Sample records for human cdna clone

  1. Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-02-01

    The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

  2. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    PubMed

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  3. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

    PubMed

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

  4. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

    PubMed Central

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

  5. Genomic clones for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kott, M.; Venta, P.J.; Larsen, J.

    1987-05-01

    A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

  6. High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hadano, S.; Ishida, Y.; Tomiyasu, H.

    1994-09-01

    To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

  7. Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

    PubMed

    Lu, L; Komada, M; Kitamura, N

    1998-06-15

    Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

  8. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    PubMed

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  9. cDNA cloning of the human monocarboxylate transporter 1 and chromosomal localization of the SLC16A1 locus to 1p13.2-p12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garcia, C.K.; Li, X.; Luna, J.

    1994-09-15

    Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.

  10. The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

    PubMed Central

    2004-01-01

    The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

  11. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  12. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  13. Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

    PubMed

    Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

    1991-03-01

    We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

  14. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

    PubMed Central

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

    2015-01-01

    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  15. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

  16. Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

    PubMed Central

    Travis, G H; Sutcliffe, J G

    1988-01-01

    To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

  17. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  18. Brain cDNA clone for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McTiernan, C.; Adkins, S.; Chatonnet, A.

    1987-10-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

  19. cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

    MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

  20. Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

    PubMed

    Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

    2005-12-02

    cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

  1. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

    1987-06-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

  2. [Cloning of human CD45 gene and its expression in Hela cells].

    PubMed

    Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

    2015-11-01

    To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

  3. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1987-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  4. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1990-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  5. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1988-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  6. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1989-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  7. Sequence verification as quality-control step for production of cDNA microarrays.

    PubMed

    Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

    2001-07-01

    To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

  8. kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system.

    PubMed Central

    Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B

    1995-01-01

    Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359

  9. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

    PubMed Central

    Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

  10. Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

    PubMed

    Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

    1987-01-26

    Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

  11. HUNT: launch of a full-length cDNA database from the Helix Research Institute.

    PubMed

    Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

    2001-01-01

    The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

  12. Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiktorowicz, J.E.; Whitman, J.M.

    1986-05-01

    Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less

  13. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.

    1991-02-15

    The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFImore » may have conserved only a subset of hIL-10 activities.« less

  14. Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

    1994-07-15

    The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

  15. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  16. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  17. Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

    PubMed Central

    Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

    1991-01-01

    Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

  18. Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

    PubMed Central

    Huebner, K; Druck, T; Croce, C M; Thiesen, H J

    1991-01-01

    cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

  19. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  20. Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

    PubMed Central

    Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

    1998-01-01

    Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

  1. Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

    PubMed

    Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

    2014-09-01

    Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

    PubMed

    Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

    1994-03-01

    Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

  3. Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

    PubMed Central

    Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

    1994-01-01

    Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

  4. Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

    PubMed Central

    Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

  5. Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Livi, G.P.; McHale, M.J.; Sathe, G.M.

    1990-06-01

    The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

  6. A transcription map of the regions surrounding the CSF1R locus on human chromosome 5q31: Candidate genes for diastrophic dysplasia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clines, G.; Lovett, M.

    1994-09-01

    Diastrophic dysplasia (DTD) is an autosomal recessive disorder of unknown pathogenesis that is characterized by abnormal skeletal and cartilage growth. Phenotypic characteristics of the disorder include short stature, scoliosis, and deformation of the first metacarpal. The diastrophic dysplasia gene has been localized to chromosome 5q31-33, within {approximately}60 kb of the colony stimulating factor 1 receptor gene (CSF1R). We have used direct cDNA selection to build a transcription map across {approximately}250 kb surrounding and including the CSF1R locus. cDNA pools from human placenta, activated T cells, cerebellum, Hela cells, fetal brain, chondrocytes, chondrosarcomas and osteosarcomas were multiplexed in these selections. Aftermore » two rounds of selection, an analysis revealed that {approximately}70% of the selected cDNAs were contained within the contig. DNA sequencing and cosmid mapping data from a collection of 310 clones revealed the presence of three new genes in this region that show no appreciable homologies on sequence database searches, as well as cDNA clones from the CSF1R and the PDGFRB loci (another of the known genes in the region). An additional cDNA was found with 100% homology to the gene encoding human ribosomal protein L7 (RPL7). This cDNA comprised {approximately}25% of all selected clones. However, further analysis of the genomic contig revealed the presence of an RPL7 processed pseudogene in very close proximity to the CSF1R and PDGFRB genes. The selection of processed pseudogenes is one previously anticipated artifact of selection metholodolgies, but has not been previously observed. Mutational analysis of the three new genes is underway in diastrophic dysplasia families, as is derivation of full length cDNA clones and the expansion of this detailed transcription map into a larger genomic contig.« less

  7. Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

    Cancer.gov

    The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

  8. Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reilly, D.S.; Nussbaum, R.L.

    1994-09-01

    The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

  9. Human somatostatin I: sequence of the cDNA.

    PubMed Central

    Shen, L P; Pictet, R L; Rutter, W J

    1982-01-01

    RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

  10. Characterization of a full-length infectious cDNA clone and a GFP reporter derivative of the oncolytic picornavirus SVV-001.

    PubMed

    Poirier, John T; Reddy, P Seshidhar; Idamakanti, Neeraja; Li, Shawn S; Stump, Kristine L; Burroughs, Kevin D; Hallenbeck, Paul L; Rudin, Charles M

    2012-12-01

    Seneca Valley virus (SVV-001) is an oncolytic picornavirus with selective tropism for a subset of human cancers with neuroendocrine differentiation. To characterize further the specificity of SVV-001 and its patterns and kinetics of intratumoral spread, bacterial plasmids encoding a cDNA clone of the full-length wild-type virus and a derivative virus expressing GFP were generated. The full-length cDNA of the SVV-001 RNA genome was cloned into a bacterial plasmid under the control of the T7 core promoter sequence to create an infectious cDNA clone, pNTX-09. A GFP reporter virus cDNA clone, pNTX-11, was then generated by cloning a fusion protein of GFP and the 2A protein from foot-and-mouth disease virus immediately following the native SVV-001 2A sequence. Recombinant GFP-expressing reporter virus, SVV-GFP, was rescued from cells transfected with in vitro RNA transcripts from pNTX-11 and propagated in cell culture. The proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable. The SVV-GFP reporter virus was used to determine that a subpopulation of permissive cells is present in small-cell lung cancer cell lines previously thought to lack permissivity to SVV-001. Finally, it was shown that SVV-GFP administered to tumour-bearing animals homes in to and infects tumours whilst having no detectable tropism for normal mouse tissues at 1×10(11) viral particles kg(-1), a dose equivalent to that administered in ongoing clinical trials. These infectious clones will be of substantial value in further characterizing the biology of this virus and as a backbone for the generation of additional oncolytic derivatives.

  11. Horse cDNA clones encoding two MHC class I genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbis, D.P.; Maher, J.K.; Stanek, J.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  12. Comparison of the canine and human acid {beta}-galactosidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

    Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

  13. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  14. Characterization of embryo-specific genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1989-01-01

    The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less

  15. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    PubMed

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  16. Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

    PubMed

    Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

    2006-10-01

    Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

  17. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, J.; Varner, J.E.

    1985-07-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

  18. cDNA library construction of two human Demodexspecies.

    PubMed

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  19. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  20. cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Du, L.; Desbarats, M.; Viel, J.

    1996-08-15

    The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

  1. cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cool, D.E.; Tonks, N.K.; Charbonneau, H.

    1989-07-01

    A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

  2. Extremely High Peak Power Pulsed RF and UWB EMR Effects on Genomic Transcription - Microarray Assessment

    DTIC Science & Technology

    2008-06-26

    Homo sapiens decorin variant C mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA...mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA sequence. 2.076 SEC23B...RAS oncogene family ; RAB33B, member RAS oncogene family 205300_s_at 0.37 U1SNRNPBP U11/U12 snRNP 35K 220728_at 0.349 218689_at 0.342 FANCF Fanconi

  3. Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

    In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

  4. Anti-liver-kidney microsome antibody type 1 recognizes human cytochrome P450 db1.

    PubMed

    Gueguen, M; Yamamoto, A M; Bernard, O; Alvarez, F

    1989-03-15

    Anti-liver-kidney microsome antibody type 1 (LKM1), present in the sera of a group of children with autoimmune hepatitis, was recently shown to recognize a 50 kDa protein identified as rat liver cytochromes P450 db1 and db2. High homology between these two members of the rat P450 IID subfamily and human P450 db1 suggested that anti-LKM1 antibody is directed against this human protein. To test this hypothesis, a human liver cDNA expression library in phage lambda GT-11 was screened using rat P450 db1 cDNA as a probe. Two human cDNA clones were found to be identical to human P450 db1 by restriction mapping. Immunoblot analysis using as antigen, the purified fusion protein from one of the human cDNA clones showed that only anti-LKM1 with anti-50 kDa reactivity recognized the fusion protein. This fusion protein was further used to develop an ELISA test that was shown to be specific for sera of children with this disease. These results: 1) identify the human liver antigen recognized by anti-LKM1 auto-antibodies as cytochrome P450 db1, 2) allow to speculate that mutation on the human P450 db1 gene could alter its expression in the hepatocyte and make it auto-antigenic, 3) provide a simple and specific diagnostic test for this disease.

  5. Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

    PubMed Central

    Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

    1992-01-01

    cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

  6. Characterization of transformation related genes in oral cancer cells.

    PubMed

    Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

    1998-04-16

    A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

  7. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  8. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  9. Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

    NASA Technical Reports Server (NTRS)

    Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

    1997-01-01

    A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

  10. Infectious Maize rayado fino virus from cloned cDNA

    USDA-ARS?s Scientific Manuscript database

    Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

  11. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    PubMed Central

    Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

    2014-01-01

    Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

  12. Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

    PubMed

    Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

    2004-12-15

    cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

  13. Characterization and chromosomal localization of the gene for human rhodopsin kinase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khani, S.C.; Yamamoto, S.; Dryja, T.P.

    1996-08-01

    G-protein-dependent receptor kinases (GRKs) play a key role in the adapatation of receptors to persistent stimuli. In rod photoreceptors rhodopsin kinase (RK) mediates rapid densensitization of rod photoreceptors to light by catalyzing phosphorylation of the visual pigment rhodopsin. To study the structure and mechanism of FRKs in human photoreceptors, we have isolated and characterized cDNA and genomic clones derived from the human RK locus using a bovine rhodopsin kinase cDNA fragment as a probe. The RK locus, assigned to chromosome 13 band q34, is composed of seven exons that encode a protein 92% identical in amino acid sequence to bovinemore » rhodopsin kinase. The marked difference between the structure of this gene and that of another recently clone human GRK gene suggests the existence of a wide evolutionary gap between members of the GRK gene family. 39 refs., 3 figs.« less

  14. Cloning, structure, and chromosome localization of the mouse glutaryl-CoA dehydrogenase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koeller, D.M.; DiGiulio, A.; Frerman, F.E.

    Glutaryl-CoA dehydrogenase (GCDH) is a nuclear-encoded, mitochondrial matrix enzyme. In humans, deficiency of GCDH leads to glutaric acidemia type I, and inherited disorder of amino acid metabolism characterized by a progressive neurodegenerative disease. In this report we describe the cloning and structure of the mouse GCDH (Gcdh) gene and cDNA and its chromosomal localization. The mouse Gcdh cDNA is 1.75 kb long and contains and open reading frame of 438 amino acids. The amino acid sequences of mouse, human, and pig GCDH are highly conserved. The mouse Gcdh gene contains 11 exons and spans 7 kb of genomic DNA. Gcdhmore » was mapped by backcross analysis to mouse chromosome 8 within a region that is homologous to a region of human chromosome 19, where the human gene was previously mapped. 14 refs., 3 figs.« less

  15. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haiming Chen; Lalioti, M.D.; Perrin, G.

    1996-07-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-binding cassette transporter gene family and is homologous to Drosophila w (and to 2 genes from other species) and tomore » a lesser extent to Drosophila brown (bw) and scarlet (st) genes that are all involved in the transport of eye pigment precursor molecules. A DNA polymorphism with 62% heterozygosity due to variation of a poly (T) region in the 3{prime} UTR of the hW has been identified and used for the incorporation of this gene to the genetic map of chromosome 21. The hW is located at 21q22.3 between DNA markers D21S212 and D21S49 in a P1 clone that also contains marker BCEI. The gene is expressed at various levels in many human tissues. The contributions of this gene to the Down syndrome phenotypes, to human eye color, and to the resulting phenotypes of null or missense mutations are presently unknown. 56 refs., 8 figs., 1 tab.« less

  16. Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

    PubMed Central

    Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

    2003-01-01

    AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

  17. Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray.

    PubMed

    Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

    2003-03-01

    To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.

  18. Differences in expression of retinal pigment epithelium mRNA between normal canines

    PubMed Central

    2004-01-01

    Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

  19. Cloning and Expression of cDNA for Rat Heme Oxygenase

    NASA Astrophysics Data System (ADS)

    Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

    1985-12-01

    Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

  20. Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

    1994-12-01

    The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

  1. Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

    PubMed

    Yokozaki, H; Tahara, H; Oue, N; Tahara, E

    2000-01-01

    A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

  2. Rapid in silico cloning of genes using expressed sequence tags (ESTs).

    PubMed

    Gill, R W; Sanseau, P

    2000-01-01

    Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

  3. Cloning and expression of a Ca(2+)-inhibitable adenylyl cyclase from NCB-20 cells.

    PubMed Central

    Yoshimura, M; Cooper, D M

    1992-01-01

    A cDNA that encodes an adenylyl cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] has been cloned from NCB-20 cells, in which adenylyl cyclase activity is inhibited by Ca2+ at physiological concentrations. The cDNA clone (5.8 kilobases) was isolated by polymerase chain reaction (PCR) using degenerate primers designed by comparison of three adenylyl cyclase sequences (types I, II, and III) and subsequent library screening. Northern analysis revealed expression of mRNA (6.1 kilobases) corresponding to this cDNA in cardiac tissue, which is a prominent source of Ca(2+)-inhibitable adenylyl cyclase. The clone encodes a protein of 1165 amino acids, whose hydrophilicity profile was very similar to those of other mammalian adenylyl cyclases that have recently been cloned. A noticeable difference between this protein and other adenylyl cyclases was a lengthy aminoterminal region before the first transmembrane span. Transient expression of this cDNA in the human embryonic kidney cell line 293 revealed a 3-fold increase in cAMP production in response to forskolin compared with control transfected cells. In purified plasma membranes from transfected cells, increased adenylyl cyclase activity was also detected, which was susceptible to inhibition by submicromolar Ca2+. Thus, this adenylyl cyclase seems to represent the Ca(2+)-inhibitable form that is encountered in NCB-20 cells, cardiac tissue, and elsewhere. Its identification should permit a determination of the structural features that determine the mode of regulation of adenylyl cyclase by Ca2+. Images PMID:1379717

  4. An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

    PubMed Central

    Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

    2015-01-01

    The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

  5. Cloning of the cocaine-sensitive bovine dopamine transporter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usdin, T.B.; Chen, C.; Brownstein, M.J.

    1991-12-15

    A cDNA encoding the dopamine transporter from bovine brain substantia nigra was identified on the basis of its structural homology to other, recently cloned, neurotransmitter transporters. The sequence of the 693-amino acid protein is quite similar to those of the rat {gamma}-aminobutyric acid, human norepinephrine, and rat serotonin transporters. Dopamine transporter mRNA was detected by in situ hybridization in the substantia nigra but not in the locus coeruleus, raphe, caudate, or other brain areas. ({sup 3}H)Dopamine accumulation in tissue culture cells transfected with the cDNA was inhibited by amphetamine, cocaine, and specific inhibitors of dopamine transports, including GBR12909.

  6. [cDNA library construction from panicle meristem of finger millet].

    PubMed

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  7. Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

    PubMed

    Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

    1997-02-01

    Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

  8. Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

    NASA Astrophysics Data System (ADS)

    Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

    1995-12-01

    Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

  9. Purification and cDNA cloning of SAPKK3, the major activator of RK/p38 in stress- and cytokine-stimulated monocytes and epithelial cells.

    PubMed Central

    Cuenda, A; Alonso, G; Morrice, N; Jones, M; Meier, R; Cohen, P; Nebreda, A R

    1996-01-01

    Two chromatographically distinct stress-activated protein kinase kinases (SAPKKs) have been identified in several mammalian cells, termed SAPKK2 and SAPKK3, which activate the MAP kinase family member RK/p38 but not JNK/SAPK in vitro. Here we demonstrate that SAPKK2 is identical or very closely related to the MAP kinase kinase family member MKK3. However, under our assay conditions, SAPKK3 was the major activator of RK/p38 detected in extracts prepared from stress- or interleukin-1-stimulated epithelial (KB) cells, from bacterial lipopolysaccharide and tumour necrosis factor alpha-stimulated THP1 monocytes or from rabbit skeletal muscle. The activated form of SAPKK3 was purified from muscle to near homogeneity, and tryptic peptide sequences were used to clone human and murine cDNAs encoding this enzyme. Human SAPKK3 comprised 334 amino acids and was 78% identical to MKK3. The murine and human SAPKK3 were 97% identical in their amino acid sequences. We also cloned a different murine cDNA that appears to encode a SAPKK3 protein truncated at the N-terminus. SAPKK3 is identical to the recently cloned MKK6. Images PMID:8861944

  10. Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

    PubMed

    Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

    1999-12-01

    An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

  11. Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

    PubMed

    Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

    2010-04-01

    We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

  12. Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

    PubMed Central

    Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

  13. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  14. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  15. Molecular cloning and characterization of arginine kinase gene of Toxocara canis.

    PubMed

    Sahu, Shivani; Samanta, S; Harish, D R; Sudhakar, N R; Raina, O K; Shantaveer, S B; Madhu, D N; Kumar, Ashok

    2015-06-01

    Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcription was done with oligo dT primers to obtain complementary DNA (cDNA). Polymerase chain reaction (PCR) was carried out using cDNA as template with specific primers which amplified a product of 1,202 bp. The amplicon was cloned into pDrive cloning vector and clone was confirmed by colony PCR and restriction endonuclease analysis. Sequence analysis of the gene showed 99.8 and 77.9 % homology with the published AK gene of T. canis (EF015466.1) and Ascaris suum respectively. Structural analysis shown that the mature AK protein consist of 400 amino acids with a molecular wt of 45360.73 Da. Further expression studies are required for producing the recombinant protein for its evaluation in the diagnosis of T. canis infection in humans as well as in adult dogs.

  16. Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

    PubMed Central

    Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

    1993-01-01

    Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

  17. Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

    PubMed

    Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

    2002-09-01

    A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

  18. Cloning of human cDNAs for Apg-1 and Apg-2, members of the Hsp110 family, and chromosomal assignment of their genes.

    PubMed

    Nonoguchi, K; Itoh, K; Xue, J H; Tokuchi, H; Nishiyama, H; Kaneko, Y; Tatsumi, K; Okuno, H; Tomiwa, K; Fujita, J

    1999-09-03

    In mice, the Hsp110/SSE family is composed of the heat shock protein (Hsp)110/105, Apg-1 and Apg-2. In humans, however, only the Hsp110/105 homolog has been identified as a member, and two cDNAs, Hsp70RY and HS24/p52, potentially encoding proteins structurally similar to, but smaller than, mouse Apg-2 have been reported. To clarify the membership of Hsp110 family in humans, we isolated Apg-1 and Apg-2 cDNAs from a human testis cDNA library. The human Apg-1 was 100% and 91.8% identical in length and amino acid (aa) sequence, respectively, to mouse Apg-1. Human Apg-2 was one aa shorter than and 95.5% identical in sequence to mouse Apg-2. In ECV304, human endothelial cells Apg-1 but not Apg-2 transcripts were induced in 2 h by a temperature shift from 32 degrees C to 39 degrees C. As found in mice, the response was stronger than that to a 37-42 degrees C shift. The human Apg-1 and Apg-2 genes were mapped to the chromosomal loci 4q28 and 5q23.3-q31.1, respectively, by fluorescence in-situ hybridization. We isolated cDNA and genomic clones encompassing the region critical for the difference between Apg-2 and HS24/p52. Although the primer sets used were derived from the sequences common to both cDNAs, all cDNA and genomic clones corresponded to Apg-2. Using a similar approach, the relationship between Apg-2 and Hsp70RY was assessed, and no clone corresponding to Hsp70RY was obtained. These results demonstrated that the Hsp110 family consists of at least three members, Apg-1, Apg-2 and Hsp110 in humans as well as in mice. The significance of HS24/p52 and Hsp70RY cDNAs previously reported remains to be determined.

  19. Development and analysis of a tick-borne encephalitis virus infectious clone using a novel and rapid strategy.

    PubMed

    Gritsun, T S; Gould, E A

    1998-12-01

    In less than 1 month we have constructed an infectious clone of attenuated tick-borne encephalitis virus (strain Vasilchenko) from 100 microl of unpurified virus suspension using long high fidelity PCR and a modified bacterial cloning system. Optimization of the 3' antisense primer concentration was essential to achieve PCR synthesis of an 11 kb cDNA copy of RNA from infectious virus. A novel system utilising two antisense primers, a 14-mer for reverse transcription and a 35-mer for long PCR, produced high yields of genomic length cDNA. Use of low copy number Able K cells and an incubation temperature of 28 degrees C increased the genetic stability of cloned cDNA. Clones containing 11 kb cDNA inserts produced colonies of reduced size, thus providing a positive selection system for full length clones. Sequencing of the infectious clone emphasised the improved fidelity of the method compared with conventional PCR and cloning methods. A simple and rapid strategy for genetic manipulation of the infectious clone is also described. These developments represent a significant advance in recombinant technology and should be applicable to positive stranded RNA viruses which cannot easily be purified or genetically manipulated.

  20. Cloning and characterization of murine fanconi anemia group A gene: Fanca protein is expressed in lymphoid tissues, testis, and ovary.

    PubMed

    van de Vrugt, H J; Cheng, N C; de Vries, Y; Rooimans, M A; de Groot, J; Scheper, R J; Zhi, Y; Hoatlin, M E; Joenje, H; Arwert, F

    2000-04-01

    Fanconi anemia (FA) is an autosomal recessive disorder in humans characterized by bone marrow failure, cancer predisposition, and cellular hypersensitivity to cross-linking agents such as mitomycin C and diepoxybutane. FA genes display a caretaker function essential for maintenance of genomic integrity. We have cloned the murine homolog of FANCA, the gene mutated in the major FA complementation group (FA-A). The full-length mouse Fanca cDNA consists of 4503 bp and encodes a protein with a predicted molecular weight of 161 kDa. The deduced Fanca mouse protein shares 81% amino acid sequence similarity and 66% identity with the human protein. The nuclear localization signal and partial leucine zipper consensus motifs found in the human FANCA protein were also present in the murine homolog. In spite of the species difference, the murine Fanca cDNA was capable of correcting the cross-linker sensitive phenotype of human FA-A cells, suggesting functional conservation. Based on Northern as well as Western blots, Fanca was mainly expressed in lymphoid tissues, testis, and ovary. This expression pattern correlates with some of the clinical symptoms observed in FA patients. The availability of the murine Fanca cDNA now allows the gene to be studied in experimental mouse models.

  1. Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

    1992-01-01

    We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

  2. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    PubMed

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  3. A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

    PubMed

    Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

    2011-09-01

    Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

  4. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA

    DTIC Science & Technology

    1989-04-01

    strain-specific identification of HAV in human fecal samples was a major aim of the original contract application, as clinical trials of live and...derived materials and human and primate fecal specimens. 4. We molecularly cloned and partially sequenced the genome of PA21 strain HAV, a virus...antibody. This approach revealed that 99% of the infectious virus particles present in disrupted cell lysates from the 23rd passage of persistently

  5. Cloning and expression of the rat homologue of the Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmitt, I.; Epplen, J.T.; Riess, O.

    1994-09-01

    Huntington`s disease (HD) is an autosomal dominant neurodegenerative disorder which is manifested usually in adult life. The age of onset is variable and leads to progressive symptoms including involuntary choreatic movements and various cognitive and psychiatric disturbances. Recently, a gene (IT15) was cloned containing a (CAG){sub n} repeat which is elongated and unstable in HD patients. IT15 is widely expressed in human tissues but unrelated to any known deduced protein sequence. To further investigate the HD gene, 15 rat cDNA libraries were screened. 24 clones have been identified covering the Huntingtin gene. Comparison of the Huntingtin gene between human andmore » rat revealed homologies between 80% and 87% at the DNA level and about 90% at the protein level. These analyses will help to define biologically important sequence regions, e.g., via evolutionary conservation. One clone contains the (CAG){sub n} repeat which consists of eight triplets compared to seven triplets in the mouse and a median of 17 in human. As in humans there are two transcripts arising from differential 3{prime}-polyadenylation. In the 3{prime}UTR a stretch of about 280 bp is exchanged for a 250 bp fragment with no homology in rodents and man. The cDNA clones are currently used to study Huntingtin gene expression during development in rodent tissues. RNA in situ hybridization of embryonic sections shows predominant signals in all neuronal tissues. In contrast to previously published data Huntingtin mRNA expression in testis is increased in spermatocytes vs. spermatogonia.« less

  6. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    PubMed

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  7. Human brain factor 1, a new member of the fork head gene family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, D.B.; Wiese, S.; Burfeind, P.

    1994-06-01

    Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less

  8. Chromosomal mapping of the human M6 genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olinsky, S.; Loop, B.T.; DeKosky, A.

    1996-05-01

    M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis.more » We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.« less

  9. Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

    PubMed Central

    Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

    2011-01-01

    Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

  10. Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.

    PubMed Central

    Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I

    1991-01-01

    The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129

  11. Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

    PubMed Central

    Kilimann, M W; DeGennaro, L J

    1985-01-01

    To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

  12. Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

    PubMed

    Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

    1997-06-05

    We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

  13. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  14. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

    PubMed Central

    Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-01-01

    Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

  15. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

    PubMed

    Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-12-01

    Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

  16. Cloning and expression of cyclophilin from Platanus orientalis pollens in Escherichia coli

    PubMed Central

    Sankian, Mojtaba; Vahedi, Fatemeh; Pazouki, Nazanin; Moghadam, Malihe; Jabbari Azad, Farahzad; Varasteh, Abdol-Reza

    2012-01-01

    Background: Allergy is a clinical disorder affecting the human population with wide geographical distribution. Platanus orientalis (P. orientalis) trees are planted in many countries and their pollen causes allergic reactions. Cyclophilin has recently been identified as one of the most important allergens of P. orientalis pollen. We aimed to clone and purify this allergen in Escherichia coli for further studies and therapeutic and diagnostic purposes for allergy to P. orientalis. Methods: RNA was extracted from P. orientalis. A full-length fragment encoding cyclophilin was prepared by polymerase chain reaction amplification of the first-strand cDNA synthesized from P. orientalis RNA. The cDNA was inserted into the pET32b (+) vector, and the construct transformed into E. coli Top10 and BL21 cells. The expressed protein was purified by the CuSO4 method. Results: The cDNA for the cyclophilin of P. orientalis pollen was cloned, and a specific reactivity of recombinant cyclophin was confirmed by immunoblotting using sera from patients allergic to P. orientalis pollen. Conclusion: The recombinant cyclophilin has a potential for immunologic assays for evaluation of allergy to P. orientalis pollen. PMID:26989705

  17. Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

    NASA Astrophysics Data System (ADS)

    Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

    1990-10-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

  18. Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

    PubMed

    Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

    1997-11-01

    Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

  19. [Construction of fetal mesenchymal stem cell cDNA subtractive library].

    PubMed

    Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

    2002-04-01

    To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

  20. Isolation and characterization of a cDNA clone specific for avian vitellogenin II.

    PubMed Central

    Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L

    1982-01-01

    A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527

  1. Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof.

    PubMed

    Nolden, T; Pfaff, F; Nemitz, S; Freuling, C M; Höper, D; Müller, T; Finke, Stefan

    2016-04-05

    Reverse genetics approaches are indispensable tools for proof of concepts in virus replication and pathogenesis. For negative strand RNA viruses (NSVs) the limited number of infectious cDNA clones represents a bottleneck as clones are often generated from cell culture adapted or attenuated viruses, with limited potential for pathogenesis research. We developed a system in which cDNA copies of complete NSV genomes were directly cloned into reverse genetics vectors by linear-to-linear RedE/T recombination. Rapid cloning of multiple rabies virus (RABV) full length genomes and identification of clones identical to field virus consensus sequence confirmed the approache's reliability. Recombinant viruses were recovered from field virus cDNA clones. Similar growth kinetics of parental and recombinant viruses, preservation of field virus characters in cell type specific replication and virulence in the mouse model were confirmed. Reduced titers after reporter gene insertion indicated that the low level of field virus replication is affected by gene insertions. The flexibility of the strategy was demonstrated by cloning multiple copies of an orthobunyavirus L genome segment. This important step in reverse genetics technology development opens novel avenues for the analysis of virus variability combined with phenotypical characterization of recombinant viruses at a clonal level.

  2. Cloning, characterization and comparative analysis of pig plasma apolipoprotein A-IV.

    PubMed

    Navarro, María A; Acín, Sergio; Iturralde, María; Calleja, Lucía; Carnicer, Ricardo; Guzmán-García, Mario A; González-Ramón, Nieves; Mata, Pedro; Isabel, Beatriz; López-Bote, Clemente J; Lampreave, Fermín; Piñeiro, Andrés; Osada, Jesús

    2004-01-21

    Pig apolipoprotein (apo) A-IV cDNA was cloned, characterized and compared to the human ortholog. Mature porcine apo A-IV consists of 362 amino acids and displays a 75.6% sequence identity with human protein. Pig apo A-IV is the smallest reported mammalian apo A-IV because it lacks the repeated motifs of glutamine and glutamic acid at the carboxyl terminus. A phylogenic tree of apo A-IV mammalian proteins reveals that porcine apo A-IV is more closely related to humans and primates than to rodents. This protein is highly hydrophobic and is mainly associated with lipoproteins.

  3. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  4. Catalytic site of human protein-glucosylgalactosylhydroxylysine glucosidase: Three crucial carboxyl residues were determined by cloning and site-directed mutagenesis.

    PubMed

    Hamazaki, Hideaki; Hamazaki, Michiko Horikawa

    2016-01-15

    Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

    PubMed Central

    LaPolla, R J; Mayne, K M; Davidson, N

    1984-01-01

    A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

  6. Molecular cloning of a novel widely expressed human 80 kDa 17 beta-hydroxysteroid dehydrogenase IV.

    PubMed Central

    Adamski, J; Normand, T; Leenders, F; Monté, D; Begue, A; Stéhelin, D; Jungblut, P W; de Launoit, Y

    1995-01-01

    Reactions of oestrogens and androgens at position C-17 are catalysed by 17 beta-hydroxysteroid dehydrogenases (17 beta-HSDs). Cloning of the cDNA of a novel human 17 beta-HSD IV and expression of its mRNA are described. A probe derived from the recently discovered porcine 17 beta-oestradiol dehydrogenase (17 beta-EDH) was used to isolate a 2.6 kb human cDNA encoding a continuous protein of 736 amino acids of high (84%) similarity to the porcine 17 beta-EDH. The calculated molecular mass of the human enzyme is 79,595 Da. Other sequence similarities shared by the two enzymes are: an N-terminal sequence which is similar to that of members of the short-chain alcohol dehydrogenase family; amino acids 343-607 which are similar to the C-terminal domains of a trifunctional Candida tropicalis enzyme and the FOX2 gene product of Saccharomyces cerevisiae; amino acids 596-736 which are similar to human sterol carrier protein 2. The previously cloned human 17 beta-HSD I, II and III are less than 25% identical with 17 beta-HSD IV. mRNA for HSD IV is a single species of 3.0 kb, present in many tissues with highest concentrations in liver, heart, prostate and testes. When over-expressed in mammalian cells, the human 17 beta-HSD IV enzyme displays a specific unidirectional oxidative 17 beta-HSD activity. Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7487879

  7. Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

    NASA Astrophysics Data System (ADS)

    Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

    2008-09-01

    We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

  8. Characterization of embryo-specific genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sung, Z.R.

    1988-01-01

    The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less

  9. Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

    PubMed

    Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

    1999-10-06

    The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

  10. cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

    PubMed

    Simon, J W; Slabas, A R

    1998-09-18

    The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

  11. Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas.

    PubMed

    Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C

    1994-06-17

    A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.

