MafK/NF-E2 p18 is required for beta-globin genes activation by mediating the proximity of LCR and active beta-globin genes in MEL cell line.

PubMed

Du, Mei-Jun; Lv, Xiang; Hao, De-Long; Zhao, Guo-Wei; Wu, Xue-Song; Wu, Feng; Liu, De-Pei; Liang, Chih-Chuan

2008-01-01

Evidences indicate that locus control region (LCR) of beta-globin spatially closes to the downstream active gene promoter to mediate the transcriptional activation by looping. DNA binding proteins may play an important role in the looping formation. NF-E2 is one of the key transcription factors in beta-globin gene transcriptional activation. To shed light on whether NF-E2 is involved in this process, DS19MafKsiRNA cell pools were established by specifically knocked down the expression of MafK/NF-E2 p18, one subunit of NF-E2 heterodimer. In the above cell pools, it was observed that the occupancy efficiency of NF-E2 on beta-globin gene locus and the expression level of beta-globin genes were decreased. H3 acetylation, H3-K4 methylation and the deposition of RNA polymerase II, but not the recruitment of GATA-1, were also found reduced at the beta-globin gene cluster. Chromosome Conformation Capture (3C) assay showed that the cross-linking frequency between the main NF-E2 binding site HS2 and downstream structural genes was reduced compared to the normal cell. This result demonstrated that MafK/NF-E2 p18 recruitment was involved in the physical proximity of LCR and active beta-globin genes upon beta-globin gene transcriptional activation.

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PubMed

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Human beta-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini.

PubMed Central

Lim, S K; Maquat, L E

1992-01-01

Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170

Activation of beta-major globin gene transcription is associated with recruitment of NF-E2 to the beta-globin LCR and gene promoter.

PubMed

Sawado, T; Igarashi, K; Groudine, M

2001-08-28

The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

PubMed

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filon, D.; Oron, V.; Krichevski, S.

The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsensemore » codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.« less

Triplication of a four-gene set during evolution of the goat beta-globin locus produced three genes now expressed differentially during development.

PubMed Central

Townes, T M; Fitzgerald, M C; Lingrel, J B

1984-01-01

Distinct hemoglobins are synthesized in goats at different stages of development, similar to humans. Embryonic hemoglobins (zeta 2 epsilon 2 and alpha 2 epsilon 2) are synthesized initially and are followed sequentially by fetal (alpha 2 beta F2), preadult (alpha 2 beta C2), and adult (alpha 2 beta A2) hemoglobins. To help understand the basis of these switches, the genes of the beta-globin locus have been cloned and their linkage arrangement has been determined by the isolation of lambda phage carrying overlapping inserts of genomic goat DNA. The locus extends over 120 kilobase pairs and consists of 12 genes arranged in the following order: epsilon I-epsilon II-psi beta X-beta C-epsilon III-epsilon IV-psi beta Z-beta A-epsilon V-epsilon VI-psi beta Y-beta F. Comparison of the nucleotide sequence of the 12 genes shows that the locus is organized into three homologous four-gene sets that presumably evolved by the triplication of an ancestral set of four genes (epsilon-epsilon-psi beta-beta). Interestingly, the three genes (beta C, beta A, and beta F) located at the ends of the four-gene sets are expressed at different stages of development. Therefore, the goat beta F-, beta C-, and beta A-globin genes appear to have evolved by a mechanism that includes the triplication of 40-50 kilobase pairs of DNA and the recruitment of newly formed genes for expression in fetal, preadult, and adult life. PMID:6593719

Genetics Home Reference: sickle cell disease

MedlinePlus

... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...

Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

PubMed

Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

2007-01-05

High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

Histone- and protamine-DNA association: conservation of different patterns within the beta-globin domain in human sperm.

PubMed

Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P

1998-06-01

Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.

Glucocorticoids inhibit coordinated translation of. cap alpha. - and. beta. -globin mRNAs in Friend erythroleukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.

The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less

Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

PubMed

Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

2008-05-01

Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

PubMed

Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein

2011-03-15

Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Louie, E.; Dietz, L.; Shafer, F.

A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, whichmore » would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.« less

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Diagnostic difficulty of beta-thalassemia syndrome in a multi-transfused patient: contribution of myelogram and studying parents.

PubMed

Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie

2017-10-01

We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.

Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.

PubMed

Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio

2007-01-01

A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.

mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin.

PubMed

Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula

2007-09-01

In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

PubMed

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

PubMed

Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

2007-12-01

We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark

2003-04-15

To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Stabilization and cytoskeletal-association of LDL receptor mRNA are mediated by distinct domains in its 3' untranslated region.

PubMed

Wilson, G M; Vasa, M Z; Deeley, R G

1998-05-01

The mRNA encoding the human low density lipoprotein (LDL) receptor is transiently stabilized after phorbol ester treatment of HepG2 cells and has been shown to associate with components of the cytoskeleton in this cell line (G. M. Wilson, E. A. Roberts, and R. G. Deeley, J. Lipid Res. 1997. 38: 437-446). Using an episomal expression system, fragments of the 3' untranslated region (3'UTR) of LDL receptor mRNA were transcribed in fusion with the coding region of beta-globin mRNA in HepG2 cells. Analyses of the decay kinetics of these beta-globin-LDL receptor fusion mRNA deletion mutants showed that sequences in the proximal 3'UTR of LDL receptor mRNA including several AU-rich elements (AREs) were sufficient to confer short constitutive mRNA half-life in the heterologous system. Stabilization of LDL receptor mRNA in the presence of PMA required sequences in the distal 3'UTR, at or near three Alu-like repetitive elements. Furthermore, the 3'UTR of LDL receptor mRNA conferred cytoskeletal association on the otherwise unassociated beta-globin mRNA, by a mechanism involving at least two distinct RNA elements. Comparisons of decay kinetics and subcellular localization of endogenous LDL receptor mRNA and beta-globin-LDL receptor mRNA fusions in HepG2 cells have demonstrated that several cis-acting elements in the receptor 3'UTR contribute to post-transcriptional regulation of receptor expression, and provide further support for involvement of the cytoskeleton in the regulation of LDL receptor mRNA turnover.

Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads

PubMed Central

Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.

2011-01-01

Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623

HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PubMed

Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri

2002-03-01

We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

PubMed

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Genetic therapy for beta-thalassemia: from the bench to the bedside.

PubMed

Arumugam, Paritha; Malik, Punam

2010-01-01

Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pirastu, M.; Galanello, R.; Doherty, M.A.

The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

2008-07-15

Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.

Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

PubMed

Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

2009-09-01

The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

PubMed

Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

2005-01-01

Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

PubMed Central

Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

2008-01-01

Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

Thalassemia

MedlinePlus

... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...

Distinct modes of gene regulation by a cell-specific transcriptional activator.

PubMed

Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J

2009-03-17

The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patrick, N.; Miyakawa, F.; Hunt, J.A.

The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5more » of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].« less

Human papillomavirus in normal conjunctival tissue and in conjunctival papilloma: types and frequencies in a large series.

PubMed

Sjö, Nicolai Christian; von Buchwald, Christian; Cassonnet, Patricia; Norrild, Bodil; Prause, Jan Ulrik; Vinding, Troels; Heegaard, Steffen

2007-08-01

To examine conjunctival papilloma and normal conjunctival tissue for the presence of human papillomavirus (HPV). Archival paraffin wax-embedded tissue from 165 conjunctival papillomas and from 20 histological normal conjunctival biopsy specimens was analysed for the presence of HPV by PCR. Specimens considered HPV positive using consensus primers, but with a negative or uncertain PCR result using type-specific HPV probes, were analysed with DNA sequencing. HPV was present in 86 of 106 (81%) beta-globin-positive papillomas. HPV type 6 was positive in 80 cases, HPV type 11 was identified in 5 cases and HPV type 45 was present in a single papilloma. All the 20 normal conjunctival biopsy specimens were beta-globin positive and HPV negative. There is a strong association between HPV and conjunctival papilloma. The study presents the largest material of conjunctival papilloma investigated for HPV and the first investigation of HPV in normal conjunctival tissue. HPV types 6 and 11 are the most common HPV types in conjunctival papilloma. This also is the first report of HPV type 45 in conjunctival papilloma.

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

PubMed

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Removing peroxide impurities from ether improves the quality of globin chains for biosynthetic studies.

PubMed

Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz

2005-01-01

The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.

A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition.

PubMed

Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J

2016-09-01

Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.

Sickle cell disease caused by Hb S/Québec-CHORI: treatment with hydroxyurea and response.

PubMed

Tubman, Venée N; Bennett, Carolyn M; Luo, Hong-yuan; Chui, David H K; Heeney, Matthew M

2007-08-01

Sickle hemoglobin (Hb S;betaGlu 6 Val) is due to an A>T transversion in codon 6 of the beta-globin gene. Other variant hemoglobins mimic Hb A, S, or C on newborn screening and clinical laboratory diagnostic tools, thus making their correct identification potentially difficult. Sickling disorders can result in individuals who are compound heterozygous for beta-globin mutations (e.g., Hb SC, HbSO(Arab)). The authors report a second case of HbS/Québec-CHORI, a severe compound heterozygous sickling disorder and their experience managing this patient with hydroxyurea.

Hb Alesha [beta67(E11)Val-->Met, GTG-->ATG] in an Argentinean girl.

PubMed

Eberle, Silvia Eandi; Noguera, Nélida I; Sciuccati, Gabriela; Bonduel, Mariana; Díaz, Lilian; Staciuk, Raquel; Targovnik, Héctor M; Feliu-Torres, Aurora

2007-01-01

Hb Alesha is caused by a GTG-->ATG mutation at codon 67 of the beta-globin gene, resulting in abnormal beta-globin chains in which the normal beta67(E11) valine is changed to methionine. This hemoglobin (Hb) is also known as Hb Bristol, the first unstable Hb described, since in a fraction of the variant the methionine is modified into an aspartic acid by a posttranslational modification. This replacement disrupts the apolar bonds between the valine and the heme group, producing an unstable Hb and severe hemolysis. We have identified this rare hemoglobinopathy in an Argentinean girl with severe hemolytic anemia, splenomegaly and frequent requirement for red blood cell transfusions.

The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

PubMed

Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

2009-11-27

The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

PubMed

Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

2008-02-01

The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

PubMed

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

PubMed

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.

PubMed

Dong, Alisa C; Rivella, Stefano

2017-01-01

Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.

Strong linkage disequilibrium of a HbE variant with the (AT)9(T)5 repeat in the BP1 binding site upstream of the beta-globin gene in the Thai population.

PubMed

Ohashi, Jun; Naka, Izumi; Patarapotikul, Jintana; Hananantachai, Hathairad; Brittenham, Gary; Looareesuwan, Sornchai; Clark, Andrew G; Tokunaga, Katsushi

2005-01-01

A binding site for the repressor protein BP1, which contains a tandem (AT)x(T)y repeat, is located approximately 530 bp 5' to the human beta-globin gene (HBB). There is accumulating evidence that BP1 binds to the (AT)9(T)5 allele more strongly than to other alleles, thereby reducing the expression of HBB. In this study, we investigated polymorphisms in the (AT)x(T)y repeat in 57 individuals living in Thailand, including three homozygotes for the hemoglobin E variant (HbE; beta26Glu-->Lys), 22 heterozygotes, and 32 normal homozygotes. We found that (AT)9(T)5 and (AT)7(T)7 alleles were predominant in the studied population and that the HbE variant is in strong linkage disequilibrium with the (AT)9(T)5 allele, which can explain why the betaE chain is inefficiently synthesized compared to the normal betaA chain. Moreover, the mildness of the HbE disease compared to other hemoglobinopathies in Thai may be due, in part, to the presence of the (AT)9(T)5 repeat on the HbE chromosome. In addition, a novel (AC)n polymorphism adjacent to the (AT)x(T)y repeat (i.e., (AC)3(AT)7(T)5) was found through the variation screening in this study.

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

PubMed

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Dexamethasone facilitates erythropoiesis in murine embryonic stem cells differentiating into hematopoietic cells in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Anand S.; Kaushal, Sharmeela; Mishra, Rangnath

2006-07-28

Differentiating embryonic stem (ES) cells are increasingly emerging as an important source of hematopoietic progenitors with a potential to be useful for both basic and clinical research applications. It has been suggested that dexamethasone facilitates differentiation of ES cells towards erythrocytes but the mechanism responsible for sequential expression of genes regulating this process are not well-understood. Therefore, we in vitro induced differentiation of murine ES cells towards erythropoiesis and studied the sequential expression of a set of genes during the process. We hypothesized that dexamethasone-activates its cognate nuclear receptors inducing up-regulation of erythropoietic genes such as GATA-1, Flk-1, Epo-R, andmore » direct ES cells towards erythropoietic differentiation. ES cells were cultured in primary hematopoietic differentiation media containing methyl-cellulose, IMDM, IL-3, IL-6, and SCF to promote embryoid body (EB) formation. Total RNA of day 3, 5, and 9-old EBs was isolated for gene expression studies using RT-PCR. Cells from day 9 EBs were subjected to secondary differentiation using three different cytokines and growth factors combinations: (1) SCF, EPO, dexamethasone, and IGF; (2) SCF, IL-3, IL-6, and TPO; and (3) SCF IL-3, IL-6, TPO, and EPO. Total RNA from day 12 of secondary differentiated ES cells was isolated to study the gene expression pattern during this process. Our results demonstrate an up-regulation of GATA-1, Flk-1, HoxB-4, Epo-R, and globin genes ({alpha}-globin, {beta}H-1 globin, {beta}-major globin, {epsilon} -globin, and {zeta}-globin) in the 9-day-old EBs, whereas, RNA from 5-day-old EBs showed expression of HoxB-4, {epsilon}-globin, {gamma}-globin, {beta}H1-globin, and Flk-1. Three-day-old EBs showed only HoxB-4 and Flk-1 gene expression and lacked expression of all globin genes. These findings indicate that erythropoiesis-specific genes are activated later in the course of differentiation. Gene expression studies on the ES cells of secondary EB origin cultured in media containing dexamethasone showed a down-regulation of GATA-3 and an up-regulation of GATA-1, Flk-1, and Epo-R in comparison to the two other cytokines and growth factor combinations containing media. The secondary differentiation also showed an enhanced production of erythrocytic precursors in dexamethasone containing media in comparison to that in the control media. Our results indicate that dexamethasone can prove to be an effective agent which can be employed to enhance differentiation towards erythrocytic progenitors from ES cells.« less

Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

PubMed Central

Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

2013-01-01

Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

PubMed Central

Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

2014-01-01

Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous ..cap alpha..-thalassemic embryos, expression of EI (x/sub 2/y/sub 2/) and EII (..cap alpha../sub 2/y/sub 2/) is deficient because the x- and ..cap alpha..-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- andmore » ..cap alpha..-globin genes indicates that these genes must be closely linked. Reduced x- and ..cap alpha..-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y/sub 4/ hemoglobin also appears in ..beta..-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and ..beta..-globin genes. In double heterozygotes, which have a single functional allele of x- and ..cap alpha..-globin genes and three functional alleles of y- and ..beta..-globin genes, synthesis of ..cap alpha.. and non-..cap alpha.. chains is severely imbalanced and half of the total hemoglobin is y/sub 4/. Mouse y/sub 4/ has a high affinity for oxygen, P/sub 50/ of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues.« less

Large-scale production of embryonic red blood cells from human embryonic stem cells.

PubMed

Olivier, Emmanuel N; Qiu, Caihong; Velho, Michelle; Hirsch, Rhoda Elison; Bouhassira, Eric E

2006-12-01

To develop a method to produce in culture large number of erythroid cells from human embryonic stem cells. Human H1 embryonic stem cells were differentiated into hematopoietic cells by coculture with a human fetal liver cell line, and the resulting CD34-positive cells were expanded in vitro in liquid culture using a three-step method. The erythroid cells produced were then analyzed by light microscopy and flow cytometry. Globin expression was characterized by quantitative reverse-transcriptase polymerase chain reaction and by high-performance liquid chromatography. CD34-positive cells produced from human embryonic stem cells could be efficiently differentiated into erythroid cells in liquid culture leading to a more than 5000-fold increase in cell number. The erythroid cells produced are similar to primitive erythroid cells present in the yolk sac of early human embryos and did not enucleate. They are fully hemoglobinized and express a mixture of embryonic and fetal globins but no beta-globin. We have developed an experimental protocol to produce large numbers of primitive erythroid cells starting from undifferentiated human embryonic stem cells. As the earliest human erythroid cells, the nucleated primitive erythroblasts, are not very well characterized because experimental material at this stage of development is very difficult to obtain, this system should prove useful to answer a number of experimental questions regarding the biology of these cells. In addition, production of mature red blood cells from human embryonic stem cells is of great potential practical importance because it could eventually become an alternate source of cell for transfusion.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, S.D.; Cooper, P.; Fung, J.

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression ofmore » human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.« less

Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

PubMed

Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

2006-01-01

Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice.

PubMed

Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.

Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

PubMed

Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

2003-08-01

The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes.

PubMed

Tan, Jin-Ai Mary Anne; Tan, Kim-Lian; Omar, Khairul Zaman; Chan, Lee-Lee; Wee, Yong-Chui; George, Elizabeth

2009-09-01

Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A). HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia. Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA. The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

Fever of unclear origin and cytopenia because of acute splenic sequestration in a young immunocompetent carrier of beta-globin mutation for Hb Valletta.

PubMed

Parrinello, Gaspare; Torres, Daniele; Paterna, Salvatore; Di Pasquale, Pietro; Licata, Giuseppe

2008-12-01

Fever of unclear origin is a clinical challenge in medical practice. Infectious diseases, neoplasms, and collagen vascular illnesses are its main causes in adults and children. Acute splenic sequestration crises, a known potentially fatal complication of sickle cell disease and sickle beta-thalassemia, are uncommon in beta-heterozygosis. We describe a case of prolonged recurrent episodes of fever with spontaneous resolution, commencing at age 10 in a 15-year-old boy with a history of hypochromic microcytic anemia attributed to a thalassemic trait. He was admitted twice to our university hospital for continuous-remittent fever with a pruritic, macular evanescent Still's skin rash, severe splenomegaly, leucopenia, thrombocytopenia, and sudden aggravation of anemia. Infectious, rheumatologic, autoimmune, and hematologic illnesses were excluded. A genetic-based study revealed heterozygosis of the beta-globin gene for a A>C (Thr>Pro) substitution at position 87 called Hemoglobin Valletta (alpha 2 beta 2 87 PRO) with a C>G transition in homozygosis in beta-globin intronic polymorphism intervening sequence 2 at nucleotide 745. After a follow-up period of 1 year without treatment, the young patient remains apyretic and in good general clinical health with persistent microcythemia and hepatosplenomegaly. Acute splenic sequestration crisis and related cytopenia may be an unusual complication of fever of unclear origin in a beta-thalassemic carrier of a Hemoglobin Valletta mutation and polymorphism in homozygosis of intervening sequence 2 at nucleotide 745. This hemoglobinopathy may predispose to a clinical phenotype of minor or intermediate thalassemia and, during a febrile illness, to hemoglobin instability and splenic sequestration.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

PubMed

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

PubMed Central

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

PubMed

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-08-10

The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from beta-globin.

Pathophysiologically based drug treatment of sickle cell disease.

PubMed

Steinberg, Martin H

2006-04-01

Sickle cell disease is a systemic disorder that is caused by a mutation (Glu6Val) in the gene that encodes beta globin. The sickle hemoglobin molecule (HbS) is a tetramer of two alpha-globin chains and two sickle beta-globin chains, and has the tendency to polymerize when deoxygenated. HbS facilitates abnormal interactions between the sickle erythrocyte and leukocytes and endothelial cells, which trigger a complex pathobiology. This multifaceted pathophysiology provides the opportunity to interrupt the disease at multiple sites, including polymerization of HbS, erythrocyte density and cell-cell interactions. For example, it is possible to induce higher concentrations of fetal hemoglobin, which disrupts the pathology-initiating step of HbS polymerization. Furthermore, it is possible to improve the hydration of sickle erythrocytes and it might be feasible to counteract the endothelial, inflammatory and oxidative abnormalities of sickle cell disease. A therapeutic approach that targets several sites of pathobiology might be most promising.

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

PubMed Central

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice

PubMed Central

Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848

Sequence Divergence in the 3′ Untranslated Regions of Human ζ- and α-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient α-to-ζ Gene Developmental Switching

PubMed Central

Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.

1998-01-01

The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789

Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

PubMed

Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

2012-03-01

The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

The Role of CREB in CML

DTIC Science & Technology

2008-02-01

Feng YQ et al. Anti-beta s- ribozyme reduces beta s mRNA levels in transgenic mice: Potential application to the gene therapy of sickle cell anemia... ribozymes . RNA 2003;9:1254–1263. 13 Pace BS, Qian X, Ofori-Acquah SF. Selective inhibition of beta-globin RNA transcripts by antisense RNA molecules. Cell

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

PubMed

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the application of MS/MS for thalassemia screening, when combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Copyright © 2016. Published by Elsevier B.V.

Production of Gene-Corrected Adult Beta Globin Protein in Human Erythrocytes Differentiated from Patient iPSCs After Genome Editing of the Sickle Point Mutation.

PubMed

Huang, Xiaosong; Wang, Ying; Yan, Wei; Smith, Cory; Ye, Zhaohui; Wang, Jing; Gao, Yongxing; Mendelsohn, Laurel; Cheng, Linzhao

2015-05-01

Human induced pluripotent stem cells (iPSCs) and genome editing provide a precise way to generate gene-corrected cells for disease modeling and cell therapies. Human iPSCs generated from sickle cell disease (SCD) patients have a homozygous missense point mutation in the HBB gene encoding adult β-globin proteins, and are used as a model system to improve strategies of human gene therapy. We demonstrate that the CRISPR/Cas9 system designer nuclease is much more efficient in stimulating gene targeting of the endogenous HBB locus near the SCD point mutation in human iPSCs than zinc finger nucleases and TALENs. Using a specific guide RNA and Cas9, we readily corrected one allele of the SCD HBB gene in human iPSCs by homologous recombination with a donor DNA template containing the wild-type HBB DNA and a selection cassette that was subsequently removed to avoid possible interference of HBB transcription and translation. We chose targeted iPSC clones that have one corrected and one disrupted SCD allele for erythroid differentiation assays, using an improved xeno-free and feeder-free culture condition we recently established. Erythrocytes from either the corrected or its parental (uncorrected) iPSC line were generated with similar efficiencies. Currently ∼6%-10% of these differentiated erythrocytes indeed lacked nuclei, characteristic of further matured erythrocytes called reticulocytes. We also detected the 16-kDa β-globin protein expressed from the corrected HBB allele in the erythrocytes differentiated from genome-edited iPSCs. Our results represent a significant step toward the clinical applications of genome editing using patient-derived iPSCs to generate disease-free cells for cell and gene therapies. Stem Cells 2015;33:1470-1479. © 2015 AlphaMed Press.

High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

PubMed

Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

2017-12-01

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

PubMed

Kim, Kihoon; Kim, AeRi

2010-09-01

Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

PubMed

Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

2008-04-11

The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.

The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

PubMed Central

Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

2016-01-01

Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

PubMed Central

Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

2000-01-01

We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

PubMed Central

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Structural and Functional Analysis of an mRNP Complex That Mediates the High Stability of Human β-Globin mRNA

PubMed Central

Yu, Jia; Russell, J. Eric

2001-01-01

Human globins are encoded by mRNAs exhibiting high stabilities in transcriptionally silenced erythrocyte progenitors. Unlike α-globin mRNA, whose stability is enhanced by assembly of a specific messenger RNP (mRNP) α complex on its 3′ untranslated region (UTR), neither the structure(s) nor the mechanism(s) that effects the high-level stability of human β-globin mRNA has been identified. The present work describes an mRNP complex assembling on the 3′ UTR of the β-globin mRNA that exhibits many of the properties of the stability-enhancing α complex. The β-globin mRNP complex is shown to contain one or more factors homologous to αCP, a 39-kDa RNA-binding protein that is integral to α-complex assembly. Sequence analysis implicates a specific 14-nucleotide pyrimidine-rich track within its 3′ UTR as the site of β-globin mRNP assembly. The importance of this track to mRNA stability is subsequently verified in vivo using mice expressing human β-globin transgenes that contain informative mutations in this region. In combination, the in vitro and in vivo analyses indicate that the high stabilities of the α- and β-globin mRNAs are maintained through related mRNP complexes that may share a common regulatory pathway. PMID:11486027

Compound heterozygosity for Hb S [beta6(A3)GluVal, GAG-->GTG] and a new thalassemic mutation [beta132(H10)Lys-->term, AAA-->TAA] detected in a family from West Africa.

PubMed

Frischknecht, Hannes; Troxler, Heinz; Greiner, Jeanette; Hengartner, Heinz; Dutly, Fabrizio

2008-01-01

We describe a Hb S/beta-thalassemia (beta-thal) mutation involving an AT transition at codon 132 of the beta-globin gene. The mutation, in the heterozygous state, unlike several other mutations in exon 3, shows no signs of dominant thalassemia but those of a typical beta(0) carrier. Compound heterozygosity with Hb S [beta6(A3)GluVal, GAGGTG] showed a severe clinical picture.

LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

PubMed

Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-12-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

Alternative options for DNA-based experimental therapy of β-thalassemia.

PubMed

Gambari, Roberto

2012-04-01

Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.

Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

PubMed

Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

2016-06-01

The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Alpha-globin gene haplotypes in South American Indians.

PubMed

Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

1995-08-01

The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

PubMed Central

Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-01-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2006-01-01

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

[Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

PubMed

Mazur, G; Braunitzer, G

1984-09-01

The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription

PubMed Central

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-01-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription.

PubMed

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-04-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinell, J.; Whitney, J.B.; Popp, R.A.

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thein, S.L.; Hesketh, C.; Wood, W.G.

Analysis of the molecular basis of dominantly inherited {beta}-thalassemia in four families has revealed different mutations involving exon 3 of the {beta}-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of {beta}-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation.

The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2006-07-01

The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

Disorders of Human Hemoglobin

NASA Astrophysics Data System (ADS)

Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco

1980-02-01

Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.

Globin switches in yolk sac-like primitive and fetal-like definitive red blood cells produced from human embryonic stem cells.

PubMed

Qiu, Caihong; Olivier, Emmanuel N; Velho, Michelle; Bouhassira, Eric E

2008-02-15

We have previously shown that coculture of human embryonic stem cells (hESCs) for 14 days with immortalized fetal hepatocytes yields CD34(+) cells that can be expanded in serum-free liquid culture into large numbers of megaloblastic nucleated erythroblasts resembling yolk sac-derived cells. We show here that these primitive erythroblasts undergo a switch in hemoglobin (Hb) composition during late terminal erythroid maturation with the basophilic erythroblasts expressing predominantly Hb Gower I (zeta(2)epsilon(2)) and the orthochromatic erythroblasts hemoglobin Gower II (alpha(2)epsilon(2)). This suggests that the switch from Hb Gower I to Hb Gower II, the first hemoglobin switch in humans is a maturation switch not a lineage switch. We also show that extending the coculture of the hESCs with immortalized fetal hepatocytes to 35 days yields CD34(+) cells that differentiate into more developmentally mature, fetal liver-like erythroblasts, that are smaller, express mostly fetal hemoglobin, and can enucleate. We conclude that hESC-derived erythropoiesis closely mimics early human development because the first 2 human hemoglobin switches are recapitulated, and because yolk sac-like and fetal liver-like cells are sequentially produced. Development of a method that yields erythroid cells with an adult phenotype remains necessary, because the most mature cells that can be produced with current systems express less than 2% adult beta-globin mRNA.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Nanoparticles for Site Specific Genome Editing

NASA Astrophysics Data System (ADS)

McNeer, Nicole Ali

Triplex-forming peptide nucleic acids (PNAs) can be used to coordinate the recombination of short 50-60 by "donor DNA" fragments into genomic DNA, resulting in site-specific correction of genetic mutations or the introduction of advantageous genetic modifications. Site-specific gene editing in hematopoietic stem and progenitor cells (HSPCs) could result in treatment or cure of inherited disorders of the blood such as beta-thalassemia. Gene editing in HSPCs and differentiated T cells could help combat HIV/AIDs by modifying receptors, such as CCR5, necessary for R5-tropic HIV entry. However, translation of genome modification technologies to clinical practice is limited by challenges in intracellular delivery, especially in difficult-to-transfect hematolymphoid cells. In vivo gene editing could also provide novel treatment for systemic monogenic disorders such as cystic fibrosis, an autosomal recessive disorder caused by mutations in the cystic fibrosis transmembrane receptor. Here, we have engineered biodegradable nanoparticles to deliver oligonucleotides for site-specific genome editing of disease-relevant genes in human cells, with high efficiency, low toxicity, and editing of clinically relevant cell types. We designed nanoparticles to edit the human beta-globin and CCR5 genes in hematopoietic cells. We show that poly(lactic-co-glycolic acid) (PLGA) nanoparticles can delivery PNA and donor DNA for site-specific gene modification in human hematopoietic cells in vitro and in vivo in NOD-scid IL2rgammanull mice. Nanoparticles delivered by tail vein localized to hematopoietic compartments in the spleen and bone marrow of humanized mice, resulting in modification of the beta-globin and CCR5 genes. Modification frequencies ranged from 0.005 to 20% of cells depending on the organ and cell type, without detectable toxicity. This project developed highly versatile methods for delivery of therapeutics to hematolymphoid cells and hematopoietic stem cells, and will help to translate gene therapies for diseases of the blood and immune system to clinical practice. In addition, we have expanded the use of this technology to an additional nonhematopoietic model system: correction of the human cystic fibrosis transmembrane receptor gene in human bronchial epithelial cells. The work presented here represents (1) the first use of biodegradable nanoparticles for PNA delivery, (2) the first direct in vivo site-specific genome modification in human cells, and (3) the first use of triplex-PNA technology for site-specific genome editing in cystic fibrosis.

Surface plasmon resonance-based molecular detection of Hb S [beta6(A3)Glu-->Val, GAG-->GTG] at the gene level.

PubMed

Atalay, Erol O; Ustel, Emre; Yildiz, Sanem; Atalay, Ayfer

2006-01-01

The surface plasmon resonance (SPR) approach, being a relatively novel biophysical method, is used to detect many different targets by biomolecular interaction. The SPR system uses optical and evanescent wave phenomenon. This approach does not need any labels, such as enzymes or isotopes, and the monitored interactions are in real time. In DNA-DNA interaction, the SPR approach is Tm-independent. Here we report our preliminary results for the molecular detection of the Hb S (GAG -->GTG) mutation at codon 6 of the human beta-globin gene. Our preliminary results show that the SPR approach could be applied as an inexpensive and fast routine test system for the molecular diagnosis of abnormal hemoglobins (Hbs), especially in premarital screening programs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thein, S.L.; Weatherall, D.J.; Sampietro, M.

[open quotes]Heterocellular hereditary persistence of fetal hemoglobin[close quotes] (HPFH) is the term used to describe the genetically determined persistence of fetal hemoglobin (Hb F) production into adult life, in the absence of any related hematological disorder. Whereas some forms are caused by mutations in the [beta]-globin gene cluster on chromosome 11, others segregate independently. While the latter are of particular interest with respect to the regulation of globin gene switching, it has not been possible to determine their chromosomal location, mainly because their mode of inheritance is not clear, but also because several other factors are known to modify Hbmore » F production. The authors have examined a large Asian Indian pedigree which includes individuals with heterocellular HPFH associated with [beta]-thalassemia and/or [alpha]-thalassemia. Segregation analysis was conducted on the HPFH trait FC, defined to be the percentage of Hb F-containing cells (F-cells), using the class D regressive model. The results provide evidence for the presence of a major gene, dominant or codominant, which controls the FC values with residual familial correlations. The major gene was detected when the effects of genetic modifiers, notably [beta]-thalassemia and the XmnI-[sup G][gamma] polymorphism, are accounted for in this analysis. Linkage with the [beta]-globin gene cluster is excluded. The transmission of the FC values in this pedigree is informative enough to allow detection of linkage with an appropriate marker(s). The analytical approach outlined in this study, using simple regression to allow for genetic modifiers and thus allowing the mode of inheritance of a trait to be dissected out, may be useful as a model for segregation and linkage analyses of other complex phenotypes. 39 refs., 4 figs., 6 tabs.« less

Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

PubMed

Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R

2017-09-04

β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

PubMed

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

Real-time monitoring of stress erythropoiesis in vivo using Gata1 and beta-globin LCR luciferase transgenic mice.

PubMed

Suzuki, Mikiko; Ohneda, Kinuko; Hosoya-Ohmura, Sakie; Tsukamoto, Saho; Ohneda, Osamu; Philipsen, Sjaak; Yamamoto, Masayuki

2006-07-15

Erythroid progenitors have the potential to proliferate rapidly in response to environmental stimuli. This process is referred to as stress erythropoiesis, with erythropoietin (EPO) playing central roles in its promotion. In this study, we wanted to elucidate the molecular mechanisms governing the regulation of stress erythropoiesis and the maintenance of red-cell homeostasis. This was achieved by our development of a noninvasive real-time monitoring system for erythropoiesis using transgenic mouse lines expressing luciferase under the control of the mouse Gata1 hematopoietic regulatory domain (G1-HRD-luc) or human beta-globin locus control region (Hbb-LCR-luc). Optical bioluminescence images revealed that the luciferase was specifically expressed in spleen and bone marrow and was induced rapidly in response to anemia and hypoxia stimuli. The G1-HRD-luc activity tracked the emergence and disappearance of proerythroblast-stage progenitors, whereas the Hbb-LCR-luc activity tracked erythroblasts and later stage erythroid cells. Increased plasma EPO concentration preceded an increase in G1-HRD-luc, supporting our contention that EPO acts as the key upstream signal in stress erythropoiesis. Hence, we conclude that G1-HRD-luc and Hbb-LCR-luc reporters are differentially activated during stress erythropoiesis and that the transgenic mouse lines used serve as an important means for understanding the homeostatic regulation of erythropoiesis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngo, K.Y.; Liu, D.; Lee, J.

During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less

Genetics Home Reference: methemoglobinemia, beta-globin type

MedlinePlus

... American Society of Hematology Resource List from the University of Kansas Medical Center: ... Melarkode K, Prinzhausen H. Hemoglobin M variant and congenital methemoglobinemia: methylene blue will not be effective in the presence of hemoglobin M. Can J ...

Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

PubMed Central

Groner, B; Hynes, N E

1980-01-01

The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

PubMed Central

Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

2011-01-01

Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

PubMed

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Tangential Flow Filtration of Hemoglobin

PubMed Central

Sun, Guoyong; Harris, David R.

2009-01-01

Bovine and human hemoglobin (bHb and hHb, respectively) was purified from bovine and human red blood cells (bRBCs and hRBCs, respectively) via tangential flow filtration (TFF) in four successive stages. TFF is a fast and simple method to purify Hb from RBCs using filtration through hollow fiber (HF) membranes. Most of the Hb was retained in stage III (100 kDa HF membrane) and displayed methemoglobin levels less than 1%, yielding final concentrations of 318 and 300 mg/mL for bHb and hHb, respectively. Purified Hb exhibited much lower endotoxin levels than their respective RBCs. The purity of Hb was initially assessed via SDS-PAGE, and showed tiny impurity bands for the stage III retentate. The oxygen affinity (P50), and cooperativity coefficient (n) were regressed from the measured oxygen-RBC/Hb equilibrium curves of RBCs and purified Hb. These results suggest that TFF yielded oxygen affinities of bHb and hHb that are comparable to values in the literature. LC-MS was used to measure the molecular weight of the alpha (α) and beta (β) globin chains of purified Hb. No impurity peaks were present in the HPLC chromatograms of purified Hb. The mass of the molecular ions corresponding to the α and β globin chains agreed well with the calculated theoretical mass of the α-and β-globin chains. Taken together, our results demonstrate that HPLC grade Hb can be generated via TFF. In general, this method can be more broadly applied to purify Hb from any source of RBCs. This work is significant, since it outlines a simple method for generating Hb for synthesis and/or formulation of Hb-based oxygen carriers (HBOCs). PMID:19224583

High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

PubMed

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and electrophortic indices in order to avoid false positive and false negative results.

Subunit assembly of hemoglobin: an important determinant of hematologic phenotype.

PubMed

Bunn, H F

1987-01-01

Hemoglobin's physiologic properties depend on the orderly assembly of its subunits in erythropoietic cells. The biosynthesis of alpha- and beta-globin polypeptide chains is normally balanced. Heme rapidly binds to the globin subunit, either during translation or shortly thereafter. The formation of the alpha beta-dimer is facilitated by electrostatic attraction of a positively charged alpha-subunit to a negatively charged beta-subunit. The alpha beta-dimer dissociates extremely slowly. The difference between the rate of dissociation of alpha beta- and alpha gamma-dimers with increasing pH explains the well-known alkaline resistance of Hb F. Two dimers combine to form the functioning alpha 2 beta 2-tetramer. This model of hemoglobin assembly explains the different levels of positively charged and negatively charged mutant hemoglobins that are encountered in heterozygotes and the effect of alpha-thalassemia and heme deficiency states in modifying the level of the variant hemoglobin as well as Hb A2. Electrostatic interactions also affect the binding of hemoglobin to the cytoplasmic surface of the red cell membrane and may underlie the formation of target cells. Enhanced binding of positively charged variants such as S and C trigger a normally dormant pathway for potassium and water loss. Thus, the positive charge on beta c is responsible for the two major contributors to the pathogenesis of Hb SC disease: increased proportion of Hb S and increased intracellular hemoglobin concentration. It is likely that electrostatic interactions play an important role in the assembly of a number of other multisubunit macromolecules, including membrane receptors, cytoskeletal proteins, and DNA binding proteins.

