set of 241 human protein-coding homeobox genes, 98 have an antisense locus (41%) while of the 277 orthologous mouse genes, only 62 protein coding gene have an antisense locus (22%), based on publicly available transcriptional evidence. PMID:26412852

  16. Nuclear actin activates human transcription factor genes including the OCT4 gene.

    PubMed

    Yamazaki, Shota; Yamamoto, Koji; Tokunaga, Makio; Sakata-Sogawa, Kumiko; Harata, Masahiko

    2015-01-01

    RNA microarray analyses revealed that nuclear actin activated many human transcription factor genes including OCT4, which is required for gene reprogramming. Oct4 is known to be activated by nuclear actin in Xenopus oocytes. Our findings imply that this process of OCT4 activation is conserved in vertebrates and among cell types and could be used for gene reprogramming of human cells.

  17. Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.

    PubMed

    Holmes, Roger S; Wright, Matthew W; Laulederkind, Stanley J F; Cox, Laura A; Hosokawa, Masakiyo; Imai, Teruko; Ishibashi, Shun; Lehner, Richard; Miyazaki, Masao; Perkins, Everett J; Potter, Phillip M; Redinbo, Matthew R; Robert, Jacques; Satoh, Tetsuo; Yamashita, Tetsuro; Yan, Bingfan; Yokoi, Tsuyoshi; Zechner, Rudolf; Maltais, Lois J

    2010-10-01

    Mammalian carboxylesterase (CES or Ces) genes encode enzymes that participate in xenobiotic, drug, and lipid metabolism in the body and are members of at least five gene families. Tandem duplications have added more genes for some families, particularly for mouse and rat genomes, which has caused confusion in naming rodent Ces genes. This article describes a new nomenclature system for human, mouse, and rat carboxylesterase genes that identifies homolog gene families and allocates a unique name for each gene. The guidelines of human, mouse, and rat gene nomenclature committees were followed and "CES" (human) and "Ces" (mouse and rat) root symbols were used followed by the family number (e.g., human CES1). Where multiple genes were identified for a family or where a clash occurred with an existing gene name, a letter was added (e.g., human CES4A; mouse and rat Ces1a) that reflected gene relatedness among rodent species (e.g., mouse and rat Ces1a). Pseudogenes were named by adding "P" and a number to the human gene name (e.g., human CES1P1) or by using a new letter followed by ps for mouse and rat Ces pseudogenes (e.g., Ces2d-ps). Gene transcript isoforms were named by adding the GenBank accession ID to the gene symbol (e.g., human CES1_AB119995 or mouse Ces1e_BC019208). This nomenclature improves our understanding of human, mouse, and rat CES/Ces gene families and facilitates research into the structure, function, and evolution of these gene families. It also serves as a model for naming CES genes from other mammalian species.

  18. Structural and functional characterization of recombinant medaka fish alpha-amylase expressed in yeast Pichia pastoris.

    PubMed

    Mizutani, Kimihiko; Toyoda, Mayuko; Otake, Yuichiro; Yoshioka, Soshi; Takahashi, Nobuyuki; Mikami, Bunzo

    2012-08-01

    The medaka fish α-amylase was expressed and purified. The expression systems were constructed using methylotrophic yeast Pichia pastoris, and the recombinant proteins were secreted into the culture medium. Purified recombinant α-amylase exhibited starch hydrolysis activity. The optimal pH, denaturation temperature, and K(M) and V(max) values were determined; chloride ions were essential for enzyme activity. The purified protein was also crystallized and examined by X-ray crystallography. The structure has the (α/β)(8) barrel fold, as do other known α-amylases, and the overall structure is very similar to the structure of vertebrate (human and pig) α-amylases. A novel expression plasmid was developed. Using this plasmid, high-throughput construction of an expression system by homologous recombination in P. pastoris cells, previously reported for membrane proteins, was successfully applied to the secretory protein.

  19. Selective abortion and gene therapy: reflections on human limits.

    PubMed

    Post, S G

    1991-01-01

    The potential impact of the Human Genome Project on selective abortion is considered here, as is human gene therapy. Themes of emphasis are broadly humanistic: human suffering, contingency, and perfection. The chief concerns of the article lie with selective abortion for less than serious reasons, and with the importance of avoiding efforts to "enhance" human beings by gene transfer methods. The style is widely interdisciplinary.

  20. Integrable alpha-amylase plasmid for generating random transcriptional fusions in Bacillus subtilis.

    PubMed Central

    O'Kane, C; Stephens, M A; McConnell, D

    1986-01-01

    An integrable plasmid, pOK4, which replicated independently in Escherichia coli was constructed for generating transcriptional fusions in vivo in Bacillus DNA. It did not replicate independently in Bacillus subtilis, but it could be made to integrate into the chromosome of B. subtilis if sequences homologous to chromosomal sequences were inserted into it. It had a selectable marker for chloramphenicol resistance and carried unique sites for EcoRI and SmaI just to the 5' side of a promoterless alpha-amylase gene from Bacillus licheniformis. When B. subtilis DNA fragments were ligated into one of these sites and the ligation mixture was used to transform an alpha-amylase-negative B. subtilis strain, chloramphenicol-resistant transformants could be isolated conveniently. Many of these were alpha-amylase positive, owing to the fusion of the plasmid amylase gene to chromosomal operons. In principle, because integration need not be mutagenic, it is possible to obtain fusions to any chromosomal operon. The site of each integration can be mapped, and the flanking sequences can be cloned into E. coli. The alpha-amylase gene can be used to detect regulated genes. We used it as an indicator to detect operons which are DNA-damage-inducible (din), and we identified insertions in both SP beta and PBSX prophages. Images PMID:3096966

  1. Cloning and Characterization of Cold-Adapted α-Amylase from Antarctic Arthrobacter agilis.

    PubMed

    Kim, Su-Mi; Park, Hyun; Choi, Jong-Il

    2017-03-01

    In this study, the gene encoding an α-amylase from a psychrophilic Arthrobacter agilis PAMC 27388 strain was cloned into a pET-28a(+) vector and heterologously expressed in Escherichia coli BL21(DE3). The recombinant α-amylase with a molecular mass of about 80 kDa was purified by using Ni(2+)-NTA affinity chromatography. This recombinant α-amylase exhibited optimal activity at pH 3.0 and 30 °C and was highly stable at varying temperatures (30-60 °C) and within the pH range of 4.0-8.0. Furthermore, α-amylase activity was enhanced in the presence of FeCl3 (1 mM) and β-mercaptoethanol (5 mM), while CoCl2 (1 mM), ammonium persulfate (5 mM), SDS (10 %), Triton X-100 (10 %), and urea (1 %) inhibited the enzymatic activity. Importantly, the presence of Ca(2+) ions and phenylmethylsulfonyl fluoride (PMSF) did not affect enzymatic activity. Thin layer chromatography (TLC) analysis showed that recombinant A. agilis α-amylase hydrolyzed starch, maltotetraose, and maltotriose, producing maltose as the major end product. These results make recombinant A. agilis α-amylase an attractive potential candidate for industrial applications in the textile, paper, detergent, and pharmaceutical industries.

  2. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris

    PubMed Central

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL−1 at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg−1. The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0–8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t1/2) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification. PMID:26090417

  3. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris.

    PubMed

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL(-1) at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg(-1). The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0-8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t₁/₂) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification.

  4. Isolation and characterization of the human Gs alpha gene.

    PubMed Central

    Kozasa, T; Itoh, H; Tsukamoto, T; Kaziro, Y

    1988-01-01

    The gene for Gs alpha (the alpha subunit of the guanine nucleotide-binding protein Gs) was isolated from human genomic libraries using rat Gs alpha cDNA as a probe. Comparison of the nucleotide sequence of the human gene with that of the rat cDNA revealed that the human Gs alpha gene spans approximately equal to 20 kilobases and is composed of 13 exons and 12 introns. Genomic Southern blot analysis suggests that the human haploid genome contains a single Gs alpha gene. Previous reports indicated the presence of multiple species of Gs alpha cDNA. The structure of the human Gs alpha gene suggests that four types of Gs alpha mRNAs may be generated from a single Gs alpha gene by alternate use of exon 3 and/or of two 3' splice sites of intron 3, where an unusual splice junction sequence (TG) instead of the consensus (AG) is used. S1 nuclease mapping analysis of human Gs alpha mRNA identified multiple transcriptional initiation sites. The promoter region of the human Gs alpha gene has extremely high G + C content (85%). It contains 4 "GC" boxes, but no typical "TATA" or "CAAT" box sequence. In the 5' flanking region, there are several blocks of sequences that are similar to the sequences of the 5' flanking region of the human c-Ki-ras2 gene. Images PMID:3127824

  5. Attenuated acute salivary α-amylase responses to gustatory stimulation with citric acid in thin children.

    PubMed

    Chen, Long Hui; Yang, Ze Min; Chen, Wei Wen; Lin, Jing; Zhang, Min; Yang, Xiao Rong; Zhao, Ling Bo

    2015-04-14

    Salivary α-amylase (sAA) is responsible for the 'pre-digestion' of starch in the oral cavity and accounts for up to 50 % of salivary protein in human saliva. An accumulating body of literature suggests that sAA is of nutritional importance; however, it is still not clear how sAA is related to individual's nutritional status. Although copy number variations (CNV) of the salivary amylase gene (AMY1) are associated with variation in sAA levels, a significant amount of sAA variation is not explained by AMY1 CNV. To measure sAA responses to gustatory stimulation with citric acid, we used sAA ratio (the ratio of stimulated sAA levels to those of resting sAA) and investigated acute sAA responses to citric acid in children with normal (Normal-BMI, n 22) and low (Low-BMI, n 21) BMI. The AMY1 gene copy number was determined by quantitative PCR. We, for the first time, demonstrated attenuated acute sAA responses (decreased sAA ratio) to gustatory stimulation in Low-BMI (thinness grade 3) children compared with the Normal-BMI children, which suggest that sAA responses to gustatory stimulation may be of nutritional importance. However, child's nutritional status was not directly related to their resting or stimulated sAA levels, and it was not associated with AMY1 gene copy number. Finally, AMY1 CNV might influence, but did not eventually determine, sAA levels in children.

  6. The nucleotide sequence of the human beta-globin gene.

    PubMed

    Lawn, R M; Efstratiadis, A; O'Connell, C; Maniatis, T

    1980-10-01

    We report the complete nucleotide sequence of the human beta-globin gene. The purpose of this study is to obtain information necessary to study the evolutionary relationships between members of the human beta-like globin gene family and to provide the basis for comparing normal beta-globin genes with those obtained from the DNA of individuals with genetic defects in hemoglobin expression.

  7. Does human gene therapy raise new ethical questions?

    PubMed

    Tauer, C A

    1990-01-01

    Consideration of the ethics of human gene therapy does not seem to raise questions that have never been asked before. However, particularly when gene therapy is extended to modification of the germ cells, several ethical issues take on an added importance or significance. These issues are: (i) possible moral limitations on tampering with "human nature"; (ii) the extent of our responsibility to future generations; (iii) the appropriate use of early human embryos in genetic research. Furthermore, standard norms in clinical and research ethics require careful application to trials of human gene therapy, even if only somatic rather than germ-line improvements are sought.

  8. Human monogenic disease genes have frequently functionally redundant paralogs.

    PubMed

    Chen, Wei-Hua; Zhao, Xing-Ming; van Noort, Vera; Bork, Peer

    2013-01-01

    Mendelian disorders are often caused by mutations in genes that are not lethal but induce functional distortions leading to diseases. Here we study the extent of gene duplicates that might compensate genes causing monogenic diseases. We provide evidence for pervasive functional redundancy of human monogenic disease genes (MDs) by duplicates by manifesting 1) genes involved in human genetic disorders are enriched in duplicates and 2) duplicated disease genes tend to have higher functional similarities with their closest paralogs in contrast to duplicated non-disease genes of similar age. We propose that functional compensation by duplication of genes masks the phenotypic effects of deleterious mutations and reduces the probability of purging the defective genes from the human population; this functional compensation could be further enhanced by higher purification selection between disease genes and their duplicates as well as their orthologous counterpart compared to non-disease genes. However, due to the intrinsic expression stochasticity among individuals, the deleterious mutations could still be present as genetic diseases in some subpopulations where the duplicate copies are expressed at low abundances. Consequently the defective genes are linked to genetic disorders while they continue propagating within the population. Our results provide insight into the molecular basis underlying the spreading of duplicated disease genes.

  9. Evolutionary conservation and disease gene association of the human genes composing pseudogenes.

    PubMed

    Sen, Kamalika; Ghosh, Tapash Chandra

    2012-06-15

    Pseudogenes, the 'genomic fossils' present portrayal of evolutionary history of human genome. The human genes configuring pseudogenes are also now coming forth as important resources in the study of human protein evolution. In this communication, we explored evolutionary conservation of the genes forming pseudogenes over the genes lacking any pseudogene and delving deeper, we probed an evolutionary rate difference between the disease genes in the two groups. We illustrated this differential evolutionary pattern by gene expressivity, number of regulatory miRNA targeting per gene, abundance of protein complex forming genes and lesser percentage of protein intrinsic disorderness. Furthermore, pseudogenes are observed to harbor sequence variations, over their entirety, those become degenerative disease-causing mutations though the disease involvement of their progenitors is still unexplored. Here, we unveiled an immense association of disease genes in the genes casting pseudogenes in human. We interpreted the issue by disease associated miRNA targeting, genes containing polymorphisms in miRNA target sites, abundance of genes having disease causing non-synonymous mutations, disease gene specific network properties, presence of genes having repeat regions, affluence of dosage sensitive genes and the presence of intrinsically unstructured protein regions.

  10. Human gene therapy: a brief overview of the genetic revolution.

    PubMed

    Misra, Sanjukta

    2013-02-01

    Advances in biotechnology have brought gene therapy to the forefront of medical research. The prelude to successful gene therapy i.e. the efficient transfer and expression of a variety of human gene into target cells has already been accomplished in several systems. Safe methods have been devised to do this, using several viral and no-viral vectors. Two main approaches emerged: in vivo modification and ex vivo modification. Retrovirus, adenovirus, adeno-associated virus are suitable for gene therapeutic approaches which are based on permanent expression of the therapeutic gene. Non-viral vectors are far less efficient than viral vectors, but they have advantages due to their low immunogenicity and their large capacity for therapeutic DNA. To improve the function of non-viral vectors, the addition of viral functions such as receptor mediated uptake and nuclear translocation of DNA may finally lead to the development of an artificial virus. Gene transfer protocols have been approved for human use in inherited diseases, cancers and acquired disorders. In 1990, the first successful clinical trial of gene therapy was initiated for adenosine deaminase deficiency. Since then, the number of clinical protocols initiated worldwide has increased exponentially. Although preliminary results of these trials are somewhat disappointing, but human gene therapy dreams of treating diseases by replacing or supplementing the product of defective or introducing novel therapeutic genes. So definitely human gene therapy is an effective addition to the arsenal of approaches to many human therapies in the 21st century.

  11. Ribosomal protein gene mapping and human chromosomal disorders

    SciTech Connect

    Kenmochi, N.; Goodman, N.; Page, D.C.

    1994-09-01

    In Drosophila, the Minute phenotype (reduced body size, diminished viability and fertility, and short, thin bristles) results from heterozygous deficiencies (deletions) at any one of 50 loci scattered about the genome. A handful of these Minute loci have been molecularly characterized, and all have been found to encode ribosomal proteins. Thus, the Minute phenotype appears to result from reduced protein synthetic capacity in flies with one rather than two copies of a given ribosomal protein (rp) gene. We are pursuing the possibility that similar reductions in protein synthetic capacity--again resulting from rp gene deficiencies--might underlie phenotypes associated with certain chromosomal disorders in humans. We and our colleagues have reported findings consistent with a role for RPS4 deficiency in the etiology of certain features of Turner syndrome, a complex human disorder classically associated with an XO karyotype. We are intrigued by the possibility that deficiencies of other human rp genes might cause phenotypic abnormalities similar to those seen in Turner syndrome--just as deficiencies of any of a number of Drosophila rp genes cause the Minute phenotype. We must first learn the chromosomal map position of each of the estimated 83 human rp genes. The task of mapping the functional (intron-containing) rp genes is complicated by the existence of processed pseudogenes elsewhere in the genome. To date, we have assigned (or confirmed the previous assignment of) 38 rp genes to individual human chromosomes by PCR analysis of human-rodent somatic cell hybrids containing subsets of human chromosomes, with all but four chromosomes carrying at least one rp gene. We have also identified more than 100 large-insert human YAC (yeast artificial chromosome) clones that contain individual rp genes. Such screening of YAC libraries will result in precise positioning of the rp genes on the emerging physical map of the human genome.

  12. Loss of gene function and evolution of human phenotypes.

    PubMed

    Oh, Hye Ji; Choi, Dongjin; Goh, Chul Jun; Hahn, Yoonsoo

    2015-07-01

    Humans have acquired many distinct evolutionary traits after the human-chimpanzee divergence. These phenotypes have resulted from genetic changes that occurred in the human genome and were retained by natural selection. Comparative primate genome analyses reveal that loss-of-function mutations are common in the human genome. Some of these gene inactivation events were revealed to be associated with the emergence of advantageous phenotypes and were therefore positively selected and fixed in modern humans (the "less-ismore" hypothesis). Representative cases of human gene inactivation and their functional implications are presented in this review. Functional studies of additional inactive genes will provide insight into the molecular mechanisms underlying acquisition of various human-specific traits.

  13. Loss of gene function and evolution of human phenotypes

    PubMed Central

    Oh, Hye Ji; Choi, Dongjin; Goh, Chul Jun; Hahn, Yoonsoo

    2015-01-01

    Humans have acquired many distinct evolutionary traits after the human-chimpanzee divergence. These phenotypes have resulted from genetic changes that occurred in the human genome and were retained by natural selection. Comparative primate genome analyses reveal that loss-of-function mutations are common in the human genome. Some of these gene inactivation events were revealed to be associated with the emergence of advantageous phenotypes and were therefore positively selected and fixed in modern humans (the “less-ismore” hypothesis). Representative cases of human gene inactivation and their functional implications are presented in this review. Functional studies of additional inactive genes will provide insight into the molecular mechanisms underlying acquisition of various human-specific traits. [BMB Reports 2015; 48(7): 373-379] PMID:25887751

  14. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  15. Differences in gene expression between mouse and human for dynamically regulated genes in early embryo.

    PubMed

    Madissoon, Elo; Töhönen, Virpi; Vesterlund, Liselotte; Katayama, Shintaro; Unneberg, Per; Inzunza, Jose; Hovatta, Outi; Kere, Juha

    2014-01-01

    Infertility is a worldwide concern that can be treated with in vitro fertilization (IVF). Improvements in IVF and infertility treatment depend largely on better understanding of the molecular mechanisms for human preimplantation development. Several large-scale studies have been conducted to identify gene expression patterns for the first five days of human development, and many functional studies utilize mouse as a model system. We have identified genes of possible importance for this time period by analyzing human microarray data and available data from online databases. We selected 70 candidate genes for human preimplantation development and investigated their expression in the early mouse development from oocyte to the 8-cell stage. Maternally loaded genes expectedly decreased in expression during development both in human and mouse. We discovered that 25 significantly upregulated genes after fertilization in human included 13 genes whose orthologs in mouse behaved differently and mimicked the expression profile of maternally expressed genes. Our findings highlight many significant differences in gene expression patterns during mouse and human preimplantation development. We also describe four cancer-testis antigen families that are also highly expressed in human embryos: PRAME, SSX, GAGE and MAGEA.

  16. Biotechnological Processes in Microbial Amylase Production

    PubMed Central

    Arshad, M. K. Md; Lakshmipriya, Thangavel; Hashim, Uda; Chinni, Suresh V.

    2017-01-01

    Amylase is an important and indispensable enzyme that plays a pivotal role in the field of biotechnology. It is produced mainly from microbial sources and is used in many industries. Industrial sectors with top-down and bottom-up approaches are currently focusing on improving microbial amylase production levels by implementing bioengineering technologies. The further support of energy consumption studies, such as those on thermodynamics, pinch technology, and environment-friendly technologies, has hastened the large-scale production of the enzyme. Herein, the importance of microbial (bacteria and fungi) amylase is discussed along with its production methods from the laboratory to industrial scales. PMID:28280725

  17. Isolation of a novel amylase and lipase-producing Pseudomonas luteola strain: study of amylase production conditions

    PubMed Central

    2014-01-01

    An amylase and lipase producing bacterium (strain C2) was enriched and isolated from soil regularly contaminated with olive washing wastewater in Sfax, Tunisia. Cell was aerobic, mesophilic, Gram-negative, motile, non-sporulating bacterium, capable of growing optimally at pH 7 and 30°C and tolerated maximally 10% (W/V) NaCl. The predominant fatty acids were found to be C18:1ω7c (32.8%), C16:1ω7c (27.3%) and C16:0 (23.1%). Phylogenetic analysis of the 16S rRNA gene revealed that this strain belonging to the genus Pseudomonas. Strain C2 was found to be closely related to Pseudomonas luteola with more than 99% of similarity. Amylase optimization extraction was carried out using Box Behnken Design (BBD). Its maximal activity was found when the pH and temperature ranged from 5.5 to 6.5 and from 33 to 37°C, respectively. Under these conditions, amylase activity was found to be about 9.48 U/ml. PMID:24405763

  18. Chromosomal localization of the human diazepam binding inhibitor gene

    SciTech Connect

    DeBernardi, M.A.; Crowe, R.R.; Mocchetti, I.; Shows, T.B.; Eddy, R.L.; Costa, E.

    1988-09-01

    The authors have used in situ chromosome hybridization and human-mouse somatic cell hybrids to map the gene(s) for human diazepam binding inhibitor (DBI), an endogenous putative modulator of the /gamma/-aminobutyric acid receptor acting at the allosteric regulatory center of this receptor that includes the benzodiazepine recognition site. In 784 chromosome spreads hybridized with human DBI cDNA, the distribution of 1,476 labeled sites revealed a significant clustering of autoradiographic grains (11.3% of total label) on the long arm of chromosome 2 (2q). Furthermore, 63.5% of the grains found on 2q were located on 2q12-21, suggesting regional mapping of DBI gene(s) to this segment. Secondary hybridization signals were frequently observed on other chromosomes and they were statistically significant mainly for chromosomes 5, 6, 11, and 14. In addition, DNA from 32 human-mouse cell hybrids was digested with BamHI and probed with human DBI cDNA. A 3.5-kilobase band, which probably represents the human DBI gene, was assigned to chromosome 2. Four higher molecular weight bands, also detected in BamHI digests, could not be unequivocally assigned. A chromosome 2 location was excluded for the 27-, 13-, and 10-kilobase bands. These results assign a human DBI gene to chromosome 2 (2q12-21) and indicate that three of the four homologous sequences detected by the human DBI probe are located on three other chromosomes.

  19. Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes

    SciTech Connect

    Kim, J.M.; Khan, T.A.; Moore, K.W. ); Brannan, C.I.; Copeland, N.G.; Jenkins, N.A. )

    1992-06-01

    The nucleotide sequence of a 7.2-kb segment containing the mouse IL-10 (mIL-10) gene was determined. Comparison to the mIL-10 cDNA sequence revealed the presence of five exons that span [approximately]5.1 kb of genomic DNA. The noncoding regions of the mIL-10 gene contain sequences that have been associated with transcriptional regulation of several cytokine genes. The mIL-10 gene was mapped to mouse chromosome 1 and the human IL-10 gene was also mapped to human chromosome 1. 35 refs., 4 figs., 3 tabs.

  20. Shaping individuality: human inheritable germ line gene modification.

    PubMed

    Salvi, M

    2001-01-01

    In this paper I deal with ethical factors surrounding germline gene therapy. Such implications include intergenerational responsibility, human dignity, moral status of embryos and so on. I will explore the relevance of the above mentioned issues to discuss the ethical implication of human germline gene therapy (HGLT). We will see that most of arguments claimed by bioethicists do not provide valid reason to oppose HGLT. I will propose an alternative view, based on personal identity issues, to discuss the ethics of human inheritable gene modification.

  1. Patenting human genes: when economic interests trump logic and ethics.

    PubMed

    Kluge, Eike-Henner W

    2003-06-01

    To date, over 5,000 applications have been filed with United States Patent Office for patents on human genes. More than 1,500 of these applications have been granted. Other jurisdictions are experiencing a similar rush to mine and protect genomic gold. This paper argues that although many jurisdictions allow the patenting of human genes, this is ethically indefensible and amounts to an unjustified appropriation of a general human heritage. Economic and legal arguments in favour of patenting are considered and rejected. Reference is made to the Wellcome Trust Consortium's initiative and the Merck Gene Index Project, which place patented genetic information into the public domain.

  2. Evolution of Brain Active Gene Promoters in Human Lineage Towards the Increased Plasticity of Gene Regulation.

    PubMed

    Gunbin, Konstantin V; Ponomarenko, Mikhail P; Suslov, Valentin V; Gusev, Fedor; Fedonin, Gennady G; Rogaev, Evgeny I

    2017-02-24

    Adaptability to a variety of environmental conditions is a prominent feature of Homo sapiens. We hypothesize that this feature can be explained by evolutionary changes in gene promoters active in the brain prefrontal cortex leading to a more flexible gene regulation network. The genotype-dependent range of gene expression can be broader in humans than in other higher primates. Thus, we searched for specific signatures of evolutionary changes in promoter architectures of multiple hominid genes, including the genes active in human cortical neurons that may indicate an increase of variability of gene expression rather than just changes in the level of expression, such as downregulation or upregulation of the genes. We performed a whole-genome search for genetic-based alterations that may impact gene regulation "flexibility" in a process of hominids evolution, such as (i) CpG dinucleotide content, (ii) predicted nucleosome-DNA dissociation constant, and (iii) predicted affinities for TATA-binding protein (TBP) in gene promoters. We tested all putative promoter regions across the human genome and especially gene promoters in active chromatin state in neurons of prefrontal cortex, the brain region critical for abstract thinking and social and behavioral adaptation. Our data imply that the origin of modern man has been associated with an increase of flexibility of promoter-driven gene regulation in brain. In contrast, after splitting from the ancestral lineages of H. sapiens, the evolution of ape species is characterized by reduced flexibility of gene promoter functioning, underlying reduced variability of the gene expression.

  3. Human brain evolution: from gene discovery to phenotype discovery.

    PubMed

    Preuss, Todd M

    2012-06-26

    The rise of comparative genomics and related technologies has added important new dimensions to the study of human evolution. Our knowledge of the genes that underwent expression changes or were targets of positive selection in human evolution is rapidly increasing, as is our knowledge of gene duplications, translocations, and deletions. It is now clear that the genetic differences between humans and chimpanzees are far more extensive than previously thought; their genomes are not 98% or 99% identical. Despite the rapid growth in our understanding of the evolution of the human genome, our understanding of the relationship between genetic changes and phenotypic changes is tenuous. This is true even for the most intensively studied gene, FOXP2, which underwent positive selection in the human terminal lineage and is thought to have played an important role in the evolution of human speech and language. In part, the difficulty of connecting genes to phenotypes reflects our generally poor knowledge of human phenotypic specializations, as well as the difficulty of interpreting the consequences of genetic changes in species that are not amenable to invasive research. On the positive side, investigations of FOXP2, along with genomewide surveys of gene-expression changes and selection-driven sequence changes, offer the opportunity for "phenotype discovery," providing clues to human phenotypic specializations that were previously unsuspected. What is more, at least some of the specializations that have been proposed are amenable to testing with noninvasive experimental techniques appropriate for the study of humans and apes.

  4. [Structural organization of the human p53 gene. I. Molecular cloning of the human p53 gene].

    PubMed

    Bukhman, V L; Ninkina, N N; Chumakov, P M; Khilenkova, M A; Samarina, O P

    1987-09-01

    Human p53 gene was cloned from the normal human placenta DNA and DNA from the strain of human kidney carcinoma transplanted into nude mice. Representative gene library from tumor strain of human kidney carcinoma and library of 15 kb EcoRI fragments of DNA from normal human placenta were constructed. Maniatis gene library was also used. Five clones were isolated from kidney carcinoma library; they covered 27 kb and included full-length p53 gene of 19.5 kb and flanking sequences. From normal placenta libraries three overlapped clones were obtained. Restriction map of cloned sequences was constructed and polarity of the p53 gene determined. The first intron of the gene is large (10.4 kb); polymorphic BglII site was observed in this intron, which allows to discriminate between allelic genes. One of these (BglII-) is ten times more abundant that the other (BglII+). Both allelic genes are able to synthesize the 2.8 kb p53 gene.

  5. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  6. Structure and in vitro transcription of human globin genes.

    PubMed

    Proudfoot, N J; Shander, M H; Manley, J L; Gefter, M L; Maniatis, T

    1980-09-19

    The alpha-like and beta-like subunits of human hemoglobin are encoded by a small family of genes that are differentially expressed during development. Through the use of molecular cloning procedures, each member of this gene family has been isolated and extensively characterized. Although the alpha-like and beta-like globin genes are located on different chromosomes, both sets of genes are arranged in closely linked clusters. In both clusters, each of the genes is transcribed from the same DNA strand, and the genes are arranged in the order of their expressions during development. Structural comparisons of immediately adjacent genes within each cluster have provided evidence for the occurrence of gene duplication and correction during evolution and have led to the discovery of pseudogenes, genes that have acquired numerous mutations that prevent their normal expression. Recently, in vivo and in vitro systems for studying the expression of cloned eukaryotic genes have been developed as a means of identifying DNA sequences that are necessary for normal gene function. This article describes the application of an in vitro transcription procedure to the study of human globin gene expression.

  7. Purification, sequencing, and biochemical characterization of a novel calcium-independent α-amylase AmyTVE from Thermoactinomyces vulgaris.

    PubMed

    El-Sayed, Ahmed K A; Abou Dobara, Mohamed I; El-Fallal, Amira A; Omar, Noha F

    2013-06-01

    α-Amylase from Thermoactinomyces vulgaris was highly purified 48.9-fold by ammonium sulfate precipitation, gel filtration on Sephadex G-50 column, and ion exchange chromatography column of DEAE-cellulose. The molecular weight of the enzyme was estimated to be 135 and 145 kDa by SDS-PAGE. Its high molecular weight is due to high glycosylation. The purified amylase exhibited maximal activity at pH 6.0 to 7.0 and was stable in the range of pH 4.0 to 9.0. The optimum temperature for its activity was 50 °C. The enzyme half-life time was 120 min at 50 °C, suggesting intermediate temperature stable α-amylase. The enzyme was sensitive to different metal ions, including NaCl, CoCl(2), and CaCl(2), and to different concentrations of EDTA. The enzyme activity was inhibited in the presence of 1 mM CaCl(2), suggesting that it is a calcium-independent α-amylase. The TLC showed that the amylase hydrolyzed starch to produce large maltooligosaccharides as the main products. A 1.1-kb DNA fragment of the putative α-amylase gene (amy TVE) from T. vulgaris was amplified by using two specific newly designed primers. Sequencing analysis showed 56.2 % similarity to other Thermoactinomyces α-amylases with two conserved active sites confirming its function.

  8. Genic insights from integrated human proteomics in GeneCards.

    PubMed

    Fishilevich, Simon; Zimmerman, Shahar; Kohn, Asher; Iny Stein, Tsippi; Olender, Tsviya; Kolker, Eugene; Safran, Marilyn; Lancet, Doron

    2016-01-01

    GeneCards is a one-stop shop for searchable human gene annotations (http://www.genecards.org/). Data are automatically mined from ∼120 sources and presented in an integrated web card for every human gene. We report the application of recent advances in proteomics to enhance gene annotation and classification in GeneCards. First, we constructed the Human Integrated Protein Expression Database (HIPED), a unified database of protein abundance in human tissues, based on the publically available mass spectrometry (MS)-based proteomics sources ProteomicsDB, Multi-Omics Profiling Expression Database, Protein Abundance Across Organisms and The MaxQuant DataBase. The integrated database, residing within GeneCards, compares favourably with its individual sources, covering nearly 90% of human protein-coding genes. For gene annotation and comparisons, we first defined a protein expression vector for each gene, based on normalized abundances in 69 normal human tissues. This vector is portrayed in the GeneCards expression section as a bar graph, allowing visual inspection and comparison. These data are juxtaposed with transcriptome bar graphs. Using the protein expression vectors, we further defined a pairwise metric that helps assess expression-based pairwise proximity. This new metric for finding functional partners complements eight others, including sharing of pathways, gene ontology (GO) terms and domains, implemented in the GeneCards Suite. In parallel, we calculated proteome-based differential expression, highlighting a subset of tissues that overexpress a gene and subserving gene classification. This textual annotation allows users of VarElect, the suite's next-generation phenotyper, to more effectively discover causative disease variants. Finally, we define the protein-RNA expression ratio and correlation as yet another attribute of every gene in each tissue, adding further annotative information. The results constitute a significant enhancement of several Gene

  9. Genic insights from integrated human proteomics in GeneCards

    PubMed Central

    Fishilevich, Simon; Zimmerman, Shahar; Kohn, Asher; Iny Stein, Tsippi; Olender, Tsviya; Kolker, Eugene; Safran, Marilyn; Lancet, Doron

    2016-01-01

    GeneCards is a one-stop shop for searchable human gene annotations (http://www.genecards.org/). Data are automatically mined from ∼120 sources and presented in an integrated web card for every human gene. We report the application of recent advances in proteomics to enhance gene annotation and classification in GeneCards. First, we constructed the Human Integrated Protein Expression Database (HIPED), a unified database of protein abundance in human tissues, based on the publically available mass spectrometry (MS)-based proteomics sources ProteomicsDB, Multi-Omics Profiling Expression Database, Protein Abundance Across Organisms and The MaxQuant DataBase. The integrated database, residing within GeneCards, compares favourably with its individual sources, covering nearly 90% of human protein-coding genes. For gene annotation and comparisons, we first defined a protein expression vector for each gene, based on normalized abundances in 69 normal human tissues. This vector is portrayed in the GeneCards expression section as a bar graph, allowing visual inspection and comparison. These data are juxtaposed with transcriptome bar graphs. Using the protein expression vectors, we further defined a pairwise metric that helps assess expression-based pairwise proximity. This new metric for finding functional partners complements eight others, including sharing of pathways, gene ontology (GO) terms and domains, implemented in the GeneCards Suite. In parallel, we calculated proteome-based differential expression, highlighting a subset of tissues that overexpress a gene and subserving gene classification. This textual annotation allows users of VarElect, the suite’s next-generation phenotyper, to more effectively discover causative disease variants. Finally, we define the protein–RNA expression ratio and correlation as yet another attribute of every gene in each tissue, adding further annotative information. The results constitute a significant enhancement of several Gene

  10. Cellular functions of genetically imprinted genes in human and mouse as annotated in the gene ontology.

    PubMed

    Hamed, Mohamed; Ismael, Siba; Paulsen, Martina; Helms, Volkhard

    2012-01-01

    By analyzing the cellular functions of genetically imprinted genes as annotated in the Gene Ontology for human and mouse, we found that imprinted genes are often involved in developmental, transport and regulatory processes. In the human, paternally expressed genes are enriched in GO terms related to the development of organs and of anatomical structures. In the mouse, maternally expressed genes regulate cation transport as well as G-protein signaling processes. Furthermore, we investigated if imprinted genes are regulated by common transcription factors. We identified 25 TF families that showed an enrichment of binding sites in the set of imprinted genes in human and 40 TF families in mouse. In general, maternally and paternally expressed genes are not regulated by different transcription factors. The genes Nnat, Klf14, Blcap, Gnas and Ube3a contribute most to the enrichment of TF families. In the mouse, genes that are maternally expressed in placenta are enriched for AP1 binding sites. In the human, we found that these genes possessed binding sites for both, AP1 and SP1.

  11. State-of-the-art human gene therapy: part II. Gene therapy strategies and clinical applications.

    PubMed

    Wang, Dan; Gao, Guangping

    2014-09-01

    In Part I of this Review (Wang and Gao, 2014), we introduced recent advances in gene delivery technologies and explained how they have powered some of the current human gene therapy applications. In Part II, we expand the discussion on gene therapy applications, focusing on some of the most exciting clinical uses. To help readers to grasp the essence and to better organize the diverse applications, we categorize them under four gene therapy strategies: (1) gene replacement therapy for monogenic diseases, (2) gene addition for complex disorders and infectious diseases, (3) gene expression alteration targeting RNA, and (4) gene editing to introduce targeted changes in host genome. Human gene therapy started with the simple idea that replacing a faulty gene with a functional copy can cure a disease. It has been a long and bumpy road to finally translate this seemingly straightforward concept into reality. As many disease mechanisms unraveled, gene therapists have employed a gene addition strategy backed by a deep knowledge of what goes wrong in diseases and how to harness host cellular machinery to battle against diseases. Breakthroughs in other biotechnologies, such as RNA interference and genome editing by chimeric nucleases, have the potential to be integrated into gene therapy. Although clinical trials utilizing these new technologies are currently sparse, these innovations are expected to greatly broaden the scope of gene therapy in the near future.

  12. A Limited Number of Globin Genes in Human DNA

    PubMed Central

    Gambino, Roberto; Kacian, Daniel; O'Donnell, Joyce; Ramirez, Francesco; Marks, Paul A.; Bank, Arthur

    1974-01-01

    The number of globin genes in human cells was determined by hybridizing DNA from human spleens to 3H-labeled DNA complementary to human globin mRNA. Assuming the rates of reannealing of complementary DNA and cellular DNA are similar, the extent of hybridization of complementary DNA at various ratios of cellular DNA to complementary DNA indicate that there are fewer than 10 globin gene copies per haploid human genome. An alternative analysis of the data, which introduces no assumptions concerning the relative rates of reaction of complementary DNA and cellular DNA, indicates fewer than 20 globin gene copies are present. DNA isolated from the spleen of a patient with β+ thalassemia contained a number of globin gene copies similar to that of normal DNA. PMID:4530276

  13. A physical map of 30,000 human genes.

    PubMed

    Deloukas, P; Schuler, G D; Gyapay, G; Beasley, E M; Soderlund, C; Rodriguez-Tomé, P; Hui, L; Matise, T C; McKusick, K B; Beckmann, J S; Bentolila, S; Bihoreau, M; Birren, B B; Browne, J; Butler, A; Castle, A B; Chiannilkulchai, N; Clee, C; Day, P J; Dehejia, A; Dibling, T; Drouot, N; Duprat, S; Fizames, C; Fox, S; Gelling, S; Green, L; Harrison, P; Hocking, R; Holloway, E; Hunt, S; Keil, S; Lijnzaad, P; Louis-Dit-Sully, C; Ma, J; Mendis, A; Miller, J; Morissette, J; Muselet, D; Nusbaum, H C; Peck, A; Rozen, S; Simon, D; Slonim, D K; Staples, R; Stein, L D; Stewart, E A; Suchard, M A; Thangarajah, T; Vega-Czarny, N; Webber, C; Wu, X; Hudson, J; Auffray, C; Nomura, N; Sikela, J M; Polymeropoulos, M H; James, M R; Lander, E S; Hudson, T J; Myers, R M; Cox, D R; Weissenbach, J; Boguski, M S; Bentley, D R

    1998-10-23

    A map of 30,181 human gene-based markers was assembled and integrated with the current genetic map by radiation hybrid mapping. The new gene map contains nearly twice as many genes as the previous release, includes most genes that encode proteins of known function, and is twofold to threefold more accurate than the previous version. A redesigned, more informative and functional World Wide Web site (www.ncbi.nlm.nih.gov/genemap) provides the mapping information and associated data and annotations. This resource constitutes an important infrastructure and tool for the study of complex genetic traits, the positional cloning of disease genes, the cross-referencing of mammalian genomes, and validated human transcribed sequences for large-scale studies of gene expression.

  14. Human DJ-1-specific Transcriptional Activation of Tyrosine Hydroxylase Gene*

    PubMed Central

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M. M.