  12. Organization of the murine Cd22 locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.

    1993-07-01

    Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less

  13. In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

    PubMed Central

    Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

    2005-01-01

    The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

  14. Cloning and characterization of the human 5,10-methenyltetrahydrofolate synthetase-encoding cDNA.

    PubMed

    Dayan, A; Bertrand, R; Beauchemin, M; Chahla, D; Mamo, A; Filion, M; Skup, D; Massie, B; Jolivet, J

    1995-11-20

    Methenyltetrahydrofolate synthetase (MTHFS) catalyses the obligatory initial metabolic step in the intracellular conversion of 5-formyltetrahydrofolate to other reduced folates. We have isolated and sequenced a human MTHFS cDNA which is 872-bp long and codes for a 203-amino-acid protein of 23,229 Da. Escherichia coli BL21(DE3), transfected with pET11c plasmids containing an open reading frame encoding MTHFS, showed a 100-fold increase in MTHFS activity in bacterial extracts after IPTG induction. Northern blot studies of human tissues determined that the MTHFS mRNA was expressed preferentially in the liver and Southern blot analysis of human genomic DNA suggested the presence of a single-copy gene.

  15. Isolation and cloning of a metalloproteinase from king cobra snake venom.

    PubMed

    Guo, Xiao-Xi; Zeng, Lin; Lee, Wen-Hui; Zhang, Yun; Jin, Yang

    2007-06-01

    A 50 kDa fibrinogenolytic protease, ohagin, from the venom of Ophiophagus hannah was isolated by a combination of gel filtration, ion-exchange and heparin affinity chromatography. Ohagin specifically degraded the alpha-chain of human fibrinogen and the proteolytic activity was completely abolished by EDTA, but not by PMSF, suggesting it is a metalloproteinase. It dose-dependently inhibited platelet aggregation induced by ADP, TMVA and stejnulxin. The full sequence of ohagin was deduced by cDNA cloning and confirmed by protein sequencing and peptide mass fingerprinting. The full-length cDNA sequence of ohagin encodes an open reading frame of 611 amino acids that includes signal peptide, proprotein and mature protein comprising metalloproteinase, disintegrin-like and cysteine-rich domains, suggesting it belongs to P-III class metalloproteinase. In addition, P-III class metalloproteinases from the venom glands of Naja atra, Bungarus multicinctus and Bungarus fasciatus were also cloned in this study. Sequence analysis and phylogenetic analysis indicated that metalloproteinases from elapid snake venoms form a new subgroup of P-III SVMPs.

  16. Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

    PubMed

    Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2015-02-02

    Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. NHE10, a novel osteoclast-specific member of the Na{sup +}/H{sup +} exchanger family, regulates osteoclast differentiation and survival

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Seoung Hoon; Kim, Taesoo; Park, Eui-Soon

    2008-05-02

    Bone homeostasis is tightly regulated by the balanced actions of osteoblasts (OBs) and osteoclasts (OCs). We previously analyzed the gene expression profile of OC differentiation using a cDNA microarray, and identified a novel osteoclastogenic gene candidate, clone OCL-1-E7 [J. Rho, C.R. Altmann, N.D. Socci, L. Merkov, N. Kim, H. So, O. Lee, M. Takami, A.H. Brivanlou, Y. Choi, Gene expression profiling of osteoclast differentiation by combined suppression subtractive hybridization (SSH) and cDNA microarray analysis, DNA Cell Biol. 21 (2002) 541-549]. In this study, we have isolated full-length cDNAs corresponding to this clone from mice and humans to determine the functionalmore » roles of this gene in osteoclastogenesis. The full-length cDNA of OCL-1-E7 encodes 12 membrane-spanning domains that are typical of isoforms of the Na{sup +}/H{sup +} exchangers (NHEs), indicating that this clone is a novel member of the NHE family (hereafter referred to as NHE10). Here, we show that NHE10 is highly expressed in OCs in response to receptor activator of nuclear factor-{kappa}B ligand signaling and is required for OC differentiation and survival.« less

  18. Demonstration of GTG as an endogenous initiation codon for a human mRNA transcript revealed by molecular cloning of the serpin endopin 2B.

    PubMed

    Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill; Hook, Vivian Y H

    2004-08-16

    This study demonstrates utilization of the novel GTG initiation codon for translation of a human mRNA transcript that encodes the serpin endopin 2B, a protease inhibitor. Molecular cloning revealed the nucleotide sequence of the human endopin 2B cDNA. Its deduced primary sequence shows high homology to bovine endopin 2A that possesses cross-class protease inhibition of elastase and papain. Notably, the human endopin 2B cDNA sequence revealed GTG as the predicted translation initiation codon; the predicted translation product of 46 kDa endopin 2B was produced by in vitro translation of 35S-endopin 2B with mammalian (rabbit) protein translation components. Importantly, bioinformatic studies demonstrated the presence of the entire human endopin 2B cDNA sequence with GTG as initiation codon within the human genome on chromosome 14. Further evidence for GTG as a functional initiation codon was illustrated by GTG-mediated in vitro translation of the heterologous protein EGFP, and by GTG-mediated expression of EGFP in mammalian PC12 cells. Mutagenesis of GTG to GTC resulted in the absence of EGFP expression in PC12 cells, indicating the function of GTG as an initiation codon. In addition, it was apparent that the GTG initiation codon produces lower levels of translated protein compared to ATG as initiation codon. Significantly, GTG-mediated translation of endopin 2B demonstrates a functional human gene product not previously predicted from initial analyses of the human genome. Further analyses based on GTG as an alternative initiation codon may predict new candidate genes of the human genome.

  19. Characterization of tumor differentiation factor (TDF) and its receptor (TDF-R).

    PubMed

    Sokolowska, Izabela; Woods, Alisa G; Gawinowicz, Mary Ann; Roy, Urmi; Darie, Costel C

    2013-08-01

    Tumor differentiation factor (TDF) is an under-investigated protein produced by the pituitary with no definitive function. TDF is secreted into the bloodstream and targets the breast and prostate, suggesting that it has an endocrine function. Initially, TDF was indirectly discovered based on the differentiation effect of alkaline pituitary extracts of the mammosomatotropic tumor MtTWlO on MTW9/PI rat mammary tumor cells. Years later, the cDNA clone responsible for this differentiation activity was isolated from a human pituitary cDNA library using expression cloning. The cDNA encoded a 108-amino-acid polypeptide that had differentiation activity on MCF7 breast cancer cells and on DU145 prostate cancer cells in vitro and in vivo. Recently, our group focused on identification of the TDF receptor (TDF-R). As potential TDF-R candidates, we identified the members of the Heat Shock 70-kDa family of proteins (HSP70) in both MCF7 and BT-549 human breast cancer cells (HBCC) and PC3, DU145, and LNCaP human prostate cancer cells (HPCC), but not in HeLa cells, NG108 neuroblastoma, or HDF-a and BLK CL.4 cells fibroblasts or fibroblast-like cells. Here we review the current advances on TDF, with particular focus on the structural investigation of its receptor and on its functional effects on breast and prostate cells.

  20. cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

    PubMed

    Huang, Shengbing; Song, Wei; Lin, Qishui

    2005-08-01

    A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

  1. Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.

    PubMed

    Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine

    2005-08-01

    Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

  2. Molecular cloning of a human Ca2+-dependent cell-cell adhesion molecule homologous to mouse placental cadherin: its low expression in human placental tissues

    PubMed Central

    1989-01-01

    P-cadherin is a subclass of Ca2+-dependent cell-cell adhesion molecules present in mouse placenta, where its localization suggests a function of connecting the embryo to the uterus (Nose, A., and M. Takeichi. 1986. J. Cell Biol. 103:2649-2658). We recently identified a human cadherin detected by an mAb capable of disrupting cell-cell adhesion of A-431 cells, and found that it was closely related immunochemically to mouse P-cadherin. Curiously, this cadherin was undetectable in human placenta by immunohistochemical examination (Shimoyama, Y., S. Hirohashi, S. Hirano, M. Noguchi, Y. Shimosato, M. Takeichi, and O. Abe. 1989. Cancer Res. 49:2128-2133). We here report the cloning and sequencing of cDNA clone encoding the human homologue of mouse P- cadherin. The deduced amino acid sequence of the human P-cadherin consists of 829 amino acid and shows striking homology with mouse P- cadherin. On Northern blot analysis, human P-cadherin was scarcely expressed in human placenta in contrast to mouse P-cadherin, which was abundantly expressed in mouse placenta throughout pregnancy, and it was shown that E-cadherin, but not P-cadherin, was the major cadherin molecule in human placenta. Moreover, NIH3T3 cells transfected with human P-cadherin cDNA expressed the functional cadherin molecule, which was identical to the cadherin we had previously identified using the mAb, showing that this molecule really does mediate cell-cell adhesion and that the cadherin we detected immunochemically is undoubtedly human P-cadherin. The results obtained in this study support the idea that P- cadherin plays little role, if any, in Ca2+-dependent cell-cell binding in human placental tissue at least after several weeks of pregnancy. PMID:2793940

  3. Cloning of a new member of the insulin gene superfamily (INSL4) expressed in human placenta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chassin, D.; Laurent, A.; Janneau, J.L.

    1995-09-20

    A new member of the insulin gene superfamily was identified by screening a subtracted cDNA library of first-trimester human placenta and, hence, was tentatively named early placenta insulin-like peptide (EPIL). In this paper, we report the cloning and sequencing of the EPIL cDNA and the EPIL gene (INSL4). Comparison of the deduced amino acid sequence of the early placenta insulin-like peptide revealed significant overall and structural homologies with members of the insulin-like hormone superfamily. Moreover, the organization of the early placenta insulin-like gene, which is composed of two exons and one intron, is similiar to that of insulin and relaxin.more » By in situ hybridization, the INSL4 gene was assigned to band p24 of the short arm of chromosome 9. RT-PCR analysis of EPIL tissue distribution revealed that its transcripts are expressed in the placenta and uterus. 22 refs., 3 figs.« less

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre

    Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less

  5. A cosmid and cDNA fine physical map of a human chromosome 13q14 region frequently lost in B-cell chronic lymphocytic leukemia and identification of a new putative tumor suppressor gene, Leu5.

    PubMed

    Kapanadze, B; Kashuba, V; Baranova, A; Rasool, O; van Everdink, W; Liu, Y; Syomov, A; Corcoran, M; Poltaraus, A; Brodyansky, V; Syomova, N; Kazakov, A; Ibbotson, R; van den Berg, A; Gizatullin, R; Fedorova, L; Sulimova, G; Zelenin, A; Deaven, L; Lehrach, H; Grander, D; Buys, C; Oscier, D; Zabarovsky, E R; Einhorn, S; Yankovsky, N

    1998-04-17

    B-cell chronic lymphocytic leukemia (B-CLL) is a human hematological neoplastic disease often associated with the loss of a chromosome 13 region between RB1 gene and locus D13S25. A new tumor suppressor gene (TSG) may be located in the region. A cosmid contig has been constructed between the loci D13S1168 (WI9598) and D13S25 (H2-42), which corresponds to the minimal region shared by B-CLL associated deletions. The contig includes more than 200 LANL and ICRF cosmid clones covering 620 kb. Three cDNAs likely corresponding to three different genes have been found in the minimally deleted region, sequenced and mapped against the contigged cosmids. cDNA clone 10k4 as well as a chimeric clone 13g3, codes for a zinc-finger domain of the RING type and shares homology to some known genes involved in tumorigenesis (RET finger protein, BRCA1) and embryogenesis (MID1). We have termed the gene corresponding to 10k4/13g3 clones LEU5. This is the first gene with homology to known TSGs which has been found in the region of B-CLL rearrangements.

  6. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    PubMed Central

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  7. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.

    1989-08-01

    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two,more » and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.« less

  8. Chromosomal localization and cDNA cloning of the human DBP and TEF genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khatib, Z.A.; Inaba, T.; Valentine, M.

    1994-09-15

    The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less

  9. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    PubMed

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  10. Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

    PubMed

    Yi, S Y; Hwang, B K

    1998-10-31

    Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

  11. Human parainfluenza virus type 3 (HPIV-3); Construction and rescue of an infectious, recombinant virus expressing the enhanced green fluorescent protein (EGFP).

    USDA-ARS?s Scientific Manuscript database

    The ability to rescue an infectious, recombinant, RNA virus from a cDNA clone, has led to new opportunities for measuring viral replication from a viral expressed reporter gene. In this protocol, the process of inserting enhanced green fluorescent protein (EGFP) gene into the human parainfluenza vi...

  12. The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simmons, C.F. Jr.; Clancy, T.E.; Quan, R.

    1995-04-10

    The human oxytocin receptor regulates parturition and myometrial contractility, breast milk let-down, and reproductive behaviors in the mammalian central nervous system. Kimura et al. recently identified a human oxytocin receptor cDNA by means of expression cloning from a human myometrial cDNA library. To elucidate further the molecular mechanisms that regulate oxytocin receptor gene expression and to define the expected Mendelian inheritance of possible human disease states, we must determine the number of genes, their localization, and their organization and structure. We summarize below our data indicating that the human oxytocin receptor gene is localized to 3p25 and exists as amore » single copy in the haploid genome. 9 refs., 2 figs.« less

  13. CLONING AND CHARACTERIZATION OF CDNA ENCODING GIARDIA LAMBLIA d-GIARDIN

    USDA-ARS?s Scientific Manuscript database

    A cDNA coding for d-giardin was cloned from Giardia lamblia trophozoites in order to localize the protein and study its function in mediating surface attachment. Recombinant d-giardin antigen was produced in Escherichia coli as a poly-histidine fusion protein and was purified by affinity chromatogr...

  14. [Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

    PubMed

    Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

    2005-03-01

    To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

  15. ILG1 : a new integrase-like gene that is a marker of bacterial contamination by the laboratory Escherichia coli strain TOP10F'.

    PubMed Central

    Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.

    2002-01-01

    BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938

  16. Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

    PubMed

    Wang, Jian-Hua; Chen, Shi-Shu

    2002-07-01

    To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

  17. Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mencinger, M.; Panagopoulos, I.; Andreasson, P.

    1997-05-01

    Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

  18. Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

    PubMed Central

    Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

    1998-01-01

    The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

  19. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    PubMed

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  20. cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoefler, G.; Forstner, M.; Hulla, W.

    1994-01-01

    Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

  1. Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

    PubMed Central

    Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

    2000-01-01

    We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

  2. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

    PubMed Central

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-01-01

    Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

  3. Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.

    PubMed Central

    Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M

    1998-01-01

    We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109

  4. Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones

    PubMed Central

    Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio

    2004-01-01

    The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In addition, among 72,027 uniquely mapped SNPs and insertions/deletions localized within human genes, 13,215 nonsynonymous SNPs, 315 nonsense SNPs, and 452 indels occurred in coding regions. Together with 25 polymorphic microsatellite repeats present in coding regions, they may alter protein structure, causing phenotypic effects or resulting in disease. The H-InvDB platform represents a substantial contribution to resources needed for the exploration of human biology and pathology. PMID:15103394

  5. A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.

    PubMed

    Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya

    2014-03-01

    Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. [Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

    PubMed

    Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

    2009-04-01

    This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

  7. Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

    NASA Astrophysics Data System (ADS)

    Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

    2015-09-01

    A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

  8. Nucleotide sequence and regulatory studies of VGF, a nervous system-specific mRNA that is rapidly and relatively selectively induced by nerve growth factor.

    PubMed

    Salton, S R

    1991-09-01

    A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.

  9. The cDNA sequence of a neutral horseradish peroxidase.

    PubMed

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  10. Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes.

    PubMed Central

    Trapani, J A; Klein, J L; White, P C; Dupont, B

    1988-01-01

    A cDNA clone encoding a human serine esterase gene was isolated from a library constructed from poly(A)+ RNA of allogeneically stimulated, interleukin 2-expanded peripheral blood mononuclear cells. The clone, designated HSE26.1, represents a full-length copy of a 0.9-kilobase mRNA present in human cytotoxic cells but absent from a wide variety of noncytotoxic cell lines. Clone HSE26.1 contains an 892-base-pair sequence, including a single 741-base-pair open reading frame encoding a putative 247-residue polypeptide. The first 20 amino acids of the polypeptide form a leader sequence. The mature protein is predicted to have an unglycosylated Mr of approximately equal to 26,000 and contains a single potential site for N-linked glycosylation. The nucleotide and predicted amino acid sequences of clone HSE26.1 are homologous with all murine and human serine esterases cloned thus far but are most similar to mouse granzyme B (70% nucleotide and 68% amino acid identity). HSE26.1 protein is expressed weakly in unstimulated peripheral blood mononuclear cells but is strongly induced within 6-hr incubation in medium containing phytohemagglutinin. The data suggest that the protein encoded by HSE26.1 plays a role in cell-mediated cytotoxicity. Images PMID:3261871

  11. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    DTIC Science & Technology

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  12. Sperm flagella protein components: Human meichroacidin constructed by the membrane occupation and recognition nexus motif

    PubMed Central

    MATSUOKA, YASUHIRO; NISHIMURA, HIROMI; NUMAZAWA, KAHORI; TSUCHIDA, JUNJI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; MATSUMIYA, KIYOMI; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

    2005-01-01

    Background and Aims:   In a previous study, the authors of the present study cloned mouse meichroacidin (MCA), which is expressed in stages of spermatogenesis from pachytene spermatocytes through round spermatid germ cells. MCA protein contains the membrane occupation and recognition nexus (MORN) motif and localizes to a male meiotic metaphase chromosome. Recently, a MCA homolog of carp (Cyprinus carpio), MORN motif‐containing sperm‐specific axonemal protein (MSAP), was reportedly identified and localized in sperm flagella. Present knowledge of human spermiogenesis requires the identification of proteins in human sperm. The present study identified the human orthologue of MCA. Methods:   Colony hybridization using a human testis plasmid cDNA library was carried out to clone human MCA (h‐MCA) cDNA. Northern blot, Western blot, and immunohistochemical analyses were carried out. Results:   h‐MCA was found to be specifically expressed in the testes. The h‐MCA amino acid sequence shared 79.8% identity with mouse MCA and contained MORN motifs. h‐MCA localized in the sperm flagellum and basal body, as does MSAP in carp. Conclusion:   Expression and localization analyses showed that h‐MCA is a component of the sperm flagellum and basal body and might play an important role in the development of the sperm flagellum in humans. (Reprod Med Biol 2005; 4: 213–219) PMID:29699225

  13. Cloning and characterization of full-length mouse thymidine kinase 2: the N-terminal sequence directs import of the precursor protein into mitochondria.

    PubMed Central

    Wang, L; Eriksson, S

    2000-01-01

    The subcellular localization of mitochondrial thymidine kinase (TK2) has been questioned, since no mitochondrial targeting sequences have been found in cloned human TK2 cDNAs. Here we report the cloning of mouse TK2 cDNA from a mouse full-length enriched cDNA library. The mouse TK2 cDNA codes for a protein of 270 amino acids, with a 40-amino-acid presumed N-terminal mitochondrial targeting signal. In vitro translation and translocation experiments with purified rat mitochondria confirmed that the N-terminal sequence directed import of the precursor TK2 into the mitochondrial matrix. A single 2.4 kb mRNA transcript was detected in most tissues examined, except in liver, where an additional shorter (1.0 kb) transcript was also observed. There was no correlation between the tissue distribution of TK2 activity and the expression of TK2 mRNA. Full-length mouse TK2 protein and two N-terminally truncated forms, one of which corresponds to the mitochondrial form of TK2 and a shorter form corresponding to the previously characterized recombinant human TK2, were expressed in Escherichia coli and affinity purified. All three forms of TK2 phosphorylated thymidine, deoxycytidine and 2'-deoxyuridine, but with different kinetic efficiencies. A number of cytostatic pyrimidine nucleoside analogues were also tested and shown to be good substrates for the various forms of TK2. The active form of full-length mouse TK2 was a dimer, as judged by Superdex 200 chromatography. These results enhance our understanding of the structure and function of TK2, and may help to explain the mitochondrial disorder, mitochondrial neurogastrointestinal encephalomyopathy. PMID:11023833

  14. Generation of a recombinant West Nile virus stably expressing the Gaussia luciferase for neutralization assay.

    PubMed

    Zhang, Pan-Tao; Shan, Chao; Li, Xiao-Dan; Liu, Si-Qing; Deng, Cheng-Lin; Ye, Han-Qing; Shang, Bao-Di; Shi, Pei-Yong; Lv, Ming; Shen, Bei-Fen; Qin, Cheng-Feng; Zhang, Bo

    2016-01-04

    West Nile virus (WNV) is a neurotropic human pathogen that has caused increasing infected cases over recent years. There is currently no licensed vaccine or effective drug for prevention and treatment of WNV infection in humans. To facilitate antiviral drug discovery and neutralizing antibody detection, a WNV cDNA clone containing a luciferase reporter gene was constructed through incorporating Gaussia luciferase (Gluc) gene within the capsid-coding region of WNV genome. Transfection of BHK-21 cells with the cDNA clone-derived RNA generated luciferase reporter WNV (WNV-Gluc) and the stable WNV-Gluc with high titers (>10(7)PFU/ml) was obtained through plaque purification. Luciferase activity was used to effectively quantify the viral production of WNV-Gluc. Using the reporter virus WNV-Gluc, we developed a luciferase based assay in a 12-well format for evaluating neutralizing antibodies. The reporter virus could be a powerful tool for epidemiological investigation of WNV, vaccine evaluation, antiviral drug screening, and the study of WNV replication and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

    PubMed Central

    Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

    1993-01-01

    A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

  16. Development of infectious cDNA clones of citrus yellow vein clearing virus using a novel and rapid strategy.

    PubMed

    Cui, Tian Tian; Bin, Yu; Yan, Jian Hong; Mei, Peng Ying; Li, Zhong An; Zhou, Chang Yong; Song, Zhen

    2018-05-04

    Yellow vein clearing disease (YVCD) causes significant economic losses in lemon and other species of citrus. Usually, citrus yellow vein clearing virus (CYVCV) is considered to be the causal agent of YVCD. However, mixed infection of CYVCV and Indian citrus ringspot virus (ICRSV) or other pathogens is often detected in citrus plants with YVCD. In this study, we re-examined the causal agent of YVCD to fulfill Koch's postulates. First, the full-length genome of CYVCV isolate AY (CYVCV-AY) was amplified by long-distance RT-PCR from a Eureka lemon [Citrus limon (L) Brum. f.] tree with typical YVCD symptoms. The genomic cDNAs were then cloned into a ternary Yeast-Escherichia coli-Agrobacterium tumefaciens shuttle vector, pCY, using transformation-associated recombination (TAR) strategy, and 15 full-length cDNA clones of CYVCV-AY were obtained. Subsequently, four of these clones were selected randomly and inoculated on Jincheng [C. sinensis (L) Osbeck] seedlings through Agrobacterium-mediated vacuum-infiltration, and it was found that 80 to 100% of inoculated plants were infected with CYVCV by RT-PCR at 20 to 40 days post inoculation (dpi) and by direct tissue blot immunoassay at 60 dpi. The progeny of CYVCV-AY from cDNA clones caused typical symptoms of YVCD such as yellow vein clearing, leaf distortion, and chlorosis, which were the same as that elicited by wild-type virus. Finally, the regeneration of CYVCV-AY genome was confirmed by long-distance RT-PCR in lemon trees inoculated with the infectious cDNA clone. These results proved that CYVCV was the primary causal agent of YVCD. This is the first report on the development of infectious cDNA clones of CYVCV, which lays the foundation for further studies on viral gene functions and virus-host interactions.

  17. Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

    PubMed Central

    Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

    1993-01-01

    A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

  18. Molecular Cloning and Function of FAS/APO1 Associated Protein in Breast Cancer.

    DTIC Science & Technology

    1996-06-01

    Ariyama T, Abe T, Druck T, Ohta M, Huebner K, Yanagisawa J, Reed JC, Sato T: PTPN13, a Fas-associated protein tyrosine phosphatase, is located on...20. Yang, Q., and Tonks, N. K. (1991). Isolation of a cDNA clone encoding a human protein-tyrosine phosphatase with homology 7. Huebner, K., Druck , T...Acad. Sci. U.S.A. 91, 7477 (1994). Res. 53, 1945 (1993).(Fig. 3D ). In contrast to Jurkat cells which 13. The original description of PTP-BAS (12

  19. Human MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-01-07

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  20. Human MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1997-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  1. Isolation and expression of the human gametocyte-specific factor 1 gene (GTSF1) in fetal ovary, oocytes, and preimplantation embryos.

    PubMed

    Huntriss, John; Lu, Jianping; Hemmings, Karen; Bayne, Rosemary; Anderson, Richard; Rutherford, Anthony; Balen, Adam; Elder, Kay; Picton, Helen M

    2017-01-01

    Gametocyte-specific factor 1 has been shown in other species to be required for the silencing of retrotransposons via the Piwi-interacting RNA (piRNA) pathway. In this study, we aimed to isolate and assess expression of transcripts of the gametocyte-specific factor 1 (GTSF1) gene in the human female germline and in preimplantation embryos. Complementary DNA (cDNA) libraries from human fetal ovaries and testes, human oocytes and preimplantation embryos and ovarian follicles isolated from an adult ovarian cortex biopsy were used to as templates for PCR, cloning and sequencing, and real time PCR experiments of GTSF1 expression. GTSF1 cDNA clones that covered the entire coding region were isolated from human oocytes and preimplantation embryos. GTSF1 mRNA expression was detected in archived cDNAs from staged human ovarian follicles, germinal vesicle (GV) stage oocytes, metaphase II oocytes, and morula and blastocyst stage preimplantation embryos. Within the adult female germline, expression was highest in GV oocytes. GTSF1 mRNA expression was also assessed in human fetal ovary and was observed to increase during gestation, from 8 to 21 weeks, during which time oogonia enter meiosis and primordial follicle formation first occurs. In human fetal testis, GTSF1 expression also increased from 8 to 19 weeks. To our knowledge, this report is the first to describe the expression of the human GTSF1 gene in human gametes and preimplantation embryos.

  2. Human mitochondrial pyrophosphatase: cDNA cloning and analysis of the gene in patients with mtDNA depletion syndromes.

    PubMed

    Curbo, Sophie; Lagier-Tourenne, Clotilde; Carrozzo, Rosalba; Palenzuela, Lluis; Lucioli, Simona; Hirano, Michio; Santorelli, Filippo; Arenas, Joaquin; Karlsson, Anna; Johansson, Magnus

    2006-03-01

    Pyrophosphatases (PPases) catalyze the hydrolysis of inorganic pyrophosphate generated in several cellular enzymatic reactions. A novel human pyrophosphatase cDNA encoding a 334-amino-acid protein approximately 60% identical to the previously identified human cytosolic PPase was cloned and characterized. The novel enzyme, named PPase-2, was enzymatically active and catalyzed hydrolysis of pyrophosphate at a rate similar to that of the previously identified PPase-1. A functional mitochondrial import signal sequence was identified in the N-terminus of PPase-2, which targeted the enzyme to the mitochondrial matrix. The human pyrophosphatase 2 gene (PPase-2) was mapped to chromosome 4q25 and the 1.4-kb mRNA was ubiquitously expressed in human tissues, with highest levels in muscle, liver, and kidney. The yeast homologue of the mitochondrial PPase-2 is required for mitochondrial DNA maintenance and yeast cells lacking the enzyme exhibit mitochondrial DNA depletion. We sequenced the PPA2 gene in 13 patients with mitochondrial DNA depletion syndromes (MDS) of unknown cause to determine if mutations in the PPA2 gene of these patients were associated with this disease. No pathogenic mutations were identified in the PPA2 gene of these patients and we found no evidence that PPA2 gene mutations are a common cause of MDS in humans.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feyereisen-Koener, J.M.

    Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

  4. Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

    PubMed

    Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

    2000-10-06

    Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

  5. An infectious full-length cDNA clone of duck Tembusu virus, a newly emerging flavivirus causing duck egg drop syndrome in China.

    PubMed

    Li, Shuang; Zhang, Lijiao; Wang, Yongyue; Wang, Shuxia; Sun, Haigang; Su, Wenliang; He, Weiyong; Han, Bo; Su, Jingliang

    2013-01-01

    Duck Tembusu virus (TMUV) is a recently identified pathogenic flavivirus that causes severe egg drop and encephalitis in Chinese ducks and geese. It has been found to be most closely related to the mosquito-origin Tembusu virus and chicken Sitiawan virus reported in Malaysia. However, the ecological characteristics and the pathogenesis of duck TMUV are largely unknown. We report the construction of full-length cDNA clone of duck TMUV strain JXSP. The virus genome was reverse transcribed, amplified as seven overlapping fragments and successively ligated into the low copy number vector pWSK29 under the control of a T7 promoter. Transfection of BHK-21 cells with the transcribed RNA from the full-length cDNA clone resulted in production of highly infectious progeny virus. In vitro growth characteristics in BHK-21 cells and virulence in ducklings and BALB/c mice were similar for the rescued and parental viruses. This stable infectious cDNA clone will be a valuable tool for studying the genetic determinants of duck TMUV. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Development of a Stable Cell Line, Overexpressing Human T-cell Immunoglobulin Mucin 1

    PubMed Central

    Ebrahimi, Mina; Kazemi, Tohid; Ganjalikhani-hakemi, Mazdak; Majidi, Jafar; khanahmad, Hossein; Rahimmanesh, Ilnaz; Homayouni, Vida; Kohpayeh, Shirin

    2015-01-01

    Background Recent researches have demonstrated that human T-cell immunoglobulin mucin 1 (TIM-1) glycoprotein plays important roles in regulation of autoimmune and allergic diseases, as well as in tumor immunity and response to viral infections. Therefore, targeting TIM-1 could be a potential therapeutic approach against such diseases. Objectives In this study, we aimed to express TIM-1 protein on Human Embryonic kidney (HEK) 293T cell line in order to have an available source of the TIM-1 antigen. Materials and Methods The cDNA was synthesized after RNA extraction from peripheral blood mononuclear cells (PBMC) and TIM-1 cDNA was amplified by PCR with specific primers. The PCR product was cloned in pcDNA™3.1/Hygro (+) and transformed in Escherichia coli TOP 10 F’. After cloning, authenticity of DNA sequence was checked and expressed in HEK 293T cells. Finally, expression of TIM-1 was analyzed by flow cytometry and real-time PCR. Results The result of DNA sequencing demonstrated correctness of TIM-1 DNA sequence. The flow cytometry results indicated that TIM-1 was expressed in about 90% of transfected HEK 293T cells. The real-time PCR analysis showed TIM-1 mRNA expression increased 195-fold in transfected cells compared with un-transfected cells. Conclusions Findings of present study demonstrated the successful cloning and expression of TIM-1 on HEK 293T cells. These cells could be used as an immunogenic source for production of specific monoclonal antibodies, nanobodies and aptamers against human TIM-1. PMID:28959306

  7. Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Legerski, R.J.; Liu, P.; Li, L.

    1994-05-01

    The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less

  8. Purification and cDNA cloning of a protein derived from Flammulina velutipes that increases the permeability of the intestinal Caco-2 cell monolayer.

    PubMed

    Watanabe, H; Narai, A; Shimizu, M

    1999-06-01

    A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.

  9. Cloning and characterization of a basic phospholipase A2 homologue from Micrurus corallinus (coral snake) venom gland.

    PubMed

    de Oliveira, Ursula Castro; Assui, Alessandra; da Silva, Alvaro Rossan de Brandão Prieto; de Oliveira, Jane Silveira; Ho, Paulo Lee

    2003-09-01

    During the cloning of abundant cDNAs expressed in the Micrurus corallinus coral snake venom gland, several putative toxins, including a phospholipase A2 homologue cDNA (clone V2), were identified. The V2 cDNA clone codes for a potential coral snake toxin with a signal peptide of 27 amino acid residues plus a predicted mature protein with 119 amino acid residues. The deduced protein is highly similar to known phospholipases A2, with seven deduced S-S bridges at the same conserved positions. This protein was expressed in Escherichia coli as a His-tagged protein that allowed the rapid purification of the recombinant protein. This protein was used to generate antibodies, which recognized the recombinant protein in Western blot. This antiserum was used to screen a large number of venoms, showing a ubiquitous distribution of immunorelated proteins in all elapidic venoms but not in the viperidic Bothrops jararaca venom. This is the first description of a complete primary structure of a phospholipase A2 homologue deduced by cDNA cloning from a coral snake.

  10. Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2002-10-01

    Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

  11. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

    PubMed

    Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

  12. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Yun-Ling; Li, Li; Wu, Keqiang

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

  13. Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

    A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

  14. Establishment of an appropriate animal model for lacritin studies: cloning and characterization of lacritin in monkey eyes.