Comparison of different methods for erythroid differentiation in the K562 cell line.

PubMed

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Bergamot (Citrus bergamia Risso) fruit extracts as γ-globin gene expression inducers: phytochemical and functional perspectives.

PubMed

Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica

2009-05-27

Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.

Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

PubMed Central

2012-01-01

Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

Genotype–phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis

PubMed Central

Traivaree, Chanchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Prasertsin, Warakorn; Boonyawat, Boonchai

2018-01-01

Introduction Beta-thalassemia is a group of inherited hemolytic anemias and one of the most common genetic disorders in Thailand. The clinical spectrum of beta-thalassemia disease ranges from mild to severe clinical symptoms including mild beta-thalassemia intermedia (TI) and severe beta-thalassemia major (TM). Objective This study aimed to determine the correlation between beta-globin gene (HBB) mutations and their phenotypic manifestations by evaluating patients’ clinical characteristics, transfusion requirements, growth and hematologic parameters, and hemoglobin typing among pediatric patients treated at Phramongkutklao Hospital. Materials and methods Seventy beta-thalassemia patients, including 63 with beta-thalassemia/hemoglobin E (HbE) and 7 with either homozygous or compound heterozygous beta-thalassemia, were enrolled in this study. Their clinical presentation, growth parameters and laboratory findings were reviewed and analyzed. The mean follow-up time was 10.52±5.62 years. Mutation analysis in each individual was performed using multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene and gap PCR for 3.4 kb deletion detection. Results All 7 homozygous and compound heterozygous beta-thalassemia patients were classified in TM. Among 63 patients with beta-thalassemia/HbE, 58 were classified in TM and 4 were classified in TI. Mean age at diagnosis was 0.8±0.49 years for homozygous or compound heterozygous beta-thalassemia and 3.43±3.5 years for beta-thalassemia/HbE. The most common HBB mutation was HBB:c.126_129delCTTT [codon 41/42 (-TCTT)] found in 34 alleles (48.6%). The height for age was also lower in homozygous beta-thalassemia patients (<3rd percentile) compared to compound heterozygous beta-thalassemia patients (25–50th percentile). Conclusion This study revealed a genotype–phenotype correlation of the most prevalent beta-thalassemia in Thai children using diagnostic capacity in genotypic analysis of HBB mutation. Our findings can provide a better prediction of clinical manifestation and severity by early identification of the type of the HBB mutations. PMID:29695942

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

Prenatal diagnosis of hemoglobinopathies: evaluation of techniques for analysing globin-chain synthesis in blood samples obtained by fetoscopy.

PubMed Central

Congote, L. F.; Hamilton, E. F.; Chow, J. C.; Perry, T. B.

1982-01-01

Three techniques for analysing hemoglobin synthesis in blood samples obtained by fetoscopy were evaluated. Of the fetuses studied, 12 were not at risk of genetic disorders, 10 were at risk of beta-thalassemia, 2 were at risk of sickle cell anemia and 1 was at risk of both diseases. The conventional method of prenatal diagnosis of hemoglobinopathies, involving the separation of globin chains labelled with a radioactive isotope on carboxymethyl cellulose (CMC) columns, was compared with a method involving globin-chain separation by high-pressure liquid chromatography (HPLC) and with direct analysis of labelled hemoglobin tetramers obtained from cell lysates by chromatography on ion-exchange columns. The last method is technically the simplest and can be used for diagnosing beta-thalassemia and sickle cell anemia. However, it gives spuriously high levels of adult hemoglobin in samples containing nonlabelled adult hemoglobin. HPLC is the fastest method for prenatal diagnosis of beta-thalassemia and may prove as reliable as the CMC method. Of the 13 fetuses at risk for hemoglobinopathies, 1 was predicted to be affected, and the diagnosis was confirmed in the abortus. Of 12 predicted to be unaffected, 1 was aborted spontaneously and was unavailable for confirmatory studies, as were 3 of the infants; however, the diagnosis was confirmed in seven cases and is awaiting confirmation when the infant in 6 months old in one case. Couples at risk of bearing a child with a hemoglobinopathy should be referred for genetic counselling before pregnancy or, at the latest, by the 12th week of gestation so that prenatal diagnosis can be attempted by amniocentesis, safer procedure, with restriction endonuclease analysis of the amniotic fluid cells. PMID:7139502

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

PubMed Central

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-01-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

Combination of a triple alpha-globin gene with beta-thalassemia in a gypsy family: importance of the genetic testing in the diagnosis and search for a donor for bone marrow transplantation for one of their children.

PubMed

Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen

2016-04-14

The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.

Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

PubMed

Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

2012-06-15

Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

β-Globin locus control region HS2 and HS3 interact structurally and functionally

PubMed Central

Jackson, David A.; McDowell, Jennifer C.; Dean, Ann

2003-01-01

The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

PubMed Central

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Phytomedicines and Nutraceuticals: Alternative Therapeutics for Sickle Cell Anemia

PubMed Central

Imaga, Ngozi Awa

2013-01-01

Sickle cell anemia is a genetically inherited disease in which the “SS” individual possesses an abnormal beta globin gene. A single base substitution in the gene encoding the human β-globin subunit results in replacement of β6 glutamic acid by valine, leading to the devastating clinical manifestations of sickle cell disease. This substitution causes drastic reduction in the solubility of sickle cell hemoglobin (HbS) when deoxygenated. Under these conditions, the HbS molecules polymerize to form long crystalline intracellular mass of fibers which are responsible for the deformation of the biconcave disc shaped erythrocyte into a sickle shape. First-line clinical management of sickle cell anemia include, use of hydroxyurea, folic acid, amino acids supplementation, penicillinprophylaxis, and antimalarial prophylaxis to manage the condition and blood transfusions to stabilize the patient's hemoglobin level. These are quite expensive and have attendant risk factors. However, a bright ray of hope involving research into antisickling properties of medicinal plants has been rewarding. This alternative therapy using phytomedicines has proven to not only reduce crisis but also reverse sickling (in vitro). The immense benefits of phytomedicines and nutraceuticals used in the management of sickle cell anemia are discussed in this paper. PMID:23476125

Erythropoiesis from Human Embryonic Stem Cells Through Erythropoietin-Independent AKT Signaling

PubMed Central

Kim, William S.; Zhu, Yuhua; Deng, Qiming; Chin, Chee Jia; He, Chong Bin; Grieco, Amanda J.; Dravid, Gautam G.; Parekh, Chintan; Hollis, Roger P.; Lane, Timothy F.; Bouhassira, Eric E.; Kohn, Donald B.; Crooks, Gay M.

2014-01-01

Unlimited self renewal capacity and differentiation potential make human pluripotent stem cells (PSC) a promising source for the ex vivo manufacture of red blood cells (RBC) for safe transfusion. Current methods to induce erythropoiesis from PSC suffer from low yields of RBCs, most of which are immature and contain embryonic and fetal rather than adult hemoglobins. We have previously shown that homo-dimerization of the intracellular component of MPL (ic-MPL) induces erythropoiesis from human cord blood progenitors. The goal of the present study was to investigate the potential of ic-MPL dimerization to induce erythropoiesis from human embryonic stem cells (hESC) and to identify the signaling pathways activated by this strategy. We present here evidence that ic-MPL dimerization induces erythropoietin (EPO)-independent erythroid differentiation from hESC by inducing the generation of erythroid progenitors and by promoting more efficient erythroid maturation with increased RBC enucleation as well as increased gamma:epsilon globin ratio and production of beta-globin protein. ic-MPL dimerization is significantly more potent than EPO in inducing erythropoiesis and its effect is additive to EPO. Signaling studies show that dimerization of ic-MPL, unlike stimulation of the wild type MPL receptor, activates AKT in the absence of JAK2/STAT5 signaling. AKT activation upregulates the GATA-1 and FOXO3 transcriptional pathways with resulting inhibition of apoptosis, modulation of cell cycle and enhanced maturation of erythroid cells. These findings open up potential new targets for the generation of therapeutically relevant RBC products from hPSC. PMID:24677652

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Problem-Solving Test: The Mechanism of Protein Synthesis

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: protein synthesis, ribosomes, amino acids, peptides, peptide bond, polypeptide chain, N- and C-terminus, hemoglobin, [alpha]- and [beta]-globin chains, radioactive labeling, [[to the third power]H] and [[to the fourteenth power]C]leucine, cytosol, differential centrifugation, density…

Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.

PubMed

Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R

2016-03-01

Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

No detection of SV40 DNA in mesothelioma tissues from a high incidence area in Sweden.

PubMed

Lundstig, Annika; Dejmek, Annika; Eklund, Carina; Filinic, Ivo; Dillner, Joakim

2007-01-01

Simian virus 40 (SV40), a polyoma virus of the rhesus macaque was discovered in 1960 as a contaminant of human polio vaccines produced in monkey cells. A number of studies have reported the detection of SV40 nucleotide sequences in human tumors, mainly mesotheliomas, but the reports have not been consistent. The presence of SV40 in 26 consecutive cases of malignant mesothelioma of biphasic type was investigated using a SV40 quantitative real time polymerase chain reaction (PCR) with a sensitivity of 10 copies of viral DNA per sample. All the samples were also tested for amplifiability using a real-time PCR for the beta-globin gene. Eighteen tumors were amplifiable, but none contained SV40 DNA. The results do not support an association between mesothelioma and SV40.

Monomethylfumarate Induces γ-Globin Expression and Fetal Hemoglobin Production in Cultured Human Retinal Pigment Epithelial (RPE) and Erythroid Cells, and in Intact Retina

PubMed Central

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.

2014-01-01

Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111

Hb Chile [beta28(B10)Leu-->Met]: an unstable hemoglobin associated with chronic methemoglobinemia and sulfonamide or methylene blue-induced hemolytic anemia.

PubMed

Hojas-Bernal, R; McNab-Martin, P; Fairbanks, V F; Holmes, M W; Hoyer, J D; McCormick, D J; Kubik, K S

1999-05-01

Among the causes of life-long cyanosis are congenital methemoglobinemia due to M hemoglobins, congenital methemoglobinemia due to methemoglobin reductase deficiency, a small number of low oxygen affinity hemoglobins, and a small number of unstable hemoglobins that spontaneously form methemoglobin in vivo at an accelerated rate. We report an unstable hemoglobin with these characteristics that was observed in a family of indigenous (native American) origin living near Santiago, Chile. This variant has the substitution beta28(B10)Leu-->Met, unambiguously corresponding to the DNA mutation of CTG-->ATG in beta-globin gene codon 28.

Molecular Basis and Genetic Modifiers of Thalassemia.

PubMed

Mettananda, Sachith; Higgs, Douglas R

2018-04-01

Thalassemia is a disorder of hemoglobin characterized by reduced or absent production of one of the globin chains in human red blood cells with relative excess of the other. Impaired synthesis of β-globin results in β-thalassemia, whereas defective synthesis of α-globin leads to α-thalassemia. Despite being a monogenic disorder, thalassemia exhibits remarkable clinical heterogeneity that is directly related to the intracellular imbalance between α- and β-like globin chains. Novel insights into the genetic modifiers have contributed to the understanding of the correlation between genotype and phenotype and are being explored as therapeutic pathways to cure this life-limiting disease. Copyright © 2017 Elsevier Inc. All rights reserved.

Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

PubMed

Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

2017-03-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596. © 2016 AlphaMed Press.

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

PubMed Central

Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima

2015-01-01

Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820

Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

PubMed

Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

1995-01-01

Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

PubMed

Li, W X; Ma, Q W; Zeng, F Y

2018-03-01

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.

Expression of transcription factors during sodium phenylacetate induced erythroid differentiation in K562 cells.

PubMed

Rath, A V; Schmahl, G E; Niemeyer, C M

1997-01-01

During 15 days of treatment of K562 cells with sodium phenylacetate, we observed an increase in the cellular hemoglobin concentration with a similar increase in the expression of gamma-globin mRNA. Morphological studies demonstrated characteristic features of erythroid differentiation and maturation. At the same time there was no change in the level of expression of the cell surface antigenes CD33, CD34, CD45, CD71 and glycophorin A. Likewise, the level of expression of the erythroid transcription factors GATA-1, GATA-2, NF-E2, SCL and RBTN2, all expressed in untreated K562 cells, did not increase during sodium phenylacetate induced erythroid differentiation. The expression of the nuclear factors Evi-1 and c-myb, known to inhibit erythroid differentiation, did not decrease. We conclude that sodium phenylacetate treatment of K562 cells increases gamma-globin mRNA and induces cell maturation as judged by morphology without affecting the expression of the erythroid transcription factors, some of which are known to be involved in the regulation of beta-like globin genes.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

PubMed

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Hb Molfetta [beta126(H4)Val-->Leu, GTG-->CTG]: a new, silent, neutral beta chain variant found in an Italian woman.

PubMed

Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo

2002-02-01

We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

PubMed

Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

2018-05-01

Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Genome-wide association study of red blood cell traits in Hispanics/Latinos: The Hispanic Community Health Study/Study of Latinos

PubMed Central

Morrison, Jean V.; Brown, Lisa; Schurmann, Claudia; Chen, Diane D.; Liu, Yong Mei; Auer, Paul L.; Taylor, Kent D.; Papanicolaou, George; Kurita, Ryo; Nakamura, Yukio; Loos, Ruth J. F.; North, Kari E.; Thornton, Timothy A.; Pankratz, Nathan; Bauer, Daniel E.

2017-01-01

Prior GWAS have identified loci associated with red blood cell (RBC) traits in populations of European, African, and Asian ancestry. These studies have not included individuals with an Amerindian ancestral background, such as Hispanics/Latinos, nor evaluated the full spectrum of genomic variation beyond single nucleotide variants. Using a custom genotyping array enriched for Amerindian ancestral content and 1000 Genomes imputation, we performed GWAS in 12,502 participants of Hispanic Community Health Study and Study of Latinos (HCHS/SOL) for hematocrit, hemoglobin, RBC count, RBC distribution width (RDW), and RBC indices. Approximately 60% of previously reported RBC trait loci generalized to HCHS/SOL Hispanics/Latinos, including African ancestral alpha- and beta-globin gene variants. In addition to the known 3.8kb alpha-globin copy number variant, we identified an Amerindian ancestral association in an alpha-globin regulatory region on chromosome 16p13.3 for mean corpuscular volume and mean corpuscular hemoglobin. We also discovered and replicated three genome-wide significant variants in previously unreported loci for RDW (SLC12A2 rs17764730, PSMB5 rs941718), and hematocrit (PROX1 rs3754140). Among the proxy variants at the SLC12A2 locus we identified rs3812049, located in a bi-directional promoter between SLC12A2 (which encodes a red cell membrane ion-transport protein) and an upstream anti-sense long-noncoding RNA, LINC01184, as the likely causal variant. We further demonstrate that disruption of the regulatory element harboring rs3812049 affects transcription of SLC12A2 and LINC01184 in human erythroid progenitor cells. Together, these results reinforce the importance of genetic study of diverse ancestral populations, in particular Hispanics/Latinos. PMID:28453575

Inhibition of G9a methyltransferase stimulates fetal hemoglobin production by facilitating LCR/γ-globin looping.

PubMed

Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L

2015-07-30

Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

PubMed Central

Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

2012-01-01

This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.

PubMed

Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold

2017-02-13

Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in hypoxia tolerance evolution of Gymnotiform electric fishes.

Specific repression of β-globin promoter activity by nuclear ferritin

PubMed Central

Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

2001-01-01

Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

PubMed

An, S F; Fleming, K A

1991-11-01

A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis.

PubMed

Hallur, V; Sehgal, R; Khurana, S

2015-01-01

The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer

PubMed Central

Wilber, Andrew; Hargrove, Phillip W.; Kim, Yoon-Sang; Riberdy, Janice M.; Sankaran, Vijay G.; Papanikolaou, Eleni; Georgomanoli, Maria; Anagnou, Nicholas P.; Orkin, Stuart H.; Nienhuis, Arthur W.

2011-01-01

β-Thalassemia major results from severely reduced or absent expression of the β-chain of adult hemoglobin (α2β2;HbA). Increased levels of fetal hemoglobin (α2γ2;HbF), such as occurs with hereditary persistence of HbF, ameliorate the severity of β-thalassemia, raising the potential for genetic therapy directed at enhancing HbF. We used an in vitro model of human erythropoiesis to assay for enhanced production of HbF after gene delivery into CD34+ cells obtained from mobilized peripheral blood of normal adults or steady-state bone marrow from patients with β-thalassemia major. Lentiviral vectors encoding (1) a human γ-globin gene with or without an insulator, (2) a synthetic zinc-finger transcription factor designed to interact with the γ-globin gene promoters, or (3) a short-hairpin RNA targeting the γ-globin gene repressor, BCL11A, were tested. Erythroid progeny of normal CD34+ cells demonstrated levels of HbF up to 21% per vector copy. For β-thalassemic CD34+ cells, similar gene transfer efficiencies achieved HbF production ranging from 45% to 60%, resulting in up to a 3-fold increase in the total cellular Hb content. These observations suggest that both lentiviral-mediated γ-globin gene addition and genetic reactivation of endogenous γ-globin genes have potential to provide therapeutic HbF levels to patients with β-globin deficiency. PMID:21156846

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

PubMed

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

Running, swimming and diving modifies neuroprotecting globins in the mammalian brain

PubMed Central

Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S

2007-01-01

The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537

Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

PubMed

Xie, Guosen; Mo, Zhongxi

2011-01-21

In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

β-Globin-Expressing Definitive Erythroid Progenitor Cells Generated from Embryonic and Induced Pluripotent Stem Cell-Derived Sacs.

PubMed

Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John

2016-06-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552. © 2016 AlphaMed Press.

Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia

PubMed Central

Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.

2013-01-01

Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047

Frequency of haemoglobinopathies and glucose-6-phosphate dehydrogenase deficiency in Basra.

PubMed

Hassan, M K; Taha, J Y; Al-Naama, L M; Widad, N M; Jasim, S N

2003-01-01

Basra, southern Iraq, was mapped for haemoglobinopathies and glucose-6-phosphate dehydrogenase (G6PD) deficiency. Of 1064 couples aged 14-60 years recruited from the Public Health Laboratory, 49 had beta-thalassaemia trait, 69 had sickle-cell trait, 2 had haemoglobin D trait, 2 had haemoglobin C trait and 1 had high persistent fetal haemoglobin. Carriers of major beta-globin disorders comprised 11.48%. G6PD deficiency was detected in 133 individuals (12.5%). Only 10 couples (0.94%) were at risk of having children affected with either sickle-cell disease or beta-thalassaemia major. These defects constitute a real health problem and necessitate a management plan and public health education for early diagnosis and therapy.

Hb Hope [beta136(H14)Gly-->Asp (GGT-->GAT)]: interactions with Hb S [beta6(A3)Glu-->Val (GAG-->GTG)], other variant hemoglobins and thalassemia.

PubMed

Ingle, John; Adewoye, Adeboye; Dewan, Robert; Okoli, Michael; Rollins, Lamarr; Eung, Shawn H; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H

2004-01-01

Hb Hope [beta136(H14)Gly-->Asp (GGT-->GAT)] was first described in an African-American family in 1965. Since then, it has been found in combination with several different globin gene mutations in many other families of divergent ethnic backgrounds. The basis for its relatively frequent occurrences remains unexplained. This variant hemoglobin (Hb) is mildly unstable and has reduced oxygen affinity, but is generally innocuous clinically. This variant Hb can present as a confounding factor in arriving at a correct diagnosis by either electrophoresis or high performance liquid chromatography (HPLC), particularly during the neonatal period. DNA-based diagnostics can help solve this potential problem.

Novel numerical and graphical representation of DNA sequences and proteins.

PubMed

Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

2006-12-01

We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

Prevalence of βS-globin gene haplotypes, α-thalassemia (3.7 kb deletion) and redox status in patients with sickle cell anemia in the state of Paraná, Brazil

PubMed Central

Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina

2015-01-01

The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435

Target-based drug discovery for [Formula: see text]-globin disorders: drug target prediction using quantitative modeling with hybrid functional Petri nets.

PubMed

Mehraei, Mani; Bashirov, Rza; Tüzmen, Şükrü

2016-10-01

Recent molecular studies provide important clues into treatment of [Formula: see text]-thalassemia, sickle-cell anaemia and other [Formula: see text]-globin disorders revealing that increased production of fetal hemoglobin, that is normally suppressed in adulthood, can ameliorate the severity of these diseases. In this paper, we present a novel approach for drug prediction for [Formula: see text]-globin disorders. Our approach is centered upon quantitative modeling of interactions in human fetal-to-adult hemoglobin switch network using hybrid functional Petri nets. In accordance with the reverse pharmacology approach, we pose a hypothesis regarding modulation of specific protein targets that induce [Formula: see text]-globin and consequently fetal hemoglobin. Comparison of simulation results for the proposed strategy with the ones obtained for already existing drugs shows that our strategy is the optimal as it leads to highest level of [Formula: see text]-globin induction and thereby has potential beneficial therapeutic effects on [Formula: see text]-globin disorders. Simulation results enable verification of model coherence demonstrating that it is consistent with qPCR data available for known strategies and/or drugs.

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

Amoebozoa Possess Lineage-Specific Globin Gene Repertoires Gained by Individual Horizontal Gene Transfers

PubMed Central

Dröge, Jasmin; Buczek, Dorota; Suzuki, Yutaka; Makałowski, Wojciech

2014-01-01

The Amoebozoa represent a clade of unicellular amoeboid organisms that display a wide variety of lifestyles, including free-living and parasitic species. For example, the social amoeba Dictyostelium discoideum has the ability to aggregate into a multicellular fruiting body upon starvation, while the pathogenic amoeba Entamoeba histolytica is a parasite of humans. Globins are small heme proteins that are present in almost all extant organisms. Although several genomes of amoebozoan species have been sequenced, little is known about the phyletic distribution of globin genes within this phylum. Only two flavohemoglobins (FHbs) of D. discoideum have been reported and characterized previously while the genomes of Entamoeba species are apparently devoid of globin genes. We investigated eleven amoebozoan species for the presence of globin genes by genomic and phylogenetic in silico analyses. Additional FHb genes were identified in the genomes of four social amoebas and the true slime mold Physarum polycephalum. Moreover, a single-domain globin (SDFgb) of Hartmannella vermiformis, as well as two truncated hemoglobins (trHbs) of Acanthamoeba castellanii were identified. Phylogenetic evidence suggests that these globin genes were independently acquired via horizontal gene transfer from some ancestral bacteria. Furthermore, the phylogenetic tree of amoebozoan FHbs indicates that they do not share a common ancestry and that a transfer of FHbs from bacteria to amoeba occurred multiple times. PMID:25013378

[Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

PubMed

Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

2012-12-01

Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

Factor IX gene haplotypes in Amerindians.

PubMed

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

[Beta thalassemia major and pregnancy during adolescence: report of two cases].

PubMed

Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

2015-06-01

Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

PubMed

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

Association between Oxidative Stress, Genetic Factors, and Clinical Severity in Children with Sickle Cell Anemia.

PubMed

Renoux, Céline; Joly, Philippe; Faes, Camille; Mury, Pauline; Eglenen, Buse; Turkay, Mine; Yavas, Gokce; Yalcin, Ozlem; Bertrand, Yves; Garnier, Nathalie; Cuzzubbo, Daniela; Gauthier, Alexandra; Romana, Marc; Möckesch, Berenike; Cannas, Giovanna; Antoine-Jonville, Sophie; Pialoux, Vincent; Connes, Philippe

2018-04-01

To investigate the associations between several sickle cell disease genetic modifiers (beta-globin haplotypes, alpha-thalassemia, and glucose-6-phosphate dehydrogenase deficiency) and the level of oxidative stress and to evaluate the association between oxidative stress and the rates of vaso-occlusive events. Steady-state oxidative and nitrosative stress markers, biological variables, genetic modulators, and vaso-occlusive crisis events requiring emergency admissions were measured during a 2-year period in 62 children with sickle cell anemia (58 SS and 4 Sβ 0 ). Twelve ethnic-matched children without sickle cell anemia also participated as healthy controls (AA) for oxidative and nitrosative stress level measurement. Oxidative and nitrosative stress were greater in patients with sickle cell anemia compared with control patients, but the rate of vaso-occlusive crisis events in sickle cell anemia was not associated with the level of oxidative stress. The presence of alpha-thalassemia, but not glucose-6-phosphate dehydrogenase deficiency or beta-globin haplotype, modulated the level of oxidative stress in children with sickle cell anemia. Mild hemolysis in children with alpha-thalassemia may limit oxidative stress and could explain the protective role of alpha-thalassemia in hemolysis-related sickle cell complications. Copyright © 2017 Elsevier Inc. All rights reserved.

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Trans activation of plasmid-borne promoters by adenovirus and several herpes group viruses.

PubMed Central

Everett, R D; Dunlop, M

1984-01-01

This paper describes experiments to test the ability of a number of viruses of the Herpes group, and also Adenovirus-2 and SV40, to activate transcription from the Herpes simplex virus-1 glycoprotein D and the rabbit beta-globin promoters. Plasmids containing these genes were transfected into HeLa cells which were then infected with various viruses. Transcriptional activation in trans of the plasmid-borne promoters was monitored by quantitative S1 nuclease analysis of total cytoplasmic RNA isolated after infection. The results showed that Herpes simplex viruses 1 and 2, Pseudorabies virus, Variella Zoster virus, Human Cytomegalovirus, Equine herpes virus-1 and Adenovirus-2 activate transcription from both promoters tested. In contrast, SV40 did not activate transcription in trans in this assay. The possible mechanisms of this activation are discussed. Images PMID:6089105

Detection of human papillomavirus in pterygium and conjunctival papilloma by hybrid capture II and PCR assays.

PubMed

Takamura, Y; Kubo, E; Tsuzuki, S; Akagi, Y

2008-11-01

To elucidate the putative role of human papillomavirus (HPV) infection in pterygium and conjunctival papilloma. Hybrid capture II (HC-II) and polymerase chain reaction (PCR) assays were performed to detect HPV in pterygium (42 samples obtained from 40 patients) and conjunctival papilloma (8 samples from 6 patients). The amount of HPV DNA was evaluated by measurement of relative light units (RLUs) on a luminometer. All papilloma samples were positive for HPV DNA by PCR and HC-II. The RLU values for specimens of recurrent and re-recurrent papilloma were markedly higher than those for specimens of primary lesions. HPV was detected by PCR in 2 of 42 (4.8%) beta-globin-positive pterygium specimens, whereas HC-II showed that HPV was negative in all pterygium samples. Our results support the hypothesis that HPV DNA is associated with the pathogenesis of conjunctival papilloma, but not pterygium. RLU measurement by HC-II may serve as a marker for evaluating the activity of HPV in conjunctival tumours.

Human papilloma virus in oral squamous cell carcinoma in a Mexican population.

PubMed

Ibieta, Blanca R; Lizano, Marcela; Fras-Mendivil, Mauricio; Barrera, José L; Carrillo, Adela; Ma Ruz-Godoy, Luz; Mohar, Alejandro

2005-03-01

To determine the human papilloma virus (HPV) infection in oral cancer and its association with smoking and drinking habits. A cross-sectional study was performed; samples were collected from 51 patients with histological diagnosis of squamous-cell carcinoma were collected at the Instituto Nacional de Cancerología in Mexico City. HPV infection was detected by polymerase chain reaction, and the clinical characteristics of this population were analyzed. Fifty samples out of 51 were positive for beta-globin; 21 (42%) cases were HPV-positive, and 14/21 were positive for HPV-16. We found more samples positive in men than in women (71% vs 29%). No differences were observed between HPV-positive and -negative patients in relation to smoking and drinking habits (81% vs 79%). HPV infection was present in 42% of patients with oral squamous-cell carcinoma (OSCC); HPV-16 was the most frequent type, identified in 66.6%. Other cofactors participate in the development of OSCC, independent of HPV infection.

The developmental genetics of human hemoglobin.

PubMed

Weatherall, D J; Wood, W G; Jones, R W; Clegg, J B

1985-01-01

Clearly, it is impossible to combine the diverse information briefly outlined in this review to provide a coherent model of the regulation of globin gene expression during development. One of the great difficulties in this field is uncertainty as to whether the mutations which are associated with persistent gamma chain production or, for the matter, the experimental models which have been used to study the differential expression of the fetal and adult globin genes, have any real relevance to an understanding of the normal switching process. Probably they do, but only with respect to one aspect of what must be an extremely complex multi-step regulatory system. The consistent changes in chromatin and methylation state of the beta globin gene cluster which are associated with activation of the different gene loci at different stages of development provide an anatomical explanation for the activity of these loci but tell us nothing about their mode of regulation. However, the gene or chromosome transfer experiments suggest that there may be developmental-stage specific trans regulatory factors which may be involved in the regulation of these genes, presumably by interacting in some way with chromatin. This is a very promising lead. Equally interesting is the possibility that the upstream mutations which are being found in some of the forms of non-deletion HPFH could provide a clue as to the site of these interactions. Thus at least we have an indication of what might be the most productive area of investigation for trying to characterize the mechanisms of regulation at the chromosomal level. This may be as far as we can go in the immediate future. The central question remains, however. How is the differential expression of the globin genes during development actually timed? All we know at the moment is that it is related fairly closely to gestational age. The only experimental data relating to this question is derived from the sheep transplant model, and suggests that there might be some form of "developmental clock' built into the hemopoietic stem cell. Here we are in considerable difficulties because we don't have an obvious experimental model with which to analyze time-related events. None of the forms of HPFH is, strictly speaking, a heterochronic mutation.(ABSTRACT TRUNCATED AT 400 WORDS)

Splice-Site Mutations Cause Rrp6-Mediated Nuclear Retention of the Unspliced RNAs and Transcriptional Down-Regulation of the Splicing-Defective Genes

PubMed Central

Eberle, Andrea B.; Hessle, Viktoria; Helbig, Roger; Dantoft, Widad; Gimber, Niclas; Visa, Neus

2010-01-01

Background Eukaryotic cells have developed surveillance mechanisms to prevent the expression of aberrant transcripts. An early surveillance checkpoint acts at the transcription site and prevents the release of mRNAs that carry processing defects. The exosome subunit Rrp6 is required for this checkpoint in Saccharomyces cerevisiae, but it is not known whether Rrp6 also plays a role in mRNA surveillance in higher eukaryotes. Methodology/Principal Findings We have developed an in vivo system to study nuclear mRNA surveillance in Drosophila melanogaster. We have produced S2 cells that express a human β-globin gene with mutated splice sites in intron 2 (mut β-globin). The transcripts encoded by the mut β-globin gene are normally spliced at intron 1 but retain intron 2. The levels of the mut β-globin transcripts are much lower than those of wild type (wt) ß-globin mRNAs transcribed from the same promoter. We have compared the expression of the mut and wt β-globin genes to investigate the mechanisms that down-regulate the production of defective mRNAs. Both wt and mut β-globin transcripts are processed at the 3′, but the mut β-globin transcripts are less efficiently cleaved than the wt transcripts. Moreover, the mut β-globin transcripts are less efficiently released from the transcription site, as shown by FISH, and this defect is restored by depletion of Rrp6 by RNAi. Furthermore, transcription of the mut β-globin gene is significantly impaired as revealed by ChIP experiments that measure the association of the RNA polymerase II with the transcribed genes. We have also shown that the mut β-globin gene shows reduced levels of H3K4me3. Conclusions/Significance Our results show that there are at least two surveillance responses that operate cotranscriptionally in insect cells and probably in all metazoans. One response requires Rrp6 and results in the inefficient release of defective mRNAs from the transcription site. The other response acts at the transcription level and reduces the synthesis of the defective transcripts through a mechanism that involves histone modifications. PMID:20634951

A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

PubMed Central

Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

2018-01-01

Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

Modulating Vascular Hemodynamics With an Alpha Globin Mimetic Peptide (HbαX).

PubMed

Keller, T C Stevenson; Butcher, Joshua T; Broseghini-Filho, Gilson Brás; Marziano, Corina; DeLalio, Leon J; Rogers, Stephen; Ning, Bo; Martin, Jennifer N; Chechova, Sylvia; Cabot, Maya; Shu, Xiahong; Best, Angela K; Good, Miranda E; Simão Padilha, Alessandra; Purdy, Michael; Yeager, Mark; Peirce, Shayn M; Hu, Song; Doctor, Allan; Barrett, Eugene; Le, Thu H; Columbus, Linda; Isakson, Brant E

2016-12-01

The ability of hemoglobin to scavenge the potent vasodilator nitric oxide (NO) in the blood has been well established as a mechanism of vascular tone homeostasis. In endothelial cells, the alpha chain of hemoglobin (hereafter, alpha globin) and endothelial NO synthase form a macromolecular complex, providing a sink for NO directly adjacent to the production source. We have developed an alpha globin mimetic peptide (named HbαX) that displaces endogenous alpha globin and increases bioavailable NO for vasodilation. Here we show that, in vivo, HbαX administration increases capillary oxygenation and blood flow in arterioles acutely and produces a sustained decrease in systolic blood pressure in normal and angiotensin II-induced hypertensive states. HbαX acts with high specificity and affinity to endothelial NO synthase, without toxicity to liver and kidney and no effect on p50 of O 2 binding in red blood cells. In human vasculature, HbαX blunts vasoconstrictive response to cumulative doses of phenylephrine, a potent constricting agent. By binding to endothelial NO synthase and displacing endogenous alpha globin, HbαX modulates important metrics of vascular function, increasing vasodilation and flow in the resistance vasculature. © 2016 American Heart Association, Inc.

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

PubMed Central

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-01-01

Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from β-globin. PMID:17688704

The Full Globin Repertoire of Turtles Provides Insights into Vertebrate Globin Evolution and Functions.

PubMed

Schwarze, Kim; Singh, Abhilasha; Burmester, Thorsten

2015-06-15

Globins are small heme proteins that play an important role in oxygen supply, but may also have other functions. Globins offer a unique opportunity to study the functional evolution of genes and proteins. We have characterized the globin repertoire of two different turtle species: the Chinese softshell turtle (Pelodiscus sinensis) and the western painted turtle (Chrysemys picta bellii). In the genomes of both species, we have identified eight distinct globin types: hemoglobin (Hb), myoglobin, neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Therefore, along with the coelacanth, turtles are so far the only known vertebrates with a full globin repertoire. This fact allows for the first time a comparative analysis of the expression of all eight globins in a single species. Phylogenetic analysis showed an early divergence of neuroglobin and globin X before the radiation of vertebrates. Among the other globins, cytoglobin diverged first, and there is a close relationship between myoglobin and globin E; the position of globin Y is not resolved. The globin E gene was selectively lost in the green anole, and the genes coding for globin X and globin Y were deleted in chicken. Quantitative real-time reverse transcription polymerase chain reaction experiments revealed that myoglobin, neuroglobin, and globin E are highly expressed with tissue-specific patterns, which are in line with their roles in the oxidative metabolism of the striated muscles, the brain, and the retina, respectively. Histochemical analyses showed high levels of globin E in the pigment epithelium of the eye. Globin E probably has a myoglobin-like role in transporting O2 across the pigment epithelium to supply in the metabolically highly active retina. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Creating a monomeric endonuclease TALE-I-SceI with high specificity and low genotoxicity in human cells.

PubMed

Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi

2015-01-01

To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

PubMed

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

PubMed

Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

2006-01-01

The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

Multiple displacement amplification on single cell and possible PGD applications.

PubMed

Hellani, Ali; Coskun, Serdar; Benkhalifa, Moncef; Tbakhi, Abelghani; Sakati, Nadia; Al-Odaib, Ali; Ozand, Pinar

2004-11-01

Multiple displacement amplification (MDA) is a technique used in the amplification of very low amounts of DNA and reported to yield large quantities of high-quality DNA. We used MDA to amplify the whole genome directly from a single cell. The most common techniques used in PGD are PCR and fluorescent in-situ hybridization (FISH). There are many limitations to these techniques including, the number of chromosomes diagnosed for FISH or the quality of DNA issued from a single cell PCR. This report shows, for the first time, use of MDA for single cell whole genome amplification. A total of 16 short tandem repeats (STRs) were amplified successfully with a similar pattern to the genomic DNA. Furthermore, allelic drop out (ADO) derived from MDA was assessed in 40 single cells by analysing (i) heterozygosity for a known beta globin mutation (IVSI-5 C-G) and by studying (ii) the heterozygous loci present in the STRs. ADO turned out to be 10.25% for the beta globin gene sequencing and 5% for the fluorescent PCR analysis of STRs. Moreover, the amplification accuracy of MDA permitted the detection of trisomy 21 on a single cell using comparative genome hybridization-array. Altogether, these data suggest that MDA can be used for single cell molecular karyotyping and the diagnosis of any single gene disorder in PGD.

Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

PubMed

Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

2014-02-01

Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

PubMed

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus)

PubMed Central

Lu, Weiqun; Mayolle, Aurelie; Cui, Guoqiang; Luo, Lei; Balment, Richard J.

2011-01-01

In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW. PMID:21969841

Electrocardiographic Presentation, Cardiac Arrhythmias, and Their Management in β-Thalassemia Major Patients.

PubMed

Russo, Vincenzo; Rago, Anna; Papa, Andrea Antonio; Nigro, Gerardo

2016-07-01

Beta-thalassemia major (β-TM) is a genetic hemoglobin disorder characterized by an absent synthesis of globin chains that are essential for hemoglobin formation, causing chronic hemolytic anemia. Clinical management of thalassemia major consists in regular long-life red blood cell transfusions and iron chelation therapy to remove iron introduced in excess with transfusions. Iron deposition in combination with inflammatory and immunogenic factors is involved in the pathophysiology of cardiac dysfunction in these patients. Heart failure and arrhythmias, caused by myocardial siderosis, are the most important life-limiting complications of iron overload in beta-thalassemia patients. Cardiac complications are responsible for 71% of global death in the beta-thalassemia major patients. The aim of this review was to describe the most frequent electrocardiographic abnormalities and arrhythmias observed in β-TM patients, analyzing their prognostic impact and current treatment strategies. © 2016 Wiley Periodicals, Inc.

Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

PubMed

Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

1997-05-01

The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

PubMed

Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

2007-05-01

We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

PubMed Central

Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

2014-01-01

Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

Clinical, genetic and fertility studies of Indians with beta S-globin gene and the influence of Hb S on Plasmodium falciparum malaria infection.

PubMed

Joishy, S K; Hassan, K; Lopes, M; Lie-Injo, L E

1988-01-01

Clinical studies were carried out on mild Indian sickle cell anaemia in Malaysia, and genetic and fertility studies were carried out on 101 families with and without sickle-cell haemoglobin (Hb S). The Indian sickle cell anaemia patients reached adulthood, and pregnancies and deliveries were uneventful without blood transfusion. There was no foetal wastage and the number of children produced was not significantly different from that in families without Hb S. 28 Indian patients hospitalized with Plasmodium falciparum malaria infection were also examined for their beta S genotype. P. falciparum malaria infection occurred much more frequently in individuals without Hb S than in Hb S carriers.

Molecular basis of beta-thalassemia in the Maldives.

PubMed

Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

1998-03-01

We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

High prevalence of human papillomavirus type 58 in Mexican colposcopy patients.

PubMed

González-Losa, Maria del Refugio; Rosado-Lopez, Iván; Valdez-González, Nina; Puerto-Solís, Marylín

2004-03-01

Cervical cancer is the second most common cancer of the women worldwide. Infection with some genotypes of human papillomavirus is the most important risk factor associated to cervical cancer. To determine the prevalence and genotypes of papillomavirus in biopsies of women with squamous intraepithelial lesion and cervical cancer. Two hundred sequential patients of colposcopy clinic were studied. HPV diagnosis was done by polymerase chain reaction using MY09/MY11 primers, for genotyping line blot hybridization was used. A total of 186 women were beta globin positive; 104 (55.9%) had histology diagnosis of low-grade squamous intraepitelial lesions (LSIL), 67 (36.0%) high-grade squamous intraepitelial lesions (HSIL) and 15 (8.1%) invasive cervical cancer (IC). The prevalence of HPV was 56.4% (104/185); HPV 58 was founded in 28.5% of all positive women, HPV 16 in 25.7%, HPV 18 in 13.3%, HPV 33 in 11.4% and 31 in 8.5%. In all grades of the lesions HPV 58 was the most frequently. The high prevalence of HPV 58 among Mexican women with HSIL and IC, has important implications in prophylaxis.

Human papillomavirus types in invasive cervical cancer specimens from Turkey.

PubMed

Usubütün, Alp; Alemany, Laia; Küçükali, Türkan; Ayhan, Ali; Yüce, Kunter; de Sanjosé, Silvia; Font, Rebeca; Lloveras, Belen; Klaustermeier, Joellen; Quint, Wim; Muñoz, Nubia; Bosch, Francesc Xavier

2009-11-01

The main aim of the study is to describe the human papillomavirus (HPV) type-specific distribution in invasive cervical cancer (ICC) specimens from Turkey. Paraffin-embedded ICC specimens were identified from the histopathologic archives of the Hacettepe University Medical School in Turkey. HPV detection was carried out through amplification of HPV DNA by a SPF-10 broad-spectrum primer polymerase chain reaction and subsequently followed by DNA enzyme immunoassay and genotyping by LiPA25 (version 1). Two hundred seventy-seven ICC cases diagnosed between 1993 and 2004 were retrieved. After histologic evaluation and human beta-globin gene analysis for sample quality, 248 cases were considered suitable for HPV/DNA testing. HPV prevalence was 93.5% (232/248; 95% confidence interval: 90.5%-96.6%). The five most common HPV types identified as single types among HPV-positive cases were HPV16 (64.7%), HPV18 (9.9%), HPV45 (9.9%), HPV31 (3.0%), and HPV33 (2.2%). The study shows that in Turkey, HPV16/HPV18 accounted for 75.4% (95% confidence interval: 69.9%-81.0%) of HPV-positive ICC cases. This information is essential to evaluate the potential impact of the HPV vaccines in the country.

EXPERIMENTAL STUDIES IN ACUTE RENAL FAILURE

PubMed Central

Menefee, Max G.; Mueller, C. Barber; Miller, Tracy B.; Myers, Joseph K.; Bell, Allen L.

1964-01-01

When purified human globin is injected intravenously into rats it produces acute renal failure characterized by tubular casts and oliguria. The globin is identifiable within vesicles and channels in the cytoplasm of the proximal tubules, through which it passes from lumen to basal side with no apparent serious effect on the cells. When a very minimal amount of globin is taken up by cells of the distal limb of Henle's loop or distal tubules (lower nephron), a markedly deleterious effect is apparent and the cells die within a short time. The mixture of cell debris and precipitated globin forms plugs within the confines of the basement membranes of the former distal limbs and distal tubules. After a number of lower nephrons are plugged a disruption of proximal tubules is found, which apparently results from the effect of back pressure in the obstructed nephrons. We suggest that any amount in excess of a low threshold of globin, either alone or combined with heme or related material, has a toxic effect on lower nephron cells. Once initiated, the toxic effect is not reversible and the resulting plug of debris and precipitate will occlude the lumen. If a sufficient number of nephrons are made non-functional the animal becomes anuric; otherwise it is oliguric. A high rate of urine flow will protect against the excess absorption of material and thus against acute renal failure. PMID:14238931

In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene

PubMed Central

Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.

2011-01-01

Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues were determined and secondary structures were observed for solvent accessibility to confirm the protein stability. The functional study in this investigation may be a good model for additional future studies. PMID:22028795

Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

PubMed Central

Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

2008-01-01

Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

Hemoglobin switching in sheep and goats. VI. Commitment of erythroid colony-forming cells to the synthesis of betaC globin

PubMed Central

1976-01-01

Bone marrow from mature goats and sheep was cultured in plasma clots, and three erythropoietin (ESF)-dependent responses-growth (colony formation), differentiation (globin production), and initiation of hemoglobin C (alpha2beta2C) synthesis--were quantitated. ESF concentrations below 0.01 U/ml supported colony growth and adult hemoglobin production in cultures of goat marrow, while maximal hemoglobin C synthesis (70%), as measured between 72 and 96 h in culture, required a 100-fold higher ESF concentration. Sheep marrow was cultured in a medium enriched to enhance growth and to permit complete maturation of colonies. These colonies active in hemoglobin synthesis between 24 and 96 h produced mainly adult hemoglobin, and only between 96 and 120 h did sheep colonies develop which produced mainly hemoglobin C (up to 70%). A similar heterogeneity may exist among goat colonies. Thus, when goat bone marrow was fractionated by unit gravity sedimentation, more hemoglobin C synthesis was observed in colonies derived from cells of intermediate sedimentation velocity than in colonies derived from the most rapidly sedimenting cells. Brief exposure of sheep (in vivo) and goat (in vitro) bone marrow to a high ESF concentration committed precursor cells to the generation of colonies which, even at low ESF concentration, produced hemoglobin C. Committment to hemoglobin phenotype appears to be an early and probably irreversible event in the development of an erythroid cell. PMID:993267

Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

PubMed

Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

2002-04-01

We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

PubMed Central

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

THE ANTIGENIC PROPERTIES OF GLOBIN CASEINATE

PubMed Central

Gay, Frederick P.; Robertson, T. Brailsford

1913-01-01

This study of globin and its compound with casein (globin caseinate) shows that globin fails to produce fixation antibodies in rabbits after repeated injections, thus agreeing with our own work and with that of others with similar histon bodies which are primarily toxic. When globin is combined with casein, however, it gives rise to antibodies that react not only with globin caseinate and casein but also with globin. The antibodies in antiglobin casein serum are apparently separate, one for globin and one for casein. In other words, the change in globin undergone on combination with casein has apparently rendered it antigenic. We did not succeed in demonstrating the genesis of this new antigenic property by anaphylaxis experiments. A further investigation of similar and more complex combined proteins is indicated and gives promise of more light on the nature of biological specificity. PMID:19867665

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rund, D.; Cohen, T.; Filon, D.

{beta}-Thalassemia is a hereditary disease caused by any of 90 different point mutations in the {beta}-globin gene. Specific populations generally carry a small number of mutations, the most common of which are those that are widely distributed regionally. The present study constitutes an extensive molecular characterization of this disease in a small, highly inbred ethnic group with a high incidence of {beta}-thalassemia-the Jews of Kurdistan. An unusual mutational diversity was observed. In 42 sibships 13 different mutations were identified, of which 3 are newly discovered. Four of the mutations are unique to Kurdish Jews and have not been discovered inmore » any other population. A fifth was found outside Kurdish Jews only in an Iranian from Khuzistan, a region bordering Kurdistan. Two-thirds of the mutant chromosomes carry the mutations unique to Kurdish Jews. The authors traced the origin of the mutations to specific geographic regions within Kurdistan. This information, supported by haplotype analysis, suggests that thalassemia in central Kurdistan (northern Iraq) has evolved primarily from multiple mutational events. They conclude that several evolutionary mechanisms contributed to the evolution of {beta}-thalassemia in this small ethnic isolate.« less

Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

PubMed

Giardine, Belinda; Borg, Joseph; Higgs, Douglas R; Peterson, Kenneth R; Philipsen, Sjaak; Maglott, Donna; Singleton, Belinda K; Anstee, David J; Basak, A Nazli; Clark, Barnaby; Costa, Flavia C; Faustino, Paula; Fedosyuk, Halyna; Felice, Alex E; Francina, Alain; Galanello, Renzo; Gallivan, Monica V E; Georgitsi, Marianthi; Gibbons, Richard J; Giordano, Piero C; Harteveld, Cornelis L; Hoyer, James D; Jarvis, Martin; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N; Papadopoulos, Petros; Pavlovic, Sonja; Perseu, Lucia; Radmilovic, Milena; Riemer, Cathy; Satta, Stefania; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John S; Wiemann, Claudia; Zukic, Branka; Chui, David H K; Wajcman, Henri; Hardison, Ross C; Patrinos, George P

2011-03-20

We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories. A total of 1,941 unique genetic variants in 37 genes, encoding globins and other erythroid proteins, are currently documented in these databases, with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants, leading to a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The principles established here will serve as a model for other systems and for the analysis of other common and/or complex human genetic diseases.

Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

PubMed

Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

2011-09-01

Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

Evidence for a large expansion and subfunctionalisation of globin genes in sea anemones.

PubMed

Smith, Hayden L; Pavasovic, Ana; Surm, Joachim M; Phillips, Matthew J; Prentis, Peter J

2018-06-27

The globin gene superfamily has been well-characterised in vertebrates, however, there has been limited research in early-diverging lineages, such as phylum Cnidaria. This study aimed to identify globin genes in multiple cnidarian lineages, and use bioinformatic approaches to characterise the evolution, structure and expression of these genes. Phylogenetic analyses and in silico protein predictions showed that all cnidarians have undergone an expansion of globin genes, which likely have a hexacoordinate protein structure. Our protein modelling has also revealed the possibility of a single pentacoordinate globin lineage in anthozoan species. Some cnidarian globin genes displayed tissue and development specific expression with very few orthologous genes similarly expressed across species. Our phylogenetic analyses also revealed that eumetazoan globin genes form a polyphyletic relationship with vertebrate globin genes. Overall, our analyses suggest that a Ngb-like and GbX-like gene were most likely present in the globin gene repertoire for the last common ancestor of eumetazoans. The identification of a large-scale expansion and subfunctionalisation of globin genes in actiniarians provides an excellent starting point to further our understanding of the evolution and function of the globin gene superfamily in early-diverging lineages.

Conservation of globin genes in the "living fossil" Latimeria chalumnae and reconstruction of the evolution of the vertebrate globin family.

PubMed

Schwarze, Kim; Burmester, Thorsten

2013-09-01

The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of globins in certain taxa may be associated with changes in the oxygen-dependent metabolism. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

PubMed

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome

PubMed Central

Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.

2015-01-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. PMID:25743544

Enrichment of human hematopoietic stem/progenitor cells facilitates transduction for stem cell gene therapy.

PubMed

Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B

2015-05-01

Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.

The fate of phenylhydroxylamine in human red cells.

PubMed

Kiese, M; Taeger, K

1976-01-01

Phenylhydroxylamine added to human red cells under aerobic conditions and in the presence of glucose was partly reduced to aniline. About half the hydroxylamine was recovered as amine after a 2-hr incubation. The aniline, after acetylation, was identified as acetanilide by melting point, Rf-value in TCL as well as UV, IR, and NMR spectroscopy. The fate of the remaining phenylhydroxylamine was followed by use of 14C-labeled phenylhydroxylamine. About 30% of the total radioactivity was bound to hemoglobin or other proteins and about 20% was found in highly polar low-molecular substances which were insoluble in organic solvents. The elucidation of the sites at which phenylhydroxylamine was bound to hemoglobin was complicated by the lability of the bonds. When purified human hemoglobin had reacted with radioactive phenylhydroxylamine, large proportions of the radioactivity bound to hemoglobin were removed by treatment with acid or with PMB for separation of alpha- and beta-chains. The radioactive compound liberated from hemoglobin by acid was found to be aniline. After reaction with phenylhydroxylamine the number of SH groups titrable with PMB was found to be diminished. Pretreatment of hemoglobin with N-ethylmaleimide or PMB decreased the amount of phenylhydroxylamine bound to hemoglobin but did not fully prevent the reaction. Tryptic digestion of hemoglobin after reaction with radioactive phenylhydroxylamine yielded tryptic peptides with lower specific activity than that of hemoglobin. Chymotryptic digestion of the tryptic core yielded a core with specific activity much higher than that of hemoglobin. Fingerprinting of the tryptic or chymotryptic hydrolyzates showed the presence of peptides with high and other ones with low or no radioactivity and of radioactive compounds which did not react with ninhydrin. In the covalent binding of phenylhydroxylamine to globin the SH group beta93 plays an important role, but other yet unknown sites are also reactive.

The presence of ancient human T-cell lymphotropic virus type I provirus DNA in an Andean mummy.

PubMed

Li, H C; Fujiyoshi, T; Lou, H; Yashiki, S; Sonoda, S; Cartier, L; Nunez, L; Munoz, I; Horai, S; Tajima, K

1999-12-01

The worldwide geographic and ethnic clustering of patients with diseases related to human T-cell lymphotropic virus type I (HTLV-I) may be explained by the natural history of HTLV-I infection. The genetic characteristics of indigenous people in the Andes are similar to those of the Japanese, and HTLV-I is generally detected in both groups. To clarify the common origin of HTLV-I in Asia and the Andes, we analyzed HTLV-I provirus DNA from Andean mummies about 1,500 years old. Two of 104 mummy bone marrow specimens yielded a band of human beta-globin gene DNA 110 base pairs in length, and one of these two produced bands of HTLV-I-pX (open reading frame encoding p40x, p27x) and HTLV-I-LTR (long terminal repeat) gene DNA 159 base pairs and 157 base pairs in length, respectively. The nucleotide sequences of ancient HTLV-I-pX and HTLV-I-LTR clones isolated from mummy bone marrow were similar to those in contemporary Andeans and Japanese, although there was microheterogeneity in the sequences of some mummy DNA clones. This result provides evidence that HTLV-I was carried with ancient Mongoloids to the Andes before the Colonial era. Analysis of ancient HTLV-I sequences could be a useful tool for studying the history of human retroviral infection as well as human prehistoric migration.

Vitamin E supplement improves erythrocyte membrane fluidity of thalassemia: an ESR spin labeling study.

PubMed

Sutipornpalangkul, Werasak; Morales, Noppawan Phumala; Unchern, Supeenun; Sanvarinda, Yupin; Chantharaksri, Udom; Fucharoen, Suthat

2012-01-01

Beta-thalassemia/Hemoglobin E (beta-thal/Hb E) is prevalent in Thailand. The imbalance of globin chains in red blood cells is the primary cause of this anemic disease. The excess alpha-globin in beta-thal/Hb E causes typical damage(s) to membrane of erythroblasts and erythrocytes. By using three paramagnetic labeled compounds (5-, 12-, and 16-spin labeled stearic acids, SLS), the changes of the molecular motion in the lipid bilayer of thalassemic RBCs that have structural modification can be detected. to investigate erythrocyte membrane fluidity and the effect of vitamin E treatment in beta-thalassemia/Hemoglobin E patients by using spin labeling techniques. The erythrocyte membrane fluidity was investigated in nine splenectomized and five non-splenectomized beta-thalassemia/hemoglobin E (beta-thal/Hb E) patients using EPR spin labeling techniques. To determine the effect of vitamin E on erythrocyte membrane fluidity, only the splenectomized patients were enrolled. Patients were divided into two groups. The first group received 350 mg vitamin E daily for a period of 1 month (n = 5) and the second group received placebo for an equal period (n = 4). Three paramagnetic fatty acid, 5-, 12-, and 16-doxyl stearic acids, (5-, 12- and 16-DS) were used to label phospholipids layer near both the surface (5-DS) and the deeper hydrophobic region of membrane (12-and 16-DS). Lipid peroxidation (TBARs) was measured using a colorimetric method. Vitamin E was measured with high performance liquid chromatography (HPLC). Significantly higher values of erythrocyte membrane fluidity were revealed with 12-, 16-DS in splenectomized patients, as compared with non-splenectomized patients and normal subjects. In 3-thal/Hb E patients, fluidity values, both outer hyperfine splitting (2T(//)) and order parameter (S) of 12-DS showed inverse correlation with serum TBARs. There was no significant difference between the fluidity values measured with 5-DS. After vitamin E supplementation, the erythrocyte membrane fluidity was decreased in almost all patients. In contrast to the vitamin E supplementation group, increased erythrocyte membrane fluidity was demonstrated in the placebo group. Vitamin E supplementation also had effect on other clinical parameters such as increased plasma vitamin E, decreased serum TBARs and no change in hemoglobin. The present results suggested the abnormal motion of lipid in the deeper phospholipids region of membrane. In addition, vitamin E supplementation may have a role in the prevention of erythrocyte membrane damage of these patients.

Globin gene structure in a reptile supports the transpositional model for amniote α- and β-globin gene evolution.

PubMed

Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall

2010-12-01

The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome.

PubMed

Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F

2015-07-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A Phylogenetic Analysis of the Globins in Fungi

PubMed Central

Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.

2012-01-01

Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from the endosymbiotic events responsible for the origin of mitochondria and chloroplasts. PMID:22384087

Evolution and Expression of Tissue Globins in Ray-Finned Fishes.

PubMed

Gallagher, Michael D; Macqueen, Daniel J

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution.

Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

NASA Astrophysics Data System (ADS)

Van Doorslaer, Sabine; Cuypers, Bert

2018-02-01

At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

PubMed

Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

2014-01-01

Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

Adipocytokine concentrations in children with different types of beta-thalassemia.

PubMed

Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

2014-06-01

Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

Copy number variations of six and seven α-globin genes in a family with intermedia and major thalassemia phenotypes.

PubMed

Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-10-01

Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.

Precision Genome Editing for Treating Single-gene Disorders

NASA Astrophysics Data System (ADS)

Bao, Gang

There are an estimated 6,000 human single-gene disorders, most of them have no cure. This imposes a significant burden on human health worldwide. The recent advent in developing engineered nucleases, especially CRISPR/Cas9 (clustered, regularly interspaced, short palindromic repeats and CRISPR-associated protein 9) systems provides a powerful tool for precisely modifying the human genome, thus revolutionizing the treatment of single-gene disorders. In this talk, I will present recent work in my lab on developing new tools and methods for the design and optimization of CRISPR/Cas9 systems, and the efforts in developing a clinically applicable gene correction strategy for treating sickle cell disease (SCD), which is the first single-gene disorder with molecular understanding. We optimized CRISPR/Cas9 systems targeting the beta-globin gene, and systematically evaluated their on- and off-target cleavage in different cells. We also quantified the nuclease-induced gene modification rates in CD34+ cells from SCD patients, and demonstrated that CRISPR/Cas9 based genome editing is effective in generating normal hemoglobin (HbA) and reducing sickling hemoglobin (HbS). These studies significantly facilitated our pre-clinical investigation of SCD treatment using CRISPR/Cas9 and donor templates. The opportunities and challenges in developing nuclease-based genome editing strategies for treating single-gene disorders are discussed.

Validation of a standardized extraction method for formalin-fixed paraffin-embedded tissue samples.

PubMed

Lagheden, Camilla; Eklund, Carina; Kleppe, Sara Nordqvist; Unger, Elizabeth R; Dillner, Joakim; Sundström, Karin

2016-07-01

Formalin-fixed paraffin-embedded (FFPE) samples can be DNA-extracted and used for human papillomavirus (HPV) genotyping. The xylene-based gold standard for extracting FFPE samples is laborious, suboptimal and involves health hazards for the personnel involved. To compare extraction with the standard xylene method to a xylene-free method used in an HPV LabNet Global Reference Laboratory at the Centers for Disease Control (CDC); based on a commercial method with an extra heating step. Fifty FFPE samples were randomly selected from a national audit of all cervical cancer cases diagnosed in Sweden during 10 years. For each case-block, a blank-block was sectioned, as a control for contamination. For xylene extraction, the standard WHO Laboratory Manual protocol was used. For the CDC method, the manufacturers' protocol was followed except for an extra heating step, 120°C for 20min. Samples were extracted and tested in parallel with β-globin real-time PCR, HPV16 real-time PCR and HPV typing using modified general primers (MGP)-PCR and Luminex assays. For a valid result the blank-block had to be betaglobin-negative in all tests and the case-block positive for beta-globin. Overall, detection was improved with the heating method and the amount of HPV-positive samples increased from 70% to 86% (p=0.039). For all samples where HPV type concordance could be evaluated, there was 100% type concordance. A xylene-free and robust extraction method for HPV-DNA typing in FFPE material is currently in great demand. Our proposed standardized protocol appears to be generally useful. Copyright © 2016. Published by Elsevier B.V.

The Prevalence of Human Papilloma Virus in Esophageal Squamous Cell Carcinoma

PubMed Central

Noori, Sadat; Monabati, Ahmad; Ghaderi, Abbasali

2012-01-01

Background: Carcinomas of esophagus, mostly squamous cell carcinomas, occur throughout the world. There are a number of suspected genetic or environmental etiologies. Human papilloma virus (HPV) is said to be a major etiology in areas with high incidence of esophageal carcinoma, while it is hardly detectable in low incidence regions. This study was designed to evaluate the prevalence of HPV in esophageal squamous cell carcinoma (ESCC) cases diagnosed in Pathology Department, Medical School, Shiraz University of Medical Sciences. Methods: DNA material for PCR amplification of HPV genome was extracted from formalin-fixed paraffin-embedded tissue blocks of 92 cases of ESCC, diagnosed during 20 years from 1982 to 2002. Polymerase chain reaction was performed for amplification and detection of common HPV and type specific HPV-16 and HPV-18 genomic sequences in the presence of positive control (HPV-18 and HPV positive biopsies of uterine exocervix) and additional internal controls i.e. beta-globin and cytotoxic T lymphocyte antigen 4 (CTLA4). Result: Good amplification of positive control and internal controls was observed. However, no amplification of HPV genome was observed. Conclusion: There is no association between HPV infection and the development of esophageal squamous cell carcinoma in the cases evaluated. PMID:23115442

Evolution and Expression of Tissue Globins in Ray-Finned Fishes

PubMed Central

Gallagher, Michael D.

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution. PMID:28173090

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

PubMed

Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

2015-05-01

The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

Ancient HTLV type 1 provirus DNA of Andean mummy.

PubMed

Sonoda, S; Li, H C; Cartier, L; Nunez, L; Tajima, K

2000-11-01

The worldwide geographic and ethnic clustering of patients with diseases related to human T cell lymphotropic virus type 1 (HTLV-1) may be explained by the natural history of HTLV-1 infection. The genetic characteristics of indigenous people in the Andes are similar to those of the Japanese, and HTLV-1 is generally detected in both groups. To clarify the common origin of HTLV-1 in Asia and the Andes, we analyzed HTLV-1 provirus DNA from Andean mummies about 1500 years old. Two of 104 mummy bone marrow specimens yielded a band of human beta-globin gene DNA 110 base pairs in length, and one of these two produced bands of HTLV-1-pX (open reading frame encoding p(40x), p(27x)) and HTLV-1-LTR (long terminal repeat) gene DNA 159 base pairs and 157 base pairs in length, respectively. The nucleotide sequences of ancient HTLV-1-pX and HTLV-1-LTR clones isolated from mummy bone marrow were similar to those in contemporary Andeans and Japanese, although there was microheterogeneity in the sequences of some mummy DNA clones. This result provides evidence that HTLV-1 was carried with ancient Mongoloids to the Andes before the Colonial era. Analysis of ancient HTLV-1 sequences could be a useful tool for studying the history of human retroviral infection as well as human prehistoric migration.

Genetic modulation of sickle cell anemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steinberg, M.H.

1995-05-01

Sickle cell anemia, a common disorder associated with reduced life span of the red blood cell and vasoocclusive events, is caused by a mutation in the {Beta}-hemoglobin gene. Yet, despite this genetic homogeneity, the phenotype of the disease is heterogeneous. This suggests the modulating influence of associated inherited traits. Some of these may influence the accumulation of fetal hemoglobin, a hemoglobin type that interferes with the polymerization of sickle hemoglobin. Another inherited trait determines the accumulation of {alpha}-globin chains. This review focuses on potential genetic regulators of the phenotype of sickle cell anemia. 125 refs., 6 figs., 3 tabs.

Biophysical Characterisation of Neuroglobin of the Icefish, a Natural Knockout for Hemoglobin and Myoglobin. Comparison with Human Neuroglobin

PubMed Central

Giordano, Daniela; Boron, Ignacio; Abbruzzetti, Stefania; Van Leuven, Wendy; Nicoletti, Francesco P.; Forti, Flavio; Bruno, Stefano; Cheng, C-H. Christina; Moens, Luc; di Prisco, Guido; Nadra, Alejandro D.; Estrin, Darío; Smulevich, Giulietta; Dewilde, Sylvia; Viappiani, Cristiano; Verde, Cinzia

2012-01-01

The Antarctic icefish Chaenocephalus aceratus lacks the globins common to most vertebrates, hemoglobin and myoglobin, but has retained neuroglobin in the brain. This conserved globin has been cloned, over-expressed and purified. To highlight similarities and differences, the structural features of the neuroglobin of this colourless-blooded fish were compared with those of the well characterised human neuroglobin as well as with the neuroglobin from the retina of the red blooded, hemoglobin and myoglobin-containing, closely related Antarctic notothenioid Dissostichus mawsoni. A detailed structural and functional analysis of the two Antarctic fish neuroglobins was carried out by UV-visible and Resonance Raman spectroscopies, molecular dynamics simulations and laser-flash photolysis. Similar to the human protein, Antarctic fish neuroglobins can reversibly bind oxygen and CO in the Fe2+ form, and show six-coordination by distal His in the absence of exogenous ligands. A very large and structured internal cavity, with discrete docking sites, was identified in the modelled three-dimensional structures of the Antarctic neuroglobins. Estimate of the free-energy barriers from laser-flash photolysis and Implicit Ligand Sampling showed that the cavities are accessible from the solvent in both proteins. Comparison of structural and functional properties suggests that the two Antarctic fish neuroglobins most likely preserved and possibly improved the function recently proposed for human neuroglobin in ligand multichemistry. Despite subtle differences, the adaptation of Antarctic fish neuroglobins does not seem to parallel the dramatic adaptation of the oxygen carrying globins, hemoglobin and myoglobin, in the same organisms. PMID:23226490

Monitoring exposure to acrylonitrile using adducts with N-terminal valine in hemoglobin.

PubMed

Osterman-Golkar, S M; MacNeela, J P; Turner, M J; Walker, V E; Swenberg, J A; Sumner, S J; Youtsey, N; Fennell, T R

1994-12-01

Human exposure to acrylonitrile (ACN), a carcinogen in rats, may occur in industrial settings, through waste water and tobacco smoke. ACN is an electrophilic compound and binds covalently to nucleophilic sites in macromolecules. Measurements of adducts with hemoglobin could be utilized for improved exposure assessments. In this study, a method for quantification of N-(2-cyanoethyl)valine (CEVal), the product of reaction of ACN with N-terminal valine in hemoglobin has been developed. The method is based on the N-alkyl Edman procedure, which involves derivatization of the globin with pentafluorophenyl isothiocyanate and gas chromatographic-mass spectrometric analysis of the resulting thiohydantoin. An internal standard was prepared by reacting valylglycylglycine with [2H3]ACN, spiked with [14C]ACN to a known sp. act. Levels of CEVal were measured in globin from rats exposed to 3-300 p.p.m. ACN in drinking water for 105 days and from humans (four smokers and four non-smokers). CEVal was detected at all exposure levels in the drinking water study. The relationship between adduct level and water concentration was linear at concentrations of 10 p.p.m. (corresponding to an average daily uptake of c. 0.74 mg ACN/kg body wt during the 65 days prior to sacrifice) and below, with a slope of 37.7 pmol CEVal/g globin/p.p.m. At higher concentrations, adduct levels increased sublinearly, indicating saturation of a metabolic process for elimination of ACN. Comparison of adduct formation with the estimated dose (mg/kg/day) of ACN indicated that at low dose (0-10 p.p.m.) CEVal = 0.508 x ACN dose + 0.048 and at high dose (35-300 p.p.m.) CEVal = 1.142 x ACN dose - 1.098. Globin from the smokers (10-20 cigarettes/day) contained about 90 pmol CEVal/g, whereas the adduct levels in globin from non-smokers were below the detection limit. The analytical sensitivity should be sufficient to allow monitoring of occupationally exposed workers at levels well below the current Occupational Safety and Health Administration standard of 2 p.p.m.

Multivariate analysis of matrix-assisted laser desorption/ionization mass spectrometric data related to glycoxidation products of human globins in nephropathic patients.

PubMed

Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro

2007-06-01

To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.

Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching

NASA Astrophysics Data System (ADS)

Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai

1988-11-01

The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

PubMed

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Mathematical modeling of erythrocyte chimerism informs genetic intervention strategies for sickle cell disease.

PubMed

Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska

2016-09-01

Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Genetic determinants and stroke in children with sickle cell disease.

PubMed

Rodrigues, Daniela O W; Ribeiro, Luiz C; Sudário, Lysla C; Teixeira, Maria T B; Martins, Marina L; Pittella, Anuska M O L; Junior, Irtis de O Fernandes

To verify genetic determinants associated with stroke in children with sickle cell disease (SCD). Prospective cohort with 110 children submitted to neonatal screening by the Neonatal Screening Program, between 1998 and 2007, with SCD diagnosis, followed at a regional reference public service for hemoglobinopathies. The analyzed variables were type of hemoglobinopathy, gender, coexistence with alpha thalassemia (α-thal), haplotypes of the beta globin chain cluster, and stroke. The final analysis was conducted with 66 children with sickle cell anemia (SCA), using the chi-squared test in the program SPSS ® version 14.0. Among children with SCD, 60% had SCA. The prevalence of coexistence with α-thal was 30.3% and the Bantu haplotype (CAR) was identified in 89.2%. The incidence of stroke was significantly higher in those with SCA (27.3% vs. 2.3%; p=0.001) and males (24.1% vs. 9.6%; p=0.044). The presence of α-thal (p=0.196), the CAR haplotype (p=0.543), and socioeconomic factors were not statistically significant in association with the occurrence of stroke. There is a high incidence of stroke in male children and in children with SCA. Coexistence with α-thal and haplotypes of the beta globin chain cluster did not show any significant association with stroke. The heterogeneity between previously evaluated populations, the non-reproducibility between studies, and the need to identify factors associated with stroke in patients with SCA indicate the necessity of conducting further research to demonstrate the relevance of genetic factors in stroke related to SCD. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.

PubMed

Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten

2016-02-01

During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.

Recent trends in the gene therapy of β-thalassemia

PubMed Central

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

PubMed

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Transduction of cultured fish cells with recombinant baculoviruses.

PubMed

Leisy, Douglas J; Lewis, Teresa D; Leong, Jo-Ann C; Rohrmann, George F

2003-05-01

Five fish cell lines were tested for their ability to be transduced by Ac-CAlacZ, a recombinant baculovirus that is capable of expressing a beta-galactosidase reporter gene from the CAG promoter (consisting of a cytomegalovirus enhancer element, a chicken actin promoter and rabbit beta-globin termination sequences). TO (Tilapia ovary), EPC (carp), CHH-1 (Chum salmon heart fibroblast) and CHSE-214 (chinook salmon embryo) cells were transducible, as demonstrated by an in situ beta-galactosidase assay, whereas RTG-2 (rainbow trout gonad) cells were not. The EPC cell line was used for more detailed studies on baculovirus transduction. The transduction frequency was found to be higher at 28 degrees C than at 21 degrees C. Addition of the histone deacetylase inhibitor sodium butyrate increased the number of blue cells detected 5- to 7-fold. The m.o.i. was positively correlated with transduction frequency, although the relationship did not appear to be strictly linear, as has been observed with mammalian cells. The temperature at which baculoviruses were adsorbed to EPC cells did not affect levels of beta-galactosidase expression. We also examined expression levels of beta-galactosidase in EPC cells after infection with a baculovirus construct that overexpresses the vesicular stomatitis virus G protein and displays it on the virion surface. Expression levels with this virus were approximately 15-fold higher than were observed with Ac-CAlacZ.

Isolation of RNA for dot hybridization by heparin-DNase I treatment of whole cell lysate.

PubMed

Krawczyk, Z; Wu, C

1987-08-15

We have developed a new procedure for the rapid preparation of undegraded total RNA from cultured cells for specific quantitation by dot blotting analysis. Pelleted cells are resuspended in hypotonic solution containing a ribonuclease inhibitor and heparin and disrupted by freeze-thaw. Heparin is employed as an agent for nuclear lysis, dissociation of chromosomal protein, and release of mRNA from rough endoplasmic reticulum. We eliminate chromosomal DNA by digestion with DNase I and denature the RNA in the lysate with formaldehyde. After centrifugation to remove debris, the supernatant is used directly for dot blotting. All manipulations are performed in the same microfuge tube and recovery of RNA is quantitative. The procedure is especially useful for processing large numbers of samples. We illustrate its versatility by analysis of specific RNAs in Drosophila, rat, and human cell lines. In reconstruction experiments, less than 80 molecules per cell of a small RNA (beta-globin) can be detected under highly stringent hybridization conditions, using only moderately labeled double-stranded plasmid DNA probes and short film exposures.

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

PubMed

Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

2015-01-01

We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

Possible etiologic heterogeneity of vulvar intraepithelial neoplasia. A correlation of pathologic characteristics with human papillomavirus detection by in situ hybridization and polymerase chain reaction.

PubMed

Park, J S; Jones, R W; McLean, M R; Currie, J L; Woodruff, J D; Shah, K V; Kurman, R J

1991-03-15

A correlated histopathologic and molecular virologic study of 30 cases of vulvar intraepithelial neoplasia Grade 3 (VIN 3) and six associated invasive vulvar carcinomas was performed. Paraffin sections were examined for human papillomavirus (HPV) types 6, 11, 16, and 18 by in situ hybridization for viral transcripts and by polymerase chain reaction (PCR) for amplification of HPV and of the beta-globin gene. Vulvar intraepithelial neoplasia Grade 3 was histologically subclassified into warty (bowenoid) (20 cases) and basaloid (undifferentiated) (ten cases) types. Warty VIN characteristically was composed of squamous cells displaying abnormal proliferation and maturation and an undulating or spiked surface creating a "condylomatous" appearance whereas basaloid VIN had a smooth surface and was composed of undifferentiated basaloid cells resembling carcinoma in situ of the cervix. Human papillomavirus-16 was the only type detected in 16 of 30 VIN 3 and in five of six invasive carcinomas. The HPV-positive women were younger than HPV-negative women (mean age at diagnosis, 49 versus 60 years), their lesions more frequently demonstrated koilocytotic atypia (94% versus 43%), and they were more likely to have warty compared with basaloid VIN lesions (65% versus 30%). These findings suggest that there are at least two different types of VIN which have differing clinical, pathologic, and viral profiles.

Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

PubMed Central

Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

2015-01-01

Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

PubMed

Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

2010-11-01

We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

Impact of radio frequency electromagnetic radiation on DNA integrity in the male germline.

PubMed

Aitken, R J; Bennetts, L E; Sawyer, D; Wiklendt, A M; King, B V

2005-06-01

Concern has arisen over human exposures to radio frequency electromagnetic radiation (RFEMR), including a recent report indicating that regular mobile phone use can negatively impact upon human semen quality. These effects would be particularly serious if the biological effects of RFEMR included the induction of DNA damage in male germ cells. In this study, mice were exposed to 900 MHz RFEMR at a specific absorption rate of approximately 90 mW/kg inside a waveguide for 7 days at 12 h per day. Following exposure, DNA damage to caudal epididymal spermatozoa was assessed by quantitative PCR (QPCR) as well as alkaline and pulsed-field gel electrophoresis. The treated mice were overtly normal and all assessment criteria, including sperm number, morphology and vitality were not significantly affected. Gel electrophoresis revealed no gross evidence of increased single- or double-DNA strand breakage in spermatozoa taken from treated animals. However, a detailed analysis of DNA integrity using QPCR revealed statistically significant damage to both the mitochondrial genome (p < 0.05) and the nuclear beta-globin locus (p < 0.01). This study suggests that while RFEMR does not have a dramatic impact on male germ cell development, a significant genotoxic effect on epididymal spermatozoa is evident and deserves further investigation.

DNA fingerprinting in zoology: past, present, future.