    2010-01-01

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-l-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice. PMID:20938049

  15. Human DJ-1-specific transcriptional activation of tyrosine hydroxylase gene.

    PubMed

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M M

    2010-12-17

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-L-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice.

  16. Identification of human HK genes and gene expression regulation study in cancer from transcriptomics data analysis.

    PubMed

    Chen, Meili; Xiao, Jingfa; Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer.

  17. Evolutionary and Topological Properties of Genes and Community Structures in Human Gene Regulatory Networks.

    PubMed

    Szedlak, Anthony; Smith, Nicholas; Liu, Li; Paternostro, Giovanni; Piermarocchi, Carlo

    2016-06-01

    The diverse, specialized genes present in today's lifeforms evolved from a common core of ancient, elementary genes. However, these genes did not evolve individually: gene expression is controlled by a complex network of interactions, and alterations in one gene may drive reciprocal changes in its proteins' binding partners. Like many complex networks, these gene regulatory networks (GRNs) are composed of communities, or clusters of genes with relatively high connectivity. A deep understanding of the relationship between the evolutionary history of single genes and the topological properties of the underlying GRN is integral to evolutionary genetics. Here, we show that the topological properties of an acute myeloid leukemia GRN and a general human GRN are strongly coupled with its genes' evolutionary properties. Slowly evolving ("cold"), old genes tend to interact with each other, as do rapidly evolving ("hot"), young genes. This naturally causes genes to segregate into community structures with relatively homogeneous evolutionary histories. We argue that gene duplication placed old, cold genes and communities at the center of the networks, and young, hot genes and communities at the periphery. We demonstrate this with single-node centrality measures and two new measures of efficiency, the set efficiency and the interset efficiency. We conclude that these methods for studying the relationships between a GRN's community structures and its genes' evolutionary properties provide new perspectives for understanding evolutionary genetics.

  18. Pancreatic Amylase Is an Environmental Signal for Regulation of Biofilm Formation and Host Interaction in Campylobacter jejuni

    PubMed Central

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A.; Nair, Sean P.; Sadiq, Sohaib; Williams, Lisa K.; Trantham, Emma K.; Stephenson, Holly; Wren, Brendan W.; Bajaj-Elliott, Mona; Cogan, Tristan A.; Laws, Andrew P.; Wade, Jim; Dorrell, Nick

    2015-01-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism. PMID:26438798

  19. Pancreatic amylase is an environmental signal for regulation of biofilm formation and host interaction in Campylobacter jejuni.

    PubMed

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A; Nair, Sean P; Sadiq, Sohaib; Williams, Lisa K; Trantham, Emma K; Stephenson, Holly; Wren, Brendan W; Bajaj-Elliott, Mona; Cogan, Tristan A; Laws, Andrew P; Wade, Jim; Dorrell, Nick; Allan, Elaine

    2015-12-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism.

  20. CdTe/CdSe quantum dots improve the binding affinities between α-amylase and polyphenols.

    PubMed

    Ni, Xiaoling

    2012-03-01

    People exposed to engineered nanomaterials have potential health risks associated. Human α-amylase is one of the key enzymes in the digestive system. There are few reports about the influence of quantum dots (QDs) on the digestive enzymes and their inhibition system. This work focused on the toxic effect of CdTe/CdSe QDs on the interactions between α-amylase and its natural inhibitors. Thirty-six dietary polyphenols, natural α-amylase inhibitors from food, were studied for their affinities for α-amylase in the absence and presence of CdTe/CdSe QDs by a fluorescence quenching method. The magnitudes of apparent binding constants of polyphenols for α-amylase were almost in the range of 10(5)-10(7) L mol(-1) in the presence of CdTe/CdSe QDs, which were higher than the magnitudes of apparent binding constants in the absence of CdTe/CdSe QDs (10(4)-10(6) L mol(-1)). CdTe/CdSe QDs obviously improved the affinities of dietary polyphenols for α-amylase up to 389.04 times. It is possible that the binding interaction between polyphenols and α-amylase in the presence of CdTe/CdSe QDs was mainly caused by electrostatic interactions. QDs significantly influence the digestive enzymes and their inhibition system.

  1. Polyaniline-graphene based α-amylase biosensor with a linear dynamic range in excess of 6 orders of magnitude.

    PubMed

    Teixeira, Sofia Rodrigues; Lloyd, Catherine; Yao, Seydou; Andrea Salvatore Gazze; Whitaker, Iain S; Francis, Lewis; Conlan, R Steven; Azzopardi, Ernest

    2016-11-15

    α-amylase is an established marker for diagnosis of pancreatic and salivary disease, and recent research has seen a substantial expansion of its use in therapeutic and diagnostic applications for infection, cancer and wound healing. The lack of bedside monitoring devices for α-amylase detection has hitherto restricted the clinical progress of such applications. We have developed a highly sensitive α-amylase immunosensor platform, produced via in situ electropolymerization of aniline onto a screen-printed graphene support (SPE). Covalently binding an α-amylase specific antibody to a polyaniline (PANI) layer and controlling device assembly using electrochemical impedance spectroscopy (EIS), we have achieved a highly linear response against α-amylase concentration. Each stage of the assembly was characterized using a suite of high-resolution topographical, chemical and mechanical techniques. Quantitative, highly sensitive detection was demonstrated using an artificially spiked human blood plasma samples. The device has a remarkably wide limit of quantification (0.025-1000IU/L) compared to α-amylase assays in current clinical use. With potential for simple scale up to volume manufacturing though standard semiconductor production techniques and subsequently clinical application, this biosensor will enable clinical benefit through early disease detection, and better informed administration of correct therapeutic dose of drugs used to treat α-amylase related diseases.

  2. Chromosomal localization of the human hexabrachion (tenascin) gene and evidence for recent reduplication within the gene.

    PubMed

    Gulcher, J R; Alexakos, M J; Le Beau, M M; Lemons, R S; Stefansson, K

    1990-04-01

    Using analysis of rodent-human somatic cell hybrids as well as in situ hybridization of hexabrachion cDNA probes to normal human metaphase chromosomes, we have localized the human hexabrachion gene to chromosome 9, bands q32-q34. We also put forward the hypothesis that there has been a recent reduplication of a small segment of the human hexabrachion gene. We support this hypothesis by comparison of codon usage in this segment of the gene to codon usage in the remainder of the gene. This hypothesis is also supported by comparison of the sequence of human hexabrachion to that of the chicken hexabrachion. In addition, the latter comparison shows that the reduplication most likely occurred after the divergence of mammalian and avian species.

  3. Gene Expression Patterns in Human Liver Cancers

    PubMed Central

    Chen, Xin; Cheung, Siu Tim; So, Samuel; Fan, Sheung Tat; Barry, Christopher; Higgins, John; Lai, Kin-Man; Ji, Jiafu; Dudoit, Sandrine; Ng, Irene O.L.; van de Rijn, Matt; Botstein, David; Brown, Patrick O.

    2002-01-01

    Hepatocellular carcinoma (HCC) is a leading cause of death worldwide. Using cDNA microarrays to characterize patterns of gene expression in HCC, we found consistent differences between the expression patterns in HCC compared with those seen in nontumor liver tissues. The expression patterns in HCC were also readily distinguished from those associated with tumors metastatic to liver. The global gene expression patterns intrinsic to each tumor were sufficiently distinctive that multiple tumor nodules from the same patient could usually be recognized and distinguished from all the others in the large sample set on the basis of their gene expression patterns alone. The distinctive gene expression patterns are characteristic of the tumors and not the patient; the expression programs seen in clonally independent tumor nodules in the same patient were no more similar than those in tumors from different patients. Moreover, clonally related tumor masses that showed distinct expression profiles were also distinguished by genotypic differences. Some features of the gene expression patterns were associated with specific phenotypic and genotypic characteristics of the tumors, including growth rate, vascular invasion, and p53 overexpression. PMID:12058060

  4. Human Studies of Angiogenic Gene Therapy

    PubMed Central

    Gupta, Rajesh; Tongers, Jörn; Losordo, Douglas W.

    2009-01-01

    Despite significant advances in medical, interventional, and surgical therapy for coronary and peripheral arterial disease, the burden of these illnesses remains high. To address this unmet need, the science of therapeutic angiogenesis has been evolving for almost two decades. Early pre-clinical studies and phase I clinical trials achieved promising results with growth factors administered as recombinant proteins or as single-agent gene therapies, and data accumulated through 10 years of clinical trials indicate that gene therapy has an acceptable safety profile. However, more rigorous phase II and phase III clinical trials have failed to unequivocally demonstrate that angiogenic agents are beneficial under the conditions and in the patients studied to date. Investigators have worked to understand the biology of the vascular system and to incorporate their findings into new treatments for patients with ischemic disease. Recent gene- and cell-therapy trials have demonstrated the bioactivity of several new agents and treatment strategies. Collectively, these observations have renewed interest in the mechanisms of angiogenesis and deepened our understanding of the complexity of vascular regeneration. Gene therapy that incorporates multiple growth factors, approaches that combine cell and gene therapy, and the administration of "master switch" agents that activate numerous downstream pathways are among the credible and plausible steps forward. In this review, we will examine the clinical development of angiogenic therapy, summarize several of the lessons learned during the conduct of these trials, and suggest how this prior experience may guide the conduct of future preclinical investigations and clinical trials. PMID:19815827

  5. Attenuation of Porphyromonas gingivalis oral infection by α-amylase and pentamidine.

    PubMed

    Li, Ying; Miao, Yu-Song; Fu, Yun; Li, Xi-Ting; Yu, Shao-Jie

    2015-08-01

    The Porphyromonas gingivalis bacterium is one of the most influential pathogens in oral infections. In the current study, the antimicrobial activity of α-amylase and pentamidine against Porphyromonas gingivalis was evaluated. Their in vitro inhibitory activity was investigated with the agar overlay technique, and the minimal inhibitory and bactericidal concentrations were determined. Using the bactericidal concentration, the antimicrobial actions of the inhibitors were investigated. In the present study, multiple techniques were utilized, including scanning electron microscopy (SEM), general structural analysis and differential gene expression analysis. The results obtained from SEM and bactericidal analysis indicated a notable observation; the pentamidine and α-amylase treatment destroyed the structure of the bacterial cell membranes, which led to cell death. These results were used to further explore these inhibitors and the mechanisms by which they act. Downregulated expression levels were observed for a number of genes coding for hemagglutinins and gingipains, and various genes involved in hemin uptake, chromosome replication and energy production. However, the expression levels of genes associated with iron storage and oxidative stress were upregulated by α-amylase and pentamidine. A greater effect was noted in response to pentamidine treatment. The results of the present study demonstrate promising therapeutic potential for α-amylases and pentamidine. These molecules have the potential to be used to develop novel drugs and broaden the availability of pharmacological tools for the attenuation of oral infections caused by Porphyromonas gingivalis.

  6. Salivary amylase and stress during stressful environment: three Mars analog mission crews study.

    PubMed

    Rai, Balwant; Kaur, Jasdeep; Foing, Bernard H

    2012-06-14

    After the establishment of the space age physicians, human factors engineers, neurologist and psychologists and their special attention to work on people's capability to meet up the physical, psychological, neuroscience and interpersonal strains of working in space, it has been regarded as an issue that seeks urgent consideration. Not study was conducted on effect of simulated Mars analog environment on stress and salivary amylase. So, this study aimed to confirm whether salivary amylase is act as stress biomarker in crew members who took part in Mars analog mission in an isolated and stressful environment. The 18 crew members were selected who took part in Mars Analog Research Station, Utah. Salivary amylase was measured using a biosensor of salivary amylase monitor and State-Trait Anxiety Inventory score at pre-extravehicular activity, post-extravehicular activity and on before mission. The state and trait anxiety scores at pre-extravehicular activity for each commander were elevated as compared to after extravehicular activity. There were significant differences in the state and trait anxiety scores between before extravehicular activity and after extravehicular activity of Commander and other members, also there were significant differences in values of before-extravehicular activity between commanders and other members. There were significant differences in values of salivary amylase at before extravehicular activity and after extravehicular activity between commander group and other members. There was significant correlation between salivary amylase and state and trait anxiety scores in all groups. Measuring salivary amylase level could be useful for stress assessment of crew members and population working in a stressful and isolated environment.

  7. Evaluation of reference genes for gene expression studies in human brown adipose tissue.

    PubMed

    Taube, Magdalena; Andersson-Assarsson, Johanna C; Lindberg, Kristin; Pereira, Maria J; Gäbel, Markus; Svensson, Maria K; Eriksson, Jan W; Svensson, Per-Arne

    2015-01-01

    Human brown adipose tissue (BAT) has during the last 5 year been subjected to an increasing research interest, due to its putative function as a target for future obesity treatments. The most commonly used method for molecular studies of human BAT is the quantitative polymerase chain reaction (qPCR). This method requires normalization to a reference gene (genes with uniform expression under different experimental conditions, e.g. similar expression levels between human BAT and WAT), but so far no evaluation of reference genes for human BAT has been performed. Two different microarray datasets with samples containing human BAT were used to search for genes with low variability in expression levels. Seven genes (FAM96B, GNB1, GNB2, HUWE1, PSMB2, RING1 and TPT1) identified by microarray analysis, and 8 commonly used reference genes (18S, B2M, GAPDH, LRP10, PPIA, RPLP0, UBC, and YWHAZ) were selected and further analyzed by quantitative PCR in both BAT containing perirenal adipose tissue and subcutaneous adipose tissue. Results were analyzed using 2 different algorithms (Normfinder and geNorm). Most of the commonly used reference genes displayed acceptably low variability (geNorm M-values <0.5) in the samples analyzed, but the novel reference genes identified by microarray displayed an even lower variability (M-values <0.25). Our data suggests that PSMB2, GNB2 and GNB1 are suitable novel reference genes for qPCR analysis of human BAT and we recommend that they are included in future gene expression studies of human BAT.

  8. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.

    PubMed

    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S

    2005-01-01

    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities.

  9. Restoration of Mitochondrial Gene Expression Using a Cloned Human Gene in Chinese Hamster Lung Cell Mutant

    PubMed Central

    Sherif, Zaki A; Broome, Carolyn W

    2015-01-01

    Background Gal−32 is a Chinese hamster lung cell nuclear mutant that is unable to grow in galactose due to a defect in mitochondrial protein synthesis. Since the product of the Gal−32 gene was unknown, it was imperative to use phenotypic complementation to clone a human gene that corrected the Gal−32 mutation. Results Recessive Gal−32 cells were co-transformed with pSV2-neo plasmid DNA and recombinant DNA from a human genomic library containing the dominant human Gal+ gene and a chloramphenicol-resistance (camr) gene present in the pSV13 vector. Primary transformants were selected by growth in galactose and the neomycin analog G418. In order to rescue the human Gal+ gene, a genomic library was constructed with primary transformant DNA and the pCV108 cosmid vector. The camr gene was used to identify clones with the nearby human sequences. DNA from two camr, Alu-hybridizing clones was able to transform the recessive Gal−32 cells to the Gal+ phenotype and to restore mitochondrial protein synthesis. Conclusion These data demonstrate the isolation of two pCV108-transformant recombinant clones containing a human gene that complements the Chinese hamster Gal−32 mutation and restores galactose metabolism. PMID:26052559

  10. Identification of Haemophilus ducreyi genes expressed during human infection.

    PubMed

    Bauer, Margaret E; Fortney, Kate R; Harrison, Alistair; Janowicz, Diane M; Munson, Robert S; Spinola, Stanley M

    2008-04-01

    To identify Haemophilus ducreyi transcripts that are expressed during human infection, we used selective capture of transcribed sequences (SCOTS) with RNA isolated from pustules obtained from three volunteers infected with H. ducreyi, and with RNA isolated from broth-grown bacteria used to infect volunteers. With SCOTS, competitive hybridization of tissue-derived and broth-derived sequences identifies genes that may be preferentially expressed in vivo. Among the three tissue specimens, we identified 531 genes expressed in vivo. Southern blot analysis of 60 genes from each tissue showed that 87 % of the identified genes hybridized better with cDNA derived from tissue specimens than with cDNA derived from broth-grown bacteria. RT-PCR on nine additional pustules confirmed in vivo expression of 10 of 11 selected genes in other volunteers. Of the 531 genes, 139 were identified in at least two volunteers. These 139 genes fell into several functional categories, including biosynthesis and metabolism, regulation, and cellular processes, such as transcription, translation, cell division, DNA replication and repair, and transport. Detection of genes involved in anaerobic and aerobic respiration indicated that H. ducreyi likely encounters both microenvironments within the pustule. Other genes detected suggest an increase in DNA damage and stress in vivo. Genes involved in virulence in other bacterial pathogens and 32 genes encoding hypothetical proteins were identified, and may represent novel virulence factors. We identified three genes, lspA1, lspA2 and tadA, known to be required for virulence in humans. This is the first study to broadly define transcripts expressed by H. ducreyi in humans.

  11. Patenting human genes and stem cells.

    PubMed

    Martin-Rendon, Enca; Blake, Derek J

    2007-01-01

    Cell lines and genetically modified single cell organisms have been considered patentable subjects for the last two decades. However, despite the technical patentability of genes and stem cell lines, social and legal controversy concerning their 'ownership' has surrounded stem cell research in recent years. Some granted patents on stem cells with extremely broad claims are casting a shadow over the commercialization of these cells as therapeutics. However, in spite of those early patents, the number of patent applications related to stem cells is growing exponentially. Both embryonic and adult stem cells have the ability to differentiate into several cell lineages in an organism as a result of specific genetic programs that direct their commitment and cell fate. Genes that control the pluripotency of stem cells have been recently identified and the genetic manipulation of these cells is becoming more efficient with the advance of new technologies. This review summarizes some of the recent published patents on pluripotency genes, gene transfer into stem cells and genetic reprogramming and takes the hematopoietic and embryonic stem cell as model systems.

  12. Organization of the human CD9 gene

    SciTech Connect

    Rubinstein, E.; Benoit, P.; Billard, M.; Plaisance, S.; Prenant, M.; Boucheix, C. ); Uzan, G. )

    1993-04-01

    The CD9 antigen was originally described as a 24-kDa molecule present on B-lineage-derived acute lymphoblastic leukemia cells and developing B lymphocytes. Platelets also express a large amount of CD9 antigen and can be activated by CD9 antibodies. The authors report here the structure of the CD9 gene, which is composed of 8 exons spanning more than 20 kb. There is no TATA or CAAT box in the 5[prime]-flanking domain of the CD9 gene, but a 120-bp region extremely rich in C and G (88%) contains several Sp1 binding sites and a consensus site for the binding of zinc-finger proteins of the Krox/EGR family. The CD9 antigen belongs to a new cell surface protein family. The organization of its gene closely resembles the organization of the genes for two other members of this protein family, TAPA1 and CD63, which share with CD9 respectively 45 and 25% identity at the amino acid level. 55 refs., 5 figs.

  13. Human decorin gene: Intron-exon junctions and chromosomal localization

    SciTech Connect

    Vetter, U.; Young, M.F.; Fisher, L.W. ); Vogel, W.; Just, W. )

    1993-01-01

    All of the protein-encoding exons and the 3[prime]flanking region of the human decorin gene have been cloned an partially sequenced. The locations of the intron-exon junctions within the coding portion of the gene were identical to those found for the homologous human gene, biglycan. The sizes of the introns in the decorin gene, however, were substantially larger than those of the same introns of the biglycan gene. Portions of introns 1, 2, and 3 as well as exon 1 were not found during our extensive screening process. The 5[prime] end of intron 2 was found to have an AG-rich region followed immediately by a CT-rich region. Furthermore, the 5[prime] end of intron 3 was very rich in thymidine, whereas the 3[prime] end of intron 7 was rich in adenosine. Several cDNA clones constructed from cultured human bone cell mRNA were found to contain a different sequence at the 5[prime] end compared to that previously published for mRNA from a human embryonic fibroblast cell line. We were also unable to find the alternate 3[prime] flanking region of the previously published cDNA sequence. We have mapped the human decorin gene by in situ methods to chromosome 12q2l.3. 30 refs., 3 figs., 1 tab.

  14. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  15. Characterization of the DNA polymerase gene of human herpesvirus 6.

    PubMed Central

    Teo, I A; Griffin, B E; Jones, M D

    1991-01-01

    The construction of a recombinant bacteriophage lambda library containing overlapping clones covering 155 kbp of the 161-kbp genome of the Ugandan U1102 isolate of human herpesvirus 6 (HHV-6) is described. The use of degenerate-primer polymerase chain reaction allowed the isolation of a DNA probe for the DNA polymerase gene of HHV-6, which was subsequently used to isolate and position the pol gene on the physical map of the viral genome. A 4.4-kbp EcoRI DNA restriction fragment containing the pol gene was isolated and sequenced. The open reading frames flanking the pol gene code for the HHV-6 glycoprotein B gene and the human cytomegalovirus UL53 homolog. This arrangement is different from that seen in the alpha and gamma herpesvirus families, lending further support to the notion that HHV-6 is a member of the beta herpesvirus group. Images PMID:1651403

  16. Pancreatic α-Amylase Controls Glucose Assimilation by Duodenal Retrieval through N-Glycan-specific Binding, Endocytosis, and Degradation.

    PubMed

    Date, Kimie; Satoh, Ayano; Iida, Kaoruko; Ogawa, Haruko

    2015-07-10

    α-Amylase, a major pancreatic protein and starch hydrolase, is essential for energy acquisition. Mammalian pancreatic α-amylase binds specifically to glycoprotein N-glycans in the brush-border membrane to activate starch digestion, whereas it significantly inhibits glucose uptake by Na(+)/glucose cotransporter 1 (SGLT1) at high concentrations (Asanuma-Date, K., Hirano, Y., Le, N., Sano, K., Kawasaki, N., Hashii, N., Hiruta, Y., Nakayama, K., Umemura, M., Ishikawa, K., Sakagami, H., and Ogawa, H. (2012) Functional regulation of sugar assimilation by N-glycan-specific interaction of pancreatic α-amylase with glycoproteins of duodenal brush border membrane. J. Biol. Chem. 287, 23104-23118). However, how the inhibition is stopped was unknown. Here, we show a new mechanism for the regulation of intestinal glucose absorption. Immunohistochemistry revealed that α-amylase in the duodena of non-fasted, but not fasted, pigs was internalized from the pancreatic fluid and immunostained. We demonstrated that after N-glycan binding, pancreatic α-amylase underwent internalization into lysosomes in a process that was inhibited by α-mannoside. The internalized α-amylase was degraded, showing low enzymatic activity and molecular weight at the basolateral membrane. In a human intestinal Caco-2 cell line, Alexa Fluor 488-labeled pancreatic α-amylase bound to the cytomembrane was transported to lysosomes through the endocytic pathway and then disappeared, suggesting degradation. Our findings indicate that N-glycan recognition by α-amylase protects enterocytes against a sudden increase in glucose concentration and restores glucose uptake by gradual internalization, which homeostatically controls the postprandial blood glucose level. The internalization of α-amylase may also enhance the supply of amino acids required for the high turnover of small intestine epithelial cells. This study provides novel and significant insights into the control of blood sugar during the absorption

  17. Discovery and characterization of pseudocyclic cystine-knot α-amylase inhibitors with high resistance to heat and proteolytic degradation.

    PubMed

    Nguyen, Phuong Q T; Wang, Shujing; Kumar, Akshita; Yap, Li J; Luu, Thuy T; Lescar, Julien; Tam, James P

    2014-10-01

    Obesity and type 2 diabetes are chronic metabolic diseases, and those affected could benefit from the use of α-amylase inhibitors to manage starch intake. The pseudocyclics, wrightides Wr-AI1 to Wr-AI3, isolated from an Apocynaceae plant show promise for further development as orally active α-amylase inhibitors. These linear peptides retain the stability known for cystine-knot peptides in the presence of harsh treatment. They are resistant to heat treatment and endopeptidase and exopeptidase degradation, which is characteristic of cyclic cystine-knot peptides. Our NMR and crystallography analysis also showed that wrightides, which are currently the smallest proteinaceous α-amylase inhibitors reported, contain the backbone-twisting cis-proline, which is preceded by a nonaromatic residue rather than a conventional aromatic residue. The modeled structure and a molecular dynamics study of Wr-AI1 in complex with yellow mealworm α-amylase suggested that, despite having a similar structure and cystine-knot fold, the knottin-type α-amylase inhibitors may bind to insect α-amylase via a different set of interactions. Finally, we showed that the precursors of pseudocyclic cystine-knot α-amylase inhibitors and their biosynthesis in plants follow a secretory protein synthesis pathway. Together, our findings provide insights for the use of the pseudocyclic α-amylase inhibitors as useful leads for the development of orally active peptidyl bioactives, as well as an alternative scaffold for cyclic peptides for engineering metabolically stable human α-amylase inhibitors.

  18. Some aspects of the mechanism of complexation of red kidney bean alpha-amylase inhibitor and alpha-amylase.

    PubMed

    Wilcox, E R; Whitaker, J R

    1984-04-10

    Bovine pancreatic alpha-amylase binds 1 mol of acarbose (a carbohydrate alpha-amylase inhibitor) per mol at the active site and also binds acarbose nonspecifically. The red kidney bean alpha-amylase inhibitor-bovine pancreatic alpha-amylase complex retained nonspecific binding for acarbose only. Binding of p-nitrophenyl alpha-D-maltoside to the final complex of red kidney bean alpha-amylase inhibitor and bovine pancreatic alpha-amylase has a beta Ks (Ks') value that is 3.4-fold greater than the Ks (16 mM) of alpha-amylase for p-nitrophenyl alpha-D-maltoside alone. The initial complex of alpha-amylase and inhibitor apparently hydrolyzes this substrate as rapidly as alpha-amylase alone. The complex retains affinity for substrates and competitive inhibitors, which, when present in high concentrations, cause dissociation of the complex. Maltose (0.5 M), a competitive inhibitor of alpha-amylase, caused dissociation of the red kidney bean alpha-amylase inhibitor--alpha-amylase complex. Interaction between red kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor and porcine pancreatic alpha-amylase proceeds through two steps. The first step has a Keq of 3.1 X 10(-5) M. The second step (unimolecular; first order) has a forward rate constant of 3.05 min-1 at pH 6.9 and 30 degrees C. alpha-Amylase inhibitor combines with alpha-amylase, in the presence of p-nitrophenyl alpha-D-maltoside, noncompetitively. On the basis of the data presented, it is likely that alpha-amylase is inactivated by the alpha-amylase inhibitor through a conformational change. A kinetic model, in the presence and absence of substrate, is described for noncompetitive, slow, tight-binding inhibitors that proceed through two steps.

  19. Human blood group genes 2004: chromosomal locations and cloning strategies.

    PubMed

    Lögdberg, Lennart; Reid, Marion E; Lamont, Ryan E; Zelinski, Teresa

    2005-01-01

    Of the 29 human blood group system genes, 27 have been localized to 14 autosomes and 2 have been assigned to the X chromosome. It is remarkable that 28 of the 29 system genes have now been localized to a single cytogenetic band on a specific chromosome. In this review, we summarize the chromosomal locations and cloning strategies used for those genes encoding blood group systems. We highlight such information about the 3 most recently defined blood group systems (I, GLOB, and GIL). In addition, we provide new information about 2 older blood group systems (SC and RAPH) whose polymorphisms have been defined in cloned genes.

  20. Human cancers overexpress genes that are specific to a variety of normal human tissues

    PubMed Central

    Lotem, Joseph; Netanely, Dvir; Domany, Eytan; Sachs, Leo

    2005-01-01

    We have analyzed gene expression data from three different kinds of samples: normal human tissues, human cancer cell lines, and leukemic cells from lymphoid and myeloid leukemia pediatric patients. We have searched for genes that are overexpressed in human cancer and also show specific patterns of tissue-dependent expression in normal tissues. Using the expression data of the normal tissues, we identified 4,346 genes with a high variability of expression and clustered these genes according to their relative expression level. Of 91 stable clusters obtained, 24 clusters included genes preferentially expressed either only in hematopoietic tissues or in hematopoietic and one to two other tissues; 28 clusters included genes preferentially expressed in various nonhematopoietic tissues such as neuronal, testis, liver, kidney, muscle, lung, pancreas, and placenta. Analysis of the expression levels of these two groups of genes in the human cancer cell lines and leukemias identified genes that were highly expressed in cancer cells but not in their normal counterparts and, thus, were overexpressed in the cancers. The different cancer cell lines and leukemias varied in the number and identity of these overexpressed genes. The results indicate that many genes that are overexpressed in human cancer cells are specific to a variety of normal tissues, including normal tissues other than those from which the cancer originated. It is suggested that this general property of cancer cells plays a major role in determining the behavior of the cancers, including their metastatic potential. PMID:16339305

  1. CRISPR RNA-guided activation of endogenous human genes.

    PubMed

    Maeder, Morgan L; Linder, Samantha J; Cascio, Vincent M; Fu, Yanfang; Ho, Quan H; Joung, J Keith

    2013-10-01

    Short guide RNAs (gRNAs) can direct catalytically inactive CRISPR-associated 9 nuclease (dCas9) to repress endogenous genes in bacteria and human cells. Here we show that single or multiple gRNAs can direct dCas9 fused to a VP64 transcriptional activation domain to increase expression of endogenous human genes. This proof-of-principle work shows that clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems can target heterologous effector domains to endogenous sites in human cells.

  2. Isolating human DNA repair genes using rodent-cell mutants

    SciTech Connect

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-03-23

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab.

  3. Evolutionary and Topological Properties of Genes and Community Structures in Human Gene Regulatory Networks

    PubMed Central

    Szedlak, Anthony; Smith, Nicholas; Liu, Li; Paternostro, Giovanni; Piermarocchi, Carlo

    2016-01-01

    The diverse, specialized genes present in today’s lifeforms evolved from a common core of ancient, elementary genes. However, these genes did not evolve individually: gene expression is controlled by a complex network of interactions, and alterations in one gene may drive reciprocal changes in its proteins’ binding partners. Like many complex networks, these gene regulatory networks (GRNs) are composed of communities, or clusters of genes with relatively high connectivity. A deep understanding of the relationship between the evolutionary history of single genes and the topological properties of the underlying GRN is integral to evolutionary genetics. Here, we show that the topological properties of an acute myeloid leukemia GRN and a general human GRN are strongly coupled with its genes’ evolutionary properties. Slowly evolving (“cold”), old genes tend to interact with each other, as do rapidly evolving (“hot”), young genes. This naturally causes genes to segregate into community structures with relatively homogeneous evolutionary histories. We argue that gene duplication placed old, cold genes and communities at the center of the networks, and young, hot genes and communities at the periphery. We demonstrate this with single-node centrality measures and two new measures of efficiency, the set efficiency and the interset efficiency. We conclude that these methods for studying the relationships between a GRN’s community structures and its genes’ evolutionary properties provide new perspectives for understanding evolutionary genetics. PMID:27359334

  4. Complete structural characterisation of the human aryl hydrocarbon receptor gene

    PubMed Central

    Bennett, P; Ramsden, D B; Williams, A C

    1996-01-01

    Aims—To clone and characterise the complete structural gene for the human aryl hydrocarbon receptor (AhR). This gene, located on chromosome 7, encodes a cytosolic receptor protein which, upon activation by various xenobiotic ligands, translocates to the nucleus, where it acts as a specific transcription factor. Methods—Primers, based on the AhR cDNA sequence, were used in conjunction with recently developed long range PCR techniques to amplify contiguous sections of the cognate gene. The amplicons produced were then cloned and characterised. A cDNA probe was also used to screen a human P1 library. Results—Using the cDNA primers, DNA fragments which mapped the entire coding region of the gene were amplified and cloned. All but one of these fragments were amplified directly from human genomic DNA. The remaining fragment was amplified using DNA prepared from a P1 clone as the PCR template. This P1 clone, obtained by screening a human P1 library, also contained the entire Ah locus. Characterisation of amplified and cloned DNA fragments provided sufficient information for the construction of a complete structural map of the gene. This also included 150 base pairs of nucleotide sequence data at all intronic termini. Conclusions—These data indicate that the human AhR gene is about 50 kilobases long and contains 11 exons. The overall intron/exon structure of the human gene is homologous to that of the previously characterised mouse gene; however, it is probably some 20 kilobases larger. These results demonstrate the need for further characterisation and provide the data to facilitate this. Images PMID:16696038

  5. Novel primary immunodeficiency candidate genes predicted by the human gene connectome.

    PubMed

    Itan, Yuval; Casanova, Jean-Laurent

    2015-01-01

    Germline genetic mutations underlie various primary immunodeficiency (PID) diseases. Patients with rare PID diseases (like most non-PID patients and healthy individuals) carry, on average, 20,000 rare and common coding variants detected by high-throughput sequencing. It is thus a major challenge to select only a few candidate disease-causing variants for experimental testing. One of the tools commonly used in the pipeline for estimating a potential PID-candidate gene is to test whether the specific gene is included in the list of genes that were already experimentally validated as PID-causing in previous studies. However, this approach is limited because it cannot detect the PID-causing mutation(s) in the many PID patients carrying causal mutations of as yet unidentified PID-causing genes. In this study, we expanded in silico the list of potential PID-causing candidate genes from 229 to 3,110. We first identified the top 1% of human genes predicted by the human genes connectome to be biologically close to the 229 known PID genes. We then further narrowed down the list of genes by retaining only the most biologically relevant genes, with functionally enriched gene ontology biological categories similar to those for the known PID genes. We validated this prediction by showing that 17 of the 21 novel PID genes published since the last IUIS classification fall into this group of 3,110 genes (p < 10(-7)). The resulting new extended list of 3,110 predicted PID genes should be useful for the discovery of novel PID genes in patients.

  6. Novel Primary Immunodeficiency Candidate Genes Predicted by the Human Gene Connectome

    PubMed Central

    Itan, Yuval; Casanova, Jean-Laurent

    2015-01-01

    Germline genetic mutations underlie various primary immunodeficiency (PID) diseases. Patients with rare PID diseases (like most non-PID patients and healthy individuals) carry, on average, 20,000 rare and common coding variants detected by high-throughput sequencing. It is thus a major challenge to select only a few candidate disease-causing variants for experimental testing. One of the tools commonly used in the pipeline for estimating a potential PID-candidate gene is to test whether the specific gene is included in the list of genes that were already experimentally validated as PID-causing in previous studies. However, this approach is limited because it cannot detect the PID-causing mutation(s) in the many PID patients carrying causal mutations of as yet unidentified PID-causing genes. In this study, we expanded in silico the list of potential PID-causing candidate genes from 229 to 3,110. We first identified the top 1% of human genes predicted by the human genes connectome to be biologically close to the 229 known PID genes. We then further narrowed down the list of genes by retaining only the most biologically relevant genes, with functionally enriched gene ontology biological categories similar to those for the known PID genes. We validated this prediction by showing that 17 of the 21 novel PID genes published since the last IUIS classification fall into this group of 3,110 genes (p < 10−7). The resulting new extended list of 3,110 predicted PID genes should be useful for the discovery of novel PID genes in patients. PMID:25883595

  7. Gene encoding human Ro-associated autoantigen Y5 RNA.

    PubMed Central

    Maraia, R; Sakulich, A L; Brinkmann, E; Green, E D

    1996-01-01

    Ro ribonucleoproteins are composed of Y RNAs and the Ro 60 kDa protein. While the Ro 60 kDa protein is implicated in an RNA discard pathway that recognizes 3'-extended 5S rRNAs, the function of Y RNAs remains unknown [O'Brien,C.A. and Wolin,S.L. (1995) Genes Dev. 8,2891-2903]. Y5 RNA occupies a large fraction of Ro 60 kDa protein in human Ro RNPs, contains an atypical 3'-extension not found on other Y RNAs, and constitutes an RNA antigen in certain autoimmune patients [Boulanger et al. (1995) Clin. Exp. Immunol. 99, 29-36]. An overabundance of Y RNA retroposed pseudogenes has previously complicated the isolation of mammalian Y RNA genes. The source gene for Y5 RNA was isolated from human DNA as well as from Galago senegalis DNA. Authenticity of the hY5 RNA gene was demonstrated in vivo and its activity was compared with the hY4 RNA gene that also uses a type 3 promoter for RNA polymerase III. The hY5 RNA gene was subsequently found to reside within a few hundred thousand base pairs of other Y RNA genes and the linear order of the four human Y RNA genes on chromosome 7q36 was determined. Phylogenetic comparative analyses of promoter and RNA structure indicate that the Y5 RNA gene has been subjected to positive selection during primate evolution. Consistent with the proposal of O'Brien and Harley [O'Brian,C.A. and Wolin,S.L. (1992) Gene 116, 285-289], analysis of flanking sequences suggest that the hY5 RNA gene may have originated as a retroposon. PMID:8836182

  8. An atlas of gene expression and gene co-regulation in the human retina

    PubMed Central

    Pinelli, Michele; Carissimo, Annamaria; Cutillo, Luisa; Lai, Ching-Hung; Mutarelli, Margherita; Moretti, Maria Nicoletta; Singh, Marwah Veer; Karali, Marianthi; Carrella, Diego; Pizzo, Mariateresa; Russo, Francesco; Ferrari, Stefano; Ponzin, Diego; Angelini, Claudia; Banfi, Sandro; di Bernardo, Diego

    2016-01-01

    The human retina is a specialized tissue involved in light stimulus transduction. Despite its unique biology, an accurate reference transcriptome is still missing. Here, we performed gene expression analysis (RNA-seq) of 50 retinal samples from non-visually impaired post-mortem donors. We identified novel transcripts with high confidence (Observed Transcriptome (ObsT)) and quantified the expression level of known transcripts (Reference Transcriptome (RefT)). The ObsT included 77 623 transcripts (23 960 genes) covering 137 Mb (35 Mb new transcribed genome). Most of the transcripts (92%) were multi-exonic: 81% with known isoforms, 16% with new isoforms and 3% belonging to new genes. The RefT included 13 792 genes across 94 521 known transcripts. Mitochondrial genes were among the most highly expressed, accounting for about 10% of the reads. Of all the protein-coding genes in Gencode, 65% are expressed in the retina. We exploited inter-individual variability in gene expression to infer a gene co-expression network and to identify genes specifically expressed in photoreceptor cells. We experimentally validated the photoreceptors localization of three genes in human retina that had not been previously reported. RNA-seq data and the gene co-expression network are available online (http://retina.tigem.it). PMID:27235414

  9. Gene × Smoking Interactions on Human Brain Gene Expression: Finding Common Mechanisms in Adolescents and Adults

    ERIC Educational Resources Information Center

    Wolock, Samuel L.; Yates, Andrew; Petrill, Stephen A.; Bohland, Jason W.; Blair, Clancy; Li, Ning; Machiraju, Raghu; Huang, Kun; Bartlett, Christopher W.

    2013-01-01

    Background: Numerous studies have examined gene × environment interactions (G × E) in cognitive and behavioral domains. However, these studies have been limited in that they have not been able to directly assess differential patterns of gene expression in the human brain. Here, we assessed G × E interactions using two publically available datasets…

  10. Enhancer Complexes Located Downstream of Both Human Immunoglobulin Cα Genes

    PubMed Central

    Mills, Frederick C.; Harindranath, Nagaradona; Mitchell, Mary; Max, Edward E.