    PubMed

    Nakajima, T; Walkup, R D; Tochigi, A; Shearer, T R; Azuma, M

    2007-11-01

    Lacritin is a mitogen of human salivary gland cells as well as a stimulator of human corneal epithelial cells. It is expected to be an important factor in maintaining the surrounding ocular surface. The monkey would be a relevant animal model in which to study the role of lacritin in ophthalmic physiology and pathology. However, to our knowledge, no cDNA cloning or functional analysis of monkey lacritin has been performed. Thus, the purposes of this study were: (1) to clone the monkey ortholog of lacritin; (2) to characterize lacritin in tears from several species; and (3) to determine the tissues where lacritin is produced and secreted. cDNA for lacritin from rhesus macaque contained 547 bp, with 411 bp in an open reading frame (ORF) encoding a protein of 137 amino acids. Monkey lacritin showed 89% amino acid homology with human lacritin; one amino acid was deleted in all three monkey strains. The predicted MW of mature lacritin was 12.2 kDa, and the isoelectric point was 4.99. Lacritin showed anomalous migration at approximately 21.0 kDa on SDS-PAGE, as confirmed by immunoblotting and amino acid sequencing. Similar to native lacritin in monkey tears, a 21 kDa band was also detected in human tears. In contrast, no lacritin was observed at a similar position on SDS-PAGE in rat, rabbit and dog tears. In the monkey, lacritin mRNA was expressed highly in the lacrimal gland, moderately in the conjunctiva and the meibomian gland, and weakly in corneal epithelium. In primates, lacritin was produced in the lacrimal gland and secreted into tear fluid. These results suggest that lacritin might be important for the maintenance of the ocular surface in higher animals, such as monkeys and humans.

  15. Using genome-wide CRISPR library screening with library resistant DCK to find new sources of Ara-C drug resistance in AML.

    PubMed

    Kurata, Morito; Rathe, Susan K; Bailey, Natashay J; Aumann, Natalie K; Jones, Justine M; Veldhuijzen, G Willemijn; Moriarity, Branden S; Largaespada, David A

    2016-11-03

    Acute myeloid leukemia (AML) can display de novo or acquired resistance to cytosine arabinoside (Ara-C), a primary component of induction chemotherapy. To identify genes capable of independently imposing Ara-C resistance, we applied a genome-wide CRISPR library to human U937 cells and exposed to them to Ara-C. Interestingly, all drug resistant clones contained guide RNAs for DCK. To avoid DCK gene modification, gRNA resistant DCK cDNA was created by the introduction of silent mutations. The CRISPR screening was repeated using the gRNA resistant DCK, and loss of SLC29A was identified as also being capable of conveying Ara-C drug resistance. To determine if loss of Dck results in increased sensitivity to other drugs, we conducted a screen of 446 FDA approved drugs using two Dck-defective BXH-2 derived murine AML cell lines and their Ara-C sensitive parental lines. Both cell lines showed an increase in sensitivity to prednisolone. Guide RNA resistant cDNA rescue was a legitimate strategy and multiple DCK or SLC29A deficient human cell clones were established with one clone becoming prednisolone sensitive. Dck-defective leukemic cells may become prednisolone sensitive indicating prednisolone may be an effective adjuvant therapy in some cases of DCK-negative AML.

  16. Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

    PubMed

    Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

    2000-05-01

    A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

  17. CDNA CLONING OF FATHEAD MINNOW (PIMEPHALES PROMELAS) ESTROGEN AND ANDROGEN RECEPTORS FOR USE IN STEROID RECEPTOR EXTRAPOLATION STUDIES FOR ENDOCRINE DISRUPTING CHEMICALS

    EPA Science Inventory

    cDNA Cloning of Fathead minnow (Pimephales promelas) Estrogen and Androgen Receptors for Use in Steroid Receptor Extrapolation Studies for Endocrine Disrupting Chemicals.

    Wilson, V.S.1,, Korte, J.2, Hartig P. 1, Ankley, G.T.2, Gray, L.E., Jr 1, , and Welch, J.E.1. 1U.S...

  18. Heterologous expression of laccase cDNA from Ceriporiopsis subvermispora yields copper-activated apoprotein and complex isoform patterns

    Treesearch

    Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna

    2003-01-01

    Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...

  19. Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, W.; Emanuel, B.S.; Siegert, J.

    1994-09-01

    DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

  20. Cell-free identification of novel N-myristoylated proteins from complementary DNA resources using bioorthogonal myristic acid analogues.

    PubMed

    Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko

    2014-11-01

    To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. A pipeline for the systematic identification of non-redundant full-ORF cDNAs for polymorphic and evolutionary divergent genomes: Application to the ascidian Ciona intestinalis

    DOE PAGES

    Gilchrist, Michael J.; Sobral, Daniel; Khoueiry, Pierre; ...

    2015-05-27

    Genome-wide resources, such as collections of cDNA clones encoding for complete proteins (full-ORF clones), are crucial tools for studying the evolution of gene function and genetic interactions. Non-model organisms, in particular marine organisms, provide a rich source of functional diversity. Marine organism genomes are, however, frequently highly polymorphic and encode proteins that diverge significantly from those of well-annotated model genomes. The construction of full-ORF clone collections from non-model organisms is hindered by the difficulty of predicting accurately the N-terminal ends of proteins, and distinguishing recent paralogs from highly polymorphic alleles. We also report a computational strategy that overcomes these difficulties,more » and allows for accurate gene level clustering of transcript data followed by the automated identification of full-ORFs with correct 5'- and 3'-ends. It is robust to polymorphism, includes paralog calling and does not require evolutionary proximity to well annotated model organisms. Here, we developed this pipeline for the ascidian Ciona intestinalis, a highly polymorphic member of the divergent sister group of the vertebrates, emerging as a powerful model organism to study chordate gene function, Gene Regulatory Networks and molecular mechanisms underlying human pathologies. Furthermore, using this pipeline we have generated the first full-ORF collection for a highly polymorphic marine invertebrate. It contains 19,163 full-ORF cDNA clones covering 60% of Ciona coding genes, and full-ORF orthologs for approximately half of curated human disease-associated genes.« less

  2. An endogenous and ectopic expression of metabotropic glutamate receptor 8 (mGluR8) inhibits proliferation and increases chemosensitivity of human neuroblastoma and glioma cells.

    PubMed

    Jantas, Danuta; Grygier, Beata; Gołda, Sławomir; Chwastek, Jakub; Zatorska, Justyna; Tertil, Magdalena

    2018-06-06

    The present study aimed to determine the role of metabotropic glutamate receptor 8 (mGluR8) in tumor biology. Using various molecular approaches (RNAi or GRM8 cDNA), cell clones with downregulated (human neuroblastoma SH-SY5Y and human glioma LN229) or overexpressed (human glioma U87-MG and LN18 cell lines) mGluR8 were generated. Next, comparative studies on cell proliferation and migration rates, induction of apoptosis and chemosensitivity were performed among these clones. The mGluR8-downregulated SH-SY5Y clones proliferated faster and were more resistant to cytotoxic action of staurosporine, doxorubicin, irinotecan and cisplatin when compared to control cells. Moreover, these clones were characterized by a lower activity of caspases, calpains and some kinases (GSK-3β, Akt and JNK). The mGluR8-downregulated LN229 clones migrated faster and were less prone to cell-damaging effect of staurosporine and irinotecan when compared with relevant control cells. In contrast, in GRM8-overexpressing U87-MG and LN18 clones, a decreased cell proliferation, increased apoptosis and elevated vulnerability to some cytotoxic agents were found. Altogether, our in vitro data for the first time evidenced a tumor suppressor and chemosensitizing role of mGluR8. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Role of mp 17O Seprase in Breast Cancer.

    DTIC Science & Technology

    1998-07-01

    identical subunits of MT 97 kDa. Recent evidence indicated that the Seprase subunit is identical to Fibroblast Activation Protein a ( FAPa ). To characterize...and define the role of this molecule in cancer, human Seprase/ FAPa cDNA was cloned and stable transfected in two human epithelial carcinoma cell lines...SW-13 and MCF-7. Unexpectedly, overexpression of Seprase/ FAPa has no apparent effect on the proliferation, matrix adhesion and matrigel invasion of

  4. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  5. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  6. The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stapleton, Mark; Liao, Guochun; Brokstein, Peter

    2002-08-12

    Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

  7. Molecular cloning and expression of a chloride channel-associated protein pICln in human young red blood cells: association with actin.

    PubMed

    Schwartz, R S; Rybicki, A C; Nagel, R L

    1997-10-15

    We report the cloning and sequencing from human reticulocytes of cDNA coding for the Cl- channel-associated protein, pICln. Human reticulocyte pICln (HRpICln) cDNA encodes a protein (predicted molecular mass 26293Da) identical with human non-pigmented ciliary epithelial cell pICln. By using full-length HRpICln cDNA (approx. 1.2 kb) to probe human lymphocyte metaphase-chromosome spreads, the location of the human ICln gene was mapped to 11q13 by fluorescence in situ hybridization analysis. Polyclonal antibodies to recombinant HRpICln detected bands at approx. 43 kDa and approx. 37 kDa in both normal (AA) and sickle (SS) red blood cell (RBC) ghost membranes. In SS ghosts, and in ghosts from a patient with autoimmune haemolytic anaemia with 9.8% reticulocytes, the amount of HRpICln was increased compared with AA ghosts, suggesting that the expression or membrane assembly of HRpICln is cell age-dependent. Laser scanning confocal fluorescent microscopy immunolocalized HRpICln largely to the RBC membrane. The increased staining intensity of HRpICln in a reticulocyte-enriched AA RBC density-separated fraction is consistent with a dependence of HRpICln membrane content on cell age. HRpICln and beta-actin form stable complexes in vivo, demonstrated with the yeast two-hybrid system. Low-ionic-strength extraction of ghost membranes, which results in the extraction of the spectrin-actin cytoskeleton, also results in the extraction of HRpICln, consistent with the possibility for the association of these proteins in RBCs in vivo. The results presented here establish the presence of the Cl- channel-associated protein, pICln, in human RBCs, and raises the possibility that this protein has a role in RBC Cl- transport and volume regulation in young RBCs. Moreover the association of RBC pICln with actin offers a model in which to test interactions between RBC ion channels and the cytoskeleton.

  8. Enhanced Tumor Growth and Invasiveness in Vivo by a Carboxyl-Terminal Fragment of α1-Proteinase Inhibitor Generated by Matrix Metalloproteinases

    PubMed Central

    Kataoka, Hiroaki; Uchino, Hirofumi; Iwamura, Takeshi; Seiki, Motoharu; Nabeshima, Kazuki; Koono, Masashi

    1999-01-01

    Matrix metalloproteinases (MMPs) are believed to contribute to the complex process of cancer progression. They also exhibit an α1-proteinase inhibitor (αPI)-degrading activity generating a carboxyl-terminal fragment of ∼5 kd (αPI-C). This study reports that overexpression of αPI-C in S2–020, a cloned subline derived from the human pancreas adenocarcinoma cell line SUIT-2, potentiates the growth capability of the cells in nude mice. After stable transfection of a vector containing a chimeric cDNA encoding a signal peptide sequence of tissue inhibitor of metalloproteinase-1 followed by cDNA for αPI-C into S2–020 cells, three clones that stably secrete αPI-C were obtained. The ectopic expression of αPI-C did not alter in vitro cellular growth. However, subcutaneous injection of the αPI-C-secreting clones resulted in tumors that were 1.5 to 3-fold larger than those of control clones with an increased tendency to invasiveness and lymph node metastasis. These effects could be a result of modulation of natural killer (NK) cell-mediated control of tumor growth in nude mice, as the growth advantage of αPI-C-secreting clones was not observed in NK-depleted mice, and αPI-C-secreting clones showed decreased NK sensitivity in vitro. In addition, production of αPI and generation of the cleaved form of αPI by MMP were observed in various human tumor cell lines and in a highly metastatic subline of SUIT-2 in vitro. These results provide experimental evidence that the αPI-degrading activity of MMPs may play a role in tumor progression not only via the inactivation of αPI but also via the generation of αPI-C. PMID:10027404

  9. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  10. [Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

    PubMed

    Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

    2003-07-01

    Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

  11. Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

    PubMed

    Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

    2002-06-15

    To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

  12. Molecular cloning of human protein 4.2: a major component of the erythrocyte membrane.

    PubMed Central

    Sung, L A; Chien, S; Chang, L S; Lambert, K; Bliss, S A; Bouhassira, E E; Nagel, R L; Schwartz, R S; Rybicki, A C

    1990-01-01

    Protein 4.2 (P4.2) comprises approximately 5% of the protein mass of human erythrocyte (RBC) membranes. Anemia occurs in patients with RBCs deficient in P4.2, suggesting a role for this protein in maintaining RBC stability and integrity. We now report the molecular cloning and characterization of human RBC P4.2 cDNAs. By immunoscreening a human reticulocyte cDNA library and by using the polymerase chain reaction, two cDNA sequences of 2.4 and 2.5 kilobases (kb) were obtained. These cDNAs differ only by a 90-base-pair insert in the longer isoform located three codons downstream from the putative initiation site. The 2.4- and 2.5-kb cDNAs predict proteins of approximately 77 and approximately 80 kDa, respectively, and the authenticity was confirmed by sequence identity with 46 amino acids of three cyanogen bromide-cleaved peptides of P4.2. Northern blot analysis detected a major 2.4-kb RNA species in reticulocytes. Isolation of two P4.2 cDNAs implies existence of specific regulation of P4.2 expression in human RBCs. Human RBC P4.2 has significant homology with human factor XIII subunit a and guinea pig liver transglutaminase. Sequence alignment of P4.2 with these two transglutaminases, however, revealed that P4.2 lacks the critical cysteine residue required for the enzymatic crosslinking of substrates. Images PMID:1689063

  13. Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).

    PubMed

    Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y

    1996-02-01

    Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.

  14. Greig syndrome: Analysis of the GL13 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grzeschik, K.H.; Gessler, M.; Heid, C.

    1994-09-01

    Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less

  15. Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

    PubMed

    Judelson, H S; Michelmore, R W

    1990-01-01

    Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

  16. A pituitary gene encodes a protein that produces differentiation of breast and prostate cancer cells.

    PubMed

    Platica, Micsunica; Ivan, Elena; Holland, James F; Ionescu, Alin; Chen, Sheryl; Mandeli, John; Unger, Pamela D; Platica, Ovidiu

    2004-02-10

    A cDNA clone of 1.1 kb encoding a 108-aa polypeptide was isolated from a human pituitary cDNA library by expression cloning. This protein was named tumor differentiation factor (TDF). The recombinant TDF protein and a 20-aa peptide, P1, selected from the ORF of the gene, induced morphological and biochemical changes consistent with differentiation of human breast and prostate cancer cells. Fibroblast, kidney, hepatoma, and leukemic lymphocytic cell lines were unaffected. Breast and prostate cancer cells aggregated in spheroid-like structures within 24 h of exposure to TDF. This effect was abrogated by a specific affinity-purified rabbit polyclonal anti-P1 Ab. E-cadherin expression was increased in a dose-dependent manner by TDF. Treatment of MCF7 cells with TDF led to production of a lactalbumin-related protein. Peptide P1 significantly decreased the growth of androgen-independent DU145 prostate cancer in severe combined immunodeficient mice. The presence of TDF protein in human sera was detected by the anti-P1 Ab, suggesting a role of TDF in endocrine metabolism. The fact that all activities of TDF can be mimicked by a peptide derived from the encoding TDF sequence opens the possibility of therapeutic applications.

  17. Cloning and characterization of mouse extracellular-signal-regulated protein kinase 3 as a unique gene product of 100 kDa.

    PubMed

    Turgeon, B; Saba-El-Leil, M K; Meloche, S

    2000-02-15

    MAP (mitogen-activated protein) kinases are a family of serine/threonine kinases that have a pivotal role in signal transduction. Here we report the cloning and characterization of a mouse homologue of extracellular-signal-regulated protein kinase (ERK)3. The mouse Erk3 cDNA encodes a predicted protein of 720 residues, which displays 94% identity with human ERK3. Transcription and translation of this cDNA in vitro generates a 100 kDa protein similar to the human gene product ERK3. Immunoblot analysis with an antibody raised against a unique sequence of ERK3 also recognizes a 100 kDa protein in mouse tissues. A single transcript of Erk3 was detected in every adult mouse tissue examined, with the highest expression being found in the brain. Interestingly, expression of Erk3 mRNA is acutely regulated during mouse development, with a peak of expression observed at embryonic day 11. The mouse Erk3 gene was mapped to a single locus on central mouse chromosome 9, adjacent to the dilute mutation locus and in a region syntenic to human chromosome 15q21. Finally, we provide several lines of evidence to support the existence of a unique Erk3 gene product of 100 kDa in mammalian cells.

  18. Primary structure, expression and chromosomal locus of a human homolog of rat ERK3.

    PubMed

    Meloche, S; Beatty, B G; Pellerin, J

    1996-10-03

    We report the cloning and characterization of a human cDNA encoding a novel homolog of rat extracellular signal-regulated kinase 3 (ERK3). The cDNA encodes a predicted protein of 721 amino acids which shares 92% amino acid identity with rat ERK3 over their shared length. Interestingly, the human protein contains a unique extension of 178 amino acids at its carboxy terminal extremity. The human ERK3 protein also displays various degrees of homology to other members of the MAP kinases family, but does not contain the typical TXY regulatory motif between subdomains VII and VIII. Northern blot analysis revealed that ERK3 mRNA is widely distributed in human tissues, with the highest expression detected in skeletal muscle. The human ERK3 gene was mapped by fluorescence in situ hybridization to chromosome 15q21, a region associated with chromosomal abnormalities in acute nonlymphoblastic leukemias. This information should prove valuable in designing studies to define the cellular function of the ERK3 protein kinase.

  19. Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

    DTIC Science & Technology

    1986-11-26

    cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a

  20. Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

    PubMed Central

    Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

    1990-01-01

    Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

  1. Inferring Higher Functional Information for RIKEN Mouse Full-Length cDNA Clones With FACTS

    PubMed Central

    Nagashima, Takeshi; Silva, Diego G.; Petrovsky, Nikolai; Socha, Luis A.; Suzuki, Harukazu; Saito, Rintaro; Kasukawa, Takeya; Kurochkin, Igor V.; Konagaya, Akihiko; Schönbach, Christian

    2003-01-01

    FACTS (Functional Association/Annotation of cDNA Clones from Text/Sequence Sources) is a semiautomated knowledge discovery and annotation system that integrates molecular function information derived from sequence analysis results (sequence inferred) with functional information extracted from text. Text-inferred information was extracted from keyword-based retrievals of MEDLINE abstracts and by matching of gene or protein names to OMIM, BIND, and DIP database entries. Using FACTS, we found that 47.5% of the 60,770 RIKEN mouse cDNA FANTOM2 clone annotations were informative for text searches. MEDLINE queries yielded molecular interaction-containing sentences for 23.1% of the clones. When disease MeSH and GO terms were matched with retrieved abstracts, 22.7% of clones were associated with potential diseases, and 32.5% with GO identifiers. A significant number (23.5%) of disease MeSH-associated clones were also found to have a hereditary disease association (OMIM Morbidmap). Inferred neoplastic and nervous system disease represented 49.6% and 36.0% of disease MeSH-associated clones, respectively. A comparison of sequence-based GO assignments with informative text-based GO assignments revealed that for 78.2% of clones, identical GO assignments were provided for that clone by either method, whereas for 21.8% of clones, the assignments differed. In contrast, for OMIM assignments, only 28.5% of clones had identical sequence-based and text-based OMIM assignments. Sequence, sentence, and term-based functional associations are included in the FACTS database (http://facts.gsc.riken.go.jp/), which permits results to be annotated and explored through web-accessible keyword and sequence search interfaces. The FACTS database will be a critical tool for investigating the functional complexity of the mouse transcriptome, cDNA-inferred interactome (molecular interactions), and pathome (pathologies). PMID:12819151

  2. Regulation of pathogenicity in hop stunt viroid-related group II citrus viroids.

    PubMed

    Reanwarakorn, K; Semancik, J S

    1998-12-01

    Nucleotide sequences were determined for two hop stunt viroid-related Group II citrus viroids characterized as either a cachexia disease non-pathogenic variant (CVd-IIa) or a pathogenic variant (CVd-IIb). Sequence identity between the two variants of 95.6% indicated a conserved genome with the principal region of nucleotide difference clustered in the variable (V) domain. Full-length viroid RT-PCR cDNA products were cloned into plasmid SP72. Viroid cDNA clones as well as derived RNA transcripts were transmissible to citron (Citrus medica L.) and Luffa aegyptiaca Mill. To determine the locus of cachexia pathogenicity as well as symptom expression in Luffa, chimeric viroid cDNA clones were constructed from segments of either the left terminal, pathogenic and conserved (T1-P-C) domains or the conserved, variable and right terminal (C-V-T2) domains of CVd-IIa or CVd-IIb in reciprocal exchanges. Symptoms induced by the various chimeric constructs on the two bioassay hosts reflected the differential response observed with CVd-IIa and -IIb. Constructs with the C-V-T2 domains region from clone-IIa induced severe symptoms on Luffa typical of CVd-IIa, but were non-symptomatic on mandarin as a bioassay host for the cachexia disease. Constructs with the same region (C-V-T2) from the clone-IIb genome induced only mild symptoms on Luffa, but produced a severe reaction on mandarin, as observed for CVd-IIb. Specific site-directed mutations were introduced into the V domain of the CVd-IIa clone to construct viroid cDNA clones with either partial or complete conversions to the CVd-IIb sequence. With the introduction of six site-specific changes into the V domain of the clone-IIa genome, cachexia pathogenicity was acquired as well as a moderation of severe symptoms on Luffa.

  3. Two tropinone reductases with different stereospecificities are short-chain dehydrogenases evolved from a common ancestor.

    PubMed Central

    Nakajima, K; Hashimoto, T; Yamada, Y

    1993-01-01

    In the biosynthetic pathway of tropane alkaloids, tropinone reductase (EC 1.1.1.236) (TR)-I and TR-II, respectively, reduce a common substrate, tropinone, stereospecifically to the stereoisomeric alkamines tropine and pseudotropine (psi-tropine). cDNA clones coding for TR-I and TR-II, as well as a structurally related cDNA clone with an unknown function, were isolated from the solanaceous plant Datura stramonium. The cDNA clones for TR-I and TR-II encode polypeptides containing 273 and 260 amino acids, respectively, and when these clones were expressed in Escherichia coli, the recombinant TRs showed the same strict stereospecificity as that observed for the native TRs that had been isolated from plants. The deduced amino acid sequences of the two clones showed an overall identity of 64% in 260-amino acid residues and also shared significant similarities with enzymes in the short-chain, nonmetal dehydrogenase family. Genomic DNA-blot analysis detected the TR-encoding genes in three tropane alkaloid-producing solanaceous species but did not detect them in tobacco. We discuss how the two TRs may have evolved to catalyze the opposite stereospecific reductions. Images Fig. 4 Fig. 5 PMID:8415746

  4. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    PubMed

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  5. Synonymous deoptimization of the foot-and-mouth disease virus P1 coding region causes attenuation in vivo while inducing a strong neutralizing antibody response

    USDA-ARS?s Scientific Manuscript database

    Codon bias deoptimization has been previously used to successfully attenuate human pathogens including polio, respiratory syncytial and influenza viruses. We have applied a similar technology to deoptimize the capsid coding region (P1 region) of the cDNA infectious clone of foot-and-mouth disease vi...

  6. Cloning, genomic organization, and chromosomal localization of human citrate transport protein to the DiGeorge/velocardiofacial syndrome minimal critical region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldmuntz, E.; Budarf, M.L.; Wang, Zhili

    1996-04-15

    DiGeorge syndrome (DGS) and velocardiofacial syndrome have been shown to be associated with microdeletions of chromosomal region 22q11. More recently, patients with conotruncal anomaly face syndrome and some nonsyndromic patients with isolated forms of conotruncal cardiac defects have been found to have 22q11 microdeletions as well. The commonly deleted region, called the DiGeorge chromosomal region (DGCR), spans approximately 1.2 mb and is estimated to contain at least 30 genes. We report a computational approach for gene identification that makes use of large-scale sequencing of cosmids from a contig spanning the DGCR. Using this methodology, we have mapped the human homologmore » of a rodent citrate transport protein to the DGCR. We have isolated a partial cDNA containing the complete open reading frame and have determined the genomic structure by comparing the genomic sequence from the cosmid to the sequence of the cDNA clone. Whether the citrate transport protein can be implicated in the biological etiology of DGS or other 22q11 microdeletion syndromes remains to be defined. 36 refs., 3 figs., 1 tab.« less

  7. Diagnostic method employing MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1998-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  8. Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

    PubMed

    Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

    2011-12-01

    Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

  9. cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds.

    PubMed

    Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin

    2005-01-01

    SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leong, JoAnn Ching

    The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

  11. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  12. Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.

    PubMed

    Geeta Vani, R; Varghese, C M; Rao, M R

    1999-12-15

    The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.

  13. Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage. lambda. immunoexpression library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullinax, R.L.; Gross, E.A.; Amberg, J.R.

    1990-10-01

    The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less

  14. Partially transformed, anchorage-independent human diploid fibroblasts result from overexpression of the c-sis oncogene: Mitogenic activity of an apparent monomeric platelet-derived growth factor 2 species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stevens, C.W.; Brondyk, W.H.; Burgess, J.A.

    1988-05-01

    A human c-sis cDNA in an expression vector was introduced into human diploid fibroblasts by transfection or electroporation. Fibroblast clones showing an aberrant, densely packed colony morphology were isolated and found to overexpress a 3.6-kilobase sis mRNA species and associated immunoprecipitable platelet-derived growth factor (PDGF) 2 proteins. Parallel analyses in cell clones of sis mRNA expression and colony formation in agar indicated that, above a threshold, a linear, positive correlation existed between sis overexpression and acquired anchorage independence. The sis-overexpressing cells formed transient, regressing tumor nodules when injected into nude mice, consistent with the finite life span which they retained.more » Protein products generated from the transfected c-sis construct in two overexpressing clones were immunoprecipitated with anti-human PDGF antibodies. One clone contained an apparent PDGF dimer of 21 kilodaltons; the second clone contained only on apparent PDGF monomer of 12 kilodaltons, which was shown to account for all of the mitogenic activity present in the cells, essentially all of which was concentrated in the membrane fraction. The results demonstrate a clear link between sis overexpression and acquisition of a partially transformed, anchorage-independent phenotype, and when combined with previous observations of sis overexpression in human tumors, clearly implicate sis overexpression as a genetic mechanism which contributes to human cell transformation.« less

  15. FragIdent--automatic identification and characterisation of cDNA-fragments.

    PubMed

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  16. Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meng, Baozhong, E-mail: bmeng@uoguelph.ca; Venkataraman, Srividhya; Li, Caihong

    Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does notmore » cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.« less

  17. Primary structure of the Aequorea victoria green-fluorescent protein.

    PubMed

    Prasher, D C; Eckenrode, V K; Ward, W W; Prendergast, F G; Cormier, M J

    1992-02-15

    Many cnidarians utilize green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving energy from either a luciferase-oxyluciferin excited-state complex or a Ca(2+)-activated phosphoprotein. These highly fluorescent proteins are unique due to the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues within the polypeptide. This report describes the cloning and sequencing of both cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria. The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones shows three different restriction enzyme patterns which suggests that at least three different genes are present in the A. victoria population at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at least three exons spread over 2.6 kb. The nucleotide sequences of the cDNA and the gene will aid in the elucidation of structure-function relationships in this unique class of proteins.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.

    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less

  19. Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

    PubMed Central

    Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

    2007-01-01

    Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

  20. Molecular cloning of the mouse gene coding for {alpha}{sub 2}-macroglobulin and targeting of the gene in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Umans, L.; Serneels, L.; Hilliker, C.

    1994-08-01

    The authors have cloned the mouse gene coding for {alpha}{sub 2}-macroglobulin in overlapping {lambda} clones and have analyzed its structure. The gene contains 36 exons, coding for the 4.8-kb cDNA that we cloned previously. Including putative control elements in the 5{prime} flanking region, the gene covers about 45 kb. A region of 3.8 kb, stretching from 835 bases upstream of the cDNA start site to exon 4, including all intervening sequences, was sequenced completely. The analysis demonstrated that the putative promoter region of the mouse A2M gene differed considerably from the known promoter sequences of the human A2M gene andmore » of the rat acute-phas A2M gene. Comparison of the exon-intron structure of all known genes of the A2M family confirmed that the rat acute phase A2M gene is more closely related to the human gene than to the mouse A2M gene. To generate mice with the A2M gene inactivated, an insertion type of construct containing 7.5 kb of genomic DNA of the mouse strain 129/J, encompassing exons 16 to 19, was synthesized. A hygromycin marker gene was embedded in intron 17. After electroporation, 198 hygromycin-resistant ES cell lines were isolated and analyzed by Southern blotting. Five ES cell lines were obtained with one allele of the mouse A2M gene targeted by this insertion construct, demonstrating that the position and the characteristics of the vector served the intended goal.« less

  1. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  2. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  3. The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

    PubMed

    Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

    2003-11-01

    Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

  4. Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

    PubMed

    Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

    2016-02-02

    Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  6. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    PubMed

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  7. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    PubMed Central

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

  8. [Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

    PubMed

    Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

    2006-09-01

    To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

  9. Localization and physical mapping of genes encoding the A+U-rich element RNA-binding protein AUF1 to human chromosomes 4 and X

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wagner, B.J.; Long, L.; Pettenati, M.J.

    Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less

  10. Pathogen-regulated genes in wheat isogenic lines differing in resistance to brown rust Puccinia triticina.

    PubMed

    Dmochowska-Boguta, Marta; Alaba, Sylwia; Yanushevska, Yuliya; Piechota, Urszula; Lasota, Elzbieta; Nadolska-Orczyk, Anna; Karlowski, Wojciech M; Orczyk, Waclaw

    2015-10-05

    Inoculation of wheat plants with Puccinia triticina (Pt) spores activates a wide range of host responses. Compatible Pt interaction with susceptible Thatcher plants supports all stages of the pathogen life cycle. Incompatible interaction with TcLr9 activates defense responses including oxidative burst and micronecrotic reactions associated with the pathogen's infection structures and leads to complete termination of pathogen development. These two contrasting host-pathogen interactions were a foundation for transcriptome analysis of incompatible wheat-Pt interaction. A suppression subtractive hybridization (SSH) library was constructed using cDNA from pathogen-inoculated susceptible Thatcher and resistant TcLr9 isogenic lines. cDNA represented steps of wheat-brown rust interactions: spore germination, haustorium mother cell (HMC) formation and micronecrotic reactions. All ESTs were clustered and validated by similarity search to wheat genome using BLASTn and sim4db tools. qRT-PCR was used to determine transcript levels of selected ESTs after inoculation in both lines. Out of 793 isolated cDNA clones, 183 were classified into 152 contigs. 89 cDNA clones and encoded proteins were functionally annotated and assigned to 5 Gene Ontology categories: catalytic activity 48 clones (54 %), binding 32 clones (36 %), transporter activity 6 clones (7 %), structural molecule activity 2 clones (2 %) and molecular transducer activity 1 clone (1 %). Detailed expression profiles of 8 selected clones were analyzed using the same plant-pathogen system. The strongest induction after pathogen infection and the biggest differences between resistant and susceptible interactions were detected for clones encoding wall-associated kinase (GenBank accession number JG969003), receptor with leucine-rich repeat domain (JG968955), putative serine/threonine protein kinase (JG968944), calcium-mediated signaling protein (JG968925) and 14-3-3 protein (JG968969). The SSH library represents transcripts regulated by pathogen infection during compatible and incompatible interactions of wheat with P. triticina. Annotation of selected clones confirms their putative roles in successive steps of plant-pathogen interactions. The transcripts can be categorized as defense-related due to their involvement in either basal defense or resistance through an R-gene mediated reaction. The possible involvement of selected clones in pathogen recognition and pathogen-induced signaling as well as resistance mechanisms such as cell wall enforcement, oxidative burst and micronecrotic reactions is discussed.