PubMed

Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

2014-02-03

In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Lalley, P.A.; Whitney, J.B.

A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less

A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

2015-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

Balanced globin protein expression and heme biosynthesis improve production of human hemoglobin in Saccharomyces cerevisiae.

PubMed

Liu, Lifang; Martínez, José L; Liu, Zihe; Petranovic, Dina; Nielsen, Jens

2014-01-01

Due to limitations associated with whole blood for transfusions (antigen compatibility, transmission of infections, supply and storage), the use of cell-free hemoglobin as an oxygen carrier substitute has been in the center of research interest for decades. Human hemoglobin has previously been synthesized in yeast, however the challenge is to balance the expression of the two different globin subunits, as well as the supply of the prosthetic heme required for obtaining the active hemoglobin (α2β2). In this work we evaluated the expression of different combinations of α and β peptides and combined this with metabolic engineering of the heme biosynthetic pathway. Through evaluation of several different strategies we showed that engineering the biosynthesis pathway can substantially increase the heme level in yeast cells, and this resulted in a significant enhancement of human hemoglobin production. Besides demonstration of improved hemoglobin production our work demonstrates a novel strategy for improving the production of complex proteins, especially multimers with a prosthetic group. © 2013 Published by International Metabolic Engineering Society on behalf of International Metabolic Engineering Society.

A Practical Platform for Blood Biomarker Study by Using Global Gene Expression Profiling of Peripheral Whole Blood

PubMed Central

Schmid, Patrick; Yao, Hui; Galdzicki, Michal; Berger, Bonnie; Wu, Erxi; Kohane, Isaac S.

2009-01-01

Background Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study. Methods and Findings We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal. Conclusion We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study. PMID:19381341

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

[Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

PubMed

Scheps, Karen G; Varela, Viviana

Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

PubMed

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

β-globin gene cluster haplotypes in ethnic minority populations of southwest China

PubMed Central

Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

2017-01-01

The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

The locus control region is required for association of the murine β-globin locus with engaged transcription factories during erythroid maturation

PubMed Central

Ragoczy, Tobias; Bender, M.A.; Telling, Agnes; Byron, Rachel; Groudine, Mark

2006-01-01

We have examined the relationship between nuclear localization and transcriptional activity of the endogenous murine β-globin locus during erythroid differentiation. Murine fetal liver cells were separated into distinct erythroid maturation stages by fluorescence-activated cell sorting, and the nuclear position of the locus was determined at each stage. We find that the β-globin locus progressively moves away from the nuclear periphery with increasing maturation. Contrary to the prevailing notion that the nuclear periphery is a repressive compartment in mammalian cells, βmajor-globin expression begins at the nuclear periphery prior to relocalization. However, relocation of the locus to the nuclear interior with maturation is accompanied by an increase in βmajor-globin transcription. The distribution of nuclear polymerase II (Pol II) foci also changes with erythroid differentiation: Transcription factories decrease in number and contract toward the nuclear interior. Moreover, both efficient relocalization of the β-globin locus from the periphery and its association with hyperphosphorylated Pol II transcription factories require the locus control region (LCR). These results suggest that the LCR-dependent association of the β-globin locus with transcriptionally engaged Pol II foci provides the driving force for relocalization of the locus toward the nuclear interior during erythroid maturation. PMID:16705039

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

PubMed Central

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Feasibility and acceptance of cervicovaginal self-sampling within the German National Cohort (Pretest 2).

PubMed

Castell, Stefanie; Krause, G; Schmitt, M; Pawlita, M; Deleré, Y; Obi, N; Flesch-Janys, D; Kemmling, Y; Kaufmann, A M

2014-11-01

Within the German National Cohort (GNC) 100,000 adult women in Germany will be comprehensively interviewed and examined. While women's health is addressed in the basic interview, direct detection of cervicovaginal microbial colonisation or infection is not part of the examination protocol. In a pilot project the feasibility of female study participants of the GNC collecting a cervicovaginal lavage at home without having to involve a gynecologist or other medical personnel was thus investigated. The ability of the procedure to detect vaginal microbes and conditions including human papillomavirus (HPV), Chlamydia trachomatis and bacterial vaginosis (BV) were also explored. This cross-sectional study was conducted in two study centers (Hamburg and Hanover) of the GNC during Pretest 2 in 2012 as an add-on module to the main program of the National Cohort. Participants were randomly selected through the population registration office. After providing written informed consent at the study center, participants self-collected a cervicovaginal lavage (Delphi Screener™) at home following written instructions. Participants mailed samples and acceptability questionnaires to the laboratory and the study center, respectively. Acceptability of self-sampling was categorized as consent, partial consent and rejection. The samples were analyzed by multiplex HPV genotyping for the presence of 27 mucosal HPV subtypes. To detect other pathogens "Sexually Transmitted Infection Profiling" (STIP) was used, a novel multiplex polymerase chain reaction (PCR) for various vaginally occurring pathogens/conditions coupled with subsequent bead-based Luminex(®) hybridization. Human beta-globin and DNA polymerase alpha (PolA) sequences were used as positive controls for the detection of human DNA during HPV detection and STIP, respectively. The participation based on the proportion of all women in Pretest 2 who could take part in the add-on Pretest 2 was 67.3 % (109 out of 162). The age of participants ranged from 20 to 69 years. The self-reported median duration of the collection of the lavage was 5 min. Analysis of the questionnaires (n = 108) revealed that the self-sampling of a cervicovaginal lavage was acceptable to 98 % of women (106 out of 108), and considered to be easy by 89 % (96 out of 108) as well as user-friendly by 96 % of the women (104 out of 108). Human beta-globin and PolA as markers for human DNA and sample quality were detected in all samples analyzed while HPV as a marker for pathogen detectability was identified in 18 out of 109 samples. Of the 107 samples tested with STIP as a second marker for pathogen detectability, 5 samples were excluded from statistical analyses on bacterial colonization because of signs in the laboratory results of the use of antibiotics. For the computation of the possible occurrence of bacterial vaginosis and candidiasis 7 and 8 samples, respectively, were excluded because of low signal intensities resulting in an evaluation of 95 or 94 samples, respectively. Ureaplasma parvum was detected in 22 out of 102 samples, BV in 14 out of 95 samples and candidiasis in 13 out of 94 samples. Chlamydia trachomatis was not detected in any sample. The feasibility study on cervicovaginal self-sampling indicates that this form of biosampling was very well accepted within the framework of the GNC and feasible in terms of pathogen detection. Its further application in the GNC would allow investigation of transience and persistence, or long-term effects of vaginal (co)infections and colonization.

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

Human papillomavirus genotype distribution and cervical squamous intraepithelial lesions among high-risk women with and without HIV-1 infection in Burkina Faso

PubMed Central

Didelot-Rousseau, M-N; Nagot, N; Costes-Martineau, V; Vallès, X; Ouedraogo, A; Konate, I; Weiss, H A; Van de Perre, P; Mayaud, P; Segondy, M

2006-01-01

Human papillomavirus (HPV) infection and cervical squamous intraepithelial lesions (SILs) were studied in 379 high-risk women. Human papillomavirus DNA was detected in 238 of 360 (66.1%) of the beta-globin-positive cervical samples, and 467 HPV isolates belonging to 35 types were identified. Multiple (2–7 types) HPV infections were observed in 52.9% of HPV-infected women. The most prevalent HPV types were HPV-52 (14.7%), HPV-35 (9.4%), HPV-58 (9.4%), HPV-51 (8.6%), HPV-16 (7.8%), HPV-31 (7.5%), HPV-53 (6.7%), and HPV-18 (6.4%). Human immunodeficiency virus type 1 (HIV-1) seroprevalence was 36.0%. Human papillomavirus prevalence was significantly higher in HIV-1-infected women (87 vs 54%, prevalence ratio (PR)=1.61, 95% confidence interval (CI): 1.4–1.8). High-risk HPV types (71 vs 40%, PR=1.79, 95% CI: 1.5–2.2), in particular HPV-16+18 (22 vs 9%, PR=2.35, 95% CI: 1.4–4.0), and multiple HPV infections (56 vs 23%, PR=2.45, 95% CI: 1.8–3.3) were more prevalent in HIV-1-infected women. High-grade SIL (HSIL) was identified in 3.8% of the women. Human immunodeficiency virus type 1 infection was strongly associated with presence of HSIL (adjusted odds ratio=17.0; 95% CI 2.2–134.1, P=0.007) after controlling for high-risk HPV infection and other risk factors for HSIL. Nine of 14 (63%) HSIL cases were associated with HPV-16 or HPV-18 infection, and might have been prevented by an effective HPV-16/18 vaccine. PMID:16832413

A Functional Element Necessary for Fetal Hemoglobin Silencing

PubMed Central

Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

2011-01-01

BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

PubMed Central

Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

2003-01-01

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412

Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

PubMed

Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

2016-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

PubMed Central

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Postnatal and non-invasive prenatal detection of β-thalassemia mutations based on Taqman genotyping assays

PubMed Central

Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto

2017-01-01

The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086

Potentially Therapeutic Levels of Anti-Sickling Globin Gene Expression Following Lentivirus-mediated Gene Transfer in Sickle Cell Disease Bone Marrow CD34+ Cells

PubMed Central

Urbinati, Fabrizia; Hargrove, Philip W.; Geiger, Sabine; Romero, Zulema; Wherley, Jennifer; Kaufman, Michael L.; Hollis, Roger P.; Chambers, Christopher B.; Persons, Derek A.; Kohn, Donald B.; Wilber, Andrew

2015-01-01

Sickle cell disease (SCD) can be cured by allogeneic hematopoietic stem cell (HSC) transplant. However, this is only possible when a matched donor is available making the development of gene therapy using autologous HSCs a highly desired alternative. We used a culture model of human erythropoiesis to directly compare two insulated, self-inactivating, and erythroid-specific lentiviral vectors, encoding for γ-globin (V5m3-400) or a modified β-globin (βAS3-FB) for production of anti-sickling hemoglobin (Hb) and correction of red cell deformability after deoxygenation. Bone marrow CD34+ cells from three SCD patients were transduced using V5m3-400 or βAS3-FB and compared to mock transduced SCD or healthy donor CD34+ cells. Lentiviral transduction did not impair cell growth or differentiation, as gauged by proliferation and acquisition of erythroid markers. Vector copy number averaged ~1 copy per cell and corrective globin mRNA levels were increased more than 7-fold over mock-transduced controls. Erythroblasts derived from healthy donor and mock-transduced SCD cells produced a low level of HbF that was increased to 23.6 ± 4.1% per vector copy for cells transduced with V5m3-400. Equivalent levels of modified HbA of 17.6 ± 3.8% per vector copy were detected for SCD cells transduced with βAS3-FB. These levels of anti-sickling Hb production were sufficient to reduce sickling of terminal stage RBCs upon deoxygenation. We conclude that the achieved levels of HbF and modified HbA would likely prove therapeutic to SCD patients who lack matched donors. PMID:25681747

DNA extraction from formalin-fixed, paraffin-embedded tissues: protein digestion as a limiting step for retrieval of high-quality DNA.

PubMed

Díaz-Cano, S J; Brady, S P

1997-12-01

Several DNA extraction methods have been used for formalin-fixed, paraffin-embedded tissues, with variable results being reported regarding the suitability of DNA obtained from such sources to serve as template in polymerase chain reaction (PCR)-based genetic analyses. We present a method routinely used for archival material in our laboratory that reliably yields DNA of sufficient quality for PCR studies. This method is based on extended proteinase K digestion (250 micrograms/ml in an EDTA-free calcium-containing buffer supplemented with mussel glycogen) followed by phenol-chloroform extraction. Agarose gel electrophoresis of both digestion buffer aliquots and PCR amplification of the beta-globin gene tested the suitability of the retrieved DNA for PCR amplification.

Genetic correction of β-thalassemia patient-specific iPS cells and its use in improving hemoglobin production in irradiated SCID mice.

PubMed

Wang, Yixuan; Zheng, Chen-Guang; Jiang, Yonghua; Zhang, Jiqin; Chen, Jiayu; Yao, Chao; Zhao, Qingguo; Liu, Sheng; Chen, Ke; Du, Juan; Yang, Ze; Gao, Shaorong

2012-04-01

The generation of induced pluripotent stem cells (iPSCs) from differentiated somatic cells by over-expression of several transcription factors has the potential to cure many genetic and degenerative diseases currently recalcitrant to traditional clinical approaches. One such genetic disease is β-thalassemia major (Cooley's anemia). This disease is caused by either a point mutation or the deletion of several nucleotides in the β-globin gene, and it threatens the lives of millions of people in China. In the present study, we successfully generated iPSCs from fibroblasts collected from a 2-year-old patient who was diagnosed with a homozygous 41/42 deletion in his β-globin gene. More importantly, we successfully corrected this genetic mutation in the β-thalassemia iPSCs by homologous recombination. Furthermore, transplantation of the genetically corrected iPSCs-derived hematopoietic progenitors into sub-lethally irradiated immune deficient SCID mice showed improved hemoglobin production compared with the uncorrected iPSCs. Moreover, the generation of human β-globin could be detected in the mice transplanted with corrected iPSCs-derived hematopietic progenitors. Our study provides strong evidence that iPSCs generated from a patient with a genetic disease can be corrected by homologous recombination and that the corrected iPSCs have potential clinical uses.

Diverse hematological phenotypes of β-thalassemia carriers.

PubMed

Luo, Hong-Yuan; Chui, David H K

2016-03-01

Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vidaud, M.; Vidaud, D.; Amselem, S.

The authors have characterized a Mediterranean {beta}-thalassemia allele containing a sequence change at codon 30 that alters both {beta}-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G {yields} C transversion at position {minus}1 of intron 1 reduces severely the utilization of the normal 5{prime} splice site since the level of the Arg {yields} Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position {minus}1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated themore » role of this nucleotide in the constitution of an active 5{prime} splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5.« less

β-Thalassemia.

PubMed

Origa, Raffaella

2017-06-01

β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.

High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

PubMed Central

Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

2015-01-01

Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

2015-01-01

The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

[Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

PubMed

Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

2002-08-01

To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV < 85 fl) and elevated levels of Hb A(2) (>/=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were found to be the compound heterozygosity for a beta-thal and an alpha-thal with 9 different types of gene defects with a detection rate 1.22%. Data from ecidation of alpha and beta-thal gene frequencies and mutation spectrum in Liuzhou city was useful for genetic counselling and prenatal diagnosis of this disease.

Gene Therapy in a Patient with Sickle Cell Disease.

PubMed

Ribeil, Jean-Antoine; Hacein-Bey-Abina, Salima; Payen, Emmanuel; Magnani, Alessandra; Semeraro, Michaela; Magrin, Elisa; Caccavelli, Laure; Neven, Benedicte; Bourget, Philippe; El Nemer, Wassim; Bartolucci, Pablo; Weber, Leslie; Puy, Hervé; Meritet, Jean-François; Grevent, David; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Ross, Robert W; Negre, Olivier; Veres, Gabor; Sandler, Laura; Soni, Sandeep; de Montalembert, Mariane; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina

2017-03-02

Sickle cell disease results from a homozygous missense mutation in the β-globin gene that causes polymerization of hemoglobin S. Gene therapy for patients with this disorder is complicated by the complex cellular abnormalities and challenges in achieving effective, persistent inhibition of polymerization of hemoglobin S. We describe our first patient treated with lentiviral vector-mediated addition of an antisickling β-globin gene into autologous hematopoietic stem cells. Adverse events were consistent with busulfan conditioning. Fifteen months after treatment, the level of therapeutic antisickling β-globin remained high (approximately 50% of β-like-globin chains) without recurrence of sickle crises and with correction of the biologic hallmarks of the disease. (Funded by Bluebird Bio and others; HGB-205 ClinicalTrials.gov number, NCT02151526 .).

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: implications for the enzyme mechanism.

PubMed

Ogura, Hiroshi; Evans, John P; Peng, Dungeng; Satterlee, James D; Ortiz de Montellano, Paul R; La Mar, Gerd N

2009-04-14

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase 1 (hHO) has been investigated by (1)H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. Two-dimensional (1)H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts that places the lone iron pi-spin in the d(xz) orbital, rather than the d(yz) orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy, and magnetic susceptibilities argues for a low-spin, (d(xy))(2)(d(yz),d(xz))(3), ground state in both azide and cyanide complexes. The switch from singly occupied d(yz) for the cyanide to d(xz) for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide pi-plane in the latter complex, which is approximately 90 degrees in-plane rotated from that of the imidazole pi-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicates that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 --> Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed.

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: Implications for the enzyme mechanism‡

PubMed Central

Ogura, Hiroshi; Evans, John P.; Peng, Dungeng; Satterlee, James D.; de Montellano, Paul R. Ortiz; Mar, Gerd N. La

2009-01-01

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase-1, (hHO) has been investigated by 1H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. 2D 1H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts, that places the lone iron π-spin in the dxz orbital, rather than the dyz orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy and magnetic susceptibilities argues for a low-spin, (dxy)2(dyz,dxz)3, ground state in both azide and cyanide complexes. The switch from singly-occupied dyz for the cyanide to dxz for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide π-plane in the latter complex, which is ∼90° in-plane rotated from that of the imidazole π-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicate that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 → Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed. PMID:19243105

Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

PubMed

Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva

2012-01-01

Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

PubMed Central

Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

2001-01-01

A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

Coexistence of multiple globin genes conferring protection against nitrosative stress to the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125.

PubMed

Coppola, Daniela; Giordano, Daniela; Milazzo, Lisa; Howes, Barry D; Ascenzi, Paolo; di Prisco, Guido; Smulevich, Giulietta; Poole, Robert K; Verde, Cinzia

2018-02-28

Despite the large number of globins recently discovered in bacteria, our knowledge of their physiological functions is restricted to only a few examples. In the microbial world, globins appear to perform multiple roles in addition to the reversible binding of oxygen; all these functions are attributable to the heme pocket that dominates functional properties. Resistance to nitrosative stress and involvement in oxygen chemistry seem to be the most prevalent functions for bacterial globins, although the number of globins for which functional roles have been studied via mutation and genetic complementation is very limited. The acquisition of structural information has considerably outpaced the physiological and molecular characterisation of these proteins. The genome of the Antarctic cold-adapted bacterium Pseudoalteromonas haloplanktis TAC125 (PhTAC125) contains genes encoding three distinct single-chain 2/2 globins, supporting the hypothesis of their crucial involvement in a number of functions, including protection against oxidative and nitrosative stress in the cold and O 2 -rich environment. In the genome of PhTAC125, the genes encoding 2/2 globins are constitutively transcribed, thus suggesting that these globins are not functionally redundant in their physiological function in PhTAC125. In the present study, the physiological role of one of the 2/2 globins, Ph-2/2HbO-2217, was investigated by integrating in vivo and in vitro results. This role includes the involvement in the detoxification of reactive nitrogen and O 2 species including NO by developing two in vivo and in vitro models to highlight the protective role of Ph-2/2HbO-2217 against reactive nitrogen species. The PSHAa2217 gene was cloned and over-expressed in the flavohemoglobin-deficient mutant of Escherichia coli and the growth properties and O 2 uptake in the presence of NO of the mutant carrying the PSHAa2217 gene were analysed. The ferric form of Ph-2/2HbO-2217 is able to catalyse peroxynitrite isomerisation in vitro, indicating its potential role in the scavenging of reactive nitrogen species. Here we present in vitro evidence for the detoxification of NO by Ph-2/2HbO-2217. Copyright © 2017. Published by Elsevier Inc.

Transcriptional regulation of fetal to adult hemoglobin switching: new therapeutic opportunities

PubMed Central

Wilber, Andrew; Nienhuis, Arthur W.

2011-01-01

In humans, embryonic, fetal, and adult hemoglobins are sequentially expressed in developing erythroblasts during ontogeny. For the past 40 years, this process has been the subject of intensive study because of its value to enlighten the biology of developmental gene regulation and because fetal hemoglobin can significantly ameliorate the clinical manifestations of both sickle cell disease and β-thalassemia. Understanding the normal process of loss of fetal globin expression and activation of adult globin expression could potentially lead to new therapeutic approaches for these hemoglobin disorders. Herein, we briefly review the history of the study of hemoglobin switching and then focus on recent discoveries in the field that now make new therapeutic approaches seem feasible in the future. Erythroid-specific knockdown of fetal gene repressors or enforced expression of fetal gene activators may provide clinically applicable approaches for genetic treatment of hemoglobin disorders that would benefit from increased fetal hemoglobin levels. PMID:21321359

Stimulation of globin synthesis: relative responsiveness of reticulocytes and nucleated erythroid cells

PubMed Central

Waxman, Herbert S.

1970-01-01

The effects of iron, cobalt, hemin, and plasma on hemoglobin synthesis by suspensions of rabbit reticulocytes and nucleated bone marrow cells were studied. L-Leucine-14C and sodium pyruvate-3-14C were employed to measure globin and heme synthesis, respectively. Normal plasma (or serum) was found to stimulate the rate of globin synthesis in both systems. The stimulatory effects of iron and hemin were additive to those of plasma or serum only in the reticulocytes. Cobaltous ion, at concentrations less than 1.0 mmole/liter, was found to stimulate globin synthesis by reticulocytes as effectively as ferrous ion; cobalt was inhibitory only at concentrations greater than 3.0-5.0 mmoles/liter. Heme synthesis by reticulocytes was inhibited at all concentrations employed (0.2-5.0 mmoles/liter). In bone marrow nucleated erythroid cells, globin synthesis was markedly enhanced by exogenous hemin. In contrast to reticulocytes, however, bone marrow cells were unresponsive to either cobalt or transferrin-bound iron. Possible implications of these findings on regulation of the rate and mechanism of iron uptake and hemoglobin synthesis in vivo are discussed. PMID:5443172

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

PubMed

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.

PubMed

Liang, Puping; Xu, Yanwen; Zhang, Xiya; Ding, Chenhui; Huang, Rui; Zhang, Zhen; Lv, Jie; Xie, Xiaowei; Chen, Yuxi; Li, Yujing; Sun, Ying; Bai, Yaofu; Songyang, Zhou; Ma, Wenbin; Zhou, Canquan; Huang, Junjiu

2015-05-01

Genome editing tools such as the clustered regularly interspaced short palindromic repeat (CRISPR)-associated system (Cas) have been widely used to modify genes in model systems including animal zygotes and human cells, and hold tremendous promise for both basic research and clinical applications. To date, a serious knowledge gap remains in our understanding of DNA repair mechanisms in human early embryos, and in the efficiency and potential off-target effects of using technologies such as CRISPR/Cas9 in human pre-implantation embryos. In this report, we used tripronuclear (3PN) zygotes to further investigate CRISPR/Cas9-mediated gene editing in human cells. We found that CRISPR/Cas9 could effectively cleave the endogenous β-globin gene (HBB). However, the efficiency of homologous recombination directed repair (HDR) of HBB was low and the edited embryos were mosaic. Off-target cleavage was also apparent in these 3PN zygotes as revealed by the T7E1 assay and whole-exome sequencing. Furthermore, the endogenous delta-globin gene (HBD), which is homologous to HBB, competed with exogenous donor oligos to act as the repair template, leading to untoward mutations. Our data also indicated that repair of the HBB locus in these embryos occurred preferentially through the non-crossover HDR pathway. Taken together, our work highlights the pressing need to further improve the fidelity and specificity of the CRISPR/Cas9 platform, a prerequisite for any clinical applications of CRSIPR/Cas9-mediated editing.

Energetic Differences at The Subunit Interfaces of Normal Human Hemoglobins Correlate with Their Developmental Profile†

PubMed Central

Manning, Lois R.; Russell, J. Eric; Popowicz, Anthony M.; Manning, Robert S.; Padovan, Julio C.; Manning, James M.

2013-01-01

A previously unrecognized function of normal human hemoglobins occurring during protein assembly is described - - self-regulation of subunit pairings and their durations arising from the variable strengths of their subunit interactions. Although it is known that many mutant human hemoglobins have altered subunit interface strengths, those of the normal embryonic, fetal, and adult human hemoglobins have not been considered to differ significantly. However, in a comprehensive study of both types of subunit interfaces of seven of the eight normal oxy human hemoglobins, we found that the strength, i.e. the free energies of the tetramer-dimer interfaces, contrary to previous reports, differ by 3-orders of magnitude and display an undulating profile similar to the transitions (“switches”) of various globin subunit types over time. The dimer interface strengths are also variable and correlate linearly with their developmental profile; embryonic hemoglobins are the weakest, fetal hemoglobin is of intermediate strength, and adult hemoglobins are the strongest. The pattern also correlates generally with their different O2 affinities and responses to allosteric regulatory molecules. Acetylation of fetal hemoglobin weakens its unusually strong subunit interactions and occurs progressively as its expression diminishes and adult hemoglobin A formations begins; a causal relationship is suggested. The relative contributions of globin gene order and competition among subunits due to differences in their interface strengths were found to be complementary and establish a connection between genetics, thermodynamics, and development. PMID:19583196

Sickle cell anemia in northern Israel: screening and prevention.

PubMed

Koren, Ariel; Zalman, Lucia; Palmor, Haya; Zamir, Ronit Bril; Levin, Carina; Openheim, Ariella; Daniel-Spiegel, Etty; Shalev, Stavit; Filon, Dvora

2009-04-01

Sickle cell anemia is a hemolytic anemia caused by a single mutation in position 6 of the beta globin molecule. About 80 patients with SCA in northern Israel are currently receiving treatment. To assess a screening program in northern Israel aimed at detecting couples at risk for having offspring with SCA. Since 1987, screening for beta thalassemia in pregnant women in northern Israel has been conducted, and from 1999 all the samples were also tested for hemoglobin S, Hgb C, Hgb D, Hgb O Arab and others. During the 20 year period 1987-2006 a total of 69,340 women were screened; 114 couples who carried Hgb S were detected and 187 prenatal diagnoses were performed in couples at risk for having an offspring with Hgb S. The mean gestational age was 13 +/- 4 weeks. Fifty-four of those diagnoses revealed affected fetuses and in 4 cases the couple declined to perform therapeutic abortion. The economic burden to the health services for treating SCA patients is about U.S.$ 7000 per year, and the institution of prevention programs has proven cost-effective in populations with a high frequency of carriers. Since our program is aimed to also detect beta thalassemia, a disease that is more frequent in this area (> 2.5%), the added cost for the prevention of SCA is less significant despite the low incidence of the S gene in our population, namely < 1%.

High-performance genetic analysis on microfabricated capillary array electrophoresis plastic chips fabricated by injection molding.

PubMed

Dang, Fuquan; Tabata, Osamu; Kurokawa, Masaya; Ewis, Ashraf A; Zhang, Lihua; Yamaoka, Yoshihisa; Shinohara, Shouji; Shinohara, Yasuo; Ishikawa, Mitsuru; Baba, Yoshinobu

2005-04-01

We have developed a novel technique for mass production of microfabricated capillary array electrophoresis (mu-CAE) plastic chips for high-speed, high-throughput genetic analysis. The mu-CAE chips, containing 10 individual separation channels of 50-microm width, 50-microm depth, and a 100-microm lane-to-lane spacing at the detection region and a sacrificial channel network, were fabricated on a poly(methyl methacrylate) substrate by injection molding and then bonded manually using a pressure-sensitive sealing tape within several seconds at room temperature. The conditions for injection molding and bonding were carefully characterized to yield mu-CAE chips with well-defined channel and injection structures. A CCD camera equipped with an image intensifier was used to monitor simultaneously the separation in a 10-channel array with laser-induced fluorescence detection. High-performance electrophoretic separations of phiX174 HaeIII DNA restriction fragments and PCR products related to the human beta-globin gene and SP-B gene (the surfactant protein B) have been demonstrated on mu-CAE plastic chips using a methylcellulose sieving matrix in individual channels. The current work demonstrated greatly simplified the fabrication process as well as a detection scheme for mu-CAE chips and will bring the low-cost mass production and application of mu-CAE plastic chips for genetic analysis.

Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

PubMed

Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

1999-07-30

A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

Plasmodium falciparum malaria skews globin gene expression balance in in-vitro haematopoietic stem cell culture system: Its implications in malaria associated anemia.

PubMed

Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha

2018-02-01

Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.

Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

PubMed

Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

2010-01-01

Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

PubMed Central

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

NASA Astrophysics Data System (ADS)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

AHSP: a novel hemoglobin helper

PubMed Central

Bank, Arthur

2007-01-01

Recently, the small protein α hemoglobin–stabilizing protein (AHSP) was identified and found to specifically bind α-globin, stabilize its structure, and limit the toxic effects of excess α-globin, which are manifest in the inherited blood disorder β thalassemia. In this issue of the JCI, Yu, Weiss, and colleagues show that AHSP is also critical to the formation and stabilization of normal amounts of hemoglobin, even when α-globin is deficient, indicating unique and previously unidentified roles for this molecule (see the related article beginning on page 1856). PMID:17607349

Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

PubMed Central

Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

2015-01-01

Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

Comparison of the DNA extraction methods for polymerase chain reaction amplification from formalin-fixed and paraffin-embedded tissues.

PubMed

Sato, Y; Sugie, R; Tsuchiya, B; Kameya, T; Natori, M; Mukai, K

2001-12-01

To obtain an adequate quality and quantity of DNA from formalin-fixed and paraffin-embedded tissue, six different DNA extraction methods were compared. Four methods used deparaffinization by xylene followed by proteinase K digestion and phenol-chloroform extraction. The temperature of the different steps was changed to obtain higher yields and improved quality of extracted DNA. The remaining two methods used microwave heating for deparaffinization. The best DNA extraction method consisted of deparaffinization by microwave irradiation, protein digestion with proteinase K at 48 degrees C overnight, and no further purification steps. By this method, the highest DNA yield was obtained and the amplification of a 989-base pair beta-globin gene fragment was achieved. Furthermore, DNA extracted by means of this procedure from five gastric carcinomas was successfully used for single strand conformation polymorphism and direct sequencing assays of the beta-catenin gene. Because the microwave-based DNA extraction method presented here is simple, has a lower contamination risk, and results in a higher yield of DNA compared with the ordinary organic chemical reagent-based extraction method, it is considered applicable to various clinical and basic fields.

Gene cooption and convergent evolution of oxygen transport hemoglobins in jawed and jawless vertebrates

PubMed Central

Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

2010-01-01

Natural selection often promotes evolutionary innovation by coopting preexisting genes for new functions, and this process may be greatly facilitated by gene duplication. Here we report an example of cooptive convergence where paralogous members of the globin gene superfamily independently evolved a specialized O2 transport function in the two deepest branches of the vertebrate family tree. Specifically, phylogenetic evidence demonstrates that erythroid-specific O2 transport hemoglobins evolved independently from different ancestral precursor proteins in jawed vertebrates (gnathostomes) and jawless fish (cyclostomes, represented by lamprey and hagfish). A comprehensive phylogenetic analysis of the vertebrate globin gene superfamily revealed that the erythroid hemoglobins of cyclostomes are orthologous to the cytoglobin protein of gnathostome vertebrates, a hexacoordinate globin that has no O2 transport function and that is predominantly expressed in fibroblasts and related cell types. The phylogeny reconstruction also revealed that vertebrate-specific globins are grouped into four main clades: (i) cyclostome hemoglobin + cytoglobin, (ii) myoglobin + globin E, (iii) globin Y, and (iv) the α- and β-chain hemoglobins of gnathostomes. In the hemoglobins of gnathostomes and cyclostomes, multisubunit quaternary structures provide the basis for cooperative O2 binding and allosteric regulation by coupling the effects of ligand binding at individual subunits with interactions between subunits. However, differences in numerous structural details belie their independent origins. This example of convergent evolution of protein function provides an impressive demonstration of the ability of natural selection to cobble together complex design solutions by tinkering with different variations of the same basic protein scaffold. PMID:20660759

Involvement of H-ras in erythroid differentiation of TF1 and human umbilical cord blood CD34 cells.

PubMed

Ge, Y; Li, Z H; Marshall, M S; Broxmeyer, H E; Lu, L

1998-06-01

To investigate the role of the ras gene in erythroid differentiation, a human erythroleukemic cell line, TF1, was transduced with a selectable retroviral vector carrying a mammalian wild type H-ras gene or a cytoplasmic dominant negative RAS1 gene. Transduction of TF1 cells with the wild type H-ras gene resulted in changes of cell types and up-regulation of erythroid-specific gene expression similar to that seen in differentiating erythroid cells. The number of red blood cell containing colonies derived from TF1 cells transduced with wild type H-ras cDNA was significantly increased and the cells in the colonies were more hemoglobinized as estimated by a deeper red color compared to those colony cells from mock or dominant negative RAS1 gene transduced TF1 cells, suggesting increased erythroid differentiation of TF1 cells after transduction of wild type H-ras in vitro. The mRNA levels of beta- and gamma-, but not alpha-, globin genes were significantly higher in H-ras transduced TF1 cells than those in TF1 cells transduced with mock or dominant negative RAS1 gene. Moreover, a 4kb pre-mRNA of the Erythropoietin receptor (EpoR) was highly expressed only in H-ras transduced TF1 cells. Additionally, human umbilical cord blood (CB) CD34 cells which are highly enriched for hematopoietic stem/progenitor cells were transduced with the same retroviral vectors to evaluate in normal primary cells the activities of H-ras in erythroid differentiation. Increased numbers of erythroid cell containing colonies (BFU-E and CFU-GEMM) were observed in CD34 cells transduced with the H-ras cDNA, compared to that from mock transduced cells. These data suggest a possible role for ras in erythroid differentiation.

Coexpression of Human α- and Circularly Permuted β-Globins Yields a Hemoglobin with Normal R State but Modified T State Properties†

PubMed Central

Asmundson, Anna L.; Taber, Alexandria M.; van der Walde, Adella; Lin, Danielle H.; Olson, John S.; Anthony-Cahill, Spencer J.

2009-01-01

For the first time, a circularly permuted human β-globin (cpβ) has been coexpressed with human α-globin in bacterial cells and shown to associate to form α-cpβ hemoglobin in solution. Flash photolysis studies of α-cpβ show markedly biphasic CO and O2 kinetics with the amplitudes for the fast association phases being dominant due the presence of large amounts of high-affinity liganded hemoglobin dimers. Extensive dimerization of liganded but not deoxygenated α-cpβ was observed by gel chromatography. The rate constants for O2 and CO binding to the R state forms of α-cpβ are almost identical to those of native HbA (k′R(CO) ≈ 5.0 μM−1 s−1; k′R(O2) ≈ 50 μM−1 s−1), and the rate of O2 dissociation from fully oxygenated α-cpβ is also very similar to that observed for HbA (kR(O2) ≈ 21–28 s−1). When the equilibrium deoxyHb form of α-cpβ is reacted with CO in rapid mixing experiments, the observed time courses are monophasic and the observed bimolecular association rate constant is ∼1.0 μM−1 s−1, which is intermediate between the R state rate measured in partial photolysis experiments (∼5 μM−1 s−1) and that observed for T state deoxyHbA (k′T(CO) ≈ 0.1 to 0.2 μM−1 s−1). Thus the deoxygenated permutated β subunits generate an intermediate, higher affinity, deoxyHb quaternary state. This conclusion is supported by equilibrium oxygen binding measurements in which α-cpβ exhibits a P50 of ∼1.5 mmHg and a low n-value (∼1.3) at pH 7, 20 °C, compared to 8.5 mmHg and n ≈ 2.8 for native HbA under identical, dilute conditions. PMID:19397368

Understanding the kinetics of ligand binding to globins with molecular dynamics simulations: the necessity of multiple state models.

PubMed

Estarellas Martin, Carolina; Seira Castan, Constantí; Luque Garriga, F Javier; Bidon-Chanal Badia, Axel

2015-10-01

Residue conformational changes and internal cavity migration processes play a key role in regulating the kinetics of ligand migration and binding events in globins. Molecular dynamics simulations have demonstrated their value in the study of these processes in different haemoglobins, but derivation of kinetic data demands the use of more complex techniques like enhanced sampling molecular dynamics methods. This review discusses the different methodologies that are currently applied to study the ligand migration process in globins and highlight those specially developed to derive kinetic data. Copyright © 2015 Elsevier Ltd. All rights reserved.

Correction of the sickle cell disease mutation in human hematopoietic stem/progenitor cells.

PubMed

Hoban, Megan D; Cost, Gregory J; Mendel, Matthew C; Romero, Zulema; Kaufman, Michael L; Joglekar, Alok V; Ho, Michelle; Lumaquin, Dianne; Gray, David; Lill, Georgia R; Cooper, Aaron R; Urbinati, Fabrizia; Senadheera, Shantha; Zhu, Allen; Liu, Pei-Qi; Paschon, David E; Zhang, Lei; Rebar, Edward J; Wilber, Andrew; Wang, Xiaoyan; Gregory, Philip D; Holmes, Michael C; Reik, Andreas; Hollis, Roger P; Kohn, Donald B

2015-04-23

Sickle cell disease (SCD) is characterized by a single point mutation in the seventh codon of the β-globin gene. Site-specific correction of the sickle mutation in hematopoietic stem cells would allow for permanent production of normal red blood cells. Using zinc-finger nucleases (ZFNs) designed to flank the sickle mutation, we demonstrate efficient targeted cleavage at the β-globin locus with minimal off-target modification. By co-delivering a homologous donor template (either an integrase-defective lentiviral vector or a DNA oligonucleotide), high levels of gene modification were achieved in CD34(+) hematopoietic stem and progenitor cells. Modified cells maintained their ability to engraft NOD/SCID/IL2rγ(null) mice and to produce cells from multiple lineages, although with a reduction in the modification levels relative to the in vitro samples. Importantly, ZFN-driven gene correction in CD34(+) cells from the bone marrow of patients with SCD resulted in the production of wild-type hemoglobin tetramers. © 2015 by The American Society of Hematology.