    1997-01-01

    To investigate regulation of human immunoglobulin heavy chain expression, we have cloned DNA downstream from the two humangenes, corresponding to the position in the mouse IgH cluster of a locus control region (LCR) that includes an enhancer which regulates isotype switching. Within 25 kb downstream of both the human immunoglobulin Cα1 and Cα2 genes we identified several segments of DNA which display B lymphoid–specific DNase I hypersensitivity as well as enhancer activity in transient transfections. The corresponding sequences downstream from each of the two humangenes are nearly identical to each other. These enhancers are also homologous to three regions which lie in similar positions downstream from the murine Cα gene and form the murine LCR. The strongest enhancers in both mouse and human have been designated HS12. Within a 135-bp core homology region, the human HS12 enhancers are ∼90% identical to the murine homolog and include several motifs previously demonstrated to be important for function of the murine enhancer; additional segments of high sequence conservation suggest the possibility of previously unrecognized functional motifs. On the other hand, certain functional elements in the murine enhancer, including a B cell–specific activator protein site, do not appear to be conserved in human HS12. The human homologs of the murine enhancers designated HS3 and HS4 show lower overall sequence conservation, but for at least two of the functional motifs in the murine HS4 (a κB site and an octamer motif  ) the human HS4 homologs are exactly conserved. An additional hypersensitivity site between human HS3 and HS12 in each human locus displays no enhancer activity on its own, but includes a region of high sequence conservation with mouse, suggesting the possibility of another novel functional element. PMID:9294139

  11. P gene as an inherited biomarker of human eye color.

    PubMed

    Rebbeck, Timothy R; Kanetsky, Peter A; Walker, Amy H; Holmes, Robin; Halpern, Allan C; Schuchter, Lynn M; Elder, David E; Guerry, DuPont

    2002-08-01

    Human pigmentation, including eye color, has been associated with skin cancer risk. The P gene is the human homologue to the mouse pink-eye dilution locus and is responsible for oculocutaneous albinism type 2 and other phenotypes that confer eye hypopigmentation. The P gene is located on chromosome 15q11.2-q12, which is also the location of a putative eye pigmentation gene (EYCL3) inferred to exist by linkage analysis. Therefore, the P gene is a strong candidate for determination of human eye color. Using a sample of 629 normally pigmented individuals, we found that individuals were less likely to have blue or gray eyes if they had P gene variants Arg305Trp (P = 0.002), Arg419Gln (P = 0.001), or the combination of both variants (P = 0.003). These results suggest that P gene, in part, determines normal phenotypic variation in human eye color and may therefore represent an inherited biomarker of cutaneous cancer risk.

  12. The d4 gene family in the human genome

    SciTech Connect

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.

    1996-08-15

    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at low stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.

  13. Characterization of human septic sera induced gene expression modulation in human myocytes

    PubMed Central

    Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem

    2009-01-01

    To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886

  14. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    NASA Astrophysics Data System (ADS)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  15. microRNA and gene networks in human laryngeal cancer

    PubMed Central

    ZHANG, FENGYU; XU, ZHIWEN; WANG, KUNHAO; SUN, LINLIN; LIU, GENGHE; HAN, BAIXU

    2015-01-01

    Genes and microRNAs (miRNAs) are considered to be key biological factors in human carcinogenesis. To date, considerable data have been obtained regarding genes and miRNAs in cancer; however, the regulatory mechanisms associated with the genes and miRNAs in cancer have yet to be fully elucidated. The aim of the present study was to use the key genes and miRNAs associated with laryngeal cancer (LC) to construct three regulatory networks (differentially expressed, LC-related and global). A network topology of the development of LC, involving 10 differentially expressed miRNAs and 55 differentially expressed genes, was obtained. These genes exhibited multiple identities, including target genes of miRNA, transcription factors (TFs) and host genes. The key regulatory interactions were determined by comparing the similarities and differences among the three networks. The nodes and pathways in LC, as well as the association between each pair of factors within the networks, such as TFs and miRNA, miRNA and target genes and miRNA and its host gene, were discussed. The mechanisms of LC involved certain key pathways featuring self-adaptation regulation and nodes without direct predecessors or successors. The findings of the present study have further elucidated the pathogenesis of LC and are likely to be beneficial for future research into LC. PMID:26668624

  16. An In Vitro and In Vivo Study of the α-Amylase Activity of Phaseolamin

    PubMed Central

    de Gouveia, Neire Moura; Alves, Fernanda Vieira; Furtado, Fabiana Barcelos; Scherer, Danielli Luana; Mundim, Antonio Vicente

    2014-01-01

    Abstract We evaluated the polypeptide profiles, inhibition of human salivary α-amylase activity, and hemagglutination properties of a commercial phaseolamin sample. We also performed an in vivo assay to investigate the effects of a commercial phaseolamin treatment (100, 500, or 1500 mg/kg) over 20 days on the glycemia, body weight, and serum biochemical parameters (total cholesterol, triglycerides, alanine aminotransferase, and aspartate aminotransferase) of nondiabetic and streptozotocin-induced diabetic rats. The in vitro evaluation showed defined protein profiles, low hemagglutination activity, and high α-amylase inhibition. None of the experimental groups treated with phaseolamin or acarbose showed decreases in body weight. Our data demonstrate that phaseolamin inhibits amylase activity in vitro, reduces blood glucose levels, decreases or attenuates some of the renal and hepatic effects of diabetes in streptozotocin-induced rats, and could therefore have therapeutic potential in the treatment or prevention of the complications of diabetes. PMID:24650210

  17. Coordinate regulation of HOX genes in human hematopoietic cells

    SciTech Connect

    Magli, M.C.; Barba, P.; Celetti, A.; De Vita, G.; Cillo, C.; Boncinelli, E. )

    1991-07-15

    Hematopoiesis is a continuous process in which precursor cells proliferate and differentiate throughout life. However, the molecular mechanisms that govern this process are not clearly defined. Homeobox-containing genes, encoding DNA-binding homeodomains. are a network of genes highly conserved throughout evolution. They are organized in clusters expressed in the developing embryo with a positional hierarchy. The authors have analyzed expression of the four human HOX loci in erythroleukemic, promyelocytic, and monocytic cell lines to investigate whether the physical organization of human HOX genes reflects a regulatory hierarchy involved in the differentiation process of hematopoietic cells. The results demonstrate that cells representing various stages of hematopoietic differentiation display differential patterns of HOX gene expression and that HOX genes are coordinately switched on or off in blocks that may include entire loci. The entire HOX4 locus is silent in all lines analyzed and almost all the HOX2 genes are active in erythroleukemic cells and turned off in myeloid-restricted cells. The observations provide information about the regulation of HOX genes and suggest that the coordinate regulation of these genes may play an important role in lineage determination during early steps of hematopoiesis.

  18. Human Intellectual Disability Genes Form Conserved Functional Modules in Drosophila

    PubMed Central

    Oortveld, Merel A. W.; Keerthikumar, Shivakumar; Oti, Martin; Nijhof, Bonnie; Fernandes, Ana Clara; Kochinke, Korinna; Castells-Nobau, Anna; van Engelen, Eva; Ellenkamp, Thijs; Eshuis, Lilian; Galy, Anne; van Bokhoven, Hans; Habermann, Bianca; Brunner, Han G.; Zweier, Christiane; Verstreken, Patrik; Huynen, Martijn A.; Schenck, Annette

    2013-01-01

    Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules. PMID:24204314

  19. Identification and characterization of essential genes in the human genome

    PubMed Central

    Wang, Tim; Birsoy, Kıvanç; Hughes, Nicholas W.; Krupczak, Kevin M.; Post, Yorick; Wei, Jenny J.; Lander, Eric S.; Sabatini, David M.

    2015-01-01

    Large-scale genetic analysis of lethal phenotypes has elucidated the molecular underpinnings of many biological processes. Using the bacterial clustered regularly interspaced short palindromic repeats (CRISPR) system, we constructed a genome-wide single-guide RNA (sgRNA) library to screen for genes required for proliferation and survival in a human cancer cell line. Our screen revealed the set of cell-essential genes, which was validated by an orthogonal gene-trap-based screen and comparison with yeast gene knockouts. This set is enriched for genes that encode components of fundamental pathways, are expressed at high levels, and contain few inactivating polymorphisms in the human population. We also uncovered a large group of uncharacterized genes involved in RNA processing, a number of whose products localize to the nucleolus. Lastly, screens in additional cell lines showed a high degree of overlap in gene essentiality, but also revealed differences specific to each cell line and cancer type that reflect the developmental origin, oncogenic drivers, paralogous gene expression pattern, and chromosomal structure of each line. These results demonstrate the power of CRISPR-based screens and suggest a general strategy for identifying liabilities in cancer cells. PMID:26472758

  20. Origins of De Novo Genes in Human and Chimpanzee

    PubMed Central

    Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M.Mar

    2015-01-01

    The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species—human, chimpanzee, macaque, and mouse—and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins. PMID:26720152

  1. Origins of De Novo Genes in Human and Chimpanzee.

    PubMed

    Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M Mar

    2015-12-01

    The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species--human, chimpanzee, macaque, and mouse--and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins.

  2. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-05-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  3. Chromosomal localization of the human vesicular amine transporter genes

    SciTech Connect

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. )

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  4. [Gene therapy for human hearing loss: challenges and promises].

    PubMed

    Meyer, Anaïs; Petit, Christine; Safieddine, Saaid

    2013-10-01

    Thanks to the advances accomplished in human genomics during the last twenty years, major progress has been made towards understanding the pathogenesis of various forms of congenital or acquired deafness. The identification of deafness genes, which are potential therapeutic targets, and generation and functional characterization of murine models for human deafness forms have advanced the knowledge of the molecular physiology of auditory sensory cells. These milestones have opened the way for the development of new therapeutic strategies, alternatives to conventional prostheses, hearing amplification for mild-to-severe hearing loss, or cochlear implantation for severe-to-profound deafness. In this review, we first summarize the progress made over the last decade in using gene therapy and antisense RNA delivery, including the development of new methods for cochlear gene transfer. We then discuss the potential of gene therapy for curing acquired or inherited deafness and the major obstacles that must be overcome before clinical application can be considered.

  5. Mapping of UV photoproducts along the human P53 gene

    SciTech Connect

    Tornaletti, S.; Rozek, D.; Pfeifer, G.P.

    1994-12-31

    Methods to detect DNA adducts at the DNA sequence level in mammalian cells have been developed, and it is now possible to relate adduct frequency and repair efficiency with mutations at certain nucleotide positions in human cancer-relevant genes. Mutations in the p53 tumor suppressor gene have been found in a large proportion of human skin cancers. These mutations are predominantly C to T transitions and CC to TT double transition mutations, two types of base alterations specifically induced by UV light. In order to find possible correlations between adduct distribution and mutations at specific p53 sequences, we have mapped at single-base resolution the distribution of cyclobutane dimers (CBD) and (6-4) photoproducts along the p53 gene in UV-irradiated human skin fibroblasts by ligation-mediated polymerase chain reaction (LMPCR).

  6. A model for gene therapy of human hereditary lymphedema

    PubMed Central

    Karkkainen, Marika J.; Saaristo, Anne; Jussila, Lotta; Karila, Kaisa A.; Lawrence, Elizabeth C.; Pajusola, Katri; Bueler, Hansruedi; Eichmann, Anne; Kauppinen, Risto; Kettunen, Mikko I.; Ylä-Herttuala, Seppo; Finegold, David N.; Ferrell, Robert E.; Alitalo, Kari

    2001-01-01

    Primary human lymphedema (Milroy's disease), characterized by a chronic and disfiguring swelling of the extremities, is associated with heterozygous inactivating missense mutations of the gene encoding vascular endothelial growth factor C/D receptor (VEGFR-3). Here, we describe a mouse model and a possible treatment for primary lymphedema. Like the human patients, the lymphedema (Chy) mice have an inactivating Vegfr3 mutation in their germ line, and swelling of the limbs because of hypoplastic cutaneous, but not visceral, lymphatic vessels. Neuropilin (NRP)-2 bound VEGF-C and was expressed in the visceral, but not in the cutaneous, lymphatic endothelia, suggesting that it may participate in the pathogenesis of lymphedema. By using virus-mediated VEGF-C gene therapy, we were able to generate functional lymphatic vessels in the lymphedema mice. Our results suggest that growth factor gene therapy is applicable to human lymphedema and provide a paradigm for other diseases associated with mutant receptors. PMID:11592985

  7. Chromosome locations of human EMX and OTX genes

    SciTech Connect

    Kastury, K.; Druck, T.; Huebner, K.

    1994-07-01

    The authors have determined the chromosomal localization of four human homeobox-containing genes, EMX1, EMX2, OTX1, and OTX2, related to Drosophila genes expressed in the developing head of the fly. Murine homologs of these genes are expressed in specific nested domains in the developing rostral brain of midgestation embryos. DNAs from a panel of 19 rodent-human hybrids, each carrying one or a few human chromosomes such that most human chromosomes regions were presented, were tested for the presence of the four gene loci by filter hybridization to radiolabeled probes. Regional chromosomal localization was determined by similarly testing DNAs from hybrid mapping panels for each of the candidate chromosomes. Finally, fluorescence in situ hybridization of cosmid clones for these loci refined the locations, two of which were in the vicinity of previously mapped orphan homeobox genes and two of which were near each other. OTX2, the earliest and most widely expressed gene, maps to chromosome region 14q21-q22; the OTX1 locus maps to 2p13; EMX2 maps to 10q26.1; and EMX1, the most narrowly and lately expressed, maps to 2p14-p13. Thus, these homeobox-containing genes involved in brain development are not linked to any of the four HOX clusters on 7p15-p14, 17q21-q22, 12q12-q13, and 2q31. However, the OTX1 and EMX1 loci may be closely linked on or near 2p13, prompting speculation that a clustered gene structure could have functional significance, as is presumably the case for the HOX clusters. 33 refs., 2 figs.

  8. Human gene transfer: Characterization of human tumor-infiltrating lymphocytes as vehicles for retroviral-mediated gene transfer in man

    SciTech Connect

    Kasid, A.; Morecki, S.; Aebersold, P.; Cornetta, K.; Culver, K.; Freeman, S.; Director, E.; Lotze, M.T.; Blaese, R.M.; Anderson, W.F.; Rosenberg, S.A. )

    1990-01-01

    Tumor-infiltrating lymphocytes (TILs) are cells generated from tumor suspensions cultured in interleukin 2 that can mediate cancer regression when adoptively transferred into mice or humans. Since TILs proliferate rapidly in vitro, recirculate, and preferentially localize at the tumor site in vivo, they provide an attractive model for delivery of exogenous genetic material into man. To determine whether efficient gene transfer into TILs is feasible. The authors transduced human TILs with the bacterial gene for neomycin-resistance (Neo{sup R}) using the retroviral vector N2. The transduced TIL populations were stable and polyclonal with respect to the intact Neo{sup R} gene integration and expressed high levels of neomycin phosphotransferase activity. The Neo{sup R} gene insertion did not alter the in vitro growth pattern and interleukin 2 dependence of the transduced TILs. Analyses of T-cell receptor gene rearrangement for {beta}- and {gamma}-chain genes revealed the oligoclonal nature of the TIL populations with no major change in the DNA rearrangement patterns or the levels of mRNA expression of the {beta} and {gamma} chains following transduction and selection of TILs in the neomycin analog G418. Human TILs expressed mRNA for tumor necrosis factors ({alpha} and {beta}) and interleukin 2 receptor P55. This pattern of cytokine-mRNA expression was not significantly altered following the transduction of TILs. The studies demonstrate the feasibility of TILs as suitable cellular vehicles for the introduction of therapeutic genes into patients receiving autologous TILs.

  9. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.

    PubMed

    Narang, Vipin; Ramli, Muhamad Azfar; Singhal, Amit; Kumar, Pavanish; de Libero, Gennaro; Poidinger, Michael; Monterola, Christopher

    2015-01-01

    Human gene regulatory networks (GRN) can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs). Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data) accompanying this manuscript.

  10. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase.

    PubMed

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua

    2015-10-01

    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation.

  11. [Microbe amylases: characteristic, properties and practical use].

    PubMed

    Kubrak, O I; Lushchak, V I

    2007-01-01

    Current data concerning structure, properties and methods of purification ofmicrobial amylolytic enzymes are summarized in this paper. A short characteristic of the main methods of amylase activity measuring is presented, the advantages and disadvantages of each method are shown. It is proposed that novel techniques of enzyme immobilization stabilize the structure of amylases and allow their multiple uses. Scientific interest to amylases is analyzed that is explained by a number of their unique properties such as thermostability and pH-tolerance. Authors have demonstrated some examples of the practical using ofamylases in different fields of industry: textile, paper, food industries, brewing and wine-making. The prospects of their possible using in detergent preparing for laundries and dishwashers are presented. It is supposed that future investigations in this trend for isolating new amrnylases from native producers will be developed.

  12. The gene for human glutaredoxin (GLRX) is localized to human chromosome 5q14

    SciTech Connect

    Padilla, C.A.; Holmgren, A.; Bajalica, S.; Lagercrantz, J.

    1996-03-05

    Glutaredoxin is a small protein (12 kDa) catalyzing glutathione-dependent disulfide oxidoreduction reactions in a coupled system with NADPH, GSH, and glutathione reductase. A cDNA encoding the human glutaredoxin gene (HGMW-approved symbol GLRX) has recently been isolated and cloned from a human fetal spleen cDNA library. The screening of a human fetal spleen cDNA library. The screening of a human genomic library in Charon 4A led to the identification of three genomic clones. Using fluorescence in situ hybridization to metaphase chromosomes with one genomic clone as a probe, the human glutaredoxin gene was localized to chromosomal region 5q14. This localization at chromosome 5 was in agreement with the somatic cell hybrid analysis, using DNA from a human-hamster and a human-mouse hybrid panel and using a human glutaredoxin cDNA as a probe. 13 refs., 2 figs.

  13. Genomic organization of the human lysosomal acid lipase gene (LIPA)

    SciTech Connect

    Aslandis, C.; Klima, H.; Lackner, K.J.; Schmitz, G. )

    1994-03-15

    Defects in the human lysosomal acid lipase gene are responsible for cholesteryl ester storage disease (CESD) and Wolman disease. Exon skipping as the cause for CESD has been demonstrated. The authors present here a summary of the exon structure of the entire human lysosomal acid lipase gene consisting of 10 exons, together with the sizes of genomic EcoRI and SacI fragments hybridizing to each exon. In addition, the DNA sequence of the putative promoter region is presented. The EMBL accession numbers for adjacent intron sequences are given. 7 refs., 2 figs., 1 tab.

  14. Aptamer-guided gene targeting in yeast and human cells

    PubMed Central

    Ruff, Patrick; Koh, Kyung Duk; Keskin, Havva; Pai, Rekha B.; Storici, Francesca

    2014-01-01

    Gene targeting is a genetic technique to modify an endogenous DNA sequence in its genomic location via homologous recombination (HR) and is useful both for functional analysis and gene therapy applications. HR is inefficient in most organisms and cell types, including mammalian cells, often limiting the effectiveness of gene targeting. Therefore, increasing HR efficiency remains a major challenge to DNA editing. Here, we present a new concept for gene correction based on the development of DNA aptamers capable of binding to a site-specific DNA binding protein to facilitate the exchange of homologous genetic information between a donor molecule and the desired target locus (aptamer-guided gene targeting). We selected DNA aptamers to the I-SceI endonuclease. Bifunctional oligonucleotides containing an I-SceI aptamer sequence were designed as part of a longer single-stranded DNA molecule that contained a region with homology to repair an I-SceI generated double-strand break and correct a disrupted gene. The I-SceI aptamer-containing oligonucleotides stimulated gene targeting up to 32-fold in yeast Saccharomyces cerevisiae and up to 16-fold in human cells. This work provides a novel concept and research direction to increase gene targeting efficiency and lays the groundwork for future studies using aptamers for gene targeting. PMID:24500205

  15. Evolution and organization of the human protein C gene.

    PubMed Central

    Plutzky, J; Hoskins, J A; Long, G L; Crabtree, G R

    1986-01-01

    We have isolated overlapping phage genomic clones covering an area of 21 kilobases that encodes the human protein C gene. The gene is at least 11.2 kilobases long and is made up of nine exons and eight introns. Two regions homologous to epidermal growth factor and transforming growth factor are encoded by amino acids 46-91 and 92-136 and are precisely delimited by introns, as is a similar sequence in the genes for coagulation factor IX and tissue plasminogen activator. When homologous amino acids of factor IX and protein C are aligned, the positions of all eight introns correspond precisely, suggesting that these genes are the product of a relatively recent gene duplication. Nevertheless, the two genes are sufficiently distantly related that no nucleic acid homology remains in the intronic regions and that the size of the introns varies dramatically between the two genes. The similarity of the genes for factor IX and protein C suggests that they may be the most closely related members of the serine protease gene family involved in coagulation and fibrinolysis. Images PMID:3511471

  16. IGD: a resource for intronless genes in the human genome.

    PubMed

    Louhichi, Amel; Fourati, Ahmed; Rebaï, Ahmed

    2011-11-15

    Intronless genes (IGs) fraction varies between 2.7 and 97.7% in eukaryotic genomes. Although many databases on exons and introns exist, there was no curated database for such genes which allowed their study in a concerted manner. Such a database would be useful to identify the functional features and the distribution of these genes across the genome. Here, a new database of IGs in eukaryotes based on GenBank data was described. This database, called IGD (Intronless Gene Database), is a collection of gene sequences that were annotated and curated. The current version of IGD contains 687 human intronless genes with their protein and CDS sequences. Some features of the entries are given in this paper. Data was extracted from GenBank release 183 using a Perl script. Data extraction was followed by a manual curation step. Intronless genes were then analyzed based on their RefSeq annotation and Gene Ontology functional class. IGD represents a useful resource for retrieval and in silico study of intronless genes. IGD is available at http://www.bioinfo-cbs.org/igd with comprehensive help and FAQ pages that illustrate the main uses of this resource.

  17. DRUMS: a human disease related unique gene mutation search engine.

    PubMed

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html.

  18. Nucleotide sequence of the human N-myc gene

    SciTech Connect

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-03-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions.

  19. Identification of a new oat β-amylase by functional proteomics.

    PubMed

    Ben Halima, Nihed; Khemakhem, Bassem; Fendri, Imen; Ogata, Hiroyuki; Baril, Patrick; Pichon, Chantal; Abdelkafi, Slim

    2016-01-01

    Oat (Avena sativa L.) seed extracts exhibited a high degree of catalytic activity including amylase activities. Proteins in the oat seed extracts were optimized for their amylolytic activities. Oat extract with amylolytic activity was separated by SDS-PAGE and a major protein band with an apparent molecular mass of 53 kDa was subjected to tryptic digestion. The generated amino acid sequences were analyzed by liquid chromatography–tandem mass spectrometry (LC/ESI/MS/MS) and database searches. These sequences were used to identify a partial cDNA from expressed sequence tags (ESTs) of A. sativa L. Based upon EST sequences, a predicted full-length gene was identified, with an open reading frame of 1464 bp encoding a protein of 488 amino acid residues (AsBAMY), with a theoretical molecular mass of 55 kDa identified as a β-amylase belonging to the plant β-amylase family. Primary structure of oat β-amylase (AsBAMY) protein indicated high similarity with other β-amylase from other cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare), and rye (Secale cereale) with two conserved Glu residues (E184 and E378) assigned as the “putative” catalytic residues which would act as an acid and base pair in the catalytic process. In addition, a 3D-model of AsBAMY was built from known X-ray structures and sequence alignments. A similar core (β/α)8-barrel architecture was found in AsBAMY like the other cereal β-amylases with a specific location of the active site in a pocket-like cavity structure made at one end of this core (β/α)8-barrel domain suggesting an accessibility of the non-reducing end of the substrate and thus confirming the results of AsBAMY exo-acting hydrolase.

  20. Redox regulation of a novel plastid-targeted beta-amylase of Arabidopsis.

    PubMed

    Sparla, Francesca; Costa, Alex; Lo Schiavo, Fiorella; Pupillo, Paolo; Trost, Paolo

    2006-07-01

    Nine genes of Arabidopsis (Arabidopsis thaliana) encode for beta-amylase isozymes. Six members of the family are predicted to be extrachloroplastic isozymes and three contain predicted plastid transit peptides. Among the latter, chloroplast-targeted beta-amylase (At4g17090) and thioredoxin-regulated beta-amylase (TR-BAMY; At3g23920; this work) are experimentally demonstrated to be targeted to plastids. Recombinant TR-BAMY was catalytically active only when expressed as a mature protein, i.e. with no transit peptide. Mature TR-BAMY was a monomer of 60 kD, hydrolyzing soluble starch with optimal activity between pH 6.0 and 8.0. The activity of recombinant TR-BAMY was strictly dependent on redox potential with an Em,7.0 of -302 +/- 14 mV. Thioredoxins f1, m1, and y1 of Arabidopsis were all able to mediate the reductive activation of oxidized TR-BAMY. Site-specific mutants showed that TR-BAMY oxidative inhibition depended on the formation of a disulfide bridge between Cys-32 and Cys-470. Consistent with TR-BAMY redox dependency, total beta-amylase activity in Arabidopsis chloroplasts was partially redox regulated and required reducing conditions for full activation. In Arabidopsis, TR-BAMY transcripts were detected in leaves, roots, flowers, pollen, and seeds. TR-BAMY may be the only beta-amylase of nonphotosynthetic plastids suggesting a redox regulation of starch metabolism in these organelles. In leaves, where chloroplast-targeted beta-amylase is involved in physiological degradation of starch in the dark, TR-BAMY is proposed to participate to a redox-regulated pathway of starch degradation under specific stress conditions.

  1. Characterization of Gene Expression in Human Breast Tumor Endothelium

    DTIC Science & Technology

    2008-05-01

    to UV-induced apoptosis in primary culture of canine mammary gland tumors (7), and SFRP2 decreased apoptosis in cardiomyocytes exposed to hypoxia(8...microdissection (LCM) of vascular cells from frozen human breast tumors and normal breast tissue for genomic analysis. We found SFRP2 to have 6 fold increased...vascular cells from frozen human breast tumors , where the RNA was of high quality and sufficient for genomic analysis(6). We found 55 genes with > 4

  2. Injury, inflammation and the emergence of human specific genes

    DTIC Science & Technology

    2016-07-12

    with the genetic versatility of inflammatory response and the emergence of injuries associated with uniquely hominid behaviors, like a bipedal posture...genes to the onset and progression of human disease have been largely understudied.2 In contrast, the genetic mechanisms to explain the emergence of...Varki A, Gagneux P, Sikela JM. Evolution of genetic and genomic features unique to the human lineage. Nat Rev Genet 2012; 13: 853–66. 3. Zhang YE

  3. Cloning and characterization of two new thermostable and alkalitolerant α-amylases from the Anoxybacillus species that produce high levels of maltose.

    PubMed

    Chai, Yen Yen; Rahman, Raja Noor Zaliha Raja Abd; Illias, Rosli Md; Goh, Kian Mau

    2012-05-01

    Two genes that encode α-amylases from two Anoxybacillus species were cloned and expressed in Escherichia coli. The genes are 1,518 bp long and encode 506 amino acids. Both sequences are 98% similar but are distinct from other well-known α-amylases. Both of the recombinant enzymes, ASKA and ADTA, were purified using an α-CD-Sepharose column. They exhibited an optimum activity at 60°C and pH 8. Both amylases were stable at pH 6-10. At 60°C in the absence of Ca²⁺, negligible reduction in activity for up to 48 h was observed. The activity half-life at 65°C was 48 and 3 h for ASKA and ADTA, respectively. In the presence of Ca²⁺ ions, both amylases were highly stable for at least 48 h and had less than a 10% decrease in activity at 70°C. Both enzymes exhibited similar end-product profiles, and the predominant yield was maltose (69%) from starch hydrolysis. To the best of our knowledge, most α-amylases that produce high levels of maltose are active at an acidic to neutral pH. This is the first report of two thermostable, alkalitolerant recombinant α-amylases from Anoxybacillus that produce high levels of maltose and have an atypical protein sequence compared with known α-amylases.

  4. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  5. Changes in Gene Expression in Human Meibomian Gland Dysfunction

    PubMed Central

    Liu, Shaohui; Richards, Stephen M.; Lo, Kristine; Hatton, Mark; Fay, Aaron

    2011-01-01

    Purpose. Meibomian gland dysfunction (MGD) may be the leading cause of dry eye syndrome throughout the world. However, the precise mechanism(s) underlying the pathogenesis of this disease is unclear. This study was conducted to identify meibomian gland genes that may promote the development and/or progression of human MGD. Methods. Lid tissues were obtained from male and female MGD patients and age-matched controls after eyelid surgeries (e.g., to correct entropion or ectropion). Meibomian glands were isolated and processed for RNA extraction and the analysis of gene expression. Results. The results show that MGD is associated with significant alterations in the expression of almost 400 genes in the human meibomian gland. The levels of 197 transcripts, including those encoding various small proline-rich proteins and S100 calcium-binding proteins, are significantly increased, whereas the expression of 194 genes, such as claudin 3 and cell adhesion molecule 1, is significantly decreased. These changes, which cannot be accounted for by sex differences, are accompanied by alterations in many gene ontologies (e.g., keratinization, cell cycle, and DNA repair). The findings also show that the human meibomian gland contains several highly expressed genes that are distinct from those in an adjacent tissue (i.e., conjunctival epithelium). Conclusions. The results demonstrate that MGD is accompanied by multiple changes in gene expression in the meibomian gland. The nature of these alterations, including the upregulation of genes encoding small proline-rich proteins and S100 calcium-binding proteins, suggest that keratinization plays an important role in the pathogenesis of MGD. PMID:21372006

  6. Two tandemly located promoters, artificially constructed, are active in a Bacillus subtilis alpha-amylase secretion vector.

    PubMed

    Furusato, T; Takano, J; Jigami, Y; Tanaka, H; Yamane, K

    1986-04-01

    An 85 bp DNA fragment, the nucleotide sequence of which had 84% homology with the sequence for the promoter, ribosome binding site and NH2-terminal five amino acids of the Bacillus amyloliquefaciens alpha-amylase gene, was chemically synthesized. In order to analyze the promoter activity of a Bacillus subtilis alpha-amylase secretion vector, the fragment was inserted between the promoter and signal peptide-coding region of Bacillus subtilis alpha-amylase gene. Both promoters, tandemly repeated, functioned in transcribing the B. subtilis alpha-amylase signal peptide-coding region followed by the Escherichia coli beta-lactamase structural gene. The transcription initiation sites were determined by the primer extension method. The extracellular production of beta-lactamase was stimulated by two promoters as compared with that by the plasmids containing either promoter region alone. The change of two amino acids in the NH2-terminal region of the B. subtilis alpha-amylase signal peptide had no effect on the secretion of beta-lactamase from B. subtilis cells.

  7. Correction of human. beta. sup S -globin gene by gene targeting

    SciTech Connect

    Shesely, E.G.; Hyungsuk Kim; Shehee, W.R.; Smithies, O. ); Papayannopoulou, T. ); Popovich, B.W. )

    1991-05-15

    As a step toward using gene targeting for gene therapy, the authors have corrected a human {beta}{sup S}-globin gene to the normal {beta}{sup A} allele by homologous recombination in the mouse-human hybrid cell line BSM. BSM is derived from a mouse erythroleukemia cell line and carries a single human chromosome 11 with the {beta}{sup S}-globin allele. A {beta}{sup A}-globin targeting construct containing a unique oligomer and a neomycin-resistance gene was electroporated into the BSM cells, which were then placed under G418 selection. Then 126 resulting pools containing a total {approx}29,000 G418-resistant clones were screened by PCR for the presence of a targeted recombinant: 3 positive pools were identified. A targeted clone was isolated by replating one of the positive pools into smaller pools and rescreening by PCR, followed by dilution cloning. Southern blot analysis demonstrated that the isolated clone had been targeted as planned. The correction of the {beta}{sup S} allele to {beta}{sup A} was confirmed both by allele-specific PCR and by allele-specific antibodies. Expression studies comparing the uninduced and induced RNA levels in unmodified BSM cells and in the targeted clone showed no significant alteration in the ability of the targeted clone to undergo induction, despite the potentially disrupting presence of a transcriptionally active neomycin gene 5{prime} to the human {beta}{sup A}-globin gene. Thus gene targeting can correct a {beta}{sup S} allele to {beta}{sup A}, and the use of a selectable helper gene need not significantly interfere with the induction of the corrected gene.

  8. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  9. Law-medicine interfacing: patenting of human genes and mutations.

    PubMed

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2011-08-01

    Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

  10. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.

    PubMed

    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata

    2015-04-01

    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  11. Contemporary Animal Models For Human Gene Therapy Applications.

    PubMed

    Gopinath, Chitra; Nathar, Trupti Job; Ghosh, Arkasubhra; Hickstein, Dennis Durand; Remington Nelson, Everette Jacob

    2015-01-01

    Over the past three decades, gene therapy has been making considerable progress as an alternative strategy in the treatment of many diseases. Since 2009, several studies have been reported in humans on the successful treatment of various diseases. Animal models mimicking human disease conditions are very essential at the preclinical stage before embarking on a clinical trial. In gene therapy, for instance, they are useful in the assessment of variables related to the use of viral vectors such as safety, efficacy, dosage and localization of transgene expression. However, choosing a suitable disease-specific model is of paramount importance for successful clinical translation. This review focuses on the animal models that are most commonly used in gene therapy studies, such as murine, canine, non-human primates, rabbits, porcine, and a more recently developed humanized mice. Though small and large animals both have their own pros and cons as disease-specific models, the choice is made largely based on the type and length of study performed. While small animals with a shorter life span could be well-suited for degenerative/aging studies, large animals with longer life span could suit longitudinal studies and also help with dosage adjustments to maximize therapeutic benefit. Recently, humanized mice or mouse-human chimaeras have gained interest in the study of human tissues or cells, thereby providing a more reliable understanding of therapeutic interventions. Thus, animal models are of great importance with regard to testing new vector technologies in vivo for assessing safety and efficacy prior to a gene therapy clinical trial.

  12. Human testis-specific genes are under relaxed negative selection.

    PubMed

    Pierron, Denis; Razafindrazaka, Harilanto; Rocher, Christophe; Letellier, Thierry; Grossman, Lawrence I

    2014-02-01

    Recent studies have suggested that selective forces and constraints acting on genes varied during human evolution depending on the organ in which they are expressed. To gain insight into the evolution of organ determined negative selection forces, we compared the non-synonymous SNP diversity of genes expressed in different organs. Based on a HAPMAP dataset, we determined for each SNP its frequency in 11 human populations and, in each case, predicted whether or not the change it produces is deleterious. We have shown that, for all organs under study, SNPs predicted to be deleterious are present at a significantly lower frequency than SNPs predicted to be tolerated. However, testis-specific genes contain a higher proportion of deleterious SNPs than other organs. This study shows that negative selection is acting on the whole human genome, but that the action of negative selection is relaxed on testis-specific genes. This result adds to and expands the hypothesis of a recent evolutionary change in the human male reproductive system and its behavior.

  13. Chromosomal mapping of the human M6 genes

    SciTech Connect

    Olinsky, S.; Loop, B.T.; DeKosky, A.

    1996-05-01

    M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis. We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.

  14. Global Patterns of Diversity and Selection in Human Tyrosinase Gene

    PubMed Central

    Hudjashov, Georgi; Villems, Richard; Kivisild, Toomas

    2013-01-01

    Global variation in skin pigmentation is one of the most striking examples of environmental adaptation in humans. More than two hundred loci have been identified as candidate genes in model organisms and a few tens of these have been found to be significantly associated with human skin pigmentation in genome-wide association studies. However, the evolutionary history of different pigmentation genes is rather complex: some loci have been subjected to strong positive selection, while others evolved under the relaxation of functional constraints in low UV environment. Here we report the results of a global study of the human tyrosinase gene, which is one of the key enzymes in melanin production, to assess the role of its variation in the evolution of skin pigmentation differences among human populations. We observe a higher rate of non-synonymous polymorphisms in the European sample consistent with the relaxation of selective constraints. A similar pattern was previously observed in the MC1R gene and concurs with UV radiation-driven model of skin color evolution by which mutations leading to lower melanin levels and decreased photoprotection are subject to purifying selection at low latitudes while being tolerated or even favored at higher latitudes because they facilitate UV-dependent vitamin D production. Our coalescent date estimates suggest that the non-synonymous variants, which are frequent in Europe and North Africa, are recent and have emerged after the separation of East and West Eurasian populations. PMID:24040225

  15. The Human Lexinome: Genes of Language and Reading

    ERIC Educational Resources Information Center

    Gibson, Christopher J.; Gruen, Jeffrey R.

    2008-01-01

    Within the human genome, genetic mapping studies have identified 10 regions of different chromosomes, known as DYX loci, in genetic linkage with dyslexia, and two, known as SLI loci, in genetic linkage with Specific Language Impairment (SLI). Further genetic studies have identified four dyslexia genes within the DYX loci: "DYX1C1" on 15q,…

  16. Designer Babies? Teacher Views on Gene Technology and Human Medicine.

    ERIC Educational Resources Information Center

    Schibeci, Renato

    1999-01-01

    Summarizes the views of a sample of primary and high school teachers on the application of gene technology to human medicine. In general, high school teachers are more positive about these developments than primary teachers, and both groups of teachers are more positive than interested lay publics. Highlights ways in which this topic can be…

  17. Death and Resurrection of the Human IRGM Gene

    PubMed Central

    Bekpen, Cemalettin; Marques-Bonet, Tomas; Alkan, Can; Antonacci, Francesca; Leogrande, Maria Bruna; Ventura, Mario; Kidd, Jeffrey M.; Siswara, Priscillia; Howard, Jonathan C.; Eichler, Evan E.

    2009-01-01

    Immunity-related GTPases (IRG) play an important role in defense against intracellular pathogens. One member of this gene family in humans, IRGM, has been recently implicated as a risk factor for Crohn's disease. We analyzed the detailed structure of this gene family among primates and showed that most of the IRG gene cluster was deleted early in primate evolution, after the divergence of the anthropoids from prosimians ( about 50 million years ago). Comparative sequence analysis of New World and Old World monkey species shows that the single-copy IRGM gene became pseudogenized as a result of an Alu retrotransposition event in the anthropoid common ancestor that disrupted the open reading frame (ORF). We find that the ORF was reestablished as a part of a polymorphic stop codon in the common ancestor of humans and great apes. Expression analysis suggests that this change occurred in conjunction with the insertion of an endogenous retrovirus, which altered the transcription initiation, splicing, and expression profile of IRGM. These data argue that the gene became pseudogenized and was then resurrected through a series of complex structural events and suggest remarkable functional plasticity where alleles experience diverse evolutionary pressures over time. Such dynamism in structure and evolution may be critical for a gene family locked in an arms race with an ever-changing repertoire of intracellular parasites. PMID:19266026

  18. Mechanical regulation of osteoclastic genes in human osteoblasts

    SciTech Connect

    Kreja, Ludwika Liedert, Astrid; Hasni, Sofia; Claes, Lutz; Ignatius, Anita

    2008-04-11

    Bone adaptation to mechanical load is accompanied by changes in gene expression of bone-forming cells. Less is known about mechanical effects on factors controlling bone resorption by osteoclasts. Therefore, we studied the influence of mechanical loading on several key genes modulating osteoclastogenesis. Human osteoblasts were subjected to various cell stretching protocols. Quantitative RT-PCR was used to evaluate gene expression. Cell stretching resulted in a significant up-regulation of receptor activator of nuclear factor-{kappa}B ligand (RANKL) immediate after intermittent loading (3 x 3 h, 3 x 6 h, magnitude 1%). Continuous loading, however, had no effect on RANKL expression. The expression of osteoprotegerin (OPG), macrophage-colony stimulating factor (M-CSF), and osteoclast inhibitory lectin (OCIL) was not significantly altered. The data suggested that mechanical loading could influence osteoclasts recruitment by modulating RANKL expression in human osteoblasts and that the effects might be strictly dependent on the quality of loading.

  19. Gene transcriptional networks integrate microenvironmental signals in human breast cancer.

    PubMed

    Xu, Ren; Mao, Jian-Hua

    2011-04-01

    A significant amount of evidence shows that microenvironmental signals generated from extracellular matrix (ECM) molecules, soluble factors, and cell-cell adhesion complexes cooperate at the extra- and intracellular level. This synergetic action of microenvironmental cues is crucial for normal mammary gland development and breast malignancy. To explore how the microenvironmental genes coordinate in human breast cancer at the genome level, we have performed gene co-expression network analysis in three independent microarray datasets and identified two microenvironment networks in human breast cancer tissues. Network I represents crosstalk and cooperation of ECM microenvironment and soluble factors during breast malignancy. The correlated expression of cytokines, chemokines, and cell adhesion proteins in Network II implicates the coordinated action of these molecules in modulating the immune response in breast cancer tissues. These results suggest that microenvironmental cues are integrated with gene transcriptional networks to promote breast cancer development.