  11. RICD: a rice indica cDNA database resource for rice functional genomics.

    PubMed

    Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

    2008-11-26

    The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  12. Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

    PubMed

    Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

    1995-07-01

    Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

  13. Molecular cloning and expression of rat brain endopeptidase 3.4.24.16.

    PubMed

    Dauch, P; Vincent, J P; Checler, F

    1995-11-10

    We have isolated by immunological screening of a lambda ZAPII cDNA library constructed from rat brain mRNAs a cDNA clone encoding endopeptidase 3.4.24.16. The longest open reading frame encodes a 704-amino acid protein with a theoretical molecular mass of 80,202 daltons and bears the consensus sequence of the zinc metalloprotease family. The sequence exhibits a 60.2% homology with those of another zinc metallopeptidase, endopeptidase 3.4.24.15. Northern blot analysis reveals two mRNA species of about 3 and 5 kilobases in rat brain, ileum, kidney, and testis. We have transiently transfected COS-7 cells with pcDNA3 containing the cloned cDNA and established the overexpression of a 70-75-kDa immunoreactive protein. This protein hydrolyzes QFS, a quenched fluorimetric substrate of endopeptidase 3.4.24.16, and cleaves neurotensin at a single peptide bond, leading to the formation of neurotensin (1-10) and neurotensin (11-13). QFS and neurotensin hydrolysis are potently inhibited by the selective endopeptidase 3.4.24.16 dipeptide blocker Pro-Ile and by dithiothreitol, while the enzymatic activity remains unaffected by phosphoramidon and captopril, the specific inhibitors of endopeptidase 3.4.24.11 and angiotensin-converting enzyme, respectively. Altogether, these physicochemical, biochemical, and immunological properties unambiguously identify endopeptidase 3.4.24.16 as the protein encoded by the isolated cDNA clone.

  14. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    PubMed

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

  15. Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

    PubMed

    Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

    1990-06-01

    Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

  16. Diagnostic method employing MSH2 nucleic acids

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1997-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  17. Diagnostic method employing MSH2 nucleic acids

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-12-02

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +}(RER{sup +}) tumor cells. 19 figs.

  18. Diagnostic method employing MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1998-11-17

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  19. Mutator gene and hereditary non-polyposis colorectal cancer

    DOEpatents

    de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD

    2008-02-05

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  20. Shark complement: an assessment.

    PubMed

    Smith, S L

    1998-12-01

    The classical (CCP) and alternative (ACP) pathways of complement activation have been established for the nurse shark (Ginglymostoma cirratum). The isolation of a cDNA clone encoding a mannan-binding protein-associated serine protease (MASP)-1-like protein from the Japanese dogfish (Triakis scyllia) suggests the presence of a lectin pathway. The CCP consists of six functionally distinct components: C1n, C2n, C3n, C4n, C8n and C9n, and is activated by immune complexes in the presence of Ca++ and Mg++ ions. The ACP is antibody independent, requiring Mg++ ions and a heat-labile 90 kDa factor B-like protein for activity. Proteins considered homologues of C1q, C3 and C4 (C2n) of the mammalian complement system have been isolated from nurse shark serum. Shark C1q is composed of at least two chain types each showing 50% identity to human C1q chains A and B. Partial sequence of the globular domain of one of the chains shows it to be C1q-like rather than like mannan-binding protein. N-terminal amino acid sequences of the alpha and beta chain of shark C3 and C4 molecules show significant identity with corresponding human C3 and C4 chains. A sequence representing shark C4 gamma chain, shows little similarity to human C4 gamma chain. The terminal shark components C8n and C9n are functional analogues of mammalian C8 and C9. Anaphylatoxin activity has been demonstrated in activated shark serum, and porcine C5a desArg induces shark leucocyte chemotaxis. The deduced amino acid sequence of a partial C3 cDNA clone from the nurse shark shows 50%, 30% and 24% homology with the corresponding region of mammalian C3, C4 and alpha 2-macroglobulin. Deduced amino acid sequence data from partial Bf/C2 cDNA clones, two from the nurse shark and one from the Japanese dogfish, suggest that at least one species of elasmobranch has two distinct Bf/C2 genes.

  1. Molecular cloning, expression, functional characterization, chromosomal localization, and gene structure of junctate, a novel integral calcium binding protein of sarco(endo)plasmic reticulum membrane.

    PubMed

    Treves, S; Feriotto, G; Moccagatta, L; Gambari, R; Zorzato, F

    2000-12-15

    Screening a cDNA library from human skeletal muscle and cardiac muscle with a cDNA probe derived from junctin led to the isolation of two groups of cDNA clones. The first group displayed a deduced amino acid sequence that is 84% identical to that of dog heart junctin, whereas the second group had a single open reading frame that encoded a polypeptide with a predicted mass of 33 kDa, whose first 78 NH(2)-terminal residues are identical to junctin whereas its COOH terminus domain is identical to aspartyl beta-hydroxylase, a member of the alpha-ketoglutarate-dependent dioxygenase family. We named the latter amino acid sequence junctate. Northern blot analysis indicates that junctate is expressed in a variety of human tissues including heart, pancreas, brain, lung, liver, kidney, and skeletal muscle. Fluorescence in situ hybridization analysis revealed that the genetic loci of junctin and junctate map to the same cytogenetic band on human chromosome 8. Analysis of intron/exon boundaries of the genomic BAC clones demonstrate that junctin, junctate, and aspartyl beta-hydroxylase result from alternative splicing of the same gene. The predicted lumenal portion of junctate is enriched in negatively charged residues and is able to bind calcium. Scatchard analysis of equilibrium (45)Ca(2+) binding in the presence of a physiological concentration of KCl demonstrate that junctate binds 21.0 mol of Ca(2+)/mol protein with a k(D) of 217 +/- 20 microm (n = 5). Tagging recombinant junctate with green fluorescent protein and expressing the chimeric polypeptide in COS-7-transfected cells indicates that junctate is located in endoplasmic reticulum membranes and that its presence increases the peak amplitude and transient calcium released by activation of surface membrane receptors coupled to InsP(3) receptor activation. Our study shows that alternative splicing of the same gene generates the following functionally distinct proteins: an enzyme (aspartyl beta-hydroxylase), a structural protein of SR (junctin), and a membrane-bound calcium binding protein (junctate).

  2. Unit-length line-1 transcripts in human teratocarcinoma cells.

    PubMed Central

    Skowronski, J; Fanning, T G; Singer, M F

    1988-01-01

    We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389

  3. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  4. Formation of functional asialoglycoprotein receptor after transfection with cDNAs encoding the receptor proteins.

    PubMed Central

    McPhaul, M; Berg, P

    1986-01-01

    The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162

  5. Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

    PubMed

    Yi, S Y; Yu, S H; Choi, D

    1999-06-30

    Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

  6. alpha-Mannosidosis in the guinea pig: cloning of the lysosomal alpha-mannosidase cDNA and identification of a missense mutation causing alpha-mannosidosis.

    PubMed

    Berg, Thomas; Hopwood, John J

    2002-03-16

    alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.

  7. cDNA cloning of an intracellular form of the human interleukin 1 receptor antagonist associated with epithelium.

    PubMed Central

    Haskill, S; Martin, G; Van Le, L; Morris, J; Peace, A; Bigler, C F; Jaffe, G J; Hammerberg, C; Sporn, S A; Fong, S

    1991-01-01

    A cDNA encoding a receptor antagonist of interleukin 1 (IL-1ra), secreted from human monocytes, has recently been isolated and sequenced [Eisenberg, S. P., Evans, R. J., Arend, W. P., Verderber, E., Brewer, M. T., Hannum, C. H. & Thompson, R. C. (1990) Nature (London) 343, 341-346]. We have identified another version of this IL-1ra, which is predominantly expressed in epithelial cells. This IL-1ra lacks a leader sequence and, thus, is probably intracellular. Both proteins are derived from the same gene through use of an alternative transcriptional start site and internal splice-acceptor site. Expression of intracellular IL-1ra cDNA in COS cells demonstrated that the intracellular product specifically inhibited exogenous interleukin 1-dependent responses. Keratinocytes were shown to contain significant amounts of nonsecreted IL-1ra protein. Constitutive expression of the intracellular IL-1ra may be an intracellular defensive mechanism in exposed epithelial cells and/or may serve to regulate autocrine interleukin 1-mediated pathways of differentiation. Images PMID:1827201

  8. Cloning of human cDNA encoding a novel heptahelix receptor expressed in Burkitt's lymphoma and widely distributed in brain and peripheral tissues.

    PubMed

    Owman, C; Blay, P; Nilsson, C; Lolait, S J

    1996-11-12

    Using PCR with degenerate primers and screening of a human B-cell lymphoblast cDNA library, a full-length cDNA encoding a 375-amino-acid protein was isolated. It contains seven regions of hydrophobic amino acids probably representing membrane-spanning domains of a novel heptahelix receptor, tentatively named CMKRL2. It shows nearly 30% overall identity with the high-affinity IL8 receptor and similar degree of homology with other chemoattractant receptors, including the "fusin" coreceptors for HIV1. Measurements of various transduction pathways following application of a panel of chemokines to transfected cells failed to evoke any reproducible response. Although the natural ligand for CMKRL2 could, thus, not be identified, receptor expression in spleen and lymph nodes as well as in Burkitt's lymphoma (irrespective of EBV status) supports a functional role in activated B-cells. Receptor message was ubiquitously distributed in normal peripheral tissues and CNS, suggesting that CMKRL2 is expressed in widespread cell populations, such as macrophages and neuroglia.

  9. Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

    PubMed

    Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

    2015-06-01

    The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

  10. Isolation and molecular cloning of a fast-growing strain of human hepatitis A virus from its double-stranded replicative form.

    PubMed Central

    Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M

    1985-01-01

    A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478

  11. Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

    PubMed

    Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

    2009-01-01

    Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

  12. Cloning and expression of cDNA coding for bouganin.

    PubMed

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  13. Molecular cloning of a murine homologue of membrane cofactor protein (CD46): preferential expression in testicular germ cells.

    PubMed Central

    Tsujimura, A; Shida, K; Kitamura, M; Nomura, M; Takeda, J; Tanaka, H; Matsumoto, M; Matsumiya, K; Okuyama, A; Nishimune, Y; Okabe, M; Seya, T

    1998-01-01

    Human membrane cofactor protein (MCP, CD46) has been suggested, although no convincing evidence has been proposed, to be a fertilization-associated protein, in addition to its primary functions as a complement regulator and a measles virus receptor. We have cloned a cDNA encoding the murine homologue of MCP. This cDNA showed 45% identity in deduced protein sequence and 62% identity in nucleotide sequence with human MCP. Its ectodomains were four short consensus repeats and a serine/threonine-rich domain, and it appeared to be a type 1 membrane protein with a 23-amino acid transmembrane domain and a short cytoplasmic tail. The protein expressed on Chinese hamster ovary cell transfectants was 47 kDa on SDS/PAGE immunoblotting, approximately 6 kDa larger than the murine testis MCP. It served as a cofactor for factor I-mediated inactivation of the complement protein C3b in a homologous system and, to a lesser extent, in a human system. Strikingly, the major message of murine MCP was 1.5 kb and was expressed predominantly in the testis. It was not detected in mice defective in spermatogenesis or with immature germ cells (until 23 days old). Thus, murine MCP may be a sperm-dominant protein the message of which is expressed selectively in spermatids during germ-cell differentiation. PMID:9461505

  14. Characterization of cis-Acting RNA Elements of Zika Virus by Using a Self-Splicing Ribozyme-Dependent Infectious Clone.

    PubMed

    Liu, Zhong-Yu; Yu, Jiu-Yang; Huang, Xing-Yao; Fan, Hang; Li, Xiao-Feng; Deng, Yong-Qiang; Ji, Xue; Cheng, Meng-Li; Ye, Qing; Zhao, Hui; Han, Jian-Feng; An, Xiao-Ping; Jiang, Tao; Zhang, Bo; Tong, Yi-Gang; Qin, Cheng-Feng

    2017-11-01

    Zika virus (ZIKV) has caused significant outbreaks and epidemics in the Americas recently, raising global concern due to its ability to cause microcephaly and other neurological complications. A stable and efficient infectious clone of ZIKV is urgently needed. However, the instability and toxicity of flavivirus cDNA clones in Escherichia coli hosts has hindered the development of ZIKV infectious clones. Here, using a novel self-splicing ribozyme-based strategy, we generated a stable infectious cDNA clone of a contemporary ZIKV strain imported from Venezuela to China in 2016. The constructed clone contained a modified version of the group II self-splicing intron P.li.LSUI2 near the junction between the E and NS1 genes, which were removed from the RNA transcripts by an easy-to-establish in vitro splicing reaction. Transfection of the spliced RNAs into BHK-21 cells led to the production of infectious progeny virus that resembled the parental virus. Finally, potential cis -acting RNA elements in ZIKV genomic RNA were identified based on this novel reverse genetics system, and the critical role of 5'-SLA promoter and 5'-3' cyclization sequences were characterized by a combination of different assays. Our results provide another stable and reliable reverse genetics system for ZIKV that will help study ZIKV infection and pathogenesis, and the novel self-splicing intron-based strategy could be further expanded for the construction of infectious clones from other emerging and reemerging flaviviruses. IMPORTANCE The ongoing Zika virus (ZIKV) outbreaks have drawn global concern due to the unexpected causal link to fetus microcephaly and other severe neurological complications. The infectious cDNA clones of ZIKV are critical for the research community to study the virus, understand the disease, and inform vaccine design and antiviral screening. A panel of existing technologies have been utilized to develop ZIKV infectious clones. Here, we successfully generated a stable infectious clone of a 2016 ZIKV strain using a novel self-splicing ribozyme-based technology that abolished the potential toxicity of ZIKV cDNA clones to the E. coli host. Moreover, two crucial cis -acting replication elements (5'-SLA and 5'-CS) of ZIKV were first identified using this novel reverse genetics system. This novel self-splicing ribozyme-based reverse genetics platform will be widely utilized in future ZIKV studies and provide insight for the development of infectious clones of other emerging viruses. Copyright © 2017 American Society for Microbiology.

  15. Characterization of cis-Acting RNA Elements of Zika Virus by Using a Self-Splicing Ribozyme-Dependent Infectious Clone

    PubMed Central

    Liu, Zhong-Yu; Yu, Jiu-Yang; Huang, Xing-Yao; Fan, Hang; Li, Xiao-Feng; Deng, Yong-Qiang; Ji, Xue; Cheng, Meng-Li; Ye, Qing; Zhao, Hui; Han, Jian-Feng; An, Xiao-Ping; Jiang, Tao; Zhang, Bo; Tong, Yi-Gang

    2017-01-01

    ABSTRACT Zika virus (ZIKV) has caused significant outbreaks and epidemics in the Americas recently, raising global concern due to its ability to cause microcephaly and other neurological complications. A stable and efficient infectious clone of ZIKV is urgently needed. However, the instability and toxicity of flavivirus cDNA clones in Escherichia coli hosts has hindered the development of ZIKV infectious clones. Here, using a novel self-splicing ribozyme-based strategy, we generated a stable infectious cDNA clone of a contemporary ZIKV strain imported from Venezuela to China in 2016. The constructed clone contained a modified version of the group II self-splicing intron P.li.LSUI2 near the junction between the E and NS1 genes, which were removed from the RNA transcripts by an easy-to-establish in vitro splicing reaction. Transfection of the spliced RNAs into BHK-21 cells led to the production of infectious progeny virus that resembled the parental virus. Finally, potential cis-acting RNA elements in ZIKV genomic RNA were identified based on this novel reverse genetics system, and the critical role of 5′-SLA promoter and 5′-3′ cyclization sequences were characterized by a combination of different assays. Our results provide another stable and reliable reverse genetics system for ZIKV that will help study ZIKV infection and pathogenesis, and the novel self-splicing intron-based strategy could be further expanded for the construction of infectious clones from other emerging and reemerging flaviviruses. IMPORTANCE The ongoing Zika virus (ZIKV) outbreaks have drawn global concern due to the unexpected causal link to fetus microcephaly and other severe neurological complications. The infectious cDNA clones of ZIKV are critical for the research community to study the virus, understand the disease, and inform vaccine design and antiviral screening. A panel of existing technologies have been utilized to develop ZIKV infectious clones. Here, we successfully generated a stable infectious clone of a 2016 ZIKV strain using a novel self-splicing ribozyme-based technology that abolished the potential toxicity of ZIKV cDNA clones to the E. coli host. Moreover, two crucial cis-acting replication elements (5′-SLA and 5′-CS) of ZIKV were first identified using this novel reverse genetics system. This novel self-splicing ribozyme-based reverse genetics platform will be widely utilized in future ZIKV studies and provide insight for the development of infectious clones of other emerging viruses. PMID:28814522

  16. Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

    PubMed Central

    Matthews, R J; Cahir, E D; Thomas, M L

    1990-01-01

    Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

  17. [Cloning and expressing of cyclophilin B gene from Schistosoma japonnicum and the analysis of immunoprotective effect].

    PubMed

    Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao

    2010-03-01

    The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.

  18. Molecular cloning, structural analysis, and expression of a human IRLB, MYC promoter-binding protein: new DENN domain-containing protein family emerges.

    PubMed

    Semova, Natalia; Kapanadze, Bagrat; Corcoran, Martin; Kutsenko, Alexei; Baranova, Ancha; Semov, Alexandre

    2003-09-01

    IRLB was originally identified as a partial cDNA clone, encoding a 191-aa protein binding the interferon-stimulated response element (ISRE) in the P2 promoter of human MYC. Here, we cloned the full-size IRLB using different bioinformatics tools and an RT-PCR approach. The full-size gene encompasses 131 kb within chromosome 15q22 and consists of 32 exons. IRLB is transcribed as a 6.6-kb mRNA encoding a protein of 1865 aa. IRLB is ubiquitously expressed and its expression is regulated in a growth- and cell cycle-dependent manner. In addition to the ISRE-binding domain IRLB contains a tripartite DENN domain, a nuclear localization signal, two PPRs, and a calmodulin-binding domain. The presence of DENN domains predicts possible interactions of IRLB with GTPases from the Rab family or regulation of growth-induced MAPKs. Strongly homologous proteins were identified in all available vertebrate genomes as well as in Caenorhabditis elegans and Drosophila melanogaster. In human and mouse a family of IRLB proteins exists, consisting of at least three members.

  19. Production of Human Albumin in Pigs Through CRISPR/Cas9-Mediated Knockin of Human cDNA into Swine Albumin Locus in the Zygotes.

    PubMed

    Peng, Jin; Wang, Yong; Jiang, Junyi; Zhou, Xiaoyang; Song, Lei; Wang, Lulu; Ding, Chen; Qin, Jun; Liu, Liping; Wang, Weihua; Liu, Jianqiao; Huang, Xingxu; Wei, Hong; Zhang, Pumin

    2015-11-12

    Precise genome modification in large domesticated animals is desirable under many circumstances. In the past it is only possible through lengthy and burdensome cloning procedures. Here we attempted to achieve that goal through the use of the newest genome-modifying tool CRISPR/Cas9. We set out to knockin human albumin cDNA into pig Alb locus for the production of recombinant human serum albumin (rHSA). HSA is a widely used human blood product and is in high demand. We show that homologous recombination can occur highly efficiently in swine zygotes. All 16 piglets born from the manipulated zygotes carry the expected knockin allele and we demonstrated the presence of human albumin in the blood of these piglets. Furthermore, the knockin allele was successfully transmitted through germline. This success in precision genomic engineering is expected to spur exploration of pigs and other large domesticated animals to be used as bioreactors for the production of biomedical products or creation of livestock strains with more desirable traits.

  20. cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

    PubMed

    Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

    2003-12-19

    SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

  1. Cloning and expression studies of the Dunaliella salina UDP-glucose dehydrogenase cDNA.

    PubMed

    Qinghua, He; Dairong, Qiao; Qinglian, Zhang; Shunji, He; Yin, Li; Linhan, Bai; Zhirong, Yang; Yi, Cao

    2005-06-01

    The enzyme UDP-glucose dehydrogenase (EC 1.1.1.22) converts UDP-glucose to UDP-glucuronate. Plant UDP-glucose dehydrogenase (UGDH) is an important enzyme in the formation of hemicellulose and pectin, the components of primary cell walls. A cDNA, named DsUGDH, (GeneBank accession number: AY795899) corresponding to UGDH was cloned by RT-PCR approach from Dunaliella salina. The cDNA is 1941-bp long and has an open reading frame encoded a protein of 483 amino acids with a calculated molecular weight of 53 kDa. The derived amino acids sequence shows high homology with reported plants UGDHs, and has highly conserved amino acids motifs believed to be NAD binding site and catalytic site. Although UDP-glucose dehydrogenase is a comparatively well characterized enzyme, the cloning and characterization of the green alga Dunaliella salina UDP-glucose dehydrogenase gene is very important to understand the salt tolerance mechanism of Dunaliella salina. Northern analyses indicate that NaCl can induce the expression the DsUGDH.

  2. Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.

    PubMed

    Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R

    2007-02-01

    To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.

  3. Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

    PubMed

    Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

    2004-05-01

    Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

  4. Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

    PubMed

    Stevens, Mark; Viganó, Felicita

    2007-04-01

    The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

  5. cDNA cloning and analysis of betaine aldehyde dehydrogenase, a salt inducible enzyme in sugar beet

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCue, K.F.; Hanson, A.D.

    1990-05-01

    Betaine accumulates and serves as a compatible osmolyte in some plants subjected to drought or salinity stress. The last enzyme in the betaine biosynthetic pathway is betaine aldehyde dehydrogenase (BADH). The activity of BADH increases in response to increasing salinity levels. This increase in activity corresponds to an increase in protein detectable by immunoblotting, and to an increase in the translatable BADH mRNA. BADH was cloned from a cDNA library constructed in {lambda}gt10 using poly(A){sup +} RNA from sugar beets salinized to 500 mM NaCl. cDNAs were size selected (>1kb) before ligation into the vector, and the library was screenedmore » with a spinach BADH cDNA probe. Three nearly full length clones obtained were confirmed as BADH by their nucleotide and deduced amino acid homology to spinach BADH. Clones averaged 1.8 kb and contained open reading frames of 500 amino acids at 80% identity with spinach BADH. RNA gel blot analysis of poly(A){sup +} RNA indicated that salinization to 500 mM NaCl resulted in a 5-fold increase of BADH mRNA level.« less

  6. Construction and characterization of a full-length infectious cDNA clone of foot-and-mouth disease virus strain O/JPN/2010 isolated in Japan in 2010.

    PubMed

    Nishi, Tatsuya; Onozato, Hiroyuki; Ohashi, Seiichi; Fukai, Katsuhiko; Yamada, Manabu; Morioka, Kazuki; Kanno, Toru

    2016-06-01

    A full-length infectious cDNA clone of the genome of a foot-and-mouth disease virus isolated from the 2010 epidemic in Japan was constructed and designated pSVL-f02. Transfection of Cos-7 or IBRS-2 cells with this clone allowed the recovery of infectious virus. The recovered virus had the same in vitro characterization as the parental virus with regard to antigenicity in neutralization and indirect immunofluorescence tests, plaque size and one-step growth. Pigs were experimentally infected with the parental virus or the recombinant virus recovered from pSVL-f02 transfected cells. There were no significant differences in clinical signs or antibody responses between the two groups, and virus isolation and viral RNA detection from clinical samples were similar. Virus recovered from transfected cells therefore retained the in vitro characteristics and the in vivo pathogenicity of their parental strain. This cDNA clone should be a valuable tool to analyze determinants of pathogenicity and mechanisms of virus replication, and to develop genetically engineered vaccines against foot-and-mouth disease virus. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. In Vitro Synthesized RNA Generated from cDNA Clones of Both Genomic Components of Cucurbit yellow stunting disorder virus Replicates in Cucumber Protoplasts

    PubMed Central

    Owen, Carolyn A.; Moukarzel, Romy; Huang, Xiao; Kassem, Mona A.; Eliasco, Eleonora; Aranda, Miguel A.; Coutts, Robert H. A.; Livieratos, Ioannis C.

    2016-01-01

    Cucurbit yellow stunting disorder virus (CYSDV), a bipartite whitefly-transmitted virus, constitutes a major threat to commercial cucurbit production worldwide. Here, construction of full-length CYSDV RNA1 and RNA2 cDNA clones allowed the in vitro synthesis of RNA transcripts able to replicate in cucumber protoplasts. CYSDV RNA1 proved competent for replication; transcription of both polarities of the genomic RNA was detectable 24 h post inoculation. Hybridization of total RNA extracted from transfected protoplasts or from naturally CYSDV-infected cucurbits revealed high-level transcription of the p22 subgenomic RNA species. Replication of CYSDV RNA2 following co-transfection with RNA1 was also observed, with similar transcription kinetics. A CYSDV RNA2 cDNA clone (T3CM8Δ) comprising the 5′- and 3′-UTRs plus the 3′-terminal gene, generated a 2.8 kb RNA able to replicate to high levels in protoplasts in the presence of CYSDV RNA1. The clone T3CM8Δ will facilitate reverse genetics studies of CYSDV gene function and RNA replication determinants. PMID:27314380

  8. Epithelin/Granulin Precursor Expression in Human Breast Carcinoma

    DTIC Science & Technology

    1998-09-01

    antisense RNA as an inhibitor of oncogenic protein production (13). The development of stable transfected clones with antisense cDNA is advantageous...in that it allows a continuous supply of antisense RNA to disrupt protein synthesis, and it is well suited for in vivo tumorigenic assays. Our...processed form epithelin 1 in normal mammary epithelial cells and mammary carcinoma cells. 3- Effect of inhibition of PCDGF expression ( antisense

  9. Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

    PubMed Central

    Suard, Y M; Tosi, M; Kraehenbuhl, J P

    1982-01-01

    Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

  10. Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.

    PubMed

    Yang, W J; Rao, K R

    2001-11-30

    Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.

  11. Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.

    PubMed

    Bujaki, Erika

    2016-01-01

    The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.

  12. Efficacy of vaccination with plasmid DNA encoding for HER2/neu or HER2/neu-eGFP fusion protein against prostate cancer in rats.

    PubMed

    Bhattachary, R; Bukkapatnam, R; Prawoko, I; Soto, J; Morgan, M; Salup, R R

    2002-05-01

    Despite early diagnosis and improved therapy, 31,500 men will die from prostate cancer (PC) this year. The HER2/neu oncoprotein is an important effector of cell growth found in the majority of high-grade prostatic tumors and is capable of rendering immunogenicity. The antigenicity of this oncoprotein might prove useful in the development of PC vaccines. Our goal is to prove the principle that a single DNA vaccine can provide reliable immunity against PC in the MatLyLu (MLL) translational tumor model. The parental rat MatLyLu PC cell line expresses low to moderate levels of the rat neu protein. To simulate in vivo human PC, MatLyLu cells were transfected with a truncated sequence of human HER2/neu cDNA cloned into the pCI-neo vector. This HER2/neu cDNA sequence encodes the first 433 amino acids of the extracellular domain (ECD). MatLyLu cells were also transfected with the same HER2/neu cDNA sequence cloned into the N1-terminal sequence of EGFP reporter gene to produce a fusion protein. The partial ECD sequence of HER2/neu includes five rat major histocompatibility (MHC)-II-restricted peptides with complete human-to-rat cross-species homology. The HER2/neu protein overexpression was documented by Western Blot analysis, and the expression of fusion protein was monitored by confocal microscopy and fluorimetry. Vaccination with a single injection of HER2/neu cDNA protected 50% of animals against HER2/neu-MatLyLu tumors (P < 0.01). When the tumor cells were engineered to express HER2/neu-EGFP fusion protein, the antitumor immunity was enhanced, as following vaccination with HER2/neu-EGFP cDNA, 80% of these rats rejected HER2/neu-EGFP-MatLyLu (P<0.001). Both vaccines induced HER2/neu-specific antibody titers. Rats vaccinated with EGFP-cDNA rejected 80% of EGFP-MatLyLu tumors and, interestingly, 40% of HER2/neu-MatLyLu tumors. None of the cDNA vaccines induced immunity against parental MatLyLu cells. Our data clearly demonstrate that a single injection of HER2/neu-EGFP cDNA is a very effective vaccine against PC tumors expressing the cognate tumor-associated antigen (TA). The antitumor immunity is significantly more pronounced if the tumors express xenogeneic HER2/neu-EGFP fusion protein as opposed to only the syngeneic HER2/neu oncoprotein. Our data suggests that the HER2/neu-EGFP-MatLyLu tumor is a potential animal tumor model for investigating therapeutic vaccine strategies against PC in vivo and demonstrates the limitations of a cDNA vaccine only encoding for MHC-II-restricted HER2/neu-ECD sequence peptides.

  13. Gene expression in the pulp of ripening bananas. Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products and cDNA cloning of 25 different ripening-related mRNAs.

    PubMed Central

    Medina-Suárez, R; Manning, K; Fletcher, J; Aked, J; Bird, C R; Seymour, G B

    1997-01-01

    mRNA was extracted from the pulp and peel of preclimacteric (d 0) bananas (Musa AAA group, cv Grand Nain) and those exposed to ethylene gas for 24 h and stored in air alone for a further 1 (d 2) and 4 d (d 5). Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products from the pulp and peel of these fruits revealed significant up-regulation of numerous transcripts during ripening. The majority of the changes were initiated by d 2, with the level of these messages increasing during the remainder of the ripening period. Pulp tissue from d 2 was used for the construction of a cDNA library. This library was differentially screened for ripening-related clones using cDNA from d-0 and d-2 pulp by a novel microtiter plate method. In the primary screen 250 up- and down-regulated clones were isolated. Of these, 59 differentially expressed clones were obtained from the secondary screen. All of these cDNAs were partially sequenced and grouped into families after database searches. Twenty-five nonredundant groups of pulp clones were identified. These encoded enzymes were involved in ethylene biosynthesis, respiration, starch metabolism, cell wall degradation, and several other key metabolic events. We describe the analysis of these clones and their possible involvement in ripening. PMID:9342865

  14. Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

    PubMed

    Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

    2013-02-01

    In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.

    PubMed

    Kröger, M; Tschesche, H

    1997-09-01

    The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.

  16. Cloning and expression profile of FLT3 gene during progenitor cell-dependent liver regeneration.

    PubMed

    Aydin, Iraz T; Tokcaer, Zeynep; Dalgic, Aydin; Konu, Ozlen; Akcali, Kamil C

    2007-12-01

    The liver has a unique capacity to regenerate upon exposure to viral infections, toxic reactions and cancer formation. Liver regeneration is a complex phenomenon in which several factors participate during its onset. Cellular proliferation is an important component of this process and the factors that regulate this proliferation have a vital role. FLT3, a well-known hematopoietic stem cell and hepatic lineage surface marker, is involved in proliferative events of hematopoietic stem cells. However, its contribution to liver regeneration is not known. Therefore, the aim of this study was to clone and examine the role of FLT3 during liver regeneration in rats. Partial cDNA of rat homolog of FLT3 gene was cloned from thymus and the tissue specific expression of this gene at mRNA and protein levels was examined by RT-PCR and Western blot. After treating with 2-AAF and performing hepatectomy in rats to induce progenitor-dependent liver regeneration, the mRNA and protein expression profile of FLT3 was investigated by real-time PCR and Western blot during liver regeneration. In addition, cellular localization of FLT3 protein was determined by immunohistochemistry. The results indicated that rat FLT3 cDNA has high homology with mouse and human FLT3 cDNA. It was also found that FLT3 is expressed in most of the rat tissues and during liver regeneration. In addition, its intracellular localization is altered during the late stages of liver regeneration. The FLT3 receptor is activated at the late stages of liver regeneration and participates in the proliferation response that is observed during progenitor-dependent liver regeneration.

  17. Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

    PubMed Central

    Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

    2011-01-01

    To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

  18. Complementary deoxyribonucleic acid cloning of spermatogonial stem cell renewal factor.

    PubMed

    Miura, Takeshi; Ohta, Takashi; Miura, Chiemi I; Yamauchi, Kohei

    2003-12-01

    Spermatogonial mitosis can be subdivided into two processes: spermatogonial stem cell renewal and spermatogonial proliferation toward meiosis. Recently it has been indicated that estrogen, estradiol-17beta, is involved in regulating the renewal of spermatogonial stem cells in eel. To determine the genes that directly regulate this process, we used expression screening to identify genes whose expression is regulated by estradiol-17beta in testes. We detected a previously unidentified cDNA clone that is up-regulated by estradiol-17beta stimulation and named it eel spermatogenesis-related substances 34 (eSRS34) cDNA. Homology searching showed that eSRS34 shares amino acid sequence similarity with human platelet-derived endothelial cell growth factor. We examined the function of eSRS34 using several in vitro systems. Recombinant eSRS34 produced by a baculovirus system induced spermatogonial mitosis in testicular organ culture. Furthermore, the addition of an antibody specific for eSRS34 prevented spermatogonial mitosis induced by estradiol-17beta stimulation in a germ cell/somatic cell coculture system. We therefore conclude that eSRS34 is a "spermatogonial stem cell renewal factor."

  19. Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.

    PubMed Central

    Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M

    1996-01-01

    The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645

  20. Identification of a GTP-binding protein. cap alpha. subunit that lacks an apparent ADP-ribosylation site for pertussis toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fong, H.K.W.; Yoshimoto, K.K.; Eversole-Cire, P.