β-Thalassemia Distribution in the Old World: an Ancient Disease Seen from a Historical Standpoint

PubMed Central

De Sanctis, Vincenzo; Kattamis, Christos; Canatan, Duran; Soliman, Ashraf T.; Elsedfy, Heba; Karimi, Mehran; Daar, Shahina; Wali, Yasser; Yassin, Mohamed; Soliman, Nada; Sobti, Praveen; Al Jaouni, Soad; El Kholy, Mohamed; Fiscina, Bernadette; Angastiniotis, Michael

2017-01-01

Background Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β-thalassaemia is characterised by the reduced synthesis (β+) or absence (βo) of the β-globin chains in the HbA molecule, resulting in accumulation of excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers) of the β-thalassemias; there is a high incidence in populations from the Mediterranean basin, throughout the Middle East, the Indian subcontinent, Southeast Asia, and Melanesia to the Pacific Islands. Aim The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations. Results Mutations involving the β-globin gene are the most common cause of genetic disorders in humans. To date, more than 350 β-thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of specific mutations in individual populations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at their geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity, and settlements. An analysis of the distribution of the molecular spectrum of haemoglobinopathies allows for the development and improvement of diagnostic tests and management of these disorders. PMID:28293406

Hemoglobin genetics: recent contributions of GWAS and gene editing

PubMed Central

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

β-Globin chain abnormalities with coexisting α-thalassemia mutations

PubMed Central

Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

2012-01-01

Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

Altitudinal Variation at Duplicated β-Globin Genes in Deer Mice: Effects of Selection, Recombination, and Gene Conversion

PubMed Central

Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.

2012-01-01

Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573

Protein adducts as biomarkers of exposure to aromatic diisocyanates in workers manufacturing polyurethane (PUR) foam.

PubMed

Säkkinen, Kirsi; Tornaeus, Jarkko; Hesso, Antti; Hirvonen, Ari; Vainio, Harri; Norppa, Hannu; Rosenberg, Christina

2011-04-01

This work was undertaken to investigate the usefulness of diisocyanate-related protein adducts in blood samples as biomarkers of occupational exposure to toluene diisocyanate (TDI; 2,4- and 2,6-isomers) and 4,4'-methylenediphenyl diisocyanate (MDI). Quantification of adducts as toluene diamines (TDAs) and methylenedianiline (MDA) was performed on perfluoroacylated derivatives by gas chromatography-mass spectrometry (GC-MS/MS) in negative chemical ionisation mode. TDI-derived adducts were found in 77% of plasma and in 59% of globin samples from exposed workers manufacturing flexible polyurethane foam. The plasma levels ranged from 0.003 to 0.58 nmol mL(-1) and those in globin from 0.012 to 0.33 nmol g(-1). The 2,6-isomer amounted to about two-thirds of the sum concentration of TDA isomers. MDI-derived adducts were detected in 3.5% of plasma and in 7% of globin samples from exposed workers manufacturing rigid polyurethane foam. A good correlation was found between the sum of TDA isomers in urine and that in plasma. The relationship between globin adducts and urinary metabolites was ambiguous. Monitoring TDI-derived TDA in plasma thus appears to be an appropriate method for assessing occupational exposure. Contrary to TDI exposure, adducts in plasma or globin were not useful in assessing workers' exposure to MDI. An important outcome of the study was that no amine-related adducts were detected in globin samples from TDI- or MDI-exposed workers, alleviating concerns that TDI or MDI might pose a carcinogenic hazard. Further studies are nevertheless required to judge whether diisocyanates per se could be such a hazard.

Screening of (-SEA) α-thalassaemia using an immunochromatographic strip assay for the ζ-globin chain in a population with a high prevalence and heterogeneity of haemoglobinopathies.

PubMed

Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2017-01-01

The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

PubMed Central

Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

2014-01-01

Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

PubMed Central

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

PubMed

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

PubMed

Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

1996-10-01

Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

Novel mutations responsible for α-thalassemia in Iranian families.

PubMed

Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

2013-01-01

α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2005-03-01

In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

PubMed

Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

2013-09-23

Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

PubMed

Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Hypomethylation of DNA from Benign and Malignant Human Colon Neoplasms

NASA Astrophysics Data System (ADS)

Goelz, Susan E.; Vogelstein, Bert; Hamilton, Stanley R.; Feinberg, Andrew P.

1985-04-01

The methylation state of DNA from human colon tissue displaying neoplastic growth was determined by means of restriction endonuclease analysis. When compared to DNA from adjacent normal tissue, DNA from both benign colon polyps and malignant carcinomas was substantially hypomethylated. With the use of probes for growth hormone, γ -globin, α -chorionic gonadotropin, and γ -crystallin, methylation changes were detected in all 23 neoplastic growths examined. Benign polyps were hypomethylated to a degree similar to that in malignant tissue. These results indicate that hypomethylation is a consistent biochemical characteristic of human colonic tumors and is an alteration in the DNA that precedes malignancy.

Genetic diversity of coastal bottlenose dolphins revealed by structurally and functionally diverse hemoglobins.

PubMed

Remington, Nicole; Stevens, Robert D; Wells, Randall S; Holn, Aleta; Dhungana, Suraj; Taboy, Celine H; Crumbliss, Alvin L; Henkens, Robert; Bonaventura, Celia

2007-08-15

Studies of structure-function relationships in the respiratory proteins of marine mammals revealed unexpected variations in the number and types of hemoglobins (Hbs) present in coastal bottlenose dolphins, Tursiops truncatus. We obtained blood samples from free-ranging coastal bottlenose dolphins as a component of capture-release studies. We found that the oxygen-binding functions of bottlenose dolphin blood are poised between effector-saturated and unsaturated levels, enabling exercise-dependent shifts in oxygen transfer functions. Isolated bottlenose dolphin Hbs showed elevated pH sensitivities (Bohr effects) and appreciably lower oxygen affinities than adult human Hb in the absence of allosteric effectors. These properties may be an adaptive modification that enhances oxygen delivery during diving episodes when oxygen tensions and effector levels are low. The Hbs of individual dolphins showed similar oxygen affinities, responses to effectors, and expression of heme-heme interaction in oxygen binding, but differed in their redox potentials and rates of autoxidation. The heterogeneity suggested by these functional variations in Hbs of individual dolphins was born out by variations in the molecular weights and numbers of their alpha and beta globin chains. Although coastal bottlenose dolphins were expected to have a single type of Hb, the mass differences observed revealed considerable genetic diversity. There were multiple Hb forms in some individuals and differences in Hb patterns among individuals within the same community.

Correlations between oxygen affinity and sequence classifications of plant hemoglobins

USDA-ARS?s Scientific Manuscript database

Plants express three phylogenetic classes of hemoglobins (Hb) based on sequence analyses. Class 1 and 2 Hbs are full length globins with the classical 8 helix Mb-like fold, whereas Class 3 plant Hbs resemble the truncated globins found in bacteria. With the exception of the specialized leghemoglobin...

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Pathophysiology and Clinical Manifestations of the β-Thalassemias

PubMed Central

Nienhuis, Arthur W.; Nathan, David G.

2012-01-01

The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183

beta. -lipotropin is the major opioid-like peptide of human pituitary and rat pars distalis: lack of significant. beta. -endorphin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liotta, A.S.; Suda, T.; Krieger, D.T.

1978-06-01

..beta..-Lipotropin is the predominant opioid peptide of the human pituitary and rat pars distalis and is present in concentrations essentially equimolar with corticotropin. When freshly obtained nonfrozen rat anterior pituitaries were homogenized with 0.2 M HCl, approximately 98% of the immunoreactivity detected utilizing an antiserum that crossreacts equally with ..beta..-lipotropin and ..beta..-endorphin coeluted with /sup 125/I-labeled human ..beta..-lipotropin upon molecular sieve chromatography. The remainder of the activity eluted with synthetic human ..beta..-endorphin. Similar results were obtained for human pituitary. HCl homogenization of thawed tissue or homogenization of fresh tissue with acetic acid yielded substantially greater concentrations of ..beta..-endorphin and decreasedmore » concentrations of ..beta..-lipotropin. In human subjects, acute anterior pituitary stimulation using either insulin-induced hypoglycemia or vasopressin administration was associated with increased plasma ..beta..-lipotropin and corticotropin levels. At the time of peak concentrations, no significant levels of ..beta..-endorphin were detectable. These data indicate the lack of significant amounts of ..beta..-endorphin in human pituitary. Additionally, there appears to be no specific intrapituitary conversion of ..beta..-lipotropin to ..beta..-endorphin.« less

Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

PubMed

Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

2013-01-01

We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

α-Globin as a molecular target in the treatment of β-thalassemia

PubMed Central

Mettananda, Sachith; Gibbons, Richard J.

2015-01-01

The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

Circulating DNA: a potential marker of sickle cell crisis.

PubMed

Vasavda, Nisha; Ulug, Pinar; Kondaveeti, Sheila; Ramasamy, Karthik; Sugai, Taku; Cheung, Gordon; Rees, David C; Awogbade, Moji; Bannister, Sybil; Cunningham, Juliette; Menzel, Stephan; Thein, Swee Lay

2007-10-01

Free circulating DNA is present in the plasma of healthy subjects, and is elevated in conditions characterized by increased cell death, such as cancer and physical trauma. Analysis of circulating DNA in plasma could provide a useful biomarker in sickle cell disease (SCD) in view of the increased cell turnover through chronic ongoing haemolysis, recurrent vaso-occlusion and inflammation. Plasma DNA was determined by real-time quantitative polymerase chain reaction (PCR) amplification of the beta-globin gene (HBB) in 154 patients with SCD [105 haemoglobin (Hb)SS, 46 HbSC and three HbS/beta(0) thalassaemia] and 53 ethnically matched controls. Blood samples were obtained from all patients in steady state; 21 of the 154 patients were also sampled during admission to hospital for acute pain. Median concentration of circulating plasma DNA in acute pain was more than 10-fold that in steady state and in controls - 10070 vs. 841 and 10070 vs. 933 genome equivalents/ml respectively (P < 0.0001, in both cases). During steady state, patients had plasma DNA levels similar to controls. Plasma DNA levels in SCD correlated with C-reactive protein levels (P < 0.005) and total white cell counts (P < 0.05) in steady state. The study shows that plasma DNA concentration may have potential as a biomarker in sickle cell patients.

Pseudoreticulocytosis in a patient with hemoglobin Köln due to autofluorescent erythrocytes enumerated as reticulocytes by the Cell-Dyn 4000.

PubMed

Sato, Shoko; Hirayama, Koichi; Koyama, Akio; Harano, Teruo; Nagasawa, Toshiro; Ninomiya, Haruhiko

2004-01-01

Pseudoreticulocytosis in a 25-year-old female patient with hemoglobin Köln is reported. The abnormal hemoglobin, hemoglobin Köln (beta chain, Val98-->Met), had previously been confirmed in the patient at the age of 21 years, as well as in her mother, by polymerase chain reaction-based direct sequence analysis of the beta globin gene. The patient underwent splenectomy at the age of 22 years. On her admission to our hospital for treatment of an immunoglobulin A nephropathy, an analysis by an automated hematology analyzer, the Abbott Cell-Dyn 4000 (CD4000), reported a marked reticulocytosis. Staining by the Brecher method with new methylene blue indicated a moderate reticulocytosis (5.7%) of a lesser extent than that indicated by the CD4000 (51.1%). The frequencies of red blood cells (RBC) with Pappenheimer bodies (13.8%), Heinz bodies (32.7%), and Howell-Jolly bodies (0.3%) were increased. The CD4000 detects RBC with RNA fluorescently stained with CD4K530 as reticulocytes. Autofluorescence of RBC with hemoglobin Köln, as we demonstrated by flow cytometry and fluorescent microscopy, was considered to have caused the pseudoreticulocytosis on the fully automated reticulocyte enumeration by the CD4000.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

LDB1-mediated enhancer looping can be established independent of mediator and cohesin.

PubMed

Krivega, Ivan; Dean, Ann

2017-08-21

Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Coordination and redox state-dependent structural changes of the heme-based oxygen sensor AfGcHK associated with intraprotein signal transduction.

PubMed

Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta

2017-12-22

The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Inhibin/activin-betaC and -betaE subunits in the Ishikawa human endometrial adenocarcinoma cell line.

PubMed

Kimmich, Tanja; Brüning, Ansgar; Käufl, Stephanie D; Makovitzky, Josef; Kuhn, Christina; Jeschke, Udo; Friese, Klaus; Mylonas, Ioannis

2010-08-01

Inhibins and activins are important regulators of the female reproductive system. Recently, two novel inhibin subunits, named betaC and betaE, have been identified and shown to be expressed in several human tissues. However, only limited data on the expression of these novel inhibin subunits in normal human endometrial tissue and endometrial adenocarcinoma cell lines exist. Samples of proliferative and secretory human endometrium were obtained from five premenopausal, non-pregnant patients undergoing gynecological surgery for benign diseases. Normal endometrial tissue and Ishikawa endometrial adenocarcinoma cell lines were analyzed by immunohistochemistry, immunofluorescence and RT-PCR. Expression of the inhibin betaC and betaE subunits could be demonstrated at the protein level by means of immunohistochemical evaluation and at the transcriptional level by establishing a betaC- and betaE-specific RT-PCR analysis in normal human endometrial tissue and the parental Ishikawa cell line. Interestingly, in a highly de-differentiated subclone of the Ishikawa cell line lacking estrogen receptor expression, the expression of the inhibin-betaC subunit appeared strongly reduced. Here, we show for the first time that the novel inhibin/activin-betaC and -betaE subunits are expressed in normal human endometrium and the estrogen receptor positive human endometrial carcinoma cell line Ishikawa using RT-PCR and immunohistochemical detection methods. Interestingly, the Ishikawa minus cell line (lacking estrogen receptor expression) demonstrated no to minimal expression of the betaC subunit as observed with immunofluorescence and RT-PCR, suggesting a possible hormone- dependency of this subunit in human endometrial cancer cells. Moreover, because the Ishikawa cell line minus is thought to be a more malignant endometrial cell line than its estrogen receptor positive counterpart, inhibin-betaC subunit might be substantially involved in the pathogenesis and malignant transformation in human endometrium.

Utility of next-generation RNA-sequencing in identifying chimeric transcription involving human endogenous retroviruses.

PubMed

Sokol, Martin; Jessen, Karen Margrethe; Pedersen, Finn Skou

2016-01-01

Several studies have shown that human endogenous retroviruses and endogenous retrovirus-like repeats (here collectively HERVs) impose direct regulation on human genes through enhancer and promoter motifs present in their long terminal repeats (LTRs). Although chimeric transcription in which novel gene isoforms containing retroviral and human sequence are transcribed from viral promoters are commonly associated with disease, regulation by HERVs is beneficial in other settings; for example, in human testis chimeric isoforms of TP63 induced by an ERV9 LTR protect the male germ line upon DNA damage by inducing apoptosis, whereas in the human globin locus the γ- and β-globin switch during normal hematopoiesis is mediated by complex interactions of an ERV9 LTR and surrounding human sequence. The advent of deep sequencing or next-generation sequencing (NGS) has revolutionized the way researchers solve important scientific questions and develop novel hypotheses in relation to human genome regulation. We recently applied next-generation paired-end RNA-sequencing (RNA-seq) together with chromatin immunoprecipitation with sequencing (ChIP-seq) to examine ERV9 chimeric transcription in human reference cell lines from Encyclopedia of DNA Elements (ENCODE). This led to the discovery of advanced regulation mechanisms by ERV9s and other HERVs across numerous human loci including transcription of large gene-unannotated genomic regions, as well as cooperative regulation by multiple HERVs and non-LTR repeats such as Alu elements. In this article, well-established examples of human gene regulation by HERVs are reviewed followed by a description of paired-end RNA-seq, and its application in identifying chimeric transcription genome-widely. Based on integrative analyses of RNA-seq and ChIP-seq, data we then present novel examples of regulation by ERV9s of tumor suppressor genes CADM2 and SEMA3A, as well as transcription of an unannotated region. Taken together, this article highlights the high suitability of contemporary sequencing methods in future analyses of human biology in relation to evolutionary acquired retroviruses in the human genome. © 2016 APMIS. Published by John Wiley & Sons Ltd.

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

PubMed

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

Recent advance on genome editing for therapy of β-hemoglobinopathies.

PubMed

Liu, Jia-Wei; Hong, Tao; Qin, Xin; Liang, Ying-Min; Zhang, Ping

2018-02-20

β-hemoglobinopathies are one of six groups of common illnesses affecting human health. Although the genetic mechanisms have been elucidated for several decades, curable treatment options, other than allogeneic bone marrow transplantation, are still lacking. In recent years, rapid development in genome editing technologies and their clinical applications have opened up new directions for treatment of β-hemoglobinopathies. Genome editing technologies, as applied in autologous CD34 + hematopoietic stem and progenitor cells, represents a promising remedial means for the β-globin disorders. Hemoglobin gene mutations could be corrected with homologous recombination-mediated DNA repair pathway to repair the genetic defects, while the nonhomologous end-joining pathway may be used to silence the key repressor of fetal globin expression and reactivate fetal hemoglobin expression, thereby alleviating the clinical symptoms of β-hemoglobinopathies in patients. This review summarizes the recent advances on genome editing of β-hemoglobinopathies from the bench design to the establishment of clinical translational platforms, thereby providing critical insights and references on the application of genome editing technologies for the development of therapeutic strategies for β-hemoglobinopathies.

The molecular basis of α-thalassemia.

PubMed

Higgs, Douglas R

2013-01-01

The globin gene disorders including the thalassemias are among the most common human genetic diseases with more than 300,000 severely affected individuals born throughout the world every year. Because of the easy accessibility of purified, highly specialized, mature erythroid cells from peripheral blood, the hemoglobinopathies were among the first tractable human molecular diseases. From the 1970s onward, the analysis of the large repertoire of mutations underlying these conditions has elucidated many of the principles by which mutations occur and cause human genetic diseases. This work will summarize our current knowledge of the α-thalassemias, illustrating how detailed analysis of this group of diseases has contributed to our understanding of the general molecular mechanisms underlying many orphan and common diseases.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, W.F.; Martinell, J.; Whitney, J.B. III

The group of diseases called the thalassemias is the largest single-gene health problem in the world according the World Health Organization. The thalassemias are lethal hereditary anemias in which the infants cannot make their own blood. Three mouse mutants are shown to be models of the human disease ..cap alpha..-thalassemia. However, since an additional gene is affected, these mutants represent a particularly severe condition in which death occurs in the homozygous embryo even before globin genes are activated. Phenotypic and genotypic characteristics are described. (ACR)

Purification of swine haptoglobin by affinity chromatography.

PubMed Central

Eurell, T E; Hall, W F; Bane, D P

1990-01-01

A globin-agarose affinity chromatography technique was used to purify swine haptoglobin. This technique provides a highly specific, single-step purification method without the contamination of extraneous serum proteins reported by previous studies. Complex formation between the haptoglobin isolate and swine hemoglobin confirmed that biological activity was maintained during the purification process. Immunoelectrophoretic and Ouchterlony immunodiffusion methods revealed that the swine haptoglobin isolate cross-reacted with polyvalent antisera against human haptoglobin. Images Fig. 2. Fig. 3. PMID:2123414

αCP Poly(C) Binding Proteins Act as Global Regulators of Alternative Polyadenylation

PubMed Central

Ji, Xinjun; Wan, Ji; Vishnu, Melanie

2013-01-01

We have previously demonstrated that the KH-domain protein αCP binds to a 3′ untranslated region (3′UTR) C-rich motif of the nascent human alpha-globin (hα-globin) transcript and enhances the efficiency of 3′ processing. Here we assess the genome-wide impact of αCP RNA-protein (RNP) complexes on 3′ processing with a specific focus on its role in alternative polyadenylation (APA) site utilization. The major isoforms of αCP were acutely depleted from a human hematopoietic cell line, and the impact on mRNA representation and poly(A) site utilization was determined by direct RNA sequencing (DRS). Bioinformatic analysis revealed 357 significant alterations in poly(A) site utilization that could be specifically linked to the αCP depletion. These APA events correlated strongly with the presence of C-rich sequences in close proximity to the impacted poly(A) addition sites. The most significant linkage was the presence of a C-rich motif within a window 30 to 40 bases 5′ to poly(A) signals (AAUAAA) that were repressed upon αCP depletion. This linkage is consistent with a general role for αCPs as enhancers of 3′ processing. These findings predict a role for αCPs in posttranscriptional control pathways that can alter the coding potential and/or levels of expression of subsets of mRNAs in the mammalian transcriptome. PMID:23629627

Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

PubMed

Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

2018-04-01

To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

PubMed

Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

2016-04-07

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

PubMed

Chu, L Y; Rhoads, R E

1978-06-13

The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.

PubMed

Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen

2017-01-01

Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1  h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .

Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

PubMed

Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

PubMed

Kutlar, Ferdane; Ameri, Afshin; Patel, Niren H; Zhuang, Lina; Johnson, Lee E; Cheng, Michael L; Kutlar, Abdullah

2014-01-01

The total number of hemoglobin (Hb) variants so far reported to the HbVar database is 1598 (April 9 2014) and 130 of them are fetal Hb variants. Fetal Hb are categorized as two different subunits, (G)γ- and (A)γ-globin chains, and γ chain variants can be observed in both subunits. There are 72 (G)γ- and 58 (A)γ-globin chain variants. Most of them are clinically silent and detected during newborn screening programs in the USA and outside the USA. In this report, we discuss the molecular characteristics and diagnostic difficulties of two new γ-globin chain variants found in an African American baby with no clinical symptoms. One is a new (G)γ-globin chain variant, Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and the other one is Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.

PubMed

Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan

2017-01-01

Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.

A Mouse β-Globin Mutant That Is an Exact Model of Hemoglobin Rainier in Man

PubMed Central

Peters, J.; Andrews, S. J.; Loutit, J. F.; Clegg, J. B.

1985-01-01

A mutation induced by ethylnitrosourea in a spermatogonial stem cell of a 101/H mouse has resulted in a structurally altered β-diffuse major globin in one of his offspring. The mutant hemoglobin is associated with polycythemia, rubor, increased oxygen affinity and decreased hem-hem interaction. The mutant haplotype has been designated Hbb d4, polycythemia. Amino acid analysis of the mutant globin has shown that a single substitution β145 Tyr → Cys has occurred, and it is proposed that ethylnitrosourea induced an A → G transition in the tyrosine codon (TAC → TGC). This murine polycythemia is homologous with hemoglobin Rainier in man, in which the amino acid substitution is also β145 Tyr → Cys and which is associated with similar physiological consequences. PMID:3839762

Human APC sequesters beta-catenin even in the absence of GSK-3beta in a Drosophila model.

PubMed

Rao, P R; Makhijani, K; Shashidhara, L S

2008-04-10

There have been conflicting reports on the requirement of GSK-3beta-mediated phosphorylation of the tumor suppressor adenomatous polyposis coli (APC) vis-à-vis its ability to bind and degrade beta-catenin. Using a unique combination of loss of function for Shaggy/GSK-3beta and a gain of function for human APC in Drosophila, we show that misexpressed human APC (hAPC) can still sequester Armadillo/beta-catenin. In addition, human APC could suppress gain of Wnt/Wingless phenotypes associated with loss of Shaggy/GSK-3beta activity, suggesting that sequestered Armadillo/beta-catenin is non-functional. Based on these studies, we propose that binding per se of beta-catenin by APC does not require phosphorylation by GSK-3beta.

Annual Research Progress Report.

DTIC Science & Technology

1979-09-30

will be trained in SLRL test procedures and the methodology will be developed for the incorporation of test materials into the standard rearing diet ...requirements exist for system software maintenance and development of software to report dosing data, to calculate diet preparation data, to manage collected...influence of diet and exercise on myo- globin and metmyoglobin reductase were evaluated in the rat. The activity of inetmyo- globin reductase was

Single-molecule RNA observation in vivo reveals dynamics of co-transcriptional splicing

NASA Astrophysics Data System (ADS)

Ferguson, M. L.; Coulon, A.; de Turris, V.; Palangat, M.; Chow, C. C.; Singer, R. H.; Larson, D. R.

2013-03-01

The synthesis of pre-mRNA and the splicing of that pre-mRNA to form completed transcripts requires coordination between two large multi-subunit complexes (the transcription elongation complex and the spliceosome). How this coordination occurs in vivo is unknown. Here we report the first experimental observation of transcription and splicing occurring at the same gene in living cells. By utilizing the PP7/MS2 fluorescent RNA reporter system, we can directly observe two distinct regions of the nascent RNA, allowing us to measure the rise and fall time of the intron and exon of a reporter gene stably integrated into a human cell line. The reporter gene consists of a beta globin gene where we have inserted a 24 RNA hairpin cassette into the intron/exon. Upon synthesis, the RNA hairpins are tightly bound by fluorescently-labeled PP7/MS2 bacteriophage coat proteins. After gene induction, a single locus of active transcription in the nucleus shows fluorescence intensity changes characteristic of the synthesis and excision of the intron/exon. Using fluctuation analysis, we determine the elongation rate to be 1.5 kb/min. From the temporal cross correlation function, we determine that splicing of this gene must be co-transcriptional with a splicing time of ~100 seconds before termination and a ~200 second pause at termination. We propose that dual-color RNA imaging may be extended to investigate other mechanisms of transcription, gene regulation, and RNA processing.

An intriguing high performance liquid chromatogram of a double heterozygosity for Hb Q-India/Hb D-Punjab.

PubMed

Badyal, Rama Kumari; Chhabra, Sanjeev; Sharma, Prashant; Das, Reena

2014-01-01

Cation exchange high performance liquid chromatography (HPLC) is commonly utilized as the first method of screening for thalassemias and hemoglobinopathies worldwide. This method of diagnosis requires knowledge of the clinical background and complete blood counts as well as skill and experience in interpreting the sometimes complex results produced. An asymptomatic 27-year-old pregnant North Indian woman was found to have a highly unusual chromatographic pattern with multiple unexpected peaks during routine antenatal screening. Most concerning was a C-window peak as Hb C (HBB: c.19G>A) is rare in ethnic Asian Indian populations. Cellulose acetate electrophoresis at alkaline pH (8.6) and parental screening were performed. These revealed the correct diagnosis to be a double heterozygosity for Hb Q-India (HBA1: c.193G>C) (an uncommon asymptomatic α-globin chain variant) plus Hb D-Punjab (HBB: c.364G>C) (a β-globin chain variant that is common in this region and is asymptomatic in the heterozygous state). The unexpected C-window peak was the hybrid of the abnormal α-Q-India and β-D-Punjab globin chains. Another small peak was explained as a variant Hb A2 formed by the combination of α-Q-India and δ-globin chains. Hematopathologists should be cognizant of the complex pattern resulting from coinheritance of both α- and β-globin structural variants. Second-line testing and parental testing are invaluable in resolving unknown peaks, especially if rare or unexpected variants are being considered. Although both Hb Q-India and Hb D-Punjab are relatively common in northwestern India, to the best of our knowledge, only two recent reports describe a total of three cases of such diagnostically puzzling coinheritance.

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

PubMed

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

PubMed

Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

2016-08-01

Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catecholmore » enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.« less

High Risk Behaviors in Marine Mammals: Linking Behavioral Responses to Anthropogenic Disturbance to Biological Consequences

DTIC Science & Technology

2014-09-30

98) Prescribed by ANSI Std Z39-18 2 injury via cardiovascular performance during submergence. Neuro -protection through globin deposition and...relationships for stroking costs, aerobic dive limits, types of neuro -protection (globin deposition, capillarity), and cardiac risk factors that will be mapped...Greenland. A custom built ECG recorder with 3- axis accelerometer recorder and pressure transducer was combined with retrieval transmitters (Argos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Epstein, N.; Than, K.A. Culp, K.M.

Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less

Identification of rare and novel deletions that cause (δβ)0-thalassaemia and hereditary persistence of foetal haemoglobin in Indian population.

PubMed

Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R

2014-06-01

Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Expression of beta-dystroglycan is reduced or absent in many human carcinomas.

PubMed

Cross, S S; Lippitt, J; Mitchell, A; Hollingsbury, F; Balasubramanian, S P; Reed, M W R; Eaton, C; Catto, J W; Hamdy, F; Winder, S J

2008-11-01

Dystroglycan is an important structural and signalling protein that is expressed in most human cells. alpha-Dystroglycan has been investigated and found to be reduced in human cancers, but there is only one published study on the expression of beta-dystroglycan in human cancer and that was only on small numbers of breast and prostatic cancers. The aim was to conduct a comprehensive immunohistochemical survey of the expression of beta-dystroglycan in normal human tissues and common cancers. Triplicate tissue microarrays of 681 samples of normal human tissues and common cancers were stained using an antibody directed against the cytoplasmic component of beta-dystroglycan. beta-Dystroglycan was strongly expressed at the intercellular junctions and basement membranes of all normal human epithelia. Expression of beta-dystroglycan was absent or markedly reduced in 100% of oesophageal adenocarcinomas, 97% of colonic cancers, 100% of transitional cell carcinomas of the urothelium and 94% of breast cancers. In the breast cancers, the only tumours that showed any retention of beta-dystroglycan expression were small low-grade oestrogen receptor-positive tumours. The only cancers that showed retention of beta-dystroglycan expression were cutaneous basal cell carcinomas. There is loss or marked reduction of beta-dystroglycan expression (by immunohistochemistry) in the vast majority of human cancers surveyed. Since beta-dystroglycan is postulated to have a tumour suppressor effect, this loss may have important functional significance.

Sickle cell disease in Madhya Pradesh, Central India: A comparison of clinical profile of sickle cell homozygote vs. sickle-beta thalassaemia individuals.

PubMed

Yadav, Rajiv; Lazarus, Monica; Ghanghoria, Pawan; Singh, Mpss; Gupta, Rasik Behari; Kumar, Surendra; Sharma, Ravendra K; Shanmugam, Rajasubramaniam

2016-10-01

The clinical manifestation in sickle cell disease (SCD) patients varies from one individual to another due to factors like the presence of alpha-thalassaemia mutation, foetal haemoglobin, and β-globin gene haplotype. The present study enumerates the clinical profile of sickle cell anaemia patients from Central India. Seven hundred seventy-six SCD patients from Jabalpur and surrounding districts (Madhya Pradesh) in central India were registered with the sickle cell clinic of NIRTH, Jabalpur. The present study reveals recorded signs and symptoms of genetically confirmed sickle cell anaemia (404) and sickle beta thalassaemia (92) patients. Majority of the patients were from scheduled caste communities (47.9%) and Gond tribal community (13.8%). Splenomegaly was the most common clinical manifestation observed (71.4%). Overall, 63.5% patients had a history of blood transfusion. The most frequent signs and symptoms observed were Pallor, Icterus, Joint pain, Fever, and Fatigue. Majority of the patients revealed onset of disease prior to attaining the age of 3 years (sickle cell anaemia 44.3% and sickle beta thalassaemia 35.9%). Mean haemoglobin levels among SCA individuals were marginally higher than SBT patients. On the other hand, mean foetal haemoglobin levels among SBT individuals showed the reverse trend. Notably, the present study reports the first incidence of priapism recorded in Central India. The study revealed a high prevalence of SCD among scheduled caste, backward caste, and tribal communities. Dissemination of study findings, screening, pre-marriage counselling, and pre-natal diagnosis are fundamental to preventing or lowering of birth of sickle cell anaemia children in the affected populations.

β-Thalassemia Intermedia: A Bird’s-Eye View

PubMed Central

Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

2014-01-01

Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia major. PMID:24764724

β-Thalassemia Intermedia: A Bird's-Eye View.

PubMed

Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

2014-03-01

Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum's extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia major.

Analysis of a Mouse α-Globin Gene Mutation Induced by Ethylnitrosourea

PubMed Central

Popp, R. A.; Bailiff, E. G.; Skow, L. C.; Johnson, F. M.; Lewis, Susan E.

1983-01-01

A DBA/2 mouse treated with ethylnitrosourea sired an offspring whose hemoglobin showed an extra band following starch gel electrophoresis. The variant hemoglobin migrated to a more cathodal position in starch gel. Isoelectric focusing indicated that chain 5 of the mutant hemoglobin migrated to a more cathodal position than the normal chain 5 from DBA/2 mice and that the other α-globin, chain 1, was not affected. On focusing gels the phenotype of the mutant allele, Hbay9, was expressed without dominance to normal chain 5, and Hbay9/Hbay9 homozygotes were fully viable in the laboratory. The molecular basis for the germinal mutation was investigated by analyzing the amino acid sequence of chain 5y9, the mutant form of α-chain 5. A single amino acid substitution (His → Leu) at position 89 was found in chain 5y9. We propose that ethylnitrosourea induced an A → T transversion in the histidine codon at position 89 (CAC → CTC). This mutation has apparently not been observed previously in humans, mice or other mammals, and its novel occurrence may be indicative of other unusual mutational events that do not ordinarily occur in the absence of specific mutagen exposure. PMID:6618166

Insulators to improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse models.

PubMed

Guglielmi, Laurence; Le Bert, Marc; Truffinet, Véronique; Cogné, Michel; Denizot, Yves

2003-08-01

A locus control region (LCR) containing four transcriptional enhancers lies downstream of the IgH chain locus. We studied transgenes carrying a 3(')IgH LCR-driven GFP reporter gene for expression and B cell differentiation stage specificity. We also compared transgenes that were or were not flanked by two copies of the beta-globin HS4 insulator, an element defined by its ability to protect transgenes from the influences of surrounding genes at the insertion site. Results indicate that insulators are instrumental in sustaining GFP expression in GFP-3(')LCR transgenic mice when they were included. Flow cytometry experiments reported a strictly B cell specific GFP expression from pre-B cells in bone marrow to mature B cells in spleen. Despite addition of 5(')HS4 insulators to the GFP-3(')LCR construct, complete transgene silencing occurred in some transgenic lines and was systematically observed in ageing animals from all lines.

High-Efficiency Synthesis of Human α-Endorphin and Magainin in the Erythrocytes of Transgenic Mice: A Production System for Therapeutic Peptides

NASA Astrophysics Data System (ADS)

Sharma, Ajay; Khoury-Christianson, Anastasia M.; White, Steven P.; Dhanjal, Nirpal K.; Huang, Wen; Paulhiac, Clara; Friedman, Eric J.; Manjula, Belur N.; Kumar, Ramesh

1994-09-01

Chemical synthesis of peptides, though feasible, is hindered by considerations of cost, purity, and efficiency of synthesizing longer chains. Here we describe a transgenic system for producing peptides of therapeutic interest as fusion proteins at low cost and high purity. Transgenic hemoglobin expression technology using the locus control region was employed to produce fusion hemoglobins in the erythrocytes of mice. The fusion hemoglobin contains the desired peptide as an extension at the C end of human α-globin. A protein cleavage site is inserted between the C end of the α-globin chain and the N-terminal residue of the desired peptide. The peptide is recovered after cleavage of the fusion protein with enzymes that recognize this cleavage signal as their substrate. Due to the selective compartmentalization of hemoglobin in the erythrocytes, purification of the fusion hemoglobin is easy and efficient. Because of its compact and highly ordered structure, the internal sites of hemoglobin are resistant to protease digestion and the desired peptide is efficiently released and recovered. The applicability of this approach was established by producing a 16-mer α-endorphin peptide and a 26-mer magainin peptide in transgenic mice. Transgenic animals and their progeny expressing these fusion proteins remain healthy, even when the fusion protein is expressed at >25% of the total hemoglobin in the erythrocytes. Additional applications and potential improvements of this methodology are discussed.

Novel, high-yield red blood cell production methods from CD34-positive cells derived from human embryonic stem, yolk sac, fetal liver, cord blood, and peripheral blood.

PubMed

Olivier, Emmanuel; Qiu, Caihong; Bouhassira, Eric E

2012-08-01

The current supply of red blood cells expressing rare blood groups is not sufficient to cover all the existing transfusion needs for chronically transfused patients, such as sickle cell disease homozygous carriers, because of alloimmunization. In vitro production of cultured red blood cells is slowly emerging as a possible complement to the existing collection-based red blood cell procurement system. The yield of cultured red blood cells can theoretically be maximized by amplifying the stem, progenitor, or precursor compartment. Here, we combined methods designed to expand these three compartments to optimize the yield of cultured red blood cells and found that exposing CD34(+) cells to a short pulse of cytokines favorable for erythroid differentiation prior to stem cell expansion followed by progenitor expansion produced the highest yield of erythroid cells. This novel serum-free red blood cell production protocol was efficient on CD34(+) cells derived from human embryonic stem cells, 6-8-week yolk sacs, 16-18-week fetal livers, cord blood, and peripheral blood. The yields of cells obtained with these new protocols were larger by an order of magnitude than the yields observed previously. Globin expression analysis by high-performance liquid chromatography revealed that these expansion protocols generally yielded red blood cells that expressed a globin profile similar to that expected for the developmental age of the CD34(+) cells.

Homozygosity for the AATAAA > AATA- - Polyadenylation Site Mutation on the α2-Globin Gene Causing Transfusion-Dependent Hb H Disease in an Iranian Patient: A Case Report.

PubMed

Farashi, Samaneh; Garous, Negin F; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemeh; Imanian, Hashem; Azarkeivan, Azita; Giordano, Piero C; Najmabadi, Hossein

2015-01-01

We describe a case of Hb H disease associated with homozygosity for a two nucleotide deletion in the polyadenylation signal of the α2-globin gene (HBA2: c.*93_*94delAA). The patient, a 27-year-old son of a consanguineous couple, needs regular blood transfusions every 6 months.

Light-induced protoporphyrin release from erythrocytes in erythropoietic protoporphyria.