  20. Splicing of many human genes involves sites embedded within introns

    PubMed Central

    Kelly, Steven; Georgomanolis, Theodore; Zirkel, Anne; Diermeier, Sarah; O'Reilly, Dawn; Murphy, Shona; Längst, Gernot; Cook, Peter R.; Papantonis, Argyris

    2015-01-01

    The conventional model for splicing involves excision of each intron in one piece; we demonstrate this inaccurately describes splicing in many human genes. First, after switching on transcription of SAMD4A, a gene with a 134 kb-long first intron, splicing joins the 3′ end of exon 1 to successive points within intron 1 well before the acceptor site at exon 2 is made. Second, genome-wide analysis shows that >60% of active genes yield products generated by such intermediate intron splicing. These products are present at ∼15% the levels of primary transcripts, are encoded by conserved sequences similar to those found at canonical acceptors, and marked by distinctive structural and epigenetic features. Finally, using targeted genome editing, we demonstrate that inhibiting the formation of these splicing intermediates affects efficient exon–exon splicing. These findings greatly expand the functional and regulatory complexity of the human transcriptome. PMID:25897131

  1. Characterization of a Digestive α-Amylase in the Midgut of Pieris brassicae L. (Lepidoptera: Pieridae)

    PubMed Central

    Sharifloo, Ali; Zibaee, Arash; Sendi, Jalal J.; Jahroumi, Khalil Talebi

    2016-01-01

    The current study deals with a digestive α-amylase in the larvae of Pieris brassicae L. through purification, enzymatic characterization, gene expression, and in vivo effect of a specific inhibitor, Acarbose. Although α-amylase activity was the highest in the whole gut homogenate of larvae but compartmentalization of amylolytic activity showed an equal activity in posterior midgut (PM) and anterior midgut (AM). A three step purification using ammonium sulfate, Sepharyl G-100 and DEAE-Cellulose Fast flow revealed an enzyme with a specific activity of 5.18 U/mg, recovery of 13.20, purification fold of 19.25 and molecular weight of 88 kDa. The purified α-amylase had the highest activity at optimal pH and temperature of 8 and 35°C. Also, the enzyme had Vmax values of 4.64 and 3.02 U/mg protein and Km values of 1.37 and 1.74% using starch and glycogen as substrates, respectively. Different concentrations of acarbose, ethylenediamine tetraacetic acid, and ethylene glycol-bis (β-aminoethylether) N, N, N′, N′-tetraacetic acid significantly decreased activity of the purified α-amylase. The 4th instar larvae of P. brassicae were fed on the treated leaves of Raphanus sativus L. with 0.22 mM of Acarbose to find in vivo effects on nutritional indices, α-amylase activity, and gene expression. The significant differences were only found in conversion efficiency of digested food, relative growth rate, and metabolic cost of control and fed larvae on Acarbose. Also, amylolytic activity significantly decreased in the treated larvae by both biochemical and native-PAGE experiments. Results of RT-PCR revealed a gene with 621 bp length responsible for α-amylase expression that had 75% identity with Papilio xuthus and P. polytes. Finally, qRT-PCR revealed higher expression of α-amylase in control larvae compared to acarbose-fed ones. PMID:27014094

  2. Detection of pulmonary amylase activity in exhaled breath condensate.

    PubMed

    Zweifel, M; Rechsteiner, T; Hofer, M; Boehler, A

    2013-12-01

    Amylase activity in exhaled breath condensate (EBC) is usually interpreted as an indication of oropharyngeal contamination despite the fact that amylase can be found in pulmonary excretions. The aim of this study was to recruit and refine an amylase assay in order to detect amylase activity in any EBC sample and to develop a method to identify EBC samples containing amylase of pulmonary origin. EBC was collected from 40 volunteers with an EcoScreen condenser. Amylase assays and methods to discriminate between oropharyngeal and pulmonary proteins were tested and developed using matched EBC and saliva samples. Our refined 2-chloro-4-nitrophenyl-α-D-maltotriosid (CNP-G3) assay was 40-fold more sensitive than the most sensitive commercial assay and allowed detection of amylase activity in 30 µl of EBC. We developed a dot-blot assay which allowed detection of salivary protein in saliva diluted up to 150 000-fold. By plotting amylase activity against staining intensity we identified a few EBC samples with high amylase activity which were aligned with diluted saliva. We believe that EBC samples aligned with diluted saliva contain amylase activity introduced during EBC collection and that all other EBC samples contain amylase activity of pulmonary origin and are basically free of oropharyngeal protein contamination.

  3. Regulated expression of the human gastrin gene in mice.

    PubMed

    Mensah-Osman, Edith; Labut, Ed; Zavros, Yana; El-Zaatari, Mohamad; Law, David J; Merchant, Juanita L

    2008-11-29

    Gastrin is secreted from neuroendocrine cells residing in the adult antrum called G cells, but constitutively low levels are also expressed in the duodenum and fetal pancreas. Gastrin normally regulates gastric acid secretion by stimulating the proliferation of enterochromaffin-like cells and the release of histamine. Gastrin and progastrin forms are expressed in a number of pathological conditions and malignancies. However, the DNA regulatory elements in the human versus the mouse gastrin promoters differ suggesting differences in their transcriptional control. Thus, we describe here the expression of the human gastrin gene using a bacterial artificial chromosome (BAC) in the antral and duodenal cells of gastrin null mice. All 5 founder lines expressed the 253 kb human gastrin BAC. hGasBAC transgenic mice were bred onto a gastrin null background so that the levels of human gastrin peptide could be analyzed by immunohistochemistry and radioimmunoassay without detecting endogenous mouse gastrin. We have shown previously that chronically elevated gastrin levels suppress somatostatin. Indeed, infusion of amidated rat gastrin depressed somatostatin levels, stimulated gastric acid secretion and an increase in the numbers of G cells in the antrum and duodenum. In conclusion, human gastrin was expressed in mouse enteroendocrine cells and was regulated by somatostatin. This mouse model provides a unique opportunity to study regulation of the human gastrin promoter in vivo by somatostatin and possibly other extracellular regulators contributing to our understanding of the mechanisms involved in transcriptional control of the human gene.

  4. Human gene therapy and imaging in neurological diseases

    PubMed Central

    Jacobs, Andreas H.; Winkler, Alexandra; Castro, Maria G.; Lowenstein, Pedro

    2010-01-01

    Molecular imaging aims to assess non-invasively disease-specific biological and molecular processes in animal models and humans in vivo. Apart from precise anatomical localisation and quantification, the most intriguing advantage of such imaging is the opportunity it provides to investigate the time course (dynamics) of disease-specific molecular events in the intact organism. Further, molecular imaging can be used to address basic scientific questions, e.g. transcriptional regulation, signal transduction or protein/protein interaction, and will be essential in developing treatment strategies based on gene therapy. Most importantly, molecular imaging is a key technology in translational research, helping to develop experimental protocols which may later be applied to human patients. Over the past 20 years, imaging based on positron emission tomography (PET) and magnetic resonance imaging (MRI) has been employed for the assessment and “phenotyping” of various neurological diseases, including cerebral ischaemia, neurodegeneration and brain gliomas. While in the past neuro-anatomical studies had to be performed post mortem, molecular imaging has ushered in the era of in vivo functional neuro-anatomy by allowing neuroscience to image structure, function, metabolism and molecular processes of the central nervous system in vivo in both health and disease. Recently, PET and MRI have been successfully utilised together in the non-invasive assessment of gene transfer and gene therapy in humans. To assess the efficiency of gene transfer, the same markers are being used in animals and humans, and have been applied for phenotyping human disease. Here, we review the imaging hallmarks of focal and disseminated neurological diseases, such as cerebral ischaemia, neurodegeneration and glioblastoma multiforme, as well as the attempts to translate gene therapy’s experimental knowledge into clinical applications and the way in which this process is being promoted through the use

  5. Transformation of Bacillus subtilis in alpha-amylase productivity by deoxyribonucleic acid from B. subtilis var. amylosacchariticus.

    PubMed

    Yoneda, Y; Yamane, K; Yamaguchi, K; Nagata, Y; Maruo, B

    1974-12-01

    Deoxyribonucleic acid (DNA) of Bacillus subtilis var. amylosacchariticus showed almost the same ability as B. subtilis Marburg to induce transfer of several genetic markers in DNA-mediated transformation. DNA-DNA hybridization data also showed an intimate relationship between the two strains. Genetic elements involved in the production of extracellular alpha-amylase (EC 3.2.1.1.) in B. subtilis var. amylosacchariticus were studied by using DNA-mediated transformation. Two Marburg derivatives, NA20(amyR2) and NA20-22(amyR1), produced about 50 and 10 U of alpha-amylase per mg of cells, respectively, whereas B. subtilis var. amylosacchariticus produced as much as 150 U of the enzyme per mg of cells. When B. subtilis var. amylosacchariticus was crossed with strain NA20-22 as recipient, transformants that acquired high alpha-amylase productivity (about 50 U/mg of cells) were obtained. Genetic analysis revealed that a regulator gene (amyR) for alpha-amylase synthesis was found in B. subtilis var. amylosacchariticus, as in the case of B. natto 1212 (amyR2) and B. subtilis Marburg (amyR1). The allele was designated amyR3; it is phenotypically indistinguishable from amyR2, but is readily distinguishable from amyR1. The presence of amyR3 was not sufficient for an organism to render production of an exceptional amount of alpha-amylase. Extra-high alpha-amylase producers could be obtained by crossing B. subtilis var. amylosacchariticus as donor with strain NA20 as recipient. The transformants produced the same or even greater amounts of the enzyme than the donor strain. Results suggest the presence of another gene that is involved in the production of the exceptional amount of alpha-amylase.

  6. Polycythemia in transgenic mice expressing the human erythropoietin gene

    SciTech Connect

    Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.; Antonarakis, S.E. )

    1989-04-01

    Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5{prime} flanking sequence and 0.7 kilobase of 3{prime} flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver, adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels.

  7. Pili of oral Streptococcus sanguinis bind to salivary amylase and promote the biofilm formation.

    PubMed

    Okahashi, Nobuo; Nakata, Masanobu; Terao, Yutaka; Isoda, Ryutaro; Sakurai, Atsuo; Sumitomo, Tomoko; Yamaguchi, Masaya; Kimura, Richard K; Oiki, Eiji; Kawabata, Shigetada; Ooshima, Takashi

    2011-01-01

    Streptococcus sanguinis is a member of oral streptococci and one of the most abundant species found in oral biofilm called dental plaque. Colonization of the oral streptococci on the tooth surface depends on the adhesion of bacteria to salivary components adsorbed to the tooth surface. Recently, we identified unique cell surface long filamentous structures named pili in this species. Herein, we investigated the role of S. sanguinis pili in biofilm formation. We found that pili-deficient mutant, in which the genes encoding the three pilus proteins PilA, PilB and PilC have been deleted, showed an impaired bacterial accumulation on saliva-coated surfaces. Confocal microscopic observations suggested that the mutant was incapable of producing typical three-dimensional layer of biofilm. Ligand blot analysis showed that the ancillary pilus proteins PilB and PilC bound to human whole saliva. Additional analysis demonstrated that PilC bound to multiple salivary components, and one of which was found to be salivary α-amylase. These results indicate that pilus proteins are members of saliva-binding proteins of oral S. sanguinis, and suggest the involvement of pili in its colonization on saliva-coated tooth surfaces and in the human oral cavity.

  8. Mice carrying a human GLUD2 gene recapitulate aspects of human transcriptome and metabolome development

    PubMed Central

    Li, Qian; Guo, Song; Jiang, Xi; Bryk, Jaroslaw; Naumann, Ronald; Enard, Wolfgang; Tomita, Masaru; Sugimoto, Masahiro; Khaitovich, Philipp; Pääbo, Svante

    2016-01-01

    Whereas all mammals have one glutamate dehydrogenase gene (GLUD1), humans and apes carry an additional gene (GLUD2), which encodes an enzyme with distinct biochemical properties. We inserted a bacterial artificial chromosome containing the human GLUD2 gene into mice and analyzed the resulting changes in the transcriptome and metabolome during postnatal brain development. Effects were most pronounced early postnatally, and predominantly genes involved in neuronal development were affected. Remarkably, the effects in the transgenic mice partially parallel the transcriptome and metabolome differences seen between humans and macaques analyzed. Notably, the introduction of GLUD2 did not affect glutamate levels in mice, consistent with observations in the primates. Instead, the metabolic effects of GLUD2 center on the tricarboxylic acid cycle, suggesting that GLUD2 affects carbon flux during early brain development, possibly supporting lipid biosynthesis. PMID:27118840

  9. Metabolic gene profile in early human fetal heart development.

    PubMed

    Iruretagoyena, J I; Davis, W; Bird, C; Olsen, J; Radue, R; Teo Broman, A; Kendziorski, C; Splinter BonDurant, S; Golos, T; Bird, I; Shah, D

    2014-07-01

    The primitive cardiac tube starts beating 6-8 weeks post fertilization in the developing embryo. In order to describe normal cardiac development during late first and early second trimester in human fetuses this study used microarray and pathways analysis and created a corresponding 'normal' database. Fourteen fetal hearts from human fetuses between 10 and 18 weeks of gestational age (GA) were prospectively collected at the time of elective termination of pregnancy. RNA from recovered tissues was used for transcriptome analysis with Affymetrix 1.0 ST microarray chip. From the amassed data we investigated differences in cardiac development within the 10-18 GA period dividing the sample by GA in three groups: 10-12 (H1), 13-15 (H2) and 16-18 (H3) weeks. A fold change of 2 or above adjusted for a false discovery rate of 5% was used as initial cutoff to determine differential gene expression for individual genes. Test for enrichment to identify functional groups was carried out using the Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG). Array analysis correctly identified the cardiac specific genes, and transcripts reported to be differentially expressed were confirmed by qRT-PCR. Single transcript and Ontology analysis showed first trimester heart expression of myosin-related genes to be up-regulated >5-fold compared with second trimester heart. In contrast the second trimester hearts showed further gestation-related increases in many genes involved in energy production and cardiac remodeling. In conclusion, fetal heart development during the first trimester was dominated by heart-specific genes coding for myocardial development and differentiation. During the second trimester, transcripts related to energy generation and cardiomyocyte communication for contractile coordination/proliferation were more dominant. Transcripts related to fatty acid metabolism can be seen as early as 10 weeks and clearly increase as the heart matures. Retinol

  10. Cell Pluripotency Levels Associated with Imprinted Genes in Human

    PubMed Central

    Yuan, Liyun; Tang, Xiaoyan; Zhang, Binyan; Ding, Guohui

    2015-01-01

    Pluripotent stem cells are exhibited similarly in the morphology, gene expression, growth properties, and epigenetic modification with embryonic stem cells (ESCs). However, it is still controversial that the pluripotency of induced pluripotent stem cell (iPSC) is much inferior to ESC, and the differentiation capacity of iPSC and ESC can also be separated by transcriptome and epigenetics. miRNAs, which act in posttranscriptional regulation of gene expression and are involved in many basic cellular processes, may reveal the answer. In this paper, we focused on identifying the hidden relationship between miRNAs and imprinted genes in cell pluripotency. Total miRNA expression patterns in iPSC and ES cells were comprehensively analysed and linked with human imprinted genes, which show a global picture of their potential function in pluripotent level. A new CPA4-KLF14 region which locates in chromosomal homologous segments (CHSs) within mammals and include both imprinted genes and significantly expressed miRNAs was first identified. Molecular network analysis showed genes interacted with imprinted genes closely and enriched in modules such as cancer, cell death and survival, and tumor morphology. This imprinted region may provide a new look for those who are interested in cell pluripotency of hiPSCs and hESCs. PMID:26504487

  11. Cell Pluripotency Levels Associated with Imprinted Genes in Human.

    PubMed

    Yuan, Liyun; Tang, Xiaoyan; Zhang, Binyan; Ding, Guohui

    2015-01-01

    Pluripotent stem cells are exhibited similarly in the morphology, gene expression, growth properties, and epigenetic modification with embryonic stem cells (ESCs). However, it is still controversial that the pluripotency of induced pluripotent stem cell (iPSC) is much inferior to ESC, and the differentiation capacity of iPSC and ESC can also be separated by transcriptome and epigenetics. miRNAs, which act in posttranscriptional regulation of gene expression and are involved in many basic cellular processes, may reveal the answer. In this paper, we focused on identifying the hidden relationship between miRNAs and imprinted genes in cell pluripotency. Total miRNA expression patterns in iPSC and ES cells were comprehensively analysed and linked with human imprinted genes, which show a global picture of their potential function in pluripotent level. A new CPA4-KLF14 region which locates in chromosomal homologous segments (CHSs) within mammals and include both imprinted genes and significantly expressed miRNAs was first identified. Molecular network analysis showed genes interacted with imprinted genes closely and enriched in modules such as cancer, cell death and survival, and tumor morphology. This imprinted region may provide a new look for those who are interested in cell pluripotency of hiPSCs and hESCs.

  12. Identification of Cancer Related Genes Using a Comprehensive Map of Human Gene Expression.

    PubMed

    Torrente, Aurora; Lukk, Margus; Xue, Vincent; Parkinson, Helen; Rung, Johan; Brazma, Alvis

    2016-01-01

    Rapid accumulation and availability of gene expression datasets in public repositories have enabled large-scale meta-analyses of combined data. The richness of cross-experiment data has provided new biological insights, including identification of new cancer genes. In this study, we compiled a human gene expression dataset from ∼40,000 publicly available Affymetrix HG-U133Plus2 arrays. After strict quality control and data normalisation the data was quantified in an expression matrix of ∼20,000 genes and ∼28,000 samples. To enable different ways of sample grouping, existing annotations where subjected to systematic ontology assisted categorisation and manual curation. Groups like normal tissues, neoplasmic tissues, cell lines, homoeotic cells and incompletely differentiated cells were created. Unsupervised analysis of the data confirmed global structure of expression consistent with earlier analysis but with more details revealed due to increased resolution. A suitable mixed-effects linear model was used to further investigate gene expression in solid tissue tumours, and to compare these with the respective healthy solid tissues. The analysis identified 1,285 genes with systematic expression change in cancer. The list is significantly enriched with known cancer genes from large, public, peer-reviewed databases, whereas the remaining ones are proposed as new cancer gene candidates. The compiled dataset is publicly available in the ArrayExpress Archive. It contains the most diverse collection of biological samples, making it the largest systematically annotated gene expression dataset of its kind in the public domain.

  13. Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage

    PubMed Central

    Pombo-Suarez, Manuel; Calaza, Manuel; Gomez-Reino, Juan J; Gonzalez, Antonio

    2008-01-01

    Background Assessment of gene expression is an important component of osteoarthritis (OA) research, greatly improved by the development of quantitative real-time PCR (qPCR). This technique requires normalization for precise results, yet no suitable reference genes have been identified in human articular cartilage. We have examined ten well-known reference genes to determine the most adequate for this application. Results Analyses of expression stability in cartilage from 10 patients with hip OA, 8 patients with knee OA and 10 controls without OA were done with classical statistical tests and the software programs geNorm and NormFinder. Results from the three methods of analysis were broadly concordant. Some of the commonly used reference genes, GAPDH, ACTB and 18S RNA, performed poorly in our analysis. In contrast, the rarely used TBP, RPL13A and B2M genes were the best. It was necessary to use together several of these three genes to obtain the best results. The specific combination depended, to some extent, on the type of samples being compared. Conclusion Our results provide a satisfactory set of previously unused reference genes for qPCR in hip and knee OA This confirms the need to evaluate the suitability of reference genes in every tissue and experimental situation before starting the quantitative assessment of gene expression by qPCR. PMID:18226276

  14. Molecular cloning and characterization of an α-amylase cDNA highly expressed in major feeding stages of the coffee berry borer, Hypothenemus hampei.

    PubMed

    Bezerra, C A; Macedo, L L P; Amorim, T M L; Santos, V O; Fragoso, R R; Lucena, W A; Meneguim, A M; Valencia-Jimenez, A; Engler, G; Silva, M C M; Albuquerque, E V S; Grossi-de-Sa, M F

    2014-12-10

    α-Amylases are common enzymes responsible for hydrolyzing starch. Insect-pests, whose larvae develop in seeds, rely obligatorily on α-amylase activity to digest starch, as their major food source. Considering the relevance of insect α-amylases and the natural α-amylase inhibitors present in seeds to protect from insect damage, we report here the molecular cloning and nucleotide sequence of the full-length AmyHha cDNA of the coffee berry borer, Hypothenemus hampei, a major insect-pest of coffee crops. The AmyHha sequence has 1879 bp, containing a 1458 bp open reading frame, which encodes a predicted protein with 485 amino acid residues, with a predicted molecular mass of 51.2 kDa. The deduced protein showed 55-79% identity to other insect α-amylases, including Anthonomus grandis, Ips typographus and Sitophilus oryzae α-amylases. In depth analysis revealed that the highly conserved three amino acid residues (Asp184, Glu220, and Asp285), which compose the catalytic site are also presented in AmyHha amylase. The AmyHha gene seems to be a single copy in the haploid genome and AmyHha transcription levels were found higher in L2 larvae and adult insects, both corresponding to major feeding phases. Modeling of the AmyHha predicted protein uncovered striking structural similarities to the Tenebrio molitor α-amylase also displaying the same amino acid residues involved in enzyme catalysis (Asp184, Glu220 and Asp285). Since AmyHha gene was mostly transcribed in the intestinal tract of H. hampei larvae, the cognate α-amylase could be considered a high valuable target to coffee bean insect control by biotechnological strategies.

  15. Horizontal gene transfer in the human gastrointestinal tract: potential spread of antibiotic resistance genes

    PubMed Central

    Huddleston, Jennifer R

    2014-01-01

    Bacterial infections are becoming increasingly difficult to treat due to widespread antibiotic resistance among pathogens. This review aims to give an overview of the major horizontal transfer mechanisms and their evolution and then demonstrate the human lower gastrointestinal tract as an environment in which horizontal gene transfer of resistance determinants occurs. Finally, implications for antibiotic usage and the development of resistant infections and persistence of antibiotic resistance genes in populations as a result of horizontal gene transfer in the large intestine will be discussed. PMID:25018641

  16. Organization of the human lipoprotein lipase gene and evolution of the lipase gene family.

    PubMed Central

    Kirchgessner, T G; Chuat, J C; Heinzmann, C; Etienne, J; Guilhot, S; Svenson, K; Ameis, D; Pilon, C; d'Auriol, L; Andalibi, A

    1989-01-01

    The human lipoprotein lipase gene was cloned and characterized. It is composed of 10 exons spanning approximately equal to 30 kilobases. The first exon encodes the 5'-untranslated region, the signal peptide plus the first two amino acids of the mature protein. The next eight exons encode the remaining 446 amino acids, and the tenth exon encodes the long 3'-untranslated region of 1948 nucleotides. The lipoprotein lipase transcription start site and the sequence of the 5'-flanking region were also determined. We compared the organization of genes for lipoprotein lipase, hepatic lipase, pancreatic lipase, and Drosophila yolk protein 1, which are members of a family of related genes. A model for the evolution of the lipase gene family is presented that involves multiple rounds of gene duplication plus exon-shuffling and intron-loss events. Images PMID:2602366

  17. Reconstructability analysis as a tool for identifying gene-gene interactions in studies of human diseases.

    PubMed

    Shervais, Stephen; Kramer, Patricia L; Westaway, Shawn K; Cox, Nancy J; Zwick, Martin

    2010-01-01

    There are a number of common human diseases for which the genetic component may include an epistatic interaction of multiple genes. Detecting these interactions with standard statistical tools is difficult because there may be an interaction effect, but minimal or no main effect. Reconstructability analysis (RA) uses Shannon's information theory to detect relationships between variables in categorical datasets. We applied RA to simulated data for five different models of gene-gene interaction, and find that even with heritability levels as low as 0.008, and with the inclusion of 50 non-associated genes in the dataset, we can identify the interacting gene pairs with an accuracy of > or =80%. We applied RA to a real dataset of type 2 non-insulin-dependent diabetes (NIDDM) cases and controls, and closely approximated the results of more conventional single SNP disease association studies. In addition, we replicated prior evidence for epistatic interactions between SNPs on chromosomes 2 and 15.

  18. Imprinted genes and human disease: an evolutionary perspective.

    PubMed

    Ubeda, Francisco; Wilkins, Jon F

    2008-01-01

    imprinting, the maternally and paternally inherited genes within a single cell have epigenetic differences that result in divergent patterns of gene expression. In the simplest scenario, only one of the two alleles at an imprinted locus is expressed. In other cases, an imprinted locus can include a variety of maternally expressed, paternally expressed and biallelically expressed transcripts. Some of these transcripts produce different proteins through alternate splicing, while others produce noncoding RNA transcripts. Genomic imprinting can also interact with the "epigenotype" in Waddington's sense: many genes are imprinted in a tissue-specific manner, with monoallelic expression in some cell types and biallelic expression in others. Other chapters in this volume cover our current understanding of the mechanisms of imprinting, the phenotypic effects of imprinted genes in mammals and what we know about imprinting in plants. In this chapter we discuss the link between imprinted genes and human disease. First, we consider the phenotypes associated with imprinted genes and ask whether the disorders associated with these genes share a common motif. Second, we consider the nature and frequency of mutations of imprinted genes. We ask whether we should expect that imprinted genes are particularly fragile. That is, are they more likely to undergo mutation and/or are mutations of imprinted genes particularly likely to result in human disease? In general we consider how the field of evolutionary medicine--the use of evolution to understand why our body's design allows for the existence of disease at all--might contribute to our comprehension of disorders linked to genomic imprinting.

  19. The p53 gene and protein in human brain tumors

    SciTech Connect

    Louis, D.N. )

    1994-01-01

    Because p53 gene alterations are commonplace in human tumors and because p53 protein is involved in a number of important cellular pathways, p53 has become a topic of intensive investigation, both by basic scientists and clinicians. p53 was initially identified by two independent laboratories in 1979 as a 53 kilodalton (kD) protein that complexes with the large T antigen of SV40 virus. Shortly thereafter, it was shown that the E1B oncoprotein of adenovirus also binds p53. The binding of two different oncogenic viral tumor proteins to the same cellular protein suggested that p53 might be integral to tumorigenesis. The human p53 cDNA and gene were subsequently cloned in the mid-1980s, and analysis of p53 gene alterations in human tumors followed a few year later. During these 10 years, researchers grappling with the vagaries of p53 first characterized the gene as an oncogene, then as a tumor suppressor gene, and most recently as both a tumor suppressor gene and a so-called [open quotes]dominant negative[close quotes] oncogene. The last few years have seen an explosion in work on this single gene and its protein product. A review of a computerized medical database revealed approximately 650 articles on p53 in 1992 alone. p53 has assumed importance in neuro-oncology because p53 mutations and protein alterations are frequent in the common diffuse, fibrillary astrocytic tumors of adults. p53 mutations in astrocytomas were first described in 1989 and were followed by more extensive analyses of gene mutations and protein alterations in adult astrocytomas. The gene has also been studied in less common brain tumors. Elucidating the role of p53 in brain tumorigenesis will not only enhance understanding of brain tumor biology but may also contribute to improved diagnosis and therapy. This discussion reviews key aspects of the p53 gene and protein, and describe their emerging roles in central nervous system neoplasia. 102 refs., 6 figs., 1 tab.

  20. Developmental expression of mucin genes in the human gastrointestinal system

    PubMed Central

    Reid, C; Harris, A

    1998-01-01

    Background and aims—Mucin glycoproteins play a key role in the normal function of the epithelium lining the gastrointestinal tract. The expression of mucin genes, MUC 3, 4, 5AC, 5B, 6, 7, and 8 in human fetal tissues was examined to establish the localisation and age of onset of expression of each mucin gene during human development. 
Methods—Mucin gene expression was assayed by mRNA in situ hybridisation. 
Results—Expression of MUC3 was detected in the small intestine and colon from 13 weeks gestation onwards and at low levels in the main pancreatic duct at 13 weeks only. MUC4 expression was seen at a low level in the colonic epithelium from 13 weeks of gestation but not elsewhere in the gastrointestinal tract. MUC5AC mRNA was detected in the colon at 17 weeks and at high levels in the stomach at 23 weeks. MUC6 transcripts were evident in the pancreatic ducts from 13 weeks of gestation and at high levels in the stomach at 23 weeks. MUC5B, MUC7, and MUC8 transcripts were not detected. 
Conclusions—Mucin genes are expressed from the early mid-trimester of gestation in the developing human fetal gastrointestinal tract. 

 Keywords: mucin; developmental expression; gastrointestinal tract PMID:9536947

  1. Identification of susceptibility genes and genetic modifiers of human diseases

    NASA Astrophysics Data System (ADS)

    Abel, Kenneth; Kammerer, Stefan; Hoyal, Carolyn; Reneland, Rikard; Marnellos, George; Nelson, Matthew R.; Braun, Andreas

    2005-03-01

    The completion of the human genome sequence enables the discovery of genes involved in common human disorders. The successful identification of these genes is dependent on the availability of informative sample sets, validated marker panels, a high-throughput scoring technology, and a strategy for combining these resources. We have developed a universal platform technology based on mass spectrometry (MassARRAY) for analyzing nucleic acids with high precision and accuracy. To fuel this technology, we generated more than 100,000 validated assays for single nucleotide polymorphisms (SNPs) covering virtually all known and predicted human genes. We also established a large DNA sample bank comprised of more than 50,000 consented healthy and diseased individuals. This combination of reagents and technology allows the execution of large-scale genome-wide association studies. Taking advantage of MassARRAY"s capability for quantitative analysis of nucleic acids, allele frequencies are estimated in sample pools containing large numbers of individual DNAs. To compare pools as a first-pass "filtering" step is a tremendous advantage in throughput and cost over individual genotyping. We employed this approach in numerous genome-wide, hypothesis-free searches to identify genes associated with common complex diseases, such as breast cancer, osteoporosis, and osteoarthritis, and genes involved in quantitative traits like high density lipoproteins cholesterol (HDL-c) levels and central fat. Access to additional well-characterized patient samples through collaborations allows us to conduct replication studies that validate true disease genes. These discoveries will expand our understanding of genetic disease predisposition, and our ability for early diagnosis and determination of specific disease subtype or progression stage.

  2. Cloning the human gene for macrophage migration inhibitory factor (MIF)

    SciTech Connect

    Paralkar, V.; Wistow, G. )

    1994-01-01

    Macrophage migration inhibitory factor (MIF) was originally identified as a lymphokine. However, recent work strongly suggests a wider role for MIF beyond the immune system. It is expressed specifically in the differentiating cells of the immunologically privileged eye lens and brain, is a delayed early response gene in fibroblasts, and is expressed in many tissues. Here, the authors report the structure of the remarkably small gene for human MIF that has three exons separated by introns of only 189 and 95 bp and covers less than 1 kb. The cloned sequence also includes 1 kb of 5[prime] flanking region. Primer extension and 5[prime] rapid amplification of cDNA ends (RACE) of human brain RNA both indicate the presence of a single transcription start site in a TATA-less promoter. Northern blot analysis shows a single size of MIF mRNA (about 800 nt) in all human tissues examined. In contrast to previous reports, they find no evidence for multiple genes for MIF in the human genome. 20 refs., 3 figs.

  3. Functional analysis of the human neurofilament light chain gene promoter.

    PubMed Central

    Yazdanbakhsh, K; Fraser, P; Kioussis, D; Vidal, M; Grosveld, F; Lindenbaum, M

    1993-01-01

    We have carried out a structural and functional analysis on the human NF-L (H-NF-L) gene. It contains a methylation-free island, spanning the 5' flanking sequences and the first exon and a number of neuronal-specific DNase I hypersensitive sites have been identified in the upstream region as well as within the body of the gene. Analysis in cell lines and transgenic mice using a combination of these sites has revealed the presence of a conserved element(s) between -300bp and -190bp which is required for neuronal-specific expression. Images PMID:8441658

  4. BRAF gene: From human cancers to developmental syndromes

    PubMed Central

    Hussain, Muhammad Ramzan Manwar; Baig, Mukhtiar; Mohamoud, Hussein Sheik Ali; Ulhaq, Zaheer; Hoessli, Daniel C.; Khogeer, Ghaidaa Siraj; Al-Sayed, Ranem Radwan; Al-Aama, Jumana Yousuf

    2014-01-01

    The BRAF gene encodes for a serine/threonine protein kinase that participates in the MAPK/ERK signalling pathway and plays a vital role in cancers and developmental syndromes (RASopathies). The current review discusses the clinical significance of the BRAF gene and other members of RAS/RAF cascade in human cancers and RAS/MAPK syndromes, and focuses the molecular basis and clinical genetics of BRAF to better understand its parallel involvement in both tumourigenesis and RAS/MAPK syndromes—Noonan syndrome, cardio-facio-cutaneous syndrome and LEOPARD syndrome. PMID:26150740

  5. Molecular cloning and characterization of amylase from soil metagenomic library derived from Northwestern Himalayas.

    PubMed

    Sharma, Sarika; Khan, Farrah Gul; Qazi, Ghulam Nabi

    2010-05-01

    The increasing demand for novel biocatalysts stimulates exploration of resources from soil. Metagenomics, a culture independent approach, represent a sheer unlimited resource for discovery of novel biocatalysts from uncultured microorganisms. In this study, a soil-derived metagenomic library containing 90,700 recombinants was constructed and screened for lipase, cellulase, protease and amylase activity. A gene (pAMY) of 909 bp encoding for amylase was found after the screening of 35,000 Escherichia coli clones. Amino acid sequence comparison and phylogenetic analysis indicated that pAMY was closely related to uncultured bacteria. The molecular mass of pAMY was estimated about 38 kDa by sodium dodecyl sulphate polyacrylamide gel electrophoresis. Amylase activity was determined using soluble starch, amylose, glycogen and maltose as substrates. The maximal activity (2.46 U/mg) was observed at 40 degrees C under nearly neutral pH conditions with amylose; whereas it retains 90% of its activity at low temperature with all the substrates used in this study. The ability of pAMY to work at low temperature is unique for amylases reported so far from microbes of cultured and uncultured division.

  6. Partial characterization of cold active amylases and proteases of Streptomyces sp. from Antarctica

    PubMed Central

    Cotârleţ, Mihaela; Negoiţă, Teodor Gh.; Bahrim, Gabriela E.; Stougaard, Peter

    2011-01-01

    The aim of this study was to isolate novel enzyme-producing bacteria from vegetation samples from East Antarctica and also to characterize them genetically and biochemically in order to establish their phylogeny. The ability to grow at low temperature and to produce amylases and proteases cold-active was also tested. The results of the 16S rRNA gene sequence analysis showed that the 4 Alga rRNA was 100% identical to the sequences of Streptomyces sp. rRNA from Norway and from the Solomon Islands. The Streptomyces grew well in submerged system at 20°C, cells multiplication up to stationary phase being drastically increased after 120 h of submerged cultivation. The beta-amylase production reached a maximum peak after seven days, while alpha-amylase and proteases were performing biosynthesis after nine days of submerged cultivation at 20°C. Newly Streptomyces were able to produce amylase and proteases in a cold environment. The ability to adapt to low temperature of these enzymes could make them valuable ingredients for detergents, the food industry and bioremediation processes which require low temperatures. PMID:24031702

  7. Halotolerant Ability and α-Amylase Activity of Some Saltwater Fungal Isolates

    PubMed Central

    Niknejad, Farhad; Moshfegh, Mahsa; Najafzadeh, Mohammad Javad; Houbraken, Jos; Rezaei, Shahla; Zarrini, Gholamreza; Faramarzi, Mohammad Ali; Nafissi-Varcheh, Nastaran

    2013-01-01

    Four halotolerant fungal isolates originating from the saltwater Lake Urmia in Iran were selected during a screening program for salt resistance and α-amylase activity. The isolates were identified based on sequencing the ITS region and a part of the β-tubulin gene, as Penicillium chrysogenum (isolate U1; CBS 132820), Fusarium incarnatum (isolate U2; CBS 132821), and Penicillium polonicum (isolate U3; CBS 132822, and isolate U4; CBS 132823). The growth of these isolates was determined by measuring the colony diameter and mycelia dry weight in Sabouraud dextrose agar and yeast nitrogen base medium supplemented with NaCl, KCl, and LiCl. Isolate U4 showed a growth up in 15% NaCl and U1 was the only isolate that could grow in 20% KCl. None of the strains grew in a media containing LiCl. The salt supplemented medium did not increase the size of colony diameter in all isolates (p > 0.05). The ability of the selected isolates for amylase production was quantitatively tested and showed that P. polonicum isolate U4 was the most potent producer of amylase with a yield of 260.9 U/L after 60 h, whereas P. polonicum isolate U3 was the lowest one with a production level of 97.9 U/L after 48 h. P. polonicum isolate U4 could be a suitable candidate for production of amylase on an industrial scale after optimization. PMID:24250679

  8. Isolation and characterisation of a novel alpha-amylase from the extreme haloarchaeon Haloterrigena turkmenica.

    PubMed

    Santorelli, Marco; Maurelli, Luisa; Pocsfalvi, Gabriella; Fiume, Immacolata; Squillaci, Giuseppe; La Cara, Francesco; Del Monaco, Giovanni; Morana, Alessandra

    2016-11-01

    An extracellular halophilic alpha-amylase (AmyA) was produced by the haloarchaeon Haloterrigena turkmenica grown in medium enriched with 0.2% (w/v) starch. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size exclusion chromatography (SEC) analyses showed a major band at 66.0kDa and a peak of 54.0kDa, respectively. Analysis of tryptic fragments of the protein present in the major SDS-PAGE band by nano-LC-ESI-MS/MS led to identification of the alpha-amylase catalytic region, encoded by the htur2110 gene, as the protein possessing the described activity. Optimal values for activity were 55°C, pH 8.5 and 2M NaCl, and high thermostability was showed at 55°C and 3M NaCl. AmyA activity was enhanced by Triton X-100 and was not influenced by n-hexane and chloroform. Starch hydrolysis produced different oligomers with maltose as the smallest end-product. The efficiency of AmyA in degrading starch contained in agronomic residues was tested in grape cane chosen as model substrate. Preliminary results showed that starch was degraded making the enzyme a potential candidate for utilization of agro-industrial waste in fuel and chemicals production. AmyA is one of the few investigated amylases produced by haloarchaea, and the first alpha-amylase described among microorganisms belonging to the genus Haloterrigena.

  9. Employing in vitro directed molecular evolution for the selection of α-amylase variant inhibitors with activity toward cotton boll weevil enzyme.

    PubMed

    da Silva, Maria Cristina Mattar; Del Sarto, Rafael Perseghini; Lucena, Wagner Alexandre; Rigden, Daniel John; Teixeira, Fabíola Rodrigues; Bezerra, Caroline de Andrade; Albuquerque, Erika Valéria Saliba; Grossi-de-Sa, Maria Fatima

    2013-09-20

    Numerous species of insect pests attack cotton plants, out of which the cotton boll weevil (Anthonomus grandis) is the main insect in Brazil and must be controlled to avert large economic losses. Like other insect pests, A. grandis secretes a high level of α-amylases in the midgut lumen, which are required for digestion of carbohydrates. Thus, α-amylase inhibitors (α-AIs) represent a powerful tool to apply in the control of insect pests. Here, we applied DNA shuffling and phage display techniques and obtained a combinatorial library containing 10⁸ α-AI variant forms. From this library, variants were selected exhibiting in vitro affinity for cotton boll weevil α-amylases. Twenty-six variant sequences were cloned into plant expression vectors and expressed in Arabidopsis thaliana. Transformed plant extracts were assayed in vitro to select specific and potent α-amylase inhibitors against boll weevil amylases. While the wild type inhibitors, used to create the shuffled library, did not inhibit the A. grandis α-amylases, three α-AI mutants, named α-AIC3, α-AIA11 and α-AIG4 revealed high inhibitory activities against A. grandis α-amylases in an in vitro assay. In summary, data reported here shown the potential biotechnology of new α-AI variant genes for cotton boll weevil control.