    1988-05-01

    Recent molecular cloning of cDNA for the ..cap alpha.. subunit of bovine transducin (a guanine nucleotide-binding regulatory protein, or G protein) has revealed the presence of two retinal-specific transducins, called T/sub r/ and T/sub c/, which are expressed in rod or cone photoreceptor cells. In a further study of G-protein diversity and signal transduction in the retina, the authors have identified a G-protein ..cap alpha.. subunit, which they refer to as G/sub z/..cap alpha.., by isolating a human retinal cDNA clone that cross-hybridizes at reduced stringency with bovine T/sub r/ ..cap alpha..-subunit cDNA. The deduced amino acid sequence of G/submore » z/..cap alpha.. is 41-67% identical with those of other known G-protein ..cap alpha.. subunits. However, the 355-residue G/sub z/..cap alpha.. lacks a consensus site for ADP-ribosylation by pertussis toxin, and its amino acid sequence varies within a number of regions that are strongly conserved among all of the other G-protein ..cap alpha.. subunits. They suggest that G/sub z/..cap alpha.., which appears to be highly expressed in neural tissues, represents a member of a subfamily of G proteins that mediate signal transduction in pertussis toxin-insensitive systems.« less

  1. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-12-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

  2. Trichoderma virens β-glucosidase I (BGLI) gene; expression in Saccharomyces cerevisiae including docking and molecular dynamics studies.

    PubMed

    Wickramasinghe, Gammadde Hewa Ishan Maduka; Rathnayake, Pilimathalawe Panditharathna Attanayake Mudiyanselage Samith Indika; Chandrasekharan, Naduviladath Vishvanath; Weerasinghe, Mahindagoda Siril Samantha; Wijesundera, Ravindra Lakshman Chundananda; Wijesundera, Wijepurage Sandhya Sulochana

    2017-06-21

    Cellulose, a linear polymer of β 1-4, linked glucose, is the most abundant renewable fraction of plant biomass (lignocellulose). It is synergistically converted to glucose by endoglucanase (EG) cellobiohydrolase (CBH) and β-glucosidase (BGL) of the cellulase complex. BGL plays a major role in the conversion of randomly cleaved cellooligosaccharides into glucose. As it is well known, Saccharomyces cerevisiae can efficiently convert glucose into ethanol under anaerobic conditions. Therefore, S.cerevisiae was genetically modified with the objective of heterologous extracellular expression of the BGLI gene of Trichoderma virens making it capable of utilizing cellobiose to produce ethanol. The cDNA and a genomic sequence of the BGLI gene of Trichoderma virens was cloned in the yeast expression vector pGAPZα and separately transformed to Saccharomyces cerevisiae. The size of the BGLI cDNA clone was 1363 bp and the genomic DNA clone contained an additional 76 bp single intron following the first exon. The gene was 90% similar to the DNA sequence and 99% similar to the deduced amino acid sequence of 1,4-β-D-glucosidase of T. atroviride (AC237343.1). The BGLI activity expressed by the recombinant genomic clone was 3.4 times greater (1.7 x 10 -3  IU ml -1 ) than that observed for the cDNA clone (5 x 10 -4  IU ml -1 ). Furthermore, the activity was similar to the activity of locally isolated Trichoderma virens (1.5 x 10 -3  IU ml -1 ). The estimated size of the protein was 52 kDA. In fermentation studies, the maximum ethanol production by the genomic and the cDNA clones were 0.36 g and 0.06 g /g of cellobiose respectively. Molecular docking results indicated that the bare protein and cellobiose-protein complex behave in a similar manner with considerable stability in aqueous medium. The deduced binding site and the binding affinity of the constructed homology model appeared to be reasonable. Moreover, it was identified that the five hydrogen bonds formed between the amino acid residues of BGLI and cellobiose are mainly involved in the integrity of enzyme-substrate association. The BGLI activity was remarkably higher in the genomic DNA clone compared to the cDNA clone. Cellobiose was successfully fermented into ethanol by the recombinant S.cerevisiae genomic DNA clone. It has the potential to be used in the industrial production of ethanol as it is capable of simultaneous saccharification and fermentation of cellobiose. Homology modeling, docking studies and molecular dynamics simulation studies will provide a realistic model for further studies in the modification of active site residues which could be followed by mutation studies to improve the catalytic action of BGLI.

  3. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    NASA Astrophysics Data System (ADS)

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective animal model of human disease.

  4. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  5. Human HST1 (HSTF1) gene maps to chromosome band 11q13 and coamplifies with the INT2 gene in human cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi

    1988-07-01

    The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less

  6. Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

    PubMed

    Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

    2013-05-01

    One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

    PubMed

    Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

    1997-01-01

    Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

  8. Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

    PubMed Central

    Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

    1995-01-01

    Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

  9. Seabream ghrelin: cDNA cloning, genomic organization and promoter studies.

    PubMed

    Yeung, Chung-Man; Chan, Chi-Bun; Woo, Norman Y S; Cheng, Christopher H K

    2006-05-01

    Recent studies have indicated that ghrelin stimulates growth hormone release from the pituitary via the growth hormone secretagogue receptor (GHSR). We have previously isolated two GHSR subtypes from the pituitary of the black seabream Acanthopagrus schlegeli. In the present study, we have cloned and characterized ghrelin from the same fish species at both the cDNA and gene levels. The full-length seabream ghrelin cDNA, isolated from sea-bream stomach using a novel approach by exploiting a single conserved region in the coding region, was found to encode a prepropeptide of 107 amino acids, with the predicted mature ghrelin peptide consisting of 20 amino acids (GSSFLSPSQKPQNRGKSSRV). Embedded in this full-length cDNA is a putative fish orthologue of the recently reported mammalian obestatin peptide. The ghrelin gene in black seabream, obtained by genomic PCR, was found to encompass four exons and three introns, possessing the same structural organization as in tilapia and goldfish, but different from that in rainbow trout. In addition, a 2230-bp 5'-flanking region of the seabream ghrelin gene was obtained by genome walking. Sequence analysis revealed that, as in the case of the human ghrelin gene, there is neither a GC box nor a CAAT box present in the isolated 5'-flanking region. However, a number of putative transcription factor-binding sites different from the human counterpart were found in the 5'-flanking region of the seabream ghrelin gene, suggesting that different cis- and trans-acting elements are involved in controlling their gene expression. Functional activity of this 5'-flanking region was examined by cloning it into the pGL3-Basic vector upstream of the luciferase reporter gene and transfected into various cell lines. Positive promoter activity could only be recorded in the colon-derived Caco-2 cells, suggesting that the cloned 5'-flanking region represents the functional promoter of the seabream ghrelin gene, which exhibits tissue-specific promoter activity. Using reverse transcriptase PCR analysis, expression of ghrelin was detected only in the seabream stomach, but not in the other tissues examined, including the brain, gill, intestine, kidney, liver and spleen. This stomach-specific expression of ghrelin in seabream is subject to regulation, as administration of growth hormone or ipamorelin to the fish in vivo was demonstrated to enhance its expression. Reminiscent of the homologous upregulation found in the transcriptional control of the seabream GHSR gene, a similar homologous regulatory mechanism might also exist in controlling the expression of seabream ghrelin. The identification of both GHSR and ghrelin from a single fish species would facilitate our subsequent studies on the elucidation of the physiological functions of the ghrelin/GHSR system in teleost. The possible existence of obestatin in teleost opens up new research avenues on the somatotropic axis in fish.

  10. Cloning, Characterization, Regulation, and Function of Dormancy-Associated MADS-Box Genes from Leafy Spurge

    USDA-ARS?s Scientific Manuscript database

    DORMANCY-ASSOCIATED MADS-BOX (DAM) genes are SHORT VEGETATIVE PHASE–Like MADS box transcription factors linked to endodormancy induction. We have cloned and characterized several cDNA and genomic clones of DAM genes from the model perennial weed leafy spurge (Euphorbia esula). We present evidence fo...

  11. Automated sample-preparation technologies in genome sequencing projects.

    PubMed

    Hilbert, H; Lauber, J; Lubenow, H; Düsterhöft, A

    2000-01-01

    A robotic workstation system (BioRobot 96OO, QIAGEN) and a 96-well UV spectrophotometer (Spectramax 250, Molecular Devices) were integrated in to the process of high-throughput automated sequencing of double-stranded plasmid DNA templates. An automated 96-well miniprep kit protocol (QIAprep Turbo, QIAGEN) provided high-quality plasmid DNA from shotgun clones. The DNA prepared by this procedure was used to generate more than two mega bases of final sequence data for two genomic projects (Arabidopsis thaliana and Schizosaccharomyces pombe), three thousand expressed sequence tags (ESTs) plus half a mega base of human full-length cDNA clones, and approximately 53,000 single reads for a whole genome shotgun project (Pseudomonas putida).

  12. Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

    PubMed

    Wu, Zhencai; Burns, Jacqueline K

    2003-04-01

    The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

  13. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

    The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

  14. Expression and kinetic properties of a recombinant 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzyme of human liver.

    PubMed

    Deyashiki, Y; Tamada, Y; Miyabe, Y; Nakanishi, M; Matsuura, K; Hara, A

    1995-08-01

    Human liver cytosol contains multiple forms of 3 alpha-hydroxysteroid dehydrogenase and dihydrodiol dehydrogenase with hydroxysteroid dehydrogenase activity, and multiple cDNAs for the enzymes have been cloned from human liver cDNA libraries. To understand the relationship of the multiple enzyme froms to the genes, a cDNA, which has been reported to code for an isoenzyme of human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase, was expressed in Escherichia coli. The recombinant enzyme showed structural and functional properties almost identical to those of the isoenzyme purified from human liver. In addition, the recombinant isoenzyme efficiently reduced 5 alpha-dihydrotestosterone and 5 beta-dihydrocortisone, the known substrates of human liver 3 alpha-hydroxysteroid dehydrogenase and chlordecone reductase previously purified, which suggests that these human liver enzymes are identical. Furthermore, the steady-state kinetic data for NADP(+)-linked (S)-1-indanol oxidation by the recombinant isoenzyme were consistent with a sequential ordered mechanism in which NADP+ binds first. Phenolphthalein inhibited this isoenzyme much more potently than it did the other human liver dihydrodiol dehydrogenases, and was a competitive inhibitor (Ki = 20 nM) that bound to the enzyme-NADP+ complex.

  15. Molecular identification and functional expression of mu 3, a novel alternatively spliced variant of the human mu opiate receptor gene.

    PubMed

    Cadet, Patrick; Mantione, Kirk J; Stefano, George B

    2003-05-15

    Studies from our laboratory have revealed a novel mu opiate receptor, mu 3, which is expressed in both vascular tissues and leukocytes. The mu 3 receptor is selective for opiate alkaloids and is insensitive to opioid peptides. We now identify the mu 3 receptor at the molecular level using a 441-bp conserved region of the mu 1 receptor. Sequence analysis of the isolated cDNA suggests that it is a novel, alternatively spliced variant of the mu opiate receptor gene. To determine whether protein expressed from this cDNA exhibits the biochemical characteristics expected of the mu 3 receptor, the cDNA clone was expressed in a heterologous system. At the functional level, COS-1 cells transfected with the mu 3 receptor cDNA exhibited dose-dependent release of NO following treatment with morphine, but not opioid peptides (i.e., Met-enkephalin). Naloxone was able to block the effect of morphine on COS-1 transfected cells. Nontransfected COS-1 cells did not produce NO in the presence of morphine or the opioid peptides at similar concentrations. Receptor binding analysis with [(3)H]dihydromorphine further supports the opiate alkaloid selectivity and opioid peptide insensitivity of this receptor. These data suggest that this new mu opiate receptor cDNA encodes the mu 3 opiate receptor, since it exhibits biochemical characteristics known to be unique to this receptor (opiate alkaloid selective and opioid peptide insensitive). Furthermore, using Northern blot, RT-PCR, and sequence analysis, we have demonstrated the expression of this new mu variant in human vascular tissue, mononuclear cells, polymorphonuclear cells, and human neuroblastoma cells.

  16. Cross-referencing yeast genetics and mammalian genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hieter, P.; Basset, D.; Boguski, M.

    1994-09-01

    We have initiated a project that will systematically transfer information about yeast genes onto the genetic maps of mice and human beings. Rapidly expanding human EST data will serve as a source of candidate human homologs that will be repeatedly searched using yeast protein sequence queries. Search results will be automatically reported to participating labs. Human cDNA sequences from which the ESTs are derived will be mapped at high resolution in the human and mouse genomes. The comparative mapping information cross-references the genomic position of novel human cDNAs with functional information known about the cognate yeast genes. This should facilitatemore » the initial identification of genes responsible for mammalian mutant phenotypes, including human disease. In addition, the identification of mammalian homologs of yeast genes provides reagents for determining evolutionary conservation and for performing direct experiments in multicellular eukaryotes to enhance study of the yeast protein`s function. For example, ESTs homologous to CDC27 and CDC16 were identified, and the corresponding cDNA clones were obtained from ATTC, completely sequenced, and mapped on human and mouse chromosomes. In addition, the CDC17hs cDNA has been used to raise antisera to the CDC27Hs protein and used in subcellular localization experiments and junctional studies in mammalian cells. We have received funding from the National Center for Human Genome Research to provide a community resource which will establish comprehensive cross-referencing among yeast, human, and mouse loci. The project is set up as a service and information on how to communicate with this effort will be provided.« less

  17. Expression of a mutation causing hypertrophic cardiomyopathy disrupts sarcomere assembly in adult feline cardiac myocytes.

    PubMed

    Marian, A J; Yu, Q T; Mann, D L; Graham, F L; Roberts, R

    1995-07-01

    Mutations in the beta-myosin heavy chain (beta MyHC) induce hypertrophic cardiomyopathy (HCM), cardiac hypertrophy, and sarcomere disarray, with the latter being the characteristic hallmark. Thus, we sought to determine whether expression of mutant beta MyHC in adult feline cardiac myocytes, a species known to develop HCM with a phenotype identical to that in humans, induces sarcomere disarray. A full-length beta MyHC cDNA was cloned from a human heart cDNA library, and an HCM-causing mutation (Arg403Gln) was induced in the beta MyHC cDNA by site-directed mutagenesis using polymerase chain reaction (PCR). The normal and mutant beta MyHC cDNAs were cloned into p delta E1spIB shuttle vector, downstream from a cytomegalovirus (CMV) promoter. Replication-deficient recombinant adenoviral constructs (Ad5/CMV/beta MyHC-N and Ad5/CMV/beta MyHC-403) were generated through homologous recombination of p delta E1spIB/CMV/beta MyHC-N or Ad5/CMV/beta MyHC-403 and pBHG10 after cotransfection in 293 host cells. Infection of COS-1 cells with the beta MyHC construct resulted in the expression of a full-length myosin protein. Efficiency of infection of isolated adult cardiac myocytes was > 95%. Expression of the beta MyHC constructs into mRNA at 48 hours after infection of feline cardiac myocytes was confirmed by reverse transcription-PCR. The net total protein and beta-myosin synthesis were determined by using the amount of incorporation of [3H]phenylalanine into total protein and beta-myosin, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. GLUT-1-independent infection of the glioblastoma/astroglioma U87 cells by the human T cell leukemia virus type 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jin Qingwen; Agrawal, Lokesh; Walther Cancer Institute, Indianapolis, IN 46208

    2006-09-15

    The human glucose transporter protein 1 (GLUT-1) functions as a receptor for human T cell leukemia virus (HTLV). GLUT-1 is a twelve-transmembrane cell surface receptor with six extracellular (ECL) and seven intracellular domains. To analyze HTLV-1 cytotropism, we utilized polyclonal antibodies to a synthetic peptide corresponding to the large extracellular domain of GLUT-1. The antibodies caused significant blocking of envelope (Env)-mediated fusion and pseudotyped virus infection of HeLa cells but had no significant effect on infection of U87 cells. This differential effect correlated with the detection of high-level surface expression of GLUT-1 on HeLa cells and very weak staining ofmore » U87 cells. To investigate this in terms of viral cytotropism, we cloned GLUT-1 cDNA from U87 cells and isolated two different versions of cDNA clones: the wild-type sequence (encoding 492 residues) and a mutant cDNA with a 5-base pair deletion (GLUT-1{delta}5) between nucleotides 1329 and 1333. The deletion, also detected in genomic DNA, resulted in a frame-shift and premature termination producing a truncated protein of 463 residues. Transfection of the wild-type GLUT-1 but not GLUT-1{delta}5 cDNA into CHO cells resulted in efficient surface expression of the human GLUT-1. Co-expression of GLUT-1 with GLUT-1{delta}5 produces a trans-inhibition by GLUT-1{delta}5 of GLUT-1-mediated HTLV-1 envelope (Env)-mediated fusion. Co-immunoprecipitation experiments demonstrated physical interaction of the wild-type and mutant proteins. Northern blot and RT-PCR analyses demonstrated lower GLUT-1 RNA expression in U87 cells. We propose two mechanisms to account for the impaired cell surface expression of GLUT-1 on U87 cells: low GLUT-1 RNA expression and the formation of GLUT-1/GLUT-1{delta}5 heterodimers that are retained intracellularly. Significant RNAi-mediated reduction of endogenous GLUT-1 expression impaired HTLV-1 Env-mediated fusion with HeLa cells but not with U87 cells. We propose a GLUT-1-independent mechanism of HTLV-1 infection of U87 cells. The results may have important implications for HTLV-1 neurotropism and pathogenesis.« less

  19. Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

    PubMed Central

    Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

    1998-01-01

    The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

  20. Expression cloning and chromosomal mapping of the leukocyte activation antigen CD97, a new seven-span transmembrane molecule of the secretin receptor superfamily with an unusual extracellular domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamann, J.; Hamann, D.; Lier, R.A.W.

    1995-08-15

    CD97 is a monomeric glycoprotein of 75 to 85 kDa that is induced rapidly on the surface of most leukocytes upon activation. We herein report the isolation of a cDNA encoding human CD97 by expression cloning in COS cells. The 3-kb cDNA clone encodes a mature polypeptide chain of 722 amino acids with a predicted molecular mass of 79 kDa. Within the C-terminal part of the protein, a region with seven hydrophobic segments was identified, suggesting that CD97 is a seven-span transmembrane molecule. Sequence comparison indicates that CD97 is the first leukocyte Ag in a recently described superfamily that includesmore » the receptors for secretin, calcitonin, and other mammalian and insect peptide hormones. Different from these receptors, CD97 has an extended extracellular region of 433 amino acids that possesses three N-terminal epidermal growth factor-like domains, two of them with a calcium-binding site, and single Arg-Gly-Asp (RGD) motif. The existence of structural elements characteristic for extracellular matrix proteins in a seven-span transmembrane molecule makes CD97 a receptor potentially involved in both adhesion and signaling processes early after leukocyte activation. The gene encoding CD97 is localized on chromosome 19 (19p13.12-13.2).« less

  1. [Screening and identification of anoikis-resistant gene UBCH7 in esophageal cancer cells].

    PubMed

    Yang, Yang; Wang, Bo-Shi; Wang, Xiao-Min; Zhang, Yu; Wang, Ming-Rong; Jia, Xue-Mei

    2012-02-01

    Anoikis is a kind of programmed cell death induced by loss of extracellular matrix (ECM) adhesion, which is one of key factors for homestasis. Resistance to anoikis is required for tumor cell metastasis. We have previously shown several anoikis-resistance genes in esophageal squamous cell carcinoma (ESCC). In order to find novel anoikis-resistant genes in ESCC, we constructed retroviral cDNA library using total RNA from ESCC cell lines. NIH 3T3 cells, which are sensitive to anoikis, were infected with the library constructed. The cells were cultured in soft agar, and the clones which can survive in detached states were selected. The cDNAs inserted into the anoikis-resistant NIH3T3 clones were amplified using retroviral specific primers. Sequencing analysis showed that a cDNA fragment inserted into the anoikis-resistant clone contains full coding sequence (ORF) of human UBCH7/UBE2L3 gene. By infection with retrovirus encoding UBCH7 ORF (pMSCV-UBCH7), forced expression of UBCH7 increased the anoikis-resistance of NIH3T3 cells. More importantly, knockdown of UBCH7 expression by siRNA transfection reduced the anoikis-resistant ability of esophageal cancer MLuC1 cells. The data suggest that UBCH7/UBE2L3 gene would be involved in anoikis-resistance in ESCC.

  2. Screening and identification of gastric adenocarcinoma metastasis-related genes using cDNA microarray coupled to FDD-PCR.

    PubMed

    Wang, Jianhua; Chen, Shishu

    2002-10-01

    To identify certain gastric adenocarcinoma metastasis-related genes, an RF-1 cell line (primary tumor from a gastric adenocarcinoma patient) and an RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by the reverse transcription method. The two color probes were then mixed and hybridized to a cDNA chip constructed with double-dots from 4,096 human genes, and scanned at two wavelengths. The experiment was repeated twice. Differentially expressedn genes from the above two cells were analyzed by use of computer. Of the total genes, 138 (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81 (2.1%) genes revealed apparent up-regulation, and 56 (1.3%) genes revealed down-regulation. Forty-five genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including three novel genes. There were seven differentially expressed genes that presented the same behaviour under both detection methods. The possible roles of some differentially expressed genes, which may be involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large-scale manner in combination with FDD-PCR for cloning unknown novel genes. Some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis and provide new targets for therapeutic intervention.

  3. Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

    PubMed

    Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

    1995-02-15

    The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

  4. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  5. The human mu opioid receptor: modulation of functional desensitization by calcium/calmodulin-dependent protein kinase and protein kinase C.

    PubMed

    Mestek, A; Hurley, J H; Bye, L S; Campbell, A D; Chen, Y; Tian, M; Liu, J; Schulman, H; Yu, L

    1995-03-01

    Opioids are some of the most efficacious analgesics used in humans. Prolonged administration of opioids, however, often causes the development of drug tolerance, thus limiting their effectiveness. To explore the molecular basis of those mechanisms that may contribute to opioid tolerance, we have isolated a cDNA for the human mu opioid receptor, the target of such opioid narcotics as morphine, codeine, methadone, and fentanyl. The receptor encoded by this cDNA is 400 amino acids long with 94% sequence similarity to the rat mu opioid receptor. Transient expression of this cDNA in COS-7 cells produced high-affinity binding sites to mu-selective agonists and antagonists. This receptor displays functional coupling to a recently cloned G-protein-activated K+ channel. When both proteins were expressed in Xenopus oocytes, functional desensitization developed upon repeated stimulation of the mu opioid receptor, as observed by a reduction in K+ current induced by the second mu receptor activation relative to that induced by the first. The extent of desensitization was potentiated by both the multifunctional calcium/calmodulin-dependent protein kinase and protein kinase C. These results demonstrate that kinase modulation is a molecular mechanism by which the desensitization of mu receptor signaling may be regulated at the cellular level, suggesting that this cellular mechanism may contribute to opioid tolerance in humans.

  6. The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

    PubMed

    Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

    1990-01-05

    We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

  7. Analysis of anticentromere autoantibodies using cloned autoantigen CENP-B.

    PubMed Central

    Earnshaw, W C; Machlin, P S; Bordwell, B J; Rothfield, N F; Cleveland, D W

    1987-01-01

    A cDNA clone encoding CENP-B, the 80-kDa human centromere autoantigen, was used to construct a panel of hybrid proteins containing four different regions of CENP-B. These have allowed us to identify three independent epitopes on CENP-B that are targets of autoantibodies. Two of these are recognized concurrently in greater than or equal to 90% of patient sera containing anticentromere autoantibodies (ACA), conclusively demonstrating that this autoimmune response is polyclonal. When present and previous data are combined, ACA are shown to recognize at least five independent epitopes on CENP-B. A radioimmunoassay based on cloned CENP-B has demonstrated that sera from greater than or equal to 96% of patients with ACA recognize the cloned antigen, thus defining a region of the protein that is recognized by virtually all patients with ACA. These findings have significant implications for models that seek to explain the origin of ACA and for the future detection of this group of autoantibodies in the clinical setting. Images PMID:2440036

  8. Analysis of anticentromere autoantibodies using cloned autoantigen CENP-B.

    PubMed

    Earnshaw, W C; Machlin, P S; Bordwell, B J; Rothfield, N F; Cleveland, D W

    1987-07-01

    A cDNA clone encoding CENP-B, the 80-kDa human centromere autoantigen, was used to construct a panel of hybrid proteins containing four different regions of CENP-B. These have allowed us to identify three independent epitopes on CENP-B that are targets of autoantibodies. Two of these are recognized concurrently in greater than or equal to 90% of patient sera containing anticentromere autoantibodies (ACA), conclusively demonstrating that this autoimmune response is polyclonal. When present and previous data are combined, ACA are shown to recognize at least five independent epitopes on CENP-B. A radioimmunoassay based on cloned CENP-B has demonstrated that sera from greater than or equal to 96% of patients with ACA recognize the cloned antigen, thus defining a region of the protein that is recognized by virtually all patients with ACA. These findings have significant implications for models that seek to explain the origin of ACA and for the future detection of this group of autoantibodies in the clinical setting.

  9. Evidence for different origin of sex chromosomes in snakes, birds, and mammals and step-wise differentiation of snake sex chromosomes

    PubMed Central

    Matsubara, Kazumi; Tarui, Hiroshi; Toriba, Michihisa; Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Agata, Kiyokazu; Matsuda, Yoichi

    2006-01-01

    All snake species exhibit genetic sex determination with the ZZ/ZW type of sex chromosomes. To investigate the origin and evolution of snake sex chromosomes, we constructed, by FISH, a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 109 cDNA clones. Eleven of the 109 clones were localized to the Z chromosome. All human and chicken homologues of the snake Z-linked genes were located on autosomes, suggesting that the sex chromosomes of snakes, mammals, and birds were all derived from different autosomal pairs of the common ancestor. We mapped the 11 Z-linked genes of E. quadrivirgata to chromosomes of two other species, the Burmese python (Python molurus bivittatus) and the habu (Trimeresurus flavoviridis), to investigate the process of W chromosome differentiation. All and 3 of the 11 clones were localized to both the Z and W chromosomes in P. molurus and E. quadrivirgata, respectively, whereas no cDNA clones were mapped to the W chromosome in T. flavoviridis. Comparative mapping revealed that the sex chromosomes are only slightly differentiated in P. molurus, whereas they are fully differentiated in T. flavoviridis, and E. quadrivirgata is at a transitional stage of sex-chromosome differentiation. The differentiation of sex chromosomes was probably initiated from the distal region on the short arm of the protosex chromosome of the common ancestor, and then deletion and heterochromatization progressed on the sex-specific chromosome from the phylogenetically primitive boids to the more advanced viperids. PMID:17110446

  10. Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

    PubMed Central

    Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

    1999-01-01

    Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

  11. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

    1991-05-01

    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

  12. Electrotransfer of the full-length dog dystrophin into mouse and dystrophic dog muscles.

    PubMed

    Pichavant, Christophe; Chapdelaine, Pierre; Cerri, Daniel G; Bizario, Joao C S; Tremblay, Jacques P

    2010-11-01

    Duchenne muscular dystrophy (DMD) is an X-linked genetic disease characterized by the absence of dystrophin (427 kDa). An approach to eventually restore this protein in patients with DMD is to introduce into their muscles a plasmid encoding dystrophin cDNA. Because the phenotype of the dystrophic dog is closer to the human phenotype than is the mdx mouse phenotype, we have studied the electrotransfer of a plasmid carrying the full-length dog dystrophin (FLDYS(dog)) in dystrophic dog muscle. To achieve this nonviral delivery, the FLDYS(dog) cDNA was cloned in two plasmids containing either a cytomegalovirus or a muscle creatine kinase promoter. In both cases, our results showed that the electrotransfer of these large plasmids (∼17 kb) into mouse muscle allowed FLDYS(dog) expression in the treated muscle. The electrotransfer of pCMV.FLDYS(dog) in a dystrophic dog muscle also led to the expression of dystrophin. In conclusion, introduction of the full-length dog dystrophin cDNA by electrotransfer into dystrophic dog muscle is a potential approach to restore dystrophin in patients with DMD. However, the electrotransfer procedure should be improved before applying it to humans.

  13. Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

    PubMed

    Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

    2007-06-01

    As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

  14. BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA from disk abalone Haliotis discus discus.

    PubMed

    Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee

    2010-11-01

    A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Purification and characterization of bovine cone arrestin (cArr).

    PubMed

    Maeda, T; Ohguro, H; Sohma, H; Kuroki, Y; Wada, H; Okisaka, S; Murakami, A

    2000-03-31

    To elucidate the quenching mechanism of phototransduction in vertebrate cone photoreceptors, a cDNA clone encoding cone specific arrestin (cArr) was isolated from a bovine retinal cDNA library using a human cArr cDNA probe. Affinity-purified anti-peptide antibody specific to cArr was prepared. Immunohistochemical staining displayed specific labeling of cArr in cone photoreceptors and immunoblotting identified a 46 kDa protein band. We purified cArr from bovine retinas by sequential column chromatography using DEAE-cellulose, gel filtration and mono Q columns. Binding studies revealed no binding of cArr to rhodopsin regardless of whether it was bleached and/or phosphorylated. cArr also failed to bind to heparin-Sepharose under conditions which rod arrestin (rArr) bound to the column. The present data suggest that cArr may play a role in the quenching of phototransduction in cone photoreceptors and that its activity therein is different to that of rArr.

  16. HOXBES2: a novel epididymal HOXB2 homeoprotein and its domain-specific association with spermatozoa.

    PubMed

    Prabagaran, E; Bandivdekar, A H; Dighe, V; Raghavan, V P

    2007-02-01

    The sperm from the testis acquires complete fertilizing ability and forward progressive motility following its transit through the epididymis. Acquisition of these characteristics results from the modification of the sperm proteome following interactions with epididymal secretions. In our attempts to identify epididymis-specific sperm plasma membrane proteins, a partial 2.83-kb clone was identified by immunoscreening a monkey epididymal cDNA library with an agglutinating monoclonal antibody raised against washed human spermatozoa. The sequence of the 2.83-kb clone exhibited homology to the region between 1 and 1097 bp of the homeobox gene, Hoxb2. This sequence was found to be species conserved, as revealed by RT-PCR analysis. To obtain a full-length clone of the sequence, 5' RACE-PCR (rapid amplification of cDNA ends PCR) was carried out using rat epididymal RNA as the template. It resulted in a full-length 1.657-kb cDNA encoding a 32.9-kDa putative protein. The protein designated HOXBES2 exhibited homology to the conserved 61-amino acid homeodomain region of the HOXB2 homeoprotein. However, characteristic differences were noted in its amino and carboxyl termini compared with HOXB2. A putative 30-kDa protein was detected in the tissue extracts from adult rat epididymis and caudal spermatozoa, and a 37-kDa protein was detected in the rat embryo when probed with a polyclonal antibody against HOXB2 protein. Multiple tissue Western blot and immunohistochemical analysis further indicated its expression in the cytoplasm of the principal and basal epithelial cells, with maximal expression in the distal epididymal segments. Northern blot analysis detected a single approximately 2.5-kb transcript from the adult epididymis. Indirect immunofluorescence localized the protein to the acrosome, midpiece, and equatorial segments of rat caudal and ejaculated human and monkey spermatozoa, respectively. In conclusion, we have identified and characterized a novel epididymal homeoprotein different from HOXB2 protein and hereafter referred to as HOXBES2, (HOXB2 homeodomain containing epididymis-specific sperm protein) with a probable role in fertilization.

  17. Identification of an NADH-Cytochrome b5 Reductase Gene from an Arachidonic Acid-Producing Fungus, Mortierella alpina 1S-4, by Sequencing of the Encoding cDNA and Heterologous Expression in a Fungus, Aspergillus oryzae

    PubMed Central

    Sakuradani, Eiji; Kobayashi, Michihiko; Shimizu, Sakayu

    1999-01-01

    Based on the sequence information for bovine and yeast NADH-cytochrome b5 reductases (CbRs), a DNA fragment was cloned from Mortierella alpina 1S-4 after PCR amplification. This fragment was used as a probe to isolate a cDNA clone with an open reading frame encoding 298 amino acid residues which show marked sequence similarity to CbRs from other sources, such as yeast (Saccharomyces cerevisiae), bovine, human, and rat CbRs. These results suggested that this cDNA is a CbR gene. The results of a structural comparison of the flavin-binding β-barrel domains of CbRs from various species and that of the M. alpina enzyme suggested that the overall barrel-folding patterns are similar to each other and that a specific arrangement of three highly conserved amino acid residues (i.e., arginine, tyrosine, and serine) plays a role in binding with the flavin (another prosthetic group) through hydrogen bonds. The corresponding genomic gene, which was also cloned from M. alpina 1S-4 by means of a hybridization method with the above probe, had four introns of different sizes. These introns had GT at the 5′ end and AG at the 3′ end, according to a general GT-AG rule. The expression of the full-length cDNA in a filamentous fungus, Aspergillus oryzae, resulted in an increase (4.7 times) in ferricyanide reduction activity involving the use of NADH as an electron donor in the microsomes. The M. alpina CbR was purified by solubilization of microsomes with cholic acid sodium salt, followed by DEAE-Sephacel, Mono-Q HR 5/5, and AMP-Sepharose 4B affinity column chromatographies; there was a 645-fold increase in the NADH-ferricyanide reductase specific activity. The purified CbR preferred NADH over NADPH as an electron donor. This is the first report of an analysis of this enzyme in filamentous fungi. PMID:10473389

  18. ( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Branchek, T.; Adham, N.; Macchi, M.

    1990-11-01

    The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

  19. Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

    PubMed Central

    Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

    1992-01-01

    cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

  20. Molecular cloning of a small prostate protein, known as beta-microsemenoprotein, PSP94 or beta-inhibin, and demonstration of transcripts in non-genital tissues.

    PubMed

    Ulvsbäck, M; Lindström, C; Weiber, H; Abrahamsson, P A; Lilja, H; Lundwall, A

    1989-11-15

    In order to study the gene expression of the seminal plasma protein beta-microseminoprotein, also known as PSP94 and beta-inhibin, clones encoding this protein were isolated from a cDNA library constructed in lambda gt11. Nucleotide sequencing confirmed the structure of a previously cloned cDNA. By northern blot analysis identical sized transcripts were demonstrated in the prostate, the respiratory (tracheal, bronchial and lung) tissues and the antrum part of the gastric mucosa. Thus, the protein is not primarily associated with male reproductive function. Although probably of no physiological significance, a slight structural similarity to the ovarian inhibin beta-chains was identified in the C-terminal half of the molecule.

  1. Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

    PubMed Central

    Matroudi, S.; Zamani, M.R.; Motallebi, M.

    2008-01-01

    In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

  2. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    PubMed

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Xenopus laevis ribosomal protein genes: isolation of recombinant cDNA clones and study of the genomic organization.

    PubMed Central

    Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F

    1981-01-01

    Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733

  4. [Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

    1997-02-01

    The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

  5. Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

    DTIC Science & Technology

    2000-04-01

    Genes, LOH Mapping, Chromosome 17, Physical Mapping, Genetic Mapping, CDNA Screening, Humans, Anatomical 81 Samples, Mutation Detection, Breast Cancer...According to the established model for LOH involving tumor suppressor genes, the allele remaining in the tumor sample would harbor the deleterious mutation ...sequencing on an AB1373A sequencer (Applied Biosystems, Foster City, CA). As none of the samples we have sequenced have revealed any mutations , we have

  6. EXPRESSION OF THE SPERMATOGENIC CELL-SPECIFIC GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (GAPDS) IN RAT TESTIS

    EPA Science Inventory

    The spermatogenic cell-specific variant of glyceraldehyde 3-phosphate dehydrogenase (GAPDS) has been cloned from a rat testis cDNA library and its pattern of expression determined. A 1417 nucleotide cDNA has been found to encode an enzyme with substantial homology to mouse GAPDS...

  7. Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2008-01-01

    Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

  8. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed Central

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-01-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rorsman, F.; Bywater, M.; Knott, T.J.

    The human platelet-derived growth factor (PDGF) A-chain locus was characterized by restriction endonuclease analysis, and the nucleotide sequence of its exons was determined. Seven exons were identified, spanning approximately 22 kilobase pairs of genomic DNA. Alternative exon usage, identified by cDNA cloning, occurs in a human glioblastoma cell line and may give rise to two types of A-chain precursors with different C termini. The exon-intron arrangement was similar to that of the PDGF B-chain/sis locus and seemed to divide the precursor proteins into functional domains. Southern blot analysis of genomic DNA showed that a single PDGF A-chain gene was presentmore » in the human genome.« less

  10. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

    PubMed

    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

    2013-11-01

    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  11. Construction of cDNA expression library of watermelon for isolation of ClWRKY1 transcription factors gene involved in resistance to Fusarium wilt.

    PubMed

    Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun

    2014-08-01

    Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.

  12. Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

    PubMed

    Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

    1998-08-01

    An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

  13. A phage display vector optimized for the generation of human antibody combinatorial libraries and the molecular cloning of monoclonal antibody fragments.

    PubMed

    Solforosi, Laura; Mancini, Nicasio; Canducci, Filippo; Clementi, Nicola; Sautto, Giuseppe Andrea; Diotti, Roberta Antonia; Clementi, Massimo; Burioni, Roberto

    2012-07-01

    A novel phagemid vector, named pCM, was optimized for the cloning and display of antibody fragment (Fab) libraries on the surface of filamentous phage. This vector contains two long DNA "stuffer" fragments for easier differentiation of the correctly cut forms of the vector. Moreover, in pCM the fragment at the heavy-chain cloning site contains an acid phosphatase-encoding gene allowing an easy distinction of the Escherichia coli cells containing the unmodified form of the phagemid versus the heavy-chain fragment coding cDNA. In pCM transcription of heavy-chain Fd/gene III and light chain is driven by a single lacZ promoter. The light chain is directed to the periplasm by the ompA signal peptide, whereas the heavy-chain Fd/coat protein III is trafficked by the pelB signal peptide. The phagemid pCM was used to generate a human combinatorial phage display antibody library that allowed the selection of a monoclonal Fab fragment antibody directed against the nucleoprotein (NP) of Influenza A virus.

  14. Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

    PubMed

    Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

    2006-08-01

    To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

  15. Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

    PubMed

    He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

    2004-09-01

    Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

  16. Cloning and characterization of a Candida albicans maltase gene involved in sucrose utilization.

    PubMed Central

    Geber, A; Williamson, P R; Rex, J H; Sweeney, E C; Bennett, J E

    1992-01-01

    In order to isolate the structural gene involved in sucrose utilization, we screened a sucrose-induced Candida albicans cDNA library for clones expressing alpha-glucosidase activity. The C. albicans maltase structural gene (CAMAL2) was isolated. No other clones expressing alpha-glucosidase activity. were detected. A genomic CAMAL2 clone was obtained by screening a size-selected genomic library with the cDNA clone. DNA sequence analysis reveals that CAMAL2 encodes a 570-amino-acid protein which shares 50% identity with the maltase structural gene (MAL62) of Saccharomyces carlsbergensis. The substrate specificity of the recombinant protein purified from Escherichia coli identifies the enzyme as a maltase. Northern (RNA) analysis reveals that transcription of CAMAL2 is induced by maltose and sucrose and repressed by glucose. These results suggest that assimilation of sucrose in C. albicans relies on an inducible maltase enzyme. The family of genes controlling sucrose utilization in C. albicans shares similarities with the MAL gene family of Saccharomyces cerevisiae and provides a model system for studying gene regulation in this pathogenic yeast. Images PMID:1400249

  17. Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

    PubMed Central

    Wu, S; Kriz, A L; Widholm, J M

    1994-01-01

    The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

  18. [Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

    PubMed

    Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

    2017-04-12

    Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

  19. Constructing and detecting a cDNA library for mites.

    PubMed

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  20. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-05-15

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

  1. Cloning, expression analysis, and chromosomal localization of HIP1R, an isolog of huntingtin interacting protein (HIP1).

    PubMed

    Seki, N; Muramatsu, M; Sugano, S; Suzuki, Y; Nakagawara, A; Ohhira, M; Hayashi, A; Hori, T; Saito, T

    1998-01-01

    Huntington disease (HD) is an inherited neurodegenerative disorder which is associated with CAG expansion in the coding region of the gene for huntingtin protein. Recently, a huntingtin interacting protein, HIP1, was isolated by the yeast two-hybrid system. Here we report the isolation of a cDNA clone for HIP1R (huntingtin interacting protein-1 related), which encodes a predicted protein product sharing a striking homology with HIP1. RT-PCR analysis showed that the messenger RNA was ubiquitously expressed in various human tissues. Based on PCR-assisted analysis of a radiation hybrid panel and fluorescence in situ hybridization, HIP1R was localized to the q24 region of chromosome 12.

  2. Rat PPAR delta contains a CGG triplet repeat and is prominently expressed in the thalamic nuclei.

    PubMed

    Xing, G; Zhang, L; Zhang, L; Heynen, T; Yoshikawa, T; Smith, M; Weiss, S; Detera-Wadleigh, S

    1995-12-26

    We have isolated a new rat sequence containing motifs of a nuclear hormone receptor from a brain cDNA library. The deduced amino acid sequence encoded by the cDNA clone showed a strong homology to the human NUCI and the mouse peroxisome proliferator activated receptor delta (PPAR delta). We therefore refer to this new clone as rat PPAR delta (rPPAR delta). The new feature of rPPAR delta is a 14 CGG triplet repeat on the 5' untranslated region, not previously reported in either NUCI or mPPAR delta. We found that rPPAR delta was expressed as a 3.5-kb transcript which showed a wide distribution in adult rat tissues. Abundant expression was detected in brain, heart, skeletal muscle, kidney and lung. Weaker expression was noted in the liver, spleen and testis. To determine the specific brain localization of rPPAR delta we performed in situ hybridization analysis. Prominent expression was observed in the thalamus, particularly in the posterior part of the ventral medial nucleus, a site responsive to pain and cold stress. These results raise the possibility that PPAR delta might play a role in modulating response to thermal and pain sensations.

  3. Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

    PubMed

    Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

    2018-01-26

    Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

  4. NEIBank: Genomics and bioinformatics resources for vision research

    PubMed Central

    Peterson, Katherine; Gao, James; Buchoff, Patee; Jaworski, Cynthia; Bowes-Rickman, Catherine; Ebright, Jessica N.; Hauser, Michael A.; Hoover, David

    2008-01-01

    NEIBank is an integrated resource for genomics and bioinformatics in vision research. It includes expressed sequence tag (EST) data and sequence-verified cDNA clones for multiple eye tissues of several species, web-based access to human eye-specific SAGE data through EyeSAGE, and comprehensive, annotated databases of known human eye disease genes and candidate disease gene loci. All expression- and disease-related data are integrated in EyeBrowse, an eye-centric genome browser. NEIBank provides a comprehensive overview of current knowledge of the transcriptional repertoires of eye tissues and their relation to pathology. PMID:18648525

  5. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    PubMed

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  6. BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields

    NASA Technical Reports Server (NTRS)

    Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.

    1998-01-01

    We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.

  7. Isolation and functional expression of human COQ2, a gene encoding a polyprenyl transferase involved in the synthesis of CoQ.

    PubMed

    Forsgren, Margareta; Attersand, Anneli; Lake, Staffan; Grünler, Jacob; Swiezewska, Ewa; Dallner, Gustav; Climent, Isabel

    2004-09-01

    The COQ2 gene in Saccharomyces cerevisiae encodes a Coq2 (p-hydroxybenzoate:polyprenyl transferase), which is required in the biosynthetic pathway of CoQ (ubiquinone). This enzyme catalyses the prenylation of p-hydroxybenzoate with an all-trans polyprenyl group. We have isolated cDNA which we believe encodes the human homologue of COQ2 from a human muscle and liver cDNA library. The clone contained an open reading frame of length 1263 bp, which encodes a polypeptide that has sequence homology with the Coq2 homologues in yeast, bacteria and mammals. The human COQ2 gene, when expressed in yeast Coq2 null mutant cells, rescued the growth of this yeast strain in the absence of a non-fermentable carbon source and restored CoQ biosynthesis. However, the rate of CoQ biosynthesis in the rescued cells was lower when compared with that in cells rescued with the yeast COQ2 gene. CoQ formed when cells were incubated with labelled decaprenyl pyrophosphate and nonaprenyl pyrophosphate, showing that the human enzyme is active and that it participates in the biosynthesis of CoQ.

  8. Tumorigenic Potential of Extracellular Matrix Metalloproteinase Inducer

    PubMed Central

    Zucker, Stanley; Hymowitz, Michelle; Rollo, Ellen E.; Mann, Richard; Conner, Cathleen E.; Cao, Jian; Foda, Hussein D.; Tompkins, David C.; Toole, Bryan P.

    2001-01-01

    Extracellular matrix metalloproteinase inducer (EMMPRIN), a glycoprotein present on the cancer cell plasma membrane, enhances fibroblast synthesis of matrix metalloproteinases (MMPs). The demonstration that peritumoral fibroblasts synthesize most of the MMPs in human tumors rather than the cancer cells themselves has ignited interest in the role of EMMPRIN in tumor dissemination. In this report we have demonstrated a role for EMMPRIN in cancer progression. Human MDA-MB-436 breast cancer cells, which are tumorigenic but slow growing in vivo, were transfected with EMMPRIN cDNA and injected orthotopically into mammary tissue of female NCr nu/nu mice. Green fluorescent protein was used to visualize metastases. In three experiments, breast cancer cell clones transfected with EMMPRIN cDNA were considerably more tumorigenic and invasive than plasmid-transfected cancer cells. Increased gelatinase A and gelatinase B expression (demonstrated by in situ hybridization and gelatin substrate zymography) was demonstrated in EMMPRIN-enhanced tumors. In contrast to de novo breast cancers in humans, human tumors transplanted into mice elicited minimal stromal or inflammatory cell reactions. Based on these experimental studies and our previous demonstration that EMMPRIN is prominently displayed in human cancer tissue, we propose that EMMPRIN plays an important role in cancer progression by increasing synthesis of MMPs. PMID:11395366

  9. Development of an infectious clone and replicon system of norovirus GII.4.

    PubMed

    Oliveira, L M; Blawid, R; Orílio, A F; Andrade, B Y G; Souza, A C A; Nagata, T

    2018-08-01

    Human norovirus (HuNoV) is one of the main causes of acute gastroenteritis worldwide and is responsible for at least 20% of all cases. The detailed molecular mechanism of this norovirus remains unknown due to the lack of a suitable in vitro culturing system. An infectious clone of HuNoV would be a useful tool for elucidating the processes of viral infection and the mechanisms of replication. We developed an infectious cDNA clone of HuNoV using the rapid technique of Gibson Assembly. The complete genome of the HuNoV GII.4 Sydney subtype was cloned into a previously modified pcDNA3.1-based plasmid vector downstream from a cytomegaloviral promoter. We monitored the viral infection in vitro by inserting the reporter gene of the green fluorescent protein (GFP) between the NTPase and p22 genes, also by Gibson Assembly, to construct a HuNoV-GFP replicon. Human Caco-2 cells were transfected with the full-length genomic clone and the replicon containing GFP. The gene encoding the VP1/VP2 capsid protein was expressed, which was indirect evidence of the synthesis of subgenomic RNAs and thus the negative strand of the genome. We successfully constructed the infectious clone and its replicon containing GFP for the HuNoV GII.4 Sydney subtype, a valuable tool that will help the study of noroviral infection and replication. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Differential display RT PCR of total RNA from human foreskin fibroblasts for investigation of androgen-dependent gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nitsche, E.M.; Moquin, A.; Adams, P.S.

    1996-05-03

    Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less

  11. ASSESSMENT OF CLONE IDENTITY AND SEQUENCE FIDELITY FOR 1189 IMAGE CDNA CLONES. (R827402)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  12. Cloning of Sucrose:Sucrose 1-Fructosyltransferase from Onion and Synthesis of Structurally Defined Fructan Molecules from Sucrose1

    PubMed Central

    Vijn, Irma; van Dijken, Anja; Lüscher, Marcel; Bos, Antoine; Smeets, Edward; Weisbeek, Peter; Wiemken, Andres; Smeekens, Sjef

    1998-01-01

    Sucrose (Suc):Suc 1-fructosyltransferase (1-SST) is the key enzyme in plant fructan biosynthesis, since it catalyzes de novo fructan synthesis from Suc. We have cloned 1-SST from onion (Allium cepa) by screening a cDNA library using acid invertase from tulip (Tulipa gesneriana) as a probe. Expression assays in tobacco (Nicotiana plumbaginifolia) protoplasts showed the formation of 1-kestose from Suc. In addition, an onion acid invertase clone was isolated from the same cDNA library. Protein extracts of tobacco protoplasts transformed with this clone showed extensive Suc-hydrolyzing activity. Conditions that induced fructan accumulation in onion leaves also induced 1-SST mRNA accumulation, whereas the acid invertase mRNA level decreased. Structurally different fructan molecules could be produced from Suc by a combined incubation of protein extract of protoplasts transformed with 1-SST and protein extract of protoplasts transformed with either the onion fructan:fructan 6G-fructosyltransferase or the barley Suc:fructan 6-fructosyltransferase. PMID:9701606

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

    To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

  14. Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

    PubMed

    Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

    1987-01-01

    cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

  15. Sequencing and analysis of 10,967 full-length cDNA clones from Xenopus laevis and Xenopus tropicalis reveals post-tetraploidization transcriptome remodeling

    PubMed Central

    Morin, Ryan D.; Chang, Elbert; Petrescu, Anca; Liao, Nancy; Griffith, Malachi; Kirkpatrick, Robert; Butterfield, Yaron S.; Young, Alice C.; Stott, Jeffrey; Barber, Sarah; Babakaiff, Ryan; Dickson, Mark C.; Matsuo, Corey; Wong, David; Yang, George S.; Smailus, Duane E.; Wetherby, Keith D.; Kwong, Peggy N.; Grimwood, Jane; Brinkley, Charles P.; Brown-John, Mabel; Reddix-Dugue, Natalie D.; Mayo, Michael; Schmutz, Jeremy; Beland, Jaclyn; Park, Morgan; Gibson, Susan; Olson, Teika; Bouffard, Gerard G.; Tsai, Miranda; Featherstone, Ruth; Chand, Steve; Siddiqui, Asim S.; Jang, Wonhee; Lee, Ed; Klein, Steven L.; Blakesley, Robert W.; Zeeberg, Barry R.; Narasimhan, Sudarshan; Weinstein, John N.; Pennacchio, Christa Prange; Myers, Richard M.; Green, Eric D.; Wagner, Lukas; Gerhard, Daniela S.; Marra, Marco A.; Jones, Steven J.M.; Holt, Robert A.

    2006-01-01

    Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection Initiative. Here we present 10,967 full ORF verified cDNA clones (8049 from X. laevis and 2918 from X. tropicalis) as a community resource. Because the genome of X. laevis, but not X. tropicalis, has undergone allotetraploidization, comparison of coding sequences from these two clawed (pipid) frogs provides a unique angle for exploring the molecular evolution of duplicate genes. Within our clone set, we have identified 445 gene trios, each comprised of an allotetraploidization-derived X. laevis gene pair and their shared X. tropicalis ortholog. Pairwise dN/dS, comparisons within trios show strong evidence for purifying selection acting on all three members. However, dN/dS ratios between X. laevis gene pairs are elevated relative to their X. tropicalis ortholog. This difference is highly significant and indicates an overall relaxation of selective pressures on duplicated gene pairs. We have found that the paralogs that have been lost since the tetraploidization event are enriched for several molecular functions, but have found no such enrichment in the extant paralogs. Approximately 14% of the paralogous pairs analyzed here also show differential expression indicative of subfunctionalization. PMID:16672307

  16. Use of Trypanosoma equiperdum infected rabbits as a source of splenic mRNA; construction of cDNA clones and identification of a rabbit mu heavy chain clone.

    PubMed

    Bernstein, K E; Pavirani, A; Alexander, C; Jacobsen, F; Fitzmaurice, L; Mage, R

    1983-01-01

    Rabbits were infected by Trypanosoma equiperdum and the splenic mRNA was isolated. In vitro translation of this RNA and immunoprecipitation with anti-light chain, anti-heavy chain, anti-mu and anti-VH antibodies demonstrated that T. equiperdum infection elicits large quantities of splenic mRNA encoding mu and kappa chains. The mu and gamma heavy chains and the kappa light chains synthesized in the cell-free translation system were specifically immunoprecipitated by antisera to heavy chain VHa and light chain kappa b allotypes. In vitro labeling of spleen cells from trypanosome-infected animals demonstrated that the biosynthetically labeled IgM has a mu chain of higher molecular weight than the mu chain synthesized by in vitro translation, a difference that is largely abolished when cellular glycosylation is blocked with the antibiotic tunicamycin. Enrichment for heavy chain or light chain mRNA was achieved by fractionating mRNA from trypanosome-infected animals on a sucrose gradient. cDNA clones carrying mu heavy chain sequences were produced using a 'one tube' protocol and identified by cross species hybridization and hybridization selection. Infection of rabbits with T. equiperdum followed by sucrose gradient enrichment of splenic mRNA has provided sufficient quantities of mRNA encoding mu heavy chain suitable for cDNA cloning.

  17. Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

    USDA-ARS?s Scientific Manuscript database

    Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

  18. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  19. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  20. Isolation and functional identification of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli.

    PubMed

    Kajiwara, S; Kakizono, T; Saito, T; Kondo, K; Ohtani, T; Nishio, N; Nagai, S; Misawa, N

    1995-10-01

    We succeeded in isolating a novel cDNA involved in astaxanthin biosynthesis from the green alga Haematococcus pluvialis, by an expression cloning method using an Escherichia coli transformant as a host that synthesizes beta-carotene due to the Erwinia uredovora carotenoid biosynthesis genes. The cloned cDNA was shown to encode a novel enzyme, beta-carotene ketolase (beta-carotene oxygenase), which converted beta-carotene to canthaxanthin via echinenone, through chromatographic and spectroscopic analysis of the pigments accumulated in an E. coli transformant. This indicates that the encoded enzyme is responsible for the direct conversion of methylene to keto groups, a mechanism that usually requires two different enzymatic reactions proceeding via a hydroxy intermediate. Northern blot analysis showed that the mRNA was synthesized only in the cyst cells of H. pluvialis. E. coli carrying the H. pluvialis cDNA and the E. uredovora genes required for zeaxanthin biosynthesis was also found to synthesize astaxanthin (3S, 3'S), which was identified after purification by a variety of spectroscopic methods.

  1. A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.

    PubMed

    Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S

    1997-07-01

    A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.

  2. Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

    PubMed

    Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

    2005-11-01

    A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

  3. Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

    PubMed

    Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

    2011-12-10

    Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Isolation and characterization of a cDNA clone coding for a glutathione S-transferase class delta enzyme from the biting midge Culicoides variipennis sonorensis Wirth and Jones.

    PubMed

    Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E

    2000-12-01

    Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.

  5. Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.

    PubMed Central

    Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E

    1994-01-01

    A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404

  6. Generation and reactivation of T-cell receptor A joining region pseudogenes in primates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thiel, C.; Lanchbury, J.S.; Otting, N.

    1996-06-01

    Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications thatmore » differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.« less

  7. Functional Proteomic Analysis of Lipid Raft Kinase Complexes

    DTIC Science & Technology

    2009-08-01

    Ribosomal protein SA Raft 12 46/300 + 16.0 8.0 2.0 18 8 2.3 14 6 2.3 712 + + IPI00023101 RQCD1 Homo sapiens protein involved in sexual development...KnownHuman 17-ODYA IPI00065486 ABCB6 CDNA FLJ32464 fis, clone SKNMC1000251, highly similar to Homo sapiens MT-ABCtransporter (MTABC) mRNA IPI00006675...3.7 : 0 + + IPI00023101 RQCD1 Homo sapiens protein involved in sexual development, complete cds + + IPI00021766 RTN4 Isoform 1 of Reticulon-4 12

  8. The Role of c-FLIP(L) in Regulating Apoptotic Pathways in Prostate Cancer

    DTIC Science & Technology

    2008-12-01

    Cell 1990;61:351–9. 5. Gray PW, Barrett K, Chantry D, Turner M, Feldmann M. Cloning of human tumor necrosis factor (TNF) receptor cDNA and...dual pro-apoptotic and anti-apoptotic functions, mosttranslocation. Bars indicate inhibition and blockage. Gray lines NOVEL TARGETED PRO-APOPTOTIC...Induced Apoptosis in Prostate Cancer 345experiments in Fig. 20.4A were 50-CCT GTG ATCCCAGCACTT TG- 30 (forward primer) and 50- CAC CAT GCC CGA CTA ATT

  9. Molecular cloning and expression of Cro s 1: an occupational allergen from saffron pollen (Crocus sativus)

    PubMed Central

    Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G.; Goldblum, Randall M.; Chapman, Martin D.; Pomés, Anna

    2012-01-01

    Background: The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. Methods: The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. Section Title The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. Conclusion: We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron. PMID:26989701

  10. Molecular cloning and expression of Cro s 1: an occupational allergen from saffron pollen (Crocus sativus).

    PubMed

    Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G; Goldblum, Randall M; Chapman, Martin D; Pomés, Anna

    2012-10-01

    The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron.

  11. Cloning, expression and N-terminal myristoylation of CpCPK1, a calcium-dependent protein kinase from zucchini (Cucurbita pepo L.).

    PubMed

    Ellard-Ivey, M; Hopkins, R B; White, T J; Lomax, T L

    1999-01-01

    We have isolated a full-length cDNA clone (CpCDPK1) encoding a calcium-dependent protein kinase (CDPK) gene from zucchini (Cucurbita pepo L.). The predicted amino acid sequence of the cDNA shows a remarkably high degree of similarity to members of the CDPK gene family from Arabidopsis thaliana, especially AtCPK1 and AtCPK2. Northern analysis of steady-state mRNA levels for CpCPK1 in etiolated and light-grown zucchini seedlings shows that the transcript is most abundant in etiolated hypocotyls and overall expression is suppressed by light. As described for other members of the CDPK gene family from different species, the CpCPK1 clone has a putative N-terminal myristoylation sequence. In this study, site-directed mutagenesis and an in vitro coupled transcription/translation system were used to demonstrate that the protein encoded by this cDNA is specifically myristoylated by a plant N-myristoyl transferase. This is the first demonstration of myristoylation of a CDPK protein which may contribute to the mechanism by which this protein is localized to the plasma membrane.

  12. Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

    PubMed

    Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

    2016-08-30

    The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

  13. Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

    PubMed

    Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

    1996-06-01

    Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

  14. Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

    PubMed

    Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

    2009-07-01

    Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

  15. Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

    PubMed

    Sugimoto, H; Hayashi, H; Yamashita, S

    1996-03-29

    A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

  16. Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

    PubMed

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

  17. Identification and characterization of novel reptile cathelicidins from elapid snakes.

    PubMed

    Zhao, Hui; Gan, Tong-Xiang; Liu, Xiao-Dong; Jin, Yang; Lee, Wen-Hui; Shen, Ji-Hong; Zhang, Yun

    2008-10-01

    Three cDNA sequences coding for elapid cathelicidins were cloned from constructed venom gland cDNA libraries of Naja atra, Bungarus fasciatus and Ophiophagus hannah. The open reading frames of the cloned elapid cathelicidins were all composed of 576bp and coded for 191 amino acid residue protein precursors. Each of the deduced elapid cathelicidin has a 22 amino acid residue signal peptide, a conserved cathelin domain of 135 amino acid residues and a mature antimicrobial peptide of 34 amino acid residues. Unlike the highly divergent cathelicidins in mammals, the nucleotide and deduced protein sequences of the three cloned elapid cathelicidins were remarkably conserved. All the elapid mature cathelicidins were predicted to be cleaved at Valine157 by elastase. OH-CATH, the deduced mature cathelicidin from king cobra, was chemically synthesized and it showed strong antibacterial activity against various bacteria with minimal inhibitory concentration of 1-20microg/ml in the presence of 1% NaCl. Meanwhile, the synthetic peptide showed no haemolytic activity toward human red blood cells even at a high dose of 200microg/ml. Phylogenetic analysis of cathelicidins from vertebrate suggested that elapid and viperid cathelicidins were grouped together in the tree. Snake cathelicidins were evolutionary closely related to the neutrophilic granule proteins (NGPs) from mouse, rat and rabbit. Snake cathelicidins also showed a close relationship with avian fowlicidins (1-3) and chicken myeloid antimicrobial peptide 27. Elapid cathelicidins might be used as models for the development of novel therapeutic drugs.

  18. Molecular cloning and sequence analysis of stearoyl-CoA desaturase in milkfish, Chanos chanos.

    PubMed

    Hsieh, S L; Liao, W L; Kuo, C M

    2001-12-01

    Stearoyl-CoA desaturase (EC 1.14.99.5) is a key enzyme in the biosynthesis of polyunsaturated fatty acids and the maintenance of the homeoviscous fluidity of biological membranes. The stearoyl-CoA desaturase cDNA in milkfish (Chanos chanos) was cloned by RT-PCR and RACE, and it was compared with the stearoyl-CoA desaturase in cold-tolerant teleosts, common carp and grass carp. Nucleotide sequence analysis revealed that the cDNA clone has a 972-bp open reading frame encoding 323 amino acid residues. Alignments of the deduced amino acid sequence showed that the milkfish stearoyl-CoA desaturase shares 79% and 75% identity with common carp and grass carp, and 63%-64% with other vertebrates such as sheep, hamsters, rats, mice, and humans. Like common carp and grass carp, the deduced amino acid sequence in milkfish well conserves three histidine cluster motifs (one HXXXXH and two HXXHH) that are essential for catalysis of stearoyl-CoA desaturase activity. However, RT-PCR analysis showed that stearoyl-CoA desaturase expression in milkfish is detected in the tissues of liver, muscle, kidney, brain, and gill, and more expression sites were found in milkfish than in common carp and grass carp. Phylogenic relationships among the deduced stearoyl-CoA desaturase amino acid sequence in milkfish and those in other vertebrates showed that the milkfish stearoyl-CoA desaturase amino acid sequence is phylogenetically closer to those of common carp and grass carp than to other higher vertebrates.

  19. Characterization of a human X-linked gene from the DXS732E locus in the candidate region for the anhidrotic ectodermal dysplasia (EDA) gene (Xq13.1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gault, J.; Zonana, J.; Zeltinger, J.

    A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at itsmore » 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.« less

  20. Sulfation of minoxidil by multiple human cytosolic sulfotransferases.

    PubMed

    Anderson, R J; Kudlacek, P E; Clemens, D L

    1998-02-20

    Minoxidil is an antihypertensive agent and hair growth promoter that is metabolized by sulfation to the active compound, minoxidil sulfate. Thermostable phenol sulfotransferase (TS PST or P-PST) was initially thought to catalyze the reaction, and the enzyme was designated minoxidil sulfotransferase (MNX-ST). Information about human ST activities toward minoxidil would be useful in developing the capacity to predict individual responses to minoxidil based on tissue levels of STs. Therefore, human STs were studied from platelet homogenates, partially purified platelets, scalp skin high speed supernatants and COS-1 cell cDNA expressed preparations using a radiochemical enzymatic assay with minoxidil as the substrate. Studies showed the presence of TS PST, TL (thermolabile) PST and MNX-ST activities in human scalp skin. Biochemical properties and correlation studies suggested that in addition to TS PST, the TL PST activity, another ST activity or both were involved in the reaction. Partially purified human platelet TL PST tested with minoxidil and dopamine showed identical thermal stabilities and similar responses to the inhibitors 2,6-dichloro-4-nitrophenol (DCNP) and NaCl. To characterize the activity of TL PST toward minoxidil, several biochemical properties of the enzyme expressed from a human liver cDNA clone were investigated. When assayed with minoxidil and dopamine, thermal stabilities of the expressed enzyme were identical and IC50 values for the inhibitors DCNP and NaCl were similar. It was also demonstrated that cDNA encoded human liver dehydroepiandrosterone sulfotransferase and estrogen sulfotransferase contributed to the sulfation of minoxidil. The results confirm that at least four human STs contribute to minoxidil sulfation. MNX-ST activity represents a combination of ST activities. The data indicate that multiple ST activities should be taken into account in attempts to predict the regulation of minoxidil sulfation and individual responses to minoxidil.

  1. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types.

    PubMed

    Kilian, A; Bowtell, D D; Abud, H E; Hime, G R; Venter, D J; Keese, P K; Duncan, E L; Reddel, R R; Jefferson, R A

    1997-11-01

    Telomerase is a multicomponent reverse transcriptase enzyme that adds DNA repeats to the ends of chromosomes using its RNA component as a template for synthesis. Telomerase activity is detected in the germline as well as the majority of tumors and immortal cell lines, and at low levels in several types of normal cells. We have cloned a human gene homologous to a protein from Saccharomyces cerevisiae and Euplotes aediculatus that has reverse transcriptase motifs and is thought to be the catalytic subunit of telomerase in those species. This gene is present in the human genome as a single copy sequence with a dominant transcript of approximately 4 kb in a human colon cancer cell line, LIM1215. The cDNA sequence was determined using clones from a LIM1215 cDNA library and by RT-PCR, cRACE and 3'RACE on mRNA from the same source. We show that the gene is expressed in several normal tissues, telomerase-positive post-crisis (immortal) cell lines and various tumors but is not expressed in the majority of normal tissues analyzed, pre-crisis (non-immortal) cells and telomerase-negative immortal (ALT) cell lines. Multiple products were identified by RT-PCR using primers within the reverse transcriptase domain. Sequencing of these products suggests that they arise by alternative splicing. Strikingly, various tumors, cell lines and even normal tissues (colonic crypt and testis) showed considerable differences in the splicing patterns. Alternative splicing of the telomerase catalytic subunit transcript may be important for the regulation of telomerase activity and may give rise to proteins with different biochemical functions.

  2. Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geraghty, M.T.; Stetten, G.; Kearns, W.

    1994-09-01

    X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

  3. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    PubMed

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  4. Molecular characterization of a gene POLR2H encoded an essential subunit for RNA polymerase II from the Giant Panda (Ailuropoda Melanoleuca).

    PubMed

    Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru

    2013-02-01

    The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.

  5. Cloning, sequence, and expression of a blood group B active recombinant alpha-D-galactosidase from pinto bean (Phaseolus vulgaris).

    PubMed

    Davis, M O; Hata, D J; Johnson, S A; Jones, D E; Harmata, M A; Evans, M L; Walker, J C; Smith, D S

    1997-07-01

    A cDNA encoding pinto bean alpha-D-galactosidase [E.C. 3.2.1.22] was obtained by amplification of cDNA using highly conserved sequences found in eucaryotic alpha-D-galactosidases. Subsequently a full length Phaseolus cDNA clone was obtained that is 1537 nt long and contains untranslated 5' and 3' sequences. The nucleotide sequence of the cDNA has a high degree of homology with other eucaryotic alpha-D-galactosidase genes. The recombinant alpha-D-galactosidase (rGal) was expressed in Escherichia coli and purified by ion exchange and affinity chromatography. Purified rGal was homogeneous by SDS-PAGE and had relative masses of 40.1 and 45.4 kDa under nonreducing and reducing conditions, respectively. The N-terminal sequence of the expressed protein contained the sequence GNGLGQTPPMG corresponding to that deduced from the cDNA sequence. The native molecular weight for rGal was determined to be 32.18 kDa by Sephacryl S-200 chromatography. The specific activity of the rGal was 349 mu moles of PNP-alpha-D-galactopyranoside hydrolyzed per mg of pure rGal per min. rGal was highly specific for alpha-D-galactosyl residues and degraded B oligosaccharide. No detectable hemagglutinin or protease activity was present in the preparations. Furthermore, rGal was active against the blood group B antigen on native human erythrocytes in cell suspension assays. The only detectable RBC phenotypic change was loss of the B and P1 epitopes. Recombinant Phaseolus vulgaris alpha-D-galactosidase may have useful biotechnical applications in the potential mass production of enzymatically converted, universally transfusable type O RBCs. alpha-D-galactosidase [E.C. 3.2.1.22] has been purified from a variety of procaryotic and eucaryotic species. Most alpha-D-galactosidases have similar low molecular weight substrate specificities, but activity against high molecular weight substrates is variable. Terminal alpha-D-galactoside residues are present in glycoproteins and glycolipids. Some alpha-D-galactosidases have activity against alpha-D-galactosyl residues on cell membrane glycoconjugates. Glycosidases with this property are useful for carbohydrate structural studies and biotechnical applications. Enzymes free of other glycosidase activities with activity near neutral pH are particularly useful for membrane modification studies on native cells. Complex sugar chains in glycolipids and glycoproteins have often been implicated in the growth and development of eucaryotes. In particular, complex sugar chains play an important role in the recognition of self in the immune system. Some alpha-D-galactosidases can modify certain carbohydrate membrane epitopes, thereby modulating the immune response. For example, the blood group B epitope expressed on erythrocytes contains a terminal alpha-D-galactosyl residue. Individuals lacking this antigen produce naturally occurring complement fixing antibodies to the B epitope. Hydrolysis of this terminal saccharide destroys the antigenic activity of the B determinant producing H antigen (blood type O) on erythrocytes. Only rare individuals produce clinically significant antibodies to the H antigen, and therefore, type O red blood cells are "universally" compatible and in great demand. Dhar purified alpha-D-galactosidase isozymes from Phaseolus vulgaris and characterized their activity. To our knowledge, our laboratory, in a brief report, is the first to describe the cloning of the gene and the use of recombinant enzyme for seroconverting blood type B to O cells. This paper describes the cloning, sequence, expression, purification, and characterization of recombinant alpha-D-galactosidase. Activity of the recombinant enzyme on the native human erythrocyte blood group B epitope is shown.

  6. Cloning and mRNA Expression of NADH Dehydrogenase during Ochlerotatus taeniorhynchus Development and Pesticide Response

    USDA-ARS?s Scientific Manuscript database

    NADH dehydrogenase, the largest of the respiratory complexes, is the first enzyme of the mitochondrial electron transport chain. We have cloned and sequenced cDNA of NADH dehydrogenase gene from Ochlerotatus (Ochlerotatus) taeniorhynchus (Wiedemann) adult (GeneBank Accession number: FJ458415). The ...

  7. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  8. Chicken immunoglobulin gamma-heavy chains: limited VH gene repertoire, combinatorial diversification by D gene segments and evolution of the heavy chain locus.

    PubMed

    Parvari, R; Avivi, A; Lentner, F; Ziv, E; Tel-Or, S; Burstein, Y; Schechter, I

    1988-03-01

    cDNA clones encoding the variable and constant regions of chicken immunoglobulin (Ig) gamma-chains were obtained from spleen cDNA libraries. Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross-hybridizing VH genes of one subgroup. Since the VH clones were randomly selected, it is likely that the bulk of chicken H-chains are encoded by a single VH subgroup. Nucleotide sequence determinations of two cDNA clones reveal VH, D, JH and the constant region. The VH segments are closely related to each other (83% homology) as expected for VH or the same subgroup. The JHs are 15 residues long and differ by one amino acid. The Ds differ markedly in sequence (20% homology) and size (10 and 20 residues). These findings strongly indicate multiple (at least two) D genes which by a combinatorial joining mechanism diversify the H-chains, a mechanism which is not operative in the chicken L-chain locus. The most notable among the chicken Igs is the so-called 7S IgG because its H-chain differs in many important aspects from any mammalian IgG. The sequence of the C gamma cDNA reported here resolves this issue. The chicken C gamma is 426 residues long with four CH domains (unlike mammalian C gamma which has three CH domains) and it shows 25% homology to the chicken C mu. The chicken C gamma is most related to the mammalian C epsilon in length, the presence of four CH domains and the distribution of cysteines in the CH1 and CH2 domains. We propose that the unique chicken C gamma is the ancestor of the mammalian C epsilon and C gamma subclasses, and discuss the evolution of the H-chain locus from that of chicken with presumably three genes (mu, gamma, alpha) to the mammalian loci with 8-10 H-chain genes.

  9. Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

    PubMed Central

    2011-01-01

    Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

  10. Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

    PubMed

    Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

    1995-12-12

    Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

  11. Molecular cloning and 3D model of first cytochrome P450 from CYP3A subfamily in saltwater crocodile (Crocodylus porosus).

    PubMed

    Tabassum, Rabia

    2017-10-18

    Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

    PubMed Central

    Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

    1999-01-01

    Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

  13. Clone and genomic repositories at the American Type Culture Collection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maglott, D.R.; Nierman, W.C.

    1990-01-01

    The American Type Culture Collection (ATCC) has a long history of characterizing, preserving, and distributing biological resource materials for the scientific community. Starting in 1925 as a repository for standard bacterial and fungal strains, its collections have diversified with technologic advances and in response to the requirements of its users. To serve the needs of the human genetics community, the National Institute of Child Health and Human Development (NICHD), National Institutes of Health (NIH), established an international Repository of Human DNA Probes and Libraries at the ATCC in 1985. This repository expanded the existing collections of recombinant clones and librariesmore » at the ATCC, with the specific purposes of (1) obtaining, amplifying, and distribution probes detecting restriction fragment length polymorphisms (RFLPs); (2) obtaining, amplifying, and distributing genomic and cDNA clones from known genes independent of RFLP detection; (3) distributing the chromosome-specific libraries generated by the National Laboratory Gene Library Project at the Lawrence Livermore and Los Alamos National Laboratories and (4) maintaining a public, online database describing the repository materials. Because it was recognized that animal models and comparative mapping can be crucial to genomic characterization, the scope of the repository was broadened in February 1989 to include probes from the mouse genome.« less

  14. Cytochrome P450 CYP3A in marsupials: cloning and identification of the first CYP3A subfamily member, isoform 3A70 from Eastern gray kangaroo (Macropus giganteus).

    PubMed

    El-Merhibi, Adaweyah; Ngo, Suong N T; Marchant, Ceilidh L; Height, Tamara A; Stupans, Ieva; McKinnon, Ross A

    2012-09-15

    Australian marsupials are unique fauna that have evolved and adapted to unique environments and thus it is likely that their detoxification systems differ considerably from those of well-studied eutherian mammals. Knowledge of these processes in marsupials is therefore vital to understanding the consequences of exposure to xenobiotics. Cytochromes P450 (CYPs) are critically important in the oxidative metabolism of a diverse array of both xenobiotics and endogenous substrates. In this study we have cloned and characterized CYP3A70, the first identified member of the CYP3A gene subfamily from Eastern gray kangaroo (Macropus giganteus). A 1665 base pair kangaroo hepatic CYP3A complete cDNA, designated CYP3A70, was cloned by reverse transcription-polymerase chain reaction approaches, which encodes a protein of 506 amino acids. The CYP3A70 cDNA shares approximately 71% nucleotide and 65% amino acid sequence homology to human CYP3A4 and displays high sequence similarity to other published mammalian CYP3As from human, monkey, cow, pig, dog, rat, rabbit, mouse, hamster, and guinea pig. Transfection of the CYP3A70 cDNAs into 293T cells resulted in stable cell lines expressing a CYP3A immuno-reactive protein that was recognized by a goat anti-human CYP3A4 polyclonal antibody. The anti-human CYP3A4 antibody also detected immunoreactive proteins in liver microsomes from all test marsupials, including the kangaroo, koala, wallaby, and wombat, with multiple CYP3A immunoreactive bands observed in kangaroo and wallaby tissues. Relatively, very low CYP catalytic activity was detected for the kangaroo CYP3A70 cDNA-expressed proteins (19.6 relative luminescent units/μg protein), which may be due to low protein expression levels. Collectively, this study provides primary molecular data regarding the Eastern kangaroo hepatic CYP3A70 gene and enables further functional analyses of CYP3A enzymes in marsupials. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  16. Molecular cloning and characterization of RGA1 encoding a G protein alpha subunit from rice (Oryza sativa L. IR-36).

    PubMed

    Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D

    1995-03-01

    A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.

  17. cDNA cloning and characterization of an aryl hydrocarbon receptor from the harbor seal (Phoca vitulina): a biomarker of dioxin susceptibility?

    PubMed

    Kim, Eun-Young; Hahn, Mark E

    2002-07-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related planar halogenated aromatic hydrocarbons (PHAHs) are found at high concentrations in some marine mammals. Species differences in sensitivity to TCDD and PHAHs are a major limitation in assessing the ecological risk to these animals. Harbor seals accumulate high levels of PHAHs and are thought to be highly sensitive to the toxic effects of these compounds. To investigate the mechanistic basis for PHAH toxicity in harbor seals (Phoca vitulina), we sought to characterize the aryl hydrocarbon receptor (AHR), an intracellular protein that is responsible for PHAH effects. Here we report the cDNA cloning and characterization of a harbor seal AHR. The harbor seal AHR cDNA has an open reading frame of 2529 nucleotides that encodes a protein of 843 amino acids with a predicted molecular mass of 94.6 kDa. The harbor seal AHR protein possesses basic helix-loop-helix (bHLH) and Per-ARNT-Sim (PAS) domains. It is most closely related to the beluga AHR (82%) and human AHR (79%) in overall amino acid identity, indicating a high degree of conservation of AHR structure between terrestrial and some marine mammals. The ligand binding properties of the harbor seal AHR were determined using protein synthesized by in vitro transcription and translation from the cloned cDNA. Velocity sedimentation analysis on sucrose gradients showed that the harbor seal AHR exhibits specific binding of [(3)H]TCDD. The [(3)H]TCDD-binding affinity of the harbor seal AHR was compared with that of the AHR from a dioxin-sensitive mouse strain (C57BL/6) using a hydroxylapatite assay. The equilibrium dissociation constants of seal and mouse AHRs were 0.93+/-0.19 and 1.70+/-0.26 nM, respectively. Thus, the harbor seal AHR bound TCDD with an affinity that was at least as high as that of the mouse AHR, suggesting that this seal species may be sensitive to PHAH effects. The characteristics of the AHR potentially can be used as a biomarker of susceptibility to dioxin-like compounds, contributing to the assessment of the risk of these compounds to marine mammals and other protected animals.

  18. Expression of lectin genes during seed development in normal and phytohemagglutinin-deficient cultivars of Phaseolus vulgaris.

    PubMed

    Staswick, P; Chrispeels, M J

    1984-01-01

    Phytohemagglutinin (PHA), the major lectin of the common bean Phaseolus vulgaris, is synthesized during the development of the seeds. In most cultivars PHA makes up 5-10% of the total seed protein, but certain cultivars do not contain PHA. In vivo labeling of a normal cultivar (Greensleeves) and a PHA-minus cultivar (Pinto 111) showed that PHA was not synthesized in the PHA-minus cultivar. To find out whether the lack of synthesis was due to the absence of mRNA for PHA, recombinant cDNA clones for PHA were obtained. Total poly(A)+ RNA was isolated from cotyledons of developing seeds of Greensleeves and used to direct cDNA synthesis. The double stranded cDNA was cloned in pUC8 and transformants of Escherichia coli screened with pPVL134, a recombinant plasmid which contains the complete coding sequence for a PHA-like protein. Two weakly hybridizing clones (pSC1 and pSC2) were selected. Hybrid selection experiments showed that these two clones selected mRNAs which could be translated into polypeptides identical in size to PHA and recognized by antibodies to PHA. The recombinant pPVL134 selected mRNA which translated into polypeptides which were slightly smaller than those of PHA, and poorly recognized by antibodies to PHA. The recombinant clones were used to demonstrate that the genes for PHA and for the PHA-like protein are under temporal control during seed development. The cultivar Pinto 111, which has no detectable PHA, also has greatly reduced levels of mRNA for PHA. However, the gene for the PHA-like protein encoded by pPVL134 is expressed to the same degree in the cultivars Greensleeves and Pinto 111.

  19. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less

  20. Molecular cloning, characterization and expression of the caffeic acid O-methyltransferase (COMT) ortholog from kenaf (Hibiscus cannabinus)

    USDA-ARS?s Scientific Manuscript database

    We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...

  1. DNA book.

    PubMed

    Kawai, Jun; Hayashizaki, Yoshihide

    2003-06-01

    We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%-100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition.

  2. Biological properties of Beet soil-borne mosaic virus and Beet necrotic yellow vein virus cDNA clones produced by isothermal in vitro recombination: Insights for reassortant appearance.

    PubMed

    Laufer, Marlene; Mohammad, Hamza; Maiss, Edgar; Richert-Pöggeler, Katja; Dall'Ara, Mattia; Ratti, Claudio; Gilmer, David; Liebe, Sebastian; Varrelmann, Mark

    2018-05-01

    Two members of the Benyviridae family and genus Benyvirus, Beet soil-borne mosaic virus (BSBMV) and Beet necrotic yellow vein virus (BNYVV), possess identical genome organization, host range and high sequence similarity; they infect Beta vulgaris with variable symptom expression. In the US, mixed infections are described with limited information about viral interactions. Vectors suitable for agroinoculation of all genome components of both viruses were constructed by isothermal in vitro recombination. All 35S promoter-driven cDNA clones allowed production of recombinant viruses competent for Nicotiana benthamiana and Beta macrocarpa systemic infection and Polymyxa betae transmission and were compared to available BNYVV B-type clone. BNYVV and BSBMV RNA1 + 2 reassortants were viable and spread long-distance in N. benthamiana with symptoms dependent on the BNYVV type. Small genomic RNAs were exchangeable and systemically infected B. macrocarpa. These infectious clones represent a powerful tool for the identification of specific molecular host-pathogen determinants. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Co-induction of hepatic IGF-I and progranulin mRNA by growth hormone in tilapia, Oreochromis mossambiccus

    USDA-ARS?s Scientific Manuscript database

    Like IGF-I, progranulin (pgrn) is a growth factor involved in tumorigenesis and wound healing. We report here the identification and characterization of pgrn cDNA in tilapia and the regulation of its expression by growth hormone(GH). The tilapia pgrn cDNA was cloned by RT-PCR ampliWcation, using g...

  4. Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

    PubMed

    Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

    2013-05-01

    Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

  5. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    PubMed

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  6. Study of the Met Tyrosine Kinase in the Pathogenesis of Breast Cancer.

    DTIC Science & Technology

    1998-10-01

    cDNA clones appeared to encode for open reading frames, however, and neither clone showed any homology to the protein Gab1 , which is a signal...domain, and tissue characterization using specific antibodies , will hopefully determine whether these clones represent important c-met targets. In...Behrens J, Birchmeier W. Interaction between Gab1 and the c-met receptor tyrosine kinase is responsible for epithelial morphogenesis. Nature 1996;384:173

  7. Characterization and phylogenetic epitope mapping of CD38 ADPR cyclase in the cynomolgus macaque

    PubMed Central

    Ferrero, Enza; Orciani, Monia; Vacca, Paola; Ortolan, Erika; Crovella, Sergio; Titti, Fausto; Saccucci, Franca; Malavasi, Fabio

    2004-01-01

    Background The CD38 transmembrane glycoprotein is an ADP-ribosyl cyclase that moonlights as a receptor in cells of the immune system. Both functions are independently implicated in numerous areas related to human health. This study originated from an inherent interest in studying CD38 in the cynomolgus monkey (Macaca fascicularis), a species closely related to humans that also represents a cogent animal model for the biomedical analysis of CD38. Results A cDNA was isolated from cynomolgus macaque peripheral blood leukocytes and is predicted to encode a type II membrane protein of 301 amino acids with 92% identity to human CD38. Both RT-PCR-mediated cDNA cloning and genomic DNA PCR surveying were possible with heterologous human CD38 primers, demonstrating the striking conservation of CD38 in these primates. Transfection of the cDNA coincided with: (i) surface expression of cynomolgus macaque CD38 by immunofluorescence; (ii) detection of ~42 and 84 kDa proteins by Western blot and (iii) the appearance of ecto-enzymatic activity. Monoclonal antibodies were raised against the cynomolgus CD38 ectodomain and were either species-specific or cross-reactive with human CD38, in which case they were directed against a common disulfide-requiring conformational epitope that was mapped to the C-terminal disulfide loop. Conclusion This multi-faceted characterization of CD38 from cynomolgus macaque demonstrates its high genetic and biochemical similarities with human CD38 while the immunological comparison adds new insights into the dominant epitopes of the primate CD38 ectodomain. These results open new prospects for the biomedical and pharmacological investigations of this receptor-enzyme. PMID:15383153

  8. Characterization of mouse and human GTP cyclohydrolase I genes. Mutations in patients with GTP cyclohydrolase I deficiency.

    PubMed

    Ichinose, H; Ohye, T; Matsuda, Y; Hori, T; Blau, N; Burlina, A; Rouse, B; Matalon, R; Fujita, K; Nagatsu, T

    1995-04-28

    GTP cyclohydrolase I is the first and rate-limiting enzyme for the biosynthesis of tetrahydrobiopterin in mammals. Previously, we reported three species of human GTP cyclohydrolase I cDNA in a human liver cDNA library (Togari, A., Ichinose, H., Matsumoto, S., Fujita, K., and Nagatsu, T. (1992) Biochem. Biophys. Res. Commun. 187, 359-365). Furthermore, very recently, we found that the GTP cyclohydrolase I gene is causative for hereditary progressive dystonia with marked diurnal fluctuation, also known as DOPA-responsive dystonia (Ichinose, H., Ohye, T., Takahashi, E., Seki, N., Hori, T., Segawa, M., Nomura, Y., Endo, K., Tanaka, H., Tsuji, S., Fujita, K., and Nagatsu, T. (1994) Nature Genetics 8, 236-242). To clarify the mechanisms that regulate transcription of the GTP cyclohydrolase I gene and to generate multiple species of mRNA, we isolated genomic DNA clones for the human and mouse GTP cyclohydrolase I genes. Structural analysis of the isolated clones revealed that the GTP cyclohydrolase I gene is encoded by a single copy gene and is composed of six exons spanning approximately 30 kilobases. We sequenced all exon/intron boundaries of the human and mouse genes. Structural analysis also demonstrated that the heterogeneity of GTP cyclohydrolase I mRNA is caused by an alternative usage of the splicing acceptor site at the sixth exon. The transcription start site of the mouse GTP cyclohydrolase I gene and the 5'-flanking sequences of the mouse and human genes were determined. We performed regional mapping of the mouse gene by fluorescence in situ hybridization, and the mouse GTP cyclohydrolase I gene was assigned to region C2-3 of mouse chromosome 14. We identified missense mutations in patients with GTP cyclohydrolase I deficiency and expressed mutated enzymes in Escherichia coli to confirm alterations in the enzyme activity.

  9. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed Central

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-01-01

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes. Images PMID:1533935

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kawagoe, Kazuyoshi; Takeda, Junji; Kinoshita, Taroh

    Many membrane proteins are anchored to the cell membrane by glycosylphosphatidylinositol (GPI). The core structure and biosynthesis of the GPI anchor are well conserved in eukaryote cells. We previously cloned a human PIGA gene that participates in GPI anchor biosynthesis. We have now cloned complementary and genomic DNA of Pig-a, the murine homologue of PIGA, and compared its function and gene structure with those of PIGA. The deduced amino acid sequence of mouse PIG-A is 88% identical with that of human PIG-A. Transfection of Pig-a cDNA complemented the defects of both a PIG-A-deficient murine cell line and a PIG-A-deficient humanmore » cell line, demonstrating that functions of mouse and human PIG-A are conserved. Like human PIGA, the chromosomal Pig-a gene has six exons and spans approximately 16 kb. Moreover, Pig-a was mapped to X-F3/4, which is syntenic to human Xp22.1, where PIGA is located. Thus, murine Pig-a provides a good animal model to study paroxysmal nocturnal hemoglobinuria, a disease caused by a somatic mutation of PIGA. Database analysis demonstrated that a yeast gene, SPT14, is homologous to Pig-a and PIGA and that these genes are members of a glycosyltransferase gene family.« less

  11. Complete sequence of HLA-B27 cDNA identified through the characterization of structural markers unique to the HLA-A, -B, and -C allelic series

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szoets, H.; Reithmueller, G.; Weiss, E.

    1986-03-01

    Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in positionmore » 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.« less

  12. A protein that interacts with members of the nuclear hormone receptor family: identification and cDNA cloning.

    PubMed Central

    Zeiner, M; Gehring, U

    1995-01-01

    In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784

  13. Overproduction and partial purification of the Norrie disease gene product, norrin, from a recombinant baculovirus.

    PubMed

    Shastry, Barkur S; Trese, Michael T

    2003-12-05

    Abnormal vascularization of the peripheral retina and retinal detachment are common clinical characteristics of Norrie disease (ND), familial exudative vitreoretinopathy, Coats' disease, and retinopathy of prematurity. Although little is known about the molecular basis of these diseases, studies have shown that all of these diseases are associated with mutations in the ND gene. In spite of this, little is known about norrin, its molecular mechanism of action, and its functional relationship with the development of abnormal retinal vasculature. To obtain a large quantity of norrin for structural and functional studies, we have overproduced it in insect cells. For this purpose, a cDNA fragment (869 bp) was isolated from a human retinal cDNA library by amplification and was cloned into an expression vector. The purified plasmid was co-transfected with wild-type linearized Bac-N-Blue DNA into S. frugiperda Sf21 insect cells. The recombinant virus plaques were purified and clones were selected based on the level of recombinant protein expressed in Sf21 cells infected with a purified recombinant virus. From these, a high-titer stock was generated and subsequently used to prepare a fused protein on a large scale. The protein was partially purified by the process of immobilized metal affinity chromatography and the use of ion exchange chromatography

  14. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  15. Molecular Cloning and Functional Characterization of a Dihydroflavonol 4-Reductase from Vitis bellula.

    PubMed

    Zhu, Yue; Peng, Qingzhong; Li, Kegang; Xie, De-Yu

    2018-04-10

    Vitis bellula is a new grape crop in southern China. Berries of this species are rich in antioxidative anthocyanins and proanthocyanidins. This study reports cloning and functional characterization of a cDNA encoding a V. bellula dihydroflavonol reductase (VbDFR) involved in the biosynthesis of anthocyanins and proanthocyanidins. A cDNA including 1014 bp was cloned from young leaves and its open reading frame (ORF) was deduced encoding 337 amino acids, highly similar to V. vinifera DFR (VvDFR). Green florescence protein fusion and confocal microscopy analysis determined the cytosolic localization of VbDFR in plant cells. A soluble recombinant VbDFR was induced and purified from E. coli for enzyme assay. In the presence of NADPH, the recombinant enzyme catalyzed dihydrokaempferol (DHK) and dihydroquercetin (DHQ) to their corresponding leucoanthocyanidins. The VbDFR cDNA was introduced into tobacco plants via Agrobacterium -mediated transformation. The overexpression of VbDFR increased anthocyanin production in flowers. Anthocyanin hydrolysis and chromatographic analysis revealed that transgenic flowers produced pelargonidin and delphinidin, which were not detected in control flowers. These data demonstrated that the overexpression of VbDFR produced new tobacco anthocyanidins. In summary, all data demonstrate that VbDFR is a useful gene to provide three types of substrates for metabolic engineering of anthocyanins and proanthocyanidins in grape crops and other crops.

  16. Molecular cloning of the Coch gene of guinea pig inner ear and its expression analysis in cultured fibrocytes of the spiral ligament.

    PubMed

    Li, Lishu; Ikezono, Tetsuo; Sekine, Kuwon; Shindo, Susumu; Matsumura, Tomohiro; Pawankar, Ruby; Ichimiya, Issei; Yagi, Toshiaki

    2010-08-01

    We have cloned guinea pig Coch cDNA and the sequence information will be useful for future molecular study combined with physiological experiments. Proper Coch gene expression appears to be dependent on the unique extracellular micro-environment of the inner ear in vivo. These results provide insight into the Coch gene expression and its regulation. To characterize the guinea pig Coch gene, we performed molecular cloning and expression analysis in the inner ear and cultured fibrocytes of the spiral ligament. The Coch cDNA was isolated using RACE. Cochlin isofoms were studied by Western blot using three different types of mammalian inner ear. The cochlear fibrocytes were cultured and characterized by immunostaining. Coch gene expression in the fibrocytes was investigated and the influence of cytokine stimulation was evaluated. The full-length 1991 bp Coch cDNA that encodes a 553 amino acid protein was isolated. The sequence had significant homology with other mammals, and the sizes of the Cochlin isoforms were identical. In the cultured fibrocytes, Coch mRNA was expressed in a very small amount and the isoform production was different, compared with the results in vivo. Cytokine stimulation did not alter the level of mRNA expression or isoform formation.

  17. Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fujita, R.; Yan, D.; McHenry, C.

    1994-09-01

    Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less

  18. Trichothecene 3-O-acetyltransferase protects both the producing organism and transformed yeast from related mycotoxins. Cloning and characterization of Tri101.

    PubMed

    Kimura, M; Kaneko, I; Komiyama, M; Takatsuki, A; Koshino, H; Yoneyama, K; Yamaguchi, I

    1998-01-16

    Trichothecene mycotoxins such as deoxynivalenol, 4,15-diacetoxyscirpenol, and T-2 toxin, are potent protein synthesis inhibitors for eukaryotic organisms. The 3-O-acetyl derivatives of these toxins were shown to reduce their in vitro activity significantly as assessed by assays using a rabbit reticulocyte translation system. The results suggested that the introduction of an O-acetyl group at the C-3 position in the biosynthetic pathway works as a resistance mechanism for Fusarium species that produce t-type trichothecenes (trichothecenes synthesized via the precursor trichotriol). A gene responsible for the 3-O-acetylation reaction, Tri101, has been successfully cloned from a Fusarium graminearum cDNA library that was designed to be expressed in Schizosaccharomyces pombe. Fission yeast transformants were selected for their ability to grow in the presence of T-2 toxin, and this strategy allowed isolation of 25 resistant clones, all of which contained a cDNA for Tri101. This is the first drug-inactivating O-acetyltransferase gene derived from antibiotic-producing organisms. The open reading frame of Tri101 codes for a polypeptide of 451 amino acid residues, which shows no similarity to any other proteins reported so far. TRI101 from recombinant Escherichia coli catalyzes O-acetylation of the trichothecene ring specifically at the C-3 position in an acetyl-CoA-dependent manner. By using the Tri101 cDNA as a probe, two least overlapping cosmid clones that cover a region of 70 kilobase pairs have been isolated from the genome of F. graminearum. Other trichothecene biosynthetic genes, Tri4, Tri5, and Tri6, were not clustered in the region covered by these cosmid clones. These new cosmid clones are considered to be located in other parts of the large biosynthetic gene cluster and might be useful for the study of trichothecene biosynthesis.

  19. STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.

    PubMed Central

    Small, D; Levenstein, M; Kim, E; Carow, C; Amin, S; Rockwell, P; Witte, L; Burrow, C; Ratajczak, M Z; Gewirtz, A M

    1994-01-01

    We cloned the cDNA for stem cell tyrosine kinase 1 (STK-1), the human homolog of murine Flk-2/Flt-3, from a CD34+ hematopoietic stem cell-enriched library and investigated its expression in subsets of normal human bone marrow. The cDNA encodes a protein of 993 aa with 85% identity and 92% similarity to Flk-2/Flt-3. STK-1 is a member of the type III receptor tyrosine kinase family that includes KIT (steel factor receptor), FMS (colony-stimulating factor 1R), and platelet-derived growth factor receptor. STK-1 expression in human blood and marrow is restricted to CD34+ cells, a population greatly enriched for stem/progenitor cells. Anti-STK-1 antiserum recognizes polypeptides of 160 and 130 kDa in several STK-1-expressing cell lines and in 3T3 cells transfected with a STK-1 expression vector. Antisense oligonucleotides directed against STK-1 sequences inhibited hematopoietic colony formation, most strongly in long-term bone marrow cultures. These data suggest that STK-1 may function as a growth factor receptor on hematopoietic stem and/or progenitor cells. Images Fig. 2 Fig. 3 Fig. 4 PMID:7507245

  20. A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

    PubMed Central

    Lassner, M W; Lardizabal, K; Metz, J G

    1996-01-01

    beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils. PMID:8742713

  1. A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

    PubMed

    Lassner, M W; Lardizabal, K; Metz, J G

    1996-02-01

    beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

  2. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

  3. cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

    PubMed

    Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

    2005-04-01

    A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

  4. Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense).

    PubMed

    Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki

    2015-01-01

    Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.

  5. ORF phage display to identify cellular proteins with different functions.

    PubMed

    Li, Wei

    2012-09-01

    Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Cloning of habutobin cDNA and antithrombotic activity of recombinant protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sunagawa, Masanori; Nakamura, Mariko; Kosugi, Tadayoshi

    2007-11-03

    The habutobin cDNA was cloned from total RNA extracted from venom glands of Trimeresurus flavoviridis (the habu snake). The conceptual translation of 1539 bp of habutobin cDNA consists of 236 amino acids and its molecular weight is 25.7 kDa. Histidine (His)-tagged recombinant habutobin fusion protein, pET-r-habutobin and AcNPV-r-habutobin, was purified by bacterial system and baculoviral system, respectively. After refolding pET-r-habutobin, there were two protein bands at about 32 kDa and 65 kDa, indicating that habutobin might be produced as a monomer protein and processed to form two concatenated protein. Purified AcNPV-r-habutobin dose-dependently increased fibrin forming activity and inhibited collagen-induced aggregationmore » of rabbit washed platelets. Thus, AcNPV-r-habutobin produced by baculoviral system is very useful for study on structure-function relationship, which is necessary for developing an antithrombotic drug from habutobin.« less

  7. cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Codina, J.; Olate, J.; Abramowitz, J.

    1988-05-15

    cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted aminomore » acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.« less

  8. Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

    PubMed

    Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

    1991-08-01

    1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

  9. Expression cloning of a gibberellin 20-oxidase, a multifunctional enzyme involved in gibberellin biosynthesis.

    PubMed Central

    Lange, T; Hedden, P; Graebe, J E

    1994-01-01

    In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921

  10. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    PubMed

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  11. Characterization of the in vitro expressed autoimmune rippling muscle disease immunogenic domain of human titin encoded by TTN exons 248-249

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zelinka, L.; McCann, S.; Budde, J.

    2011-08-05

    Highlights: {yields} Affinity purification of the autoimmune rippling muscle disease immunogenic domain of titin. {yields} Partial sequence analysis confirms that the peptides is in the I band region of titin. {yields} This region of the human titin shows high degree of homology to mouse titin N2-A. -- Abstract: Autoimmune rippling muscle disease (ARMD) is an autoimmune neuromuscular disease associated with myasthenia gravis (MG). Past studies in our laboratory recognized a very high molecular weight skeletal muscle protein antigen identified by ARMD patient antisera as the titin isoform. These past studies used antisera from ARMD and MG patients as probes tomore » screen a human skeletal muscle cDNA library and several pBluescript clones revealed supporting expression of immunoreactive peptides. This study characterizes the products of subcloning the titin immunoreactive domain into pGEX-3X and the subsequent fusion protein. Sequence analysis of the fusion gene indicates the cloned titin domain (GenBank ID: (EU428784)) is in frame and is derived from a sequence of N2-A spanning the exons 248-250 an area that encodes the fibronectin III domain. PCR and EcoR1 restriction mapping studies have demonstrated that the inserted cDNA is of a size that is predicted by bioinformatics analysis of the subclone. Expression of the fusion protein result in the isolation of a polypeptide of 52 kDa consistent with the predicted inferred amino acid sequence. Immunoblot experiments of the fusion protein, using rippling muscle/myasthenia gravis antisera, demonstrate that only the titin domain is immunoreactive.« less

  12. Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

    PubMed

    Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

    2003-09-01

    The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

  13. The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi

    1993-01-01

    Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less

  14. Molecular cloning and immunoglobulin E reactivity of a natural rubber latex lecithinase homologue, the major allergenic component of Hev b 4.

    PubMed

    Sunderasan, E; Bahari, A; Arif, S A M; Zainal, Z; Hamilton, R G; Yeang, H Y

    2005-11-01

    Hev b 4 is an allergenic natural rubber latex (NRL) protein complex that is reactive in skin prick tests and in vitro immunoassays. On SDS-polyacrylamide gel electrophoresis (SDS-PAGE), Hev b 4 is discerned predominantly at 53-55 kDa together with a 57 kDa minor component previously identified as a cyanogenic glucosidase. Of the 13 NRL allergens recognized by the International Union of Immunological Societies, the 53-55 kDa Hev b 4 major protein is the only candidate that lacks complete cDNA and protein sequence information. We sought to clone the transcript encoding the Hev b 4 major protein, and characterize the native protein and its recombinant form in relation to IgE binding. The 5'/3' rapid amplification of cDNA ends method was employed to obtain the complete cDNA of the Hev b 4 major protein. A recombinant form of the protein was over-expressed in Escherichia coli. The native Hev b 4 major protein was deglycosylated by trifluoromethane sulphonic acid. Western immunoblots of the native, deglycosylated and recombinant proteins were performed using both polyclonal antibodies and sera from latex-allergic patients. The cDNA encoding the Hev b 4 major protein was cloned. Its open reading frame matched lecithinases in the conserved domain database and contained 10 predicted glycosylation sites. Detection of glycans on the Hev b 4 lecithinase homologue confirmed it to be a glycoprotein. The deglycosylated lecithinase homologue was discerned at 40 kDa on SDS-PAGE, this being comparable to the 38.53 kDa mass predicted by its cDNA. Deglycosylation of the lecithinase homologue resulted in the loss of IgE recognition, although reactivity to polyclonal rabbit anti-Hev b 4 was retained. IgE from latex-allergic patients also failed to recognize the non-glycosylated E. coli recombinant lecithinase homologue. The IgE epitopes of the Hev b 4 lecithinase homologue reside mainly in its carbohydrate moiety, which also account for the discrepancy between the observed molecular weight of the protein and the value calculated from its cDNA.

  15. Genotypic variation in sulfur assimilation and metabolism of onion (Allium cepa L.) III. Characterization of sulfite reductase

    USDA-ARS?s Scientific Manuscript database

    Genomic and cDNA sequences corresponding to a ferredoxin-sulfite reductase (SiR) have been cloned from bulb onion (Allium cepa L.) and the expression of the gene and activity of the enzyme characterised with respect to sulfur (S) supply. Cloning, mapping and expression studies revealed that onion ha...

  16. Design and construction of a first-generation high-throughput integrated robotic molecular biology platform for bioenergy applications

    USDA-ARS?s Scientific Manuscript database

    The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-based clones to expres...

  17. Virtual Northern analysis of the human genome.

    PubMed

    Hurowitz, Evan H; Drori, Iddo; Stodden, Victoria C; Donoho, David L; Brown, Patrick O

    2007-05-23

    We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes.

  18. Characterization and mapping of the human rhodopsin kinase gene and screening of the gene for mutations in patients with retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khani, S.C.; Lin, D.; Magovcevic, I.

    1994-09-01

    Rhodopsin kinase (RK) is a cytosolic enzyme in rod photoreceptors that initiates the deactivation of the phototransductions cascade by phosphorylating photoactivated rhodopsin. Although the cDNA sequence of bovine RK has been determined previously, no human cDNA or genomic sequence has thus far been available for genetic studies. In order to investigate the possible role of this candidate gene in retinitis pigmentosa (RP) and allied diseases, we have isolated and characterized human cDNA and genomic clones derived from the RK locus. The coding sequence of the human gene is 1692 nucleotides in length and is split into seven exons. The humanmore » and the bovine sequence show 84% identity at the nucleotide level and 92% identity at the amino acid level. Thus far, the intronic sequences flanking each exon except for one have been determined. We have also mapped the human RK gene to chromosome 13q34 using fluorescence in situ hybridization. To our knowledge, no RP gene has as yet been linked to this region. However, since the substrate for RK (rhodopsin) and other members of the phototransduction cascade have been implicated in the pathogenesis of RP, it is conceivable that defects in RK can also cause some forms of this disease. We are evaluating this possibility by screening DNA from 173 patients with autosomal recessive RP and 190 patients with autosomal dominant RP. So far, we have found 11 patients with variant bands. In one patient with autosomal dominant RP we discovered the missense change Ser536Leu. Cosegregation studies and further sequencing of the variant bands are currently underway.« less

  19. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    PubMed Central

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  20. Cloning and expression of delta-1-pyrroline-5-carboxylate dehydrogenase in Escherichia coli DH5α improves phosphate solubilization.

    PubMed

    Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong

    2014-11-01

    A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.

  1. The alpha-spectrin gene is on chromosome 1 in mouse and man.

    PubMed

    Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

    1985-06-01

    By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies.

  2. [Cloning and expression regulation of 1-deoxy-D-xylulose-5-phosphate reductoisomerase cDNA from Alpinia officinarum].

    PubMed

    Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min

    2012-11-01

    The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.

  3. Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Finlay, C.A.; Hinds, P.W.; Tan, T.H.

    1988-02-01

    The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

  4. Molecular Cloning and Characterization of an Acetylcholinesterase cDNA in the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389

  5. Molecular Cloning, Bioinformatics Analysis and Expression of Insulin-Like Growth Factor 2 from Tianzhu White Yak, Bos grunniens

    PubMed Central

    Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu

    2014-01-01

    The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317

  6. Cloning and characterization of cDNAs encoding human gastrin-releasing peptide.

    PubMed Central

    Spindel, E R; Chin, W W; Price, J; Rees, L H; Besser, G M; Habener, J F

    1984-01-01

    We have prepared and cloned cDNAs derived from poly(A)+ RNA from a human pulmonary carcinoid tumor rich in immunoreactivity to gastrin-releasing peptide, a peptide closely related in structure to amphibian bombesin. Mixtures of synthetic oligodeoxyribonucleotides corresponding to amphibian bombesin were used as hybridization probes to screen a cDNA library prepared from the tumor RNA. Sequencing of the recombinant plasmids shows that human gastrin-releasing peptide (hGRP) mRNA encodes a precursor of 148 amino acids containing a typical signal sequence, hGRP consisting of 27 or 28 amino acids, and a carboxyl-terminal extension peptide. hGRP is flanked at its carboxyl terminus by two basic amino acids, following a glycine used for amidation of the carboxyl-terminal methionine. RNA blot analyses of tumor RNA show a major mRNA of 900 bases and a minor mRNA of 850 bases. Blot hybridization analyses using human genomic DNA are consistent with a single hGRP-encoding gene. The presence of two mRNAs encoding the hGRP precursor protein in the face of a single hGRP gene raises the possibility of alternative processing of the single RNA transcript. Images PMID:6207529

  7. Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank

    PubMed Central

    Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.

    2008-01-01

    Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676

  8. Transgenic-cloned pigs systemically expressing red fluorescent protein, Kusabira-Orange.

    PubMed

    Matsunari, Hitomi; Onodera, Masafumi; Tada, Norihiro; Mochizuki, Hideki; Karasawa, Satoshi; Haruyama, Erika; Nakayama, Naoki; Saito, Hitoshi; Ueno, Satoshi; Kurome, Mayuko; Miyawaki, Atsushi; Nagashima, Hiroshi

    2008-09-01

    Genetically engineered pigs with cell markers such as fluorescent proteins are highly useful in lines of research that include the tracking of transplanted cells or tissues. In this study, we produced transgenic-cloned pigs carrying a gene for the newly developed red fluorescent protein, humanized Kusabira-Orange (huKO), which was cloned from the coral stone Fungia concinna. The nuclear transfer embryos, reconstructed with fetal fibroblast cells that had been transduced with huKO cDNA using retroviral vector D Delta Nsap, developed efficiently in vitro into blastocysts (28.0%, 37/132). Nearly all (94.6%, 35/37) of the cloned blastocysts derived from the transduced cells exhibited clear huKO gene expression. A total of 429 nuclear transfer embryos were transferred to four recipients, all of which became pregnant and gave birth to 18 transgenic-cloned offspring in total. All of the pigs highly expressed huKO fluorescence in all of the 23 organs and tissues analyzed, including the brain, eyes, intestinal and reproductive organs, skeletal muscle, bone, skin, and hoof. Furthermore, such expression was also confirmed by histological analyses of various tissues such as pancreatic islets, renal corpuscles, neuronal and glial cells, the retina, chondrocytes, and hematopoietic cells. These data demonstrate that transgenic-cloned pigs exhibiting systemic red fluorescence expression can be efficiently produced by nuclear transfer of somatic cells retrovirally transduced with huKO gene.

  9. Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus.

    PubMed

    Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D

    2013-01-01

    Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.

  10. Differential cDNA cloning by enzymatic degrading subtraction (EDS).

    PubMed Central

    Zeng, J; Gorski, R A; Hamer, D

    1994-01-01

    We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

  11. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    PubMed

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  12. Generation and characterization of a human-mouse chimeric high-affinity antibody that detects the DYKDDDDK FLAG peptide.

    PubMed

    Ikeda, Koki; Koga, Tomoaki; Sasaki, Fumiyuki; Ueno, Ayumi; Saeki, Kazuko; Okuno, Toshiaki; Yokomizo, Takehiko

    2017-05-13

    DYKDDDDK peptide (FLAG) is a useful tool for investigating the function and localization of proteins whose antibodies (Abs) are not available. We recently established a high-affinity monoclonal antibody (mAb) for FLAG (clone 2H8). The 2H8 Ab is highly sensitive for detecting FLAG-tagged proteins by flowcytometry and immunoprecipitation, but it can yield nonspecific signals in immunohistochemistry of mouse tissues because it is of mouse origin. In this study, we reduced nonspecific signals by generating a chimeric 2H8 Ab with Fc fragments derived from human immunoglobulin. We fused a 5' terminal cDNA fragments for the Fab region of 2H8 mAb with 3' terminal cDNA fragments for Fc region of human IgG1. We transfected both chimeric plasmids and purified the resulting human-mouse chimeric 2H8. The chimeric 2H8 Ab successfully detected FLAG-tagged proteins in flowcytometry with anti-human IgG secondary Ab with comparable sensitivity to 2H8 mAb. Importantly, chimeric 2H8 detected specific FLAG peptide signals without nonspecific signals in immunohistochemical analysis with mouse tissues. This human-mouse chimeric high-affinity anti-FLAG Ab will prove useful for future immunohistochemical analysis of mouse tissues. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Molecular cloning and chromosomal localization of a pseudogene related to the human Acyl-CoA binding protein/diazepam binding inhibitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gersuk, V.H.; Rose, T.M.; Todaro, G.J.

    The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less

  14. Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

    PubMed Central

    Newsome, A L; McLean, J W; Lively, M O

    1992-01-01

    Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

  15. 1,4-Benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akileswaran, L.; Brock, B.J.; Cereghino, J.L.

    1999-02-01

    A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less

  16. Molecular Cloning and Characterization of a Xanthone Prenyltransferase from Hypericum calycinum Cell Cultures.

    PubMed

    Fiesel, Tobias; Gaid, Mariam; Müller, Andreas; Bartels, Joana; El-Awaad, Islam; Beuerle, Till; Ernst, Ludger; Behrends, Sönke; Beerhues, Ludger

    2015-08-27

    In plants, prenylation of metabolites is widely distributed to generate compounds with efficient defense potential and distinct pharmacological activities profitable to human health. Prenylated compounds are formed by members of the prenyltransferase (PT) superfamily, which catalyze the addition of prenyl moieties to a variety of acceptor molecules. Cell cultures of Hypericum calycinum respond to elicitor treatment with the accumulation of the prenylated xanthone hyperxanthone E. A cDNA encoding a membrane-bound PT (HcPT) was isolated from a subtracted cDNA library and transcript preparations of H. calycinum. An increase in the HcPT transcript level preceded hyperxanthone E accumulation in cell cultures of H. calycinum treated with elicitor. The HcPT cDNA was functionally characterized by expression in baculovirus-infected insect cells. The recombinant enzyme catalyzed biosynthesis of 1,3,6,7-tetrahydroxy-8-prenylxanthone through regiospecific C-8 prenylation of 1,3,6,7-tetrahydroxyxanthone, indicating its involvement in hyperxanthone E formation. The enzymatic product shared significant structural features with the previously reported cholinesterase inhibitor γ-mangostin. Thus, our findings may offer a chance for semisynthesis of new active agents to be involved in the treatment of Alzheimer's disease.

  17. Expression analysis of kenaf cinnamate 4-hydroxylase (C4H) ortholog during developmental and stress responses

    USDA-ARS?s Scientific Manuscript database

    This study was conducted to clone and analyze the expression pattern of a C4H gene encoding cinnamate 4-hydroxylase from kenaf (Hibiscus cannabinus L.). A full-length C4H ortholog was cloned using degenerate primers and the RACE (rapid amplification of cDNA ends) method. The full-length C4H ortholog...

  18. Molecular cloning and expression of rat liver bile acid CoA ligase.

    PubMed

    Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen

    2002-12-01

    Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.

  19. DNA Book

    PubMed Central

    Kawai, Jun; Hayashizaki, Yoshihide

    2003-01-01

    We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%–100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition. PMID:12819147

  20. An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van De Loo, F.J.; Broun, P.; Turner, S.

    1995-07-18

    Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less

  1. Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

    PubMed

    Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

    2001-04-01

    Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

  2. Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

    PubMed Central

    Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

    1990-01-01

    Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

  3. Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Claffey, K.P.; Herrera, V.L.; Brecher, P.

    1987-12-01

    A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

  4. Genomic resources for songbird research and their use in characterizing gene expression during brain development

    PubMed Central

    Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

    2007-01-01

    Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

  5. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    PubMed Central

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  6. Molecular cloning and functional characterization of borneol dehydrogenase from the glandular trichomes of Lavandula x intermedia.

    PubMed

    Sarker, Lukman S; Galata, Mariana; Demissie, Zerihun A; Mahmoud, Soheil S

    2012-12-15

    Several varieties of Lavandula x intermedia (lavandins) are cultivated for their essential oils (EOs) for use in cosmetic, hygiene and personal care products. These EOs are mainly constituted of monoterpenes including camphor, which contributes an off odor reducing the olfactory appeal of the oil. We have recently constructed a cDNA library from the glandular trichomes (the sites of EO synthesis) of L. x intermedia plants. Here, we describe the cloning of a borneol dehydrogenase cDNA (LiBDH) from this library. The 780 bp open reading frame of the cDNA encoded a 259 amino acid short chain alcohol dehydrogenase with a predicted molecular mass of ca. 27.5 kDa. The recombinant LiBDH was expressed in Escherichia coli, purified by Ni-NTA agarose affinity chromatography, and functionally characterized in vitro. The bacterially produced enzyme specifically converted borneol to camphor as the only product with K(m) and k(cat) values of 53 μM and 4.0 × 10(-4) s(-1), respectively. The LiBDH transcripts were specifically expressed in glandular trichomes of mature flowers indicating that like other Lavandula monoterpene synthases the expression of this gene is regulated in a tissue-specific manner. The cloning of LiBDH has far reaching implications in improving the quality of Lavandula EOs through metabolic engineering. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

    PubMed

    Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

    1996-10-31

    Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

  8. 30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Mineralocorticoid receptor antagonists: 60 years of research and development

    PubMed Central

    Bärfacker, Lars

    2017-01-01

    The cDNA of the mineralocorticoid receptor (MR) was cloned 30 years ago, in 1987. At that time, spirolactone, the first generation of synthetic steroid-based MR antagonists (MRAs), which was identified in preclinical in vivo models, had already been in clinical use for 30 years. Subsequent decades of research and development by Searle & Co., Ciba-Geigy, Roussel Uclaf and Schering AG toward identifying a second generation of much more specific steroidal MRAs were all based on the initial 17-spirolactone construct. The salient example is eplerenone, first described in 1987, coincidentally with the cloning of MR cDNA. Its launch on the market in 2003 paralleled intensive drug discovery programs for a new generation of non-steroidal MRAs. Now, 30 years after the cDNA cloning of MR and 60 years of clinical use of steroidal MRAs, novel non-steroidal MRAs such as apararenone, esaxerenone and finerenone are in late-stage clinical trials in patients with heart failure, chronic kidney disease (CKD), hypertension and liver disease. Finerenone has already been studied in over 2000 patients with heart failure plus chronic kidney disease and/or diabetes, and in patients with diabetic kidney disease, in five phase II clinical trials. Here, we reflect on the history of the various generations of MRAs and review characteristics of the most important steroidal and non-steroidal MRAs. PMID:28634268

  9. Production of Cloned Miniature Pigs Expressing High Levels of Human Apolipoprotein(a) in Plasma.

    PubMed

    Ozawa, Masayuki; Himaki, Takehiro; Ookutsu, Shoji; Mizobe, Yamato; Ogawa, Junki; Miyoshi, Kazuchika; Yabuki, Akira; Fan, Jianglin; Yoshida, Mitsutoshi

    2015-01-01

    High lipoprotein(a) [Lp(a)] levels are a major risk factor for the development of atherosclerosis. However, because apolipoprotein(a) [apo(a)], the unique component of Lp(a), is found only in primates and humans, the study of human Lp(a) has been hampered due to the lack of appropriate animal models. Using somatic cell nuclear transfer (SCNT) techniques, we produced transgenic miniature pigs expressing human apo(a) in the plasma. First, we placed the hemagglutinin (HA)-tagged cDNA of human apo(a) under the control of the β-actin promoter and cytomegalovirus enhancer, and then introduced this construct into kidney epithelial cells. Immunostaining of cells with anti-HA antibody allowed identification of cells stably expressing apo(a); one of the positive clones was used to provide donor cells for SCNT, yielding blastocysts that expressed apo(a). Immunohistochemical analysis of tissue sections and RT-PCR analysis of total RNA from organs of cloned piglet revealed that apo(a) is expressed in various tissues/organs including heart, liver, kidney, and intestine. More importantly, a transgenic line exhibited a high level (>400 mg/dL) of Lp(a) in plasma, and the transgenic apo(a) gene was transmitted to the offspring. Thus, we generated a human apo(a)-transgenic miniature pig that can be used as a model system to study advanced atherosclerosis related to human disease. The anatomical and physiological similarities between the swine and human cardiovascular systems will make this pig model a valuable source of information on the role of apo(a) in the formation of atherosclerosis, as well as the mechanisms underlying vascular health and disease.

  10. Characterization of the human pH- and PKA-activated ClC-2G(2 alpha) Cl- channel.

    PubMed

    Sherry, A M; Stroffekova, K; Knapp, L M; Kupert, E Y; Cuppoletti, J; Malinowska, D H

    1997-08-01

    A ClC-2G(2 alpha) Cl- channel was identified to be present in human lung and stomach, and a partial cDNA for this Cl- channel was cloned from a human fetal lung library. A full-length expressible human ClC-2G(2 alpha) cDNA was constructed by ligation of mutagenized expressible rabbit ClC-2G(2 alpha) cDNA with the human lung ClC-2G(2 alpha) cDNA, expressed in oocytes, and characterized at the single-channel level. Adenosine 3',5'-cyclic monophosphate-dependent protein kinase (PKA) treatment increased the probability of opening of the channel (Po). After PKA activation, the channel exhibited a linear (r = 0.99) current-voltage curve with a slope conductance of 22.1 +/- 0.8 pS in symmetric 800 mM tetraethylammonium chloride (TEACl; pH 7.4). Under fivefold gradient conditions of TEACl, a reversal potential of +21.5 +/- 2.8 mV was measured demonstrating anion-to-cation discrimination. As previously demonstrated for the rabbit ClC-2G(2 alpha) Cl- channel, the human analog, hClC-2G(2 alpha), was active at pH 7.4 as well as when the pH of the extracellular face of the channel (trans side of the bilayer; pHtrans) was asymmetrically reduced to pH 3.0. The extent of PKA activation was dependent on pHtrans. With PKA treatment, Po increased fourfold with a pHtrans of 7.4 and eightfold with a pHtrans of 3.0. Effects of sequential PKA addition followed by pHtrans reduction on the same channel suggested that the PKA- and pH-dependent increases in channel Po were separable and cumulative. Northern analysis showed ClC-2G(2 alpha) mRNA to be present in human adult and fetal lung and adult stomach, and quantitative reverse transcriptase-polymerase chain reaction showed this channel to be present in the adult human lung and stomach at about one-half the level found in fetal lung. The findings of the present study suggest that the ClC-2G(2 alpha) Cl- channel may play an important role in Cl- transport in the fetal and adult human lung.

  11. Mapping Flagellar Genes in Chlamydomonas Using Restriction Fragment Length Polymorphisms

    PubMed Central

    Ranum, LPW.; Thompson, M. D.; Schloss, J. A.; Lefebvre, P. A.; Silflow, C. D.

    1988-01-01

    To correlate cloned nuclear DNA sequences with previously characterized mutations in Chlamydomonas and, to gain insight into the organization of its nuclear genome, we have begun to map molecular markers using restriction fragment length polymorphisms (RFLPs). A Chlamydomonas reinhardtii strain (CC-29) containing phenotypic markers on nine of the 19 linkage groups was crossed to the interfertile species Chlamydomonas smithii. DNA from each member of 22 randomly selected tetrads was analyzed for the segregation of RFLPs associated with cloned genes detected by hybridization with radioactive DNA probes. The current set of markers allows the detection of linkage to new molecular markers over approximately 54% of the existing genetic map. This study focused on mapping cloned flagellar genes and genes whose transcripts accumulate after deflagellation. Twelve different molecular clones have been assigned to seven linkage groups. The α-1 tubulin gene maps to linkage group III and is linked to the genomic sequence homologous to pcf6-100, a cDNA clone whose corresponding transcript accumulates after deflagellation. The α-2 tubulin gene maps to linkage group IV. The two β-tubulin genes are linked, with the β-1 gene being approximately 12 cM more distal from the centromere than the β-2 gene. A clone corresponding to a 73-kD dynein protein maps to the opposite arm of the same linkage group. The gene corresponding to the cDNA clone pcf6-187, whose mRNA accumulates after deflagellation, maps very close to the tightly linked pf-26 and pf-1 mutations on linkage group V. PMID:2906025

  12. Development and Characterization of an Infectious cDNA Clone of the Modified Live Virus Vaccine Strain of Equine Arteritis Virus

    PubMed Central

    Zhang, Jianqiang; Go, Yun Young; Huang, Chengjin M.; Meade, Barry J.; Lu, Zhengchun; Snijder, Eric J.; Timoney, Peter J.

    2012-01-01

    A stable full-length cDNA clone of the modified live virus (MLV) vaccine strain of equine arteritis virus (EAV) was developed. RNA transcripts generated from this plasmid (pEAVrMLV) were infectious upon transfection into mammalian cells, and the resultant recombinant virus (rMLV) had 100% nucleotide identity to the parental MLV vaccine strain of EAV. A single silent nucleotide substitution was introduced into the nucleocapsid gene (pEAVrMLVB), enabling the cloned vaccine virus (rMLVB) to be distinguished from parental MLV vaccine as well as other field and laboratory strains of EAV by using an allelic discrimination real-time reverse transcription (RT)-PCR assay. In vitro studies revealed that the cloned vaccine virus rMLVB and the parental MLV vaccine virus had identical growth kinetics and plaque morphologies in equine endothelial cells. In vivo studies confirmed that the cloned vaccine virus was very safe and induced high titers of neutralizing antibodies against EAV in experimentally immunized horses. When challenged with the heterologous EAV KY84 strain, the rMLVB vaccine virus protected immunized horses in regard to reducing the magnitude and duration of viremia and virus shedding but did not suppress the development of signs of EVA, although these were reduced in clinical severity. The vaccine clone pEAVrMLVB could be further manipulated to improve the vaccine efficacy as well as to develop a marker vaccine for serological differentiation of EAV naturally infected from vaccinated animals. PMID:22739697

  13. [Three regions of Rpb10 mini-subunit of nuclear RNA polymerases are strictly conserved in all eukaryotes].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N

    1996-12-01

    The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.

  14. Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.

    PubMed

    Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk

    2016-05-01

    Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Transduction of human IL-9 receptor cDNA into TF1 cells induces IL-9 dependency and erythroid differentiation.

    PubMed

    Xiao, M; Luo, Z; Mantel, C; Broxmeyer, H E; Lu, L

    2000-02-01

    Human growth factor-dependent cell line TF1, which lacks interleukin (IL)-9 receptors (R) and does not grow in IL-9, was transduced with a retroviral vector containing human IL-9R cDNA and a selection marker. An IL-9-dependent TF1 cell line, which could also grow in other cytokines, was established after selection in G418 and could produce mature RBC in response to cytokine stimulation. TF1 cells transduced with the same viral vector without the IL-9R insert cDNA (mock control) and then selected responded the same as nontransduced TF1 cells. They failed to grow in response to IL-9 and did not generate RBC. An increased number and size of burst-forming units-erythroid (BFU-E)-like colonies were detected from IL-9R-transduced TF1 cells, compared with mock-transduced cells, in response to erythropoietin (EPO) and IL-9. To evaluate self-renewal and differentiation capacity, colony-replating assays were performed in the presence of IL-3, GM-CSF, IL-9, and EPO. After four replatings, the cloning efficiency of IL-9R-transduced TF1 cells decreased from 98% to 38%, most likely due to terminal erythroid cell differentiation. In contrast, no change in replating efficiency was detected in mock-transduced cells. TF1 cells stably expressing IL-9R and responding to IL-9 can serve as a cell line model to study the intracellular signals mediating IL-9-induced erythroid cell proliferation and differentiation.

  16. Four subunits that are shared by the three classes of RNA polymerase are functionally interchangeable between Homo sapiens and Saccharomyces cerevisiae.

    PubMed Central

    Shpakovski, G V; Acker, J; Wintzerith, M; Lacroix, J F; Thuriaux, P; Vigneron, M

    1995-01-01

    Four cDNAs encoding human polypeptides hRPB7.0, hRPB7.6, hRPB17, and hRPB14.4 (referred to as Hs10 alpha, Hs10 beta, Hs8, and Hs6, respectively), homologous to the ABC10 alpha, ABC10 beta, ABC14.5, and ABC23 RNA polymerase subunits (referred to as Sc10 alpha, Sc10 beta, Sc8, and Sc6, respectively) of Saccharomyces cerevisiae, were cloned and characterized for their ability to complement defective yeast mutants. Hs10 alpha and the corresponding Sp10 alpha of Schizosaccharomyces pombe can complement an S. cerevisiae mutant (rpc10-delta::HIS3) defective in Sc10 alpha. The peptide sequences are highly conserved in their carboxy-terminal halves, with an invariant motif CX2CX12RCX2CGXR corresponding to a canonical zinc-binding domain. Hs10 beta, Sc10 beta, and the N subunit of archaeal RNA polymerase are homologous. An invariant CX2CGXnCCR motif presumably forms an atypical zinc-binding domain. Hs10 beta, but not the archaeal subunit, complemented an S. cerevisiae mutant (rpb10-delta 1::HIS3) lacking Sc10 beta. Hs8 complemented a yeast mutant (rpb8-delta 1::LYS2) defective in the corresponding Sc8 subunit, although with a strong thermosensitive phenotype. Interspecific complementation also occurred with Hs6 and with the corresponding Dm6 cDNA of Drosophila melanogaster. Hs6 cDNA and the Sp6 cDNA of S. pombe are dosage-dependent suppressors of rpo21-4, a mutation generating a slowly growing yeast defective in the largest subunit of RNA polymerase II. Finally, a doubly chimeric S. cerevisiae strain bearing the Sp6 cDNA and the human Hs10 beta cDNA was also viable. No interspecific complementation was observed for the human hRPB25 (Hs5) homolog of the yeast ABC27 (Sc5) subunit. PMID:7651387

  17. Molecular cloning and characterization of a cDNA encoding a novel apoplastic protein preferentially expressed in a shikonin-producing callus strain of Lithospermum erythrorhizon.

    PubMed

    Yamamura, Yoshimi; Sahin, F Pinar; Nagatsu, Akito; Mizukami, Hajime

    2003-04-01

    A cDNA (LEPS-2) encoding a novel cell wall protein was cloned from shikonin-producing callus tissues of Lithospermum erythrorhizon by differential display between a shikonin-producing culture strain and a non-producing strain. The LEPS-2 cDNA encoded a polypeptide of 184 amino acids. The deduced amino acid sequence exhibited no significant homology with known proteins. Expression of LEPS-2 gene as well as accumulation of LEPS-2 protein was highly correlated with shikonin production in L. erythrorhizon cells in culture. In the intact plant, expression of LEPS-2 was detected only in the roots where shikonin pigments accumulated. Cell fractionation experiments and immunocytochemical analysis showed that the protein was localized in the apoplast fraction of the cell walls. The shikonin pigments were also stored on the cell walls as oil droplets. These results indicate that expression of the LEPS-2 is closely linked with shikonin biosynthesis and the LEPS-2 protein may be involved in the intra-cell wall trapping of shikonin pigments.

  18. An open reading frame in intron seven of the sea urchin DNA-methyltransferase gene codes for a functional AP1 endonuclease.

    PubMed

    Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita

    2002-08-01

    Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.

  19. Studies of the effects of Vilon and Epithalon on gene expression in mouse heart using DNA-microarray technology.

    PubMed

    Anisimov, S V; Bokheler, K R; Khavinson, V Kh; Anisimov, V N

    2002-03-01

    Expression of 15,247 clones from a cDNA library in the heart of mice receiving Vilon and Epithalon was studied by DNA-microarray technology. We revealed 300 clones (1.94% of the total count), whose expression changed more than by 2 times. Vilon changed expression of 36 clones, while Epithalon modulated expression of 98 clones. Combined treatment with Vilon and Epithalon changed expression of 144 clones. Vilon alone or in combination with Epithalon activated expression of 157 clones (maximally by 6.13 times) and inhibited expression of 23 clones (maximally by 2.79 times). Epithalon alone or in combination with Vilon activated expression of 194 clones (maximally by 6.61 times) and inhibited expression of 48 clones (maximally by 2.71 times). Our results demonstrate the specific effects of Epithalon and Vilon on gene expression.

  20. The active gene that encodes human High Mobility Group 1 protein (HMG1) contains introns and maps to chromosome 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferrari, S.; Finelli, P.; Rocchi, M.

    The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mousemore » Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.« less

Top