PubMed Central

Sandberg, S; Brun, A

1982-01-01

The photohemolysis of normal erythrocytes incubated with protoporphyrin is reduced in the presence of albumin. When globin is added to normal erythrocytes loaded with protoporphyrin, protoporphyrin is bound to globin. During irradiation protoporphyrin moves from globin to the erythrocyte membrane and photohemolysis is initiated. Erythrocytes in patients with erythropoietic protoporphyria contain large amounts of protoporphyrin bound to hemoglobin. Upon irradiation of these cells in the absence of albumin, 40% of protoporphyrin and 80% of hemoglobin is released after 240 kJ/m2. The released protoporphyrin is hemoglobin bound. In contrast, when albumin is present only 8% of hemoglobin is released whereas protoporphyrin is released to 76%. The released protoporphyrin is albumin bound. A hypothesis for the release of erythrocyte protoporphyrin in erythropoietic protoporphyria without simultaneous hemolysis is proposed. Upon irradiation protoporphyrin photodamages its binding sites on hemoglobin, moves through the plasma membrane, and is bound to albumin in plasma. PMID:7107898

Neuroglobin and cytoglobin: two new members of globin family

PubMed Central

Tosqui, Priscilla; Colombo, Marcio Francisco

2011-01-01

The globin family has long been defined by myoglobin and hemoglobin, proteins with the functions of oxygen storage and transportation, respectively. Recently, two new members of this family were discovered: neuroglobin present in neurons and retinal cells and cytoglobin found in various types of tissue. The increased expression of these proteins in hypoxic conditions first suggested a role in oxygen supply. However structural and functional differences, such as the hexacoordinated heme, a high autoxidation rate and different concentrations between different cellular types, have dismissed this hypothesis. The protective role of these globins has already been established. In vitro and in vivo studies have demonstrated increased survival of neurons under stress in the presence of neuroglobin and increased resistance to neurodegenerative diseases. However the mechanism remains unknown. Functions, including detoxification of nitric oxide, free radical scavenging and as an antioxidant and signaling of apoptosis, have also been suggested for neuroglobin and an antifibrotic function for cytoglobin. PMID:23049323

Erythroid differentiation ability of butyric acid analogues: identification of basal chemical structures of new inducers of foetal haemoglobin.

PubMed

Bianchi, Nicoletta; Chiarabelli, Cristiano; Zuccato, Cristina; Lampronti, Ilaria; Borgatti, Monica; Amari, Gabriele; Delcanale, Maurizio; Chiavilli, Francesco; Prus, Eugenia; Fibach, Eitan; Gambari, Roberto

2015-04-05

Several investigations have demonstrated a mild clinical status in patients with β-globin disorders and congenital high persistence of foetal haemoglobin. This can be mimicked by a pharmacological increase of foetal γ-globin genes expression and foetal haemoglobin production. Our goal was to apply a multistep assay including few screening methods (benzidine staining, RT-PCR and HPLC analyses) and erythroid cellular model systems (the K562 cell line and erythroid precursors collected from peripheral blood) to select erythroid differentiation agents with foetal haemoglobin inducing potential. With this methodology, we have identified a butyric acid derivative, namely the 4174 cyclopropanecarboxylic acid compound, able to induce erythroid differentiation without antiproliferative effect in K562 cells and increase of γ-globin gene expression in erythroid precursor cells. The results are relevant for pharmacological treatments of haemoglobinopathies, including β-thalassaemia and sickle cell anaemia. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular cloning of a novel widely expressed human 80 kDa 17 beta-hydroxysteroid dehydrogenase IV.

PubMed Central

Adamski, J; Normand, T; Leenders, F; Monté, D; Begue, A; Stéhelin, D; Jungblut, P W; de Launoit, Y

1995-01-01

Reactions of oestrogens and androgens at position C-17 are catalysed by 17 beta-hydroxysteroid dehydrogenases (17 beta-HSDs). Cloning of the cDNA of a novel human 17 beta-HSD IV and expression of its mRNA are described. A probe derived from the recently discovered porcine 17 beta-oestradiol dehydrogenase (17 beta-EDH) was used to isolate a 2.6 kb human cDNA encoding a continuous protein of 736 amino acids of high (84%) similarity to the porcine 17 beta-EDH. The calculated molecular mass of the human enzyme is 79,595 Da. Other sequence similarities shared by the two enzymes are: an N-terminal sequence which is similar to that of members of the short-chain alcohol dehydrogenase family; amino acids 343-607 which are similar to the C-terminal domains of a trifunctional Candida tropicalis enzyme and the FOX2 gene product of Saccharomyces cerevisiae; amino acids 596-736 which are similar to human sterol carrier protein 2. The previously cloned human 17 beta-HSD I, II and III are less than 25% identical with 17 beta-HSD IV. mRNA for HSD IV is a single species of 3.0 kb, present in many tissues with highest concentrations in liver, heart, prostate and testes. When over-expressed in mammalian cells, the human 17 beta-HSD IV enzyme displays a specific unidirectional oxidative 17 beta-HSD activity. Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7487879

Evaluation of the transforming growth factor-beta activity in normal and dry eye human tears by CCL-185 cell bioassay.

PubMed

Zheng, Xiaofen; De Paiva, Cintia S; Rao, Kavita; Li, De-Quan; Farley, William J; Stern, Michael; Pflugfelder, Stephen C

2010-09-01

To develop a new bioassay method using human lung epithelial cells (CCL-185) to assess activity of transforming growth factor beta (TGF-beta) in human tear fluid from normal subjects and patients with dry eye. Two epithelial cell lines, mink lung cells (CCL-64) and human lung cells (CCL-185), were compared to detect the active form of TGF-beta by BrdU incorporation (quantitation of cell DNA synthesis) and WST assay (metabolic activity of viable cells). The effect of TGF-beta on the growth of CCL-185 cells was observed microscopically. Human tears from normal control subjects and patients with dry eye (DE) with and without Sjögren syndrome were evaluated for TGF-beta concentration by Luminex microbead assay, and TGF-beta activity by the CCL-185 cell growth inhibition bioassay. The metabolic activity of viable CCL-185 cells, measured by WST, was shown to be proportional to the TGF-beta1 concentration (R = 0.919) and confirmed by BrdU assay (R = 0.969). Compared with CCL-185, metabolic activity of viable cells and DNA synthesis, measured by WST and BrdU incorporation assays, were shown to be less proportional to the TGF-beta1 concentration in the CCL-64 line (R = 0.42 and 0.17, respectively). Coincubation with human anti-TGF-beta1 antibody (MAB-240) yielded a dose-dependent inhibition of TGF-beta1 (0.3 ng/mL) activity. CCL-185 cell growth observed microscopically was noted to decrease in response to increasing TGF-beta1 concentrations. Levels of immuodetectable TGF-beta1 and TGF-beta2 were similar in normal and DE tears. TGF-beta bioactivity in DE human tears measured by the CCL-185 cells assay was found to be higher (9777.5 +/- 10481.9 pg/mL) than those in normal controls (4129.3 +/- 1342.9 pg/mL) (P < 0.05). Among patients with DE, TGF-beta bioactivity was highest in those with Sjögren syndrome. Approximately, 79.1% of TGF-beta in DE tears and 37.6% TGF-beta in normal tears were found to be biologically active. The CCL-185 cell assay was found to be a suitable tool for assessing TGF-beta activity in human tears. Tear TGF-beta bioactivity increases in DE, particularly in Sjögren syndrome, where elevated levels of TGF-beta1 transcripts in the conjunctival epithelium have been previously detected.

Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

PubMed

Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

1987-01-26

Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

Membrane protein GARP is a receptor for latent TGF-beta on the surface of activated human Treg.

PubMed

Stockis, Julie; Colau, Didier; Coulie, Pierre G; Lucas, Sophie

2009-12-01

Human Treg and Th clones secrete the latent form of TGF-beta, in which the mature TGF-beta protein is bound to the latency-associated peptide (LAP), and is thereby prevented from binding to the TGF-beta receptor. We previously showed that upon TCR stimulation, human Treg clones but not Th clones produce active TGF-beta and bear LAP on their surface. Here, we show that latent TGF-beta, i.e. both LAP and mature TGF-beta, binds to glycoprotein A repetitions predominant (GARP), a transmembrane protein containing leucine rich repeats, which is present on the surface of stimulated Treg clones but not on Th clones. Membrane localization of latent TGF-beta mediated by binding to GARP may be necessary for the ability of Treg to activate TGF-beta upon TCR stimulation. However, it is not sufficient as lentiviral-mediated expression of GARP in human Th cells induces binding of latent TGF-beta to the cell surface, but does not result in the production of active TGF-beta upon stimulation of these Th cells.

A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

PubMed

Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

2017-01-01

We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin

PubMed Central

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-01-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260

PGC-1 Coactivator Activity Is Required for Murine Erythropoiesis

PubMed Central

Cui, Shuaiying; Tanabe, Osamu; Lim, Kim-Chew; Xu, H. Eric; Zhou, X. Edward; Lin, Jiandie D.; Shi, Lihong; Schmidt, Lindsay; Campbell, Andrew; Shimizu, Ritsuko; Yamamoto, Masayuki

2014-01-01

Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) and PGC-1β have been shown to be intimately involved in the transcriptional regulation of cellular energy metabolism as well as other biological processes, but both coactivator proteins are expressed in many other tissues and organs in which their function is, in essence, unexplored. Here, we found that both PGC-1 proteins are abundantly expressed in maturing erythroid cells. PGC-1α and PGC-1β compound null mutant (Pgc-1c) animals express less β-like globin mRNAs throughout development; consequently, neonatal Pgc-1c mice exhibit growth retardation and profound anemia. Flow cytometry shows that the number of mature erythrocytes is markedly reduced in neonatal Pgc-1c pups, indicating that erythropoiesis is severely compromised. Furthermore, hematoxylin and eosin staining revealed necrotic cell death and cell loss in Pgc-1c livers and spleen. Chromatin immunoprecipitation studies revealed that both PGC-1α and -1β, as well as two nuclear receptors, TR2 and TR4, coordinately bind to the various globin gene promoters. In addition, PGC-1α and -1β can interact with TR4 to potentiate transcriptional activation. These data provide new insights into our understanding of globin gene regulation and raise the interesting possibility that the PGC-1 coactivators can interact with TR4 to elicit differential stage-specific effects on globin gene transcription. PMID:24662048

Relaxed functional constraints on triplicate α-globin gene in the bank vole suggest a different evolutionary history from other rodents

PubMed Central

Marková, S; Searle, J B; Kotlík, P

2014-01-01

Gene duplication plays an important role in the origin of evolutionary novelties, but the mechanisms responsible for the retention and functional divergence of the duplicated copy are not fully understood. The α-globin genes provide an example of a gene family with different numbers of gene duplicates among rodents. Whereas Rattus and Peromyscus each have three adult α-globin genes (HBA-T1, HBA-T2 and HBA-T3), Mus has only two copies. High rates of amino acid evolution in the independently derived HBA-T3 genes of Peromyscus and Rattus have been attributed to positive selection. Using RACE PCR, reverse transcription-PCR (RT–PCR) and RNA-seq, we show that another rodent, the bank vole Clethrionomys glareolus, possesses three transcriptionally active α-globin genes. The bank vole HBA-T3 gene is distinguished from each HBA-T1 and HBA-T2 by 20 amino acids and is transcribed 23- and 4-fold lower than HBA-T1 and HBA-T2, respectively. Polypeptides corresponding to all three genes are detected by electrophoresis, demonstrating that the translated products of HBA-T3 are present in adult erythrocytes. Patterns of codon substitution and the presence of low-frequency null alleles suggest a postduplication relaxation of purifying selection on bank vole HBA-T3. PMID:24595364

Assignment of the structural gene for human beta glucuronidase to chromosome 7 and tetrameric association of subunits in the enzyme molecule.

PubMed Central

Chern, C J; Croce, C M

1976-01-01

The structural locus for human beta glucuronidase is assigned to chromosome 7, a localization based upon concordant segregation of the expression of the human enzyme and the presence of human chromosome 7 in somatic cell hybrid clones derived independently from fusions of different human and mouse cells. Hybrid clones containing only human chromosome 7 are included in this study. Electrophoresis of beta glucuronidase also has revealed that human beta glucuronidase has a tetrametric structure. Images Fig. 1 Fig. 2 Fig. 3 PMID:941902

The Molecular Basis of β-Thalassemia

PubMed Central

Thein, Swee Lay

2013-01-01

The β-thalassemias are characterized by a quantitative deficiency of β-globin chains underlaid by a striking heterogeneity of molecular defects. Although most of the molecular lesions involve the structural β gene directly, some down-regulate the gene through distal cis effects, and rare trans-acting mutations have also been identified. Most β-thalassemias are inherited in a Mendelian recessive fashion but there is a subgroup of β-thalassemia alleles that behave as dominant negatives. Unraveling the molecular basis of β-thalassemia has provided a paradigm for understanding of much of human genetics. PMID:23637309

Structural relationships between human erythrocyte sialoglycoproteins beta and gamma and abnormal sialoglycoproteins found in certain rare human erythrocyte variants lacking the Gerbich blood-group antigen(s).

PubMed Central

Reid, M E; Anstee, D J; Tanner, M J; Ridgwell, K; Nurse, G T

1987-01-01

The human erythrocyte membrane sialoglycoproteins beta and gamma are important for the maintenance of the discoid shape of the normal erythrocyte. In this paper we show that the human erythrocyte sialoglycoproteins beta and gamma (hereafter called beta and gamma) are structurally related. Rabbit antisera produced against purified beta and beta 1 and rendered specific to the cytoplasmic portion of these proteins also react with the cytoplasmic portion of gamma. Some human anti-Gerbich (Ge) sera react with the extracellular portion of both beta and gamma. This reactivity is shown to be directed towards a common epitope on beta and gamma. However, most anti-Ge sera do not react with beta, but react with an extracellular epitope only present on gamma. All individuals who lack the Ge antigens lack beta and gamma. In some cases abnormal sialoglycoproteins are present in the erythrocytes, and these are shown to be structurally related to beta and gamma. Rabbit antisera raised against the purified abnormal sialoglycoprotein from a Ge-negative erythrocyte type reacted with the cytoplasmic portion of both beta and gamma. Unlike normal beta and gamma, the abnormal sialoglycoproteins found in Ge-negative erythrocytes migrate as a diffuse band on SDS/polyacrylamide-gel electrophoresis. Studies using endoglycosidases suggest that the diffuse nature of these bands results from carbohydrate heterogeneity and that the abnormal sialoglycoproteins contain N-glycosidically linked oligosaccharides with repeating lactosamine units. Such polylactosamine chains are not present on normal beta or gamma. Images Fig. 1. Fig. 2. Fig. 3. PMID:2444210

Engineered U7 snRNA mediates sustained splicing correction in erythroid cells from β-thalassemia/HbE patients.

PubMed

Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros

2018-04-30

Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.

The effect of histone deacetylase inhibitors on AHSP expression

PubMed Central

Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

2018-01-01

Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05), except for the expression of BCL11A, which was down-regulated (p < 0.05) in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005) on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

Urocortin 3 Marks Mature Human Primary and Embryonic Stem Cell-Derived Pancreatic Alpha and Beta Cells

PubMed Central

van der Meulen, Talitha; Xie, Ruiyu; Kelly, Olivia G.; Vale, Wylie W.; Sander, Maike; Huising, Mark O.

2012-01-01

The peptide hormone Urocortin 3 (Ucn 3) is abundantly and exclusively expressed in mouse pancreatic beta cells where it regulates insulin secretion. Here we demonstrate that Ucn 3 first appears at embryonic day (E) 17.5 and, from approximately postnatal day (p) 7 and onwards throughout adult life, becomes a unifying and exclusive feature of mouse beta cells. These observations identify Ucn 3 as a potential beta cell maturation marker. To determine whether Ucn 3 is similarly restricted to beta cells in humans, we conducted comprehensive immunohistochemistry and gene expression experiments on macaque and human pancreas and sorted primary human islet cells. This revealed that Ucn 3 is not restricted to the beta cell lineage in primates, but is also expressed in alpha cells. To substantiate these findings, we analyzed human embryonic stem cell (hESC)-derived pancreatic endoderm that differentiates into mature endocrine cells upon engraftment in mice. Ucn 3 expression in hESC-derived grafts increased robustly upon differentiation into mature endocrine cells and localized to both alpha and beta cells. Collectively, these observations confirm that Ucn 3 is expressed in adult beta cells in both mouse and human and appears late in beta cell differentiation. Expression of Pdx1, Nkx6.1 and PC1/3 in hESC-derived Ucn 3+ beta cells supports this. However, the expression of Ucn 3 in primary and hESC-derived alpha cells demonstrates that human Ucn 3 is not exclusive to the beta cell lineage but is a general marker for both the alpha and beta cell lineages. Ucn 3+ hESC-derived alpha cells do not express Nkx6.1, Pdx1 or PC1/3 in agreement with the presence of a separate population of Ucn 3+ alpha cells. Our study highlights important species differences in Ucn 3 expression, which have implications for its utility as a marker to identify mature beta cells in (re)programming strategies. PMID:23251699

Stability and Application of Reactive Nitrogen and Oxygen Species-Induced Hemoglobin Modifications in Dry Blood Spots As Analyzed by Liquid Chromatography Tandem Mass Spectrometry.

PubMed

Chen, Hauh-Jyun Candy; Fan, Chih-Huang; Yang, Ya-Fen

2016-12-19

Dried blood spot (DBS) is an emerging microsampling technique for the bioanalysis of small molecules, including fatty acids, metabolites, drugs, and toxicants. DBS offers many advantages as a sample format including easy sample collection and cheap sample shipment. Hemoglobin adducts have been recognized as a suitable biomarker for monitoring chemical exposure. We previously reported that certain modified peptides in hemoglobin derived from reactive chlorine, nitrogen, and oxygen species are associated with factors including smoking, diabetes mellitus, and aging. However, the stability of these oxidation-induced modifications of hemoglobin remains unknown and whether they can be formed artifactually during storage of DBS. To answer these questions, globin extracted from the DBS cards was analyzed, and the stability of the modifications was evaluated. After storage of the DBS cards at 4 °C or room temperature up to 7 weeks, we isolated globin from a quarter of the spot every week. The extents of 11 sites and types of post-translational modifications (PTMs), including nitration and nitrosylation of tyrosine and oxidation of cysteine and methionine residues, in human hemoglobin were measured in the trypsin digest by nanoflow liquid chromatography-nanospray ionization tandem mass spectrometry (nanoLC-NSI/MS/MS) using selected reaction monitoring. The extents of all these PTMs are stable within 14 days when stored on DBS at room temperature and at 4 °C, while those from direct extraction of fresh blood are stable for at least 8 weeks when stored as an aqueous solution at -20 °C. Extraction of globin from a DBS card is of particular importance for hemolytic blood samples. To our knowledge, this is the first report on the stability of oxidative modifications of hemoglobin on DBSs, which are stable for 14 days under ambient conditions (room temperature, in air). Therefore, it is feasible and convenient to analyze these hemoglobin modifications from DBSs in studies involving large populations.

Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

PubMed

Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

2010-03-01

Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Synthesis and cytotoxic analysis of some disodium 3beta,6beta-dihydroxysterol disulfates.

PubMed

Cui, Jianguo; Wang, Hui; Huang, Yanmin; Xin, Yi; Zhou, Aimin

2009-01-01

Disodium 3beta,6beta-dihydroxy-5alpha-cholestane disulfate (1) was synthesized in 4 steps with a high overall yield from cholesterol. First, cholesterol (4a) was converted to cholest-4-en-3,6-dione (5a) via oxidation with pyridinium chlorochromate (PCC) and then 5a was reduced by NaBH(4) in the presence of NiCl(2) to produce cholest-3beta,6beta-diol (6a). The reaction of 6a with the triethylamine-sulfur trioxide complex generated diammonium 3beta,6beta-dihydroxy-5alpha-cholestane disulfate (7a) and the treatment of 7a by cation exchange resin 732 (sodium form)(Na(+)) yielded the target steroid 1. Disodium 24-ethyl-3beta,6beta-dihydroxycholest-22-ene disulfate (2) and disodium 24-ethyl-3beta,6beta-dihydroxycholestane disulfate (3) were synthesized using a similar method. The cytotoxicity of these compounds against Sk-Hep-1 (human liver carcinoma cell line), H-292 (human lung carcinoma cell line), PC-3 (human prostate carcinoma cell line) and Hey-1B (human ovarian carcinoma cell line) cells was investigated. Our results indicate that presence of a cholesterol-type side chain at position 17 is necessary for their biological activity.

Specific radioimmunoassay of human. beta. -endorphin in unextracted plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiedemann, E.; Saito, T.; Linfoot, J.A.

1979-09-01

With an antiserum against human ..beta..-endorphin (..beta..-EP) crossreacting <2% with human ..beta..-lipotropin (..beta..-LPH) by weight we have developed a radioimmunoassay that can detect 1 pg ..beta..-EP in diluted raw plasma. In a.m. fasting plasma of 14 normal subjects ..beta..-EP ranged from <5 to 45 pg/ml. ..beta..-EP was elevated in untreated, but normal in successfully treated Cushing's disease; undetectable in a patient with adrenal adenoma; extremely high in Nelson's syndrome; and elevated in a patient with bronchogenic carcinoma before, but undetectable after tumor resection. In subjects with intact hypothalamic-pituitary-adrenal axis, ..beta..-EP was undectectable after dexamethasone and increased after metyrapone administration andmore » insulin-induced hypoglycemia. ..beta..-EP concentration was considerably lower in serum than in simultaneously collected plasma, but increased in serum left unfrozen for several hours after clot removal. Thus, ..beta..-EP behaves like a hormone responding to the same stimuli as ACTH and ..beta..-LPH and blood appears to contain enzymes both generating and destroying immunoreactive ..beta..-EP.« less

Stability of human interferon-beta 1: oligomeric human interferon-beta 1 is inactive but is reactivated by monomerization.

PubMed

Utsumi, J; Yamazaki, S; Kawaguchi, K; Kimura, S; Shimizu, H

1989-10-05

Human interferon-beta 1 is extremely stable is a low ionic strength solution of pH 2 such as 10 mM HCl at 37 degrees C. However, the presence of 0.15 M NaCl led to a remarkable loss of antiviral activity. The molecular-sieve high-performance liquid chromatography revealed that, whereas completely active human interferon-beta 1 eluted as a 25 kDa species (monomeric form), the inactivated preparation eluted primarily as a 90 kDa species (oligomeric form). The specific activity (units per mg protein) of the oligomeric form was approx. 10% of that of the monomeric form. This observation shows that oligomeric human interferon-beta 1 is apparently in an inactive form. When the oligomeric eluate was resolved by polyacrylamide gel containing sodium dodecyl sulphate (SDS), it appeared to be monomeric under non-reducing conditions. Monomerization of the oligomeric human interferon-beta 1 by treatment with 1% SDS, fully regenerated its antiviral activity. These results suggest that the inactivation of the human interferon-beta 1 preparation was caused by its oligomerization via hydrophobic interactions without the formation of intermolecular disulphide bonds. These oligomers can be dissociated by SDS to restore biological activity.

Beta2 toxin is not involved in in vitro cell cytotoxicity caused by human and porcine cpb2-harbouring Clostridium perfringens.

PubMed

Allaart, Janneke G; van Asten, Alphons J A M; Vernooij, Johannes C M; Gröne, Andrea

2014-06-25

Clostridium perfringens is a common cause of intestinal disease in animals and humans. Its pathogenicity is attributed to the toxins it can produce, including the beta2 toxin. The presence of cpb2, the gene encoding the beta2 toxin, has been associated with diarrhoea in neonatal piglets and humans. However, the exact role of the beta2 toxin in the development of diarrhoea is still unknown. In this study we investigated the level of cytotoxicity to porcine IPI-21 and human Caco-2 cell-lines caused by porcine and human cpb2-harbouring C. perfringens and the significance of the beta2 toxin for the induction of cell cytotoxicity. Supernatants of porcine cpb2-harbouring C. perfringens strains were cytotoxic to both cell lines. Cell cytotoxicity caused by supernatant of human cpb2-harbouring C. perfringens strains was variable among strains. However, removal of the beta2 toxin by anti-beta2 toxin antibodies or degradation of the beta2 toxin by trypsin did not reduce the cytotoxic effect of any of the supernatants. These data suggest that beta2 toxin does not play a role in the development of cell cytotoxicity in in vitro experiments. In vivo studies are necessary to definitely define the role of beta2 toxin in the development of cell cytotoxicity and subsequent diarrhoea. Copyright © 2014 Elsevier B.V. All rights reserved.

Vectorization of morpholino oligomers by the (R-Ahx-R)4 peptide allows efficient splicing correction in the absence of endosomolytic agents.

PubMed

Abes, Saïd; Moulton, Hong M; Clair, Philippe; Prevot, Paul; Youngblood, Derek S; Wu, Rebecca P; Iversen, Patrick L; Lebleu, Bernard

2006-12-01

The efficient and non-toxic nuclear delivery of steric-block oligonucleotides (ON) is a prerequisite for therapeutic strategies involving splice correction or exon skipping. Cationic cell penetrating peptides (CPPs) have given rise to much interest for the intracellular delivery of biomolecules, but their efficiency in promoting cytoplasmic or nuclear delivery of oligonucleotides has been hampered by endocytic sequestration and subsequent degradation of most internalized material in endocytic compartments. In the present study, we compared the splice correction activity of three different CPPs conjugated to PMO(705), a steric-block ON targeted against the mutated splicing site of human beta-globin pre-mRNA in the HeLa pLuc705 splice correction model. In contrast to Tat48-60 (Tat) and oligoarginine (R(9)F(2)) PMO(705) conjugates, the 6-aminohexanoic-spaced oligoarginine (R-Ahx-R)(4)-PMO(705) conjugate was able to promote an efficient splice correction in the absence of endosomolytic agents. Our mechanistic investigations about its uptake mechanisms lead to the conclusion that these three vectors are internalized using the same endocytic route involving proteoglycans, but that the (R-Ahx-R)(4)-PMO(705) conjugate has the unique ability to escape from lysosomial fate and to access to the nuclear compartment. This vector, which has displays an extremely low cytotoxicity, the ability to function without chloroquine adjunction and in the presence of serum proteins. It thus offers a promising lead for the development of vectors able to enhance the delivery of therapeutic steric-block ON in clinically relevant models.

Beta-Cryptoxanthin as a source of Vitamin A.

USDA-ARS?s Scientific Manuscript database

Beta-cryptoxanthin is a common carotenoid that is found in fruit, and in human blood and tissues. Foods that are rich in beta-cryptoxanthin include tangerines, persimmons, and oranges. Beta-cryptoxanthin has several functions that are important for human health, including roles in antioxidant defens...

Familial congenital cyanosis caused by Hb-MYantai(α-76 GAC → TAC, Asp → Tyr)

PubMed Central

2010-01-01

Methemoglobin (Hb-M) is a rare hemoglobinopathy in China. We hereby report on a family living in Yantai, East China, with congenital cyanosis due to Hb-M mutation. The proband, a 65-year-old female, presented 63% oxygen saturation. Both Hb-M concentration and arterial oxygen saturation remained unchanged, even following intravenous treatment with methylene blue. There was also no change in blood-color (chocolate-brown) after adding 0.1% KCN. A fast-moving band (Hb-X) in hemolysates was found by cellulose acetate electrophoresis, the Hb-X/Hb-A ratio exceeding 10%. GT transition at 131nt of exon 2, although present in one of the α2 -globin alleles, was not found in α1 -globin alleles as a whole. This mutation leads to the aspartic acid to tyrosine substitution (Asp76Tyr). In this family, the novel mutation in the α2 -globin gene resulted in a rare form of congenital cyanosis due to Hb-M. This hemoglobin was named Hb-M Yantai . PMID:21637412

Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.

PubMed

Thein, Swee Lay

2017-01-01

β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.

Identification of Mutations Causing Aberrant Termination and Deficient Splice Donor Site on the HBA1 Gene.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Forouzesh Pour, Fatemeh; Zeinali, Fatemeh; Rad, Fariba; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects on the α-globin gene cluster can result in α-thal that may develop a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. In the present study, four Iranian individuals with hypochromic microcytic anemia, who revealed none of the known mutations responsible for α-thal, were subjected for further investigations. The thalassemic phenotype of these patients resulted from abnormal RNA splicing sites owing to a missense at the splice donor site, a truncated protein or hemoglobin (Hb) variants as a result of two different substitutions on the α1-globin gene. The clinical presentation of mild anemia in these individuals showed the contribution of these novel mutations in α-thal in spite of the dominantly expressed α2-globin gene. This study describes hematological manifestations of subjects carrying some novel mutations comparable to the reported phenotype of α(+)-thal trait.

Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

PubMed

Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

A distal ligand mutes the interaction of hydrogen sulfide with human neuroglobin

PubMed Central

Ruetz, Markus; Kumutima, Jacques; Lewis, Brianne E.; Filipovic, Milos R.; Lehnert, Nicolai; Stemmler, Timothy L.; Banerjee, Ruma

2017-01-01

Hydrogen sulfide is a critical signaling molecule, but high concentrations cause cellular toxicity. A four-enzyme pathway in the mitochondrion detoxifies H2S by converting it to thiosulfate and sulfate. Recent studies have shown that globins like hemoglobin and myoglobin can also oxidize H2S to thiosulfate and hydropolysulfides. Neuroglobin, a globin enriched in the brain, was reported to bind H2S tightly and was postulated to play a role in modulating neuronal sensitivity to H2S in conditions such as stroke. However, the H2S reactivity of the coordinately saturated heme in neuroglobin is expected a priori to be substantially lower than that of the 5-coordinate hemes present in myoglobin and hemoglobin. To resolve this discrepancy, we explored the role of the distal histidine residue in muting the reactivity of human neuroglobin toward H2S. Ferric neuroglobin is slowly reduced by H2S and catalyzes its inefficient oxidative conversion to thiosulfate. Mutation of the distal His64 residue to alanine promotes rapid binding of H2S and its efficient conversion to oxidized products. X-ray absorption, EPR, and resonance Raman spectroscopy highlight the chemically different reaction options influenced by the distal histidine ligand. This study provides mechanistic insights into how the distal heme ligand in neuroglobin caps its reactivity toward H2S and identifies by cryo-mass spectrometry a range of sulfide oxidation products with 2–6 catenated sulfur atoms with or without oxygen insertion, which accumulate in the absence of the His64 ligand. PMID:28246171

Beta-lactoglobulin secretion in human milk varies widely after cow's milk ingestion in mothers of infants with cow's milk allergy.

PubMed

Sorva, R; Mäkinen-Kiljunen, S; Juntunen-Backman, K

1994-04-01

Cow's milk proteins secreted in human milk may cause cow's milk allergy (CMA) even during exclusive breast-feeding. We studied beta-lactoglobulin levels in human milk of mothers of infants with CMA. We also studied intestinal absorption of macromolecules in the same mothers to see whether it is related to the secretion of beta-lactoglobulin in human milk. CMA was verified with oral challenge in 46 of 55 infants assessed. beta-Lactoglobulin levels were assessed in human milk from 53 of 55 mothers of the infants before (basal sample) and 1 and 2 hours after an oral cow's milk load, which was given after a 24-hour milk-free diet. beta-Lactoglobulin was determined by an ELISA with a detection limit of 0.002 microgram/L. The 6-hour urine recovery of a high-molecular-weight polyethylene glycol (PEG) 3000 was assessed after an oral load of PEG in 45 of 55 mothers. beta-Lactoglobulin was found in the 1- or 2-hour samples in 75% of the mothers. beta-Lactoglobulin levels were increased in the 1- or 2-hour samples as compared with the basal levels in about half of the mothers. The respective levels were decreased in one third of the mothers whose basal beta-lactoglobulin levels were higher than in the others. beta-Lactoglobulin was found in none of the three human milk samples in 15% of the mothers. After an oral load of a high-molecular-weight PEG 3000, the 6-hour urine recovery of PEG was similar in the mothers of the infants with CMA and the mothers of infants without CMA. Neither was the urinary recovery of PEG related to the beta-lactoglobulin levels in human milk. The results support the view that beta-lactoglobulin in human milk may contribute to, but does not alone explain, the development of CMA in breast-fed infants.

Study on molecular epidemiology of the alpha-thalassemias in Liuzhou City, Guangxi Autonomous Region, China.

PubMed

Cai, Ren; Liu, Jingzhong; Wang, Lirong; Liang, Xin; Xiao, Bai; Su, Liu; Zhou, Yan; Pan, Lizhen

2004-01-01

Guangxi is one of the provinces of Southern China with the highest incidence of alpha-thalassemia (thal). Liuzhou is the second biggest city in Guangxi. To find out the incidence of the various alpha-thal genotypes, and their distribution in the Liuzhou area, an F820 Blood Cell Analysis System was used to measure the parameters of red blood cells. A SPIFE Rapid Auto-Electrophoresis System was used to analyze the normal and abnormal hemoglobins (Hbs). Multiplex polymerase chain reaction (mPCR) was used to detect the alpha-globin genotypes. Thirty-two (2.05%) out of 7805 young couples undergoing pre-marriage counseling, were diagnosed as having an Hb H (beta4) disease. The study of 1228 cord blood samples revealed 138 newborn children carrying an alpha-thal determinant with nine different genotypes, thus making the total incidence of alpha-thal 11.24%. Among 185 cases of Hb H, 119 (64.1%) were confirmed as being deletional, and 66 cases (35.7%) nondeletional types. The severity of the Hb H diseases could be classified in the following order: alphaCSalpha/--SEA (alphaConstant (Spring)alpha/--Southeast Asia); alpha(-4.2)/--SEA; alpha(-3.7)/--SEA. Ten cases of alpha-thal determinants were found in combination with beta-thal. The mPCR technique can detect all kinds of combinations of the three common large deletions (--SEA, alpha(-4.2) and alpha(-3.7)) accurately and conveniently.

Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

PubMed

Moorchung, Nikhil; Phillip, Joseph; Sarkar, Ravi Shankar; Prasad, Rupesh; Dutta, Vibha

2013-01-01

Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC) is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR)-based allele-specific Amplification Refractory Mutation System (ARMS). Molecular analysis for the sickle cell mutation was done by standard methods. The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23%) of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS) because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

Clostridium perfringens enterotoxin is a superantigen reactive with human T cell receptors V beta 6.9 and V beta 22

PubMed Central

1992-01-01

Candidate superantigens were screened for their ability to induce lysis of human histocompatibility leukocyte antigen class II-positive targets by human CD8+ influenza-specific cytotoxic T cell (CTL) lines. Clostridium perfringens enterotoxin (CPET) induced major histocompatibility complex unrestricted killing by some but not all CTL lines. Using "anchored" polymerase chain reactions, CPET was shown to selectively stimulate peripheral blood lymphocytes bearing T cell receptor V beta 6.9 and V beta 22 in five healthy donors. V beta 24, V beta 21, V beta 18, V beta 5, and V beta 6.1-5 appeared to be weakly stimulated. Antigen processing was not required for CPET to induce proliferation. Like the staphylococcal enterotoxins, CPET is a major cause of food poisoning. These data suggest that superantigenic and enterotoxigenic properties may be closely linked. PMID:1512551

Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calabrese, G.; Morizio, E.; Palka, G.

1994-11-01

Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here themore » authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.« less

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin.

PubMed

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-12-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

Immunogenicity of an interferon-beta1a product.

PubMed

Kauffman, M A; Sterin-Prync, A; Papouchado, M; González, E; Vidal, A J; Grossberg, S E; Chuppa, S; Odoriz, B; Vrech, C; Diez, R A; Ferro, H H

2011-01-01

In order to determine whether Blastoferon®, a biosimilar interferon (IFN)- beta 1a formulation, shares epitopes with other known IFN-beta products, a series of neutralization bioassays were performed with a set of well-characterized anti-IFN- beta monoclonal antibodies and human sera (World Health Organization Reference Reagents). The bioassay was the interferon-induced inhibition of virus cytopathic effect on human cells in culture (EMC virus and A-549 cells). Computer-calculated results were reported as Tenfold Reduction Units (TRU)/ml. To further assess Blastoferon® immunogenicity, in vivo production of anti-IFN beta antibodies was determined in sera of patients included in the pharmacovigilance plan of Blastoferon® by the level of IFN- beta 1a binding antibodies (by enzyme immunoassay -EIA) and neutralizing antibodies (in the Wish-VSV system). The highly characterized neutralizing monoclonal antibodies A1 and A5 that bind to specific regions of the IFN- beta molecule reacted positively with the three beta 1a IFNs: Blastoferon®, Rebif®, and the IFN- beta WHO Second International Standard 00/572. As expected, the non-neutralizing monoclonal antibodies B4 and B7 did not neutralize any of the IFN- beta preparations. The commercially available monoclonal antibody B-02 reacted essentially equally with Rebif® and Blastoferon®. The WHO Reference Reagent human serum anti-IFN- beta polyclonal antibody neutralized all the IFN- beta products, whereas the WHO Reference Reagent human serum anti-IFN-alpha polyclonal antibody G037-501-572 appropriately failed to react with any of the IFN- beta products. On the basis of in vitro reactivity with known, well-characterized monoclonal and polyclonal antibody preparations, Blastoferon® shares immunological determinants with other human interferon- beta products, especially IFN- beta 1a. In vivo antibodies were detected by EIA in 72.9% of 37 chronically treated multiple sclerosis patients, whereas neutralizing antibodies were found in 8.1% of them. Blastoferon® appears to have immunological characteristics comparable to other IFN- beta 1a products.

Expression and structural features of endoglin (CD105), a transforming growth factor beta1 and beta3 binding protein, in human melanoma.

PubMed Central

Altomonte, M.; Montagner, R.; Fonsatti, E.; Colizzi, F.; Cattarossi, I.; Brasoveanu, L. I.; Nicotra, M. R.; Cattelan, A.; Natali, P. G.; Maio, M.