  10. Validation of internal reference genes for relative quantitation studies of gene expression in human laryngeal cancer

    PubMed Central

    Wang, Xiaofeng; He, Jinting; Wang, Wei; Ren, Ming; Gao, Sujie; Zhao, Guanjie

    2016-01-01

    Background The aim of this study was to determine the expression stabilities of 12 common internal reference genes for the relative quantitation analysis of target gene expression performed by reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR) in human laryngeal cancer. Methods Hep-2 cells and 14 laryngeal cancer tissue samples were investigated. The expression characteristics of 12 internal reference gene candidates (18S rRNA, GAPDH, ACTB, HPRT1, RPL29, HMBS, PPIA, ALAS1, TBP, PUM1, GUSB, and B2M) were assessed by RT-qPCR. The data were analyzed by three commonly used software programs: geNorm, NormFinder, and BestKeeper. Results The use of the combination of four internal reference genes was more appropriate than the use of a single internal reference gene. The optimal combination was PPIA + GUSB + RPL29 + HPRT1 for both the cell line and tissues; while the most appropriate combination was GUSB + RPL29 + HPRT1 + HMBS for the tissues. Conclusions Our recommended internal reference genes may improve the accuracy of relative quantitation analysis of target gene expression performed by the RT-qPCR method in further gene expression research on laryngeal tumors. PMID:27957397

  11. The human gene damage index as a gene-level approach to prioritizing exome variants

    PubMed Central

    Itan, Yuval; Shang, Lei; Boisson, Bertrand; Patin, Etienne; Bolze, Alexandre; Moncada-Vélez, Marcela; Scott, Eric; Ciancanelli, Michael J.; Lafaille, Fabien G.; Markle, Janet G.; Martinez-Barricarte, Ruben; de Jong, Sarah Jill; Kong, Xiao-Fei; Nitschke, Patrick; Belkadi, Aziz; Bustamante, Jacinta; Puel, Anne; Boisson-Dupuis, Stéphanie; Stenson, Peter D.; Gleeson, Joseph G.; Cooper, David N.; Quintana-Murci, Lluis; Claverie, Jean-Michel; Zhang, Shen-Ying; Abel, Laurent; Casanova, Jean-Laurent

    2015-01-01

    The protein-coding exome of a patient with a monogenic disease contains about 20,000 variants, only one or two of which are disease causing. We found that 58% of rare variants in the protein-coding exome of the general population are located in only 2% of the genes. Prompted by this observation, we aimed to develop a gene-level approach for predicting whether a given human protein-coding gene is likely to harbor disease-causing mutations. To this end, we derived the gene damage index (GDI): a genome-wide, gene-level metric of the mutational damage that has accumulated in the general population. We found that the GDI was correlated with selective evolutionary pressure, protein complexity, coding sequence length, and the number of paralogs. We compared GDI with the leading gene-level approaches, genic intolerance, and de novo excess, and demonstrated that GDI performed best for the detection of false positives (i.e., removing exome variants in genes irrelevant to disease), whereas genic intolerance and de novo excess performed better for the detection of true positives (i.e., assessing de novo mutations in genes likely to be disease causing). The GDI server, data, and software are freely available to noncommercial users from lab.rockefeller.edu/casanova/GDI. PMID:26483451

  12. Quantitative Real-Time Gene Profiling of Human Alveolar Osteoblasts.

    PubMed

    Coates, Dawn E; Zafar, Sobia; Milne, Trudy J

    2017-01-01

    The use of quantitative real-time reverse transcriptase PCR (qRT(2)-PCR) for the identification of differentially regulated genes is a powerful technology. The protocol presented here uses qRT(2)-PCR gene arrays to investigate the regulation of 84 angiogenic related genes in human primary alveolar osteoblasts following treatment with the bisphosphonate, zoledronic acid (ZA), and geranylgeraniol (GGOH). GGOH has potential as a therapeutic agent for Bisphosphate-Related Osteonecrosis of the Jaw (BRONJ), a serious side-effect resulting from the treatment for metastatic cancer (Zafar et al., J Oral Pathol Med 43:711-721, 2014; Ruggiero, Ann NY Acad Sci 1218:38-46, 2011). The isolation of the primary osteoblast cells follows the methods previously described (Dillon et al., Methods Mol Biol 816:3-18, 2012) with a new RNA extraction technique described fully. The method highlights the importance of obtaining high-quality RNA which is DNA-free. Relative levels of gene expression are normalized against selected housekeeping genes (HKG) and a number of examples of how fold regulation (2(-∆∆Cq)) and gene expression level (2(-∆Cq)) data can be presented are given.

  13. GeneStoryTeller: a mobile app for quick and comprehensive information retrieval of human genes

    PubMed Central

    Eleftheriou, Stergiani V.; Bourdakou, Marilena M.; Athanasiadis, Emmanouil I.; Spyrou, George M.

    2015-01-01

    In the last few years, mobile devices such as smartphones and tablets have become an integral part of everyday life, due to their software/hardware rapid development, as well as the increased portability they offer. Nevertheless, up to now, only few Apps have been developed in the field of bioinformatics, capable to perform fast and robust access to services. We have developed the GeneStoryTeller, a mobile application for Android platforms, where users are able to instantly retrieve information regarding any recorded human gene, derived from eight publicly available databases, as a summary story. Complementary information regarding gene–drugs interactions, functional annotation and disease associations for each selected gene is also provided in the gene story. The most challenging part during the development of the GeneStoryTeller was to keep balance between storing data locally within the app and obtaining the updated content dynamically via a network connection. This was accomplished with the implementation of an administrative site where data are curated and synchronized with the application requiring a minimum human intervention. Database URL: http://bioserver-3.bioacademy.gr/Bioserver/GeneStoryTeller/. PMID:26055097

  14. Impact of Statins on Gene Expression in Human Lung Tissues

    PubMed Central

    Lane, Jérôme; van Eeden, Stephan F.; Obeidat, Ma’en; Sin, Don D.; Tebbutt, Scott J.; Timens, Wim; Postma, Dirkje S.; Laviolette, Michel; Paré, Peter D.; Bossé, Yohan

    2015-01-01

    Statins are 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitors that alter the synthesis of cholesterol. Some studies have shown a significant association of statins with improved respiratory health outcomes of patients with asthma, chronic obstructive pulmonary disease and lung cancer. Here we hypothesize that statins impact gene expression in human lungs and may reveal the pleiotropic effects of statins that are taking place directly in lung tissues. Human lung tissues were obtained from patients who underwent lung resection or transplantation. Gene expression was measured on a custom Affymetrix array in a discovery cohort (n = 408) and two replication sets (n = 341 and 282). Gene expression was evaluated by linear regression between statin users and non-users, adjusting for age, gender, smoking status, and other covariables. The results of each cohort were combined in a meta-analysis and biological pathways were studied using Gene Set Enrichment Analysis. The discovery set included 141 statin users. The lung mRNA expression levels of eighteen and three genes were up-regulated and down-regulated in statin users (FDR < 0.05), respectively. Twelve of the up-regulated genes were replicated in the first replication set, but none in the second (p-value < 0.05). Combining the discovery and replication sets into a meta-analysis improved the significance of the 12 up-regulated genes, which includes genes encoding enzymes and membrane proteins involved in cholesterol biosynthesis. Canonical biological pathways altered by statins in the lung include cholesterol, steroid, and terpenoid backbone biosynthesis. No genes encoding inflammatory, proteases, pro-fibrotic or growth factors were altered by statins, suggesting that the direct effect of statin in the lung do not go beyond its antilipidemic action. Although more studies are needed with specific lung cell types and different classes and doses of statins, the improved health outcomes and survival observed in statin

  15. Testis-specific expression of the human MYCL2 gene.

    PubMed Central

    Robertson, N G; Pomponio, R J; Mutter, G L; Morton, C C

    1991-01-01

    We have characterized the expression of MYCL2, an intronless X-linked gene related to MYCL1. RNase protection analysis of a panel of human normal and tumor tissues has revealed that MYCL2 is expressed almost exclusively in human adult normal testis; much lower levels of transcript were detected in one human lung adenocarcinoma. No MYCL2 transcript was found in human testis RNA obtained from second trimester fetuses. This observation suggests a germ cell rather than somatic cell origin of the transcript and possible developmental regulation of MYCL2. Northern blot analysis of poly(A)+ RNA from adult human normal testis with an antisense riboprobe revealed a transcript of approximately 4.8-kb, which is in agreement with the size predicted from the MYCL2 nucleotide sequence. Antisense transcripts were found spanning regions of MYCL2 corresponding to all three exons of MYCL1. No sizable open reading frame was seen for the MYCL2 antisense transcripts suggesting that they may represent either regulatory sequences or an intron of a gene encoded by the complementary strand. RNase protection assays and the 5' RACE protocol (Rapid Amplification of cDNA Ends) were used to address the localization of the transcription start site of the MYCL2 sense transcript and different putative promoters and transcription regulatory elements have been identified. Images PMID:1711681

  16. The GLI-Kruppel family of human genes

    SciTech Connect

    Ruppert, J.M.; Kinzler, K.W.; Wong, A.J.; Bigner, S.H.; Kao, F.T.; Law, M.L.; Seuanez, H.N.; O'Brien, S.J.; Vogelstein, B.

    1988-08-01

    Previous characterization of GLI, a gene found to be amplified and expressed in a subset of human brain tumors, revealed the presence of five tandem fingers related to those of Kruppel (Kr), a Drosophila segmentation gene of the gap class. The authors have used the GLI cDNA as a molecular probe to isolate related sequences from the human genome. Partial characterization of six related loci, including sequence determination, expression studies, and chromosome localization, revealed that each locus could encode a separate finger protein. The predicted proteins all had similar H-C links, i.e., a conserved stretch of 9 amino acids connecting the C-terminal histidine of one finger to the N-terminal cysteine of the next. On the basis of amino acid sequence and intron-exon organization, the genes could be placed into one of two subgroups: the GLI subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 3/GCX/sub 3/(F/Y)X/sub 5/LX/sub 2/HX/sub 3-4/H(T/X)GEKP) or the Kr subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 2/CX/sub 3/FX/sub 5/LX/sub 2/HXRXHTGEKP). Unlike GLI or Kr, most of the newly isolated genes were expressed in many adult tissues. The predicted proteins probably control the expression of other genes and, by analogy with Kr and GLI, may be important in human development, tissue-specific differentiation, or neoplasia.

  17. Cloning and chromosomal localization of the three human syntrophin genes

    SciTech Connect

    Feener, C.A.; Anderson, M.D.S.; Selig, S.

    1994-09-01

    Dystrophin, the protein product the Duchenne muscular dystrophy locus, is normally found to be associated with a complex of proteins. Among these dystrophin-associated proteins are the syntrophins, a group of 59 kDa membrane-associated proteins. When the syntrophins are purified based upon their association with dystrophin, they have been shown previously to form two distinct groups, the acidic ({alpha}) and basic ({beta}) forms. Based on peptide and rodent cDNA sequences, three separate syntrophin genes have been cloned and characterized from human tissues. The predicted amino acid sequences from these cDNA reveal that these proteins are related but are distinct with respect to charge, as predicted from their biochemistry. The family consists of one acidic ({alpha}-syntrophin, analogous to mouse syntrophin-1) and two basic ({beta}{sub 1}-syntrophin; and {beta}{sub 2}-syntrophin, analogous to mouse syntrophin-2) genes. Each of the three genes are widely expressed in a variety of human tissues, but the relative abundance of the three are unique with respect to each other. {alpha}-syntrophin is expressed primarily in skeletal muscle and heart as a single transcript. {beta}{sub 1}-syntrophin is expressed widely in up to five distinct transcript sizes, and is most abundant in brain. The human chromosomal locations of the three syntrophins are currently being mapped. {beta}{sub 1}-syntrophin maps to chromosome 8q23-24 and {beta}{sub 2}-syntrophin to chromosome 16. The {alpha}-syntrophin gene will be mapped accordingly. Although all three genes are candidates for neuromuscular diseases, the predominant expression of {alpha}-syntrophin in skeletal muscle and heart makes it a strong candidate to be involved in a neuromuscular disease.

  18. Study of human dopamine sulfotransferases based on gene expression programming.

    PubMed

    Si, Hongzong; Zhao, Jiangang; Cui, Lianhua; Lian, Ning; Feng, Hanlin; Duan, Yun-Bo; Hu, Zhide

    2011-09-01

    A quantitative model is developed to predict the Km of 47 human dopamine sulfotransferases by gene expression programming. Each kind of compound is represented by several calculated structural descriptors of moment of inertia A, average electrophilic reactivity index for a C atom, relative number of triple bonds, RNCG relative negative charge, HA-dependent HDSA-1, and HBCA H-bonding charged surface area. Eight fitness functions of the gene expression programming method are used to find the best nonlinear model. The best quantitative model with squared standard error and square of correlation coefficient are 0.096 and 0.91 for training data set, and 0.102 and 0.88 for test set, respectively. It is shown that the gene expression programming-predicted results with fitness function are in good agreement with experimental ones.

  19. Effect of adenovirus infection on expression of human histone genes.

    PubMed Central

    Flint, S J; Plumb, M A; Yang, U C; Stein, G S; Stein, J L

    1984-01-01

    The influence of adenovirus type 2 infection of HeLa cells upon expression of human histone genes was examined as a function of the period of infection. Histone RNA synthesis was assayed after run-off transcription in nuclei isolated from mock-infected cells and after various periods of adenovirus infection. Histone protein synthesis was measured by [3H]leucine labeling of intact cells and fluorography of electrophoretically fractionated nuclear and cytoplasmic proteins. The cellular representation of RNA species complementary to more than 13 different human histone genes was determined by RNA blot analysis of total cellular, nuclear or cytoplasmic RNA by using a series of 32P-labeled cloned human histone genes as hybridization probes and also by analysis of 3H-labeled histone mRNA species synthesized in intact cells. By 18 h after infection, HeLa cell DNA synthesis and all parameters of histone gene expression, including transcription and the nuclear and cytoplasmic concentrations of core and H1 mRNA species, were reduced to less than 5 to 10% of the control values. By contrast, transcription and processing of other cellular mRNA sequences have been shown to continue throughout this period of infection. The early period of adenovirus infection was marked by an inhibition of transcription of histone genes that accompanied the reduction in rate of HeLa cell DNA synthesis. These results suggest that the adenovirus-induced inhibition of histone gene expression is mediated in part at the transcriptional level. However, the persistence of histone mRNA species at concentrations comparable to those of mock-infected control cells during the early phase of the infection, despite a reduction in histone gene transcription and histone protein synthesis, implies that histone gene expression is also regulated post-transcriptionally in adenovirus-infected cells. These results suggest that the tight coupling between histone mRNA concentrations and the rate of cellular DNA

  20. Variable imprinting of the MEST gene in human preimplantation embryos

    PubMed Central

    Huntriss, John D; Hemmings, Karen E; Hinkins, Matthew; Rutherford, Anthony J; Sturmey, Roger G; Elder, Kay; Picton, Helen M

    2013-01-01

    There is evidence that expression and methylation of the imprinted paternally expressed gene 1/mesoderm-specific transcript homologue (PEG1/MEST) gene may be affected by assisted reproductive technologies (ARTs) and infertility. In this study, we sought to assess the imprinting status of the MEST gene in a large cohort of in vitro-derived human preimplantation embryos, in order to characterise potentially adverse effects of ART and infertility on this locus in early human development. Embryonic genomic DNA from morula or blastocyst stage embryos was screened for a transcribed AflIII polymorphism in MEST and imprinting analysis was then performed in cDNA libraries derived from these embryos. In 10 heterozygous embryos, MEST expression was monoallelic in seven embryos, predominantly monoallelic in two embryos, and biallelic in one embryo. Screening of cDNA derived from 61 additional human preimplantation embryos, for which DNA for genotyping was unavailable, identified eight embryos with expression originating from both alleles (biallelic or predominantly monoallelic). In some embryos, therefore, the onset of imprinted MEST expression occurs during late preimplantation development. Variability in MEST imprinting was observed in both in vitro fertilization and intracytoplasmic sperm injection-derived embryos. Biallelic or predominantly monoallelic MEST expression was not associated with any one cause of infertility. Characterisation of the main MEST isoforms revealed that isoform 2 was detected in early development and was itself variably imprinted between embryos. To our knowledge, this report constitutes the largest expression study to date of genomic imprinting in human preimplantation embryos and reveals that for some imprinted genes, contrasting imprinting states exist between embryos. PMID:22763377

  1. Social regulation of gene expression in human leukocytes

    PubMed Central

    Cole, Steve W; Hawkley, Louise C; Arevalo, Jesusa M; Sung, Caroline Y; Rose, Robert M; Cacioppo, John T

    2007-01-01

    Background Social environmental influences on human health are well established in the epidemiology literature, but their functional genomic mechanisms are unclear. The present study analyzed genome-wide transcriptional activity in people who chronically experienced high versus low levels of subjective social isolation (loneliness) to assess alterations in the activity of transcription control pathways that might contribute to increased adverse health outcomes in social isolates. Results DNA microarray analysis identified 209 genes that were differentially expressed in circulating leukocytes from 14 high- versus low-lonely individuals, including up-regulation of genes involved in immune activation, transcription control, and cell proliferation, and down-regulation of genes supporting mature B lymphocyte function and type I interferon response. Promoter-based bioinformatic analyses showed under-expression of genes bearing anti-inflammatory glucocorticoid response elements (GREs; p = 0.032) and over-expression of genes bearing response elements for pro-inflammatory NF-κB/Rel transcription factors (p = 0.011). This reciprocal shift in pro- and anti-inflammatory signaling was not attributable to differences in circulating cortisol levels, or to other demographic, psychological, or medical characteristics. Additional transcription control pathways showing differential activity in bioinformatic analyses included the CREB/ATF, JAK/STAT, IRF1, C/EBP, Oct, and GATA pathways. Conclusion These data provide the first indication that human genome-wide transcriptional activity is altered in association with a social epidemiological risk factor. Impaired transcription of glucocorticoid response genes and increased activity of pro-inflammatory transcription control pathways provide a functional genomic explanation for elevated risk of inflammatory disease in individuals who experience chronically high levels of subjective social isolation. PMID:17854483

  2. The transcriptional regulation of the human CYP2C genes

    PubMed Central

    Chen, Yuping; Goldstein, Joyce A.

    2010-01-01

    In humans, four members of the CYP2C subfamily (CYP2C8, CYP2C9, CYP2C18, and CYP2C19) metabolize more than 20% of all therapeutic drugs as well as a number of endogenous compounds. The CYP2C enzymes are found predominantly in the liver, where they comprise ∼20% of the total cytochrome P450. A variety of xenobiotics such as phenobarbital, rifampicin, and hyperforin have been shown to induce the transcriptional expression of CYP2C genes in primary human hepatocytes and to increase the metabolism of CYP2C substrates in vivo in man. This induction can result in drug-drug interactions, drug tolerance, and therapeutic failure. Several drug-activated nuclear receptors including CAR, PXR, VDR, and GR recognize drug responsive elements within the 5′ flanking promoter region of CYP2C genes to mediate the transcriptional upregulation of these genes in response to xenobiotics and steroids. Other nuclear receptors and transcriptional factors including HNF4α, HNF3γ, C/EBPα and more recently RORs, have been reported to regulate the constitutive expression of CYP2C genes in liver. The maximum transcriptional induction of CYP2C genes appears to be achieved through a coordinative cross-talk between drug responsive nuclear receptors, hepatic factors, and coactivators. The transcriptional regulatory mechanisms of the expression of CYP2C genes in extrahepatic tissues has received less study, but these may be altered by perturbations from pathological conditions such as ischemia as well as some of the receptors mentioned above. PMID:19702536

  3. Current status of the human obesity gene map.

    PubMed

    Bouchard, C; Pérusse, L

    1996-01-01

    An overview of the status of the human obestiy gene map up to October 1995 is presented. The evidence is drawn from several lines of clinical and experimental research. First, 12 loci linked to Mendelian disorders exhibiting obesity as one clinical feature are reviewed. Second, six loci causing obesity in rodent models of the disease are considered. Third, eight chromosomal regions where quantitative trait loci, identified by crossbreeding experiments with informative strains of mice, are defined. Fourth, 10 candidate genes exhibiting a statistical association with BMI or body fat are introduced. Fifth, nine loci found to be linked to a relevant phenotype are listed and the four cases for which the evidence for linkage is strongest are emphasized. The latter are mapped to 2p25, 6p21.3, 7q33 and 20q12-13.11. Finally, the studies that have concluded that there was no association or linkage with a marker or gene are also reviewed. It is recommended that a system be developed by the obesity research community to ensure that an accurate and easily accessible computerized version of the human obesity gene map becomes available in the near future.

  4. Mutation analysis of the Smad3 gene in human osteoarthritis.

    PubMed

    Yao, Jun-Yan; Wang, Yan; An, Jing; Mao, Chun-Ming; Hou, Ning; Lv, Ya-Xin; Wang, You-Liang; Cui, Fang; Huang, Min; Yang, Xiao

    2003-09-01

    Osteoarthritis (OA) is the most common joint disease worldwide. Recent studies have shown that targeted disruption of Smad3 in mouse results in OA. To reveal the possible association between the Smad3 gene mutation and human OA, we employed polymerase chain reaction-single strand conformation polymorphism and sequencing to screen mutations in all nine exons of the Smad3 gene in 32 patients with knee OA and 50 patients with only bone fracture. A missense mutation of the Smad3 gene was found in one patient. The single base mutation located in the linker region of the SMAD3 protein was A --> T change in the position 2 of codon 197 and resulted in an asparagine to isoleucine amino-acid substitution. The expressions of matrix metalloproteinase 2 (MMP-2) and MMP-9 in sera of the patient carrying the mutation were higher than other OA patients and controls. This is the first report showing that the Smad3 gene mutations could be associated with the pathogenesis of human OA.

  5. FGFR-TACC gene fusions in human glioma.

    PubMed

    Lasorella, Anna; Sanson, Marc; Iavarone, Antonio

    2016-11-16

    Chromosomal translocations joining in-frame members of the fibroblast growth factor receptor-transforming acidic coiled-coil gene families (the FGFR-TACC gene fusions) were first discovered in human glioblastoma multiforme (GBM) and later in many other cancer types. Here, we review this rapidly expanding field of research and discuss the unique biological and clinical features conferred to isocitrate dehydrogenase wild-type glioma cells by FGFR-TACC fusions. FGFR-TACC fusions generate powerful oncogenes that combine growth-promoting effects with aneuploidy through the activation of as yet unclear intracellular signaling mechanisms. FGFR-TACC fusions appear to be clonal tumor-initiating events that confer strong sensitivity to FGFR tyrosine kinase inhibitors. Screening assays have recently been reported for the accurate identification of FGFR-TACC fusion variants in human cancer, and early clinical data have shown promising effects in cancer patients harboring FGFR-TACC fusions and treated with FGFR inhibitors. Thus, FGFR-TACC gene fusions provide a "low-hanging fruit" model for the validation of precision medicine paradigms in human GBM.

  6. Promoter Methylation Analysis of IDH Genes in Human Gliomas.

    PubMed

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C Y; Suter, Catherine M; Buckland, Michael E

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a "toxic gain-of-function" to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  7. Spina Bifida: Pathogenesis, Mechanisms, and Genes in Mice and Humans.

    PubMed

    Mohd-Zin, Siti W; Marwan, Ahmed I; Abou Chaar, Mohamad K; Ahmad-Annuar, Azlina; Abdul-Aziz, Noraishah M

    2017-01-01

    Spina bifida is among the phenotypes of the larger condition known as neural tube defects (NTDs). It is the most common central nervous system malformation compatible with life and the second leading cause of birth defects after congenital heart defects. In this review paper, we define spina bifida and discuss the phenotypes seen in humans as described by both surgeons and embryologists in order to compare and ultimately contrast it to the leading animal model, the mouse. Our understanding of spina bifida is currently limited to the observations we make in mouse models, which reflect complete or targeted knockouts of genes, which perturb the whole gene(s) without taking into account the issue of haploinsufficiency, which is most prominent in the human spina bifida condition. We thus conclude that the need to study spina bifida in all its forms, both aperta and occulta, is more indicative of the spina bifida in surviving humans and that the measure of deterioration arising from caudal neural tube defects, more commonly known as spina bifida, must be determined by the level of the lesion both in mouse and in man.

  8. Spina Bifida: Pathogenesis, Mechanisms, and Genes in Mice and Humans

    PubMed Central

    Abou Chaar, Mohamad K.; Ahmad-Annuar, Azlina

    2017-01-01

    Spina bifida is among the phenotypes of the larger condition known as neural tube defects (NTDs). It is the most common central nervous system malformation compatible with life and the second leading cause of birth defects after congenital heart defects. In this review paper, we define spina bifida and discuss the phenotypes seen in humans as described by both surgeons and embryologists in order to compare and ultimately contrast it to the leading animal model, the mouse. Our understanding of spina bifida is currently limited to the observations we make in mouse models, which reflect complete or targeted knockouts of genes, which perturb the whole gene(s) without taking into account the issue of haploinsufficiency, which is most prominent in the human spina bifida condition. We thus conclude that the need to study spina bifida in all its forms, both aperta and occulta, is more indicative of the spina bifida in surviving humans and that the measure of deterioration arising from caudal neural tube defects, more commonly known as spina bifida, must be determined by the level of the lesion both in mouse and in man. PMID:28286691

  9. Aldosterone does not modify gene expression in human endothelial cells.

    PubMed

    Verhovez, A; Williams, T A; Morello, F; Monticone, S; Brizzi, M F; Dentelli, P; Fallo, F; Fabris, B; Amenta, F; Gomez-Sanchez, C; Veglio, F; Mulatero, P

    2012-03-01

    The toxic effects of aldosterone on the vasculature, and in particular on the endothelial layer, have been proposed as having an important role in the cardiovascular pathology observed in mineralocorticoid-excess states. In order to characterize the genomic molecular mechanisms driving the aldosterone-induced endothelial dysfunction, we performed an expression microarray on transcripts obtained from both human umbilical vein endothelial cells and human coronary artery endothelial cells stimulated with 10 - 7 M aldosterone for 18 h. The results were then subjected to qRT-PCR confirmation, also including a group of genes known to be involved in the control of the endothelial function or previously described as regulated by aldosterone. The state of activation of the mineralocorticoid receptor was investigated by means of a luciferase-reporter assay using a plasmid encoding a mineralocorticoid and glucocorticoid-sensitive promoter. Aldosterone did not determine any significant change in gene expression in either cell type both in the microarray and in the qRT-PCR analysis. The luciferase-reporter assay showed no activation of the mineralocorticoid receptor following aldosterone stimulation. The status of nonfunctionality of the mineralocorticoid receptor expressed in cultured human umbilical and coronary artery endothelial cells does not allow aldosterone to modify gene expression and provides evidence against either a beneficial or harmful genomic effect of aldosterone on healthy endothelial cells.

  10. Reference gene alternatives to Gapdh in rodent and human heart failure gene expression studies

    PubMed Central

    2010-01-01

    Background Quantitative real-time RT-PCR (RT-qPCR) is a highly sensitive method for mRNA quantification, but requires invariant expression of the chosen reference gene(s). In pathological myocardium, there is limited information on suitable reference genes other than the commonly used Gapdh mRNA and 18S ribosomal RNA. Our aim was to evaluate and identify suitable reference genes in human failing myocardium, in rat and mouse post-myocardial infarction (post-MI) heart failure and across developmental stages in fetal and neonatal rat myocardium. Results The abundance of Arbp, Rpl32, Rpl4, Tbp, Polr2a, Hprt1, Pgk1, Ppia and Gapdh mRNA and 18S ribosomal RNA in myocardial samples was quantified by RT-qPCR. The expression variability of these transcripts was evaluated by the geNorm and Normfinder algorithms and by a variance component analysis method. Biological variability was a greater contributor to sample variability than either repeated reverse transcription or PCR reactions. Conclusions The most stable reference genes were Rpl32, Gapdh and Polr2a in mouse post-infarction heart failure, Polr2a, Rpl32 and Tbp in rat post-infarction heart failure and Rpl32 and Pgk1 in human heart failure (ischemic disease and cardiomyopathy). The overall most stable reference genes across all three species was Rpl32 and Polr2a. In rat myocardium, all reference genes tested showed substantial variation with developmental stage, with Rpl4 as was most stable among the tested genes. PMID:20331858

  11. Muscle Gene Expression Patterns in Human Rotator Cuff Pathology

    PubMed Central

    Choo, Alexander; McCarthy, Meagan; Pichika, Rajeswari; Sato, Eugene J.; Lieber, Richard L.; Schenk, Simon; Lane, John G.; Ward, Samuel R.

    2014-01-01

    Background: Rotator cuff pathology is a common source of shoulder pain with variable etiology and pathoanatomical characteristics. Pathological processes of fatty infiltration, muscle atrophy, and fibrosis have all been invoked as causes for poor outcomes after rotator cuff tear repair. The aims of this study were to measure the expression of key genes associated with adipogenesis, myogenesis, and fibrosis in human rotator cuff muscle after injury and to compare the expression among groups of patients with varied severities of rotator cuff pathology. Methods: Biopsies of the supraspinatus muscle were obtained arthroscopically from twenty-seven patients in the following operative groups: bursitis (n = 10), tendinopathy (n = 7), full-thickness rotator cuff tear (n = 8), and massive rotator cuff tear (n = 2). Quantitative polymerase chain reaction (qPCR) was performed to characterize gene expression pathways involved in myogenesis, adipogenesis, and fibrosis. Results: Patients with a massive tear demonstrated downregulation of the fibrogenic, adipogenic, and myogenic genes, indicating that the muscle was not in a state of active change and may have difficulty responding to stimuli. Patients with a full-thickness tear showed upregulation of fibrotic and adipogenic genes; at the tissue level, these correspond to the pathologies most detrimental to outcomes of surgical repair. Patients with bursitis or tendinopathy still expressed myogenic genes, indicating that the muscle may be attempting to accommodate the mechanical deficiencies induced by the tendon tear. Conclusions: Gene expression in human rotator cuff muscles varied according to tendon injury severity. Patients with bursitis and tendinopathy appeared to be expressing pro-myogenic genes, whereas patients with a full-thickness tear were expressing genes associated with fatty atrophy and fibrosis. In contrast, patients with a massive tear appeared to have downregulation of all gene programs except inhibition of

  12. Gene-gene interactions contribute to eye colour variation in humans.

    PubMed

    Pośpiech, Ewelina; Draus-Barini, Jolanta; Kupiec, Tomasz; Wojas-Pelc, Anna; Branicki, Wojciech

    2011-06-01

    Prediction of phenotypes from genetic data is considered to be the first practical application of data gained from association studies, with potential importance for medicine and the forensic sciences. Multiple genes and polymorphisms have been found to be associated with variation in human pigmentation. Their analysis enables prediction of blue and brown eye colour with a reasonably high accuracy. More accurate prediction, especially in the case of intermediate eye colours, may require better understanding of gene-gene interactions affecting this polygenic trait. Using multifactor dimensionality reduction and logistic regression methods, a study of gene-gene interactions was conducted based on variation in 11 known pigmentation genes examined in a cohort of 718 individuals of European descent. The study revealed significant interactions of a redundant character between the HERC2 and OCA2 genes affecting determination of hazel eye colour and between HERC2 and SLC24A4 affecting determination of blue eye colour. Our research indicates interactive effects of a synergistic character between HERC2 and OCA2, and also provides evidence for a novel strong synergistic interaction between HERC2 and TYRP1, both affecting determination of green eye colour.

  13. Transcriptional activation of cloned human beta-globin genes by viral immediate-early gene products.

    PubMed

    Green, M R; Treisman, R; Maniatis, T

    1983-11-01

    When the human beta-globin gene is transfected into Hela cells, no beta-globin RNA is detected unless the gene is linked to a viral transcription enhancer. In this paper we show that trans-acting adenovirus and herpesvirus (pseudorabies) transcriptional regulatory proteins can circumvent this enhancer requirement for detectable beta-globin transcription in transient expression assays. The viral gene products can be provided by constitutively expressed, integrated viral genes in established cell lines, by viral infection of permissive cells, or by transfection of cells with bacterial plasmids carrying the viral immediate-early genes. These results demonstrate the utility of transient expression assays for studying regulatory mechanisms involving trans-acting factors. Analysis of beta-globin promoter mutants indicates that between 75 and 128 bp of sequence 5' to the mRNA cap site is required for enhancer-dependent transcription in Hela cells. In contrast, beta-globin transcription in the presence of viral immediate-early gene products requires only 36 bp of 5'-flanking sequence, which includes the TATA box. Thus both cis and trans-acting viral factors activate beta-globin gene transcription in transient expression experiments, but the mechanisms by which they act appear to be fundamentally different.

  14. Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus.

    PubMed

    Wang, Shihui; Jeyaseelan, Jenasia; Liu, Yun; Qin, Wensheng

    2016-09-01

    The costs of amylase represent ca. 24 % of the expenditures in the starch industry and an increase in amylase production and/or activity will greatly cut down on production costs. In the present study, we obtained a high amylase-producing strain of bacteria, WangLB, and identified it as a member of the Bacillus genus based on 16S rDNA analysis. The fermentation conditions for amylase production in the strain were optimized, and the maximum amylase activity we obtained was 26,670 ± 1390 U/mL, under the optimized conditions of 48-h incubation in liquid starch medium, 35 °C, pH 10, 1 % v/v inoculum concentration, 20 g/L starch concentration, and 0.1 % w/v peptone. The influences of 16 small organic inducers on amylase production were tested, and the results showed that 20 mmol/L alanine greatly enhanced amylase production to 290 % of the baseline level. We also conducted an amylase enzymology analysis. The molecular weight of the amylase was 55 kD, determined by SDS-PAGE. The optimum temperature and pH for the amylase were 55 °C and pH 9, respectively. The enzyme also showed high activity over a wide range of temperatures (50-85 °C) and pH values (3-10), and the activity of the amylase was Ca(2+) independent. The kinetic parameters K m and V max were 0.37 ± 0.02 mg/mL and 233 U/mg, respectively. Finally, the amylase was applied to the hydrolysis of five different brands of starch. It was found that the hydrolyzability of the substrate by amylase increased along with starch solubility.

  15. Bakers' asthma caused by alpha amylase.

    PubMed

    Valdivieso, R; Subiza, J; Subiza, J L; Hinojosa, M; de Carlos, E; Subiza, E

    1994-10-01

    Two bakers with bronchial asthma and two with rhinoconjunctivitis are described. Prick and RAST tests were positive with wheat flour in all of them, but the challenge test (nasal or bronchial) with wheat flour extract was positive only in one asthmatic baker. The prick test, RAST, and nasal or bronchial challenge done with alpha amylase extract (a glycolytic enzyme obtained from Aspergillus oryzae and used as a flour additive) were positive in all four patients. Our results support previous data indicating that alpha amylase used in bakeries is an important antigen that could cause respiratory allergy in bakers. It can function as sole causative allergen or in addition with other allergens used in the baking industry.

  16. Adenovirus dodecahedron, a new vector for human gene transfer.

    PubMed

    Fender, P; Ruigrok, R W; Gout, E; Buffet, S; Chroboczek, J

    1997-01-01

    Recombinant adenovirus is one of most efficient delivery vehicles for gene therapy. However, the initial enthusiasm for the use of recombinant adenovirus for gene therapy has been tempered by strong immune responses that develop to the virus and virus-infected cells. Even though recombinant adenoviruses are replication-defective, they introduce into the recipient cell, together with the gene of interest, viral genetes that might lead to fortuitous recombination if the recipient is infected by wild-type adenovirus. We propose the use of a dodecahedron made of adenovirus pentons or penton bases as an alternative vector for human gene therapy. The penton is a complex of two oligomeric proteins, a penton base and fiber, involved in the cell attachment, internalization, and liberation of virus into the cytoplasm. The dodecahedron retains many of the advantages of adenovirus for gene transfer such as efficiency of entry, efficient release of DNA from endosomes, and wide range of cell and tissue targets. Because it consists of only one or two adenovirus proteins instead of the 11 contained in an adenovirus virion and it does not contain the viral genome, it is potentially a safer alternative to recombinant adenovirus.

  17. Human T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    Multiple DNA and protein sequence alignments have been constructed for the human T-cell receptor {alpha}/{delta}, {beta}, and {gamma} (TCRA/D, B, and G) variable (V) gene segments. The traditional classification into subfamilies was confirmed using a much larger pool of sequences. For each sequence, a name was derived which complies with the standard nomenclature. The traditional numbering of V gene segments in the order of their discovery was continued and changed when in conflict with names of other segments. By discriminating between alleles at the same locus versus genes from different loci, we were able to reduce the number of more than 150 different TCRBV sequences in the database to a repertoire of only 47 functional TCRBV gene segments. An extension of this analysis to the over 100 TCRAV sequences results in a predicted repertoire of 42 functional TCRAV gene segments. Our alignment revealed two residues that distinguish between the highly homologous V{delta} and V{alpha}, one at a site that in V{sub H} contacts the constant region, the other at the interface between immunoglobulin V{sub H} and V{sub L}. This site may be responsible for restricted pairing between certain V{delta} and V{gamma} chains. On the other hand, V{beta} and V{gamma} appear to be related by the fact that their CDR2 length is increased by four residues as compared with that of V{alpha}/{delta} peptides. 150 refs., 12 figs., 5 tabs.

  18. The NEUROD gene maps to human chromosome 2q32 and mouse chromosome 2

    SciTech Connect

    Tamimi, R.; Dyer-Montgomery, K.; Hernandez, R.; Tapscott, S.J.

    1996-06-15

    The Neurod gene is a basic-helix-loop-helix gene that regulates neurogenesis and is identical to the hamster beta2 gene that was cloned as a regulator of insulin transcription. Here we report the cloning of human NEUROD and mapping of the gene to human chromosome 2q32 and to mouse chromosome 2. 12 refs., 1 fig.

  19. Human gene copy number spectra analysis in congenital heart malformations

    PubMed Central

    Mahnke, Donna K.; Struble, Craig A.; Tuffnell, Maureen E.; Stamm, Karl D.; Hidestrand, Mats; Harris, Susan E.; Goetsch, Mary A.; Simpson, Pippa M.; Bick, David P.; Broeckel, Ulrich; Pelech, Andrew N.; Tweddell, James S.; Mitchell, Michael E.

    2012-01-01

    The clinical significance of copy number variants (CNVs) in congenital heart disease (CHD) continues to be a challenge. Although CNVs including genes can confer disease risk, relationships between gene dosage and phenotype are still being defined. Our goal was to perform a quantitative analysis of CNVs involving 100 well-defined CHD risk genes identified through previously published human association studies in subjects with anatomically defined cardiac malformations. A novel analytical approach permitting CNV gene frequency “spectra” to be computed over prespecified regions to determine phenotype-gene dosage relationships was employed. CNVs in subjects with CHD (n = 945), subphenotyped into 40 groups and verified in accordance with the European Paediatric Cardiac Code, were compared with two control groups, a disease-free cohort (n = 2,026) and a population with coronary artery disease (n = 880). Gains (≥200 kb) and losses (≥100 kb) were determined over 100 CHD risk genes and compared using a Barnard exact test. Six subphenotypes showed significant enrichment (P ≤ 0.05), including aortic stenosis (valvar), atrioventricular canal (partial), atrioventricular septal defect with tetralogy of Fallot, subaortic stenosis, tetralogy of Fallot, and truncus arteriosus. Furthermore, CNV gene frequency spectra were enriched (P ≤ 0.05) for losses at: FKBP6, ELN, GTF2IRD1, GATA4, CRKL, TBX1, ATRX, GPC3, BCOR, ZIC3, FLNA and MID1; and gains at: PRKAB2, FMO5, CHD1L, BCL9, ACP6, GJA5, HRAS, GATA6 and RUNX1. Of CHD subjects, 14% had causal chromosomal abnormalities, and 4.3% had likely causal (significantly enriched), large, rare CNVs. CNV frequency spectra combined with precision phenotyping may lead to increased molecular understanding of etiologic pathways. PMID:22318994

  20. Membrane channel gene expression in human costal and articular chondrocytes

    PubMed Central

    Asmar, A.; Barrett-Jolley, R.; Werner, A.; Kelly, R.; Stacey, M.

    2016-01-01

    ABSTRACT Chondrocytes are the uniquely resident cells found in all types of cartilage and key to their function is the ability to respond to mechanical loads with changes of metabolic activity. This mechanotransduction property is, in part, mediated through the activity of a range of expressed transmembrane channels; ion channels, gap junction proteins, and porins. Appropriate expression of ion channels has been shown essential for production of extracellular matrix and differential expression of transmembrane channels is correlated to musculoskeletal diseases such as osteoarthritis and Albers-Schönberg. In this study we analyzed the consistency of gene expression between channelomes of chondrocytes from human articular and costal (teenage and fetal origin) cartilages. Notably, we found 14 ion channel genes commonly expressed between articular and both types of costal cartilage chondrocytes. There were several other ion channel genes expressed only in articular (6 genes) or costal chondrocytes (5 genes). Significant differences in expression of BEST1 and KCNJ2 (Kir2.1) were observed between fetal and teenage costal cartilage. Interestingly, the large Ca2+ activated potassium channel (BKα, or KCNMA1) was very highly expressed in all chondrocytes examined. Expression of the gap junction genes for Panx1, GJA1 (Cx43) and GJC1 (Cx45) was also observed in chondrocytes from all cartilage samples. Together, this data highlights similarities between chondrocyte membrane channel gene expressions in cells derived from different anatomical sites, and may imply that common electrophysiological signaling pathways underlie cellular control. The high expression of a range of mechanically and metabolically sensitive membrane channels suggest that chondrocyte mechanotransduction may be more complex than previously thought. PMID:27116676

  1. Sarcoptes scabiei mites modulate gene expression in human skin equivalents.

    PubMed

    Morgan, Marjorie S; Arlian, Larry G; Markey, Michael P

    2013-01-01

    The ectoparasitic mite, Sarcoptes scabiei that burrows in the epidermis of mammalian skin has a long co-evolution with its hosts. Phenotypic studies show that the mites have the ability to modulate cytokine secretion and expression of cell adhesion molecules in cells of the skin and other cells of the innate and adaptive immune systems that may assist the mites to survive in the skin. The purpose of this study was to identify genes in keratinocytes and fibroblasts in human skin equivalents (HSEs) that changed expression in response to the burrowing of live scabies mites. Overall, of the more than 25,800 genes measured, 189 genes were up-regulated >2-fold in response to scabies mite burrowing while 152 genes were down-regulated to the same degree. HSEs differentially expressed large numbers of genes that were related to host protective responses including those involved in immune response, defense response, cytokine activity, taxis, response to other organisms, and cell adhesion. Genes for the expression of interleukin-1α (IL-1α) precursor, IL-1β, granulocyte/macrophage-colony stimulating factor (GM-CSF) precursor, and G-CSF precursor were up-regulated 2.8- to 7.4-fold, paralleling cytokine secretion profiles. A large number of genes involved in epithelium development and keratinization were also differentially expressed in response to live scabies mites. Thus, these skin cells are directly responding as expected in an inflammatory response to products of the mites and the disruption of the skin's protective barrier caused by burrowing. This suggests that in vivo the interplay among these skin cells and other cell types, including Langerhans cells, dendritic cells, lymphocytes and endothelial cells, is responsible for depressing the host's protective response allowing these mites to survive in the skin.

  2. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    PubMed

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs.

  3. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  4. Gene expression in human hippocampus from cocaine abusers identifies genes which regulate extracellular matrix remodeling.

    PubMed

    Mash, Deborah C; ffrench-Mullen, Jarlath; Adi, Nikhil; Qin, Yujing; Buck, Andrew; Pablo, John

    2007-11-14

    The chronic effects of cocaine abuse on brain structure and function are blamed for the inability of most addicts to remain abstinent. Part of the difficulty in preventing relapse is the persisting memory of the intense euphoria or cocaine "rush". Most abused drugs and alcohol induce neuroplastic changes in brain pathways subserving emotion and cognition. Such changes may account for the consolidation and structural reconfiguration of synaptic connections with exposure to cocaine. Adaptive hippocampal plasticity could be related to specific patterns of gene expression with chronic cocaine abuse. Here, we compare gene expression profiles in the human hippocampus from cocaine addicts and age-matched drug-free control subjects. Cocaine abusers had 151 gene transcripts upregulated, while 91 gene transcripts were downregulated. Topping the list of cocaine-regulated transcripts was RECK in the human hippocampus (FC = 2.0; p<0.05). RECK is a membrane-anchored MMP inhibitor that is implicated in the coordinated regulation of extracellular matrix integrity and angiogenesis. In keeping with elevated RECK expression, active MMP9 protein levels were decreased in the hippocampus from cocaine abusers. Pathway analysis identified other genes regulated by cocaine that code for proteins involved in the remodeling of the cytomatrix and synaptic connections and the inhibition of blood vessel proliferation (PCDH8, LAMB1, ITGB6, CTGF and EphB4). The observed microarray phenotype in the human hippocampus identified RECK and other region-specific genes that may promote long-lasting structural changes with repeated cocaine abuse. Extracellular matrix remodeling in the hippocampus may be a persisting effect of chronic abuse that contributes to the compulsive and relapsing nature of cocaine addiction.

  5. Human glucose phosphate isomerase: Exon mapping and gene structure

    SciTech Connect

    Xu, Weiming; Lee, Pauline; Beutler, E.

    1995-10-10

    The structure of the gene for human glucose phosphate isomerase (GPI) has been determined. Three GPI clones were isolated from a human genomic library by using a full-length GPI cDNA probe and were characterized. Oligonucleotides based on the known cDNA sequence were used as primers in amplification and sequence analyses. This led to the identification of the exon-intron junctions. By this approach, 18 exons and 17 introns have been identified. The exons range in size from 44 to 431 nucleotides. The intronic sequences surrounding the exons provide useful information for the identification of mutations that give rise to human GPI deficiency associated with chronic hemolytic anemia. 13 refs., 4 figs., 1 tab.

  6. Decorin gene expression and its regulation in human keratinocytes

    SciTech Connect

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico; Kuri-Harcuch, Walid

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  7. Identification of Cancer Related Genes Using a Comprehensive Map of Human Gene Expression

    PubMed Central

    Lukk, Margus; Xue, Vincent; Parkinson, Helen; Rung, Johan; Brazma, Alvis

    2016-01-01

    Rapid accumulation and availability of gene expression datasets in public repositories have enabled large-scale meta-analyses of combined data. The richness of cross-experiment data has provided new biological insights, including identification of new cancer genes. In this study, we compiled a human gene expression dataset from ∼40,000 publicly available Affymetrix HG-U133Plus2 arrays. After strict quality control and data normalisation the data was quantified in an expression matrix of ∼20,000 genes and ∼28,000 samples. To enable different ways of sample grouping, existing annotations where subjected to systematic ontology assisted categorisation and manual curation. Groups like normal tissues, neoplasmic tissues, cell lines, homoeotic cells and incompletely differentiated cells were created. Unsupervised analysis of the data confirmed global structure of expression consistent with earlier analysis but with more details revealed due to increased resolution. A suitable mixed-effects linear model was used to further investigate gene expression in solid tissue tumours, and to compare these with the respective healthy solid tissues. The analysis identified 1,285 genes with systematic expression change in cancer. The list is significantly enriched with known cancer genes from large, public, peer-reviewed databases, whereas the remaining ones are proposed as new cancer gene candidates. The compiled dataset is publicly available in the ArrayExpress Archive. It contains the most diverse collection of biological samples, making it the largest systematically annotated gene expression dataset of its kind in the public domain. PMID:27322383

  8. Abdominal pain and a raised amylase? It's not always pancreatitis. . .

    PubMed

    Oluwatowoju, I O; Abu, O E; Lawson, G

    2013-01-01

    We report the case of a 72 year old man with a history of COPD and heavy alcohol consumption who was initially diagnosed with acute pancreatitis based on a presentation with epigastric pain and elevated serum amylase. Review of his notes revealed several previous similar admissions and extensive normal investigations apart from persistently elevated amylase. Further analysis showed evidence of macroamylasaemia which accounted for the apparently high serum amylase level.

  9. Growth inhibition of human pancreatic cancer cells by human interferon-beta gene combined with gemcitabine.

    PubMed

    Endou, Masato; Mizuno, Masaaki; Nagata, Takuya; Tsukada, Kazuhiro; Nakahara, Norimoto; Tsuno, Takaya; Osawa, Hirokatsu; Kuno, Tomohiko; Fujita, Mitsugu; Hatano, Manabu; Yoshida, Jun

    2005-02-01

    We examined the anti-tumor effect of cationic multilamellar liposome containing human IFN-beta (huIFN-beta) gene against cultured human pancreatic cancer cells. We also evaluated the combined effect of huIFN-beta gene entrapped in liposomes and gemcitabine. Furthermore, we examined the anti-tumor mechanisms of the therapy, with emphasis on the Ras-related signal pathway. Three human pancreatic cancer cell lines (AsPc-1, MIAPaCa-2, and PANC-1) were used in this study. The growth inhibition together with the therapy were evaluated by WST-1 assay; the production of huIFN-beta protein was measured by ELISA; the cell cycle and apoptosis were analyzed using a FACScan flow cytometer; the protein levels of Son of sevenless (SOS-1) and Ras-GAP were measured by Western blotting; and the activation of Ras-GTP was evaluated by the immunoprecipitation method. As a result, we found that huIFN-beta gene entrapped in liposomes demonstrated a strong anti-tumor effect against human pancreatic cancer cells. The treatment that combined huIFN-beta gene entrapped in liposomes and gemcitabine was more effective than each treatment alone. Although gemcitabine remarkably reduced the level of SOS-1, the above combined therapy reduced the level of SOS-1 even more significantly. Both huIFN-beta gene entrapped in liposomes and the com-bination of huIFN-beta gene entrapped in liposomes and gemcitabine increased the level of Ras-GAP, and decreased the activity of Ras-GTP. These results suggest that this combination therapy can induce strong anti-tumor activity against human pancreatic cancer cells through the regulation of the Ras-related signal pathway.

  10. Structure of the human histamine H1 receptor gene.

    PubMed Central

    De Backer, M D; Loonen, I; Verhasselt, P; Neefs, J M; Luyten, W H

    1998-01-01

    Histamine H1 receptor expression has been reported to change in disorders such as allergic rhinitis, autoimmune myocarditis, rheumatoid arthritis and atherosclerosis. Here we report the isolation and characterization of genomic clones containing the 5' flanking (regulatory) region of the human histamine H1 receptor gene. An intron of approx. 5.8 kb was identified in the 5' untranslated region, which suggests that an entire subfamily of G-protein-coupled receptors may contain an intron immediately upstream of the start codon. The transcription initiation site was mapped by 5' rapid amplification of cDNA ends to a region 6.2 kb upstream of the start codon. Immediately upstream of the transcription start site a fragment of 1.85 kb was identified that showed promoter activity when placed upstream of a luciferase reporter gene and transiently transfected into cells expressing the histamine H1 receptor. The promoter sequence shares a number of characteristics with the promoter sequences of other G-protein-coupled receptor encoding genes, including binding sites for several transcription factors, and the absence of TATA and CAAT sequences at the appropriate locations. The promoter sequence described here differs from that reported previously [Fukui, Fujimoto, Mizuguchi, Sakamoto, Horio, Takai, Yamada and Ito (1994) Biochem. Biophys. Res. Commun. 201, 894-901] because the reported genomic clone was chimaeric. Furthermore our study provides evidence that the 3' untranslated region of the H1 receptor mRNA is much longer than previously accepted. Together, these findings provide a complete view of the structure of the human histamine H1 receptor gene. Both the coding region of the H1 receptor gene and its promoter region were independently mapped to chromosome 3p25. PMID:9794809

  11. MORPHIN: a web tool for human disease research by projecting model organism biology onto a human integrated gene network.

    PubMed

    Hwang, Sohyun; Kim, Eiru; Yang, Sunmo; Marcotte, Edward M; Lee, Insuk

    2014-07-01

    Despite recent advances in human genetics, model organisms are indispensable for human disease research. Most human disease pathways are evolutionally conserved among other species, where they may phenocopy the human condition or be associated with seemingly unrelated phenotypes. Much of the known gene-to-phenotype association information is distributed across diverse databases, growing rapidly due to new experimental techniques. Accessible bioinformatics tools will therefore facilitate translation of discoveries from model organisms into human disease biology. Here, we present a web-based discovery tool for human disease studies, MORPHIN (model organisms projected on a human integrated gene network), which prioritizes the most relevant human diseases for a given set of model organism genes, potentially highlighting new model systems for human diseases and providing context to model organism studies. Conceptually, MORPHIN investigates human diseases by an orthology-based projection of a set of model organism genes onto a genome-scale human gene network. MORPHIN then prioritizes human diseases by relevance to the projected model organism genes using two distinct methods: a conventional overlap-based gene set enrichment analysis and a network-based measure of closeness between the query and disease gene sets capable of detecting associations undetectable by the conventional overlap-based methods. MORPHIN is freely accessible at http://www.inetbio.org/morphin.

  12. Activated effect of lignin on α-amylase.

    PubMed

    Zhang, Juan; Cui, Jun-Hui; Yin, Tingting; Sun, Lizhou; Li, Genxi

    2013-12-01

    This paper reports a new kind of activator of α-amylase, lignin, which can greatly increase α-amylase activity. The promoted ratio of lignin is even much higher than that of chloride ion, the traditional activator of α-amylase. Further experimental results reveal that lignin may interact with α-amylase to form a 1:1 complex with a binding constant of 4.47×10(5) M(-1). The binding is spontaneous and lignin/α-amylase complex formation is an exothermal reaction. Hydrogen bonding plays a key role and non-radiation energy transfers from α-amylase to lignin in the binding process. Lignin, combining with α-amylase, conforms to a first-order exponential decay function. The formation of the lignin/α-amylase complex results in the reduction of α-helical content from 57.7% to 53.9%, the increase of the polarity around tryptophan residues, the decrease of the hydrophobicity, and the enlargement of protein granule volume. This work will give a deeper insight into lignin as a kind of dietary fibre, known as an important food functional factor. Furthermore, it also contributes to the exploration of an activator of α-amylase, used in the food industry.

  13. Thermal adaptation of α-amylases: a review.

    PubMed

    Hiteshi, Kalpana; Gupta, Reena

    2014-11-01

    The temperature adaptation of α-amylase can be gained by different adjustments in protein structure with consecutive effects on the stability and flexibility of the protein. In this review, meso, thermo and cold-active α-amylases have been compared with respect to their structure and intramolecular interactions. With decrease in temperature, the number of ionic interactions also decreases, leading to greater flexibility of proteins. It has also been observed that the proline and arginine content is higher in thermophilic amylases as compared to meso and psychrophilic amylases, increasing the rigidity and structural stability of protein molecule.

  14. Variation in amylase activities in radish (Raphanus sativus) cultivars.

    PubMed

    Hara, Masakazu; Ito, Fumio; Asai, Tatsuo; Kuboi, Toru

    2009-09-01

    The radish (Raphanus sativus) is a root vegetable of the Brassicaceae family which shows amylolytic activity in the taproot. However, there is little information about differences in these amylolytic activities among radish cultivars. We analyzed the amylase activities and starch contents of 7 kinds of radish cultivars. The Koshin cultivar showed the highest amylase activity, with a level approximately 6 times higher than that of the Sobutori cultivar, which had the lowest. Cultivars with higher amylase activities showed higher starch contents. These results suggest that there are intraspecies variations in amylolytic activities in radishes, and positive correlations between amylase activity and starch content.

  15. The human thyrotropin beta-subunit gene differs in 5' structure from murine TSH-beta genes.

    PubMed

    Guidon, P T; Whitfield, G K; Porti, D; Kourides, I A

    1988-12-01

    The gene encoding the beta-subunit of human thyrotropin (hTSH-beta) was isolated, and its nucleotide sequence was determined. The gene is 4.3 kb in length, consists of three exons and two introns, and is present as a single copy as determined by Southern blot analysis of total genomic DNA. The protein coding portion of the gene, which includes exons 2 and 3, was isolated from a human genomic phage library, while exon 1, which encodes only 5' untranslated mRNA sequence, was isolated from a plasmid library of size-selected genomic DNA fragments. Here we describe the isolation of the 5' untranslated exon of the hTSH-beta subunit and 5'-flanking region. The structure of the hTSH-beta gene is very similar to the previously characterized TSH-beta genes from mouse and rat. The genes from all three species have two distinct promoter regions, but while both promoters are utilized by the murine TSH-beta genes, the human TSH-beta gene apparently utilizes only the proximal promoter for transcription initiation. A striking difference in hTSH-beta gene structure compared to the murine genes is that exon 1 of the human gene is 36 nucleotides. An analysis of the mouse, rat, and human exon 1 and 5'-flanking region shows a high percentage of sequence homology, with the exception of a 9-nucleotide insertion 13 bases 3' from the proximal TATA box found in the human gene but not found in the other two species. We propose that this insertion results in the additional length of human exon 1 compared to the mouse and rat genes. By isolating the promoter region of the hTSH-beta gene, we can begin to identify specific sequences involved in the regulation of hTSH gene expression.

  16. A recellularized human colon model identifies cancer driver genes

    PubMed Central

    Chen, Huanhuan Joyce; Wei, Zhubo; Sun, Jian; Bhattacharya, Asmita; Savage, David J; Serda, Rita; Mackeyev, Yuri; Curley, Steven A.; Bu, Pengcheng; Wang, Lihua; Chen, Shuibing; Cohen-Gould, Leona; Huang, Emina; Shen, Xiling; Lipkin, Steven M.; Copeland, Neal G.; Jenkins, Nancy A.; Shuler, Michael L.

    2016-01-01

    Refined cancer models are needed to bridge the gap between cell-line, animal and clinical research. Here we describe the engineering of an organotypic colon cancer model by recellularization of a native human matrix that contains cell-populated mucosa and an intact muscularis mucosa layer. This ex vivo system recapitulates the pathophysiological progression from APC-mutant neoplasia to submucosal invasive tumor. We used it to perform a Sleeping Beauty transposon mutagenesis screen to identify genes that cooperate with mutant APC in driving invasive neoplasia. 38 candidate invasion driver genes were identified, 17 of which have been previously implicated in colorectal cancer progression, including TCF7L2, TWIST2, MSH2, DCC and EPHB1/2. Six invasion driver genes that to our knowledge have not been previously described were validated in vitro using cell proliferation, migration and invasion assays, and ex vivo using recellularized human colon. These results demonstrate the utility of our organoid model for studying cancer biology. PMID:27398792

  17. Microbiota diversity and gene expression dynamics in human oral biofilms

    PubMed Central

    2014-01-01

    Background Micro-organisms inhabiting teeth surfaces grow on biofilms where a specific and complex succession of bacteria has been described by co-aggregation tests and DNA-based studies. Although the composition of oral biofilms is well established, the active portion of the bacterial community and the patterns of gene expression in vivo have not been studied. Results Using RNA-sequencing technologies, we present the first metatranscriptomic study of human dental plaque, performed by two different approaches: (1) A short-reads, high-coverage approach by Illumina sequencing to characterize the gene activity repertoire of the microbial community during biofilm development; (2) A long-reads, lower-coverage approach by pyrosequencing to determine the taxonomic identity of the active microbiome before and after a meal ingestion. The high-coverage approach allowed us to analyze over 398 million reads, revealing that microbial communities are individual-specific and no bacterial species was detected as key player at any time during biofilm formation. We could identify some gene expression patterns characteristic for early and mature oral biofilms. The transcriptomic profile of several adhesion genes was confirmed through qPCR by measuring expression of fimbriae-associated genes. In addition to the specific set of gene functions overexpressed in early and mature oral biofilms, as detected through the short-reads dataset, the long-reads approach detected specific changes when comparing the metatranscriptome of the same individual before and after a meal, which can narrow down the list of organisms responsible for acid production and therefore potentially involved in dental caries. Conclusions The bacteria changing activity during biofilm formation and after meal ingestion were person-specific. Interestingly, some individuals showed extreme homeostasis with virtually no changes in the active bacterial population after food ingestion, suggesting the presence of a microbial

  18. Human Transporter Database: Comprehensive Knowledge and Discovery Tools in the Human Transporter Genes

    PubMed Central

    Ye, Adam Y.; Liu, Qing-Rong; Li, Chuan-Yun; Zhao, Min; Qu, Hong

    2014-01-01

    Transporters are essential in homeostatic exchange of endogenous and exogenous substances at the systematic, organic, cellular, and subcellular levels. Gene mutations of transporters are often related to pharmacogenetics traits. Recent developments in high throughput technologies on genomics, transcriptomics and proteomics allow in depth studies of transporter genes in normal cellular processes and diverse disease conditions. The flood of high throughput data have resulted in urgent need for an updated knowledgebase with curated, organized, and annotated human transporters in an easily accessible way. Using a pipeline with the combination of automated keywords query, sequence similarity search and manual curation on transporters, we collected 1,555 human non-redundant transporter genes to develop the Human Transporter Database (HTD) (http://htd.cbi.pku.edu.cn). Based on the extensive annotations, global properties of the transporter genes were illustrated, such as expression patterns and polymorphisms in relationships with their ligands. We noted that the human transporters were enriched in many fundamental biological processes such as oxidative phosphorylation and cardiac muscle contraction, and significantly associated with Mendelian and complex diseases such as epilepsy and sudden infant death syndrome. Overall, HTD provides a well-organized interface to facilitate research communities to search detailed molecular and genetic information of transporters for development of personalized medicine. PMID:24558441

  19. Comparison of Non-Human Primate and Human Whole Blood Tissue Gene Expression Profiles

    DTIC Science & Technology

    2005-03-01

    studies have used rhesus, chimpanzee, gorilla, or orangutan RNA, but to date no gene expression profiling studies are available that use AGM or cynomologus...previous work has been published using human genechips to study NHPs, particularly rhesus, chimpanzee, gorilla, and orangutan (Uddin et al., 2004; Kayo

  20. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii.

    PubMed

    Nikitkova, A E; Haase, E M; Scannapieco, F A

    2012-08-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml(-1) amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, up-regulate AbpA expression in S. gordonii.

  1. The human insulin gene is part of a large open chromatin domain specific for human islets.

    PubMed

    Mutskov, Vesco; Felsenfeld, Gary

    2009-10-13

    Knowledge of how insulin (INS) gene expression is regulated will lead to better understanding of normal and abnormal pancreatic beta cell function. We have mapped histone modifications over the INS region, coupled with an expression profile, in freshly isolated islets from multiple human donors. Unlike many other human genes, in which active modifications tend to be concentrated within 1 kb around the transcription start site, these marks are distributed over the entire coding region of INS as well. Moreover, a region of approximately 80 kb around the INS gene, which contains the {tyrosine hydroxylase (TH)-(INS)-insulin-like growth factor 2 antisense (IGF2AS)-insulin-like growth factor 2 (IGF2)} gene cluster, unusually is marked by almost uniformly elevated levels of histone acetylation and H3K4 dimethylation, extending both downstream into IGF2 and upstream beyond the TH gene. This is accompanied by islet specific coordinate expression with INS of the neighboring TH and IGF2 genes. The presence of islet specific intergenic transcripts suggests their possible function in the maintenance of this unusual large open chromatin domain.

  2. Thermodynamic stability of a cold-active alpha-amylase from the Antarctic bacterium Alteromonas haloplanctis.

    PubMed

    Feller, G; d'Amico, D; Gerday, C

    1999-04-06

    The thermal stability of the cold-active alpha-amylase (AHA) secreted by the Antarctic bacterium Alteromonas haloplanctis has been investigated by intrinsic fluorescence, circular dichroism, and differential scanning calorimetry. It was found that this heat-labile enzyme is the largest known multidomain protein exhibiting a reversible two-state unfolding, as demonstrated by the recovery of DeltaHcal values after consecutive calorimetric transitions, a DeltaHcal/DeltaHeff ratio close to unity, and the independence of unfolding thermodynamic parameters of scan rates. By contrast, the mesophilic alpha-amylases investigated here (from porcine pancreas, human salivary glands, yellow meal beetle, Bacillus amyloliquefaciens, and Bacillus licheniformis) unfold irreversibly according to a non-two-state mechanism. Unlike mesophilic alpha-amylases, the melting point of AHA is independent of calcium and chloride binding while the allosteric and structural functions of these ions are conserved. The thermostability of AHA at optimal conditions is characterized by a Tm of 43.7 degrees C, a DeltaHcal of 238 kcal mol-1, and a DeltaCp of 8.47 kcal mol-1 K-1. These values were used to calculate the Gibbs free energy of unfolding over a wide range of temperatures. This stability curve shows that (a) the specific DeltaGmax of AHA [22 cal (mol of residue)-1] is 4 times lower than that of mesophilic alpha-amylases, (b) group hydration plays a crucial role in the enzyme flexibility at low temperatures, (c) the temperature of cold unfolding closely corresponds to the lower limit of bacterial growth, and (d) the recombinant heat-labile enzyme can be expressed in mesophilic hosts at moderate temperatures. It is also argued that the cold-active alpha-amylase has evolved toward the lowest possible conformational stability of its native state.

  3. Structural organization of the human sorbitol dehydrogenase gene (SORD)

    SciTech Connect

    Iwata, T.; Carper, D.; Popescu, N.C.

    1995-03-01

    The primary structure of human sorbitol dehydrogenase (SORD) was determined by cDNA and genomic cloning. The nucleotide sequence of the mRNA covers 2471 bp including an open reading frame that yields a protein of 356 amino acid residues. The gene structure of SORD spans approximatley 30 kb divided into 9 exons and 8 introns. The gene was localized to chromosome 15q21.1 by in situ hybridization. Two transcription initiation sites were detected. Three Sp1 sites and a repetitive sequence (CAAA){sub 5} were observed in the 5{prime} noncoding region; no classical TATAA or CCAAT elements were found. The related alcohol dehydrogenases and {zeta}-crystallin have the same gene organization split by 8 introns, but no splice points coincide between SORD and these gene types. The deduced amino acid sequence of the SORD structure differs at a few positions from the directly determined protein sequence, suggesting allelic forms of the enzyme. High levels of SORD transcripts were observed in lens and kidney, as judged from Northern blot analysis. 42 refs., 7 figs., 1 tab.

  4. Gene expression profiling gut microbiota in different races of humans

    NASA Astrophysics Data System (ADS)

    Chen, Lei; Zhang, Yu-Hang; Huang, Tao; Cai, Yu-Dong

    2016-03-01

    The gut microbiome is shaped and modified by the polymorphisms of microorganisms in the intestinal tract. Its composition shows strong individual specificity and may play a crucial role in the human digestive system and metabolism. Several factors can affect the composition of the gut microbiome, such as eating habits, living environment, and antibiotic usage. Thus, various races are characterized by different gut microbiome characteristics. In this present study, we studied the gut microbiomes of three different races, including individuals of Asian, European and American races. The gut microbiome and the expression levels of gut microbiome genes were analyzed in these individuals. Advanced feature selection methods (minimum redundancy maximum relevance and incremental feature selection) and four machine-learning algorithms (random forest, nearest neighbor algorithm, sequential minimal optimization, Dagging) were employed to capture key differentially expressed genes. As a result, sequential minimal optimization was found to yield the best performance using the 454 genes, which could effectively distinguish the gut microbiomes of different races. Our analyses of extracted genes support the widely accepted hypotheses that eating habits, living environments and metabolic levels in different races can influence the characteristics of the gut microbiome.

  5. Rod photoreceptor-specific gene expression in human retinoblastoma cells.

    PubMed Central

    Di Polo, A; Farber, D B

    1995-01-01

    Retinoblastoma cells in culture have previously been shown to express cone-specific genes but not their rod counterparts. We have detected the messages for the rod alpha, beta, and gamma subunits of cGMP phosphodiesterase (PDE), the rod alpha subunit of transducin, rod opsin, and the cone alpha' subunit of PDE in RNA of human Y-79 retinoblastoma cells by reverse transcription-PCR. Quantitative analysis of the mRNAs for the rod alpha and cone alpha' PDE subunits revealed that they were expressed at comparable levels; however, the transcript encoding the rod beta PDE subunit was 10 times more abundant in these cells. Northern hybridization analysis of Y-79 cell RNA confirmed the presence of the transcripts for rod and cone PDE catalytic subunits. To test whether the transcriptional machinery required for the expression of rod-specific genes was endogenous in Y-79 retinoblastoma cells, cultures were transfected with a construct containing the promoter region of the rod beta PDE subunit gene attached to the firefly luciferase reporter vector. Significant levels of reporter enzyme activity were observed in the cell lysates. Our results demonstrate that the Y-79 retinoblastoma cell line is a good model system for the study of transcriptional regulation of rod-specific genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7732024

  6. Gene expression profiling gut microbiota in different races of humans

    PubMed Central

    Chen, Lei; Zhang, Yu-Hang; Huang, Tao; Cai, Yu-Dong

    2016-01-01

    The gut microbiome is shaped and modified by the polymorphisms of microorganisms in the intestinal tract. Its composition shows strong individual specificity and may play a crucial role in the human digestive system and metabolism. Several factors can affect the composition of the gut microbiome, such as eating habits, living environment, and antibiotic usage. Thus, various races are characterized by different gut microbiome characteristics. In this present study, we studied the gut microbiomes of three different races, including individuals of Asian, European and American races. The gut microbiome and the expression levels of gut microbiome genes were analyzed in these individuals. Advanced feature selection methods (minimum redundancy maximum relevance and incremental feature selection) and four machine-learning algorithms (random forest, nearest neighbor algorithm, sequential minimal optimization, Dagging) were employed to capture key differentially expressed genes. As a result, sequential minimal optimization was found to yield the best performance using the 454 genes, which could effectively distinguish the gut microbiomes of different races. Our analyses of extracted genes support the widely accepted hypotheses that eating habits, living environments and metabolic levels in different races can influence the characteristics of the gut microbiome. PMID:26975620

  7. Dynamic Gene Regulatory Networks of Human Myeloid Differentiation.

    PubMed

    Ramirez, Ricardo N; El-Ali, Nicole C; Mager, Mikayla Anne; Wyman, Dana; Conesa, Ana; Mortazavi, Ali

    2017-03-27

    The reconstruction of gene regulatory networks underlying cell differentiation from high-throughput gene expression and chromatin data remains a challenge. Here, we derive dynamic gene regulatory networks for human myeloid differentiation using a 5-day time series of RNA-seq and ATAC-seq data. We profile HL-60 promyelocytes differentiating into macrophages, neutrophils, monocytes, and monocyte-derived macrophages. We find a rapid response in the expression of key transcription factors and lineage markers that only regulate a subset of their targets at a given time, which is followed by chromatin accessibility changes that occur later along with further gene expression changes. We observe differences between promyelocyte- and monocyte-derived macrophages at both the transcriptional and chromatin landscape level, despite using the same differentiation stimulus, which suggest that the path taken by cells in the differentiation landscape defines their end cell state. More generally, our approach of combining neighboring time points and replicates to achieve greater sequencing depth can efficiently infer footprint-based regulatory networks from long series data.

  8. Cloning an expressed gene shared by the human sex chromosomes

    SciTech Connect

    Darling, S.M.; Banting, G.S.; Pym, B.; Wolfe, J.; Goodfellow, P.N.

    1986-01-01

    The existence of genes shared by mammalian sex chromosomes has been predicted on both evolutionary and functional grounds. However, the only experimental evidence for such genes in humans is the cell-surface antigen encoded by loci on the X and Y chromosomes (MIC2X and MIC2Y, respectively), which is recognized by the monoclonal antibody 12E7. Using the bacteriophage lambdagt11 expression system in Escherichia coli and immunoscreening techniques, the authors have isolated a cDNA clone whose primary product is recognized by 12E7. Southern blot analysis using somatic cell hybrids containing only the human X or Y chromosomes shows that the sequences reacting with the cDNA clone are localized to the sex chromosomes. In addition, the clone hybridizes to DNAs isolated from mouse cells that have been transfected with human DNA and selected for 12E7 expression on the fluorescence-activated cell sorter. The authors conclude that the cDNA clone encodes the 12E7 antigen, which is the primary product of the MIC2 loci. The clone was used to explore sequence homology between MIC2X and MIC2Y; these loci are closely related, if not identical.

  9. The timing of selection at the human FOXP2 gene.

    PubMed

    Coop, Graham; Bullaughey, Kevin; Luca, Francesca; Przeworski, Molly

    2008-07-01

    Krause J, Lalueza-Fox C, Orlando L, et al. recently examined patterns of genetic variation at FOXP2 in 2 Neanderthals. This gene is of particular interest because it is involved in speech and language and was previously shown to harbor the signature of recent positive selection. The authors found the same 2 amino acid substitutions in Neanderthals as in modern humans. Assuming that these sites were the targets of selection and no interbreeding between the 2 groups, they concluded that selection at FOXP2 occurred before the populations split, over 300 thousand years ago. Here, we show that the data are unlikely under this scenario but may instead be consistent with low rates of gene flow between modern humans and Neanderthals. We also collect additional data and introduce a modeling framework to estimate levels of modern human contamination of the Neanderthal samples. We find that, depending on the assumptions, additional control experiments may be needed to rule out contamination at FOXP2.

  10. Human Specific Regulation of the Telomerase Reverse Transcriptase Gene

    PubMed Central

    Zhang, Fan; Cheng, De; Wang, Shuwen; Zhu, Jiyue

    2016-01-01

    Telomerase, regulated primarily by the transcription of its catalytic subunit telomerase reverse transcriptase (TERT), is critical for controlling cell proliferation and tissue homeostasis by maintaining telomere length. Although there is a high conservation between human and mouse TERT genes, the regulation of their transcription is significantly different in these two species. Whereas mTERT expression is widely detected in adult mice, hTERT is expressed at extremely low levels in most adult human tissues and cells. As a result, mice do not exhibit telomere-mediated replicative aging, but telomere shortening is a critical factor of human aging and its stabilization is essential for cancer development in humans. The chromatin environment and epigenetic modifications of the hTERT locus, the binding of transcriptional factors to its promoter, and recruitment of nucleosome modifying complexes all play essential roles in restricting its transcription in different cell types. In this review, we will discuss recent progress in understanding the molecular mechanisms of TERT regulation in human and mouse tissues and cells, and during cancer development. PMID:27367732

  11. Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene

    SciTech Connect

    Glenn, C.C.; Jong, T.C.; Filbrandt, M.M.

    1996-02-01

    The human SNRPN (small nuclear ribonucleoprotein polypeptide N) gene is one of a gene family that encode proteins involved in pre-mRNA splicing and maps to the smallest deletion region involved in the Prader-Willi syndrome (PWS) within chromosome 15q11-q13. Paternal only expression of SNRPN has previously been demonstrated by use of cell lines from PWS patients (maternal allele only) and Angelman syndrome (AS) patients (paternal allele only). We have characterized two previously unidentified 5{prime} exons of the SNRPN gene and demonstrate that exons -1 and 0 are included in the full-length transcript. This gene is expressed in a wide range of somatic tissues and at high, approximately equal levels in all regions of the brain. Both the first exon of SNRPN (exon -1) and the putative transcription start site are embedded within a CpG island. This CpG island is extensively methylated on the repressed maternal allele and is unmethylated on the expressed paternal allele, in a wide range of fetal and adult somatic cells. This provides a quick and highly reliable diagnostic assay for PWS and AS, which is based on DNA-methylation analysis that has been tested on >100 patients in a variety of tissues. Conversely, several CpG sites {approximately}22 kb downstream of the transcription start site in intron 5 are preferentially methylated on the expressed paternal allele in somatic tissues and male germ cells, whereas these same sites are unmethylated in fetal oocytes. These findings are consistent with a key role for DNA methylation in the imprinted inheritance and subsequent gene expression of the human SNRPN gene. 59 refs., 9 figs., 1 tab.

  12. The human BDNF gene: peripheral gene expression and protein levels as biomarkers for psychiatric disorders

    PubMed Central

    Cattaneo, A; Cattane, N; Begni, V; Pariante, C M; Riva, M A

    2016-01-01

    Brain-derived neurotrophic factor (BDNF) regulates the survival and growth of neurons, and influences synaptic efficiency and plasticity. The human BDNF gene consists of 11 exons, and distinct BDNF transcripts are produced through the use of alternative promoters and splicing events. The majority of the BDNF transcripts can be detected not only in the brain but also in the blood cells, although no study has yet investigated the differential expression of BDNF transcripts at the peripheral level. This review provides a description of the human BDNF gene structure as well as a summary of clinical and preclinical evidence supporting the role of BDNF in the pathogenesis of psychiatric disorders. We will discuss several mechanisms as possibly underlying BDNF modulation, including epigenetic mechanisms. We will also discuss the potential use of peripheral BDNF as a biomarker for psychiatric disorders, focusing on the factors that can influence BDNF gene expression and protein levels. Within this context, we have also characterized, for we believe the first time, the expression of BDNF transcripts in the blood, with the aim to provide novel insights into the molecular mechanisms and signaling that may regulate peripheral BDNF gene expression levels. PMID:27874848

  13. Primary function analysis of human mental retardation related gene CRBN.

    PubMed

    Xin, Wang; Xiaohua, Ni; Peilin, Chen; Xin, Chen; Yaqiong, Sun; Qihan, Wu

    2008-06-01

    The mutation of human cereblon gene (CRBN) is revealed to be related with mild mental retardation. Since the molecular characteristics of CRBN have not been well presented, we investigated the general properties of CRBN. We analyzed its gene structure and protein homologues. The CRBN protein might belong to a family of adenosine triphosphate (ATP)-dependent Lon protease. We also found that CRBN was widely expressed in different tissues, and the expression level in testis is significantly higher than other tissues. This may suggested it could play some important roles in several other tissues besides brain. Transient transfection experiment in AD 293 cell lines suggested that both CRBN and CRBN mutant (nucleotide position 1,274(C > T)) are located in the whole cells. This may suggest new functions of CRBN in cell nucleolus besides its mitochondria protease activity in cytoplasm.

  14. Bioinformatics approach for choosing the correct reference genes when studying gene expression in human keratinocytes.

    PubMed

    Beer, Lucian; Mlitz, Veronika; Gschwandtner, Maria; Berger, Tanja; Narzt, Marie-Sophie; Gruber, Florian; Brunner, Patrick M; Tschachler, Erwin; Mildner, Michael

    2015-10-01

    Reverse transcription polymerase chain reaction (qRT-PCR) has become a mainstay in many areas of skin research. To enable quantitative analysis, it is necessary to analyse expression of reference genes (RGs) for normalization of target gene expression. The selection of reliable RGs therefore has an important impact on the experimental outcome. In this study, we aimed to identify and validate the best suited RGs for qRT-PCR in human primary keratinocytes (KCs) over a broad range of experimental conditions using the novel bioinformatics tool 'RefGenes', which is based on a manually curated database of published microarray data. Expression of 6 RGs identified by RefGenes software and 12 commonly used RGs were validated by qRT-PCR. We assessed whether these 18 markers fulfilled the requirements for a valid RG by the comprehensive ranking of four bioinformatics tools and the coefficient of variation (CV). In an overall ranking, we found GUSB to be the most stably expressed RG, whereas the expression values of the commonly used RGs, GAPDH and B2M were significantly affected by varying experimental conditions. Our results identify RefGenes as a powerful tool for the identification of valid RGs and suggest GUSB as the most reliable RG for KCs.