1996-01-01

Human endoglin (CD105) is a member of the transforming growth factor beta (TGF-beta) receptor family that binds TGF-beta1 and -beta3, but not TGF-beta2, on human endothelial cells. Immunohistochemical analyses demonstrated that CD105 is expressed on normal and neoplastic cells of the melanocytic lineage. The anti-CD105 MAb, MAEND3, stained 50, 25 and 34% of intradermal naevi, primary and metastatic melanomas investigated, respectively, and nine out of 12 melanoma cell lines. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis revealed that CD105 expressed by melanoma cells consists of a homodimeric protein with an apparent molecular weight of 180 and 95 kDa under non-reducing and reducing conditions. Cross-linking of 125I-labelled TGF-beta1 to melanoma cells, Mel 97, by disuccinimidyl suberate (DSS) demonstrated that CD105 expressed on pigmented cells binds TGF-beta1; the pattern of binding of TGF-beta1 to melanoma cells was found to be similar to that of human umbilical vein endothelial cells. The addition of exogenous, bioactive TGF-beta1 significantly (P<0.05) inhibited the growth of CD105-positive melanoma cells, Mel 97, but did not affect that of CD105-negative melanoma cells, F0-1. These data, altogether, demonstrate that CD105 is expressed on pigmented cells and might play a functionally relevant role in the biology of human melanoma cells by regulating their sensitivity to TGF-betas. Images Figure 1 Figure 3 Figure 4 PMID:8932339

Specific radioimmunoassay for human. beta. -lipotropin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeffcoate, W.J.; Rees, L.H.; Lowry, P.J.

1978-07-01

A homologous RIA for human ..beta..-lipotropin (..beta..hLPH) has been developed. At a final dilution of 1:24,000, the antiserum employed shows cross-reaction with ..beta..hLPH but none with human ..beta..-MSH (..beta..hMSH), and it is concluded that the antigenic determinant lies within the N-terminal 1 to 36 region of ..beta..hLPH. With extraction of 3-ml plasma samples, the assay is sufficiently sensitive to measure circulating ..beta..hLPH levels in normal individuals at 0900 h (25 to 200 pg/ml). There is a circadian variation with levels falling to (less than 20 to 80 pg/ml) at 2300 h. ..beta..hLPH levels rise after metyrapone and after insulin-induced hypoglycemia,more » and fall after administration of dexamethasone. In patients with a variety of diseases of the pituitary-adrenal axis, levels of ..beta..hLPH follow immunoreactive ACTH levels, although the two are not always secreted on a 1:1 molar basis.« less

Transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to gelatin.

PubMed

Kubo, Miyoko; Clark, Richard A F; Katz, Anne B; Taichman, Lorne B; Jin, Zaishun; Zhao, Ying; Moriguchi, Takahiko

2007-04-01

alphavbeta3 is a multiligand integrin receptor that interacts with fibrinogen (FG), fibrin (FB), fibronectin (FN), vitronectin (VN), and denatured collagen. We previously reported that cultured normal human keratinocytes, like in vivo keratinocytes, do not express alphavbeta3 on the cell surface, and do not adhere to and migrate on FG and FB. Furthermore, we reported that human keratinocytes transduced with beta3 integrin subunit cDNA by a retrovirus-mediated transduction method express alphavbeta3 on the cell surface and adhere to FG, FB, FN, and VN significantly compared with beta-galactosidase (beta-gal) cDNA-transduced keratinocytes (control). In this study, we determined whether these beta3 integrin subunit cDNA-transduced keratinocytes or normal human keratinocytes adhere to denatured collagen (gelatin) using a 1 h cell adhesion assay. beta3 cDNA-transduced keratinocytes adhered to gelatin, whereas no significant adhesion was observed with the control cells (beta-gal cDNA-transduced keratinocytes and normal human keratinocytes). The adhesion to gelatin was inhibited by LM609, a monoclonal antibody to alphavbeta3, and RGD peptides but not by normal mouse IgG1 nor RGE peptides. Thus, transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to denatured collagen (gelatin) as well as to FG, FB, VN, and FN. Otherwise, normal human keratinocytes do not adhere to gelatin. These data support the idea that beta3 cDNA-transduced human keratinocytes can be a good material for cultured epithelium to achieve better take rate with acute or chronic wounds, in which FG, FB, and denatured collagen are abundantly present.

Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

PubMed

Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

1992-05-15

A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

Difference between beta1-adrenoceptor autoantibodies of human and animal origin-Limitations detecting beta1-adrenoceptor autoantibodies using peptide based ELISA technology.

PubMed

Wenzel, Katrin; Schulze-Rothe, Sarah; Müller, Johannes; Wallukat, Gerd; Haberland, Annekathrin

2018-01-01

Cell-based analytics for the detection of the beta1-adrenoceptor autoantibody (beta1-AAB) are functional, yet difficult to handle, and should be replaced by easily applicable, routine lab methods. Endeavors to develop solid-phase-based assays such as ELISA to exploit epitope moieties for trapping autoantibodies are ongoing. These solid-phase-based assays, however, are often unreliable when used with human patient material, in contrast to animal derived autoantibodies. We therefore tested an immunogen peptide-based ELISA for the detection of beta1-AAB, and compared commercially available goat antibodies against the 2nd extracellular loop of human beta1-adrenoceptor (ADRB1-AB) to autoantibodies enriched from patient material. The functionality of these autoantibodies was tested in a cell based assay for comparison and their structural appearance was investigated using 2D gel electrophoresis. The ELISA showed a limit of detection for ADRB1-AB of about 1.5 nmol antibody/L when spiked in human control serum and only about 25 nmol/L when spiked in species identical (goat) matrix material. When applied to samples of human origin, the ELISA failed to identify the specific beta1-AABs. A low concentration of beta1-AAB, together with structural inconsistency of the patient originated samples as seen from the 2D Gel appearance, might contribute to the failure of the peptide based ELISA technology to detect human beta1-AABs.

Two genetic markers closely linked to adult polycystic kidney disease on chromosome 16.

PubMed Central

Reeders, S T; Breuning, M H; Corney, G; Jeremiah, S J; Meera Khan, P; Davies, K E; Hopkinson, D A; Pearson, P L; Weatherall, D J

1986-01-01

The genetic locus for autosomal dominant adult polycystic kidney disease was recently assigned to chromosome 16 by the finding of genetic linkage to the alpha globin gene cluster. Further study showed that the phosphoglycolate phosphatase locus is also closely linked to both the locus for adult polycystic kidney disease and the alpha globin gene cluster. These findings have important implications for the prenatal and presymptomatic diagnosis of adult polycystic kidney disease and for a better understanding of its pathogenesis. Images FIG 1 PMID:3008903

Individual specific DNA fingerprints from a hypervariable region probe: alpha-globin 3'HVR.

PubMed

Fowler, S J; Gill, P; Werrett, D J; Higgs, D R

1988-06-01

A probe detecting a hypervariable region (HVR) 3' to the alpha globin locus on chromosome 16 has been used to produce DNA fingerprints. Segregation analysis has revealed multiple, randomly dispersed DNA fragments inherited in a Mendelian fashion with minimal allelism and linkage. The fingerprints are highly polymorphic (probability of chance association between random individuals much less than 10(-14]. The probe is, therefore, a powerful discriminating tool: it is envisaged that this probe will have forensic applications, including paternity cases, and will be informative in linkage analysis.

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Selective destruction of mouse islet beta cells by human T lymphocytes in a newly-established humanized type 1 diabetic model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Yong, E-mail: yongzhao@uic.edu; Guo, Chengshan; Hwang, David

2010-09-03

Research highlights: {yields} Establish a human immune-mediated type 1 diabetic model in NOD-scid IL2r{gamma}{sup null} mice. {yields} Using the irradiated diabetic NOD mouse spleen mononuclear cells as trigger. {yields} The islet {beta} cells were selectively destroyed by infiltrated human T cells. {yields} The model can facilitate translational research to find a cure for type 1 diabetes. -- Abstract: Type 1 diabetes (T1D) is caused by a T cell-mediated autoimmune response that leads to the loss of insulin-producing {beta} cells. The optimal preclinical testing of promising therapies would be aided by a humanized immune-mediated T1D model. We develop this model inmore » NOD-scid IL2r{gamma}{sup null} mice. The selective destruction of pancreatic islet {beta} cells was mediated by human T lymphocytes after an initial trigger was supplied by the injection of irradiated spleen mononuclear cells (SMC) from diabetic nonobese diabetic (NOD) mice. This resulted in severe insulitis, a marked loss of total {beta}-cell mass, and other related phenotypes of T1D. The migration of human T cells to pancreatic islets was controlled by the {beta} cell-produced highly conserved chemokine stromal cell-derived factor 1 (SDF-1) and its receptor C-X-C chemokine receptor (CXCR) 4, as demonstrated by in vivo blocking experiments using antibody to CXCR4. The specificity of humanized T cell-mediated immune responses against islet {beta} cells was generated by the local inflammatory microenvironment in pancreatic islets including human CD4{sup +} T cell infiltration and clonal expansion, and the mouse islet {beta}-cell-derived CD1d-mediated human iNKT activation. The selective destruction of mouse islet {beta} cells by a human T cell-mediated immune response in this humanized T1D model can mimic those observed in T1D patients. This model can provide a valuable tool for translational research into T1D.« less

Rapid comparison of properties on protein surface.

PubMed

Sael, Lee; La, David; Li, Bin; Rustamov, Raif; Kihara, Daisuke

2008-10-01

The mapping of physicochemical characteristics onto the surface of a protein provides crucial insights into its function and evolution. This information can be further used in the characterization and identification of similarities within protein surface regions. We propose a novel method which quantitatively compares global and local properties on the protein surface. We have tested the method on comparison of electrostatic potentials and hydrophobicity. The method is based on 3D Zernike descriptors, which provides a compact representation of a given property defined on a protein surface. Compactness and rotational invariance of this descriptor enable fast comparison suitable for database searches. The usefulness of this method is exemplified by studying several protein families including globins, thermophilic and mesophilic proteins, and active sites of TIM beta/alpha barrel proteins. In all the cases studied, the descriptor is able to cluster proteins into functionally relevant groups. The proposed approach can also be easily extended to other surface properties. This protein surface-based approach will add a new way of viewing and comparing proteins to conventional methods, which compare proteins in terms of their primary sequence or tertiary structure.

Human beta-endorphin: synthesis and biological activity of analogs with substitutions in positions 2, 9, 18, 27 and 31.

PubMed

Yeung, H W; Yamashiro, D; Tseng, L F; Chang, W C; Li, C H

1981-02-01

Four analogs of the opioid peptide human beta-endorphin (Bh-EP) have been synthesized: [D-Lys9, Phe27, Gly31]-beta h-EP, [D-PHe18,Phe27,Gly31]-beta h-EP, [D-Thr2,D-Lys9,Phe27,Gly31]-beta h-EP, and [D-Thr2,D-Phe18,Phe27,Gly31]-beta h-EP. All are practically indistinguishable from beta h-EP in the guinea pig ileum assay. All show diminished analgesic potency in the mouse tail-flick assay.

A Novel Di-Leucine Motif at the N-Terminus of Human Organic Solute Transporter Beta Is Essential for Protein Association and Membrane Localization.

PubMed

Xu, Shuhua; Soroka, Carol J; Sun, An-Qiang; Backos, Donald S; Mennone, Albert; Suchy, Frederick J; Boyer, James L

2016-01-01

The heteromeric membrane protein Organic Solute Transporter alpha/beta is the major bile acid efflux transporter in the intestine. Physical association of its alpha and beta subunits is essential for their polarized basolateral membrane localization and function in the transport of bile acids and other organic solutes. We identified a highly conserved acidic dileucine motif (-EL20L21EE) at the extracellular amino-tail of organic solute transporter beta from multiple species. To characterize the role of this protein interacting domain in the association of the human beta and alpha subunits and in membrane localization of the transporter, Leu20 and Leu21 on the amino-tail of human organic solute transporter beta were replaced with alanines by site-directed mutagenesis. Co-immunoprecipitation study in HEK293 cells demonstrated that substitution of the leucine residues with alanines prevented the interaction of the human beta mutant with the alpha subunit. Membrane biotinylation demonstrated that the LL/AA mutant eliminated membrane expression of both subunits. Computational-based modelling of human organic solute transporter beta suggested that the LL/AA mutation substantially alters both the structure and lipophilicity of the surface, thereby not only affecting the interaction with the alpha subunit but also possibly impacting the capacity of the beta subunit to traffick through the cell and interact with the membrane. In summary, our findings indicate that the dileucine motif in the extracellular N-terminal region of human organic solute transporter beta subunit plays a critical role in the association with the alpha subunit and in its polarized plasma membrane localization.

The receptor protein tyrosine phosphatase (RPTP){beta}/{zeta} is expressed in different subtypes of human breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perez-Pinera, Pablo; Garcia-Suarez, Olivia; Instituto Universitario de Oncologia del Principado de Asturias, Oviedo

2007-10-12

Increasing evidence suggests mutations in human breast cancer cells that induce inappropriate expression of the 18-kDa cytokine pleiotrophin (PTN, Ptn) initiate progression of breast cancers to a more malignant phenotype. Pleiotrophin signals through inactivating its receptor, the receptor protein tyrosine phosphatase (RPTP){beta}/{zeta}, leading to increased tyrosine phosphorylation of different substrate proteins of RPTP{beta}/{zeta}, including {beta}-catenin, {beta}-adducin, Fyn, GIT1/Cat-1, and P190RhoGAP. PTN signaling thus has wide impact on different important cellular systems. Recently, PTN was found to activate anaplastic lymphoma kinase (ALK) through the PTN/RPTP{beta}/{zeta} signaling pathway; this discovery potentially is very important, since constitutive ALK activity of nucleophosmin (NPM)-ALK fusionmore » protein is causative of anaplastic large cell lymphomas, and, activated ALK is found in other malignant cancers. Recently ALK was identified in each of 63 human breast cancers from 22 subjects. We now demonstrate that RPTP{beta}/{zeta} is expressed in each of these same 63 human breast cancers that previously were found to express ALK and in 10 additional samples of human breast cancer. RPTP{beta}/{zeta} furthermore was localized not only in its normal association with the cell membrane but also scattered in cytoplasm and in nuclei in different breast cancer cells and, in the case of infiltrating ductal carcinomas, the distribution of RPTP{beta}/{zeta} changes as the breast cancer become more malignant. The data suggest that the PTN/RPTP{beta}/{zeta} signaling pathway may be constitutively activated and potentially function to constitutively activate ALK in human breast cancer.« less

Effect of (R)-2-(2-aminothiazol-4-yl)-4'-{2-[(2-hydroxy-2-phenylethyl)amino]ethyl} acetanilide (YM178), a novel selective beta3-adrenoceptor agonist, on bladder function.

PubMed

Takasu, Toshiyuki; Ukai, Masashi; Sato, Shuichi; Matsui, Tetsuo; Nagase, Itsuro; Maruyama, Tatsuya; Sasamata, Masao; Miyata, Keiji; Uchida, Hisashi; Yamaguchi, Osamu

2007-05-01

We evaluated the pharmacological characteristics of (R)-2-(2-aminothiazol-4-yl)-4'-{2-[(2-hydroxy-2-phenylethyl)amino]-ethyl} acetanilide (YM178). YM178 increased cyclic AMP accumulation in Chinese hamster ovary (CHO) cells expressing human beta3-adrenoceptor (AR). The half-maximal effective concentration (EC50) value was 22.4 nM. EC50 values of YM178 for human beta1- and beta2-ARs were 10,000 nM or more, respectively. The ratio of intrinsic activities of YM178 versus maximal response induced by isoproterenol (nonselective beta-AR agonist) was 0.8 for human beta3-ARs, 0.1 for human beta1-ARs, and 0.1 for human beta2-ARs. The relaxant effects of YM178 were evaluated in rats and humans bladder strips precontracted with carbachol (CCh) and compared with those of isoproterenol and 4-[3-[(1,1-dimethylethyl)amino]-2-hydroxypropoxy]-1,3-dihydro-2H-benzimidazol-2-one hydrochloride (CGP-12177A) (beta3-AR agonist). EC50 values of YM178 and isoproterenol in rat bladder strips precontracted with 10(-6) M CCh were 5.1 and 1.4 microM, respectively, whereas those in human bladder strips precontracted with 10(-7) M CCh were 0.78 and 0.28 microM, respectively. In in vivo study, YM178 at a dose of 3 mg/kg i.v. decreased the frequency of rhythmic bladder contraction induced by intravesical filling with saline without suppressing its amplitude in anesthetized rats. These findings suggest the suitability of YM178 as a therapeutic drug for the treatment of symptoms of overactive bladder such as urinary frequency, urgency, and urge incontinence.

Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

PubMed

Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

2016-11-30

Thalassemia is an inherited autosomal recessive blood disorder, caused by mutations in globin genes or their regulatory regions. This results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains precipitate in red blood cells, leading to their destruction (haemolysis) and ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the curative potential. This is an update of a previously published Cochrane Review. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 18 August 2016. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.

PubMed

Vasseur, Corinne; Domingues-Hamdi, Elisa; Ledudal, Katia; Le Corvoisier, Philippe; Barau, Caroline; Ghaleh, Bijan; Rialland, Amandine; Pissard, Serge; Galactéros, Frédéric; Baudin-Creuza, Véronique

2017-10-01

The severity of β-thalassaemia (β-thal) intermedia is mainly correlated to the degree of imbalanced α/non α-globin chain synthesis. The phenotypic diversity of β-thal depends on this imbalance and reflects all possible combinations of α- and β-globin genotypes, levels of fetal haemoglobin (HbF) and co-inheritance of other modulating factors. This study aimed to demonstrate the validity of a new surrogate of α/non α-globin biosynthetic ratio by measuring the soluble α-Hb pool in lysed red blood cells. Our results confirm that the α-Hb pool measurement allows a good discrimination between β-thal intermedia patients, controls and α-thal patients (P < 0·003). Receiver operator characteristic analyses revealed an area under the curve of 0·978 for the α-Hb pool measurement at a threshold of 120 ng free α-Hb/mg of total Hb/ml of haemolysate (ppm) with a sensitivity and specificity of 86% and 100%, respectively, to discriminate between β-thal and not β-thal subjects. Significant correlations were observed between the α-Hb pool and biological parameters of β-thal, the most significant association being observed with red cell hexokinase activity. This study indicates that the α-Hb pool could be a new marker for assistance in diagnostic orientation of β-thal intermedia patients and may be clinically useful for monitoring the evolution of the disequilibrium of globin synthesis in response to treatments. © 2017 John Wiley & Sons Ltd.

Molecular Mechanism of Yisui Shengxue Granule, a Complex Chinese Medicine, on Thalassemia Patients Suffering from Hemolysis and Anemia of Erythrocytes

PubMed Central

Chu, Na-Li; Wu, Zhi-kui; Zhang, Xin-Hua; Fang, Su-Ping; Wang, Wen-Juan; Cheng, Yan-Ling

2014-01-01

The objective of this study was to investigate the therapeutic biological mechanism of Yisui Shengxue Granule (YSSXG), a complex Chinese medicine, on the hemolysis and anemia of erythrocytes from patient with thalassemia disease. Sixteen patients with thalassemia (8 cases of α-thalassemia and 8 cases of β-thalassemia) disease were collected and treated with YSSXG for 3 months. The improvements of blood parameter demonstrated that YSSXG had a positive clinical effect on patients with thalassemia disease. For patients with α-thalassemia disease, RT-PCR showed that YSSXG upregulated the relative mRNA expression level of α-globin to β-globin and downregulated DNMT1, DNMT3a, and DNMT3b mRNA compared with pretreatment. Western blotting showed that YSSXG downregulated the expression of DNMT1 and DNMT3a. For patients with β-thalassemia disease, the relative expression level of A γ-globin to α-globin had an increasing trend and the level of BCL11A mRNA expression obviously increased. For all patients, RT-PCR showed that YSSXG upregulated mRNA expression of SPTA1 and SPTB. Activities of SOD and GSH-Px significantly increased and MDA obviously reduced on erythrocyte and blood serum after YSSXG treatment. TEM showed that YSSXG decreased the content of inclusion bodies. Activities of Na+K+-ATPtase and T-ATPtase of erythrocyte increased significantly after YSSXG treatment. This study provides the basis for mechanisms of YSSXG on thalassemia suffering with hemolysis and anemia of erythrocytes from patient. PMID:25574177

Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

PubMed Central

Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

1992-01-01

A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes. Images PMID:1533935

Dynamics of active sites in biological macromolecules using a Green-function approach: An application to heme vibrational dynamics in myoglobin

NASA Astrophysics Data System (ADS)

Rai, Brajesh; Prohofsky, Earl

2003-03-01

Dynamics of functionally active regions of biological macromolecules can be studied using a Green-function technique. This approach uses the fact that in most cases one has a good set of force constants for active sites, and rather poorly defined force field parameters for other regions of the macromolecule. The Green-function method is applied to study the iron vibrational modes of the heme active site in myoglobin. In this approach, the heme active site is viewed as a system interacting with surrounding globin, which acts as an excitation bath. The normal modes of heme and globin are separately calculated using the best available force fields for the two entities. The iron vibrational spectrum of myoglobin is then obtained using the solutions of the heme and globin, and by considering physically meaningful interactions between the two units. The refinement of the Green-function calculations to the experimental data from an x-ray synchrotron-based Nuclear Resonance Vibrational Spectroscopy provides important insights into the character of iron normal modes of myoglobin.

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

Discovery of phenylsulfonylfuroxan derivatives as gamma globin inducers by histone acetylation.

PubMed

Melo, Thais Regina Ferreira de; Kumkhaek, Chutima; Fernandes, Guilherme Felipe Dos Santos; Lopes Pires, Maria Elisa; Chelucci, Rafael Consolin; Barbieri, Karina Pereira; Coelho, Fernanda; Capote, Ticiana Sidorenko de Oliveira; Lanaro, Carolina; Carlos, Iracilda Zeppone; Marcondes, Sisi; Chegaev, Konstantin; Guglielmo, Stefano; Fruttero, Roberta; Chung, Man Chin; Costa, Fernando Ferreira; Rodgers, Griffin P; Dos Santos, Jean Leandro

2018-05-28

N-oxide derivatives 5(a-b), 8(a-b), and 11(a-c) were designed, synthesized and evaluated in vitro and in vivo as potential drugs that are able to ameliorate sickle cell disease (SCD) symptoms. All of the compounds demonstrated the capacity to releasing nitric oxide at different levels ranging from 0.8 to 30.1%, in vivo analgesic activity and ability to reduce TNF-α levels in the supernatants of monocyte cultures. The most active compound (8b) protected 50.1% against acetic acid-induced abdominal constrictions, while dipyrone, which was used as a control only protected 35%. Compounds 8a and 8b inhibited ADP-induced platelet aggregation by 84% and 76.1%, respectively. Both compounds increased γ-globin in K562 cells at 100 μM. The mechanisms involved in the γ-globin increase are related to the acetylation of histones H3 and H4 that is induced by these compounds. In vitro, the most promising compound (8b) was not cytotoxic, mutagenic and genotoxic. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Thalassaemia.

PubMed

Higgs, Douglas R; Engel, James Douglas; Stamatoyannopoulos, George

2012-01-28

Thalassaemia is one of the most common genetic diseases worldwide, with at least 60,000 severely affected individuals born every year. Individuals originating from tropical and subtropical regions are most at risk. Disorders of haemoglobin synthesis (thalassaemia) and structure (eg, sickle-cell disease) were among the first molecular diseases to be identified, and have been investigated and characterised in detail over the past 40 years. Nevertheless, treatment of thalassaemia is still largely dependent on supportive care with blood transfusion and iron chelation. Since 1978, scientists and clinicians in this specialty have met regularly in an international effort to improve the management of thalassaemia, with the aim of increasing the expression of unaffected fetal genes to improve the deficiency in adult β-globin synthesis. In this Seminar we discuss important advances in the understanding of the molecular and cellular basis of normal and abnormal expression of globin genes. We will summarise new approaches to the development of tailored pharmacological agents to alter regulation of globin genes, the first trial of gene therapy for thalassaemia, and future prospects of cell therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.

Nonisotopic detection of human papillomavirus DNA in clinical specimens using a consensus PCR and a generic probe mix in an enzyme-linked immunosorbent assay format.

PubMed

Kornegay, J R; Shepard, A P; Hankins, C; Franco, E; Lapointe, N; Richardson, H; Coutleé, F

2001-10-01

We assessed the value of a new digoxigenin (DIG)-labeled generic probe mix in a PCR-enzyme-linked immunosorbent assay format to screen for the presence of human papillomavirus (HPV) DNA amplified from clinical specimens. After screening with this new generic assay is performed, HPV DNA-positive samples can be directly genotyped using a reverse blotting method with product from the same PCR amplification. DNA from 287 genital specimens was amplified via PCR using biotin-labeled consensus primers directed to the L1 gene. HPV amplicons were captured on a streptavidin-coated microwell plate (MWP) and detected with a DIG-labeled HPV generic probe mix consisting of nested L1 fragments from types 11, 16, 18, and 51. Coamplification and detection of human DNA with biotinylated beta-globin primers served as a control for both sample adequacy and PCR amplification. All specimens were genotyped using a reverse line blot assay (13). Results for the generic assay using MWPs and a DIG-labeled HPV generic probe mix (DIG-MWP generic probe assay) were compared with results from a previous analysis using dot blots with a radiolabeled nested generic probe mix and type-specific probes for genotyping. The DIG-MWP generic probe assay resulted in high intralaboratory concordance in genotyping results (88% versus 73% agreement using traditional methods). There were 207 HPV-positive results using the DIG-MWP method and 196 positives using the radiolabeled generic probe technique, suggesting slightly improved sensitivity. Only one sample failed to test positive with the DIG-MWP generic probe assay in spite of a positive genotyping result. Concordance between the two laboratories was nearly 87%. Approximately 6% of samples that were positive or borderline when tested with the DIG-MWP generic probe assay were not detected with the HPV type-specific panel, perhaps representing very rare or novel HPV types. This new method is easier to perform than traditional generic probe techniques and uses more objective interpretation criteria, making it useful in studies of HPV natural history.

Human erythrocytes analyzed by generalized 2D Raman correlation spectroscopy

NASA Astrophysics Data System (ADS)

Wesełucha-Birczyńska, Aleksandra; Kozicki, Mateusz; Czepiel, Jacek; Łabanowska, Maria; Nowak, Piotr; Kowalczyk, Grzegorz; Kurdziel, Magdalena; Birczyńska, Malwina; Biesiada, Grażyna; Mach, Tomasz; Garlicki, Aleksander

2014-07-01

The most numerous elements of the blood cells, erythrocytes, consist mainly of two components: homogeneous interior filled with hemoglobin and closure which is the cell membrane. To gain insight into their specific properties we studied the process of disintegration, considering these two constituents, and comparing the natural aging process of human healthy blood cells. MicroRaman spectra of hemoglobin within the single RBC were recorded using 514.5, and 785 nm laser lines. The generalized 2D correlation method was applied to analyze the collected spectra. The time passed from blood donation was regarded as an external perturbation. The time was no more than 40 days according to the current storage limit of blood banks, although, the average RBC life span is 120 days. An analysis of the prominent synchronous and asynchronous cross peaks allow us to get insight into the mechanism of hemoglobin decomposition. Appearing asynchronous cross-peaks point towards globin and heme separation from each other, while synchronous shows already broken globin into individual amino acids. Raman scattering analysis of hemoglobin "wrapping", i.e. healthy erythrocyte ghosts, allows for the following peculiarity of their behavior. The increasing power of the excitation laser induced alterations in the assemblage of membrane lipids. 2D correlation maps, obtained with increasing laser power recognized as an external perturbation, allows for the consideration of alterations in the erythrocyte membrane structure and composition, which occurs first in the proteins. Cross-peaks were observed indicating an asynchronous correlation between the senescent-cell antigen (SCA) and heme or proteins vibrations. The EPR spectra of the whole blood was analyzed regarding time as an external stimulus. The 2D correlation spectra points towards participation of the selected metal ion centers in the disintegration process.

AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adam, Tasneem; Opie, Lionel H.; Essop, M. Faadiel, E-mail: mfessop@sun.ac.za

Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transientlymore » transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.« less

Discovery of novel acetanilide derivatives as potent and selective beta3-adrenergic receptor agonists.

PubMed

Maruyama, Tatsuya; Onda, Kenichi; Hayakawa, Masahiko; Matsui, Tetsuo; Takasu, Toshiyuki; Ohta, Mitsuaki

2009-06-01

In the search for potent and selective human beta3-adrenergic receptor (AR) agonists as potential drugs for the treatment of obesity and noninsulin-dependent (type II) diabetes, a novel series of acetanilide-based analogues were prepared and their biological activities were evaluated at the human beta3-, beta2-, and beta1-ARs. Among these compounds, 2-pyridylacetanilide (2f), pyrimidin-2-ylacetanilide (2u), and pyrazin-2-ylacetanilide (2v) derivatives exhibited potent agonistic activity at the beta3-AR with functional selectivity over the beta1- and beta2-ARs. In particular, compound 2u was found to be the most potent and selective beta3-AR agonist with an EC(50) value of 0.11 microM and no agonistic activity for either the beta1- or beta2-AR. In addition, 2f, 2u, and 2v showed significant hypoglycemic activity in a rodent diabetic model.

Neural mechanisms of transient neocortical beta rhythms: Converging evidence from humans, computational modeling, monkeys, and mice.

PubMed

Sherman, Maxwell A; Lee, Shane; Law, Robert; Haegens, Saskia; Thorn, Catherine A; Hämäläinen, Matti S; Moore, Christopher I; Jones, Stephanie R

2016-08-16

Human neocortical 15-29-Hz beta oscillations are strong predictors of perceptual and motor performance. However, the mechanistic origin of beta in vivo is unknown, hindering understanding of its functional role. Combining human magnetoencephalography (MEG), computational modeling, and laminar recordings in animals, we present a new theory that accounts for the origin of spontaneous neocortical beta. In our MEG data, spontaneous beta activity from somatosensory and frontal cortex emerged as noncontinuous beta events typically lasting <150 ms with a stereotypical waveform. Computational modeling uniquely designed to infer the electrical currents underlying these signals showed that beta events could emerge from the integration of nearly synchronous bursts of excitatory synaptic drive targeting proximal and distal dendrites of pyramidal neurons, where the defining feature of a beta event was a strong distal drive that lasted one beta period (∼50 ms). This beta mechanism rigorously accounted for the beta event profiles; several other mechanisms did not. The spatial location of synaptic drive in the model to supragranular and infragranular layers was critical to the emergence of beta events and led to the prediction that beta events should be associated with a specific laminar current profile. Laminar recordings in somatosensory neocortex from anesthetized mice and awake monkeys supported these predictions, suggesting this beta mechanism is conserved across species and recording modalities. These findings make several predictions about optimal states for perceptual and motor performance and guide causal interventions to modulate beta for optimal function.

Oxidative stress in β-thalassaemia and sickle cell disease

PubMed Central

Voskou, S.; Aslan, M.; Fanis, P.; Phylactides, M.; Kleanthous, M.

2015-01-01

Sickle cell disease and β-thalassaemia are inherited haemoglobinopathies resulting in structural and quantitative changes in the β-globin chain. These changes lead to instability of the generated haemoglobin or to globin chain imbalance, which in turn impact the oxidative environment both intracellularly and extracellularly. The ensuing oxidative stress and the inability of the body to adequately overcome it are, to a large extent, responsible for the pathophysiology of these diseases. This article provides an overview of the main players and control mechanisms involved in the establishment of oxidative stress in these haemoglobinopathies. PMID:26285072

Gene Editing and Human Pluripotent Stem Cells: Tools for Advancing Diabetes Disease Modeling and Beta-Cell Development.

PubMed

Millette, Katelyn; Georgia, Senta

2017-10-05

This review will focus on the multiple approaches to gene editing and address the potential use of genetically modified human pluripotent stem cell-derived beta cells (SC-β) as a tool to study human beta-cell development and model their function in diabetes. We will explore how new variations of CRISPR/Cas9 gene editing may accelerate our understanding of beta-cell developmental biology, elucidate novel mechanisms that establish and regulate beta-cell function, and assist in pioneering new therapeutic modalities for treating diabetes. Improvements in CRISPR/Cas9 target specificity and homology-directed recombination continue to advance its use in engineering stem cells to model and potentially treat disease. We will review how CRISPR/Cas9 gene editing is informing our understanding of beta-cell development and expanding the therapeutic possibilities for treating diabetes and other diseases. Here we focus on the emerging use of gene editing technology, specifically CRISPR/Cas9, as a means of manipulating human gene expression to gain novel insights into the roles of key factors in beta-cell development and function. Taken together, the combined use of SC-β cells and CRISPR/Cas9 gene editing will shed new light on human beta-cell development and function and accelerate our progress towards developing new therapies for patients with diabetes.

15 beta-hydroxysteroids (Part IV). Steroids of the human perinatal period: the synthesis of 3 alpha,15 beta,17 alpha-trihydroxy-5 alpha-pregnan-20-one and its A/B-ring configurational isomers.

PubMed

Reeder, A Y; Joannou, G E

1995-12-01

In recent years several 15 beta-hydroxysteroids have emerged pathognomonic of adrenal disorders in human neonates of which 3 alpha,15 beta,17 alpha-trihydroxy-5 beta-pregnan-20-one (2) was the first to be identified in the urine of newborn infants affected with congenital adrenal hyperplasia. In this investigation we report the synthesis of the three remaining 3 xi,5 xi-isomers, namely 3 alpha,15 beta,17 alpha-trihydroxy-5 alpha-pregnan-20-one (3), 3 beta,15 beta,17 alpha-trihydroxy-5 alpha-pregnan-20-one (7) and 3 beta,15 beta,17 alpha-trihydroxy-5 beta-pregnan-20-one (8) for their definitive identification in pathological conditions in human neonates. 3 beta,15 beta-Diacetoxy-17 alpha-hydroxy-5-pregnen-20-one (11), a product of chemical synthesis was converted to the isomeric 3 and 7, while conversion of 15 beta,17 alpha-dihydroxy-4-pregnen-3,20-dione (4), a product of microbiological transformation, resulted in the preparation of 8. In brief, selective acetate hydrolysis of 11 gave 15 beta-acetoxy-3 beta,17 alpha-dihydroxy-5-pregnen-20-one (12) which on catalytic hydrogenation gave 15 beta-acetoxy-3 beta,17 alpha-dihydroxy-5 alpha-pregnan-20-one (13) a common intermediate for the synthesis of the 3 beta(and alpha),5 alpha-isomers. Hydrolysis of the 15 beta-acetate gave 7, whereas oxidation with pyridinium chlorochromate gave 15 beta-acetoxy-17 alpha-hydroxy-5 alpha-pregnan-3,20-dione (14) which on reduction with L-Selectride and hydrolysis of the 15 beta-acetate gave 3. Finally, hydrogenation of 4 gave 15 beta, 17 alpha-dihydroxy-5 beta-pregnan-3,20-dione (10) which on reduction with L-Selectride gave 8.

Human beta-cell precursors mature into functional insulin-producing cells in an immunoisolation device: implications for diabetes cell therapies.

PubMed

Lee, Seung-Hee; Hao, Ergeng; Savinov, Alexei Y; Geron, Ifat; Strongin, Alex Y; Itkin-Ansari, Pamela

2009-04-15

Islet transplantation is limited by the need for chronic immunosuppression and the paucity of donor tissue. As new sources of human beta-cells are developed (e.g., stem cell-derived tissue), transplanting them in a durable device could obviate the need for immunosuppression, while also protecting the patient from any risk of tumorigenicity. Here, we studied (1) the survival and function of encapsulated human beta-cells and their progenitors and (2) the engraftment of encapsulated murine beta-cells in allo- and autoimmune settings. Human islets and human fetal pancreatic islet-like cell clusters were encapsulated in polytetrafluorethylene devices (TheraCyte) and transplanted into immunodeficient mice. Graft survival and function was measured by immunohistochemistry, circulating human C-peptide levels, and blood glucose levels. Bioluminescent imaging was used to monitor encapsulated neonatal murine islets. Encapsulated human islet-like cell clusters survived, replicated, and acquired a level of glucose responsive insulin secretion sufficient to ameliorate hyperglycemia in diabetic mice. Bioluminescent imaging of encapsulated murine neonatal islets revealed a dynamic process of cell death followed by regrowth, resulting in robust long-term allograft survival. Further, in the non-obese diabetic (NOD) mouse model of type I diabetes, encapsulated primary beta-cells ameliorated diabetes without stimulating a detectable T-cell response. We demonstrate for the first time that human beta-cells function is compatible with encapsulation in a durable, immunoprotective device. Moreover, our study suggests that encapsulation of beta-cells before terminal differentiation will be a successful approach for new cell-based therapies for diabetes, such as those derived from stem cells.

Regulation of human nitric oxide synthase 2 expression by Wnt beta-catenin signaling.

PubMed

Du, Qiang; Park, Kyung Soo; Guo, Zhong; He, Peijun; Nagashima, Makoto; Shao, Lifang; Sahai, Rohit; Geller, David A; Hussain, S Perwez

2006-07-15

Nitric oxide (NO.), an important mediator of inflammation, and beta-catenin, a component of the Wnt-adenomatous polyposis coli signaling pathway, contribute to the development of cancer. We have identified two T-cell factor 4 (Tcf-4)-binding elements (TBE1 and TBE2) in the promoter of human inducible NO synthase 2 (NOS2). We tested the hypothesis that beta-catenin regulates human NOS2 gene. Mutation in either of the two TBE sites decreased the basal and cytokine-induced NOS2 promoter activity in different cell lines. The promoter activity was significantly reduced when both TBE1 and TBE2 sites were mutated (P < 0.01). Nuclear extract from HCT116, HepG2, or DLD1 cells bound to NOS2 TBE1 or TBE2 oligonucleotides in electrophoretic mobility shift assays and the specific protein-DNA complexes were supershifted with anti-beta-catenin or anti-Tcf-4 antibody. Overexpression of beta-catenin and Tcf-4 significantly increased both basal and cytokine-induced NOS2 promoter activity (P < 0.01), and the induction was dependent on intact TBE sites. Overexpression of beta-catenin or Tcf-4 increased NOS2 mRNA and protein expression in HCT116 cells. Lithium chloride (LiCl), an inhibitor of glycogen synthase kinase-3beta, increased cytosolic and nuclear beta-catenin level, NOS2 expression, and NO. production in primary human and rat hepatocytes and cancer cell lines. Treatment with Wnt-3A-conditioned medium increased beta-catenin and NOS2 expression in fetal human hepatocytes. When administered in vivo, LiCl increased hepatic beta-catenin level in a dose-dependent manner with simultaneous increase in NOS2 expression. These data are consistent with the hypothesis that beta-catenin up-regulates NOS2 and suggest a novel mechanism by which the Wnt/beta-catenin signaling pathway may contribute to cancer by increasing NO. production.

MRG15 Regulates Embryonic Development and Cell Proliferation

PubMed Central

Tominaga, Kaoru; Kirtane, Bhakti; Jackson, James G.; Ikeno, Yuji; Ikeda, Takayoshi; Hawks, Christina; Smith, James R.; Matzuk, Martin M.; Pereira-Smith, Olivia M.

2005-01-01

MRG15 is a highly conserved protein, and orthologs exist in organisms from yeast to humans. MRG15 associates with at least two nucleoprotein complexes that include histone acetyltransferases and/or histone deacetylases, suggesting it is involved in chromatin remodeling. To study the role of MRG15 in vivo, we generated knockout mice and determined that the phenotype is embryonic lethal, with embryos and the few stillborn pups exhibiting developmental delay. Immunohistochemical analysis indicates that apoptosis in Mrg15−/− embryos is not increased compared with wild-type littermates. However, the number of proliferating cells is significantly reduced in various tissues of the smaller null embryos compared with control littermates. Cell proliferation defects are also observed in Mrg15−/− mouse embryonic fibroblasts. The hearts of the Mrg15−/− embryos exhibit some features of hypertrophic cardiomyopathy. The increase in size of the cardiomyocytes is most likely a response to decreased growth of the cells. Mrg15−/− embryos appeared pale, and microarray analysis revealed that α-globin gene expression was decreased in null versus wild-type embryos. We determined by chromatin immunoprecipitation that MRG15 was recruited to the α-globin promoter during dimethyl sulfoxide-induced mouse erythroleukemia cell differentiation. These findings demonstrate that MRG15 has an essential role in embryonic development via chromatin remodeling and transcriptional regulation. PMID:15798182

Insulin-producing cells could not mimic the physiological regulation of insulin secretion performed by pancreatic beta cells

PubMed Central

2013-01-01

Objective The aim of this study was to compare the difference between insulin-producing cells (IPCs) and normal human pancreatic beta cells both in physiological function and morphological features in cellular level. Methods The levels of insulin secretion were measured by enzyme-linked immunosorbent assay. The insulin gene expression was determined by real-time quantitative polymerase chain reaction. The morphological features were detected by atomic force microscopy (AFM) and laser confocal scanning microscopy. Results IPCs and normal human pancreatic beta cells were similar to each other under the observation in AFM with the porous structure features in the cytoplasm. Both number of membrane particle size and average roughness of normal human beta cells were higher than those of IPCs. Conclusions Our results firstly revealed that the cellular ultrastructure of IPCs was closer to that of normal human pancreatic beta cells, but they still could not mimic the physiological regulation of insulin secretion performed by pancreatic beta cells. PMID:23421382

Carotenoids: more than just beta-carotene.

PubMed

Gellenbeck, K W

1998-12-01

Fruits and vegetables of the human diet contain many of the over 600 carotenoid pigments that have been identified in plants. Led by work with beta-carotene, researchers have constantly been learning more about the metabolism of these compounds in the human body. Research work is now expanding beyond beta-carotene in an effort to understand what happens to all the pigments found in the human diet. This discussion briefly looks at research results on the carotenoids found in human serum as well as the effects of supplementation. Recent confusing results from large intervention trials with beta-carotene and lung cancer incidence are emphasized in relation to supplementation doses and beta-carotene source (synthetic vs. natural). The summation of results emphasizes the importance of the broad spectrum of carotenoids in the diet and relates to supplementation products currently being designed for the marketplace.

Acute effect of ephedrine on 24-h energy balance

NASA Technical Reports Server (NTRS)

Shannon, J. R.; Gottesdiener, K.; Jordan, J.; Chen, K.; Flattery, S.; Larson, P. J.; Candelore, M. R.; Gertz, B.; Robertson, D.; Sun, M.

1999-01-01

Ephedrine is used to help achieve weight control. Data on its true efficacy and mechanisms in altering energy balance in human subjects are limited. We aimed to determine the acute effect of ephedrine on 24-h energy expenditure, mechanical work and urinary catecholamines in a double-blind, randomized, placebo-controlled, two-period crossover study. Ten healthy volunteers were given ephedrine (50 mg) or placebo thrice daily during each of two 24-h periods (ephedrine and placebo) in a whole-room indirect calorimeter, which accurately measures minute-by-minute energy expenditure and mechanical work. Measurements were taken of 24-h energy expenditure, mechanical work, urinary catecholamines and binding of (+/-)ephedrine in vitro to human beta1-, beta2- and beta3-adrenoreceptors. Twenty-four-hour energy expenditure was 3.6% greater (8965+/-1301 versus 8648+/-1347 kJ, P<0.05) with ephedrine than with placebo, but mechanical work was not different between the ephedrine and placebo periods. Noradrenaline excretion was lower with ephedrine (0.032+/-0.011 microg/mg creatinine) compared with placebo (0.044+/-0.012 microg/mg creatinine) (P<0.05). (+/-)Ephedrine is a relatively weak partial agonist of human beta1- and beta2-adrenoreceptors, and had no detectable activity at human beta3-adrenoreceptors. Ephedrine (50 mg thrice daily) modestly increases energy expenditure in normal human subjects. A lack of binding of ephedrine to beta3-adrenoreceptors and the observed decrease in urinary noradrenaline during ephedrine treatment suggest that the thermogenic effect of ephedrine results from direct beta1-/beta2-adrenoreceptor agonism. An indirect beta3-adrenergic effect through the release of noradrenaline seems unlikely as urinary noradrenaline decreased significantly with ephedrine.

Developing injectable immunoglobulins to treat cognitive impairment in Alzheimer's disease.

PubMed

Steinitz, Michael

2008-05-01

Alzheimer's disease is a devastating disorder, clinically characterized by a comprehensive cognitive decline. The novel strategy of anti-amyloid-beta immunotherapy has been suggested following encouraging results obtained in murine models of Alzheimer's disease, in non-human primates, and in small-scale clinical trials. To examine the choice between active or passive anti-amyloid-beta immunization and the choice of the molecule to which the immune machinery should be targeted, which are central issues in future immune therapy of Alzheimer's disease. Research into the new area of Alzheimer's disease immune therapy is primarily based on in vivo and in vitro studies of murine models of Alzheimer's disease. The studies are hence limited to defined genetic deficiencies. In humans, infusion of anti-amyloid-beta antibodies is considered a safer approach than active anti-amyloid-beta vaccination. Alzheimer's-disease-protective anti-amyloid-beta monoclonal antibodies should target specific epitopes within the amyloid beta(1 42) peptide, avoiding possibly harmful binding to the ubiquitous normal amyloid precursor protein. Since Alzheimer's disease immunotherapy requires repeated infusion of antibodies over a prolonged period of time, Alzheimer's disease patients will tolerate such antibodies provided the latter are exclusively of human origin. Human monoclonal antibodies that correspond to ubiquitous anti-amyloid-beta, present in all healthy humans, might bear important protective characteristics.

Multicenter Comparative Evaluation of Five Commercial Methods for Toxoplasma DNA Extraction from Amniotic Fluid▿

PubMed Central

Yera, H.; Filisetti, D.; Bastien, P.; Ancelle, T.; Thulliez, P.; Delhaes, L.

2009-01-01

Over the past few years, a number of new nucleic acid extraction methods and extraction platforms using chemistry combined with magnetic or silica particles have been developed, in combination with instruments to facilitate the extraction procedure. The objective of the present study was to investigate the suitability of these automated methods for the isolation of Toxoplasma gondii DNA from amniotic fluid (AF). Therefore, three automated procedures were compared to two commercialized manual extraction methods. The MagNA Pure Compact (Roche), BioRobot EZ1 (Qiagen), and easyMAG (bioMérieux) automated procedures were compared to two manual DNA extraction kits, the QIAamp DNA minikit (Qiagen) and the High Pure PCR template preparation kit (Roche). Evaluation was carried out with two specific Toxoplasma PCRs (targeting the 529-bp repeat element), inhibitor search PCRs, and human beta-globin PCRs. The samples each consisted of 4 ml of AF with or without a calibrated Toxoplasma gondii RH strain suspension (0, 1, 2.5, 5, and 25 tachyzoites/ml). All PCR assays were laboratory-developed real-time PCR assays, using either TaqMan or fluorescent resonance energy transfer probes. A total of 1,178 PCRs were performed, including 978 Toxoplasma PCRs. The automated and manual methods were similar in sensitivity for DNA extraction from T. gondii at the highest concentration (25 Toxoplasma gondii cells/ml). However, our results showed that the DNA extraction procedures led to variable efficacy in isolating low concentrations of tachyzoites in AF samples (<5 Toxoplasma gondii cells/ml), a difference that might have repercussions since low parasite concentrations in AF exist and can lead to congenital toxoplasmosis. PMID:19846633

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Molecular systematics of higher primates: genealogical relations and classification.

PubMed Central

Miyamoto, M M; Koop, B F; Slightom, J L; Goodman, M; Tennant, M R

1988-01-01

We obtained 5' and 3' flanking sequences (5.4 kilobase pairs) from the psi eta-globin gene region of the rhesus macaque (Macaca mulatta) and combined them with available nucleotide data. The completed sequence, representing 10.8 kilobase pairs of contiguous noncoding DNA, was compared to the same orthologous regions available for human (Homo sapiens, as represented by five different alleles), common chimpanzee (Pan troglodytes), gorilla (Gorilla gorilla), and orangutan (Pongo pygmaeus). The nucleotide sequence for Macaca mulatta provided the outgroup perspective needed to evaluate better the relationships of humans and great apes. Pairwise comparisons and parsimony analysis of these orthologues clearly demonstrated (i) that humans and great apes share a high degree of genetic similarity and (ii) that humans, chimpanzees, and gorillas form a natural monophyletic group. These conclusions strongly favor a genealogical classification for higher primates consisting of a single family (Hominidae) with two subfamilies (Homininae for Homo, Pan, and Gorilla and Ponginae for Pongo). PMID:3174657

Target recognition of beta2-glycoprotein I (beta2GPI)-dependent anticardiolipin antibodies: evidence for involvement of the fourth domain of beta2GPI in antibody binding.

PubMed

George, J; Gilburd, B; Hojnik, M; Levy, Y; Langevitz, P; Matsuura, E; Koike, T; Shoenfeld, Y

1998-04-15

Beta2-glycoprotein I (beta2GPI) is an absolute requirement for the binding of autoimmune anticardiolipin Abs (aCL) to cardiolipin (CL). We evaluated the target recognition of human beta2GPI by IgG derived from two patients with primary and two with secondary antiphospholipid syndrome. The total IgG serum fractions and beta2GPI affinity-purified IgGs were assessed by using various domain-deleted mutants (DM) of human beta2GPI (DMs: I-III, I-IV, II-V, III-V, IV-V, and V) and mouse mAbs against individual beta2GPI domains. The four IgGs bound slightly to CL in the absence of beta2GPI and showed increased binding in the beta2GPI presence. Following affinity purification of the IgGs on a beta2GPI column, reactivity toward CL was absent. DMs containing domain V inhibited the binding of biotinylated beta2GPI to CL. The addition to CL-coated plates of DM V, but not the other DMs, reduced the binding of all four IgGs. The anti-beta2GPI IgGs bound only to complete beta2GPI and DM I-IV coated on the plates. The binding to plate-adsorbed beta2GPI could be inhibited by complete beta2GPI and DM I-IV, the latter being a more efficient inhibitor. Further, the human anti-beta2GPI IgGs could compete with the binding to beta2GPI of Cof-21 mouse mAb (directed at domain IV), but not with the two other mouse mAbs. The results suggest that some "autoimmune:" beta2GPI-dependent anticardiolipin Abs recognize a beta2GPI target that is distinct from the CL-binding site in domain V. The target site for some antiphospholipid syndrome IgGs appear to reside in domain IV of beta2GPI.

Adrenergic receptors in human fetal liver membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Falkay, G.; Kovacs, L.

1990-01-01

The adrenergic receptor binding capacities in human fetal and adult livers were measured to investigate the mechanism of the reduced alpha-1 adrenoreceptor response of the liver associated with a reciprocal increase in beta-adrenoreceptor activity in a number of conditions. Alpha-1 and beta-adrenoreceptor density were determined using {sup 3}H-prazosin and {sup 3}H-dihydroalprenolol, respectively, as radioligand. Heterogeneous populations of beta-adrenoreceptors were found in fetal liver contrast to adult. Decreased alpha-1 and increased beta-receptor density were found which may relate to a decreased level in cellular differentiation. These findings may be important for the investigation of perinatal hypoglycemia of newborns after treatment ofmore » premature labor with beta-mimetics. This is the first demonstration of differences in the ratio of alpha-1 and beta-adrenoceptors in human fetal liver.« less

CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

NASA Technical Reports Server (NTRS)

Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

2003-01-01

Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

Effects of common hemoglobin variants on HbA1c measurements in China: results for α- and β-globin variants measured by six methods.

PubMed

Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling

2018-04-07

HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.

AT-rich sequence elements promote nascent transcript cleavage leading to RNA polymerase II termination

PubMed Central

White, Eleanor; Kamieniarz-Gdula, Kinga; Dye, Michael J.; Proudfoot, Nick J.

2013-01-01

RNA Polymerase II (Pol II) termination is dependent on RNA processing signals as well as specific terminator elements located downstream of the poly(A) site. One of the two major terminator classes described so far is the Co-Transcriptional Cleavage (CoTC) element. We show that homopolymer A/T tracts within the human β-globin CoTC-mediated terminator element play a critical role in Pol II termination. These short A/T tracts, dispersed within seemingly random sequences, are strong terminator elements, and bioinformatics analysis confirms the presence of such sequences in 70% of the putative terminator regions (PTRs) genome-wide. PMID:23258704

Beta3 subunits promote expression and nicotine-induced up-regulation of human nicotinic alpha6* nicotinic acetylcholine receptors expressed in transfected cell lines.

PubMed

Tumkosit, Prem; Kuryatov, Alexander; Luo, Jie; Lindstrom, Jon

2006-10-01

Nicotinic acetylcholine receptors (AChRs) containing alpha6 subunits are typically found at aminergic nerve endings where they play important roles in nicotine addiction and Parkinson's disease. alpha6* AChRs usually contain beta3 subunits. beta3 subunits are presumed to assemble only in the accessory subunit position within AChRs where they do not participate in forming acetylcholine binding sites. Assembly of subunits in the accessory position may be a critical final step in assembly of mature AChRs. Human alpha6 AChRs subtypes were permanently transfected into human tsA201 human embryonic kidney (HEK) cell lines. alpha6beta2beta3 and alpha6beta4beta3 cell lines were found to express much larger amounts of AChRs and were more sensitive to nicotine-induced increase in the amount of AChRs than were alpha6beta2 or alpha6beta4 cell lines. The increased sensitivity to nicotine-induced up-regulation was due not to a beta3-induced increase in affinity for nicotine but probably to a direct effect on assembly of AChR subunits. HEK cells express only a small amount of mature alpha6beta2 AChRs, but many of these subunits are on the cell surface. This contrasts with Xenopus laevis oocytes, which express a large amount of incorrectly assembled alpha6beta2 subunits that bind cholinergic ligands but form large amorphous intracellular aggregates. Monoclonal antibodies (mAbs) were made to the alpha6 and beta3 subunits to aid in the characterization of these AChRs. The alpha6 mAbs bind to epitopes C-terminal of the extracellular domain. These data demonstrate that both cell type and the accessory subunit beta3 can play important roles in alpha6* AChR expression, stability, and up-regulation by nicotine.

Chromosome mapping of the human arrestin (SAG), {beta}-arrestin 2 (ARRB2), and {beta}-adrenergic receptor kinase 2 (ADRBK2) genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calabrese, G.; Sallese, M.; Stornaiuolo, A.

1994-09-01

Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor and its functional cofactor, {beta}-arrestin. Both {beta}ARK and {beta}-arrestin are members of multigene families. The family of G-protein-coupled receptor kinases includes rhodopsin kinase, {beta}ARK1, {beta}ARK2, IT11-A (GRK4), GRK5, and GRK6. The arrestin/{beta}-arrestin gene family includes arrestin (also known as S-antigen), {beta}-arrestin 1, and {beta}-arrestin 2. Here we report the chromosome mapping of the human genes for arrestin (SAG), {beta}arrestin 2 (ARRB2), and {beta}ARK2 (ADRBK2) by fluorescence in situ hybridization (FISH). FISH results confirmed the assignment ofmore » the gene coding for arrestin (SAG) to chromosome 2 and allowed us to refine its localization to band q37. The gene coding for {beta}-arrestin 2 (ARRB2) was mapped to chromosome 17p13 and that coding for {beta}ARK2 (ADRBK2) to chromosome 22q11. 17 refs., 1 fig.« less

Decursin suppresses human androgen-independent PC3 prostate cancer cell proliferation by promoting the degradation of beta-catenin.

PubMed

Song, Gyu-Yong; Lee, Jee-Hyun; Cho, Munju; Park, Byeoung-Soo; Kim, Dong-Eun; Oh, Sangtaek

2007-12-01

Alterations in the Wnt/beta-catenin pathway are associated with the development and progression of human prostate cancer. Decursin, a pyranocoumarin isolated from the Korean Angelica gigas root, inhibits the growth of androgen-independent human prostate cancer cells, but little is known about its mechanism of action. Using a cell-based screen, we found that decursin attenuates the Wnt/beta-catenin pathway. Decursin antagonized beta-catenin response transcription (CRT), which was induced with Wnt3a-conditioned medium and LiCl, by promoting the degradation of beta-catenin. Furthermore, decursin suppressed the expression of cyclin D1 and c-myc, which are downstream target genes of beta-catenin and thus inhibited the growth of PC3 prostate cancer cells. In contrast, decursinol, in which the (CH3)2-C=CH-COO- side chain of decursin is replaced with -OH, had no effect on CRT, the level of intracellular beta-catenin, or PC3 cell proliferation. Our findings suggest that decursin exerts its anticancer activity in prostate cancer cells via inhibition of the Wnt/beta-catenin pathway.

Alpha cells secrete acetylcholine as a non-neuronal paracrine signal priming human beta cell function

PubMed Central

Rodriguez-Diaz, Rayner; Dando, Robin; Jacques-Silva, M. Caroline; Fachado, Alberto; Molina, Judith; Abdulreda, Midhat; Ricordi, Camillo; Roper, Stephen D.; Berggren, Per-Olof; Caicedo, Alejandro

2011-01-01

Acetylcholine is a neurotransmitter that plays a major role in the function of the insulin secreting pancreatic beta cell1,2. Parasympathetic innervation of the endocrine pancreas, the islets of Langerhans, has been shown to provide cholinergic input to the beta cell in several species1,3,4, but the role of autonomic innervation in human beta cell function is at present unclear. Here we show that, in contrast to mouse islets, cholinergic innervation of human islets is sparse. Instead, we find that the alpha cells of the human islet provide paracrine cholinergic input to surrounding endocrine cells. Human alpha cells express the vesicular acetylcholine transporter and release acetylcholine when stimulated with kainate or a lowering in glucose concentration. Acetylcholine secretion by alpha cells in turn sensitizes the beta cell response to increases in glucose concentration. Our results demonstrate that in human islets acetylcholine is a paracrine signal that primes the beta cell to respond optimally to subsequent increases in glucose concentration. We anticipate these results to revise models about neural input and cholinergic signaling in the endocrine pancreas. Cholinergic signaling within the islet represents a potential therapeutic target in diabetes5, highlighting the relevance of this advance to future drug development. PMID:21685896

The quest to make fully functional human pancreatic beta cells from embryonic stem cells: climbing a mountain in the clouds.

PubMed

Johnson, James D

2016-10-01

The production of fully functional insulin-secreting cells to treat diabetes is a major goal of regenerative medicine. In this article, I review progress towards this goal over the last 15 years from the perspective of a beta cell biologist. I describe the current state-of-the-art, and speculate on the general approaches that will be required to identify and achieve our ultimate goal of producing functional beta cells. The need for deeper phenotyping of heterogeneous cultures of stem cell derived islet-like cells in parallel with a better understanding of the heterogeneity of the target cell type(s) is emphasised. This deep phenotyping should include high-throughput single-cell analysis, as well as comprehensive 'omics technologies to provide unbiased characterisation of cell products and human beta cells. There are justified calls for more detailed and well-powered studies of primary human pancreatic beta cell physiology, and I propose online databases of standardised human beta cell responses to physiological stimuli, including both functional and metabolomic/proteomic/transcriptomic profiles. With a concerted, community-wide effort, including both basic and applied scientists, beta cell replacement will become a clinical reality for patients with diabetes.

A fully human anti-Ep-CAM scFv-beta-glucuronidase fusion protein for selective chemotherapy with a glucuronide prodrug.

PubMed

de Graaf, M; Boven, E; Oosterhoff, D; van der Meulen-Muileman, I H; Huls, G A; Gerritsen, W R; Haisma, H J; Pinedo, H M

2002-03-04

Monoclonal antibodies against tumour-associated antigens could be useful to deliver enzymes selectively to the site of a tumour for activation of a non-toxic prodrug. A completely human fusion protein may be advantageous for repeated administration, as host immune responses may be avoided. We have constructed a fusion protein consisting of a human single chain Fv antibody, C28, against the epithelial cell adhesion molecule and the human enzyme beta-glucuronidase. The sequences encoding C28 and human enzyme beta-glucuronidase were joined by a sequence encoding a flexible linker, and were preceded by the IgGkappa signal sequence for secretion of the fusion protein. A CHO cell line was engineered to secrete C28-beta-glucuronidase fusion protein. Antibody specificity and enzyme activity were retained in the secreted fusion protein that had an apparent molecular mass of 100 kDa under denaturing conditions. The fusion protein was able to convert a non-toxic prodrug of doxorubicin, N-[4-doxorubicin-N-carbonyl(oxymethyl)phenyl]-O-beta-glucuronyl carbamate to doxorubicin, resulting in cytotoxicity. A bystander effect was demonstrated, as doxorubicin was detected in all cells after N-[4-doxorubicin-N-carbonyl(oxymethyl)phenyl]-O-beta-glucuronyl carbamate administration when only 10% of the cells expressed the fusion protein. This is the first fully human and functional fusion protein consisting of an scFv against epithelial cell adhesion molecule and human enzyme beta-glucuronidase for future use in tumour-specific activation of a non-toxic glucuronide prodrug. Copyright 2002 Cancer Research UK

Transforming growth factor-β1 induces expression of human coagulation factor XII via Smad3 and JNK signaling pathways in human lung fibroblasts.

PubMed

Jablonska, Ewa; Markart, Philipp; Zakrzewicz, Dariusz; Preissner, Klaus T; Wygrecka, Malgorzata

2010-04-09

Coagulation factor XII (FXII) is a liver-derived serine protease involved in fibrinolysis, coagulation, and inflammation. The regulation of FXII expression is largely unknown. Transforming growth factor-beta1 (TGF-beta1) is a multifunctional cytokine that has been linked to several pathological processes, including tissue fibrosis by modulating procoagulant and fibrinolytic activities. This study investigated whether TGF-beta1 may regulate FXII expression in human lung fibroblasts. Treatment of human lung fibroblasts with TGF-beta1 resulted in a time-dependent increase in FXII production, activation of p44/42, p38, JNK, and Akt, and phosphorylation and translocation into the nucleus of Smad3. However, TGF-beta1-induced FXII expression was repressed only by the JNK inhibitor and JNK and Smad3 antisense oligonucleotides but not by MEK, p38, or phosphoinositide 3-kinase blockers. JNK inhibition had no effect on TGF-beta1-induced Smad3 phosphorylation, association with Smad4, and its translocation into the nucleus but strongly suppressed Smad3-DNA complex formation. FXII promoter analysis revealed that the -299/+1 region was sufficient for TGF-beta1 to induce FXII expression. Sequence analysis of this region detected a potential Smad-binding element at position -272/-269 (SBE-(-272/-269)). Chromatin immunoprecipitation and streptavidin pulldown assays demonstrated TGF-beta1-dependent Smad3 binding to SBE-(-272/-269). Mutation or deletion of SBE-(-272/-269) substantially reduced TGF-beta1-mediated activation of the FXII promoter. Clinical relevance was demonstrated by elevated FXII levels and its co-localization with fibroblasts in the lungs of patients with acute respiratory distress syndrome. Our results show that JNK/Smad3 pathway plays a critical role in TGF-beta1-induced FXII expression in human lung fibroblasts and implicate its possible involvement in pathological conditions characterized by elevated TGF-beta1 levels.

Prostaglandin E2 suppresses beta1-integrin expression via E-prostanoid receptor in human monocytes/macrophages.

PubMed

Hasegawa, Shunji; Ichiyama, Takashi; Kohno, Fumitaka; Korenaga, Yuno; Ohsaki, Ayami; Hirano, Reiji; Haneda, Yasuhiro; Fukano, Reiji; Furukawa, Susumu

2010-01-01

Beta1-integrins mediate cell attachment to different extracellular matrix proteins, intracellular proteins, and intercellular adhesions. Recently, it has been reported that prostaglandin E2 (PGE2) has anti-inflammatory properties such as inhibition of the expression of adhesion molecules or production of chemokines. However, the effect of PGE2 on the expression of beta1-integrin remains unknown. In this study, we investigated the effects of PGE2 on the expression of beta1-integrin in the human monocytic cell line THP-1 and in CD14+ monocytes/macrophages in human peripheral blood. For this, we examined the role of four subtypes of PGE2 receptors and E-prostanoid (EP) receptors on PGE2-mediated inhibition. We found that PGE2 significantly inhibited the expression of beta1-integrin, mainly through EP4 receptors in THP-1 cells and CD14+ monocytes/macrophages in human peripheral blood. We suggest that PGE2 has anti-inflammatory effects, leading to the inhibited expression of beta1-integrin in human monocytes/macrophages, and that the EP4 receptor may play an important role in PGE2-mediated inhibition. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Correction of murine mucopolysaccharidosis VII by a human. beta. -glucuronidase transgene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kyle, J.W.; Vogler, C.; Hoffmann, J.W.

1990-05-01

The authors recently described a murine model for mucopolysaccharidosis VII in mice that have an inherited deficiency of {beta}-glucuronidase. Affected mice, of genotype gus{sup mps}/gus{sup mps}, present clinical manifestations similar to those of humans with mucopolysaccharidosis VII (Sly syndrome) and are shown here to have secondary elevations of other lysosomal enzymes. The mucopolysaccharidosis VII phenotype in both species includes dwarfism, skeletal deformities, and premature death. Lysosome storage is visualized within enlarged vesicles and correlates biochemically with accumulation of undegraded and partially degraded glycosaminoglycans. In this report they describe the consequences of introducing the human {beta}-glucuronidase gene, GUSB, into gus{sup mps}/gus{supmore » mps} mice that produce virtually no murine {beta}-glucuronidase. Transgenic mice homozygous for the mucopolysaccharidosis VII mutation expressed high levels of human {beta}-glucuronidase activity in all tissues examined and were phenotypically normal. Biochemically, both the intralysosomal storage of glycosaminoglycans and the secondary elevation of other acid hydrolases were corrected. These findings demonstrate that the GUSB transgene is expressed in gus{sup mps}/gus{sup mps} mice and that human {beta}-glucuronidase corrects the murine mucopolysaccharidosis storage disease.« less

Mice Expressing RHAG and RHD Human Blood Group Genes

PubMed Central

Goossens, Dominique; da Silva, Nelly; Metral, Sylvain; Cortes, Ulrich; Callebaut, Isabelle; Picot, Julien; Mouro-Chanteloup, Isabelle; Cartron, Jean-Pierre

2013-01-01

Anti-RhD prophylaxis of haemolytic disease of the fetus and newborn (HDFN) is highly effective, but as the suppressive mechanism remains uncertain, a mouse model would be of interest. Here we have generated transgenic mice expressing human RhAG and RhD erythrocyte membrane proteins in the presence and, for human RhAG, in the absence, of mouse Rhag. Human RhAG associates with mouse Rh but not mouse Rhag on red blood cells. In Rhag knockout mice transgenic for human RHAG, the mouse Rh protein is “rescued” (re-expressed), and co-immunoprecipitates with human RhAG, indicating the presence of hetero-complexes which associate mouse and human proteins. RhD antigen was expressed from a human RHD gene on a BAC or from RHD cDNA under control of β-globin regulatory elements. RhD was never observed alone, strongly indicative that its expression absolutely depends on the presence of transgenic human RhAG. This first expression of RhD in mice is an important step in the creation of a mouse model of RhD allo-immunisation and HDFN, in conjunction with the Rh-Rhag knockout mice we have developed previously. PMID:24260394

Beta-propellers: associated functions and their role in human diseases.

PubMed

Pons, Tirso; Gómez, Raú; Chinea, Glay; Valencia, Alfonso

2003-03-01

The beta-propeller fold appears as a very fascinating architecture based on four-stranded antiparallel and twisted beta-sheets, radially arranged around a central tunnel. Similar to the alpha/beta-barrel (TIM-barrel) fold, the beta-propeller has a wide range of different functions, and is gaining substantial attention. Some proteins containing beta-propeller domains have been implicated in the pathogenesis of a variety of diseases such as cancer, Alzheimer, Huntington, arthritis, familial hypercholesterolemia, retinitis pigmentosa, osteogenesis, hypertension, and microbial and viral infections. This article reviews some aspects of 3D structure, amino acids sequence regularities, and biological functions of the proteins containing beta-propeller domains. Major emphasis has been laid on beta-propellers whose functions are associated to human diseases. Recent research efforts reported in the fields of protein engineering, drug design, and protein structure-function relationship studies, concerning the beta-propeller architecture, have also been discussed.

Optimized formation of detergent micelles of beta-carotene and retinal production using recombinant human beta,beta-carotene 15,15'-monooxygenase.

PubMed

Kim, Nam-Hee; Kim, Yeong-Su; Kim, Hye-Jung; Oh, Deok-Kun

2008-01-01

The formation of beta-carotene detergent micelles and their conversion into retinal by recombinant human beta,beta-carotene 15,15'-monooxygenase was optimized under aqueous conditions. Toluene was the most hydrophobic among the organic solvents tested; thus, it was used to dissolve beta-carotene, which is a hydrophobic compound. Tween 80 was selected as the detergent because it supported the highest level of retinal production among all of the detergents tested. The maximum production of retinal was achieved in detergent micelles containing 200 mg/L of beta-carotene and 2.4% (w/v) Tween 80. Under these conditions, the recombinant enzyme produced 97 mg/L of retinal after 16 h with a conversion yield of 48.5% (w/w). The amount of retinal produced, which is the highest ever reported, is a result of the ability of our system to dissolve large amounts of beta-carotene.

[Hemolytic anemia due to hemoglobin Evans in an Argentinean family].

PubMed

Zanotto, María I; Calvo, Karina; Schvartzman, Gabriel; Deana, Alejandra; Noguera, Nélida; Bragós, Irma; Milani, Angela

2010-12-01

Unstable hemoglobins are structural variants of the hemoglobin molecule, mostly originated by single amino-acid replacement in some globin chains. These changes affect molecule stability, leading to loss of solubility, precipitation, and cellular lysis. Patients carrying these unstable hemoglobins may present mild to severe chronic hemolytic anemia. Hemoglobin Evans is an unstable variant originated by replacement of valine with methionine at position 62 of the α-globin chain. We have identified this variant in a girl with an acute hemolytic crisis associated to pharyngitis, as well as in two of her family members. This is the third case of hemolytic anemia due to hemoglobin Evans reported in the literature.

Temporal regulation of Stat5 activity in determination of cell differentiation program

PubMed Central

Hoshino, Akemi; Fujii, Hodaka

2007-01-01

Although Stat5 is activated by various cytokines, only ethrytopoietin (Epo) and a small number of cytokines induce Stat5-dependent erythroid differentiation. Here, by using a reporter gene system to monitor transcriptional activity of Stat5, we showed that Epo but not interleukin (IL)-3 supports sustained activation of Stat5, which induces globin gene expression. IL-3 or IL-2 stimulation inhibits Epo-induced globin gene expression. The acidic region of the IL-2 receptor β chain was essential for this inhibition. These results underscore the importance of temporal regulation of Stat activity for regulation of cytokine-specific cell differentiation. PMID:17511959

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

PubMed

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF-related complexes in β-globin expression and erythroid development

PubMed Central

Bultman, Scott J.; Gebuhr, Thomas C.; Magnuson, Terry

2005-01-01

The Brg1 catalytic subunit of SWI/SNF-related complexes has been implicated in many developmental and physiological processes, but null homozygotes die as blastocysts prior to implantation. To circumvent this early embryonic lethality, we performed an ENU mutagenesis screen and generated a Brg1 hypomorph mutation in the ATPase domain. The mutant Brg1 protein is stable, assembles into SWI/SNF-related complexes, and exhibits normal ATPase activity but is unable to establish DNase I hypersensitivity sites characteristic of open chromatin. Mutant embryos develop normally until midgestation but then exhibit a distinct block in the development of the erythroid lineage, leading to anemia and death. The mutant Brg1 protein is recruited to the β-globin locus, but chromatin remodeling and transcription are perturbed. Histone acetylation and DNA methylation are also affected. To our knowledge, Brg1 is the first chromatin-modifying factor shown to be required for β-globin regulation and erythropoiesis in vivo. Not only does this mutation establish a role for Brg1 during organogenesis, it also demonstrates that ATPase activity can be uncoupled from chromatin remodeling. PMID:16287714

The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.

PubMed

Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E

1994-01-28

The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.

Two-photon excited fluorescence emission from hemoglobin

NASA Astrophysics Data System (ADS)

Sun, Qiqi; Zeng, Yan; Zhang, Wei; Zheng, Wei; Luo, Yi; Qu, Jianan Y.

2015-03-01

Hemoglobin, one of the most important proteins in blood, is responsible for oxygen transportation in almost all vertebrates. Recently, we discovered two-photon excited hemoglobin fluorescence and achieved label-free microvascular imaging based on the hemoglobin fluorescence. However, the mechanism of its fluorescence emission still remains unknown. In this work, we studied the two-photon excited fluorescence properties of the hemoglobin subunits, heme/hemin (iron (II)/(III) protoporphyrin IX) and globin. We first studied the properties of heme and the similar spectral and temporal characteristics of heme and hemoglobin fluorescence provide strong evidence that heme is the fluorophore in hemoglobin. Then we studied the fluorescence properties of hemin, globin and methemoglobin, and found that the hemin may have the main effect on the methemoglobin fluorescence and that globin has tryptophan fluorescence like other proteins. Finally, since heme is a centrosymmetric molecule, that the Soret band fluorescence of heme and hemoglobin was not observed in the single photon process in the previous study may be due to the parity selection rule. The discovery of heme two-photon excited fluorescence may open a new window for heme biology research, since heme as a cofactor of hemoprotein has many functions, including chemical catalysis, electron transfer and diatomic gases transportation.

Globins Scavenge Sulfur Trioxide Anion Radical*

PubMed Central

Gardner, Paul R.; Gardner, Daniel P.; Gardner, Alexander P.

2015-01-01

Ferrous myoglobin was oxidized by sulfur trioxide anion radical (STAR) during the free radical chain oxidation of sulfite. Oxidation was inhibited by the STAR scavenger GSH and by the heme ligand CO. Bimolecular rate constants for the reaction of STAR with several ferrous globins and biomolecules were determined by kinetic competition. Reaction rate constants for myoglobin, hemoglobin, neuroglobin, and flavohemoglobin are large at 38, 120, 2,600, and ≥ 7,500 × 106 m−1 s−1, respectively, and correlate with redox potentials. Measured rate constants for O2, GSH, ascorbate, and NAD(P)H are also large at ∼100, 10, 130, and 30 × 106 m−1 s−1, respectively, but nevertheless allow for favorable competition by globins and a capacity for STAR scavenging in vivo. Saccharomyces cerevisiae lacking sulfite oxidase and deleted of flavohemoglobin showed an O2-dependent growth impairment with nonfermentable substrates that was exacerbated by sulfide, a precursor to mitochondrial sulfite formation. Higher O2 exposures inactivated the superoxide-sensitive mitochondrial aconitase in cells, and hypoxia elicited both aconitase and NADP+-isocitrate dehydrogenase activity losses. Roles for STAR-derived peroxysulfate radical, superoxide radical, and sulfo-NAD(P) in the mechanism of STAR toxicity and flavohemoglobin protection in yeast are suggested. PMID:26381408