  15. Somatic cell gene mutations in humans: biomarkers for genotoxicity.

    PubMed Central

    Albertini, R J; Nicklas, J A; O'Neill, J P

    1993-01-01

    Somatic cell gene mutations arising in vivo in humans provide biomarkers for genotoxicity. Four assays, each measuring changes in a different "recorder" gene, are available for detecting mutations of the hemoglobin (Hb) and glycophorin A (gpa) genes in red blood cells and the hypoxanthine-guanine phosphoribosyltransferase (hprt) and HLA genes in T-lymphocytes. Mean adult background mutant frequencies have been established; i.e., approximately 4 x 10(-8) (Hb), 5-10 x 10(-6) (hprt), 10-20 x 10(-6) (gpa) and 30 x 10(-6) (HLA). All the assays have now been used in studies of individuals exposed to physical and/or chemical genotoxic agents, and all have shown elevated values following exposures; examples are presented. In addition to quantitation, the lymphocyte assays allow molecular analyses of in vivo mutations, the definition of background and induced mutational spectra, and the search for unique changes for characterizing specific mutagens. The HPRT system currently has the largest database in this regard. Approximately 15% of adult background hprt mutations are due to gross structural alterations (primarily deletions) having random breakpoints; 85% result from "point" changes detected only by sequencing. In contrast, a specific intragenic deletion due to DNA cleavage at specific sites characterizes fetal hprt mutations, implicating a developmental mistake in their genesis. (This kind of developmental mistake in other genes is frequently observed in lymphoid malignancies.) Mutational spectra are just beginning to be defined for induced hprt mutations, e.g., ionizing radiation produces large deletions.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8143616

  16. Calcium pantothenate modulates gene expression in proliferating human dermal fibroblasts.

    PubMed

    Wiederholt, Tonio; Heise, Ruth; Skazik, Claudia; Marquardt, Yvonne; Joussen, Sylvia; Erdmann, Kati; Schröder, Henning; Merk, Hans F; Baron, Jens Malte

    2009-11-01

    Topical application of pantothenate is widely used in clinical practice for wound healing. Previous studies identified a positive effect of pantothenate on migration and proliferation of cultured fibroblasts. However, these studies were mainly descriptive with no molecular data supporting a possible model of its action. In this study, we first established conditions for an in vitro model of pantothenate wound healing and then analysed the molecular effects of pantothenate. To test the functional effect of pantothenate on dermal fibroblasts, cells were cultured and in vitro proliferation tests were performed using a standardized scratch test procedure. For all three donors analysed, a strong stimulatory effect of pantothenate at a concentration of 20 microg/ml on the proliferation of cultivated dermal fibroblasts was observed. To study the molecular mechanisms resulting in the proliferative effect of pantothenate, gene expression was analysed in dermal fibroblasts cultivated with 20 microg/ml of pantothenate compared with untreated cells using the GeneChip Human Exon 1.0 ST Array. A number of significantly regulated genes were identified including genes coding for interleukin (IL)-6, IL-8, Id1, HMOX-1, HspB7, CYP1B1 and MARCH-II. Regulation of these genes was subsequently verified by quantitative real-time polymerase chain reaction analysis. Induction of HMOX-1 expression by pantothenol and pantothenic acid in dermal cells was confirmed on the protein level using immunoblots. Functional studies revealed the enhanced suppression of free radical formation in skin fibroblasts cultured with panthenol. In conclusion, these studies provided new insight in the molecular mechanisms linked to the stimulatory effect of pantothenate and panthenol on the proliferation of dermal fibroblasts.

  17. Evaluation of the GeneXpert for Human Monkeypox Diagnosis

    PubMed Central

    Li, Daniel; Wilkins, Kimberly; McCollum, Andrea M.; Osadebe, Lynda; Kabamba, Joelle; Nguete, Beatrice; Likafi, Toutou; Balilo, Marcel Pie; Lushima, Robert Shongo; Malekani, Jean; Damon, Inger K.; Vickery, Michael C. L.; Pukuta, Elisabeth; Nkawa, Frida; Karhemere, Stomy; Tamfum, Jean-Jacques Muyembe; Okitolonda, Emile Wemakoy; Li, Yu; Reynolds, Mary G.

    2017-01-01

    Monkeypox virus (MPXV), a zoonotic orthopoxvirus (OPX), is endemic in the Democratic Republic of Congo (DRC). Currently, diagnostic assays for human monkeypox (MPX) focus on real-time quantitative polymerase chain reaction (PCR) assays, which are typically performed in sophisticated laboratory settings. Herein, we evaluated the accuracy and utility of a multiplex MPX assay using the GeneXpert platform, a portable rapid diagnostic device that may serve as a point-of-care test to diagnose infections in endemic areas. The multiplex MPX/OPX assay includes a MPX-specific PCR test, OPX-generic PCR test, and an internal control PCR test. In total, 164 diagnostic specimens (50 crusts and 114 vesicular swabs) were collected from suspected MPX cases in Tshuapa Province, DRC, under national surveillance guidelines. The specimens were tested with the GeneXpert MPX/OPX assay and an OPX PCR assay at the Institut National de Recherche Biomedicale (INRB) in Kinshasa. Aliquots of each specimen were tested in parallel with a MPX-specific PCR assay at the Centers for Disease Control and Prevention. The results of the MPX PCR were used as the gold standard for all analyses. The GeneXpert MPX/OPX assay performed at INRB had a sensitivity of 98.8% and specificity of 100%. The GeneXpert assay performed well with both crust and vesicle samples. The GeneXpert MPX/OPX test incorporates a simple methodology that performs well in both laboratory and field conditions, suggesting its viability as a diagnostic platform that may expand and expedite current MPX detection capabilities. PMID:27994107

  18. Assignment of adenosine deaminase complexing protein (ADCP) gene(s) to human chromosome 2 in rodent-human somatic cell hybrids.

    PubMed

    Herbschleb-Voogt, E; Grzeschik, K H; Pearson, P L; Meera Khan, P

    1981-01-01

    The experiments reported in this paper indicate that the expression of human adenosine deaminase complexing protein (ADCP) in the human-rodent somatic cell hybrids is influenced by the state of confluency of the cells and the background rodent genome. Thus, the complement of the L-cell derived A9 or B82 mouse parent apparently prevents the expression of human ADCP in the interspecific somatic cell hybrids. In the a3, E36, or RAG hybrids the human ADCP expression was not prevented by the rodent genome and was found to be proportional to the degree of confluency of the cell in the culture as in the case of primary human fibroblasts. An analysis of human chromosomes, chromosome specific enzyme markers, and ADCP in a panel of rodent-human somatic cell hybrids optimally maintained and harvested at full confluency has shown that the expression of human ADCP in the mouse (RAG)-human as well as in the hamster (E36 or a3)-human hybrids is determined by a gene(s) in human chromosome 2 and that neither chromosome 6 nor any other of the chromosomes of man carry any gene(s) involved in the formation of human ADCP at least in the Chinese hamster-human hybrids. A series of rodent-human hybrid clones exhibiting a mitotic separation of IDH1 and MDH1 indicated that ADCP is most probably situated between corresponding loci in human chromosome 2.

  19. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  20. Temperature impacts the multiple attack action of amylases.

    PubMed

    Bijttebier, Annabel; Goesaert, Hans; Delcour, Jan A

    2007-03-01

    The action pattern of several amylases was studied at 35, 50, and 70 degrees C using potato amylose, a soluble (Red Starch) and insoluble (cross-linked amylose) chromophoric substrate. With potato amylose as substrate, Bacillus stearothermophilus alpha-amylase (BStA) and porcine pancreatic alpha-amylase displayed a high degree of multiple attack (DMA, i.e., the number of bonds broken during the lifetime of an enzyme-substrate complex minus one), the fungal alpha-amylase from Aspergillus oryzae a low DMA, and the alpha-amylases from B. licheniformis, Thermoactinomyces vulgaris, B. amyloliquifaciens, and B. subtilis an intermediate DMA. These data are discussed in relation to structural properties of the enzymes. The level of multiple attack (LMA), based on the relation between the drop in iodine binding of amylose and the increase in total reducing value, proved to be a good alternative for DMA measurements. The LMA of the endo-amylases increased with temperature to a degree depending on the amylase. In contrast, BStA showed a decreased LMA when temperature was raised. Furthermore, different enzymes had different activities on Red Starch and cross-linked amylose. Hence, next to the temperature, the action pattern of alpha-amylases is influenced by structural parameters of the starch substrate.

  1. The Amylase Project: Creating a Classroom of Biotechnologists.

    ERIC Educational Resources Information Center

    Sweeney, Diane

    1998-01-01

    A biotechnologist-turned-teacher introduces a series of laboratory modules incorporating concepts from microbiology, cellular biology, molecular biology, biochemistry, and evolution. The Amylase Project aims to distill the biotechnology process into a few short steps using amylase, the easiest enzyme to detect of those commonly produced by…

  2. Aleppo tannin: structural analysis and salivary amylase inhibition.

    PubMed

    Zajácz, Agnes; Gyémánt, Gyöngyi; Vittori, Natale; Kandra, Lili

    2007-04-09

    The effectiveness and specificity of a tannin inhibition on human salivary amylase (HSA) catalyzed hydrolysis was studied using 2-chloro-4-nitrophenyl 4-O-beta-D-galactopyranosyl-alpha-maltoside (GalG(2)-CNP) and amylose substrates. Aleppo tannin was isolated from the gall nut of Aleppo oak. This tannin is a gallotannin, in which glucose is esterified with gallic acids. This is the first kinetic report, which details the inhibitory effects of this compound on HSA. A mixed non-competitive type inhibition has been observed on both substrates. The extent of inhibition is markedly dependent on the substrate-type. Kinetic constants were calculated from Lineweaver-Burk secondary plots for GalG(2)-CNP (K(EI) 0.82 microg mL(-1), K(ESI) 3.3 microg mL(-1)). This indicates a 1:1 binding ratio of inhibitor-enzyme and/or inhibitor-enzyme-substrate complex. When amylose was the substrate the binding ratio of inhibitor to enzyme-substrate complex was found to be 2:1, with the binding constants of K(EI) 17.4 microg mL(-1), K(ESI) 14.9 microg mL(-1), K(ESI(2)) 9.6 microg mL(-1). Presumably, the tannin inhibitor can bind not only to HSA, but to the amylose substrate, as well. Kinetic data suggest that Aleppo tannin is a more efficient amylase inhibitor than the recently studied other tannin with quinic acid core (GalG(2)-CNP: K(EI) 9.0 microg mL(-1), K(ESI) 47.9 microg mL(-1)).

  3. Comprehensive genomic characterization defines human glioblastoma genes and core pathways.

    PubMed

    2008-10-23

    Human cancer cells typically harbour multiple chromosomal aberrations, nucleotide substitutions and epigenetic modifications that drive malignant transformation. The Cancer Genome Atlas (TCGA) pilot project aims to assess the value of large-scale multi-dimensional analysis of these molecular characteristics in human cancer and to provide the data rapidly to the research community. Here we report the interim integrative analysis of DNA copy number, gene expression and DNA methylation aberrations in 206 glioblastomas--the most common type of adult brain cancer--and nucleotide sequence aberrations in 91 of the 206 glioblastomas. This analysis provides new insights into the roles of ERBB2, NF1 and TP53, uncovers frequent mutations of the phosphatidylinositol-3-OH kinase regulatory subunit gene PIK3R1, and provides a network view of the pathways altered in the development of glioblastoma. Furthermore, integration of mutation, DNA methylation and clinical treatment data reveals a link between MGMT promoter methylation and a hypermutator phenotype consequent to mismatch repair deficiency in treated glioblastomas, an observation with potential clinical implications. Together, these findings establish the feasibility and power of TCGA, demonstrating that it can rapidly expand knowledge of the molecular basis of cancer.

  4. The Family of Crumbs Genes and Human Disease

    PubMed Central

    Slavotinek, Anne M.

    2016-01-01

    The family of vertebrate Crumbs proteins, homologous to Drosophila Crumbs (Crb), share large extracellular domains with epidermal growth factor-like repeats and laminin-globular domains, a single transmembrane domain, and a short intracellular C-terminus containing a single membrane proximal 4.1/ezrin/radixin/moesin-binding domain and PSD-95/Discs large/ZO-1-binding motifs. There are 3 Crb genes in humans - Crumbs homolog-1 (CRB1), Crumbs homolog-2 (CRB2), and Crumbs homolog-3 (CRB3). Bilallelic loss-of-function mutations in CRB1 cause visual impairment, with Leber's congenital amaurosis and retinitis pigmentosa, whereas CRB2 mutations are associated with raised maternal serum and amniotic fluid alpha feto-protein levels, ventriculomegaly/hydrocephalus, and renal disease, ranging from focal segmental glomerulosclerosis to congenital Finnish nephrosis. CRB3 has not yet been associated with human disease. In this review, we summarize the phenotypic findings associated with deleterious sequence variants in CRB1 and CRB2. We discuss the mutational spectrum, animal models of loss of function for both genes and speculate on the likely mechanisms of disease. PMID:27867342

  5. Comprehensive genomic characterization defines human glioblastoma genes and core pathways

    PubMed Central

    2008-01-01

    Human cancer cells typically harbor multiple chromosomal aberrations, nucleotide substitutions and epigenetic modifications that drive malignant transformation. The Cancer Genome Atlas (TCGA) pilot project aims to assess the value of large-scale multidimensional analysis of these molecular characteristics in human cancer and to provide the data rapidly to the research community. Here, we report the interim integrative analysis of DNA copy number, gene expression and DNA methylation aberrations in 206 glioblastomas (GBM), the most common type of adult brain cancer, and nucleotide sequence aberrations in 91 of the 206 GBMs. This analysis provides new insights into the roles of ERBB2, NF1 and TP53, uncovers frequent mutations of the PI3 kinase regulatory subunit gene PIK3R1, and provides a network view of the pathways altered in the development of GBM. Furthermore, integration of mutation, DNA methylation and clinical treatment data reveals a link between MGMT promoter methylation and a hypermutator phenotype consequent to mismatch repair deficiency in treated glioblastomas, an observation with potential clinical implications. Together, these findings establish the feasibility and power of TCGA, demonstrating that it can rapidly expand knowledge of the molecular basis of cancer. PMID:18772890

  6. On the mechanism of alpha-amylase.

    PubMed

    Oudjeriouat, Naïma; Moreau, Yann; Santimone, Marius; Svensson, Birte; Marchis-Mouren, Guy; Desseaux, Véronique

    2003-10-01

    Two inhibitors, acarbose and cyclodextrins (CD), were used to investigate the active site structure and function of barley alpha-amylase isozymes, AMY1 and AMY2. The hydrolysis of DP 4900-amylose, reduced (r) DP18-maltodextrin and maltoheptaose (catalysed by AMY1 and AMY2) was followed in the absence and in the presence of inhibitor. Without inhibitor, the highest activity was obtained with amylose, kcat/Km decreased 103-fold using rDP18-maltodextrin and 10(5) to 10(6)-fold using maltoheptaose as substrate. Acarbose is an uncompetitive inhibitor with inhibition constant (L1i) for amylose and maltodextrin in the micromolar range. Acarbose did not bind to the active site of the enzyme, but to a secondary site to give an abortive ESI complex. Only AMY2 has a second secondary binding site corresponding to an ESI2 complex. In contrast, acarbose is a mixed noncompetitive inhibitor of maltoheptaose hydrolysis. Consequently, in the presence of this oligosaccharide substrate, acarbose bound both to the active site and to a secondary binding site. alpha-CD inhibited the AMY1 and AMY2 catalysed hydrolysis of amylose, but was a very weak inhibitor compared to acarbose.beta- and gamma-CD are not inhibitors. These results are different from those obtained previously with PPA. However in AMY1, as already shown for amylases of animal and bacterial origin, in addition to the active site, one secondary carbohydrate binding site (s1) was necessary for activity whereas two secondary sites (s1 and s2) were required for the AMY2 activity. The first secondary site in both AMY1 and AMY2 was only functional when substrate was bound in the active site. This appears to be a general feature of the alpha-amylase family.

  7. Measuring Escherichia coli Gene Expression during Human Urinary Tract Infections

    PubMed Central

    Mobley, Harry L. T.

    2016-01-01

    Extraintestinal Escherichia coli (E. coli) evolved by acquisition of pathogenicity islands, phage, plasmids, and DNA segments by horizontal gene transfer. Strains are heterogeneous but virulent uropathogenic isolates more often have specific fimbriae, toxins, and iron receptors than commensal strains. One may ask whether it is the virulence factors alone that are required to establish infection. While these virulence factors clearly contribute strongly to pathogenesis, bacteria must survive by metabolizing nutrients available to them. By constructing mutants in all major metabolic pathways and co-challenging mice transurethrally with each mutant and the wild type strain, we identified which major metabolic pathways are required to infect the urinary tract. We must also ask what else is E. coli doing in vivo? To answer this question, we examined the transcriptome of E. coli CFT073 in the murine model of urinary tract infection (UTI) as well as for E. coli strains collected and analyzed directly from the urine of patients attending either a urology clinic or a university health clinic for symptoms of UTI. Using microarrays and RNA-seq, we measured in vivo gene expression for these uropathogenic E. coli strains, identifying genes upregulated during murine and human UTI. Our findings allow us to propose a new definition of bacterial virulence. PMID:26784237

  8. THE IMPORTANCE OF DIETARY CARBOHYDRATE IN HUMAN EVOLUTION.

    PubMed

    Hardy, Karen; Brand-Miller, Jennie; Brown, Katherine D; Thomas, Mark G; Copeland, Les

    2015-09-01

    ABSTRACT We propose that plant foods containing high quantities of starch were essential for the evolution of the human phenotype during the Pleistocene. Although previous studies have highlighted a stone tool-mediated shift from primarily plant-based to primarily meat-based diets as critical in the development of the brain and other human traits, we argue that digestible carbohydrates were also necessary to accommodate the increased metabolic demands of a growing brain. Furthermore, we acknowledge the adaptive role cooking played in improving the digestibility and palatability of key carbohydrates. We provide evidence that cooked starch, a source of preformed glucose, greatly increased energy availability to human tissues with high glucose demands, such as the brain, red blood cells, and the developing fetus. We also highlight the auxiliary role copy number variation in the salivary amylase genes may have played in increasing the importance of starch in human evolution following the origins of cooking. Salivary amylases are largely ineffective on raw crystalline starch, but cooking substantially increases both their energy-yielding potential and glycemia. Although uncertainties remain regarding the antiquity of cooking and the origins of salivary amylase gene copy number variation, the hypothesis we present makes a testable prediction that these events are correlated.

  9. Human speech- and reading-related genes display partially overlapping expression patterns in the marmoset brain.

    PubMed

    Kato, Masaki; Okanoya, Kazuo; Koike, Taku; Sasaki, Erika; Okano, Hideyuki; Watanabe, Shigeru; Iriki, Atsushi

    2014-06-01

    Language is a characteristic feature of human communication. Several familial language impairments have been identified, and candidate genes for language impairments already isolated. Studies comparing expression patterns of these genes in human brain are necessary to further understanding of these genes. However, it is difficult to examine gene expression in human brain. In this study, we used a non-human primate (common marmoset; Callithrix jacchus) as a biological model of the human brain to investigate expression patterns of human speech- and reading-related genes. Expression patterns of speech disorder- (FoxP2, FoxP1, CNTNAP2, and CMIP) and dyslexia- (ROBO1, DCDC2, and KIAA0319) related genes were analyzed. We found the genes displayed overlapping expression patterns in the ocular, auditory, and motor systems. Our results enhance understanding of the molecular mechanisms underlying language impairments.

  10. Protein structures of common bean (Phaseolus vulgaris) alpha-amylase inhibitors.

    PubMed

    Lee, Shih-Chieh; Gepts, Paul L; Whitaker, John R

    2002-10-23

    Two nucleotide sequences for genes that encode alpha-amylase inhibitor 4 (alphaAI-4) from white kidney bean (WKB) cv. 858, designated gene alphaAI-4 (Accession No. ), and alpha-amylase inhibitor 5 (alphaAI-5) from black bean (BB), designated gene alphaAI-5 (Accession No. ), were determined. Genes alphaAI-4 and alphaAI-5 encode 244 amino acid prepro-alphaAI-4 and prepro-alphaAI-5 polypeptides that are 93 and 95% identical with alpha-amylase inhibitor l (alphaAI-l; Hoffman, L. M.; Ma, Y.; Barker, R. F. Nucleic Acids Res. 1982, 10, 7819-7828), 40 and 43% identical with red kidney bean lectin, and 52 and 55% identical with arcelin l of wild-type bean. The high degree of sequence similarity indicates the evolutionary relationship among these genes. PCR analysis of genomic DNA purified from six genotypes of Phaseolus vulgaris showed very similar band patterns in 2% agarose gel, another indication of the conserved size homology among these genes. Proteolytic processing sites were located between Asn77 and Ser78 for pro-alphaAI-4 and pro-alphaAI-5. A bend next to Asn77 in three-dimensional model structures of alphaAI-4 and alphaAI-5 proinhibitors indicates that the proteolytic cleavage is necessary to remove the conformational constraint for activation to the mature protein. Mature WKB alphaAI-4 was composed of four subunits (2alpha2beta) and had a molecular weight of 50000 determined by multiangle laser light scattering and 56714 determined by laser-assisted time-of-flight mass spectrometry.

  11. Public acceptance of human gene therapy and perceptions of human genetic manipulation.

    PubMed

    Macer, D R

    1992-10-01

    Clinical trials of gene therapy are underway in different countries, and further countries can be expected to use gene therapy soon. Little remains known, however, about public perceptions of gene therapy. Nationwide mail response opinion surveys were conducted in Japan in August-October, 1991. A total of 54% of the public, 65% of the high school biology teachers, and 54% of the scientists who responded said that they would be willing to use gene therapy, and 66%, 73%, and 62%, respectively, said that they would be willing to use gene therapy on their children. There appears to be growing acceptance of gene therapy in Japan, although about one-quarter of the population are against it. The underlying reasoning behind the acceptability of human genetic manipulation and perceived benefits and risks are presented, and these were found to be generally similar to reasoning expressed in a similar survey conducted in New Zealand in May, 1990. Public perceptions are also compared to those in Europe and the United States. People perceive both benefits and risks from genetic manipulation. There appears to be more teaching of ethical, social, and environmental issues associated with genetic engineering in senior high school biology classes in New Zealand than in Japan. In Japan and New Zealand, about 90% of the public would support including discussion of social issues associated with science and technology in the curriculum.

  12. Gene expression analysis of primary normal human hepatocytes infected with human hepatitis B virus

    PubMed Central

    Ryu, Hyun Mi; Park, Sung Gyoo; Yea, Sung Su; Jang, Won Hee; Yang, Young-Il; Jung, Guhung

    2006-01-01

    AIM: To find the relationship between hepatitis B virus (HBV) and hepatocytes during the initial state of infection by cDNA microarray. METHODS: Primary normal human hepatocytes (PNHHs) were isolated and infected with HBV. From the PNHHs, RNA was isolated and inverted into complement DNA (cDNA) with Cy3- or Cy5- labeled dUTP for microarray analysis. The labeled cDNA was hybridized with microarray chip, including 4224 cDNAs. From the image of the microarray, expression profiles were produced and some of them were confirmed by RT-PCR, immunoblot analysis, and NF-κB luciferase reporter assay. RESULTS: From the cDNA microarray, we obtained 98 differentially regulated genes. Of the 98 genes, 53 were up regulated and 45 down regulated. Interestingly, in the up regulated genes, we found the TNF signaling pathway-related genes: LT-α, TRAF2, and NIK. By using RT-PCR, we confirmed the up-regulation of these genes in HepG2, Huh7, and Chang liver cells, which were transfected with pHBV1.2×, a plasmid encoding all HBV messages. Moreover, these three genes participated in HBV-mediated NF-κB activation. CONCLUSION: During the initial state of HBV infection, hepatocytes facilitate the activation of NF-κB through up regulation of LT-α, TRAF2, and NIK. PMID:16937494

  13. α-Amylase inhibitory triterpene from Abrus precatorius leaves.

    PubMed

    Yonemoto, Ryuta; Shimada, Miyuki; Gunawan-Puteri, Maria D P T; Kato, Eisuke; Kawabata, Jun

    2014-08-20

    In the screening experiments for porcine pancreatic α-amylase inhibitors in 18 plants obtained from Indonesia, a potent inhibitory activity was detected in the extract of leaves of Abrus precatorius. The enzyme assay-guided fractionation of the extract led to the isolation of a triterpene ketone, lupenone (1), as a potent α-amylase inhibitor, together with 24-methylenecycloartenone (2) and luteolin (3). The mode of inhibition of compound 1 against porcine pancreatic α-amylase was a mixed inhibition. This is the first report that describes the potent α-amylase inhibitory activity of the low-polar triterpene ketone similar to compound 1. A comparison of the activities of the isolate and related compounds indicated the importance of C-3 ketone and the lupane skeleton in the α-amylase inhibitory activity.

  14. [Mechanism of amylase action on glucoside starch bonds].

    PubMed

    Zherebtsov, N A; Zabelina, L F; Ektoba, A I

    1976-12-01

    Functional groups of glucoamylase and alpha-amylase from Asp. awamori, alpha-amylase from Asp. oryzae and alpha- and beta-amylases from barley malt are identified. Kinetic curves of the activity dependency on pH, values of ionization heats and photooxidative inactivation draw to the conclusion that carboxyl-imidazole system enters into the active site of the enzymes. A hypothetic mechanism of hydrolysis of alpha-1,4-glucoside bond in starch molecule by alpha- and beta-amylases and of alpha-1,4- and alpha-1,6-glucoside bonds by glucoamylase is given. A theory of induced correspondence of enzyme and substrate satisfactorily explains the specificity of the enzyme action and the cause of complete starch convertion into glucose under glucoamylase action and of terminal starch hydrolysis by alpha- and beta-amylases.

  15. Human HST1 (HSTF1) gene maps to chromosome band 11q13 and coamplifies with the INT2 gene in human cancer.

    PubMed Central

    Yoshida, M C; Wada, M; Satoh, H; Yoshida, T; Sakamoto, H; Miyagawa, K; Yokota, J; Koda, T; Kakinuma, M; Sugimura, T

    1988-01-01

    The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. We have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of a panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene. Images PMID:3290903

  16. Large Scale Gene Expression Meta-Analysis Reveals Tissue-Specific, Sex-Biased Gene Expression in Humans

    PubMed Central

    Mayne, Benjamin T.; Bianco-Miotto, Tina; Buckberry, Sam; Breen, James; Clifton, Vicki; Shoubridge, Cheryl; Roberts, Claire T.

    2016-01-01

    The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analyzed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes), followed by the heart (375 genes), kidney (224 genes), colon (218 genes), and thyroid (163 genes). More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs, and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases. PMID:27790248

  17. Does the human X contain a third evolutionary block? Origin of genes on human Xp11 and Xq28.

    PubMed

    Delbridge, Margaret L; Patel, Hardip R; Waters, Paul D; McMillan, Daniel A; Marshall Graves, Jennifer A

    2009-08-01

    Comparative gene mapping of human X-borne genes in marsupials defined an ancient conserved region and a recently added region of the eutherian X, and the separate evolutionary origins of these regions was confirmed by their locations on chicken chromosomes 4p and 1q, respectively. However, two groups of genes, from the pericentric region of the short arm of the human X (at Xp11) and a large group of genes from human Xq28, were thought to be part of a third evolutionary block, being located in a single region in fish, but mapping to chicken chromosomes other than 4p and 1q. We tested this hypothesis by comparative mapping of genes in these regions. Our gene mapping results show that human Xp11 genes are located on the marsupial X chromosome and platypus chromosome 6, indicating that the Xp11 region was part of original therian X chromosome. We investigated the evolutionary origin of genes from human Xp11 and Xq28, finding that chicken paralogs of human Xp11 and Xq28 genes had been misidentified as orthologs, and their true orthologs are represented in the chicken EST database, but not in the current chicken genome assembly. This completely undermines the evidence supporting a separate evolutionary origin for this region of the human X chromosome, and we conclude, instead, that it was part of the ancient autosome, which became the conserved region of the therian X chromosome 166 million years ago.

  18. Age distribution patterns of human gene families: divergent for Gene Ontology categories and concordant between different subcellular localizations.

    PubMed

    Liu, Gangbiao; Zou, Yangyun; Cheng, Qiqun; Zeng, Yanwu; Gu, Xun; Su, Zhixi

    2014-04-01

    The age distribution of gene duplication events within the human genome exhibits two waves of duplications along with an ancient component. However, because of functional constraint differences, genes in different functional categories might show dissimilar retention patterns after duplication. It is known that genes in some functional categories are highly duplicated in the early stage of vertebrate evolution. However, the correlations of the age distribution pattern of gene duplication between the different functional categories are still unknown. To investigate this issue, we developed a robust pipeline to date the gene duplication events in the human genome. We successfully estimated about three-quarters of the duplication events within the human genome, along with the age distribution pattern in each Gene Ontology (GO) slim category. We found that some GO slim categories show different distribution patterns when compared to the whole genome. Further hierarchical clustering of the GO slim functional categories enabled grouping into two main clusters. We found that human genes located in the duplicated copy number variant regions, whose duplicate genes have not been fixed in the human population, were mainly enriched in the groups with a high proportion of recently duplicated genes. Moreover, we used a phylogenetic tree-based method to date the age of duplications in three signaling-related gene superfamilies: transcription factors, protein kinases and G-protein coupled receptors. These superfamilies were expressed in different subcellular localizations. They showed a similar age distribution as the signaling-related GO slim categories. We also compared the differences between the age distributions of gene duplications in multiple subcellular localizations. We found that the distribution patterns of the major subcellular localizations were similar to that of the whole genome. This study revealed the whole picture of the evolution patterns of gene functional

  19. Precise and in situ genetic humanization of 6 Mb of mouse immunoglobulin genes.

    PubMed

    Macdonald, Lynn E; Karow, Margaret; Stevens, Sean; Auerbach, Wojtek; Poueymirou, William T; Yasenchak, Jason; Frendewey, David; Valenzuela, David M; Giallourakis, Cosmas C; Alt, Frederick W; Yancopoulos, George D; Murphy, Andrew J

    2014-04-08

    Genetic humanization, which involves replacing mouse genes with their human counterparts, can create powerful animal models for the study of human genes and diseases. One important example of genetic humanization involves mice humanized for their Ig genes, allowing for human antibody responses within a mouse background (HumAb mice) and also providing a valuable platform for the generation of fully human antibodies as therapeutics. However, existing HumAb mice do not have fully functional immune systems, perhaps because of the manner in which they were genetically humanized. Heretofore, most genetic humanizations have involved disruption of the endogenous mouse gene with simultaneous introduction of a human transgene at a new and random location (so-called KO-plus-transgenic humanization). More recent efforts have attempted to replace mouse genes with their human counterparts at the same genetic location (in situ humanization), but such efforts involved laborious procedures and were limited in size and precision. We describe a general and efficient method for very large, in situ, and precise genetic humanization using large compound bacterial artificial chromosome-based targeting vectors introduced into mouse ES cells. We applied this method to genetically humanize 3-Mb segments of both the mouse heavy and κ light chain Ig loci, by far the largest genetic humanizations ever described. This paper provides a detailed description of our genetic humanization approach, and the companion paper reports that the humoral immune systems of mice bearing these genetically humanized loci function as efficiently as those of WT mice.

  20. Complete Genes May Pass from Food to Human Blood

    PubMed Central

    Spisák, Sándor; Solymosi, Norbert; Ittzés, Péter; Bodor, András; Kondor, Dániel; Vattay, Gábor; Barták, Barbara K.; Sipos, Ferenc; Galamb, Orsolya; Tulassay, Zsolt; Szállási, Zoltán; Rasmussen, Simon; Sicheritz-Ponten, Thomas; Brunak, Søren; Molnár, Béla; Csabai, István

    2013-01-01

    Our bloodstream is considered to be an environment well separated from the outside world and the digestive tract. According to the standard paradigm large macromolecules consumed with food cannot pass directly to the circulatory system. During digestion proteins and DNA are thought to be degraded into small constituents, amino acids and nucleic acids, respectively, and then absorbed by a complex active process and distributed to various parts of the body through the circulation system. Here, based on the analysis of over 1000 human samples from four independent studies, we report evidence that meal-derived DNA fragments which are large enough to carry complete genes can avoid degradation and through an unknown mechanism enter the human circulation system. In one of the blood samples the relative concentration of plant DNA is higher than the human DNA. The plant DNA concentration shows a surprisingly precise log-normal distribution in the plasma samples while non-plasma (cord blood) control sample was found to be free of plant DNA. PMID:23936105

  1. G protein-cAMP signaling pathway mediated by PGA3 plays different roles in regulating the expressions of amylases and cellulases in Penicillium decumbens.

    PubMed

    Hu, Yibo; Liu, Guodong; Li, Zhonghai; Qin, Yuqi; Qu, Yinbo; Song, Xin

    2013-01-01

    Heterotrimeric G proteins (G proteins) have been extensively investigated for their regulatory functions in morphogenesis and development in filamentous fungi. In addition, G proteins were also shown to be involved in the regulation of cellulase expression in some fungi. Here, we report the different regulatory effects of PGA3, a group III G protein α subunit, on the expressions of amylases and cellulases in Penicillium decumbens. Deletion of pga3 resulted in impaired amylase production and significantly decreased transcription of the major amylase gene amy15A. Supplementation of exogenous cAMP or its analog dibutyryl-cAMP restored amylase production in Δpga3 strain, suggesting an essential role of PGA3 in amylase synthesis via controlling cAMP level. On the other hand, the transcription of major cellulase gene cel7A-2 increased, nevertheless cellulase activity in the medium was not affected, in Δpga3. The above regulatory effects of PGA3 are carbon source-independent, and are achieved, at least, by cAMP-mediated regulation of the expression level of transcription factor AmyR. The functions of PGA3 revealed by gene deletion were partially supported by the analysis of the mutant carrying dominantly-activated PGA3. The results provided new insights into the understanding of the physiological functions of G protein-cAMP pathway in filamentous fungi.

  2. Compositional features are potentially involved in the regulation of gene expression of tumor suppressor genes in human tissues.

    PubMed

    Hajjari, Mohammadreza; Khoshnevisan, Atefeh; Behmanesh, Mehrdad

    2014-12-15

    Different mechanisms regulate the expression level of tissue specific genes in human. Here we report some compositional features such as codon usage bias, amino acid usage bias, codon frequency, and base composition which may be potentially related to mRNA amount of tissue specific tumor suppressor genes. Our findings support the possibility that structural elements in gene and protein may play an important role in the regulation of tumor suppressor genes, development, and tumorigenesis. The data presented here can open broad vistas in the understanding and treatment of a variety of human malignancies.

  3. GeneBase 1.1: a tool to summarize data from NCBI gene datasets and its application to an update of human gene statistics.

    PubMed

    Piovesan, Allison; Caracausi, Maria; Antonaros, Francesca; Pelleri, Maria Chiara; Vitale, Lorenza

    2016-01-01

    We release GeneBase 1.1, a local tool with a graphical interface useful for parsing, structuring and indexing data from the National Center for Biotechnology Information (NCBI) Gene data bank. Compared to its predecessor GeneBase (1.0), GeneBase 1.1 now allows dynamic calculation and summarization in terms of median, mean, standard deviation and total for many quantitative parameters associated with genes, gene transcripts and gene features (exons, introns, coding sequences, untranslated regions). GeneBase 1.1 thus offers the opportunity to perform analyses of the main gene structure parameters also following the search for any set of genes with the desired characteristics, allowing unique functionalities not provided by the NCBI Gene itself. In order to show the potential of our tool for local parsing, structuring and dynamic summarizing of publicly available databases for data retrieval, analysis and testing of biological hypotheses, we provide as a sample application a revised set of statistics for human nuclear genes, gene transcripts and gene features. In contrast with previous estimations strongly underestimating the length of human genes, a 'mean' human protein-coding gene is 67 kbp long, has eleven 309 bp long exons and ten 6355 bp long introns. Median, mean and extreme values are provided for many other features offering an updated reference source for human genome studies, data useful to set parameters for bioinformatic tools and interesting clues to the biomedical meaning of the gene features themselves.Database URL: http://apollo11.isto.unibo.it/software/.

  4. GeneBase 1.1: a tool to summarize data from NCBI gene datasets and its application to an update of human gene statistics

    PubMed Central

    Piovesan, Allison; Caracausi, Maria; Antonaros, Francesca; Pelleri, Maria Chiara; Vitale, Lorenza

    2016-01-01

    We release GeneBase 1.1, a local tool with a graphical interface useful for parsing, structuring and indexing data from the National Center for Biotechnology Information (NCBI) Gene data bank. Compared to its predecessor GeneBase (1.0), GeneBase 1.1 now allows dynamic calculation and summarization in terms of median, mean, standard deviation and total for many quantitative parameters associated with genes, gene transcripts and gene features (exons, introns, coding sequences, untranslated regions). GeneBase 1.1 thus offers the opportunity to perform analyses of the main gene structure parameters also following the search for any set of genes with the desired characteristics, allowing unique functionalities not provided by the NCBI Gene itself. In order to show the potential of our tool for local parsing, structuring and dynamic summarizing of publicly available databases for data retrieval, analysis and testing of biological hypotheses, we provide as a sample application a revised set of statistics for human nuclear genes, gene transcripts and gene features. In contrast with previous estimations strongly underestimating the length of human genes, a ‘mean’ human protein-coding gene is 67 kbp long, has eleven 309 bp long exons and ten 6355 bp long introns. Median, mean and extreme values are provided for many other features offering an updated reference source for human genome studies, data useful to set parameters for bioinformatic tools and interesting clues to the biomedical meaning of the gene features themselves. Database URL: http://apollo11.isto.unibo.it/software/ PMID:28025344

  5. The human homolog of a mouse-imprinted gene, Peg3, maps to a zinc finger gene-rich region of human chromosome 19q13.4.

    PubMed

    Kim, J; Ashworth, L; Branscomb, E; Stubbs, L

    1997-05-01

    Peg3 (paternally expressed gene 3) is the first imprinted gene detected in the proximal region of mouse chromosome 7. Because imprinting is a trait that is generally conserved among mammals, and imprinted domains generally encompass several adjacent genes, expression patterns and chromosomal environment of the human counterpart of Peg3 are of special interest. In this study we have localized human PEG3 approximately 2 Mb proximal of the telomere of chromosome 19q, within a region known to carry large numbers of tandemly clustered Krüppel-type zinc finger-containing (ZNF) genes. Peg3 also encodes a Krüppel-type ZNF protein but one that is distinguished from other ZNF gene products by the fact that it carries two novel proline-rich motifs. Comparison between mouse Peg3 and partial human PEG3 gene sequences revealed a high level of conservation between the two species, despite the fact that one of the two proline-rich repeats is absent from the human gene. Our data demonstrate that the human gene is expressed at highest levels in ovary and placenta; mouse Peg3, by contrast, is transcribed at highest levels in the adult brain. These comparative mapping, sequencing, and expression data provide the first clues to the potential activities of PEG3, and generate new tools to aid in the analysis of structure and function of a potentially new imprinted domain located in human chromosome 19q13.4 and mouse chromosome 7.

  6. Pressure-natriuresis and -diuresis in transgenic rats harboring both human renin and human angiotensinogen genes.

    PubMed

    Dehmel, B; Mervaala, E; Lippoldt, A; Gross, V; Bohlender, J; Ganten, D; Luft, F C

    1998-12-01

    The hypertensive double transgenic rat harboring both the human renin and human angiotensinogen genes (dTGR) offers a unique opportunity to study the human renin-angiotensin system in an experimental animal model. Since nothing is known about the control of sodium and water excretion in these rats, this study was performed to compare pressure-natriuresis relationships in hypertensive dTGR and normotensive control rats harboring only the human renin gene (hREN), in order to determine how the pressure-natriuresis relationship is reset in hypertensive dTGR. To differentiate between extrinsic and intrinsic renal mechanisms, experiments were performed with and without renal denervation, and with and without infusions of vasopressin, norepinephrine, 17-OH-corticosterone, and aldosterone. Human and rat angiotensinogen and renin mRNA expression were also determined. In hREN without controlled renal function, urine flow and sodium excretion increased from 13 to 169 microl/min per g kidney wet weight (kwt) and from 1 to 30 micromol/min per g kwt, respectively, as renal perfusion pressure was increased from 67 to 135 mmHg. Renal blood flow (RBF) and GFR ranged between 3 to 7 and 0.9 to 1.5 ml/min per g kwt. In dTGR, pressure-natriuresis-diuresis relationships were shifted approximately 40 mmHg rightward. RBF was lower in dTGR than in hREN; GFR was not different. In dTGR with neurohormonal factors controlled, RBF was decreased and pressure-natriuresis-diuresis curves were not different compared to dTGR curves without these interventions. By light microscopy, the kidneys of these 6-wk-old dTGR and hREN rats were normal and indistinguishable. Both human and rat renin and angiotensinogen mRNA were expressed in the kidneys of dTGR. The two renin mRNA were decreased in dTGR, indicating a physiologic downregulation of renin gene expression by high BP. It is concluded that the renal pressure-natriuresis mechanism is reset toward higher pressure levels in dTGR and participates in the

  7. Epigenetic regulation of the RHOX homeobox gene cluster and its association with human male infertility.

    PubMed

    Richardson, Marcy E; Bleiziffer, Andreas; Tüttelmann, Frank; Gromoll, Jörg; Wilkinson, Miles F

    2014-01-01

    The X-linked RHOX cluster encodes a set of homeobox genes that are selectively expressed in the reproductive tract. Members of the RHOX cluster regulate target genes important for spermatogenesis promote male fertility in mice. Studies show that demethylating agents strongly upregulate the expression of mouse Rhox genes, suggesting that they are regulated by DNA methylation. However, whether this extends to human RHOX genes, whether DNA methylation directly regulates RHOX gene transcription and how this relates to human male infertility are unknown. To address these issues, we first defined the promoter regions of human RHOX genes and performed gain- and loss-of-function experiments to determine whether human RHOX gene transcription is regulated by DNA methylation. Our results indicated that DNA methylation is necessary and sufficient to silence human RHOX gene expression. To determine whether RHOX cluster methylation associates with male infertility, we evaluated the methylation status of RHOX genes in sperm from a large cohort of infertility patients. Linear regression analysis revealed a strong association between RHOX gene cluster hypermethylation and three independent types of semen abnormalities. Hypermethylation was restricted specifically to the RHOX cluster; we did not observe it in genes immediately adjacent to it on the X chromosome. Our results strongly suggest that human RHOX homeobox genes are under an epigenetic control mechanism that is aberrantly regulated in infertility patients. We propose that hypermethylation of the RHOX gene cluster serves as a marker for idiopathic infertility and that it is a candidate to exert a causal role in male infertility.

  8. Gene copy number variation spanning 60 million years of human and primate evolution

    PubMed Central

    Dumas, Laura; Kim, Young H.; Karimpour-Fard, Anis; Cox, Michael; Hopkins, Janet; Pollack, Jonathan R.; Sikela, James M.

    2007-01-01

    Given the evolutionary importance of gene duplication to the emergence of species-specific traits, we have extended the application of cDNA array-based comparative genomic hybridization (aCGH) to survey gene duplications and losses genome-wide across 10 primate species, including human. Using human cDNA arrays that contained 41,126 cDNAs, corresponding to 24,473 unique human genes, we identified 4159 genes that likely represent most of the major lineage-specific gene copy number gains and losses that have occurred in these species over the past 60 million years. We analyzed 1,233,780 gene-to-gene data points and found that gene gains typically outnumbered losses (ratio of gains/losses = 2.34) and these frequently cluster in complex and dynamic genomic regions that are likely to serve as gene nurseries. Almost one-third of all human genes (6696) exhibit an aCGH- predicted change in copy number in one or more of these species, and within-species gene amplification is also evident. Many of the genes identified here are likely to be important to lineage-specific traits including, for example, human-specific duplications of the AQP7 gene, which represent intriguing candidates to underlie the key physiological adaptations in thermoregulation and energy utilization that permitted human endurance running. PMID:17666543

  9. Activity and storage of commercial amylases in the 2013 Louisiana grinding season

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A current problem in the application of amylases at sugarcane factories is the existence of a wide variation in the activities and activity per unit cost of commercial amylases. The efficiency of amylase action to break down starch in the factory is related to the activity of the amylase used. Until...

  10. Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

    SciTech Connect

    Tucker, James D.; Joiner, Michael C.; Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V.; Chinkhota, Chantelle N.; Smolinski, Joseph M.; Divine, George W.; Auner, Gregory W.

    2014-03-15

    Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

  11. Single base resolution analysis of 5-hydroxymethylcytosine in 188 human genes: implications for hepatic gene expression

    PubMed Central

    Ivanov, Maxim; Kals, Mart; Lauschke, Volker; Barragan, Isabel; Ewels, Philip; Käller, Max; Axelsson, Tomas; Lehtiö, Janne; Milani, Lili; Ingelman-Sundberg, Magnus

    2016-01-01

    To improve the epigenomic analysis of tissues rich in 5-hydroxymethylcytosine (hmC), we developed a novel protocol called TAB-Methyl-SEQ, which allows for single base resolution profiling of both hmC and 5-methylcytosine by targeted next-generation sequencing. TAB-Methyl-SEQ data were extensively validated by a set of five methodologically different protocols. Importantly, these extensive cross-comparisons revealed that protocols based on Tet1-assisted bisulfite conversion provided more precise hmC values than TrueMethyl-based methods. A total of 109 454 CpG sites were analyzed by TAB-Methyl-SEQ for mC and hmC in 188 genes from 20 different adult human livers. We describe three types of variability of hepatic hmC profiles: (i) sample-specific variability at 40.8% of CpG sites analyzed, where the local hmC values correlate to the global hmC content of livers (measured by LC-MS), (ii) gene-specific variability, where hmC levels in the coding regions positively correlate to expression of the respective gene and (iii) site-specific variability, where prominent hmC peaks span only 1 to 3 neighboring CpG sites. Our data suggest that both the gene- and site-specific components of hmC variability might contribute to the epigenetic control of hepatic genes. The protocol described here should be useful for targeted DNA analysis in a variety of applications. PMID:27131363

  12. Sequence analysis of the ERCC2 gene regions in human, mouse, and hamster reveals three linked genes

    SciTech Connect

    Lamerdin, J.E.; Stilwagen, S.A.; Ramirez, M.H.

    1996-06-15

    The ERCC2 (excision repair cross-complementing rodent repair group 2) gene product is involved in transcription-coupled repair as an integral member of the basal transcription factor BTF2/TFIIH complex. Defects in this gene can result in three distinct human disorders, namely the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. We report the comparative analysis of 91.6 kb of new sequence including 54.3 kb encompassing the human ERCC2 locus, the syntenic region in the mouse (32.6 kb), and a further 4.7 kb of sequence 3{prime} of the previously reported ERCC2 region in the hamster. In addition to ERCC2, our analysis revealed the presence of two previously undescribed genes in all three species. The first is centromeric (in the human) to ERCC2 and is most similar to the kinesin light chain gene in sea urchin. The second gene is telomeric (in the human) to ERCC2 and contains a motif found in ankyrins, some cell proteins, and transcription factors. Multiple EST matches to this putative new gene indicate that it is expressed in several human tissues, including breast. The identification and description of two new genes provides potential candidate genes for disorders mapping to this region of 19q13.2. 42 refs., 6 figs., 3 tabs.

  13. Sequence analysis of the ERCC2 gene regions in human, mouse, and hamster reveals three linked genes.

    PubMed

    Lamerdin, J E; Stilwagen, S A; Ramirez, M H; Stubbs, L; Carrano, A V

    1996-06-15

    The ERCC2 (excision repair cross-complementing rodent repair group 2) gene product is involved in transcription-coupled repair as an integral member of the basal transcription factor BTF2/TFIIH complex. Defects in this gene can result in three distinct human disorders, namely the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. We report the comparative analysis of 91.6 kb of new sequence including 54.3 kb encompassing the human ERCC2 locus, the syntenic region in the mouse (32.6 kb), and a further 4.7 kb of sequence 3' of the previously reported ERCC2 region in the hamster. In addition to ERCC2, our analysis revealed the presence of two previously undescribed genes in all three species. The first is centromeric (in the human) to ERCC2 and is most similar to the kinesin light chain gene in sea urchin. The second gene is telomeric (in the human) to ERCC2 and contains a motif found in ankyrins, some cell cycle proteins, and transcription factors. Multiple EST matches to this putative new gene indicate that it is expressed in several human tissues, including breast. The identification and description of two new genes provides potential candidate genes for disorders mapping to this region of 19q13.2.

  14. Characterization and target genes of nine human PRD-like homeobox domain genes expressed exclusively in early embryos

    PubMed Central

    Madissoon, Elo; Jouhilahti, Eeva-Mari; Vesterlund, Liselotte; Töhönen, Virpi; Krjutškov, Kaarel; Petropoulous, Sophie; Einarsdottir, Elisabet; Linnarsson, Sten; Lanner, Fredrik; Månsson, Robert; Hovatta, Outi; Bürglin, Thomas R.; Katayama, Shintaro; Kere, Juha

    2016-01-01

    PAIRED (PRD)-like homeobox genes belong to a class of predicted transcription factor genes. Several of these PRD-like homeobox genes have been predicted in silico from genomic sequence but until recently had no evidence of transcript expression. We found recently that nine PRD-like homeobox genes, ARGFX, CPHX1, CPHX2, DPRX, DUXA, DUXB, NOBOX, TPRX1 and TPRX2, were expressed in human preimplantation embryos. In the current study we characterized these PRD-like homeobox genes in depth and studied their functions as transcription factors. We cloned multiple transcript variants from human embryos and showed that the expression of these genes is specific to embryos and pluripotent stem cells. Overexpression of the genes in human embryonic stem cells confirmed their roles as transcription factors as either activators (CPHX1, CPHX2, ARGFX) or repressors (DPRX, DUXA, TPRX2) with distinct targets that could be explained by the amino acid sequence in homeodomain. Some PRD-like homeodomain transcription factors had high concordance of target genes and showed enrichment for both developmentally important gene sets and a 36 bp DNA recognition motif implicated in Embryo Genome Activation (EGA). Our data implicate a role for these previously uncharacterized PRD-like homeodomain proteins in the regulation of human embryo genome activation and preimplantation embryo development. PMID:27412763

  15. Human enteric defensins. Gene structure and developmental expression.

    PubMed

    Mallow, E B; Harris, A; Salzman, N; Russell, J P; DeBerardinis, R J; Ruchelli, E; Bevins, C L

    1996-02-23

    Paneth cells, secretory epithelial cells of the small intestinal crypts, are proposed to contribute to local host defense. Both mouse and human Paneth cells express a collection of antimicrobial proteins, including members of a family of antimicrobial peptides named defensins. In this study, data from an anchored polymerase chain reaction (PCR) strategy suggest that only two defensin mRNA isoforms are expressed in the human small intestine, far fewer than the number expressed in the mouse. The two isoforms detected by this PCR approach were human defensin family members, HD-5 and HD-6. The gene encoding HD-6 was cloned and characterized. HD-6 has a genomic organization similar to HD-5, and the two genes have a striking pattern of sequence similarity localized chiefly in their proximal 5'-flanking regions. Analysis of human fetal RNA by reverse transcriptase-PCR detected enteric defensin HD-5 mRNA at 13.5 weeks of gestation in the small intestine and the colon, but by 17 weeks HD-5 was restricted to the small intestine. HD-6 mRNA was detectable at 13.5-17 weeks of gestation in the small intestine but not in the colon. This pattern of expression coincides with the previously described appearance of Paneth cells as determined by ultrastructural approaches. Northern analysis of total RNA from small intestine revealed quantifiable enteric defensin mRNA in five samples from 19 24 weeks of gestation at levels approximately 40-250-fold less than those observed in the adult, with HD-5 mRNA levels greater than those of HD-6 in all samples. In situ hybridization analysis localized expression of enteric defensin mRNA to Paneth cells at 24 weeks of gestation, as is seen in the newborn term infant and the adult. Consistent with earlier morphological studies, the ratio of Paneth cell number per crypt was reduced in samples at 24 weeks of gestation compared with the adult, and this lower cell number partially accounts for the lower defensin mRNA levels as determined by Northern

  16. Ape parasite origins of human malaria virulence genes

    PubMed Central

    Larremore, Daniel B.; Sundararaman, Sesh A.; Liu, Weimin; Proto, William R.; Clauset, Aaron; Loy, Dorothy E.; Speede, Sheri; Plenderleith, Lindsey J.; Sharp, Paul M.; Hahn, Beatrice H.; Rayner, Julian C.; Buckee, Caroline O.

    2015-01-01

    Antigens encoded by the var gene family are major virulence factors of the human malaria parasite Plasmodium falciparum, exhibiting enormous intra- and interstrain diversity. Here we use network analysis to show that var architecture and mosaicism are conserved at multiple levels across the Laverania subgenus, based on var-like sequences from eight single-species and three multi-species Plasmodium infections of wild-living or sanctuary African apes. Using select whole-genome amplification, we also find evidence of multi-domain var structure and synteny in Plasmodium gaboni, one of the ape Laverania species most distantly related to P. falciparum, as well as a new class of Duffy-binding-like domains. These findings indicate that the modular genetic architecture and sequence diversity underlying var-mediated host-parasite interactions evolved before the radiation of the Laverania subgenus, long before the emergence of P. falciparum. PMID:26456841

  17. Transgenic cowpea (Vigna unguiculata) seeds expressing a bean alpha-amylase inhibitor 1 confer resistance to storage pests, bruchid beetles.

    PubMed

    Solleti, Siva Kumar; Bakshi, Souvika; Purkayastha, Jubilee; Panda, Sanjib Kumar; Sahoo, Lingaraj

    2008-12-01

    Cowpea is one of the important grain legumes. Storage pests, Callosobruchus maculatus and C. chinensis cause severe damage to the cowpea seeds during storage. We employ a highly efficient Agrobacterium-mediated cowpea transformation method for introduction of the bean (Phaseolus vulgaris) alpha-amylase inhibitor-1 (alphaAI-1) gene into a commercially important Indian cowpea cultivar, Pusa Komal and generated fertile transgenic plants. The use of constitutive expression of additional vir genes in resident pSB1 vector in Agrobacterium strain LBA4404, thiol compounds during cocultivation and a geneticin based selection system resulted in twofold increase in stable transformation frequency. Expression of alphaAI-1 gene under bean phytohemagglutinin promoter results in accumulation of alphaAI-1 in transgenic seeds. The transgenic protein was active as an inhibitor of porcine alpha-amylase in vitro. Transgenic cowpeas expressing alphaAI-1 strongly inhibited the development of C. maculatus and C. chinensis in insect bioassays.

  18. Bacillus thuringiensis HCB6 Amylase Immobilization by Chitosan Beads

    NASA Astrophysics Data System (ADS)

    Zusfahair; Ningsih, D. R.; Kartika, D.; Fatoni, A.; Zuliana, A. L.

    2017-02-01

    The purpose of this study was to optimize the amylase immobilization using a chitosan bead and to characterize immobilized amylase of Bacillus thuringiensis Bacteria HCB6. This study was started of amylase production, continued by immobilization optimization including ratio of chitosan:enzymes, enzyme-matrix contact time, substrate concentration, pH effect, incubation temperature effect, reaction time, and stability of immobilized enzyme. Amylase activity assay was dinitro salicylic (DNS) method. The results showed the optimum chitosan:enzyme ratio was 2.5: 1 (v/v), immobilization contact time of 18 hours and immobilization efficiency of 87.93%. Furthermore, immobilized amylase of B. thuringiensis HCB6 showed optimum substrate concentration of 1.5%, optimum pH of 6, optimum incubation temperature of 37 ° C, and the reaction time of 30 minutes. The Michaelis-Menten constant KM value for free and immobilized amylase were 5.30% and 1.33% respectively. Immobilized amylase can be used up to five times with the remaining activity of 43.3%.

  19. Antiviral Cystine Knot α-Amylase Inhibitors from Alstonia scholaris*

    PubMed Central

    Nguyen, Phuong Quoc Thuc; Ooi, Justin Seng Geap; Nguyen, Ngan Thi Kim; Wang, Shujing; Huang, Mei; Liu, Ding Xiang; Tam, James P.

    2015-01-01

    Cystine knot α-amylase inhibitors are cysteine-rich, proline-rich peptides found in the Amaranthaceae and Apocynaceae plant species. They are characterized by a pseudocyclic backbone with two to four prolines and three disulfides arranged in a knotted motif. Similar to other knottins, cystine knot α-amylase inhibitors are highly resistant to degradation by heat and protease treatments. Thus far, only the α-amylase inhibition activity has been described for members of this family. Here, we show that cystine knot α-amylase inhibitors named alstotides discovered from the Alstonia scholaris plant of the Apocynaceae family display antiviral activity. The alstotides (As1–As4) were characterized by both proteomic and genomic methods. All four alsotides are novel, heat-stable and enzyme-stable and contain 30 residues. NMR determination of As1 and As4 structures reveals their conserved structural fold and the presence of one or more cis-proline bonds, characteristics shared by other cystine knot α-amylase inhibitors. Genomic analysis showed that they contain a three-domain precursor, an arrangement common to other knottins. We also showed that alstotides are antiviral and cell-permeable to inhibit the early phase of infectious bronchitis virus and Dengue infection, in addition to their ability to inhibit α-amylase. Taken together, our results expand membership of cystine knot α-amylase inhibitors in the Apocynaceae family and their bioactivity, functional promiscuity that could be exploited as leads in developing therapeutics. PMID:26546678

  20. Activity and cellular localization of amylases of rabbit cecal bacteria.

    PubMed

    Sirotek, K; Marounek, M; Suchorská, O

    2006-01-01

    Five 11-week-old rabbits, fed a commercial granulated feed, were slaughtered and cecal starch-degrading bacteria enumerated; total concentration of cultivable bacteria utilizing starch averaged 5.5 x 10(10) CFU/g. The activity and cellular localization of amylases was determined in 9 bacteria identified as Actinomyces israeli (strains AA2 and AD4), Bacteroides spp. (strain AA3), Dichelobacter nodosus (strain AA4), Mitsuokella multiacidus (strain AA6), Eubacterium spp. (strains AA7 and AB2), Clostridium spp. (strains AD1 and AA5). Four strains (AA3, AA4, AA5, AD4) produced extracellular amylases with an activity of 26-35 micromol of reducing sugars per h per mg of protein; in five strains (AA2, AA6, AA7, AB2, AD1) amylases were membrane-bound with an activity of 14-18 micromol of reducing sugars per h per mg of protein. All strains exhibited a low intracellular amylolytic activity. The pH optimum of amylases was 6.8-7.0. In strains producing extracellular amylases a substantial loss of viscosity was observed during incubations of cultivation supernatant with starch, similar to viscosity reduction in starch solutions treated with alpha-amylase; this indicates an endo-type (random cleavage) of extracellular amylase reaction in the bacteria under study. No strain possessed glucoamylase activity.

  1. Investigating different duplication pattern of essential genes in mouse and human.

    PubMed

    Acharya, Debarun; Mukherjee, Dola; Podder, Soumita; Ghosh, Tapash C

    2015-01-01

    Gene duplication is one of the major driving forces shaping genome and organism evolution and thought to be itself regulated by some intrinsic properties of the gene. Comparing the essential genes among mouse and human, we observed that the essential genes avoid duplication in mouse while prefer to remain duplicated in humans. In this study, we wanted to explore the reasons behind such differences in gene essentiality by cross-species comparison of human and mouse. Moreover, we examined essential genes that are duplicated in humans are functionally more redundant than that in mouse. The proportion of paralog pseudogenization of essential genes is higher in mouse than that of humans. These duplicates of essential genes are under stringent dosage regulation in human than in mouse. We also observed slower evolutionary rate in the paralogs of human essential genes than the mouse counterpart. Together, these results clearly indicate that human essential genes are retained as duplicates to serve as backed up copies that may shield themselves from harmful mutations.

  2. Expression of MAGE-1 and -3 genes and gene products in human hepatocellular carcinoma

    PubMed Central

    Kariyama, K; Higashi, T; Kobayashi, Y; Nouso, K; Nakatsukasa, H; Yamano, T; Ishizaki, M; Kaneyoshi, T; Toshikuni, N; Ohnishi, T; Fujiwara, K; Nakayama, E; Terracciano, L; Spagnoli, G C; Tsuji, T

    1999-01-01

    MAGE gene family encodes peptides recognized by autologous cytotoxic T lymphocytes in a major histocompatibility complex (MHC) class-I restricted fashion. In the present study, we have performed reverse-transcription polymerase chain reaction (RT-PCR) for the genes, as well as immunohistochemical analysis and Western blotting of MAGE-1 and -3 proteins in 33 surgically resected hepatocellular carcinomas (HCCs). MAGE-1 and -3 mRNAs were constitutively expressed exclusively in 78 and 42% of HCCs respectively. On immunohistochemistry with monoclonal antibodies, 77B for MAGE-1 and 57B for MAGE-3, MAGE-1 and -3 proteins were recognized in cytoplasm of only six among 33 (18%) and two of 29 HCCs (7%) respectively. The distribution pattern was mostly focal in HCC nodules. By contrast, the Western blot analysis revealed that the MAGE-1 (46 kDa) and -3 proteins (48 kDa) were expressed in 80 and 60% of 15 HCCs examined respectively. The proteins of MAGE-1 and -3 were also expressed exclusively in HCCs regardless of the histological grading and clinical staging. Our results indicate that the detection of the genes by RT-PCR or the proteins by Western blotting is useful for differentiating early HCCs from non-cancerous lesions, and that the peptides derived from MAGE-1 and -3 proteins might be suitable targets for immunotherapy of human HCC. © 1999 Cancer Research Campaign PMID:10576668

  3. The Human Intermediate Filament Database: comprehensive information on a gene family involved in many human diseases.

    PubMed

    Szeverenyi, Ildiko; Cassidy, Andrew J; Chung, Cheuk Wang; Lee, Bernett T K; Common, John E A; Ogg, Stephen C; Chen, Huijia; Sim, Shu Yin; Goh, Walter L P; Ng, Kee Woei; Simpson, John A; Chee, Li Lian; Eng, Goi Hui; Li, Bin; Lunny, Declan P; Chuon, Danny; Venkatesh, Aparna; Khoo, Kian Hoe; McLean, W H Irwin; Lim, Yun Ping; Lane, E Birgitte

    2008-03-01

    We describe a revised and expanded database on human intermediate filament proteins, a major component of the eukaryotic cytoskeleton. The family of 70 intermediate filament genes (including those encoding keratins, desmins, and lamins) is now known to be associated with a wide range of diverse diseases, at least 72 distinct human pathologies, including skin blistering, muscular dystrophy, cardiomyopathy, premature aging syndromes, neurodegenerative disorders, and cataract. To date, the database catalogs 1,274 manually-curated pathogenic sequence variants and 170 allelic variants in intermediate filament genes from over 459 peer-reviewed research articles. Unrelated cases were collected from all of the six sequence homology groups and the sequence variations were described at cDNA and protein levels with links to the related diseases and reference articles. The mutations and polymorphisms are presented in parallel with data on protein structure, gene, and chromosomal location and basic information on associated diseases. Detailed statistics relating to the variants records in the database are displayed by homology group, mutation type, affected domain, associated diseases, and nucleic and amino acid substitutions. Multiple sequence alignment algorithms can be run from queries to determine DNA or protein sequence conservation. Literature sources can be interrogated within the database and external links are provided to public databases. The database is freely and publicly accessible online at www.interfil.org (last accessed 13 September 2007). Users can query the database by various keywords and the search results can be downloaded. It is anticipated that the Human Intermediate Filament Database (HIFD) will provide a useful resource to study human genome variations for basic scientists, clinicians, and students alike.

  4. Human MSC gene expression under simulated microgravity (RPM)

    NASA Astrophysics Data System (ADS)

    Buravkova, Ludmila; Gershovich, Pavel; Grigoriev, Anatoly

    It is generally supposed that microgravity cell response is mediated by some structures of actin cytoskeleton that can be implicated in cell mechanosensitivity. Cytoskeletal reorganization in the microgravity environment can affect gene expression, which results in alterations of cell function. However the direct impact of microgravity on expression of some cytoskeletal genes and encoded proteins remains unknown. Multipotential adult mesechymal stromal cells (MSCs) are the early precursors of bone marrow that can be induced to differentiate into bone-like cells as well as to the other mesenchymal tissues. In our previous experiments we revealed cytoskele-ton alterations and reduced human MSCs growth and osteogenesis in simulated microgravity by Random Positioning Machine. The purpose of this study was to determine the impact of low gravity on F-actin organization and gene expression level of α-, β-, γ-actin, vinculin, cofilin, small GTPase RhoA, Rho kinase (ROCK) and protein expression of some adhesion molecules in cultured hMSCs. Fluorescent microscopy have shown that even 30 min of SMG results in rearrangement of F-actin and the lack of stress fibers in cultured hMSCs. Cell number with abnormal F-actin organization was increased after 6 h, 24 h and 48 h of SMG. On the other hand, after 120 hours of SMG cells displayed partial restoration of F-actin fibers in comparison with 24 h and 48 h. Similarly, near the same restoration was seen in F-actin after readaptation for 24 h in 1g environment after 24 h of SMG. However, the observed alterations in F-actin dimensional organization were accompanied by changes in related proteins gene expression. Real-time PCR revealed slight up-regulation of α-actin expression that became more signifi-cant after 48 h of SMG. Down-regulation of γ-actin was observed after 48 hours of exposure in RPM. Moreover the up-regulation of β-tubulin, cofilin and small GTPase RhoA gene expres-sion was also detected after 48 h of SMG. On the

  5. Expression of liver alpha-amylase in obese mouse hepatocytes

    PubMed Central

    Afsartala, Zohreh; Savabkar, Sanaz; Nazemalhosseini Mojarad, Ehsan; Assadollahi, Vahideh; Tanha, Shima; Bijangi, Khosro; Gholami, Mohammadreza

    2016-01-01

    Aim: The aim of this study is to demonstrate the relation between the expression of liver alpha-amylase and obesity. Background: Alpha-amylase catalyses the hydrolysis of 1, 4-alpha-glucosidic linkages in polysaccharides and has three main subtypes, including: salivary, pancreatic, and hepatic. Hepatic alpha-amylase is involved in glycogen metabolism, and has a role in obesity and its management. In this study, we aimed to analyze the expression of liver alpha-amylase in overweight and obese mouse. Material and methods: In this study, NMRI male mice were randomly divided into two groups. The sample group (obese) took a high-fat and carbohydrate diet, while the control group (normal) took a laboratory pellet chow for eight weeks. During this period, their weight was measured. After eight weeks, liver hepatocytes were isolated using an enzymatic digestion method. Immunocytochemistry (ICC) and flow cytometry analysis were performed to measure alpha amylase protein expression in mouse liver hepatocyte cells. Results: A significant difference in the body weight was observed between the two groups (p<0.05). The qualitative protein expression of liver alpha-amylase was found to be higher in the obese group in both tests (immunocytochemistry and flow cytometry). Animals from the test group presented higher alpha-amylase expression, which suggests that this hepatic protein may constitute a potential indicator of susceptibility for fat tissue accumulation and obesity. The present data demonstrates an increased expression of liver amylase in obese mice. Conclusion: These results suggest that liver amylase secretion might be useful for predicting susceptibility to obesity induced by consumption of a high-fat and carbohydrate diet. PMID:27895853

  6. Gene expression analysis of precision-cut human liver slices indicates stable expression of ADME-Tox related genes

    SciTech Connect

    Elferink, M.G.L.; Olinga, P.; van Leeuwen, E.M.; Bauerschmidt, S.; Polman, J.; Schoonen, W.G.; Heisterkamp, S.H.; Groothuis, G.M.M.

    2011-05-15

    In the process of drug development it is of high importance to test the safety of new drugs with predictive value for human toxicity. A promising approach of toxicity testing is based on shifts in gene expression profiling of the liver. Toxicity screening based on animal liver cells cannot be directly extrapolated to humans due to species differences. The aim of this study was to evaluate precision-cut human liver slices as in vitro method for the prediction of human specific toxicity by toxicogenomics. The liver slices contain all cell types of the liver in their natural architecture. This is important since drug-induced toxicity often is a multi-cellular process. Previously we showed that toxicogenomic analysis of rat liver slices is highly predictive for rat in vivo toxicity. In this study we investigated the levels of gene expression during incubation up to 24 h with Affymetrix microarray technology. The analysis was focused on a broad spectrum of genes related to stress and toxicity, and on genes encoding for phase-I, -II and -III metabolizing enzymes and transporters. Observed changes in gene expression were associated with cytoskeleton remodeling, extracellular matrix and cell adhesion, but for the ADME-Tox related genes only minor changes were observed. PCA analysis showed that changes in gene expression were not associated with age, sex or source of the human livers. Slices treated with acetaminophen showed patterns of gene expression related to its toxicity. These results indicate that precision-cut human liver slices are relatively stable during 24 h of incubation and represent a valuable model for human in vitro hepatotoxicity testing despite the human inter-individual variability.

  7. Parallel evolutionary events in the haptoglobin gene clusters of rhesus monkey and human

    SciTech Connect

    Erickson, L.M.; Maeda, N.

    1994-08-01

    Parallel occurrences of evolutionary events in the haptoglobin gene clusters of rhesus monkeys and humans were studied. We found six different haplotypes among 11 individuals from two rhesus monkey families. The six haplotypes include two types of haptoglobin gene clusters: one type with a single gene and the other with two genes. DNA sequence analysis indicates that the one-gene and the two-gene clusters were both formed by unequal homologous crossovers between two genes of an ancestral three-gene cluster, near exon 5, the longest exon of the gene. This exon is also the location where a separate unequal homologous crossover occured in the human lineage, forming the human two-gene haptoglobin gene cluster from an ancestral three-gene cluster. The occurrence of independent homologous unequal crossovers in rhesus monkey and in human within the same region of DNA suggests that the evolutionary history of the haptoglobin gene cluster in primates is the consequence of frequent homologous pairings facilitated by the longest and most conserved exon of the gene. 27 refs., 7 figs., 1 tab.

  8. A semiautomated approach to gene discovery through expressed sequence tag data mining: discovery of new human transporter genes.

    PubMed

    Brown, Shoshana; Chang, Jean L; Sadée, Wolfgang; Babbitt, Patricia C

    2003-01-01

    Identification and functional characterization of the genes in the human genome remain a major challenge. A principal source of publicly available information used for this purpose is the National Center for Biotechnology Information database of expressed sequence tags (dbEST), which contains over 4 million human ESTs. To extract the information buried in this data more effectively, we have developed a semiautomated method to mine dbEST for uncharacterized human genes. Starting with a single protein input sequence, a family of related proteins from all species is compiled. This entire family is then used to mine the human EST database for new gene candidates. Evaluation of putative new gene candidates in the context of a family of characterized proteins provides a framework for inference of the structure and function of the new genes. When applied to a test data set of 28 families within the major facilitator superfamily (MFS) of membrane transporters, our protocol found 73 previously characterized human MFS genes and 43 new MFS gene candidates. Development of this approach provided insights into the problems and pitfalls of automated data mining using public databases.

  9. Do polymorphisms in chemosensory genes matter for human ingestive behavior?

    PubMed

    Hayes, John E; Feeney, Emma L; Allen, Alissa L

    2013-12-01

    In the last decade, basic research in chemoreceptor genetics and neurobiology have revolutionized our understanding of individual differences in chemosensation. From an evolutionary perspective, chemosensory variations appear to have arisen in response to different living environments, generally in the avoidance of toxins and to better detect vital food sources. Today, it is often assumed that these differences may drive variable food preferences and choices, with downstream effects on health and wellness. A growing body of evidence indicates chemosensory variation is far more complex than previously believed. However, just because a genetic polymorphism results in altered receptor function in cultured cells or even behavioral phenotypes in the laboratory, this variation may not be sufficient to influence food choice in free living humans. Still, there is ample evidence to indicate allelic variation in TAS2R38 predicts variation in bitterness of synthetic pharmaceuticals (e.g., propylthiouracil) and natural plant compounds (e.g., goitrin), and this variation associates with differential intake of alcohol and vegetables. Further, this is only one of 25 unique bitter taste genes (TAS2Rs) in humans, and emerging evidence suggests other TAS2Rs may also contain polymorphisms that a functional with respect to ingestive behavior. For example, TAS2R16 polymorphisms are linked to the bitterness of naturally occurring plant compounds and alcoholic beverage intake, a TAS2R19 polymorphism predicts differences in quinine bitterness and grapefruit bitterness and liking, and TAS2R31 polymorphisms associate with differential bitterness of plant compounds like aristolochic acid and the sulfonyl amide sweeteners saccharin and acesulfame-K. More critically with respect to food choices, these polymorphisms may vary independently from each other within and across individuals, meaning a monolithic one-size-fits-all approach to bitterness needs to be abandoned. Nor are genetic

  10. Do polymorphisms in chemosensory genes matter for human ingestive behavior?

    PubMed Central

    Hayes, John E.; Feeney, Emma L.; Allen, Alissa L.

    2013-01-01

    In the last decade, basic research in chemoreceptor genetics and neurobiology have revolutionized our understanding of individual differences in chemosensation. From an evolutionary perspective, chemosensory variations appear to have arisen in response to different living environments, generally in the avoidance of toxins and to better detect vital food sources. Today, it is often assumed that these differences may drive variable food preferences and choices, with downstream effects on health and wellness. A growing body of evidence indicates chemosensory variation is far more complex than previously believed. However, just because a genetic polymorphism results in altered receptor function in cultured cells or even behavioral phenotypes in the laboratory, this variation may not be sufficient to influence food choice in free living humans. Still, there is ample evidence to indicate allelic variation in TAS2R38 predicts variation in bitterness of synthetic pharmaceuticals (e.g., propylthiouracil) and natural plant compounds (e.g., goitrin), and this variation associates with differential intake of alcohol and vegetables. Further, this is only one of 25 unique bitter taste genes (TAS2Rs) in humans, and emerging evidence suggests other TAS2Rs may also contain polymorphisms that a functional with respect to ingestive behavior. For example, TAS2R16 polymorphisms are linked to the bitterness of naturally occurring plant compounds and alcoholic beverage intake, a TAS2R19 polymorphism predicts differences in quinine bitterness and grapefruit bitterness and liking, and TAS2R31 polymorphisms associate with differential bitterness of plant compounds like aristolochic acid and the sulfonyl amide sweeteners saccharin and acesulfame-K. More critically with respect to food choices, these polymorphisms may vary independently from each other within and across individuals, meaning a monolithic one-size-fits-all approach to bitterness needs to be abandoned. Nor are genetic

  11. Structure of the chromosomal gene for granulocyte-macrophage colony stimulating factor: comparison of the mouse and human genes.

    PubMed Central

    Miyatake, S; Otsuka, T; Yokota, T; Lee, F; Arai, K

    1985-01-01

    A cDNA clone that expresses granulocyte-macrophage colony stimulating factor (GM-CSF) activity in COS-7 cells has been isolated from a pcD library prepared from mRNA derived from concanavalin A-activated mouse helper T cell clones. Based on homology with the mouse GM-CSF cDNA sequence, the mouse GM-CSF gene was isolated. The human GM-CSF gene was also isolated based on homology with the human GM-CSF cDNA sequence. The nucleotide sequences determined for the genes and their flanking regions revealed that both the mouse and human GM-CSF genes are composed of three introns and four exons. The organization of the mouse and human GM-CSF genes are highly homologous and strong sequence homology between the two genes is found both in the coding and non-coding regions. A 'TATA'-like sequence was found 20-25 bp upstream from the transcription initiation site. In the 5'-flanking region, there is a highly homologous region extending 330 bp upstream of the putative TATA box. This sequence may play a role in regulation of expression of the GM-CSF gene. These structures are compared with those of different lymphokine genes and their regulatory regions. Images Fig. 2. Fig. 6. PMID:3876930

  12. Characterisation of three starch degrading enzymes: thermostable β-amylase, maltotetraogenic and maltogenic α-amylases.

    PubMed

    Derde, L J; Gomand, S V; Courtin, C M; Delcour, J A

    2012-11-15

    Maltogenic α-amylase from Bacillus stearothermophilus (BStA) is widely used as bread crumb anti-firming enzyme. A maltotetraose-forming α-amylase from Pseudomonas saccharophila (PSA) was recently proposed as alternative, hence the need to compare both exo-acting enzymes with some endo-action component. A purely exo-acting thermostable β-amylase from Clostridium thermosulfurogenes (CTB) was included for reference purposes. Under the experimental conditions used, temperature optima of the enzymes are rather similar (60-65 °C), but temperature stability decreased in the order BStA, PSA and CTB. The action of the enzymes on different substrates and their impact on the rheological behaviour of maize starch suspensions demonstrated that, while CTB acts exclusively through an exo-action mechanism, BStA displayed limited endo-action which became more pronounced at higher temperatures. PSA has more substantial endo-action than BStA, which is rather temperature independent. This is important for their impact in processes such as breadmaking, where temperature is gradually increased.

  13. Structural investigation and homology modeling studies of native and truncated forms of alpha-amylases from Sclerotinia sclerotiorum.

    PubMed

    Ben Abdelmalek, Imen; Urdaci, Maria Camino; Ben Ali, Mamdouh; Denayrolles, Muriel; Chaignepain, Stephane; Limam, Ferid; Bejar, Samir; Marzouki, Mohamed Nejib

    2009-11-01

    The filamentous ascomycete Sclerotinia sclerotiorum is well known for its ability to produce a large variety of hydrolytic enzymes for the degradation of plant polysaccharide material. Two alpha-amylases designated as ScAmy54 and ScAmy43 were biochemically characterized and predicted to play an important role in starch degradation. Those enzymes produce specific oligosaccharides, essentially maltotriose, that have a considerable commercial interest. The primary structures of the two enzymes were analyzed by N-terminal sequencing, MALDI-TOF mass spectrometry, and cDNA cloning, and implied that the two proteins have the same N-terminal catalytic domain and ScAmy43 was produced from ScAmy54 by truncation of 96 amino acids at the carboxyl-terminal region. The result of genomic analysis suggested that the two enzymes originated from the same alpha-amylase gene and that truncation of ScAmy54 to ScAmy43 occurred probably during the S. sclerotiorum cultivation. The structural gene of ScAmy54 consisted of 9 exons and 8 introns, containing a single 1,500-bp open reading frame encoding 499 amino acids including a signal peptide of 21 amino acids. ScAmy54 exhibited high amino acid identity to other liquefying fungal alpha-amylases, essentially in the four conserved regions and in the putative catalytic triad. A 3D structure model of ScAmy54 and ScAmy43 was built using the 3D structure of 2guy from A. niger as template. ScAmy54 with three domains A, B, and C, including the well-known (beta/alpha)8-barrel motif in domain A, has a typical structure of the alpha-amylase family. ScAmy43 composed only of domains A and B constitutes a smallest fungal alpha-amylase with only a catalytic domain.

  14. Inhibition of Sunn pest, Eurygaster integriceps, α-amylases by α-amylase inhibitors (T-αAI) from Triticale.

    PubMed

    Mehrabadi, Mohammad; Bandani, Ali R; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the K(m) remained constant (0.58%) but the maximum velocity (V(max)) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T(50)) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase.