Sample records for human cdna libraries

  1. Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

    PubMed

    Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

    2014-09-01

    Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. [Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

    PubMed

    Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

    2005-03-01

    To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

  3. cDNA library construction of two human Demodexspecies.

    PubMed

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  4. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  5. High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hadano, S.; Ishida, Y.; Tomiyasu, H.

    1994-09-01

    To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

  6. Comparison of the canine and human acid {beta}-galactosidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

    Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

  7. Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

    PubMed

    Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

    2005-12-02

    cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

  8. Genomic clones for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kott, M.; Venta, P.J.; Larsen, J.

    1987-05-01

    A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

  9. Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

    PubMed

    Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

    2010-04-01

    We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

  10. Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

    PubMed Central

    Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

  11. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

  12. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  13. Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

    PubMed

    Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

    2002-06-15

    To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

  14. An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

    PubMed Central

    Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

    2015-01-01

    The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

  15. [cDNA library construction from panicle meristem of finger millet].

    PubMed

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  16. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  17. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  18. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  19. Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

    PubMed

    Lu, L; Komada, M; Kitamura, N

    1998-06-15

    Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

  20. cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

    MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

  1. Structure and chromosomal localization of the human PD-1 gene (PDCD1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shinohara, T.; Ishida, Y.; Kawaichi, M.

    1994-10-01

    A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

  2. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  3. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1998-11-03

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

  4. Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

    PubMed Central

    Travis, G H; Sutcliffe, J G

    1988-01-01

    To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

  5. cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cool, D.E.; Tonks, N.K.; Charbonneau, H.

    1989-07-01

    A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

  6. Identification of genes differentially expressed in association with acquired cisplatin resistance

    PubMed Central

    Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G

    2000-01-01

    The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653

  7. Constructing and detecting a cDNA library for mites.

    PubMed

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  8. Expressed sequence tag analysis of adult human optic nerve for NEIBank: Identification of cell type and tissue markers

    PubMed Central

    Bernstein, Steven L; Guo, Yan; Peterson, Katherine; Wistow, Graeme

    2009-01-01

    Background The optic nerve is a pure white matter central nervous system (CNS) tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR) and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data provide an initial overview of gene expression patterns in this tissue. The data provide clues for tissue-specific and species-specific properties of human ON that will help in design of therapeutic models. PMID:19778450

  9. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  10. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  11. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1996-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  12. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1996-01-09

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  13. Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

    PubMed Central

    Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

    2004-01-01

    We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

  14. [Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

    PubMed

    Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

    2003-07-01

    Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

  15. Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

    PubMed

    Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

    2004-12-15

    cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

  16. Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

    PubMed

    Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

    2009-09-01

    We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

  17. An anti-tumor protein produced by Trichinella spiralis and identified by screening a T7 phage display library, induces apoptosis in human hepatoma H7402 cells

    USDA-ARS?s Scientific Manuscript database

    Trichinella spiralis infection confers effective resistance to tumor cell expansion. In this study, a T7 phage cDNA display library was constructed to express genes encoded by T. spiralis. Organic phase multi-cell screening was used to sort through candidate proteins in a transfected human chronic m...

  18. Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

    PubMed

    Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

    2003-09-01

    The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

  19. Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

    PubMed Central

    Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

    2016-01-01

    A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

  20. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  1. [Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

    PubMed

    Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

    2017-04-12

    Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

  2. Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

    PubMed

    Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

    2002-09-01

    A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

  3. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    PubMed

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  4. Brain cDNA clone for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McTiernan, C.; Adkins, S.; Chatonnet, A.

    1987-10-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

  5. Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

    PubMed Central

    Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

    1991-01-01

    Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

  6. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  7. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  8. Horse cDNA clones encoding two MHC class I genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbis, D.P.; Maher, J.K.; Stanek, J.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  9. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, M.D.; Soares, M.B.

    1997-12-30

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

  10. Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

    PubMed

    Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

    1997-06-05

    We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

  11. Display of a maize cDNA library on baculovirus infected insect cells.

    PubMed

    Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A

    2008-08-12

    Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  12. A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.

    PubMed

    Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S

    2003-06-01

    The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.

  13. HUNT: launch of a full-length cDNA database from the Helix Research Institute.

    PubMed

    Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

    2001-01-01

    The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

  14. Sequence and pattern of expression of a bovine homologue of a human mitochondrial transport protein associated with Grave's disease.

    PubMed

    Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F

    1992-01-01

    A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.

  15. Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism

    PubMed Central

    Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang

    2013-01-01

    Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972

  16. Design and screening of M13 phage display cDNA libraries.

    PubMed

    Georgieva, Yuliya; Konthur, Zoltán

    2011-02-17

    The last decade has seen a steady increase in screening of cDNA expression product libraries displayed on the surface of filamentous bacteriophage. At the same time, the range of applications extended from the identification of novel allergens over disease markers to protein-protein interaction studies. However, the generation and selection of cDNA phage display libraries is subjected to intrinsic biological limitations due to their complex nature and heterogeneity, as well as technical difficulties regarding protein presentation on the phage surface. Here, we review the latest developments in this field, discuss a number of strategies and improvements anticipated to overcome these challenges making cDNA and open reading frame (ORF) libraries more readily accessible for phage display. Furthermore, future trends combining phage display with next generation sequencing (NGS) will be presented.

  17. Sequence verification as quality-control step for production of cDNA microarrays.

    PubMed

    Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

    2001-07-01

    To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

  18. Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

    PubMed

    Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

    1999-10-06

    The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

  19. Construction of a High-Quality Yeast Two-Hybrid Library and Its Application in Identification of Interacting Proteins with Brn1 in Curvularia lunata.

    PubMed

    Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie

    2015-06-01

    Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.

  20. The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

    PubMed Central

    Allison, J; Hall, L; MacIntyre, I; Craig, R K

    1981-01-01

    (1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

  1. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    PubMed Central

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  2. The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

    PubMed Central

    2004-01-01

    The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

  3. Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

    PubMed Central

    Eberwine, James; Bartfai, Tamas

    2011-01-01

    We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

  4. The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simmons, C.F. Jr.; Clancy, T.E.; Quan, R.

    1995-04-10

    The human oxytocin receptor regulates parturition and myometrial contractility, breast milk let-down, and reproductive behaviors in the mammalian central nervous system. Kimura et al. recently identified a human oxytocin receptor cDNA by means of expression cloning from a human myometrial cDNA library. To elucidate further the molecular mechanisms that regulate oxytocin receptor gene expression and to define the expected Mendelian inheritance of possible human disease states, we must determine the number of genes, their localization, and their organization and structure. We summarize below our data indicating that the human oxytocin receptor gene is localized to 3p25 and exists as amore » single copy in the haploid genome. 9 refs., 2 figs.« less

  5. Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

    PubMed

    Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

    1987-01-26

    Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

  6. Diagnostic value of protein chips constructed by lung-cancer-associated markers selected by the T7 phage display library.

    PubMed

    Li, Hong-Mei; Guo, Kang; Yu, Zhuang; Feng, Rui; Xu, Ping

    2015-07-01

    Traditional diagnostic technology with tumor biomarkers is inefficient, expensive and requires a large number of serum samples. The purpose of this study was to construct human lung cancer protein chips with new lung cancer biomarkers screened by the T7-phage display library, and improve the early diagnosis rate of lung cancer. A T7-phage cDNA display library was constructed of fresh samples from 30 lung cancer patients. With biopanning and high-throughput screening, we gained the immunogenic phage clones from the cDNA library. The insert of selected phage was blasted at GeneBank for alignment to find the exact or the most similar known genes. Protein chips were then constructed and used to assay their expression level in lung cancer serum from 217 cases of lung cancer groups:80 cases of benign lung disease and 220 healthy controls. After four rounds of Biopanning and two rounds of enzyme-linked immunosorbent assay, 12 phage monoclonal samples were selected from 2880 phage monoclonal samples. After blasting at GeneBank, six similar genes were used to construct diagnostic protein chips. The protein chips were then used to assay expression level in lung cancer serum. The expression level of six genes in lung cancer groups was significantly higher than those in the other two groups (P < 0.05). In this study, we successfully constructed diagnostic protein chips with biomarkers selected from the lung cancer T7-phage cDNA library, which can be used for the early screening of lung cancer patients.

  7. Miniaturization Technologies for Efficient Single-Cell Library Preparation for Next-Generation Sequencing.

    PubMed

    Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C

    2016-08-01

    As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.

  8. Construction of a cDNA library for miniature pig mandibular deciduous molars

    PubMed Central

    2014-01-01

    Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

  9. Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank

    PubMed Central

    Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.

    2008-01-01

    Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676

  10. Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

    PubMed

    Eberwine, James; Bartfai, Tamas

    2011-03-01

    We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  12. Anti-liver-kidney microsome antibody type 1 recognizes human cytochrome P450 db1.

    PubMed

    Gueguen, M; Yamamoto, A M; Bernard, O; Alvarez, F

    1989-03-15

    Anti-liver-kidney microsome antibody type 1 (LKM1), present in the sera of a group of children with autoimmune hepatitis, was recently shown to recognize a 50 kDa protein identified as rat liver cytochromes P450 db1 and db2. High homology between these two members of the rat P450 IID subfamily and human P450 db1 suggested that anti-LKM1 antibody is directed against this human protein. To test this hypothesis, a human liver cDNA expression library in phage lambda GT-11 was screened using rat P450 db1 cDNA as a probe. Two human cDNA clones were found to be identical to human P450 db1 by restriction mapping. Immunoblot analysis using as antigen, the purified fusion protein from one of the human cDNA clones showed that only anti-LKM1 with anti-50 kDa reactivity recognized the fusion protein. This fusion protein was further used to develop an ELISA test that was shown to be specific for sera of children with this disease. These results: 1) identify the human liver antigen recognized by anti-LKM1 auto-antibodies as cytochrome P450 db1, 2) allow to speculate that mutation on the human P450 db1 gene could alter its expression in the hepatocyte and make it auto-antigenic, 3) provide a simple and specific diagnostic test for this disease.

  13. A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

    EPA Science Inventory

    A Bioinformatic Strategy to Rapidly Characterize cDNA Libraries

    G. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.
    1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

  14. [Construction of fetal mesenchymal stem cell cDNA subtractive library].

    PubMed

    Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

    2002-04-01

    To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

  15. A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

    PubMed

    Gadkar, Vijay J; Filion, Martin

    2013-06-01

    In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

  16. Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

    PubMed Central

    Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

    1992-01-01

    cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

  17. Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

    PubMed

    Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

    1994-03-01

    Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

  18. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

    1987-06-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

  19. Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

    NASA Technical Reports Server (NTRS)

    Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

    1997-01-01

    A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

  20. Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

    PubMed Central

    Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

    2010-01-01

    In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

  1. Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

    PubMed

    Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

    2009-10-01

    Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

  2. Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

    PubMed Central

    Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

    2007-01-01

    Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

  3. Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Livi, G.P.; McHale, M.J.; Sathe, G.M.

    1990-06-01

    The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

  4. hEcd, A Novel Regulator of Mammary Epithelial Cell Survival

    DTIC Science & Technology

    2009-09-01

    theYeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient oncogene to immortalize hMECs in vitro) as a bait and mammary...transformation. We have identified a novel protein us ing the Yeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient...epithelial cell cDNA library, we identified hEcd ( human orthologue of Drosophila Ecdysoneless) as a novel E6 binding partner. To study the cellular

  5. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    USDA-ARS?s Scientific Manuscript database

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  6. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    PubMed

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  7. Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

    1994-07-15

    The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

  8. Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin

    PubMed Central

    Loit, Evelin; Melnyk, Charles W; MacFarlane, Amanda J; Scott, Fraser W; Altosaar, Illimar

    2009-01-01

    Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D). Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s) encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health. PMID:19615078

  9. In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

    PubMed Central

    Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

    2005-01-01

    The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

  10. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

    PubMed Central

    Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

  11. ORF phage display to identify cellular proteins with different functions.

    PubMed

    Li, Wei

    2012-09-01

    Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage. lambda. immunoexpression library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullinax, R.L.; Gross, E.A.; Amberg, J.R.

    1990-10-01

    The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less

  13. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    PubMed

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  14. Identification of Novel Targets of the Human Cell Cycle Regulatory Protein Cdc34

    DTIC Science & Technology

    1998-07-01

    Bohman, for stains and plamids, J. La Baer for the cDNA library, C. Molina, H. P. Roest, J. Hoeijmaker, P. Sassone-Corsi for antisera, and to Shirong...mammalian CDC34 cell cycle gene. American Association of Cancer Research, 36, A191 (1995). Hershko, A., Role of ubiquitin-mediated proteolysis in cell

  15. Rapid in silico cloning of genes using expressed sequence tags (ESTs).

    PubMed

    Gill, R W; Sanseau, P

    2000-01-01

    Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

  16. Human somatostatin I: sequence of the cDNA.

    PubMed Central

    Shen, L P; Pictet, R L; Rutter, W J

    1982-01-01

    RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

  17. Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.

    PubMed

    Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun

    2018-06-26

    Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.

  18. Construction and application of EST library from Setaria italica in response to dehydration stress.

    PubMed

    Zhang, Jinpeng; Liu, Tingsong; Fu, Junjie; Zhu, Yun; Jia, Jinping; Zheng, Jun; Zhao, Yinhe; Zhang, Ying; Wang, Guoying

    2007-07-01

    Foxtail millet is a gramineous crop with low water requirement. Despite its high water use efficiency, less attention has been paid to the molecular genetics of foxtail millet. This article reports the construction of subtracted cDNA libraries from foxtail millet seedlings under dehydration stress and the expression profile analysis of 1947 UniESTs from the subtracted cDNA libraries by a cDNA microarray. The results showed that 95 and 57 ESTs were upregulated by dehydration stress, respectively, in roots and shoots of seedlings and that 10 and 27 ESTs were downregulated, respectively, in roots and shoots. The expression profile analysis showed that genes induced in foxtail millet roots were different from those in shoots during dehydration stress and that the early response to dehydration stress in foxtail millet roots was the activation of the glycolysis metabolism. Moreover, protein degradation pathway may also play a pivotal role in drought-tolerant responses of foxtail millet. Finally, Northern blot analysis validated well the cDNA microarray data.

  19. Using genome-wide CRISPR library screening with library resistant DCK to find new sources of Ara-C drug resistance in AML.

    PubMed

    Kurata, Morito; Rathe, Susan K; Bailey, Natashay J; Aumann, Natalie K; Jones, Justine M; Veldhuijzen, G Willemijn; Moriarity, Branden S; Largaespada, David A

    2016-11-03

    Acute myeloid leukemia (AML) can display de novo or acquired resistance to cytosine arabinoside (Ara-C), a primary component of induction chemotherapy. To identify genes capable of independently imposing Ara-C resistance, we applied a genome-wide CRISPR library to human U937 cells and exposed to them to Ara-C. Interestingly, all drug resistant clones contained guide RNAs for DCK. To avoid DCK gene modification, gRNA resistant DCK cDNA was created by the introduction of silent mutations. The CRISPR screening was repeated using the gRNA resistant DCK, and loss of SLC29A was identified as also being capable of conveying Ara-C drug resistance. To determine if loss of Dck results in increased sensitivity to other drugs, we conducted a screen of 446 FDA approved drugs using two Dck-defective BXH-2 derived murine AML cell lines and their Ara-C sensitive parental lines. Both cell lines showed an increase in sensitivity to prednisolone. Guide RNA resistant cDNA rescue was a legitimate strategy and multiple DCK or SLC29A deficient human cell clones were established with one clone becoming prednisolone sensitive. Dck-defective leukemic cells may become prednisolone sensitive indicating prednisolone may be an effective adjuvant therapy in some cases of DCK-negative AML.

  20. Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

    PubMed Central

    Huebner, K; Druck, T; Croce, C M; Thiesen, H J

    1991-01-01

    cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

  1. Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiktorowicz, J.E.; Whitman, J.M.

    1986-05-01

    Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less

  2. Identification and genetic mapping of a homeobox gene to the 4p16. 1 region of human chromosome 4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stadler, H.S.; Padanilam, B.J.; Solursh, M.

    1992-12-01

    A human craniofacial cDNA library was screened with a degenerate oligonucleotide probe based on the conserved third helix of homeobox genes. From this screening, we identified a homeobox gene, H6, which shared only 57-65% amino acid identity to previously reported homeodomains. H6 was physically mapped to the 4P16.1 region by using somatic cell hybrids containing specific deletions of human chromosome 4. Linkage data from a single-stranded conformational polymorphism derived from the 3[prime] untranslated region of the H6 cDNA placed this homeobox gene more than 20 centimorgans proximal of the previously mapped HOX7 gene on chromosome 4. Identity comparisons of themore » H6 Homeodomain with previously reported homeodomains reveal the highest identities to be with the Nk class of homeobox genes in Drosophila melanogaster. 53 refs., 5 figs., 2 tabs.« less

  3. Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

    NASA Astrophysics Data System (ADS)

    Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

    1995-12-01

    Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

  4. An annotated cDNA library of juvenile Euprymna scolopes with and without colonization by the symbiont Vibrio fischeri

    PubMed Central

    Chun, Carlene K; Scheetz, Todd E; Bonaldo, Maria de Fatima; Brown, Bartley; Clemens, Anik; Crookes-Goodson, Wendy J; Crouch, Keith; DeMartini, Tad; Eyestone, Mari; Goodson, Michael S; Janssens, Bernadette; Kimbell, Jennifer L; Koropatnick, Tanya A; Kucaba, Tamara; Smith, Christina; Stewart, Jennifer J; Tong, Deyan; Troll, Joshua V; Webster, Sarahrose; Winhall-Rice, Jane; Yap, Cory; Casavant, Thomas L; McFall-Ngai, Margaret J; Soares, M Bento

    2006-01-01

    Background Biologists are becoming increasingly aware that the interaction of animals, including humans, with their coevolved bacterial partners is essential for health. This growing awareness has been a driving force for the development of models for the study of beneficial animal-bacterial interactions. In the squid-vibrio model, symbiotic Vibrio fischeri induce dramatic developmental changes in the light organ of host Euprymna scolopes over the first hours to days of their partnership. We report here the creation of a juvenile light-organ specific EST database. Results We generated eleven cDNA libraries from the light organ of E. scolopes at developmentally significant time points with and without colonization by V. fischeri. Single pass 3' sequencing efforts generated 42,564 expressed sequence tags (ESTs) of which 35,421 passed our quality criteria and were then clustered via the UIcluster program into 13,962 nonredundant sequences. The cDNA clones representing these nonredundant sequences were sequenced from the 5' end of the vector and 58% of these resulting sequences overlapped significantly with the associated 3' sequence to generate 8,067 contigs with an average sequence length of 1,065 bp. All sequences were annotated with BLASTX (E-value < -03) and Gene Ontology (GO). Conclusion Both the number of ESTs generated from each library and GO categorizations are reflective of the activity state of the light organ during these early stages of symbiosis. Future analyses of the sequences identified in these libraries promise to provide valuable information not only about pathways involved in colonization and early development of the squid light organ, but also about pathways conserved in response to bacterial colonization across the animal kingdom. PMID:16780587

  5. Differential cDNA cloning by enzymatic degrading subtraction (EDS).

    PubMed Central

    Zeng, J; Gorski, R A; Hamer, D

    1994-01-01

    We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

  6. Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

    Cancer.gov

    The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

  7. Construction of cDNA expression library of watermelon for isolation of ClWRKY1 transcription factors gene involved in resistance to Fusarium wilt.

    PubMed

    Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun

    2014-08-01

    Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.

  8. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    PubMed

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  9. Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

    PubMed

    Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

    2017-02-16

    Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our results provide a cDNA expression library for further screening of T cell stimulating or inhibiting antigens of E. maxima. Moreover, our results provide six candidate protective antigens for developing new vaccines against E. maxima.

  10. Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

    PubMed

    Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

    2007-06-01

    As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

  11. Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

    PubMed Central

    2011-01-01

    Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

  12. Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.

    PubMed

    Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu

    2004-02-18

    By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.

  13. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  14. Human brain factor 1, a new member of the fork head gene family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, D.B.; Wiese, S.; Burfeind, P.

    1994-06-01

    Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less

  15. Genomic resources for songbird research and their use in characterizing gene expression during brain development

    PubMed Central

    Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

    2007-01-01

    Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

  16. Cloning of human cDNA encoding a novel heptahelix receptor expressed in Burkitt's lymphoma and widely distributed in brain and peripheral tissues.

    PubMed

    Owman, C; Blay, P; Nilsson, C; Lolait, S J

    1996-11-12

    Using PCR with degenerate primers and screening of a human B-cell lymphoblast cDNA library, a full-length cDNA encoding a 375-amino-acid protein was isolated. It contains seven regions of hydrophobic amino acids probably representing membrane-spanning domains of a novel heptahelix receptor, tentatively named CMKRL2. It shows nearly 30% overall identity with the high-affinity IL8 receptor and similar degree of homology with other chemoattractant receptors, including the "fusin" coreceptors for HIV1. Measurements of various transduction pathways following application of a panel of chemokines to transfected cells failed to evoke any reproducible response. Although the natural ligand for CMKRL2 could, thus, not be identified, receptor expression in spleen and lymph nodes as well as in Burkitt's lymphoma (irrespective of EBV status) supports a functional role in activated B-cells. Receptor message was ubiquitously distributed in normal peripheral tissues and CNS, suggesting that CMKRL2 is expressed in widespread cell populations, such as macrophages and neuroglia.

  17. A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.

    PubMed

    Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka

    2008-04-01

    The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.

  18. Expression screening using a Medaka cDNA library identifies evolutionarily conserved regulators of the p53/Mdm2 pathway.

    PubMed

    Zhang, Ping; Kratz, Anne Sophie; Salama, Mohammed; Elabd, Seham; Heinrich, Thorsten; Wittbrodt, Joachim; Blattner, Christine; Davidson, Gary

    2015-10-08

    The p53 tumor suppressor protein is mainly regulated by alterations in the half-life of the protein, resulting in significant differences in p53 protein levels in cells. The major regulator of this process is Mdm2, which ubiquitinates p53 and targets it for proteasomal degradation. This process can be enhanced or reduced by proteins that associate with p53 or Mdm2 and several proteins have been identified with such an activity. Furthermore, additional ubiquitin ligases for p53 have been identified in recent years. Nevertheless, our understanding of how p53 abundance and Mdm2 activity are regulated remains incomplete. Here we describe a cell culture based overexpression screen to identify evolutionarily conserved regulators of the p53/Mdm2 circuit. The results from this large-scale screening method will contribute to a better understanding of the regulation of these important proteins. Expression screening was based on co-transfection of H1299 cells with pools of cDNA's from a Medaka library together with p53, Mdm2 and, as internal control, Ror2. After cell lysis, SDS-PAGE/WB analysis was used to detect alterations in these proteins. More than one hundred hits that altered the abundance of either p53, Mdm2, or both were identified in the primary screen. Subscreening of the library pools that were identified in the primary screen identified several potential novel regulators of p53 and/or Mdm2. We also tested whether the human orthologues of the Medaka genes regulate p53 and/or Mdm2 abundance. All human orthologues regulated p53 and/or Mdm2 abundance in the same manner as the proteins from Medaka, which underscores the suitability of this screening methodology for the identification of new modifiers of p53 and Mdm2. Despite enormous efforts in the last two decades, many unknown regulators for p53 and Mdm2 abundance are predicted to exist. This cross-species approach to identify evolutionarily conserved regulators demonstrates that our Medaka unigene cDNA library represents a powerful tool to screen for these novel regulators of the p53/Mdm2 pathway.

  19. Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis

    PubMed Central

    Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.

    1999-01-01

    With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933

  20. The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stapleton, Mark; Liao, Guochun; Brokstein, Peter

    2002-08-12

    Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

  1. Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

    1996-01-15

    The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

  2. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, J.; Varner, J.E.

    1985-07-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

  3. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  4. Errors in CGAP xProfiler and cDNA DGED: the importance of library parsing and gene selection algorithms.

    PubMed

    Milnthorpe, Andrew T; Soloviev, Mikhail

    2011-04-15

    The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used.

  5. Errors in CGAP xProfiler and cDNA DGED: the importance of library parsing and gene selection algorithms

    PubMed Central

    2011-01-01

    Background The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. Results We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Conclusion Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used. PMID:21496233

  6. Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

    PubMed Central

    Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

    1994-01-01

    Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

  7. A simple and novel method for RNA-seq library preparation of single cell cDNA analysis by hyperactive Tn5 transposase.

    PubMed

    Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta

    2012-10-01

    Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.

  8. Sequence evaluation of four specific cDNA libraries for developmental genomics of sunflower.

    PubMed

    Tamborindeguy, C; Ben, C; Liboz, T; Gentzbittel, L

    2004-04-01

    Four different cDNA libraries were constructed from sunflower protoplasts growing under embryogenic and non-embryogenic conditions: one standard library from each condition and two subtractive libraries in opposite sense. A total of 22,876 cDNA clones were obtained and 4800 ESTs were sequenced, giving rise to 2479 high quality ESTs representing an unigene set of 1502 sequences. This set was compared with ESTs represented in public databases using the programs BLASTN and BLASTX, and its members were classified according to putative function using the catalog in the Kyoto Encyclopedia of Genes and Genomes (KEGG). Some 33% of sequences failed to align with existing plant ESTs and therefore represent putative novel genes. The libraries show a low level of redundancy and, on average, 50% of the present ESTs have not been previously reported for sunflower. Several potentially interesting genes were identified, based on their homology with genes involved in animal zygotic division or plant embryogenesis. We also identified two ESTs that show significantly different levels of expression under embryogenic and non-embryogenic conditions. The libraries described here represent an original and valuable resource for the discovery of yet unknown genes putatively involved in dicot embryogenesis and improving our knowledge of the mechanisms involved in polarity acquisition by plant embryos.

  9. Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Montermini, L.; Zara, F.; Pandolfo, M.

    1994-09-01

    Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

  10. Construction and Evaluation of Normalized cDNA Libraries Enriched with Full-Length Sequences for Rapid Discovery of New Genes from Sisal (Agave sisalana Perr.) Different Developmental Stages

    PubMed Central

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-01-01

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944

  11. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  12. The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

    PubMed

    Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

    1990-01-05

    We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

  13. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  14. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  15. Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis.

    PubMed

    Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela

    2013-10-30

    Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.

  16. Construction and characterization of a normalized cDNA library of Nannochloropsis oculata (Eustigmatophyceae)

    NASA Astrophysics Data System (ADS)

    Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong

    2010-07-01

    We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.

  17. Expression and kinetic properties of a recombinant 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzyme of human liver.

    PubMed

    Deyashiki, Y; Tamada, Y; Miyabe, Y; Nakanishi, M; Matsuura, K; Hara, A

    1995-08-01

    Human liver cytosol contains multiple forms of 3 alpha-hydroxysteroid dehydrogenase and dihydrodiol dehydrogenase with hydroxysteroid dehydrogenase activity, and multiple cDNAs for the enzymes have been cloned from human liver cDNA libraries. To understand the relationship of the multiple enzyme froms to the genes, a cDNA, which has been reported to code for an isoenzyme of human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase, was expressed in Escherichia coli. The recombinant enzyme showed structural and functional properties almost identical to those of the isoenzyme purified from human liver. In addition, the recombinant isoenzyme efficiently reduced 5 alpha-dihydrotestosterone and 5 beta-dihydrocortisone, the known substrates of human liver 3 alpha-hydroxysteroid dehydrogenase and chlordecone reductase previously purified, which suggests that these human liver enzymes are identical. Furthermore, the steady-state kinetic data for NADP(+)-linked (S)-1-indanol oxidation by the recombinant isoenzyme were consistent with a sequential ordered mechanism in which NADP+ binds first. Phenolphthalein inhibited this isoenzyme much more potently than it did the other human liver dihydrodiol dehydrogenases, and was a competitive inhibitor (Ki = 20 nM) that bound to the enzyme-NADP+ complex.

  18. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    PubMed

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  19. Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.

    PubMed Central

    Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E

    1987-01-01

    We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261

  20. Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas.

    PubMed

    Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C

    1994-06-17

    A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.

  1. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    PubMed Central

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  2. Construction of a full-length enriched cDNA library and preliminary analysis of expressed sequence tags from Bengal Tiger Panthera tigris tigris.

    PubMed

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-05-24

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  3. Identification and characterization of antimicrobial peptide, defensin, in the taiga tick, Ixodes persulcatus.

    PubMed

    Saito, Y; Konnai, S; Yamada, S; Imamura, S; Nishikado, H; Ito, T; Onuma, M; Ohashi, K

    2009-08-01

    Ixodes persulcatus is the primary vector for human tick-borne diseases in Japan. A cDNA library was constructed from whole body homogenates of fed nymphs of I. persulcatus. From this library, one cDNA encoding defensin-like antimicrobial peptide was identified. The amino-acid sequence showed high similarity to those of the defensins of other ticks and arthropods. I. persulcatus defensin mRNA transcripts were detected at all life cycle stages of fed ticks and found to be predominantly expressed in the midguts of adult female ticks, but not in the salivary glands, a finding corroborated by Western blotting analysis. To investigate the function of I. persulcatus defensin, we examined its antibacterial activity by evaluation of growth of several bacterial strains in the presence of the synthetic peptide. The defensin from I. persulcatus markedly inhibited the growth of Gram-positive bacteria including Staphylococcus aureus, Bacillus subtilis and Corynebacterium renale, but not Gram-negative bacteria except Escherichia coli O157. In conclusion, these results suggest that I. persulcatus defensin may be playing a significant role in the defence against microbes from bloodmeals.

  4. Comparison of the efficiency of antibody selection from semi-synthetic scFv and non-immune Fab phage display libraries against protein targets for rapid development of diagnostic immunoassays.

    PubMed

    Chan, Conrad E Z; Chan, Annie H Y; Lim, Angeline P C; Hanson, Brendon J

    2011-10-28

    Rapid development of diagnostic immunoassays against novel emerging or genetically modified pathogens in an emergency situation is dependent on the timely isolation of specific antibodies. Non-immune antibody phage display libraries are an efficient in vitro method for selecting monoclonal antibodies and hence ideal in these circumstances. Such libraries can be constructed from a variety of sources e.g. B cell cDNA or synthetically generated, and use a variety of antibody formats, typically scFv or Fab. However, antibody source and format can impact on the quality of antibodies generated and hence the effectiveness of this methodology for the timely production of antibodies. We have carried out a comparative screening of two antibody libraries, a semi-synthetic scFv library and a human-derived Fab library against the protective antigen toxin component of Bacillus anthracis and the epsilon toxin of Clostridium botulinum. We have shown that while the synthetic library produced a diverse collection of specific scFv-phage, these contained a high frequency of unnatural amber stops and glycosylation sites which limited their conversion to IgG, and also a high number which lost specificity when expressed as IgG. In contrast, these limitations were overcome by the use of a natural human library. Antibodies from both libraries could be used to develop sandwich ELISA assays with similar sensitivity. However, the ease and speed with which full-length IgG could be generated from the human-derived Fab library makes screening this type of library the preferable method for rapid antibody generation for diagnostic assay development. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. The construction of an EST database for Bombyx mori and its application

    PubMed Central

    Mita, Kazuei; Morimyo, Mitsuoki; Okano, Kazuhiro; Koike, Yoshiko; Nohata, Junko; Kawasaki, Hideki; Kadono-Okuda, Keiko; Yamamoto, Kimiko; Suzuki, Masataka G.; Shimada, Toru; Goldsmith, Marian R.; Maeda, Susumu

    2003-01-01

    To build a foundation for the complete genome analysis of Bombyx mori, we have constructed an EST database. Because gene expression patterns deeply depend on tissues as well as developmental stages, we analyzed many cDNA libraries prepared from various tissues and different developmental stages to cover the entire set of Bombyx genes. So far, the Bombyx EST database contains 35,000 ESTs from 36 cDNA libraries, which are grouped into ≈11,000 nonredundant ESTs with the average length of 1.25 kb. The comparison with FlyBase suggests that the present EST database, SilkBase, covers >55% of all genes of Bombyx. The fraction of library-specific ESTs in each cDNA library indicates that we have not yet reached saturation, showing the validity of our strategy for constructing an EST database to cover all genes. To tackle the coming saturation problem, we have checked two methods, subtraction and normalization, to increase coverage and decrease the number of housekeeping genes, resulting in a 5–11% increase of library-specific ESTs. The identification of a number of genes and comprehensive cloning of gene families have already emerged from the SilkBase search. Direct links of SilkBase with FlyBase and WormBase provide ready identification of candidate Lepidoptera-specific genes. PMID:14614147

  6. Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reilly, D.S.; Nussbaum, R.L.

    1994-09-01

    The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

  7. Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

    PubMed

    Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

    2003-04-02

    Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

  8. Purification and characterization of bovine cone arrestin (cArr).

    PubMed

    Maeda, T; Ohguro, H; Sohma, H; Kuroki, Y; Wada, H; Okisaka, S; Murakami, A

    2000-03-31

    To elucidate the quenching mechanism of phototransduction in vertebrate cone photoreceptors, a cDNA clone encoding cone specific arrestin (cArr) was isolated from a bovine retinal cDNA library using a human cArr cDNA probe. Affinity-purified anti-peptide antibody specific to cArr was prepared. Immunohistochemical staining displayed specific labeling of cArr in cone photoreceptors and immunoblotting identified a 46 kDa protein band. We purified cArr from bovine retinas by sequential column chromatography using DEAE-cellulose, gel filtration and mono Q columns. Binding studies revealed no binding of cArr to rhodopsin regardless of whether it was bleached and/or phosphorylated. cArr also failed to bind to heparin-Sepharose under conditions which rod arrestin (rArr) bound to the column. The present data suggest that cArr may play a role in the quenching of phototransduction in cone photoreceptors and that its activity therein is different to that of rArr.

  9. Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

    PubMed

    Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

    2004-05-01

    Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

  10. Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens

    PubMed Central

    Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J.; Rohan, Thomas; Ben-Dov, Iddo Z.

    2017-01-01

    Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens. PMID:28335433

  11. Non-biased and efficient global amplification of a single-cell cDNA library

    PubMed Central

    Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki

    2014-01-01

    Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095

  12. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haiming Chen; Lalioti, M.D.; Perrin, G.

    1996-07-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-binding cassette transporter gene family and is homologous to Drosophila w (and to 2 genes from other species) and tomore » a lesser extent to Drosophila brown (bw) and scarlet (st) genes that are all involved in the transport of eye pigment precursor molecules. A DNA polymorphism with 62% heterozygosity due to variation of a poly (T) region in the 3{prime} UTR of the hW has been identified and used for the incorporation of this gene to the genetic map of chromosome 21. The hW is located at 21q22.3 between DNA markers D21S212 and D21S49 in a P1 clone that also contains marker BCEI. The gene is expressed at various levels in many human tissues. The contributions of this gene to the Down syndrome phenotypes, to human eye color, and to the resulting phenotypes of null or missense mutations are presently unknown. 56 refs., 8 figs., 1 tab.« less

  13. Isolation and functional expression of human COQ2, a gene encoding a polyprenyl transferase involved in the synthesis of CoQ.

    PubMed

    Forsgren, Margareta; Attersand, Anneli; Lake, Staffan; Grünler, Jacob; Swiezewska, Ewa; Dallner, Gustav; Climent, Isabel

    2004-09-01

    The COQ2 gene in Saccharomyces cerevisiae encodes a Coq2 (p-hydroxybenzoate:polyprenyl transferase), which is required in the biosynthetic pathway of CoQ (ubiquinone). This enzyme catalyses the prenylation of p-hydroxybenzoate with an all-trans polyprenyl group. We have isolated cDNA which we believe encodes the human homologue of COQ2 from a human muscle and liver cDNA library. The clone contained an open reading frame of length 1263 bp, which encodes a polypeptide that has sequence homology with the Coq2 homologues in yeast, bacteria and mammals. The human COQ2 gene, when expressed in yeast Coq2 null mutant cells, rescued the growth of this yeast strain in the absence of a non-fermentable carbon source and restored CoQ biosynthesis. However, the rate of CoQ biosynthesis in the rescued cells was lower when compared with that in cells rescued with the yeast COQ2 gene. CoQ formed when cells were incubated with labelled decaprenyl pyrophosphate and nonaprenyl pyrophosphate, showing that the human enzyme is active and that it participates in the biosynthesis of CoQ.

  14. Carbohydrate active enzymes revealed in Coptotermes formosanus transcriptome

    USDA-ARS?s Scientific Manuscript database

    A normalized cDNA library of Coptotermes formosanus was constructed using mixed RNA isolated from workers, soldiers, nymphs and alates of both sexes. Sequencing of this library generated 131,637 EST and 25,939 unigenes were assembled. Carbohydrate active enzymes (CAZymes) revealed in this library we...

  15. Characterization of tumor differentiation factor (TDF) and its receptor (TDF-R).

    PubMed

    Sokolowska, Izabela; Woods, Alisa G; Gawinowicz, Mary Ann; Roy, Urmi; Darie, Costel C

    2013-08-01

    Tumor differentiation factor (TDF) is an under-investigated protein produced by the pituitary with no definitive function. TDF is secreted into the bloodstream and targets the breast and prostate, suggesting that it has an endocrine function. Initially, TDF was indirectly discovered based on the differentiation effect of alkaline pituitary extracts of the mammosomatotropic tumor MtTWlO on MTW9/PI rat mammary tumor cells. Years later, the cDNA clone responsible for this differentiation activity was isolated from a human pituitary cDNA library using expression cloning. The cDNA encoded a 108-amino-acid polypeptide that had differentiation activity on MCF7 breast cancer cells and on DU145 prostate cancer cells in vitro and in vivo. Recently, our group focused on identification of the TDF receptor (TDF-R). As potential TDF-R candidates, we identified the members of the Heat Shock 70-kDa family of proteins (HSP70) in both MCF7 and BT-549 human breast cancer cells (HBCC) and PC3, DU145, and LNCaP human prostate cancer cells (HPCC), but not in HeLa cells, NG108 neuroblastoma, or HDF-a and BLK CL.4 cells fibroblasts or fibroblast-like cells. Here we review the current advances on TDF, with particular focus on the structural investigation of its receptor and on its functional effects on breast and prostate cells.

  16. Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.

    PubMed Central

    Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E

    1994-01-01

    A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404

  17. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  18. Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

    PubMed

    Yokozaki, H; Tahara, H; Oue, N; Tahara, E

    2000-01-01

    A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

  19. The Molecular Basis of the Response to Radiation

    DTIC Science & Technology

    1999-07-01

    S. cerevisiae and S. pombe ). After PCR amplification of human cDNA libraries as described below, PCR products are analyzed on 4% NuSieve agarose...media lacking uracil as well as counterselected against on media containing uracil and 0.1% 5-fluoroorotic acid (5FOA). Induction of the LacZ gene...evolutionarily distant species (S. cerevisiae andS. pombe ) to develop degenerate PCR based primers. For example, a fission yeast homolog of RAD9 named rhp9 was

  20. Genetic Regulation in the Aiptasia pallida Symbiosis - Performance Report, Year 1.

    DTIC Science & Technology

    1997-02-01

    and symbiotic zooxanthellae is one developed for serial analysis of gene expression (SAGE). We initially tested the SAGE protocol with cDNA generated...technically difficult. We are now focusing on constructing representative cDNA libraries from cultured and symbiotic zooxanthellae and will sequence

  1. Cloning of a new member of the insulin gene superfamily (INSL4) expressed in human placenta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chassin, D.; Laurent, A.; Janneau, J.L.

    1995-09-20

    A new member of the insulin gene superfamily was identified by screening a subtracted cDNA library of first-trimester human placenta and, hence, was tentatively named early placenta insulin-like peptide (EPIL). In this paper, we report the cloning and sequencing of the EPIL cDNA and the EPIL gene (INSL4). Comparison of the deduced amino acid sequence of the early placenta insulin-like peptide revealed significant overall and structural homologies with members of the insulin-like hormone superfamily. Moreover, the organization of the early placenta insulin-like gene, which is composed of two exons and one intron, is similiar to that of insulin and relaxin.more » By in situ hybridization, the INSL4 gene was assigned to band p24 of the short arm of chromosome 9. RT-PCR analysis of EPIL tissue distribution revealed that its transcripts are expressed in the placenta and uterus. 22 refs., 3 figs.« less

  2. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  3. Purification and characterization of an antifungal protein, C-FKBP, from Chinese cabbage.

    PubMed

    Park, Seong-Cheol; Lee, Jung Ro; Shin, Sun-Oh; Jung, Ji Hyun; Lee, Young Mee; Son, Hyosuk; Park, Yoonkyung; Lee, Sang Yeol; Hahm, Kyung-Soo

    2007-06-27

    An antifungal protein was isolated from Chinese cabbage (Brassica campestris L. ssp. pekinensis) by buffer-soluble extraction and two chromatographic procedures. The results of matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry revealed that the isolated Chinese cabbage protein was identical to human FK506-binding protein (FKBP). A cDNA encoding FKBP was isolated from a Chinese cabbage leaf cDNA library and named C-FKBP. The open reading frame of the gene encoded a 154-amino acid polypeptide. The amino acid sequence of C-FKBP exhibits striking degrees of identity with the corresponding mouse (61%), human (60%), and yeast (56%) proteins. Genomic Southern blot analyses using the full-length C-FKBP cDNA probe revealed a multigene family in the Chinese cabbage genome. The C-FKBP mRNA was highly expressed in vegetative tissues. We also analyzed the antifungal and peptidyl-prolyl cis-trans isomerase activity of recombinant C-FKBP protein expressed in Escherichia coli. This protein inhibited pathogenic fungal strains, including Candida albicans, Botrytis cinerea, Rhizoctonia solani, and Trichoderma viride, whereas it exhibited no activity against E. coli and Staphylococcus aureus. These results suggest that recombinant C-FKBP is an excellent candidate as a lead compound for the development of antifungal agents.

  4. VpWRKY3, a biotic and abiotic stress-related transcription factor from the Chinese wild Vitis pseudoreticulata.

    PubMed

    Zhu, Ziguo; Shi, Jiangli; Cao, Jiangling; He, Mingyang; Wang, Yuejin

    2012-11-01

    Chinese wild grapevine Vitis pseudoreticulata accession 'Baihe-35-1' is identified as the precious resource with multiple resistances to pathogens. A directional cDNA library was constructed from the young leaves inoculated with Erysiphe necator. A total of 3,500 clones were sequenced, yielding 1,727 unigenes. Among them, 762 unigenes were annotated and classified into three classes, respectively, using Gene Ontology, including 22 ESTs related to transcription regulator activity. A novel WRKY transcription factor was isolated from the library, and designated as VpWRKY3 (GenBank Accession No. JF500755). The full-length cDNA is 1,280 bp, encoding a WRKY protein of 320 amino acids. VpWRKY3 is localized to nucleus and functions as a transcriptional activator. QRT-PCR analysis showed that the VpWRKY3 specifically accumulated in response to pathogen, salicylic acid, ethylene and drought stress. Overexpression of VpWRKY3 in tobacco increased the resistance to Ralstonia solanacearum, indicating that VpWRKY3 participates in defense response. Furthermore, VpWRKY3 is also involved in abscisic acid signal pathway and salt stress. This experiment provided an important basis for understanding the defense mechanisms mediated by WRKY genes in China wild grapevine. Generation of the EST collection from the cDNA library provided valuable information for the grapevine breeding. Key message We constructed a cDNA library from Chinese wild grapevine leaves inoculated with powdery mildew. VpWRKY3 was isolated and demonstrated that it was involved in biotic and abiotic stress responses.

  5. EXPRESSION OF THE SPERMATOGENIC CELL-SPECIFIC GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (GAPDS) IN RAT TESTIS

    EPA Science Inventory

    The spermatogenic cell-specific variant of glyceraldehyde 3-phosphate dehydrogenase (GAPDS) has been cloned from a rat testis cDNA library and its pattern of expression determined. A 1417 nucleotide cDNA has been found to encode an enzyme with substantial homology to mouse GAPDS...

  6. Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2008-01-01

    Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

  7. Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq

    PubMed Central

    Stork, Cheryl; Zheng, Sika

    2017-01-01

    UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263

  8. Construction of high quality Gateway™ entry libraries and their application to yeast two-hybrid for the monocot model plant Brachypodium distachyon.

    PubMed

    Cao, Shuanghe; Siriwardana, Chamindika L; Kumimoto, Roderick W; Holt, Ben F

    2011-05-19

    Monocots, especially the temperate grasses, represent some of the most agriculturally important crops for both current food needs and future biofuel development. Because most of the agriculturally important grass species are difficult to study (e.g., they often have large, repetitive genomes and can be difficult to grow in laboratory settings), developing genetically tractable model systems is essential. Brachypodium distachyon (hereafter Brachypodium) is an emerging model system for the temperate grasses. To fully realize the potential of this model system, publicly accessible discovery tools are essential. High quality cDNA libraries that can be readily adapted for multiple downstream purposes are a needed resource. Additionally, yeast two-hybrid (Y2H) libraries are an important discovery tool for protein-protein interactions and are not currently available for Brachypodium. We describe the creation of two high quality, publicly available Gateway™ cDNA entry libraries and their derived Y2H libraries for Brachypodium. The first entry library represents cloned cDNA populations from both short day (SD, 8/16-h light/dark) and long day (LD, 20/4-h light/dark) grown plants, while the second library was generated from hormone treated tissues. Both libraries have extensive genome coverage (~5 × 107 primary clones each) and average clone lengths of ~1.5 Kb. These entry libraries were then used to create two recombination-derived Y2H libraries. Initial proof-of-concept screens demonstrated that a protein with known interaction partners could readily re-isolate those partners, as well as novel interactors. Accessible community resources are a hallmark of successful biological model systems. Brachypodium has the potential to be a broadly useful model system for the grasses, but still requires many of these resources. The Gateway™ compatible entry libraries created here will facilitate studies for multiple user-defined purposes and the derived Y2H libraries can be immediately applied to large scale screening and discovery of novel protein-protein interactions. All libraries are freely available for distribution to the research community.

  9. EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries

    PubMed Central

    Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

    2008-01-01

    Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700

  10. EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.

    PubMed

    Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

    2008-04-10

    Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.

  11. Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.

    PubMed

    Mattsson, J G; Ljunggren, E L; Bergström, K

    2001-05-01

    The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.

  12. Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

    PubMed

    Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

    1995-12-12

    Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

  13. Use of a Novel Embryonic Mammary Stem Cell Gene Signature to Improve Human Breast Cancer Diagnostics and Therapeutic Decision Making

    DTIC Science & Technology

    2013-10-01

    the fMaSC population into its component cell types. Based on in vitro sphere formation and in vivo limiting dilution transplantation functional...vivo transplantation . This approach will not only enable us to identify biomarkers useful for prospectively identifying fMaSCs, but should also...capture wells containing candidate fMaSC cells. green=live (Calcein-AM), red= dead (Ethidium Bromide). (B) RT-PCR analysis of prepared cDNA libraries

  14. Analysis of expressed sequence tags from the four main developmental stages of Trypanosoma congolense

    PubMed Central

    Helm, Jared R.; Hertz-Fowler, Christiane; Aslett, Martin; Berriman, Matthew; Sanders, Mandy; Quail, Michael A.; Soares, Marcelo B.; Bonaldo, Maria F.; Sakurai, Tatsuya; Inoue, Noboru; Donelson, John E.

    2009-01-01

    Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and twenty-six VSG EST clusters were found in the bloodstream library, six of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the T. brucei and T. cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. PMID:19559733

  15. Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

    PubMed Central

    Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

    1993-01-01

    Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

  16. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  17. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  18. A phage display vector optimized for the generation of human antibody combinatorial libraries and the molecular cloning of monoclonal antibody fragments.

    PubMed

    Solforosi, Laura; Mancini, Nicasio; Canducci, Filippo; Clementi, Nicola; Sautto, Giuseppe Andrea; Diotti, Roberta Antonia; Clementi, Massimo; Burioni, Roberto

    2012-07-01

    A novel phagemid vector, named pCM, was optimized for the cloning and display of antibody fragment (Fab) libraries on the surface of filamentous phage. This vector contains two long DNA "stuffer" fragments for easier differentiation of the correctly cut forms of the vector. Moreover, in pCM the fragment at the heavy-chain cloning site contains an acid phosphatase-encoding gene allowing an easy distinction of the Escherichia coli cells containing the unmodified form of the phagemid versus the heavy-chain fragment coding cDNA. In pCM transcription of heavy-chain Fd/gene III and light chain is driven by a single lacZ promoter. The light chain is directed to the periplasm by the ompA signal peptide, whereas the heavy-chain Fd/coat protein III is trafficked by the pelB signal peptide. The phagemid pCM was used to generate a human combinatorial phage display antibody library that allowed the selection of a monoclonal Fab fragment antibody directed against the nucleoprotein (NP) of Influenza A virus.

  19. Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

    USDA-ARS?s Scientific Manuscript database

    Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

  20. Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

    NASA Astrophysics Data System (ADS)

    Gao, Lan; Li, Hao-Ming

    2017-08-01

    Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

  1. Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

    PubMed Central

    Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

    2000-01-01

    We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

  2. Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pennacchio, L.A.

    1994-05-06

    We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

  3. Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

    PubMed

    Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

    2017-02-03

    This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.

  4. Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

    PubMed

    Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

    2004-03-01

    The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

  5. Identification of transcripts related to high egg production in the chicken hypothalamus and pituitary gland.

    PubMed

    Shiue, Yow-Ling; Chen, Lih-Ren; Chen, Chih-Feng; Chen, Yi-Ling; Ju, Jhy-Phen; Chao, Ching-Hsien; Lin, Yuan-Ping; Kuo, Yu-Ming; Tang, Pin-Chi; Lee, Yen-Pai

    2006-09-15

    To identify transcripts related to high egg production expressed specifically in the hypothalamus and pituitary gland of the chicken, two subtracted cDNA libraries were constructed. Two divergently selected strains of Taiwan Country Chickens (TCCs), B (sire line) and L2 (dam line) were used; they had originated from a single population and were further subjected (since 1982) to selection for egg production to 40 wk of age and body weight/comb size, respectively. A total of 324 and 370 clones were identified from the L2-B (L2-subtract-B) and the B-L2 subtracted cDNA libraries, respectively. After sequencing and annotation, 175 and 136 transcripts that represented 53 known and 65 unknown non-redundant sequences were characterized in the L2-B subtracted cDNA library. Quantitative reverse-transcription (RT)-PCR was used to screen the mRNA expression levels of 32 randomly selected transcripts in another 78 laying hens from five different strains. These strains included the two original strains (B and L2) used to construct the subtracted cDNA libraries and an additional three commercial strains, i.e., Black- and Red-feather TCCs and Single-Comb White Leghorn (WL) layer. The mRNA expression levels of 16 transcripts were significantly higher in the L2 than in the B strain, whereas the mRNA expression levels of nine transcripts, BDH, NCAM1, PCDHA@, PGDS, PLAG1, PRL, SAR1A, SCG2 and STMN2, were significantly higher in two high egg production strains, L2 and Single-Comb WL; this indicated their usefulness as molecular markers of high egg production.

  6. The proteins interacting with C-terminal of μ receptor are identified by bacterial two-hybrid system from brain cDNA library in morphine-dependent rats.

    PubMed

    Zhou, Peilan; Jiang, Jiebing; Dong, Zhaoqi; Yan, Hui; You, Zhendong; Su, Ruibin; Gong, Zehui

    2015-12-15

    Opioid addiction is associated with long-term adaptive changes in the brain that involve protein expression. The carboxyl-terminal of the μ opioid receptor (MOR-C) is important for receptor signal transduction under opioid treatment. However, the proteins that interact with MOR-C after chronic morphine exposure remain unknown. The brain cDNA library of chronic morphine treatment rats was screened using rat MOR-C to investigate the regulator of opioids dependence in the present study. The brain cDNA library from chronic morphine-dependent rats was constructed using the SMART (Switching Mechanism At 5' end of RNA Transcript) technique. Bacterial two-hybrid system was used to screening the rat MOR-C interacting proteins from the cDNA library. RT-qPCR and immunoblotting were used to determine the variation of MOR-C interacting proteins in rat brain after chronic morphine treatment. Column overlay assays, immunocytochemistry and coimmunoprecipitation were used to demonstrate the interaction of MOR-C and p75NTR-associated cell death executor (NADE). 21 positive proteins, including 19 known proteins were screened to interact with rat MOR-C. Expression of several of these proteins was altered in specific rat brain regions after chronic morphine treatment. Among these proteins, NADE was confirmed to interact with rat MOR-C by in vitro protein-protein binding and coimmunoprecipitation in Chinese hamster ovary (CHO) cells and rat brain with or without chronic morphine treatment. Understanding the rat MOR-C interacting proteins and the proteins variation under chronic morphine treatment may be critical for determining the pathophysiological basis of opioid tolerance and addiction. Copyright © 2015. Published by Elsevier Inc.

  7. Transcriptome Analysis in Venom Gland of the Predatory Giant Ant Dinoponera quadriceps: Insights into the Polypeptide Toxin Arsenal of Hymenopterans

    PubMed Central

    Chong, Cheong-Meng; Leung, Siu Wai; Prieto-da-Silva, Álvaro R. B.; Havt, Alexandre; Quinet, Yves P.; Martins, Alice M. C.; Lee, Simon M. Y.; Rádis-Baptista, Gandhi

    2014-01-01

    Background Dinoponera quadriceps is a predatory giant ant that inhabits the Neotropical region and subdues its prey (insects) with stings that deliver a toxic cocktail of molecules. Human accidents occasionally occur and cause local pain and systemic symptoms. A comprehensive study of the D. quadriceps venom gland transcriptome is required to advance our knowledge about the toxin repertoire of the giant ant venom and to understand the physiopathological basis of Hymenoptera envenomation. Results We conducted a transcriptome analysis of a cDNA library from the D. quadriceps venom gland with Sanger sequencing in combination with whole-transcriptome shotgun deep sequencing. From the cDNA library, a total of 420 independent clones were analyzed. Although the proportion of dinoponeratoxin isoform precursors was high, the first giant ant venom inhibitor cysteine-knot (ICK) toxin was found. The deep next generation sequencing yielded a total of 2,514,767 raw reads that were assembled into 18,546 contigs. A BLAST search of the assembled contigs against non-redundant and Swiss-Prot databases showed that 6,463 contigs corresponded to BLASTx hits and indicated an interesting diversity of transcripts related to venom gene expression. The majority of these venom-related sequences code for a major polypeptide core, which comprises venom allergens, lethal-like proteins and esterases, and a minor peptide framework composed of inter-specific structurally conserved cysteine-rich toxins. Both the cDNA library and deep sequencing yielded large proportions of contigs that showed no similarities with known sequences. Conclusions To our knowledge, this is the first report of the venom gland transcriptome of the New World giant ant D. quadriceps. The glandular venom system was dissected, and the toxin arsenal was revealed; this process brought to light novel sequences that included an ICK-folded toxins, allergen proteins, esterases (phospholipases and carboxylesterases), and lethal-like toxins. These findings contribute to the understanding of the ecology, behavior and venomics of hymenopterans. PMID:24498135

  8. STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.

    PubMed Central

    Small, D; Levenstein, M; Kim, E; Carow, C; Amin, S; Rockwell, P; Witte, L; Burrow, C; Ratajczak, M Z; Gewirtz, A M

    1994-01-01

    We cloned the cDNA for stem cell tyrosine kinase 1 (STK-1), the human homolog of murine Flk-2/Flt-3, from a CD34+ hematopoietic stem cell-enriched library and investigated its expression in subsets of normal human bone marrow. The cDNA encodes a protein of 993 aa with 85% identity and 92% similarity to Flk-2/Flt-3. STK-1 is a member of the type III receptor tyrosine kinase family that includes KIT (steel factor receptor), FMS (colony-stimulating factor 1R), and platelet-derived growth factor receptor. STK-1 expression in human blood and marrow is restricted to CD34+ cells, a population greatly enriched for stem/progenitor cells. Anti-STK-1 antiserum recognizes polypeptides of 160 and 130 kDa in several STK-1-expressing cell lines and in 3T3 cells transfected with a STK-1 expression vector. Antisense oligonucleotides directed against STK-1 sequences inhibited hematopoietic colony formation, most strongly in long-term bone marrow cultures. These data suggest that STK-1 may function as a growth factor receptor on hematopoietic stem and/or progenitor cells. Images Fig. 2 Fig. 3 Fig. 4 PMID:7507245

  9. Sorghum Expressed Sequence Tags Identify Signature Genes for Drought, Pathogenesis, and Skotomorphogenesis from a Milestone Set of 16,801 Unique Transcripts1[w

    PubMed Central

    Pratt, Lee H.; Liang, Chun; Shah, Manish; Sun, Feng; Wang, Haiming; Reid, St. Patrick; Gingle, Alan R.; Paterson, Andrew H.; Wing, Rod; Dean, Ralph; Klein, Robert; Nguyen, Henry T.; Ma, Hong-mei; Zhao, Xin; Morishige, Daryl T.; Mullet, John E.; Cordonnier-Pratt, Marie-Michèle

    2005-01-01

    Improved knowledge of the sorghum transcriptome will enhance basic understanding of how plants respond to stresses and serve as a source of genes of value to agriculture. Toward this goal, Sorghum bicolor L. Moench cDNA libraries were prepared from light- and dark-grown seedlings, drought-stressed plants, Colletotrichum-infected seedlings and plants, ovaries, embryos, and immature panicles. Other libraries were prepared with meristems from Sorghum propinquum (Kunth) Hitchc. that had been photoperiodically induced to flower, and with rhizomes from S. propinquum and johnsongrass (Sorghum halepense L. Pers.). A total of 117,682 expressed sequence tags (ESTs) were obtained representing both 3′ and 5′ sequences from about half that number of cDNA clones. A total of 16,801 unique transcripts, representing tentative UniScripts (TUs), were identified from 55,783 3′ ESTs. Of these TUs, 9,032 are represented by two or more ESTs. Collectively, these libraries were predicted to contain a total of approximately 31,000 TUs. Individual libraries, however, were predicted to contain no more than about 6,000 to 9,000, with the exception of light-grown seedlings, which yielded an estimate of close to 13,000. In addition, each library exhibits about the same level of complexity with respect to both the number of TUs preferentially expressed in that library and the frequency with which two or more ESTs is found in only that library. These results indicate that the sorghum genome is expressed in highly selective fashion in the individual organs and in response to the environmental conditions surveyed here. Close to 2,000 differentially expressed TUs were identified among the cDNA libraries examined, of which 775 were differentially expressed at a confidence level of 98%. From these 775 TUs, signature genes were identified defining drought, Colletotrichum infection, skotomorphogenesis (etiolation), ovary, immature panicle, and embryo. PMID:16169961

  10. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    PubMed

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  11. Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.

    PubMed Central

    Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I

    1991-01-01

    The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129

  12. Illumina sequencing of green stink bug nymph and adult cdna to identify potential rnai gene targets

    USDA-ARS?s Scientific Manuscript database

    Whole-body transcriptomes for nymphs and adults of the green stink bug, Acrosternum hilare (Say), were sequenced on an Illumina® Genome Analyzer IIx sequencer. The insects were collected from sites in North Carolina and Virginia, USA. The cDNA library for each sample was sequenced on one lane of an...

  13. Sperm flagella protein components: Human meichroacidin constructed by the membrane occupation and recognition nexus motif

    PubMed Central

    MATSUOKA, YASUHIRO; NISHIMURA, HIROMI; NUMAZAWA, KAHORI; TSUCHIDA, JUNJI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; MATSUMIYA, KIYOMI; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

    2005-01-01

    Background and Aims:   In a previous study, the authors of the present study cloned mouse meichroacidin (MCA), which is expressed in stages of spermatogenesis from pachytene spermatocytes through round spermatid germ cells. MCA protein contains the membrane occupation and recognition nexus (MORN) motif and localizes to a male meiotic metaphase chromosome. Recently, a MCA homolog of carp (Cyprinus carpio), MORN motif‐containing sperm‐specific axonemal protein (MSAP), was reportedly identified and localized in sperm flagella. Present knowledge of human spermiogenesis requires the identification of proteins in human sperm. The present study identified the human orthologue of MCA. Methods:   Colony hybridization using a human testis plasmid cDNA library was carried out to clone human MCA (h‐MCA) cDNA. Northern blot, Western blot, and immunohistochemical analyses were carried out. Results:   h‐MCA was found to be specifically expressed in the testes. The h‐MCA amino acid sequence shared 79.8% identity with mouse MCA and contained MORN motifs. h‐MCA localized in the sperm flagellum and basal body, as does MSAP in carp. Conclusion:   Expression and localization analyses showed that h‐MCA is a component of the sperm flagellum and basal body and might play an important role in the development of the sperm flagellum in humans. (Reprod Med Biol 2005; 4: 213–219) PMID:29699225

  14. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

    PubMed

    Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

    2003-01-01

    A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

  16. Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

    PubMed Central

    Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

    1993-01-01

    A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

  17. Characterization of embryo-specific genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1989-01-01

    The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less

  18. Physical mapping of the torsion dystonia region of human chromosome 9q34

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ozelius, L.J.; Hewett, J.; Shalish, C.

    1994-09-01

    Torsion dystonia is a syndrome characterized by loss of voluntary movements appearing as sustained muscle contractions and/or abnormal postures. The DYT1 gene is responsible for a subtype of torsion dystonia in which onset of symptoms tends to occur in a limb at an early age (mean 13 years) and to progress to a generalized state. Expression of the disease gene follows an autosomal dominant mode of inheritance with reduced penetrance. We initially mapped this gene to human chromosome 9q34 and have now defined its location to a < 1 cM region near the ASS locus based on historic recombination eventsmore » around a founder mutation in the Ashkenazic Jewish population. Using the CEPH YAC library and a chromosome 9 flow-sorted YAC library, we have generated a YAC contig spanning about 500 kb of this region. These YACs are being used to identify cosmids by direct hybridization to chromosome 9-specific cosmid libraries. Cosmids are being aligned by restriction digest patterns and by hybridization with oligonucleotide repeat probes. In addition, the cosmids are being {open_quotes}trapped{close_quotes} by exon amplification and these exons used to screen cDNA libraries. Thus far we have identified several candidate transcripts in this region.« less

  19. Characterization of the human pH- and PKA-activated ClC-2G(2 alpha) Cl- channel.

    PubMed

    Sherry, A M; Stroffekova, K; Knapp, L M; Kupert, E Y; Cuppoletti, J; Malinowska, D H

    1997-08-01

    A ClC-2G(2 alpha) Cl- channel was identified to be present in human lung and stomach, and a partial cDNA for this Cl- channel was cloned from a human fetal lung library. A full-length expressible human ClC-2G(2 alpha) cDNA was constructed by ligation of mutagenized expressible rabbit ClC-2G(2 alpha) cDNA with the human lung ClC-2G(2 alpha) cDNA, expressed in oocytes, and characterized at the single-channel level. Adenosine 3',5'-cyclic monophosphate-dependent protein kinase (PKA) treatment increased the probability of opening of the channel (Po). After PKA activation, the channel exhibited a linear (r = 0.99) current-voltage curve with a slope conductance of 22.1 +/- 0.8 pS in symmetric 800 mM tetraethylammonium chloride (TEACl; pH 7.4). Under fivefold gradient conditions of TEACl, a reversal potential of +21.5 +/- 2.8 mV was measured demonstrating anion-to-cation discrimination. As previously demonstrated for the rabbit ClC-2G(2 alpha) Cl- channel, the human analog, hClC-2G(2 alpha), was active at pH 7.4 as well as when the pH of the extracellular face of the channel (trans side of the bilayer; pHtrans) was asymmetrically reduced to pH 3.0. The extent of PKA activation was dependent on pHtrans. With PKA treatment, Po increased fourfold with a pHtrans of 7.4 and eightfold with a pHtrans of 3.0. Effects of sequential PKA addition followed by pHtrans reduction on the same channel suggested that the PKA- and pH-dependent increases in channel Po were separable and cumulative. Northern analysis showed ClC-2G(2 alpha) mRNA to be present in human adult and fetal lung and adult stomach, and quantitative reverse transcriptase-polymerase chain reaction showed this channel to be present in the adult human lung and stomach at about one-half the level found in fetal lung. The findings of the present study suggest that the ClC-2G(2 alpha) Cl- channel may play an important role in Cl- transport in the fetal and adult human lung.

  20. Isolation and expression analysis of cDNAs that are associated with alternate bearing in Olea europaea L. cv. Ayvalık

    PubMed Central

    2013-01-01

    Background Olive cDNA libraries to isolate candidate genes that can help enlightening the molecular mechanism of periodicity and / or fruit production were constructed and analyzed. For this purpose, cDNA libraries from the leaves of trees in “on year” and in “off year” in July (when fruits start to appear) and in November (harvest time) were constructed. Randomly selected 100 positive clones from each library were analyzed with respect to sequence and size. A fruit-flesh cDNA library was also constructed and characterized to confirm the reliability of each library’s temporal and spatial properties. Results Quantitative real-time RT-PCR (qRT-PCR) analyses of the cDNA libraries confirmed cDNA molecules that are associated with different developmental stages (e. g. “on year” leaves in July, “off year” leaves in July, leaves in November) and fruits. Hence, a number of candidate cDNAs associated with “on year” and “off year” were isolated. Comparison of the detected cDNAs to the current EST database of GenBank along with other non - redundant databases of NCBI revealed homologs of previously described genes along with several unknown cDNAs. Of around 500 screened cDNAs, 48 cDNA elements were obtained after eliminating ribosomal RNA sequences. These independent transcripts were analyzed using BLAST searches (cutoff E-value of 1.0E-5) against the KEGG and GenBank nucleotide databases and 37 putative transcripts corresponding to known gene functions were annotated with gene names and Gene Ontology (GO) terms. Transcripts in the biological process were found to be related with metabolic process (27%), cellular process (23%), response to stimulus (17%), localization process (8.5%), multicellular organismal process (6.25%), developmental process (6.25%) and reproduction (4.2%). Conclusions A putative P450 monooxigenase expressed fivefold more in the “on year” than that of “off year” leaves in July. Two putative dehydrins expressed significantly more in “on year” leaves than that of “off year” leaves in November. Homologs of UDP – glucose epimerase, acyl - CoA binding protein, triose phosphate isomerase and a putative nuclear core anchor protein were significant in fruits only, while a homolog of an embryo binding protein / small GTPase regulator was detected in “on year” leaves only. One of the two unknown cDNAs was specific to leaves in July while the other was detected in all of the libraries except fruits. KEGG pathway analyses for the obtained sequences correlated with essential metabolisms such as galactose metabolism, amino sugar and nucleotide sugar metabolisms and photosynthesis. Detailed analysis of the results presents candidate cDNAs that can be used to dissect further the genetic basis of fruit production and / or alternate bearing which causes significant economical loss for olive growers. PMID:23552171

  1. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    PubMed Central

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jakob; Gilchrist, Michael J; Panitz, Frank; Jørgensen, Claus; Scheibye-Knudsen, Karsten; Arvin, Troels; Lumholdt, Steen; Sawera, Milena; Green, Trine; Nielsen, Bente J; Havgaard, Jakob H; Rosenkilde, Carina; Wang, Jun; Li, Heng; Li, Ruiqiang; Liu, Bin; Hu, Songnian; Dong, Wei; Li, Wei; Yu, Jun; Wang, Jian; Stærfeldt, Hans-Henrik; Wernersson, Rasmus; Madsen, Lone B; Thomsen, Bo; Hornshøj, Henrik; Bujie, Zhan; Wang, Xuegang; Wang, Xuefei; Bolund, Lars; Brunak, Søren; Yang, Huanming; Bendixen, Christian; Fredholm, Merete

    2007-01-01

    Background Knowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. Results Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories. Conclusion This EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies. PMID:17407547

  2. Isolation and expression of the human gametocyte-specific factor 1 gene (GTSF1) in fetal ovary, oocytes, and preimplantation embryos.

    PubMed

    Huntriss, John; Lu, Jianping; Hemmings, Karen; Bayne, Rosemary; Anderson, Richard; Rutherford, Anthony; Balen, Adam; Elder, Kay; Picton, Helen M

    2017-01-01

    Gametocyte-specific factor 1 has been shown in other species to be required for the silencing of retrotransposons via the Piwi-interacting RNA (piRNA) pathway. In this study, we aimed to isolate and assess expression of transcripts of the gametocyte-specific factor 1 (GTSF1) gene in the human female germline and in preimplantation embryos. Complementary DNA (cDNA) libraries from human fetal ovaries and testes, human oocytes and preimplantation embryos and ovarian follicles isolated from an adult ovarian cortex biopsy were used to as templates for PCR, cloning and sequencing, and real time PCR experiments of GTSF1 expression. GTSF1 cDNA clones that covered the entire coding region were isolated from human oocytes and preimplantation embryos. GTSF1 mRNA expression was detected in archived cDNAs from staged human ovarian follicles, germinal vesicle (GV) stage oocytes, metaphase II oocytes, and morula and blastocyst stage preimplantation embryos. Within the adult female germline, expression was highest in GV oocytes. GTSF1 mRNA expression was also assessed in human fetal ovary and was observed to increase during gestation, from 8 to 21 weeks, during which time oogonia enter meiosis and primordial follicle formation first occurs. In human fetal testis, GTSF1 expression also increased from 8 to 19 weeks. To our knowledge, this report is the first to describe the expression of the human GTSF1 gene in human gametes and preimplantation embryos.

  3. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  4. [Cloning and characterization of a novel rat gene RSD-7 differentially expressed in testis].

    PubMed

    Zhang, Xiao-dong; Gou, Da-wei; Miao, Shi-ying; Zhang, Jian-chao; Zong, Shu-dong; Wang, Lin-fang

    2003-06-01

    To isolate and identify the differentially expressed genes in spermatogenesis for the understanding molecular mechanism of spermatogenesis. Screening of the cDNA library, Northern blot, expression and purification in E. coli with GST expression system, immunocytochemical staining of testis sections were used. (1) A cDNA fragment designated as RSD-7 was isolated from rat testis cDNA library. It was 1,238 bp in length, coding a protein of 232 amino acids with the GenBank accession number AF315467. The encoding protein of RSD-7 cDNA had a Ubiquitin-like domain. (2) Northern blot indicated that RSD-7 was uniquely expressed in rat testis, and in the testis RSD-7 emerged on the 30th postnatal day and expressed until 120th postnatal day. (3) Expression and purification of RSD-7 protein in E. coli with GST expression system and were used to obtain anti-RSD-7 antibody. (4) Immunolocalization of RSD-7 in rat testis revealed that it is expressed only in Sertoli cells. Transcription pattern of RSD-7 and localization of RSD-7 protein in testis have been made, which established the base for the functional study of RSD-7.

  5. Clone and genomic repositories at the American Type Culture Collection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maglott, D.R.; Nierman, W.C.

    1990-01-01

    The American Type Culture Collection (ATCC) has a long history of characterizing, preserving, and distributing biological resource materials for the scientific community. Starting in 1925 as a repository for standard bacterial and fungal strains, its collections have diversified with technologic advances and in response to the requirements of its users. To serve the needs of the human genetics community, the National Institute of Child Health and Human Development (NICHD), National Institutes of Health (NIH), established an international Repository of Human DNA Probes and Libraries at the ATCC in 1985. This repository expanded the existing collections of recombinant clones and librariesmore » at the ATCC, with the specific purposes of (1) obtaining, amplifying, and distribution probes detecting restriction fragment length polymorphisms (RFLPs); (2) obtaining, amplifying, and distributing genomic and cDNA clones from known genes independent of RFLP detection; (3) distributing the chromosome-specific libraries generated by the National Laboratory Gene Library Project at the Lawrence Livermore and Los Alamos National Laboratories and (4) maintaining a public, online database describing the repository materials. Because it was recognized that animal models and comparative mapping can be crucial to genomic characterization, the scope of the repository was broadened in February 1989 to include probes from the mouse genome.« less

  6. Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

    PubMed

    Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

    1997-11-01

    Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

  7. Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L.) Taub)

    PubMed Central

    Naoumkina, Marina; Torres-Jerez, Ivone; Allen, Stacy; He, Ji; Zhao, Patrick X; Dixon, Richard A; May, Gregory D

    2007-01-01

    Background Guar, Cyamopsis tetragonoloba (L.) Taub, is a member of the Leguminosae (Fabaceae) family and is economically the most important of the four species in the genus. The endosperm of guar seed is a rich source of mucilage or gum, which forms a viscous gel in cold water, and is used as an emulsifier, thickener and stabilizer in a wide range of foods and industrial applications. Guar gum is a galactomannan, consisting of a linear (1→4)-β-linked D-mannan backbone with single-unit, (1→6)-linked, α-D-galactopyranosyl side chains. To better understand regulation of guar seed development and galactomannan metabolism we created cDNA libraries and a resulting EST dataset from different developmental stages of guar seeds. Results A database of 16,476 guar seed ESTs was constructed, with 8,163 and 8,313 ESTs derived from cDNA libraries I and II, respectively. Library I was constructed from seeds at an early developmental stage (15–25 days after flowering, DAF), and library II from seeds at 30–40 DAF. Quite different sets of genes were represented in these two libraries. Approximately 27% of the clones were not similar to known sequences, suggesting that these ESTs represent novel genes or may represent non-coding RNA. The high flux of energy into carbohydrate and storage protein synthesis in guar seeds was reflected by a high representation of genes annotated as involved in signal transduction, carbohydrate metabolism, chaperone and proteolytic processes, and translation and ribosome structure. Guar unigenes involved in galactomannan metabolism were identified. Among the seed storage proteins, the most abundant contig represented a conglutin accounting for 3.7% of the total ESTs from both libraries. Conclusion The present EST collection and its annotation provide a resource for understanding guar seed biology and galactomannan metabolism. PMID:18034910

  8. [Construction and analysis of a forward and reverse subtractive cDNA library from leaves and stem of Polygonum sibiricum Laxm. under salt stress].

    PubMed

    Liu, Guan-Jun; Liu, Ming-Kun; Xu, Zhi-Ru; Yan, Xiu-Feng; Wei, Zhi-Gang; Yang, Chuan-Ping

    2009-04-01

    Using cDNAs prepared from the leaves and stems of Polygonum sibiricum Laxm. treated with NaHCO3 stress for 48 h as testers and cDNAs from unstressed P. sibiricum leaves and stems as drivers library, suppression subtractive hybridization (SSH) was employed to construct a cDNA subtracted library, which contained 2 282 valid sequences including 598 ESTs in the stems forward SSH library and 490 ESTs in the stem reverse SSH library, 627 ESTs in the leaf forward SSH library and 567 in the leaf reverse SSH library. According to the functional catalogue of MIPs and the comparison of the reverse and forward SSH libraries of the stem and leaf, the responses to NaHCO3 stress were different between leaf and stem, except for the same trend in cell rescue defense and transport facilitation. The trend in the metabolism, energy, photosynthesis, protein synthesis, transcription, and signal transduction was opposite. RT-PCR analysis demonstrated that the expression of 12 putative stress related genes in the NaHCO3-treated leaves and stems was different from that in the untreated leaves and stems. This indicated that different mechanisms might be responsible for reactions of leaf and stem in P. sibiricum. The results from this study are useful in understanding the molecular mechanism of saline-alkali tolerance in P. sibiricum.

  9. Molecular Cloning and Characterization of a Xanthone Prenyltransferase from Hypericum calycinum Cell Cultures.

    PubMed

    Fiesel, Tobias; Gaid, Mariam; Müller, Andreas; Bartels, Joana; El-Awaad, Islam; Beuerle, Till; Ernst, Ludger; Behrends, Sönke; Beerhues, Ludger

    2015-08-27

    In plants, prenylation of metabolites is widely distributed to generate compounds with efficient defense potential and distinct pharmacological activities profitable to human health. Prenylated compounds are formed by members of the prenyltransferase (PT) superfamily, which catalyze the addition of prenyl moieties to a variety of acceptor molecules. Cell cultures of Hypericum calycinum respond to elicitor treatment with the accumulation of the prenylated xanthone hyperxanthone E. A cDNA encoding a membrane-bound PT (HcPT) was isolated from a subtracted cDNA library and transcript preparations of H. calycinum. An increase in the HcPT transcript level preceded hyperxanthone E accumulation in cell cultures of H. calycinum treated with elicitor. The HcPT cDNA was functionally characterized by expression in baculovirus-infected insect cells. The recombinant enzyme catalyzed biosynthesis of 1,3,6,7-tetrahydroxy-8-prenylxanthone through regiospecific C-8 prenylation of 1,3,6,7-tetrahydroxyxanthone, indicating its involvement in hyperxanthone E formation. The enzymatic product shared significant structural features with the previously reported cholinesterase inhibitor γ-mangostin. Thus, our findings may offer a chance for semisynthesis of new active agents to be involved in the treatment of Alzheimer's disease.

  10. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  11. ESTminer: a Web interface for mining EST contig and cluster databases.

    PubMed

    Huang, Yecheng; Pumphrey, Janie; Gingle, Alan R

    2005-03-01

    ESTminer is a Web application and database schema for interactive mining of expressed sequence tag (EST) contig and cluster datasets. The Web interface contains a query frame that allows the selection of contigs/clusters with specific cDNA library makeup or a threshold number of members. The results are displayed as color-coded tree nodes, where the color indicates the fractional size of each cDNA library component. The nodes are expandable, revealing library statistics as well as EST or contig members, with links to sequence data, GenBank records or user configurable links. Also, the interface allows 'queries within queries' where the result set of a query is further filtered by the subsequent query. ESTminer is implemented in Java/JSP and the package, including MySQL and Oracle schema creation scripts, is available from http://cggc.agtec.uga.edu/Data/download.asp agingle@uga.edu.

  12. Human parainfluenza virus type 2 V protein inhibits caspase-1.

    PubMed

    Ohta, Keisuke; Matsumoto, Yusuke; Nishio, Machiko

    2018-04-01

    The multifunctional V protein of human parainfluenza virus type 2 (hPIV2) plays important roles in controlling viral genome replication, inhibiting the host interferon response and promoting virus growth. We screened a yeast two-hybrid library using V protein as bait to identify host factors that are important for other functions of V. One of several positive clones isolated from HeLa cell-derived cDNA library encodes caspase-1. We found that the C-terminal region of V interacts with the C-terminal region of caspase-1 in mammalian cells. Moreover, the V protein repressed caspase-1 activity and the formation of interleukin-1β (IL-1β) in a dose-dependent manner. IL-1β secretion induced by wild-type hPIV2 infection in human monocytic THP-1 cells was significantly lower than that induced by recombinant hPIV2 lacking V protein or having a mutant V. These data suggest that hPIV2 V protein inhibits caspase-1-mediated maturation of IL-1β via its interaction with caspase-1.

  13. Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.

    PubMed

    Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R

    2007-02-01

    To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.

  14. Characterization of the venom from the Australian scorpion Urodacus yaschenkoi: Molecular mass analysis of components, cDNA sequences and peptides with antimicrobial activity.

    PubMed

    Luna-Ramírez, Karen; Quintero-Hernández, Veronica; Vargas-Jaimes, Leonel; Batista, Cesar V F; Winkel, Kenneth D; Possani, Lourival D

    2013-03-01

    The Urodacidae scorpions are the most widely distributed of the four families in Australia and represent half of the species in the continent, yet their venoms remain largely unstudied. This communication reports the first results of a proteome analysis of the venom of the scorpion Urodacus yaschenkoi performed by mass fingerprinting, after high performance liquid chromatography (HPLC) separation. A total of 74 fractions were obtained by HPLC separation allowing the identification of approximately 274 different molecular masses with molecular weights varying from 287 to 43,437 Da. The most abundant peptides were those from 1 K Da and 4-5 K Da representing antimicrobial peptides and putative potassium channel toxins, respectively. Three such peptides were chemically synthesized and tested against Gram-positive and Gram-negative bacteria showing minimum inhibitory concentration in the low micromolar range, but with moderate hemolytic activity. It also reports a transcriptome analysis of the venom glands of the same scorpion species, undertaken by constructing a cDNA library and conducting random sequencing screening of the transcripts. From the resultant cDNA library 172 expressed sequence tags (ESTs) were analyzed. These transcripts were further clustered into 120 unique sequences (23 contigs and 97 singlets). The identified putative proteins can be assorted in several groups, such as those implicated in common cellular processes, putative neurotoxins and antimicrobial peptides. The scorpion U. yaschenkoi is not known to be dangerous to humans and its venom contains peptides similar to those of Opisthacanthus cayaporum (antibacterial), Scorpio maurus palmatus (maurocalcin), Opistophthalmus carinatus (opistoporines) and Hadrurus gerstchi (scorpine-like molecules), amongst others. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

    1994-12-01

    The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

  16. Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, W.; Emanuel, B.S.; Siegert, J.

    1994-09-01

    DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

  17. Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design

    PubMed Central

    Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg

    2007-01-01

    Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414

  18. Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus.

    PubMed

    Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D

    2013-01-01

    Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.

  19. Molecular cloning of human protein 4.2: a major component of the erythrocyte membrane.

    PubMed Central

    Sung, L A; Chien, S; Chang, L S; Lambert, K; Bliss, S A; Bouhassira, E E; Nagel, R L; Schwartz, R S; Rybicki, A C

    1990-01-01

    Protein 4.2 (P4.2) comprises approximately 5% of the protein mass of human erythrocyte (RBC) membranes. Anemia occurs in patients with RBCs deficient in P4.2, suggesting a role for this protein in maintaining RBC stability and integrity. We now report the molecular cloning and characterization of human RBC P4.2 cDNAs. By immunoscreening a human reticulocyte cDNA library and by using the polymerase chain reaction, two cDNA sequences of 2.4 and 2.5 kilobases (kb) were obtained. These cDNAs differ only by a 90-base-pair insert in the longer isoform located three codons downstream from the putative initiation site. The 2.4- and 2.5-kb cDNAs predict proteins of approximately 77 and approximately 80 kDa, respectively, and the authenticity was confirmed by sequence identity with 46 amino acids of three cyanogen bromide-cleaved peptides of P4.2. Northern blot analysis detected a major 2.4-kb RNA species in reticulocytes. Isolation of two P4.2 cDNAs implies existence of specific regulation of P4.2 expression in human RBCs. Human RBC P4.2 has significant homology with human factor XIII subunit a and guinea pig liver transglutaminase. Sequence alignment of P4.2 with these two transglutaminases, however, revealed that P4.2 lacks the critical cysteine residue required for the enzymatic crosslinking of substrates. Images PMID:1689063

  20. Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).

    PubMed

    Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y

    1996-02-01

    Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.

  1. The active gene that encodes human High Mobility Group 1 protein (HMG1) contains introns and maps to chromosome 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferrari, S.; Finelli, P.; Rocchi, M.

    The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mousemore » Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.« less

  2. Cloning of apg-2 encoding a novel member of heat shock protein 110 family.

    PubMed

    Kaneko, Y; Kimura, T; Kishishita, M; Noda, Y; Fujita, J

    1997-04-11

    Chinese hamster heat shock protein 110-encoding gene (hsp110), mouse apg-1 and human hsp70RY are structurally related genes, with the first two encoding about 110-kDa HSPs [Yoon et al. (1995) J. Biol. Chem. 270, 15725-15733; Kaneko et al. (1997) J. Biol. Chem., in press; Fathallah et al. (1993) J. Immunol. 151, 810-813]. Using apg-1 cDNA as a probe, we isolated a novel cDNA, apg-2 from a mouse testis cDNA library, which was highly homologous to human hsp70RY. However, the predicted amino acid (aa) sequence of APG-2 was longer (841 aa) than that of HSP70RY (701 aa) and comparable to those of HSP110 and APG-1. Northern blot analysis revealed that the expression of apg-2 transcripts was ubiquitous in various mouse tissues, and most abundant in the testis and ovary. While induction of hsp70 transcripts was observed in mouse TAMA26 Sertoli cells and NIH/3T3 fibroblasts on temperature shift from 37 degrees C to 42 degrees C (traditional heat shock) or from 32 degrees C to 39 degrees C, apg-2 transcripts were not induced under either condition. These results suggest that apg-2 is an isoform of mouse homolog of hsp70RY, but that it belongs to the hsp110 family instead of hsp70 family, and that it plays a role under non-stress conditions.

  3. A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

    PubMed

    Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

    2015-04-09

    Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

  4. Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

    PubMed

    Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

    2013-05-01

    One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Expression of Ornithine Decarboxylase Is Transiently Increased by Pollination, 2,4-Dichlorophenoxyacetic Acid, and Gibberellic Acid in Tomato Ovaries1

    PubMed Central

    Alabadí, David; Carbonell, Juan

    1998-01-01

    A cDNA encoding for a functional ornithine decarboxylase has been isolated from a cDNA library of carpels of tomato (Lycopersicon esculentum Mill.). Ornithine decarboxylase in tomato is represented by a single-copy gene that we show to be up-regulated during early fruit growth induced by 2,4-dichlorophenoxyacetic acid and gibberellic acid. PMID:9733552

  6. The mining of pearl formation genes in pearl oyster Pinctada fucata by cDNA suppression subtractive hybridization.

    PubMed

    Wang, Ning; Kinoshita, Shigeharu; Nomura, Naoko; Riho, Chihiro; Maeyama, Kaoru; Nagai, Kiyohito; Watabe, Shugo

    2012-04-01

    Recent researches revealed the regional preference of biomineralization gene transcription in the pearl oyster Pinctada fucata: it transcribed mainly the genes responsible for nacre secretion in mantle pallial, whereas the ones regulating calcite shells expressed in mantle edge. This study took use of this character and constructed the forward and reverse suppression subtractive hybridization (SSH) cDNA libraries. A total of 669 cDNA clones were sequenced and 360 expressed sequence tags (ESTs) greater than 100 bp were generated. Functional annotation associated 95 ESTs with specific functions, and 79 among them were identified from P. fucata at the first time. In the forward SSH cDNA library, it recognized mass amount of nacre protein genes, biomineralization genes dominantly expressed in the mantle pallial, calcium-ion-binding genes, and other biomineralization-related genes important for pearl formation. Real-time PCR showed that all the examined genes were distributed in oyster mantle tissues with a consistence to the SSH design. The detection of their RNA transcripts in pearl sac confirmed that the identified genes were certainly involved in pearl formation. Therefore, the data from this work will initiate a new round of pearl formation gene study and shed new insights into molluscan biomineralization.

  7. A pituitary gene encodes a protein that produces differentiation of breast and prostate cancer cells.

    PubMed

    Platica, Micsunica; Ivan, Elena; Holland, James F; Ionescu, Alin; Chen, Sheryl; Mandeli, John; Unger, Pamela D; Platica, Ovidiu

    2004-02-10

    A cDNA clone of 1.1 kb encoding a 108-aa polypeptide was isolated from a human pituitary cDNA library by expression cloning. This protein was named tumor differentiation factor (TDF). The recombinant TDF protein and a 20-aa peptide, P1, selected from the ORF of the gene, induced morphological and biochemical changes consistent with differentiation of human breast and prostate cancer cells. Fibroblast, kidney, hepatoma, and leukemic lymphocytic cell lines were unaffected. Breast and prostate cancer cells aggregated in spheroid-like structures within 24 h of exposure to TDF. This effect was abrogated by a specific affinity-purified rabbit polyclonal anti-P1 Ab. E-cadherin expression was increased in a dose-dependent manner by TDF. Treatment of MCF7 cells with TDF led to production of a lactalbumin-related protein. Peptide P1 significantly decreased the growth of androgen-independent DU145 prostate cancer in severe combined immunodeficient mice. The presence of TDF protein in human sera was detected by the anti-P1 Ab, suggesting a role of TDF in endocrine metabolism. The fact that all activities of TDF can be mimicked by a peptide derived from the encoding TDF sequence opens the possibility of therapeutic applications.

  8. Screening and analyzing genes associated with Amur tiger placental development.

    PubMed

    Li, Q; Lu, T F; Liu, D; Hu, P F; Sun, B; Ma, J Z; Wang, W J; Wang, K F; Zhang, W X; Chen, J; Guan, W J; Ma, Y H; Zhang, M H

    2014-09-26

    The Amur tiger is a unique endangered species in the world, and thus, protection of its genetic resources is extremely important. In this study, an Amur tiger placenta cDNA library was constructed using the SMART cDNA Library Construction kit. A total of 508 colonies were sequenced, in which 205 (76%) genes were annotated and mapped to 74 KEGG pathways, including 29 metabolism, 29 genetic information processing, 4 environmental information processing, 7 cell motility, and 5 organismal system pathways. Additionally, PLAC8, PEG10 and IGF-II were identified after screening genes from the expressed sequence tags, and they were associated with placental development. These findings could lay the foundation for future functional genomic studies of the Amur tiger.

  9. cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

    PubMed

    Simon, J W; Slabas, A R

    1998-09-18

    The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

  10. Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

    PubMed

    Wu, Zhencai; Burns, Jacqueline K

    2003-04-01

    The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

  11. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    PubMed Central

    2011-01-01

    Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934

  12. Novel transcripts of the estrogen receptor α gene in channel catfish

    USGS Publications Warehouse

    Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

    2000-01-01

    Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.

  13. The identification of cellular targets of 17β estradiol using a lytic (T7) cDNA phage display approach.

    PubMed

    Van Dorst, Bieke; Mehta, Jaytry; Rouah-Martin, Elsa; De Coen, Wim; Blust, Ronny; Robbens, Johan

    2011-02-01

    To unravel the mechanism of action of chemical compounds, it is crucial to know their cellular targets. A novel in vitro tool that can be used as a fast, simple and cost effective alternative is cDNA phage display. This tool is used in our study to select cellular targets of 17β estradiol (E2). It was possible to select two potential cellular targets of E2 out of the T7 Select™ Human Breast cDNA phage library. The selected cellular targets, autophagy/beclin-1 regulator 1 (beclin 1) and ATP synthase F(0) subunit 6 (ATP6) have so far been unknown as binding proteins of E2. To confirm the E2 binding properties of these selected proteins, surface plasmon resonance (SPR) was used. With SPR the K(d) values were determined to be 0.178±0.031 and 0.401±0.142 nM for the ATP6 phage and beclin 1 phage, respectively. These K(d) values in the low nM range verify that the selected cellular proteins are indeed binding proteins for E2. The selection and identification of these two potential cellular targets of E2, can enhance our current understanding of its mechanism of action. This illustrates the potential of lytic (T7) cDNA phage display in toxicology, to provide important information about cellular targets of chemical compounds. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. Upregulated Genes In Sporadic, Idiopathic Pulmonary Arterial Hypertension

    PubMed Central

    Edgar, Alasdair J; Chacón, Matilde R; Bishop, Anne E; Yacoub, Magdi H; Polak, Julia M

    2006-01-01

    Background To elucidate further the pathogenesis of sporadic, idiopathic pulmonary arterial hypertension (IPAH) and identify potential therapeutic avenues, differential gene expression in IPAH was examined by suppression subtractive hybridisation (SSH). Methods Peripheral lung samples were obtained immediately after removal from patients undergoing lung transplant for IPAH without familial disease, and control tissues consisted of similarly sampled pieces of donor lungs not utilised during transplantation. Pools of lung mRNA from IPAH cases containing plexiform lesions and normal donor lungs were used to generate the tester and driver cDNA libraries, respectively. A subtracted IPAH cDNA library was made by SSH. Clones isolated from this subtracted library were examined for up regulated expression in IPAH using dot blot arrays of positive colony PCR products using both pooled cDNA libraries as probes. Clones verified as being upregulated were sequenced. For two genes the increase in expression was verified by northern blotting and data analysed using Student's unpaired two-tailed t-test. Results We present preliminary findings concerning candidate genes upregulated in IPAH. Twenty-seven upregulated genes were identified out of 192 clones examined. Upregulation in individual cases of IPAH was shown by northern blot for tissue inhibitor of metalloproteinase-3 and decorin (P < 0.01) compared with the housekeeping gene glyceraldehydes-3-phosphate dehydrogenase. Conclusion Four of the up regulated genes, magic roundabout, hevin, thrombomodulin and sucrose non-fermenting protein-related kinase-1 are expressed specifically by endothelial cells and one, muscleblind-1, by muscle cells, suggesting that they may be associated with plexiform lesions and hypertrophic arterial wall remodelling, respectively. PMID:16390543

  15. Ultraviolet light-resistant primary transfectants of xeroderma pigmentosum cells are also DNA repair-proficient

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stark, M.; Naiman, T.; Canaani, D.

    1989-08-15

    In a previous work, an immortal xeroderma pigmentosum cell line belonging to complementation group C was complemented to a UV-resistant phenotype by transfection with a human cDNA clone library. We now report that the primary transformants selected for UV-resistance also acquired normal levels of DNA repair. This was assessed both by measurement of UV-induced ({sup 3}H)thymidine incorporation and by equilibrium sedimentation analysis of repair-DNA synthesis. Therefore, the transduced DNA element which confers normal UV-resistance also corrects the excision repair defect of the xeroderma pigmentosum group C cell line.

  16. The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

    PubMed Central

    Craig, R K; Hall, L; Parker, D; Campbell, P N

    1981-01-01

    A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

  17. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  18. Cloning of human cDNAs for Apg-1 and Apg-2, members of the Hsp110 family, and chromosomal assignment of their genes.

    PubMed

    Nonoguchi, K; Itoh, K; Xue, J H; Tokuchi, H; Nishiyama, H; Kaneko, Y; Tatsumi, K; Okuno, H; Tomiwa, K; Fujita, J

    1999-09-03

    In mice, the Hsp110/SSE family is composed of the heat shock protein (Hsp)110/105, Apg-1 and Apg-2. In humans, however, only the Hsp110/105 homolog has been identified as a member, and two cDNAs, Hsp70RY and HS24/p52, potentially encoding proteins structurally similar to, but smaller than, mouse Apg-2 have been reported. To clarify the membership of Hsp110 family in humans, we isolated Apg-1 and Apg-2 cDNAs from a human testis cDNA library. The human Apg-1 was 100% and 91.8% identical in length and amino acid (aa) sequence, respectively, to mouse Apg-1. Human Apg-2 was one aa shorter than and 95.5% identical in sequence to mouse Apg-2. In ECV304, human endothelial cells Apg-1 but not Apg-2 transcripts were induced in 2 h by a temperature shift from 32 degrees C to 39 degrees C. As found in mice, the response was stronger than that to a 37-42 degrees C shift. The human Apg-1 and Apg-2 genes were mapped to the chromosomal loci 4q28 and 5q23.3-q31.1, respectively, by fluorescence in-situ hybridization. We isolated cDNA and genomic clones encompassing the region critical for the difference between Apg-2 and HS24/p52. Although the primer sets used were derived from the sequences common to both cDNAs, all cDNA and genomic clones corresponded to Apg-2. Using a similar approach, the relationship between Apg-2 and Hsp70RY was assessed, and no clone corresponding to Hsp70RY was obtained. These results demonstrated that the Hsp110 family consists of at least three members, Apg-1, Apg-2 and Hsp110 in humans as well as in mice. The significance of HS24/p52 and Hsp70RY cDNAs previously reported remains to be determined.

  19. A novel cysteine-rich antimicrobial peptide from the mucus of the snail of Achatina fulica.

    PubMed

    Zhong, Jian; Wang, Wenhong; Yang, Xiaomei; Yan, Xiuwen; Liu, Rui

    2013-01-01

    Antimicrobial peptides (AMPs) are important components of the innate immunity. Many antimicrobial peptides have been found from marine mollusks. Little information about AMPs of mollusks living on land is available. A novel cysteine-rich antimicrobial peptide (mytimacin-AF) belonging to the peptide family of mytimacins was purified and characterized from the mucus of the snail of Achatina fulica. Its cDNA was also cloned from the cDNA library. Mytimacin-AF is composed of 80 amino acid residues including 10 cysteines. Mytimacin-AF showed potent antimicrobial activity against Gram-negative and Gram-positive bacteria and the fungus Candida albicans. Among tested microorganisms, it exerted strongest antimicrobial activity against Staphylococcus aureus with a minimal peptide concentration (MIC) of 1.9 μg/ml. Mytimacin-AF had little hemolytic activity against human blood red cells. The current work confirmed the presence of mytimacin-like antimicrobial peptide in land-living mollusks. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  20. Next generation sequencing technology: a powerful tool for the genome characterization of sugarcane mosaic virus from Sorghum almum

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing (NGS) technology was used to analyze the occurrence of viruses in Sorghum almum plants in Florida exhibiting mosaic symptoms. Total RNA was extracted from symptomatic leaves and used as a template for cDNA library preparation. The resulting library was sequenced on an Illu...

  1. Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

    USDA-ARS?s Scientific Manuscript database

    Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by ESTs only from the oocyte library. The novel...

  2. [Screening and identification of anoikis-resistant gene UBCH7 in esophageal cancer cells].

    PubMed

    Yang, Yang; Wang, Bo-Shi; Wang, Xiao-Min; Zhang, Yu; Wang, Ming-Rong; Jia, Xue-Mei

    2012-02-01

    Anoikis is a kind of programmed cell death induced by loss of extracellular matrix (ECM) adhesion, which is one of key factors for homestasis. Resistance to anoikis is required for tumor cell metastasis. We have previously shown several anoikis-resistance genes in esophageal squamous cell carcinoma (ESCC). In order to find novel anoikis-resistant genes in ESCC, we constructed retroviral cDNA library using total RNA from ESCC cell lines. NIH 3T3 cells, which are sensitive to anoikis, were infected with the library constructed. The cells were cultured in soft agar, and the clones which can survive in detached states were selected. The cDNAs inserted into the anoikis-resistant NIH3T3 clones were amplified using retroviral specific primers. Sequencing analysis showed that a cDNA fragment inserted into the anoikis-resistant clone contains full coding sequence (ORF) of human UBCH7/UBE2L3 gene. By infection with retrovirus encoding UBCH7 ORF (pMSCV-UBCH7), forced expression of UBCH7 increased the anoikis-resistance of NIH3T3 cells. More importantly, knockdown of UBCH7 expression by siRNA transfection reduced the anoikis-resistant ability of esophageal cancer MLuC1 cells. The data suggest that UBCH7/UBE2L3 gene would be involved in anoikis-resistance in ESCC.

  3. Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

    PubMed Central

    Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

    2010-01-01

    PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040

  4. Metatranscriptomics of Soil Eukaryotic Communities.

    PubMed

    Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2016-01-01

    Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

  5. RNA-Seq analysis to capture the transcriptome landscape of a single cell

    PubMed Central

    Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim

    2013-01-01

    We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668

  6. Role of messenger RNA-ribosome complex in complementary DNA display.

    PubMed

    Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke

    2013-07-15

    In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

  8. PAGE-1, an X chromosome-linked GAGE-like gene that is expressed in normal and neoplastic prostate, testis, and uterus

    PubMed Central

    Brinkmann, Ulrich; Vasmatzis, George; Lee, Byungkook; Yerushalmi, Noga; Essand, Magnus; Pastan, Ira

    1998-01-01

    We have used a combination of computerized database mining and experimental expression analyses to identify a gene that is preferentially expressed in normal male and female reproductive tissues, prostate, testis, fallopian tube, uterus, and placenta, as well as in prostate cancer, testicular cancer, and uterine cancer. This gene is located on the human X chromosome, and it is homologous to a family of genes encoding GAGE-like proteins. GAGE proteins are expressed in a variety of tumors and in testis. We designate the novel gene PAGE-1 because the expression pattern in the Cancer Genome Anatomy Project libraries indicates that it is predominantly expressed in normal and neoplastic prostate. Further database analysis indicates the presence of other genes with high homology to PAGE-1, which were found in cDNA libraries derived from testis, pooled libraries (with testis), and in a germ cell tumor library. The expression of PAGE-1 in normal and malignant prostate, testicular, and uterine tissues makes it a possible target for the diagnosis and possibly for the vaccine-based therapy of neoplasms of prostate, testis, and uterus. PMID:9724777

  9. PAGE-1, an X chromosome-linked GAGE-like gene that is expressed in normal and neoplastic prostate, testis, and uterus.

    PubMed

    Brinkmann, U; Vasmatzis, G; Lee, B; Yerushalmi, N; Essand, M; Pastan, I

    1998-09-01

    We have used a combination of computerized database mining and experimental expression analyses to identify a gene that is preferentially expressed in normal male and female reproductive tissues, prostate, testis, fallopian tube, uterus, and placenta, as well as in prostate cancer, testicular cancer, and uterine cancer. This gene is located on the human X chromosome, and it is homologous to a family of genes encoding GAGE-like proteins. GAGE proteins are expressed in a variety of tumors and in testis. We designate the novel gene PAGE-1 because the expression pattern in the Cancer Genome Anatomy Project libraries indicates that it is predominantly expressed in normal and neoplastic prostate. Further database analysis indicates the presence of other genes with high homology to PAGE-1, which were found in cDNA libraries derived from testis, pooled libraries (with testis), and in a germ cell tumor library. The expression of PAGE-1 in normal and malignant prostate, testicular, and uterine tissues makes it a possible target for the diagnosis and possibly for the vaccine-based therapy of neoplasms of prostate, testis, and uterus.

  10. A catalog for the transcripts from the venomous structures of the caterpillar Lonomia obliqua: identification of the proteins potentially involved in the coagulation disorder and hemorrhagic syndrome

    PubMed Central

    Veiga, Ana B. G.; Ribeiro, José M. C.; Guimarães, Jorge A.; Francischetti, Ivo M.B.

    2010-01-01

    Accidents with the caterpillar Lonomia obliqua are often associated with a coagulation disorder and hemorrhagic syndrome in humans. In the present study, we have constructed cDNA libraries from two venomous structures of the caterpillar, namely the tegument and the bristle. High-throughput sequencing and bioinformatics analyses were performed in parallel. Over one thousand cDNAs were obtained and clustered to produce a database of 538 contigs and singletons (clusters) for the tegument library and 368 for the bristle library. We have thus identified dozens of full-length cDNAs coding for proteins with sequence homology to snake venom prothrombin activator, trypsin-like enzymes, blood coagulation factors and prophenoloxidase cascade activators. We also report cDNA coding for cysteine proteases, Group III phospholipase A2, C-type lectins, lipocalins, in addition to protease inhibitors including serpins, Kazal-type inhibitors, cystatins and trypsin inhibitor-like molecules. Antibacterial proteins and housekeeping genes are also described. A significant number of sequences were devoid of database matches, suggesting that their biologic function remains to be defined. We also report the N-terminus of the most abundant proteins present in the bristle, tegument, hemolymph, and "cryosecretion". Thus, we have created a catalog that contains the predicted molecular weight, isoelectric point, accession number, and putative function for each selected molecule from the venomous structures of L. obliqua. The role of these molecules in the coagulation disorder and hemorrhagic syndrome caused by envenomation with this caterpillar is discussed. All sequence information and the Supplemental Data, including Figures and Tables with hyperlinks to FASTA-formatted files for each contig and the best match to the Databases, are available at http://www.ncbi.nih.gov/projects/omes. PMID:16023793

  11. Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

    PubMed

    Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

    2012-01-01

    Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

  12. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    PubMed

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Single-Cell RNA Sequencing of Glioblastoma Cells.

    PubMed

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

    2018-01-01

    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  14. Analysis of beta-carotene hydroxylase gene cDNA isolated from the American oil-palm (Elaeis oleifera) mesocarp tissue cDNA library

    PubMed Central

    Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H

    2010-01-01

    It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789

  15. EST resources and establishment and validation of a 16k cDNA microarray from Atlantic cod (Gadus morhua).

    PubMed

    Edvardsen, Rolf B; Malde, Ketil; Mittelholzer, Christian; Taranger, Geir Lasse; Nilsen, Frank

    2011-03-01

    The Atlantic cod, Gadus morhua, is an important species both for traditional fishery and increasingly also in fish farming. The Atlantic cod is also under potential threat from various environmental changes such as pollution and climate change, but the biological impact of such changes are not well known, in particular when it comes to sublethal effects that can be difficult to assert. Modern molecular and genomic approaches have revolutionized biological research during the last decade, and offer new avenues to study biological functions and e.g. the impact of anthropogenic activities at different life-stages for a given organism. In order to develop genomic data and genomic tools for Atlantic cod we conducted a program were we constructed 20 cDNA libraries, and produced and analyzed 44006 expressed sequence tags (ESTs) from these. Several tissues are represented in the multiple cDNA libraries, that differ in either sexual maturation or immulogical stimulation. This approach allowed us to identify genes that are expressed in particular tissues, life-stages or in response to specific stimuli, and also gives us information about potential functions of the transcripts. The ESTs were used to construct a 16k cDNA microarray to further investigate the cod transcriptome. Microarray analyses were preformed on pylorus, pituitary gland, spleen and testis of sexually maturing male cod. The four different tissues displayed tissue specific transcriptomes demonstrating that the cDNA array is working as expected and will prove to be a powerful tool in further experiments. Copyright © 2010 Elsevier Inc. All rights reserved.

  16. Cloning and Expression of cDNA for Rat Heme Oxygenase

    NASA Astrophysics Data System (ADS)

    Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

    1985-12-01

    Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

  17. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.

    1989-08-01

    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two,more » and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.« less

  18. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  19. RICD: a rice indica cDNA database resource for rice functional genomics.

    PubMed

    Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

    2008-11-26

    The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  20. Identification, characterization and leucocyte expression of Siglec-10, a novel human sialic acid-binding receptor.

    PubMed Central

    Munday, J; Kerr, S; Ni, J; Cornish, A L; Zhang, J Q; Nicoll, G; Floyd, H; Mattei, M G; Moore, P; Liu, D; Crocker, P R

    2001-01-01

    Here we characterize Siglec-10 as a new member of the Siglec family of sialic acid-binding Ig-like lectins. A full-length cDNA was isolated from a human spleen library and the corresponding gene identified. Siglec-10 is predicted to contain five extracellular Ig-like domains and a cytoplasmic tail containing three putative tyrosine-based signalling motifs. Siglec-10 exhibited a high degree of sequence similarity to CD33-related Siglecs and mapped to the same region, on chromosome 19q13.3. The expressed protein was able to mediate sialic acid-dependent binding to human erythrocytes and soluble sialoglycoconjugates. Using specific antibodies, Siglec-10 was detected on subsets of human leucocytes including eosinophils, monocytes and a minor population of natural killer-like cells. The molecular properties and expression pattern suggest that Siglec-10 may function as an inhibitory receptor within the innate immune system. PMID:11284738

  1. A tolerance gene for prenylated flavonoid encodes a 26S proteasome regulatory subunit in Sophora flavescens.

    PubMed

    Shitan, Nobukazu; Kamimoto, Yoshihisa; Minami, Shota; Kubo, Mizuki; Ito, Kozue; Moriyasu, Masataka; Yazaki, Kazufumi

    2011-01-01

    Yeast functional screening with a Sophora flavescens cDNA library was performed to identify the genes involved in the tolerant mechanism to the self-producing prenylated flavonoid sophoraflavanone G (SFG). One cDNA, which conferred SFG tolerance, encoded a regulatory particle triple-A ATPase 2 (SfRPT2), a member of the 26S proteasome subunit. The yeast transformant of SfRPT2 showed reduced SFG accumulation in the cells.

  2. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

    PubMed

    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

    2013-11-01

    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  3. Localization and physical mapping of genes encoding the A+U-rich element RNA-binding protein AUF1 to human chromosomes 4 and X

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wagner, B.J.; Long, L.; Pettenati, M.J.

    Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less

  4. Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

    PubMed Central

    Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

    1998-01-01

    Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

  5. Rat organic solute carrier protein 1 (rOscp1) mediated the transport of organic solutes in Xenopus laevis oocytes: isolation and pharmacological characterization of rOscp1.

    PubMed

    Izuno, Hisanori; Kobayashi, Yasuna; Sanada, Yutaka; Nihei, Daisuke; Suzuki, Masako; Kohyama, Noriko; Ohbayashi, Masayuki; Yamamoto, Toshinori

    2007-09-22

    Rat organic solute carrier protein 1 (rOscp1) was isolated from a rat testis cDNA library. Isolated rOscp1 cDNA consisted of 1089 base pairs that encoded a 363-amino acid protein, and the amino acid sequence was 88% and 93% identical to that of human OSCP1 (hOSCP1) and mouse Oscp1 (mOscp1), respectively. The message for rOscp1 is highly detected in rat testis. When expressed in X. oocytes, rOscp1 mediated the high affinity transport of p-aminohippurate (PAH) with a Km value of 15.7+/-1.9 microM, and rOscp1-mediated organic solutes were exhibited in time- and Na+-independent manners. rOscp1 also transported various structurally heterogenous compounds such as testosterone, dehydroepiandrosterone sulfate (DHEA-S), and taurocholate with some differences in substrate specificity compared with hOSCP1. Immunohistochemical analysis revealed that the rOscp1 protein is localized in the basal membrane side of Sertoli cells as observed in mouse testis [Kobayashi et al., 2007; Kobayashi, Y., Tsuchiya, A., Hayashi, T., Kohyama, N., Ohbayashi, M., Yamamoto, T., 2007. Isolation and characterization of polyspecific mouse organic solute carrier protein 1 (mOscp1). Drug Metabolism and Disposition 35 (7), 1239-1245]. Thus, the present results indicate that a newly isolated cDNA clone, rOscp1, is a polyspecific organic solute carrier protein with some differences in substrate specificity compared with human and mouse OSCP1.

  6. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

    PubMed

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

  7. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

    PubMed Central

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

  8. Distinct profiles of expressed sequence tags during intestinal regeneration in the sea cucumber Holothuria glaberrima

    PubMed Central

    Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.

    2010-01-01

    Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180

  9. Construction of cDNA library from intestine, mesentery and coelomocyte of Apostichopus japonicus Selenka infected with Vibrio sp. and a preliminary analysis of immunity-related genes

    NASA Astrophysics Data System (ADS)

    Liu, Hongzhan; Zheng, Fengrong; Sun, Xiuqin; Cai, Yimei

    2012-06-01

    The aquaculture of sea cucumber Apostichopus japonicus (Echinodermata, Holothuroidea) has grown rapidly during recent years and has become an important sector of the marine industry in Northern China. However, with the rapid growth of the industry and the use of non-standard culture techniques, epidemic diseases of A. japonicus now pose increasing problems to the industry. To screen the genes with stress response to bacterial infection in sea cucumber at a genome wide level, we constructed a cDNA library from A. japonicus Selenka (Aspidochirotida: Stichopodidae) after infecting them with Vibrio sp. for 48 h. Total RNA was extracted from the intestine, mesentery and coelomocyte of infected sea cucumber using Trizol and mRNA was isolated by Oligotex mRNA Kits. The ligated cDNAs were transformed into DH5α, and a library of 3.24×105 clones (3.24×105 cfu mL-1) was obtained with the sizes of inserted fragments ranging from 0.8 to 2.5 kb. Sequencing the cDNA clones resulted in a total of 1106 ESTs that passed the quality control. BlastX and BlastN searches have identified 168 (31.5%) ESTs sharing significant homology with known sequences in NCBI protein or nucleotide databases. Among a panel of 25 putative immunity-related genes, serum lectin isoform, complement component 3, complement component 3-like genes were further studied by real-time PCR and they all increased more than 5 fold in response to Vibrio sp. challenge. Our library provides a valuable molecular tool for future study of invertebrate immunity against bacterial infection and our gene expression data indicates the importance of the immune system in the evolution and development of sea cucumber.

  10. Identification of differentially-expressed genes potentially implicated in drought response in pitaya (Hylocereus undatus) by suppression subtractive hybridization and cDNA microarray analysis.

    PubMed

    Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng

    2014-01-01

    Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.

  11. The construction of cDNA library and the screening of related antigen of ascitic tumor cells of ovarian cancer.

    PubMed

    Hou, Q; Chen, K; Shan, Z

    2015-01-01

    To construct the cDNA library of the ascites tumor cells of ovarian cancer, which can be used to screen the related antigen for the early diagnosis of ovarian cancer and therapeutic targets of immune treatment. Four cases of ovarian serous cystadenocarcinoma, two cases of ovarian mucinous cystadenocarcinoma, and two cases of ovarian endometrial carcinoma in patients with ascitic tumor cells which were used to construct the cDNA library. To screen the ovarian cancer antigen gene, evaluate the enzyme, and analyze nucleotide sequence, serological analysis of recombinant tumor cDNA expression libraries (SEREX) and suppression subtractive hybridization technique (SSH) techniques were utilized. The detection method of recombinant expression-based serological mini-arrays (SMARTA) was used to detect the ovarian cancer antigen and the positive reaction of 105 cases of ovarian cancer patients and 105 normal women's autoantibodies correspondingly in serum. After two rounds of serologic screening and glycosides sequencing analysis, 59 candidates of ovarian cancer antigen gene fragments were finally identified, which corresponded to 50 genes. They were then divided into six categories: (1) the homologous genes which related to the known ovarian cancer genes, such as BARD 1 gene, etc; (2) the homologous genes which were associated with other tumors, such as TM4SFI gene, etc; (3) the genes which were expressed in a special organization, such as ILF3, FXR1 gene, etc; (4) the genes which were the same with some protein genes of special function, such as TIZ, ClD gene; (5) the homologous genes which possessed the same source with embryonic genes, such as PKHD1 gene, etc; (6) the remaining genes were the unknown genes without the homologous sequence in the gene pool, such as OV-189 genes. SEREX technology combined with SSH method is an effective research strategy which can filter tumor antigen with high specific character; the corresponding autoantibodies of TM4SFl, ClD, TIZ, BARDI, FXRI, and OV-189 gene's recombinant antigen in serum can be regarded as the biomarkers which are used to diagnose ovarian cancer. The combination of multiple antigen detection can improve diagnostic efficiency.

  12. Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-02-01

    The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

  13. Expression and permeation properties of the K(+) channel Kir7.1 in the retinal pigment epithelium.

    PubMed

    Shimura, M; Yuan, Y; Chang, J T; Zhang, S; Campochiaro, P A; Zack, D J; Hughes, B A

    2001-03-01

    Bovine Kir7.1 clones were obtained from a retinal pigment epithelium (RPE)-subtracted cDNA library. Human RPE cDNA library screening resulted in clones encoding full-length human Kir7.1. Northern blot analysis indicated that bovine Kir7.1 is highly expressed in the RPE. Human Kir7.1 channels were expressed in Xenopus oocytes and studied using the two-electrode voltage-clamp technique. The macroscopic Kir7.1 conductance exhibited mild inward rectification and an inverse dependence on extracellular K+ concentration ([K+]o). The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.013) > Na+ (0.003) approximately Li+ (0.001) and the sequence based on conductance ratios was Rb+ (9.5) > K+ (1.0) > Na+ (0.458) > Cs+ (0.331) > Li+ (0.139). Non-stationary noise analysis of Rb+ currents in cell-attached patches yielded a unitary conductance for Kir7.1 of approximately 2 pS. In whole-cell recordings from freshly isolated bovine RPE cells, the predominant current was a mild inwardly rectifying K+ current that exhibited an inverse dependence of conductance on [K+]o. The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.021) > Na+ (0.003) approximately Li+ (0.002) and the sequence based on conductance ratios was Rb+ (8.9) > K+ (1.0) > Na+ (0.59) > Cs+ (0.23) > Li+ (0.08). In cell-attached recordings with Rb+ in the pipette, inwardly rectifying currents were observed in nine of 12 patches of RPE apical membrane but in only one of 13 basolateral membrane patches. Non-stationary noise analysis of Rb+ currents in cell-attached apical membrane patches yielded a unitary conductance for RPE Kir of approximately 2 pS. On the basis of this molecular and electrophysiological evidence, we conclude that Kir7.1 channel subunits comprise the K+ conductance of the RPE apical membrane.

  14. Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants.

    PubMed

    Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

    2002-06-15

    The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.

  15. Cloning and expression of a Ca(2+)-inhibitable adenylyl cyclase from NCB-20 cells.

    PubMed Central

    Yoshimura, M; Cooper, D M

    1992-01-01

    A cDNA that encodes an adenylyl cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] has been cloned from NCB-20 cells, in which adenylyl cyclase activity is inhibited by Ca2+ at physiological concentrations. The cDNA clone (5.8 kilobases) was isolated by polymerase chain reaction (PCR) using degenerate primers designed by comparison of three adenylyl cyclase sequences (types I, II, and III) and subsequent library screening. Northern analysis revealed expression of mRNA (6.1 kilobases) corresponding to this cDNA in cardiac tissue, which is a prominent source of Ca(2+)-inhibitable adenylyl cyclase. The clone encodes a protein of 1165 amino acids, whose hydrophilicity profile was very similar to those of other mammalian adenylyl cyclases that have recently been cloned. A noticeable difference between this protein and other adenylyl cyclases was a lengthy aminoterminal region before the first transmembrane span. Transient expression of this cDNA in the human embryonic kidney cell line 293 revealed a 3-fold increase in cAMP production in response to forskolin compared with control transfected cells. In purified plasma membranes from transfected cells, increased adenylyl cyclase activity was also detected, which was susceptible to inhibition by submicromolar Ca2+. Thus, this adenylyl cyclase seems to represent the Ca(2+)-inhibitable form that is encountered in NCB-20 cells, cardiac tissue, and elsewhere. Its identification should permit a determination of the structural features that determine the mode of regulation of adenylyl cyclase by Ca2+. Images PMID:1379717

  16. Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

    PubMed Central

    Matthews, R J; Cahir, E D; Thomas, M L

    1990-01-01

    Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

  17. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    PubMed

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  18. Fibrinolysis in Tumor Associated Angiogenesis

    DTIC Science & Technology

    2005-07-01

    tPA expression in mammary vessel assays and in animals with use of retroviral vectors to deliver antisense RNA . We still intend to use that strategy...pads of nude mice. RNA obtained from tumor- and mam- mary fat pad-associated endothelial cells was used to synthesize cDNA and cDNA libraries, which... RNA (mRNA) for tPA and MT1-MMP, with some upregulation of uPA expression. BODY 1. Confirm differential expression of tPA and MT1-MIP with GAPDH control

  19. Comparative Analysis of Expressed Genes from Cacao Meristems Infected by Moniliophthora perniciosa

    PubMed Central

    Gesteira, Abelmon S.; Micheli, Fabienne; Carels, Nicolas; Da Silva, Aline C.; Gramacho, Karina P.; Schuster, Ivan; Macêdo, Joci N.; Pereira, Gonçalo A. G.; Cascardo, Júlio C. M.

    2007-01-01

    Background and Aims Witches' broom disease is caused by the hemibiotrophic basidiomycete Moniliophthora perniciosa, and is one of the most important diseases of cacao in the western hemisphere. Because very little is known about the global process of such disease development, expressed sequence tags (ESTs) were used to identify genes expressed during the Theobroma cacao–Moniliophthora perniciosa interaction. Methods Two cDNA libraries corresponding to the resistant (RT) and susceptible (SP) cacao–M. perniciosa interactions were constructed from total RNA, using the DB SMART Creator cDNA library kit (Clontech). Clones were randomly selected, sequenced from the 5′ end and analysed using bioinformatics tools including in silico analysis of the differential gene expression. Key Results A total of 6884 ESTs were generated from the RT and SP cDNA libraries. These ESTs were composed of 2585 singlets and 341 contigs for a total of 2926 non-redundant sequences. The redundancy of the libraries was low and their specificity high when compared with the few other cacao libraries already published. Sequence analysis allowed the assignment of a putative functional category for 54 % of sequences, whereas approx. 22 % of sequences corresponded to unknown function and approx. 24 % of sequences did not show any significant similarity with other proteins present in the database. Despite the similar overall distribution of the sequences in functional categories between the two libraries, qualitative differences were observed. Genes involved during the defence response to pathogen infection or in programmed cell death were identified, such as pathogenesis related-proteins, trypsin inhibitor or oxalate oxidase, and some of them showed an in silico differential expression between the resistant and the susceptible interactions. Conclusions As far as is known this is the first EST resource from the cacao–M. perniciosa interaction and it is believed that it will provide a significant contribution to the understanding of the molecular mechanisms of the resistance and susceptibility of cacao to M. perniciosa, to develop strategies to control witches broom, and as a source of polymorphism for molecular marker development and marker-assisted selection. PMID:17557832

  20. Biological Bases of Space Radiation Risk

    NASA Technical Reports Server (NTRS)

    1997-01-01

    In this session, Session JP4, the discussion focuses on the following topics: Hematopoiesis Dynamics in Irradiated Mammals, Mathematical Modeling; Estimating Health Risks in Space from Galactic Cosmic Rays; Failure of Heavy Ions to Affect Physiological Integrity of the Corneal Endothelial Monolayer; Application of an Unbiased Two-Gel CDNA Library Screening Method to Expression Monitoring of Genes in Irradiated Versus Control Cells; Detection of Radiation-Induced DNA Strand Breaks in Mammalian Cells By Enzymatic Post-Labeling; Evaluation of Bleomycin-Induced Chromosome Aberrations Under Microgravity Conditions in Human Lymphocytes, Using "Fish" Techniques; Technical Description of the Space Exposure Biology Assembly Seba on ISS; and Cytogenetic Research in Biological Dosimetry.

  1. Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples.

    PubMed

    Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

    2006-01-01

    Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.

  2. Isolating Viral and Host RNA Sequences from Archival Material and Production of cDNA Libraries for High-Throughput DNA Sequencing

    PubMed Central

    Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K.

    2015-01-01

    The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus at high coverage was determined in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases. PMID:26344216

  3. Molecular analysis of the biological bleaching of kraft pulps by Trametes versicolor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dumonceaux, T.J.; Archibald, F.S.

    1996-10-01

    Biological bleaching of kraft pulps by the fungus Trametes versicolor, based on the biodegradation of the recalcitrant polymer, lignin, could replace chlorine-based bleaching in Canadian pulp and paper mills. Enzymes that may be involved in lignin degradation include manganese peroxidase (MnP), laccase, and cellobiose-quinone oxidoreductase (CBQase). All three of these enzymatic activities are thought to interact extensively in cyclic oxidation/reduction reactions which ultimately bring about the degradation of lignin. We have constructed a cDNA library from T versicolor with the aim of isolating clones encoding factors that are relevant to biobleaching. We first determined the optimum growth conditions for expressionmore » of bleaching-related mRNA. A clear induction of bleaching ability was observed when the fungus was preincubated with 0.25% acid-washed pulp; the augmentation of bleaching was not explained by differences in MnP or laccase levels, suggesting that the expression of either CBQase or unidentified biobleaching factors was responsible for the increased pulp brightness. mRNA isolated from induced cultures was used to construct a cDNA library in a XZAP vector. This library has been probed with a degenerate oligonucleotide probe based upon a peptide sequence derived from purified CBQase, resulting in the identification of several hybridizing cDNA molecules. The CBQase clone will be used to examine in further detail the potential role of this enzyme in pulp biobleaching and lignin degradation.« less

  4. Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

    PubMed

    Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

    2009-01-01

    Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

  5. Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

    PubMed

    Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

    1997-02-01

    Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

  6. Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

    PubMed

    Sugimoto, H; Hayashi, H; Yamashita, S

    1996-03-29

    A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

  7. Transcriptomic and physiological analyses of Medicago sativa L. roots in response to lead stress

    PubMed Central

    Zhang, Shichao; Guo, Qiang; Jin, Yan; Chen, Jingjing; Ma, Hongxia

    2017-01-01

    Lead (Pb) is one of the nonessential and toxic metals that threaten the environment and human health. Medicago sativa L. is a legume with high salt tolerance and high biomass production. It is not only a globally important forage crop but is also an ideal plant for phytoremediation. However, the biological and molecular mechanisms that respond to heavy metals are still not well defined in M. sativa. In this study, de novo and strand-specific RNA-sequencing was performed to identify genes involved in the Pb stress response in M. sativa roots. A total of 415,350 unigenes were obtained from the assembled cDNA libraries, among which 5,416 were identified as significantly differentially expressed genes (DEGs) (false discovery rate < 0.005) between cDNA libraries from control and Pb-treated plants. Gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the DEGs showed they mainly clustered with terms associated with binding, transport, membranes, and the pathways related to signal and energy metabolism. Moreover, a number of candidate genes included antioxidant enzymes, metal transporters, and transcription factors involved in heavy metal response were upregulated under Pb stress. Quantitative real-time PCR(qRT-PCR) validation of the expression patterns of 10 randomly selected candidate DEGs were consistent with the transcriptome analysis results. Thus, this study offers new information towards the investigation of biological changes and molecular mechanisms related to Pb stress response in plants. PMID:28388670

  8. cDNA cloning and analysis of betaine aldehyde dehydrogenase, a salt inducible enzyme in sugar beet

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCue, K.F.; Hanson, A.D.

    1990-05-01

    Betaine accumulates and serves as a compatible osmolyte in some plants subjected to drought or salinity stress. The last enzyme in the betaine biosynthetic pathway is betaine aldehyde dehydrogenase (BADH). The activity of BADH increases in response to increasing salinity levels. This increase in activity corresponds to an increase in protein detectable by immunoblotting, and to an increase in the translatable BADH mRNA. BADH was cloned from a cDNA library constructed in {lambda}gt10 using poly(A){sup +} RNA from sugar beets salinized to 500 mM NaCl. cDNAs were size selected (>1kb) before ligation into the vector, and the library was screenedmore » with a spinach BADH cDNA probe. Three nearly full length clones obtained were confirmed as BADH by their nucleotide and deduced amino acid homology to spinach BADH. Clones averaged 1.8 kb and contained open reading frames of 500 amino acids at 80% identity with spinach BADH. RNA gel blot analysis of poly(A){sup +} RNA indicated that salinization to 500 mM NaCl resulted in a 5-fold increase of BADH mRNA level.« less

  9. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    PubMed

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  10. Construction of a cDNA library for sea cucumber Acaudina leucoprocta and differential expression of ferritin peptide

    NASA Astrophysics Data System (ADS)

    Zhou, Jun; Hou, Fujing; Li, Ye; Su, Xiurong; Li, Taiwu; Jin, Chunhua

    2016-07-01

    Acaudina leucoprocta is an edible sea cucumber of economic interest that is widely distributed in China. Little information is available concerning the molecular genetics of this species although such knowledge would contribute to a better understanding of the optimal conditions for its aquaculture and its mechanisms of defense against disease. Therefore, we constructed a cDNA library and, based on bioinformatics analysis of the sequences, the functions of 75% of the cDNAs were identified, including those involved in cell structure, energy metabolism, mitochondrial function, and signal transduction pathways. Approximately 25% of genes in the library were unmatched. The gene for A. leucoprocta ferritin was also cloned. The predicted amino-acid sequence of ferritin displayed significant homology with other sea-cucumber counterparts but indicated that it was a new member of the ferritin family. Semiquantitative real-time RT-PCR indicated the highest levels of ferritin mRNA expression in the intestine. A polyclonal antibody of ferritin was also produced. These data provide a set of molecular tools essential for further studies of the functions of ferritin protein in A. leucoprocta.

  11. A database of annotated tentative orthologs from crop abiotic stress transcripts.

    PubMed

    Balaji, Jayashree; Crouch, Jonathan H; Petite, Prasad V N S; Hoisington, David A

    2006-10-07

    A minimal requirement to initiate a comparative genomics study on plant responses to abiotic stresses is a dataset of orthologous sequences. The availability of a large amount of sequence information, including those derived from stress cDNA libraries allow for the identification of stress related genes and orthologs associated with the stress response. Orthologous sequences serve as tools to explore genes and their relationships across species. For this purpose, ESTs from stress cDNA libraries across 16 crop species including 6 important cereal crops and 10 dicots were systematically collated and subjected to bioinformatics analysis such as clustering, grouping of tentative orthologous sets, identification of protein motifs/patterns in the predicted protein sequence, and annotation with stress conditions, tissue/library source and putative function. All data are available to the scientific community at http://intranet.icrisat.org/gt1/tog/homepage.htm. We believe that the availability of annotated plant abiotic stress ortholog sets will be a valuable resource for researchers studying the biology of environmental stresses in plant systems, molecular evolution and genomics.

  12. Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

    PubMed

    Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

    2017-08-01

    Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system.

    PubMed

    Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

    2017-12-01

    We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

  14. TsAg5, a Taenia solium cysticercus protein with a marginal trypsin-like activity in the diagnosis of human neurocysticercosis.

    PubMed

    Rueda, Analiz; Sifuentes, Cecilia; Gilman, Robert H; Gutiérrez, Andrés H; Piña, Ruby; Chile, Nancy; Carrasco, Sebastián; Larson, Sandra; Mayta, Holger; Verástegui, Manuela; Rodriguez, Silvia; Gutiérrez-Correa, Marcel; García, Héctor H; Sheen, Patricia; Zimic, Mirko

    2011-12-01

    Neurocysticercosis is an endemic parasitic disease caused by Taenia solium larva. Although the mechanism of infection is not completely understood, it is likely driven by proteolytic activity that degrades the intestinal wall to facilitate oncosphere penetration and further infection. We analyzed the publicly available T. solium EST/DNA library and identified two contigs comprising a full-length cDNA fragment very similar to Echinococcus granulosus Ag5 protein. The T. solium cDNA sequence included a proteolytic trypsin-like-domain in the C-terminal region, and a thrombospondin type-1 adherence-domain in the N-terminal region. Both the trypsin-like and adherence domains were expressed independently as recombinant proteins in bacterial systems. TsAg5 showed marginal trypsin-like activity and high sequence similarity to Ag5. The purified antigens were tested in a Western immunoblot assay to diagnose human neurocysticercosis. The sensitivity of the trypsin-like-domain was 96.36% in patients infected with extraparenchymal cysts, 75.44% in patients infected with multiple cysts, and 39.62% in patients with a single cyst. Specificity was 76.70%. The thrombospondin type-1 adherence-domain was not specific for neurocysticercosis. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Akt regulates drug-induced cell death through Bcl-w downregulation.

    PubMed

    Garofalo, Michela; Quintavalle, Cristina; Zanca, Ciro; De Rienzo, Assunta; Romano, Giulia; Acunzo, Mario; Puca, Loredana; Incoronato, Mariarosaria; Croce, Carlo M; Condorelli, Gerolama

    2008-01-01

    Akt is a serine threonine kinase with a major role in transducing survival signals and regulating proteins involved in apoptosis. To find new interactors of Akt involved in cell survival, we performed a two-hybrid screening in yeast using human full-length Akt c-DNA as bait and a murine c-DNA library as prey. Among the 80 clones obtained, two were identified as Bcl-w. Bcl-w is a member of the Bcl-2 family that is essential for the regulation of cellular survival, and that is up-regulated in different human tumors, such as gastric and colorectal carcinomas. Direct interaction of Bcl-w with Akt was confirmed by immunoprecipitation assays. Subsequently, we addressed the function of this interaction: by interfering with the activity or amount of Akt, we have demonstrated that Akt modulates the amount of Bcl-w protein. We have found that inhibition of Akt activity may promote apoptosis through the downregulation of Bcl-w protein and the consequential reduction in interaction of Bcl-w with pro-apoptotic members of the Bcl-2 family. Our data provide evidence that Bcl-w is a new member of the Akt pathway and that Akt may induce anti-apoptotic signals at least in part through the regulation of the amount and activity of Bcl-w.

  16. Suppression subtractive hybridization identified differentially expressed genes in lung adenocarcinoma: ERGIC3 as a novel lung cancer-related gene

    PubMed Central

    2013-01-01

    Background To understand the carcinogenesis caused by accumulated genetic and epigenetic alterations and seek novel biomarkers for various cancers, studying differentially expressed genes between cancerous and normal tissues is crucial. In the study, two cDNA libraries of lung cancer were constructed and screened for identification of differentially expressed genes. Methods Two cDNA libraries of differentially expressed genes were constructed using lung adenocarcinoma tissue and adjacent nonmalignant lung tissue by suppression subtractive hybridization. The data of the cDNA libraries were then analyzed and compared using bioinformatics analysis. Levels of mRNA and protein were measured by quantitative real-time polymerase chain reaction (q-RT-PCR) and western blot respectively, as well as expression and localization of proteins were determined by immunostaining. Gene functions were investigated using proliferation and migration assays after gene silencing and gene over-expression. Results Two libraries of differentially expressed genes were obtained. The forward-subtracted library (FSL) and the reverse-subtracted library (RSL) contained 177 and 59 genes, respectively. Bioinformatic analysis demonstrated that these genes were involved in a wide range of cellular functions. The vast majority of these genes were newly identified to be abnormally expressed in lung cancer. In the first stage of the screening for 16 genes, we compared lung cancer tissues with their adjacent non-malignant tissues at the mRNA level, and found six genes (ERGIC3, DDR1, HSP90B1, SDC1, RPSA, and LPCAT1) from the FSL were significantly up-regulated while two genes (GPX3 and TIMP3) from the RSL were significantly down-regulated (P < 0.05). The ERGIC3 protein was also over-expressed in lung cancer tissues and cultured cells, and expression of ERGIC3 was correlated with the differentiated degree and histological type of lung cancer. The up-regulation of ERGIC3 could promote cellular migration and proliferation in vitro. Conclusions The two libraries of differentially expressed genes may provide the basis for new insights or clues for finding novel lung cancer-related genes; several genes were newly found in lung cancer with ERGIC3 seeming a novel lung cancer-related gene. ERGIC3 may play an active role in the development and progression of lung cancer. PMID:23374247

  17. Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

    PubMed Central

    LaPolla, R J; Mayne, K M; Davidson, N

    1984-01-01

    A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

  18. Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.

    PubMed Central

    Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M

    1998-01-01

    We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109

  19. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-12-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

  20. Recombinant antigens for immunodiagnosis of cystic echinococcosis

    PubMed Central

    Li, Jun; Zhang, Wen-Bao

    2004-01-01

    Three cDNAs, termed EpC1, TPxEg and EgG5, were isolated by immunoscreening from an Echinococcus granulosus cDNA library. The recombinant phages exhibited strong reactivity with sera from humans with confirmed cystic echinococcosis (CE) and with sera from mice infected with E. granulosus oncospheres. The cDNAs were subcloned into a pET vector, expressed as fusion proteins tagged with GST and affinity purified against the GST tag. Of the three recombinant proteins, EpC1 achieved the highest performance for serodiagnosis of CE in Western blot analysis using a panel of clinically defined human sera to initially address the sensitivity and specificity of the molecules. The protein yielded an overall sensitivity of 92.2% and specificity of 95.6%, levels unprecedented taking into account the large panel of 896 human sera that were tested. The strategy used may also prove suitable for improved immunodiagnosis of other parasitic infections. PMID:15188015

  1. Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

    PubMed Central

    Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

    1993-01-01

    A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

  2. Identification of drought-responsive genes in roots of upland rice (Oryza sativa L)

    PubMed Central

    Rabello, Aline R; Guimarães, Cléber M; Rangel, Paulo HN; da Silva, Felipe R; Seixas, Daniela; de Souza, Emanuel; Brasileiro, Ana CM; Spehar, Carlos R; Ferreira, Márcio E; Mehta, Ângela

    2008-01-01

    Background Rice (Oryza sativa L.) germplasm represents an extraordinary source of genes that control traits of agronomic importance such as drought tolerance. This diversity is the basis for the development of new cultivars better adapted to water restriction conditions, in particular for upland rice, which is grown under rainfall. The analyses of subtractive cDNA libraries and differential protein expression of drought tolerant and susceptible genotypes can contribute to the understanding of the genetic control of water use efficiency in rice. Results Two subtractive libraries were constructed using cDNA of drought susceptible and tolerant genotypes submitted to stress against cDNA of well-watered plants. In silico analysis revealed 463 reads, which were grouped into 282 clusters. Several genes expressed exclusively in the tolerant or susceptible genotypes were identified. Additionally, proteome analysis of roots from stressed plants was performed and 22 proteins putatively associated to drought tolerance were identified by mass spectrometry. Conclusion Several genes and proteins involved in drought-response, as well as genes with no described homologs were identified. Genes exclusively expressed in the tolerant genotype were, in general, related to maintenance of turgor and cell integrity. In contrast, in the susceptible genotype, expression of genes involved in protection against cell damage was not detected. Several protein families identified in the proteomic analysis were not detected in the cDNA analysis. There is an indication that the mechanisms of susceptibility to drought in upland rice are similar to those of lowland varieties. PMID:18922162

  3. A large-scale full-length cDNA analysis to explore the budding yeast transcriptome

    PubMed Central

    Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi

    2006-01-01

    We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987

  4. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    PubMed

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  5. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    PubMed

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  6. Isolation and characterization of a cDNA encoding a membrane bound acyl-CoA binding protein from Agave americana L. epidermis.

    PubMed

    Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio

    2006-01-01

    A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.

  7. Isolation of epidermal cells and cDNA cloning of TNF decoy receptor 3 of conger eel, Conger myriaster.

    PubMed

    Tsutsui, Shigeyuki; Yoshino, Yuko; Matsui, Saho; Nakamura, Osamu; Muramoto, Koji; Watanabe, Tasuku

    2008-03-01

    By using EDTA and a trypsin solution, we established a method for isolating the epidermal cells of the conger eel, Conger myriaster. We then identified TNF decoy receptor (DcR) cDNA in the species from a suppression subtractive hybridization library prepared from the epidermal cells stimulated with LPS. The full-length cDNA of conger TNF DcR (conDcR) consisted of 1479 base pairs, and the protein comprised 286 amino acid residues. Phylogenetic analysis indicated that conDcR was clustered into a DcR3 branch. ConDcR is likely to act as an important immune-regulating factor in inhibiting the apoptosis-inducing effect of TNF in the skin of conger eel.

  8. Flow cytometric purification of Colletotrichum higginsianum biotrophic hyphae from Arabidopsis leaves for stage-specific transcriptome analysis.

    PubMed

    Takahara, Hiroyuki; Dolf, Andreas; Endl, Elmar; O'Connell, Richard

    2009-08-01

    Generation of stage-specific cDNA libraries is a powerful approach to identify pathogen genes that are differentially expressed during plant infection. Biotrophic pathogens develop specialized infection structures inside living plant cells, but sampling the transcriptome of these structures is problematic due to the low ratio of fungal to plant RNA, and the lack of efficient methods to isolate them from infected plants. Here we established a method, based on fluorescence-activated cell sorting (FACS), to purify the intracellular biotrophic hyphae of Colletotrichum higginsianum from homogenates of infected Arabidopsis leaves. Specific selection of viable hyphae using a fluorescent vital marker provided intact RNA for cDNA library construction. Pilot-scale sequencing showed that the library was enriched with plant-induced and pathogenicity-related fungal genes, including some encoding small, soluble secreted proteins that represent candidate fungal effectors. The high purity of the hyphae (94%) prevented contamination of the library by sequences derived from host cells or other fungal cell types. RT-PCR confirmed that genes identified in the FACS-purified hyphae were also expressed in planta. The method has wide applicability for isolating the infection structures of other plant pathogens, and will facilitate cell-specific transcriptome analysis via deep sequencing and microarray hybridization, as well as proteomic analyses.

  9. Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

    PubMed Central

    2010-01-01

    Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

  10. Cloning, expression and characterization of a mammalian Nudix hydrolase-like enzyme that cleaves the pyrophosphate bond of UDP-glucose.

    PubMed Central

    Yagi, Toshihiro; Baroja-Fernández, Edurne; Yamamoto, Ryuji; Muñoz, Francisco José; Akazawa, Takashi; Hong, Kyoung Su; Pozueta-Romero, Javier

    2003-01-01

    A distinct UDP-glucose (UDPG) pyrophosphatase (UGPPase, EC 3.6.1.45) has been characterized using pig kidney ( Sus scrofa ). This enzyme hydrolyses UDPG, the precursor molecule of numerous glycosylation reactions in animals, to produce glucose 1-phosphate (G1P) and UMP. Sequence analyses of the purified enzyme revealed that, similar to the case of a nucleotide-sugar hydrolase controlling the intracellular levels of ADP-glucose linked to glycogen biosynthesis in Escherichia coli [Moreno-Bruna, Baroja-Fernández, Muñoz, Bastarrica-Berasategui, Zandueta-Criado, Rodri;guez-López, Lasa, Akazawa and Pozueta-Romero (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 8128-8132], UGPPase appears to be a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated Nudix hydrolases. A complete cDNA of the UGPPase-encoding gene, designated UGPP, was isolated from a human thyroid cDNA library and expressed in E. coli. The resulting cells accumulated a protein that showed kinetic properties identical to those of pig UGPPase. PMID:12429023

  11. Cloning, expression and characterization of a mammalian Nudix hydrolase-like enzyme that cleaves the pyrophosphate bond of UDP-glucose.

    PubMed

    Yagi, Toshihiro; Baroja-Fernández, Edurne; Yamamoto, Ryuji; Muñoz, Francisco José; Akazawa, Takashi; Hong, Kyoung Su; Pozueta-Romero, Javier

    2003-03-01

    A distinct UDP-glucose (UDPG) pyrophosphatase (UGPPase, EC 3.6.1.45) has been characterized using pig kidney ( Sus scrofa ). This enzyme hydrolyses UDPG, the precursor molecule of numerous glycosylation reactions in animals, to produce glucose 1-phosphate (G1P) and UMP. Sequence analyses of the purified enzyme revealed that, similar to the case of a nucleotide-sugar hydrolase controlling the intracellular levels of ADP-glucose linked to glycogen biosynthesis in Escherichia coli [Moreno-Bruna, Baroja-Fernández, Muñoz, Bastarrica-Berasategui, Zandueta-Criado, Rodri;guez-López, Lasa, Akazawa and Pozueta-Romero (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 8128-8132], UGPPase appears to be a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated Nudix hydrolases. A complete cDNA of the UGPPase-encoding gene, designated UGPP, was isolated from a human thyroid cDNA library and expressed in E. coli. The resulting cells accumulated a protein that showed kinetic properties identical to those of pig UGPPase.

  12. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    PubMed Central

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

  13. Characterization of embryo-specific genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sung, Z.R.

    1988-01-01

    The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less

  14. Cloning, annotation and expression analysis of mycoparasitism-related genes in Trichoderma harzianum 88.

    PubMed

    Yao, Lin; Yang, Qian; Song, Jinzhu; Tan, Chong; Guo, Changhong; Wang, Li; Qu, Lianhai; Wang, Yun

    2013-04-01

    Trichoderma harzianum 88, a filamentous soil fungus, is an effective biocontrol agent against several plant pathogens. High-throughput sequencing was used here to study the mycoparasitism mechanisms of T. harzianum 88. Plate confrontation tests of T. harzianum 88 against plant pathogens were conducted, and a cDNA library was constructed from T. harzianum 88 mycelia in the presence of plant pathogen cell walls. Randomly selected transcripts from the cDNA library were compared with eukaryotic plant and fungal genomes. Of the 1,386 transcripts sequenced, the most abundant Gene Ontology (GO) classification group was "physiological process". Differential expression of 19 genes was confirmed by real-time RT-PCR at different mycoparasitism stages against plant pathogens. Gene expression analysis revealed the transcription of various genes involved in mycoparasitism of T. harzianum 88. Our study provides helpful insights into the mechanisms of T. harzianum 88-plant pathogen interactions.

  15. Cloning and characterization of full-length mouse thymidine kinase 2: the N-terminal sequence directs import of the precursor protein into mitochondria.

    PubMed Central

    Wang, L; Eriksson, S

    2000-01-01

    The subcellular localization of mitochondrial thymidine kinase (TK2) has been questioned, since no mitochondrial targeting sequences have been found in cloned human TK2 cDNAs. Here we report the cloning of mouse TK2 cDNA from a mouse full-length enriched cDNA library. The mouse TK2 cDNA codes for a protein of 270 amino acids, with a 40-amino-acid presumed N-terminal mitochondrial targeting signal. In vitro translation and translocation experiments with purified rat mitochondria confirmed that the N-terminal sequence directed import of the precursor TK2 into the mitochondrial matrix. A single 2.4 kb mRNA transcript was detected in most tissues examined, except in liver, where an additional shorter (1.0 kb) transcript was also observed. There was no correlation between the tissue distribution of TK2 activity and the expression of TK2 mRNA. Full-length mouse TK2 protein and two N-terminally truncated forms, one of which corresponds to the mitochondrial form of TK2 and a shorter form corresponding to the previously characterized recombinant human TK2, were expressed in Escherichia coli and affinity purified. All three forms of TK2 phosphorylated thymidine, deoxycytidine and 2'-deoxyuridine, but with different kinetic efficiencies. A number of cytostatic pyrimidine nucleoside analogues were also tested and shown to be good substrates for the various forms of TK2. The active form of full-length mouse TK2 was a dimer, as judged by Superdex 200 chromatography. These results enhance our understanding of the structure and function of TK2, and may help to explain the mitochondrial disorder, mitochondrial neurogastrointestinal encephalomyopathy. PMID:11023833

  16. Expression of a mutation causing hypertrophic cardiomyopathy disrupts sarcomere assembly in adult feline cardiac myocytes.

    PubMed

    Marian, A J; Yu, Q T; Mann, D L; Graham, F L; Roberts, R

    1995-07-01

    Mutations in the beta-myosin heavy chain (beta MyHC) induce hypertrophic cardiomyopathy (HCM), cardiac hypertrophy, and sarcomere disarray, with the latter being the characteristic hallmark. Thus, we sought to determine whether expression of mutant beta MyHC in adult feline cardiac myocytes, a species known to develop HCM with a phenotype identical to that in humans, induces sarcomere disarray. A full-length beta MyHC cDNA was cloned from a human heart cDNA library, and an HCM-causing mutation (Arg403Gln) was induced in the beta MyHC cDNA by site-directed mutagenesis using polymerase chain reaction (PCR). The normal and mutant beta MyHC cDNAs were cloned into p delta E1spIB shuttle vector, downstream from a cytomegalovirus (CMV) promoter. Replication-deficient recombinant adenoviral constructs (Ad5/CMV/beta MyHC-N and Ad5/CMV/beta MyHC-403) were generated through homologous recombination of p delta E1spIB/CMV/beta MyHC-N or Ad5/CMV/beta MyHC-403 and pBHG10 after cotransfection in 293 host cells. Infection of COS-1 cells with the beta MyHC construct resulted in the expression of a full-length myosin protein. Efficiency of infection of isolated adult cardiac myocytes was > 95%. Expression of the beta MyHC constructs into mRNA at 48 hours after infection of feline cardiac myocytes was confirmed by reverse transcription-PCR. The net total protein and beta-myosin synthesis were determined by using the amount of incorporation of [3H]phenylalanine into total protein and beta-myosin, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Identification of Eukaryotic Open Reading Frames in Metagenomic cDNA Libraries Made from Environmental Samples†

    PubMed Central

    Grant, Susan; Grant, William D.; Cowan, Don A.; Jones, Brian E.; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

    2006-01-01

    Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at −20°C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes. PMID:16391035

  18. An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

    PubMed

    Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

    2004-01-21

    We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

  19. Differential expression of a novel seven transmembrane domain protein in epididymal fat from aged and diabetic mice.

    PubMed

    Yang, H; Egan, J M; Rodgers, B D; Bernier, M; Montrose-Rafizadeh, C

    1999-06-01

    To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.

  20. Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

    PubMed

    Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

    1996-02-01

    There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

  1. Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization

    PubMed Central

    Sahu, Binod B; Shaw, Birendra P

    2009-01-01

    Background Despite wealth of information generated on salt tolerance mechanism, its basics still remain elusive. Thus, there is a need of continued effort to understand the salt tolerance mechanism using suitable biotechnological techniques and test plants (species) to enable development of salt tolerant cultivars of interest. Therefore, the present study was undertaken to generate information on salt stress responsive genes in a natural halophyte, Suaeda maritima, using PCR-based suppression subtractive hybridization (PCR-SSH) technique. Results Forward and reverse SSH cDNA libraries were constructed after exposing the young plants to 425 mM NaCl for 24 h. From the forward SSH cDNA library, 429 high quality ESTs were obtained. BLASTX search and TIGR assembler programme revealed overexpression of 167 unigenes comprising 89 singletons and 78 contigs with ESTs redundancy of 81.8%. Among the unigenes, 32.5% were found to be of special interest, indicating novel function of these genes with regard to salt tolerance. Literature search for the known unigenes revealed that only 17 of them were salt-inducible. A comparative analysis of the existing SSH cDNA libraries for NaCl stress in plants showed that only a few overexpressing unigenes were common in them. Moreover, the present study also showed increased expression of phosphoethanolamine N-methyltransferase gene, indicating the possible accumulation of a much studied osmoticum, glycinebetaine, in halophyte under salt stress. Functional categorization of the proteins as per the Munich database in general revealed that salt tolerance could be largely determined by the proteins involved in transcription, signal transduction, protein activity regulation and cell differentiation and organogenesis. Conclusion The study provided a clear indication of possible vital role of glycinebetaine in the salt tolerance process in S. maritima. However, the salt-induced expression of a large number of genes involved in a wide range of cellular functions was indicative of highly complex nature of the process as such. Most of the salt inducible genes, nonetheless, appeared to be species-specific. In light of the observations made, it is reasonable to emphasize that a comparative analysis of ESTs from SSH cDNA libraries generated systematically for a few halophytes with varying salt exposure time may clearly identify the key salt tolerance determinant genes to a minimum number, highly desirable for any genetic manipulation adventure. PMID:19497134

  2. Organization of the murine Cd22 locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.

    1993-07-01

    Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less

  3. ILG1 : a new integrase-like gene that is a marker of bacterial contamination by the laboratory Escherichia coli strain TOP10F'.

    PubMed Central

    Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.

    2002-01-01

    BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938

  4. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    PubMed Central

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

  5. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

    PubMed Central

    Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

    1987-01-01

    Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

  6. Proteomic screening of variola virus reveals a unique NF-kappaB inhibitor that is highly conserved among pathogenic orthopoxviruses.

    PubMed

    Mohamed, Mohamed R; Rahman, Masmudur M; Lanchbury, Jerry S; Shattuck, Donna; Neff, Chris; Dufford, Max; van Buuren, Nick; Fagan, Katharine; Barry, Michele; Smith, Scott; Damon, Inger; McFadden, Grant

    2009-06-02

    Identification of the binary interactions between viral and host proteins has become a valuable tool for investigating viral tropism and pathogenesis. Here, we present the first systematic protein interaction screening of the unique variola virus proteome by using yeast 2-hybrid screening against a variety of human cDNA libraries. Several protein-protein interactions were identified, including an interaction between variola G1R, an ankryin/F-box containing protein, and human nuclear factor kappa-B1 (NF-kappaB1)/p105. This represents the first direct interaction between a pathogen-encoded protein and NF-kappaB1/p105. Orthologs of G1R are present in a variety of pathogenic orthopoxviruses, but not in vaccinia virus, and expression of any one of these viral proteins blocks NF-kappaB signaling in human cells. Thus, proteomic screening of variola virus has the potential to uncover modulators of the human innate antiviral responses.

  7. Cloning and expression of the rat homologue of the Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmitt, I.; Epplen, J.T.; Riess, O.

    1994-09-01

    Huntington`s disease (HD) is an autosomal dominant neurodegenerative disorder which is manifested usually in adult life. The age of onset is variable and leads to progressive symptoms including involuntary choreatic movements and various cognitive and psychiatric disturbances. Recently, a gene (IT15) was cloned containing a (CAG){sub n} repeat which is elongated and unstable in HD patients. IT15 is widely expressed in human tissues but unrelated to any known deduced protein sequence. To further investigate the HD gene, 15 rat cDNA libraries were screened. 24 clones have been identified covering the Huntingtin gene. Comparison of the Huntingtin gene between human andmore » rat revealed homologies between 80% and 87% at the DNA level and about 90% at the protein level. These analyses will help to define biologically important sequence regions, e.g., via evolutionary conservation. One clone contains the (CAG){sub n} repeat which consists of eight triplets compared to seven triplets in the mouse and a median of 17 in human. As in humans there are two transcripts arising from differential 3{prime}-polyadenylation. In the 3{prime}UTR a stretch of about 280 bp is exchanged for a 250 bp fragment with no homology in rodents and man. The cDNA clones are currently used to study Huntingtin gene expression during development in rodent tissues. RNA in situ hybridization of embryonic sections shows predominant signals in all neuronal tissues. In contrast to previously published data Huntingtin mRNA expression in testis is increased in spermatocytes vs. spermatogonia.« less

  8. Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

    PubMed

    Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

    1999-12-01

    An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

  9. Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

    PubMed Central

    Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

    2000-01-01

    Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

  10. Isolation and characterization of a cDNA clone specific for avian vitellogenin II.

    PubMed Central

    Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L

    1982-01-01

    A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527

  11. Genes expressed during the development and ripening of watermelon fruit.

    PubMed

    Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S

    2006-11-01

    A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.

  12. Gibberellin (GA3) enhances cell wall invertase activity and mRNA levels in elongating dwarf pea (Pisum sativum) shoots

    NASA Technical Reports Server (NTRS)

    Wu, L. L.; Mitchell, J. P.; Cohn, N. S.; Kaufman, P. B.

    1993-01-01

    The invertase (EC 3.2.1.26) purified from cell walls of dwarf pea stems to homogeneity has a molecular mass of 64 kilodaltons (kD). Poly(A)+RNA was isolated from shoots of dwarf pea plants, and a cDNA library was constructed using lambda gt11 as an expression vector. The expression cDNA library was screened with polyclonal antibodies against pea cell wall invertase. One invertase cDNA clone was characterized as a full-length cDNA with 1,863 base pairs. Compared with other known invertases, one homologous region in the amino acid sequence was found. The conserved motif, Asn-Asp-Pro-Asn-Gly, is located near the N-terminal end of invertase. Northern blot analysis showed that the amount of invertase mRNA (1.86 kb) was rapidly induced to a maximal level 4 h after GA3 treatment, then gradually decreased to the control level. The mRNA level at 4 h in GA3-treated peas was fivefold higher than that of the control group. The maximal increase in activity of pea cell wall invertase elicited by GA3 occcured at 8 h after GA3 treatment. This invertase isoform was shown immunocytochemically to be localized in the cell walls, where a 10-fold higher accumulation occurred in GA3-treated tissue compared with control tissue. This study indicates that the expression of the pea shoot cell-wall invertase gene could be regulated by GA3 at transcriptional and/or translational levels.

  13. Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

    PubMed

    Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

    2008-12-01

    Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

  14. R1, a novel repressor of the human monoamine oxidase A.

    PubMed

    Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

    2005-03-25

    Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

  15. Molecular cloning of metaphase chromosome protein 1 (MCP1), a novel human autoantigen that associates with condensed chromosomes during mitosis.

    PubMed

    Bronze-da-Rocha, E; Catita, J A; Sunkel, C E

    1998-02-01

    Systemic lupus erythematosus autoantibodies were used to identify and to characterize new human chromosome-associated proteins. Previous immunolocalization studies in human and murine tissue culture cells showed that some of these monoclonal antibodies recognize nuclear antigens that associate with condensed chromosomes during mitosis. One antibody was selected for screening a human HeLa S3 cDNA expression library, and cDNAs that code for an antigen of 31-33 kDa were isolated. Immunological, biochemical and cell fractionation data indicate that the 31- to 33-kDa antigen corresponds to the chromosome-associated protein recognized by the original monoclonal antibody. Sequence analysis shows that we isolated a novel human gene. Immunolocalization to human tissue culture cells shows that during interphase the antigen is dispersed in the nucleus and that during mitosis it associates exclusively with condensed chromosomes. A similar pattern of localization was also observed in mouse fibroblasts, suggesting that the antigen is conserved among different species. Finally, we show that part of the antigen remains bound to the scaffold/matrix component, even after high salt extraction.

  16. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed Central

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-01-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

  17. [Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

    1997-02-01

    The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

  18. Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

    PubMed

    Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

    2000-05-01

    A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

  19. Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

    PubMed Central

    Kilimann, M W; DeGennaro, L J

    1985-01-01

    To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

  20. Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

    PubMed Central

    Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

    1990-01-01

    Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

  1. cDNA cloning of the human monocarboxylate transporter 1 and chromosomal localization of the SLC16A1 locus to 1p13.2-p12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garcia, C.K.; Li, X.; Luna, J.

    1994-09-15

    Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.

  2. Sequence of Spider Aciniform and Piriform Silks

    DTIC Science & Technology

    2001-09-19

    7/98nd subtan-6/01 4. TITLE AND SUBTITLE Sequence of Spider Aciniform and Piriform Silks 5. FUNDING NUMBERS DAAD19-01-1-0569 6...aciniform glands from Argiope trifasciata were used to construct a cDNA library. The library was probed with various DNA probes based on known spider silk ...sequence in a number of other spider silks . The 5’end of the clone still appears to be repetitive sequence and thus it is unlikely to be a full-length

  3. Improving RNA-Seq expression estimates by correcting for fragment bias

    PubMed Central

    2011-01-01

    The biochemistry of RNA-Seq library preparation results in cDNA fragments that are not uniformly distributed within the transcripts they represent. This non-uniformity must be accounted for when estimating expression levels, and we show how to perform the needed corrections using a likelihood based approach. We find improvements in expression estimates as measured by correlation with independently performed qRT-PCR and show that correction of bias leads to improved replicability of results across libraries and sequencing technologies. PMID:21410973

  4. DNA Damage and Oxidative Stress in Dyskeratosis Congenita: Analysis of Pathways and Therapeutic Stategies Using CPISPR and iPSC Model Systems

    DTIC Science & Technology

    2017-06-01

    Milestone Achieved: HRPO/ACURO Approval 6 Finished Major Task 2 CRISPR knockout/RNAseq Viral infection/prep 3-6 CRISPR KO virus library prep...finished; RNA-Seq: ~75% Cell manipulation 3-6 CRISPR KO virus infection: 50%; Single cDNA infections: finished Bioinformatics 1 CRISPR KO library...characterization 1-3 Finished Update: production of iPSC clones harboring DC mutations generated by CRISPR : Design 1 Finished Update: production of

  5. A Novel Approach to the Elucidation of the Mechanism of Development of Androgen-Independent Growth of Prostate Cancer

    DTIC Science & Technology

    2001-01-01

    with 1.0 with differential hybridization to the two probes. Phage plaques corresponding ml of RIPA buffer with protease inhibitors (PBS, 1% NP40, 0.5...hybridized to radiolabeled probe prepared from plaque-purified phage . at 10,000 X g for 20 min; supernatants were collected and centrifuged again to...Screening. Lambda phage plaques from the primary unamplified Differential expression screening of cDNA libraries constructed CWR22 library were plated

  6. Peregrine

    PubMed Central

    Langevin, Stanley A.; Bent, Zachary W.; Solberg, Owen D.; Curtis, Deanna J.; Lane, Pamela D.; Williams, Kelly P.; Schoeniger, Joseph S.; Sinha, Anupama; Lane, Todd W.; Branda, Steven S.

    2013-01-01

    Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows. PMID:23558773

  7. Sequencing cDNAs: An Introduction to DNA Sequence Analysis in the Undergraduate Molecular Genetics Course.

    ERIC Educational Resources Information Center

    Galewsky, Samuel

    2000-01-01

    Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)

  8. Cloning of Sucrose:Sucrose 1-Fructosyltransferase from Onion and Synthesis of Structurally Defined Fructan Molecules from Sucrose1

    PubMed Central

    Vijn, Irma; van Dijken, Anja; Lüscher, Marcel; Bos, Antoine; Smeets, Edward; Weisbeek, Peter; Wiemken, Andres; Smeekens, Sjef

    1998-01-01

    Sucrose (Suc):Suc 1-fructosyltransferase (1-SST) is the key enzyme in plant fructan biosynthesis, since it catalyzes de novo fructan synthesis from Suc. We have cloned 1-SST from onion (Allium cepa) by screening a cDNA library using acid invertase from tulip (Tulipa gesneriana) as a probe. Expression assays in tobacco (Nicotiana plumbaginifolia) protoplasts showed the formation of 1-kestose from Suc. In addition, an onion acid invertase clone was isolated from the same cDNA library. Protein extracts of tobacco protoplasts transformed with this clone showed extensive Suc-hydrolyzing activity. Conditions that induced fructan accumulation in onion leaves also induced 1-SST mRNA accumulation, whereas the acid invertase mRNA level decreased. Structurally different fructan molecules could be produced from Suc by a combined incubation of protein extract of protoplasts transformed with 1-SST and protein extract of protoplasts transformed with either the onion fructan:fructan 6G-fructosyltransferase or the barley Suc:fructan 6-fructosyltransferase. PMID:9701606

  9. Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species

    PubMed Central

    Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.

    2014-01-01

    The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892

  10. Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stewart, G.J.; Savioz, A.; Davies, R.W.

    1997-01-15

    The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

    To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

  12. Identification and activity of a lower eukaryotic serine proteinase inhibitor (serpin) from Cyanea capillata: analysis of a jellyfish serpin, jellypin.

    PubMed

    Cole, Elisabeth B; Miller, David; Rometo, David; Greenberg, Robert M; Brömme, Dieter; Cataltepe, Sule; Pak, Stephen C; Mills, David R; Silverman, Gary A; Luke, Cliff J

    2004-09-21

    Delineating the phylogenetic relationships among members of a protein family can provide a high degree of insight into the evolution of domain structure and function relationships. To identify an early metazoan member of the high molecular weight serine proteinase inhibitor (serpin) superfamily, we initiated a cDNA library screen of the cnidarian, Cyanea capillata. We identified one serpin cDNA encoding for a full-length serpin, jellypin. Phylogenetic analysis using the deduced amino acid sequence showed that jellypin was most similar to the platyhelminthe Echinococcus multiocularis serpin and the clade P serpins, suggesting that this serpin evolved approximately 1000 million years ago (MYA). Modeling of jellypin showed that it contained all the functional elements of an inhibitory serpin. In vitro biochemical analysis confirmed that jellypin was an inhibitor of the S1 clan SA family of serine proteinases. Analysis of the interactions between the human serine proteinases, chymotrypsin, cathepsin G, and elastase, showed that jellypin inhibited these enzymes in the classical serpin manner, forming a SDS stable enzyme/inhibitor complex. These data suggest that the coevolution of serpin structure and inhibitory function date back to at least early metazoan evolution, approximately 1000 MYA.

  13. Rat PPAR delta contains a CGG triplet repeat and is prominently expressed in the thalamic nuclei.

    PubMed

    Xing, G; Zhang, L; Zhang, L; Heynen, T; Yoshikawa, T; Smith, M; Weiss, S; Detera-Wadleigh, S

    1995-12-26

    We have isolated a new rat sequence containing motifs of a nuclear hormone receptor from a brain cDNA library. The deduced amino acid sequence encoded by the cDNA clone showed a strong homology to the human NUCI and the mouse peroxisome proliferator activated receptor delta (PPAR delta). We therefore refer to this new clone as rat PPAR delta (rPPAR delta). The new feature of rPPAR delta is a 14 CGG triplet repeat on the 5' untranslated region, not previously reported in either NUCI or mPPAR delta. We found that rPPAR delta was expressed as a 3.5-kb transcript which showed a wide distribution in adult rat tissues. Abundant expression was detected in brain, heart, skeletal muscle, kidney and lung. Weaker expression was noted in the liver, spleen and testis. To determine the specific brain localization of rPPAR delta we performed in situ hybridization analysis. Prominent expression was observed in the thalamus, particularly in the posterior part of the ventral medial nucleus, a site responsive to pain and cold stress. These results raise the possibility that PPAR delta might play a role in modulating response to thermal and pain sensations.

  14. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-05-15

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

  15. Molecular cloning, expression and immunolocalization of a novel human cementum-derived protein (CP-23).

    PubMed

    Alvarez-Pérez, Marco Antonio; Narayanan, Sampath; Zeichner-David, Margarita; Rodríguez Carmona, Bruno; Arzate, Higinio

    2006-03-01

    Cementum is a unique mineralized connective tissue that covers the root surfaces of the teeth. The cementum is critical for appropriate maturation of the periodontium, both during development as well as that associated with regeneration of periodontal tissues, IU; however, one major impediment to understand the molecular mechanisms that regulate periodontal regeneration is the lack of cementum markers. Here we report on the identification and characterization of one such differentially human expressed gene, termed "cementum protein-23" (CP-23) that appears to be periodontal ligament and cementum-specific. We screened human cementum tumor-derived cDNA libraries by transient expression in COS-7 cells and "panning" with a rabbit polyclonal antibody against a cementoblastoma conditioned media-derived protein (CP). One isolated cDNA, CP-23, was expressed in E. coli and polyclonal antibodies against the recombinant human CP-23 were produced. Expression of CP-23 protein by cells of the periodontium was examined by Northern blot and in situ hybridization. Expression of CP-23 transcripts in human cementoblastoma-derived cells, periodontal ligament cells, human gingival fibroblasts and alveolar bone-derived cells was determined by RT-PCR. Our results show that we have isolated a 1374-bp human cDNA containing an open reading frame that encodes a polypeptide with 247 amino acid residues, with a predicted molecular mass of 25.9 kDa that represents CP species. The recombinant human CP-23 protein cross-reacted with antibodies against CP and type X collagen. Immunoscreening of human periodontal tissues revealed that CP-23 gene product is localized to the cementoid matrix of cementum and cementoblasts throughout the entire surface of the root, cell subpopulations of the periodontal ligament as well as cells located paravascularly to the blood vessels into the periodontal ligament. Furthermore, 98% of putative cementoblasts and 15% of periodontal ligament cells cultured in vitro expressed CP-23 gene product. Cementoblastoma cells and periodontal ligament cells contained a 5.0 kb CP-23 mRNA. In situ hybridization showed strong expression of CP-23 mRNA on cementoblast, cell subpopulations of the periodontal ligament and cells located around blood vessels into the periodontal ligament. Our results demonstrate that CP-23 represents a novel, tissue-specific-gene product being expressed by periodontal ligament subpopulations and cementoblasts. These findings offer the possibility to determine the cellular and molecular events that regulate the cementogenesis process during root development. Furthermore, it might provide new venues for the design of translational studies aimed at achieving predictable new cementogenesis and regeneration of the periodontal tissues.

  16. The painted turtle, Chrysemys picta: a model system for vertebrate evolution, ecology, and human health.

    PubMed

    Valenzuela, Nicole

    2009-07-01

    Painted turtles (Chrysemys picta) are representatives of a vertebrate clade whose biology and phylogenetic position hold a key to our understanding of fundamental aspects of vertebrate evolution. These features make them an ideal emerging model system. Extensive ecological and physiological research provide the context in which to place new research advances in evolutionary genetics, genomics, evolutionary developmental biology, and ecological developmental biology which are enabled by current resources, such as a bacterial artificial chromosome (BAC) library of C. picta, and the imminent development of additional ones such as genome sequences and cDNA and expressed sequence tag (EST) libraries. This integrative approach will allow the research community to continue making advances to provide functional and evolutionary explanations for the lability of biological traits found not only among reptiles but vertebrates in general. Moreover, because humans and reptiles share a common ancestor, and given the ease of using nonplacental vertebrates in experimental biology compared with mammalian embryos, painted turtles are also an emerging model system for biomedical research. For example, painted turtles have been studied to understand many biological responses to overwintering and anoxia, as potential sentinels for environmental xenobiotics, and as a model to decipher the ecology and evolution of sexual development and reproduction. Thus, painted turtles are an excellent reptilian model system for studies with human health, environmental, ecological, and evolutionary significance.

  17. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    PubMed

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  18. Lunar Gene Bank For Endangered Species

    NASA Astrophysics Data System (ADS)

    Swain, R.; Behera, D.; Sahoo, P. K.; Swain, S. K.; Sasmal, A.

    2012-09-01

    Before the dawn of the 22nd century, we face the huge risk of losing our genetic heritage accumulated during aeons of evolution. The losses include hundreds of vertebrates, hundreds of thousands of plants and over a million insect species. The gene pools of many human ethnic groups are also threatened. As we have observed, adequate conservation of habitat is unfeasible and active breeding programs cover only a handful of the many thousand species threatened. Against such indispensable losses scientists are starting cryopreservation of germplasms by creation of gene banks. I propose to construct a cDNA library based gene bank for endangered species in the permanently shadowed polar lunar craters that would provide immunity from both natural disadvantages and humanitarian intrusions [4].

  19. Molecular cloning and functional characterization of borneol dehydrogenase from the glandular trichomes of Lavandula x intermedia.

    PubMed

    Sarker, Lukman S; Galata, Mariana; Demissie, Zerihun A; Mahmoud, Soheil S

    2012-12-15

    Several varieties of Lavandula x intermedia (lavandins) are cultivated for their essential oils (EOs) for use in cosmetic, hygiene and personal care products. These EOs are mainly constituted of monoterpenes including camphor, which contributes an off odor reducing the olfactory appeal of the oil. We have recently constructed a cDNA library from the glandular trichomes (the sites of EO synthesis) of L. x intermedia plants. Here, we describe the cloning of a borneol dehydrogenase cDNA (LiBDH) from this library. The 780 bp open reading frame of the cDNA encoded a 259 amino acid short chain alcohol dehydrogenase with a predicted molecular mass of ca. 27.5 kDa. The recombinant LiBDH was expressed in Escherichia coli, purified by Ni-NTA agarose affinity chromatography, and functionally characterized in vitro. The bacterially produced enzyme specifically converted borneol to camphor as the only product with K(m) and k(cat) values of 53 μM and 4.0 × 10(-4) s(-1), respectively. The LiBDH transcripts were specifically expressed in glandular trichomes of mature flowers indicating that like other Lavandula monoterpene synthases the expression of this gene is regulated in a tissue-specific manner. The cloning of LiBDH has far reaching implications in improving the quality of Lavandula EOs through metabolic engineering. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. NADE (p75NTR-associated cell death executor) suppresses cellular growth in vivo.

    PubMed

    Tong, Xiangjun; Xie, Dong; Roth, Wilfried; Reed, John; Koeffler, H Phillip

    2003-06-01

    NADE, a p75NTR (low-affinity neurotrophin receptor p75) -associated cell death executor, was initially cloned from a human ovarian granulosa cell cDNA library, as an unknown protein with the name, pHGR74. It was reported to mediate nerve growth factor-induced apoptosis. We independently isolated human NADE (pHGR74) from breast cancer cell lines. Expression of NADE in various human cancer cell lines, and human and murine tissues was examined. NADE was highly expressed in human endocrine-related organs and embryotic murine tissues. Forced expression of NADE in CHO (Chinese hamster ovary) cells and MDA-MB-231 human breast cancer cells had little effect on the growth of the cells in vitro, while it dramatically suppressed cellular growth in vivo. We used the yeast two-hybrid system to search for NADE binding protein. Dynactin was identified as a candidate. The p75NTR was not found in this assay and did not co-immunoprecipitate with human NADE. Furthermore, the cells stably transfected with NADE did not respond to NGF or TNF. Thus, human and murine NADE appear to have different functions.

  1. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types.

    PubMed

    Kilian, A; Bowtell, D D; Abud, H E; Hime, G R; Venter, D J; Keese, P K; Duncan, E L; Reddel, R R; Jefferson, R A

    1997-11-01

    Telomerase is a multicomponent reverse transcriptase enzyme that adds DNA repeats to the ends of chromosomes using its RNA component as a template for synthesis. Telomerase activity is detected in the germline as well as the majority of tumors and immortal cell lines, and at low levels in several types of normal cells. We have cloned a human gene homologous to a protein from Saccharomyces cerevisiae and Euplotes aediculatus that has reverse transcriptase motifs and is thought to be the catalytic subunit of telomerase in those species. This gene is present in the human genome as a single copy sequence with a dominant transcript of approximately 4 kb in a human colon cancer cell line, LIM1215. The cDNA sequence was determined using clones from a LIM1215 cDNA library and by RT-PCR, cRACE and 3'RACE on mRNA from the same source. We show that the gene is expressed in several normal tissues, telomerase-positive post-crisis (immortal) cell lines and various tumors but is not expressed in the majority of normal tissues analyzed, pre-crisis (non-immortal) cells and telomerase-negative immortal (ALT) cell lines. Multiple products were identified by RT-PCR using primers within the reverse transcriptase domain. Sequencing of these products suggests that they arise by alternative splicing. Strikingly, various tumors, cell lines and even normal tissues (colonic crypt and testis) showed considerable differences in the splicing patterns. Alternative splicing of the telomerase catalytic subunit transcript may be important for the regulation of telomerase activity and may give rise to proteins with different biochemical functions.

  2. Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geraghty, M.T.; Stetten, G.; Kearns, W.

    1994-09-01

    X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

  3. A new virus from the family Tombusviridae infecting sugarcane

    USDA-ARS?s Scientific Manuscript database

    Sugarcane is an economically important crop cultivated in tropical and sub-tropical regions worldwide. Viral diseases are one of the major constraints for sugarcane production. Total RNA was extracted from leaves exhibiting mosaic symptoms on a sugarcane quarantine accession. A cDNA library was cons...

  4. Daytime soybean transcriptome fluctuations during water deficit stress

    USDA-ARS?s Scientific Manuscript database

    Since drought can seriously affect plant growth and development and little is known about how the oscillations of gene expression during the drought stress-acclimation response in soybean is affected, we applied Illumina technology to sequence 36 cDNA libraries synthesized from control and drought-s...

  5. Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herzog, R.; Lutz, S.; Blin, N.

    1991-02-05

    Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

  6. Grb-IR: A SH2-Domain-Containing Protein that Binds to the Insulin Receptor and Inhibits Its Function

    NASA Astrophysics Data System (ADS)

    Liu, Feng; Roth, Richard A.

    1995-10-01

    To identify potential signaling molecules involved in mediating insulin-induced biological responses, a yeast two-hybrid screen was performed with the cytoplasmic domain of the human insulin receptor (IR) as bait to trap high-affinity interacting proteins encoded by human liver or HeLa cDNA libraries. A SH2-domain-containing protein was identified that binds with high affinity in vitro to the autophosphorylated IR. The mRNA for this protein was found by Northern blot analyses to be highest in skeletal muscle and was also detected in fat by PCR. To study the role of this protein in insulin signaling, a full-length cDNA encoding this protein (called Grb-IR) was isolated and stably expressed in Chinese hamster ovary cells overexpressing the human IR. Insulin treatment of these cells resulted in the in situ formation of a complex of the IR and the 60-kDa Grb-IR. Although almost 75% of the Grb-IR protein was bound to the IR, it was only weakly tyrosine-phosphorylated. The formation of this complex appeared to inhibit the insulin-induced increase in tyrosine phosphorylation of two endogenous substrates, a 60-kDa GTPase-activating-protein-associated protein and, to a lesser extent, IR substrate 1. The subsequent association of this latter protein with phosphatidylinositol 3-kinase also appeared to be inhibited. These findings raise the possibility that Grb-IR is a SH2-domain-containing protein that directly complexes with the IR and serves to inhibit signaling or redirect the IR signaling pathway.

  7. A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.

    PubMed

    Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S

    1997-07-01

    A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.

  8. Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

    PubMed

    Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Isolation and Identification of miRNAs in Jatropha curcas

    PubMed Central

    Wang, Chun Ming; Liu, Peng; Sun, Fei; Li, Lei; Liu, Peng; Ye, Jian; Yue, Gen Hua

    2012-01-01

    MicroRNAs (miRNAs) are small noncoding RNAs that play crucial regulatory roles by targeting mRNAs for silencing. To identify miRNAs in Jatropha curcas L, a bioenergy crop, cDNA clones from two small RNA libraries of leaves and seeds were sequenced and analyzed using bioinformatic tools. Fifty-two putative miRNAs were found from the two libraries, among them six were identical to known miRNAs and 46 were novel. Differential expression patterns of 15 miRNAs in root, stem, leave, fruit and seed were detected using quantitative real-time PCR. Ten miRNAs were highly expressed in fruit or seed, implying that they may be involved in seed development or fatty acids synthesis in seed. Moreover, 28 targets of the isolated miRNAs were predicted from a jatropha cDNA library database. The miRNA target genes were predicted to encode a broad range of proteins. Sixteen targets had clear BLASTX hits to the Uniprot database and were associated with genes belonging to the three major gene ontology categories of biological process, cellular component, and molecular function. Four targets were identified for JcumiR004. By silencing JcumiR004 primary miRNA, expressions of the four target genes were up-regulated and oil composition were modulated significantly, indicating diverse functions of JcumiR004. PMID:22419887

  10. A tick B-cell inhibitory protein from salivary glands of the hard tick, Hyalomma asiaticum asiaticum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Da; Department of Life Science and Technology, Changshu Institute of Technology, Changshu 215500; Liang Jiangguo

    2006-05-05

    Some studies done to date suggest that B-cell inhibitory factor occurred in tick saliva. In this study, a novel protein having B-cell inhibitory activity was purified and characterized from the salivary glands of the hard tick, Hyalomma asiaticum asiaticum. This protein was named B-cell inhibitory factor (BIF). The cDNA encoding BIF was cloned by cDNA library screening. The predicted protein from the cDNA sequence is composed of 138 amino acids including the mature BIF. No similarity was found by Blast search. The lipopolysaccharide-induced B-cell proliferation was inhibited by BIF. This is First report of the identification and characterization of B-cellmore » inhibitory protein from tick. The current study facilitates the study of identifying the interaction among tick, Borrelia burgdorferi, the causative agent of Lyme disease, and host.« less

  11. Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.

    PubMed

    Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil

    2003-06-30

    Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.

  12. Transcriptome analysis of Schistosoma mansoni larval development using serial analysis of gene expression (SAGE).

    PubMed

    Taft, A S; Vermeire, J J; Bernier, J; Birkeland, S R; Cipriano, M J; Papa, A R; McArthur, A G; Yoshino, T P

    2009-04-01

    Infection of the snail, Biomphalaria glabrata, by the free-swimming miracidial stage of the human blood fluke, Schistosoma mansoni, and its subsequent development to the parasitic sporocyst stage is critical to establishment of viable infections and continued human transmission. We performed a genome-wide expression analysis of the S. mansoni miracidia and developing sporocyst using Long Serial Analysis of Gene Expression (LongSAGE). Five cDNA libraries were constructed from miracidia and in vitro cultured 6- and 20-day-old sporocysts maintained in sporocyst medium (SM) or in SM conditioned by previous cultivation with cells of the B. glabrata embryonic (Bge) cell line. We generated 21 440 SAGE tags and mapped 13 381 to the S. mansoni gene predictions (v4.0e) either by estimating theoretical 3' UTR lengths or using existing 3' EST sequence data. Overall, 432 transcripts were found to be differentially expressed amongst all 5 libraries. In total, 172 tags were differentially expressed between miracidia and 6-day conditioned sporocysts and 152 were differentially expressed between miracidia and 6-day unconditioned sporocysts. In addition, 53 and 45 tags, respectively, were differentially expressed in 6-day and 20-day cultured sporocysts, due to the effects of exposure to Bge cell-conditioned medium.

  13. Peregrine: A rapid and unbiased method to produce strand-specific RNA-Seq libraries from small quantities of starting material.

    PubMed

    Langevin, Stanley A; Bent, Zachary W; Solberg, Owen D; Curtis, Deanna J; Lane, Pamela D; Williams, Kelly P; Schoeniger, Joseph S; Sinha, Anupama; Lane, Todd W; Branda, Steven S

    2013-04-01

    Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows.

  14. Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

    PubMed Central

    Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

    2012-01-01

    Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

  15. Functional Transcriptomics of Wild-Caught Lutzomyia intermedia Salivary Glands: Identification of a Protective Salivary Protein against Leishmania braziliensis Infection

    PubMed Central

    Carneiro, Marcia W.; Miranda, José Carlos; Clarêncio, Jorge; Barral-Netto, Manoel; Brodskyn, Cláudia; Barral, Aldina; Ribeiro, José M. C.; Valenzuela, Jesus G.; de Oliveira, Camila I.

    2013-01-01

    Background Leishmania parasites are transmitted in the presence of sand fly saliva. Together with the parasite, the sand fly injects salivary components that change the environment at the feeding site. Mice immunized with Phlebotomus papatasi salivary gland (SG) homogenate are protected against Leishmania major infection, while immunity to Lutzomyia intermedia SG homogenate exacerbated experimental Leishmania braziliensis infection. In humans, antibodies to Lu. intermedia saliva are associated with risk of acquiring L. braziliensis infection. Despite these important findings, there is no information regarding the repertoire of Lu. intermedia salivary proteins. Methods and Findings A cDNA library from the Salivary Glands (SGs) of wild-caught Lu. intermedia was constructed, sequenced, and complemented by a proteomic approach based on 1D SDS PAGE and mass/mass spectrometry to validate the transcripts present in this cDNA library. We identified the most abundant transcripts and proteins reported in other sand fly species as well as novel proteins such as neurotoxin-like proteins, peptides with ML domain, and three small peptides found so far only in this sand fly species. DNA plasmids coding for ten selected transcripts were constructed and used to immunize BALB/c mice to study their immunogenicity. Plasmid Linb-11—coding for a 4.5-kDa protein—induced a cellular immune response and conferred protection against L. braziliensis infection. This protection correlated with a decreased parasite load and an increased frequency of IFN-γ-producing cells. Conclusions We identified the most abundant and novel proteins present in the SGs of Lu. intermedia, a vector of cutaneous leishmaniasis in the Americas. We also show for the first time that immunity to a single salivary protein from Lu. intermedia can protect against cutaneous leishmaniasis caused by L. braziliensis. PMID:23717705

  16. Functional transcriptomics of wild-caught Lutzomyia intermedia salivary glands: identification of a protective salivary protein against Leishmania braziliensis infection.

    PubMed

    de Moura, Tatiana R; Oliveira, Fabiano; Carneiro, Marcia W; Miranda, José Carlos; Clarêncio, Jorge; Barral-Netto, Manoel; Brodskyn, Cláudia; Barral, Aldina; Ribeiro, José M C; Valenzuela, Jesus G; de Oliveira, Camila I

    2013-01-01

    Leishmania parasites are transmitted in the presence of sand fly saliva. Together with the parasite, the sand fly injects salivary components that change the environment at the feeding site. Mice immunized with Phlebotomus papatasi salivary gland (SG) homogenate are protected against Leishmania major infection, while immunity to Lutzomyia intermedia SG homogenate exacerbated experimental Leishmania braziliensis infection. In humans, antibodies to Lu. intermedia saliva are associated with risk of acquiring L. braziliensis infection. Despite these important findings, there is no information regarding the repertoire of Lu. intermedia salivary proteins. A cDNA library from the Salivary Glands (SGs) of wild-caught Lu. intermedia was constructed, sequenced, and complemented by a proteomic approach based on 1D SDS PAGE and mass/mass spectrometry to validate the transcripts present in this cDNA library. We identified the most abundant transcripts and proteins reported in other sand fly species as well as novel proteins such as neurotoxin-like proteins, peptides with ML domain, and three small peptides found so far only in this sand fly species. DNA plasmids coding for ten selected transcripts were constructed and used to immunize BALB/c mice to study their immunogenicity. Plasmid Linb-11--coding for a 4.5-kDa protein--induced a cellular immune response and conferred protection against L. braziliensis infection. This protection correlated with a decreased parasite load and an increased frequency of IFN-γ-producing cells. We identified the most abundant and novel proteins present in the SGs of Lu. intermedia, a vector of cutaneous leishmaniasis in the Americas. We also show for the first time that immunity to a single salivary protein from Lu. intermedia can protect against cutaneous leishmaniasis caused by L. braziliensis.

  17. [Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

    PubMed

    Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

    2006-05-01

    Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

  18. Identifying differentially expressed genes in leaves of Glycine tomentella in the presence of the fungal pathogen Phakopsora pachyrhizi

    USDA-ARS?s Scientific Manuscript database

    Transcription profiles of Glycine tomentella genotypes having different responses to soybean rust, caused by the fungal pathogen Phakopsora pachyrhizi, were compared using suppression subtractive hybridization (SSH). Four cDNA libraries were constructed from infected and non-infected leaves of resis...

  19. [Identification of proteins interacting with the circadian clock protein PER1 in tumors using bacterial two-hybrid system technique].

    PubMed

    Zhang, Yu; Yao, Youlin; Jiang, Siyuan; Lu, Yilu; Liu, Yunqiang; Tao, Dachang; Zhang, Sizhong; Ma, Yongxin

    2015-04-01

    To identify protein-protein interaction partners of PER1 (period circadian protein homolog 1), key component of the molecular oscillation system of the circadian rhythm in tumors using bacterial two-hybrid system technique. Human cervical carcinoma cell Hela library was adopted. Recombinant bait plasmid pBT-PER1 and pTRG cDNA plasmid library were cotransformed into the two-hybrid system reporter strain cultured in a special selective medium. Target clones were screened. After isolating the positive clones, the target clones were sequenced and analyzed. Fourteen protein coding genes were identified, 4 of which were found to contain whole coding regions of genes, which included optic atrophy 3 protein (OPA3) associated with mitochondrial dynamics and homo sapiens cutA divalent cation tolerance homolog of E. coli (CUTA) associated with copper metabolism. There were also cellular events related proteins and proteins which are involved in biochemical reaction and signal transduction-related proteins. Identification of potential interacting proteins with PER1 in tumors may provide us new insights into the functions of the circadian clock protein PER1 during tumorigenesis.

  20. The EML4-ALK oncogene: targeting an essential growth driver in human cancer.

    PubMed

    Mano, Hiroyuki

    2015-01-01

    Targeting of essential growth drivers represents an ideal approach to cancer treatment. To identify such molecules in clinical specimens, we developed a highly sensitive functional screening system based on the preparation of retroviral cDNA expression libraries. By screening such a library of lung adenocarcinoma with a focus formation assay, we discovered the EML4-ALK fusion-type oncogene. A small chromosomal inversion thus leads to fusion of the amino-terminal portion of the microtubule-associated protein EML4 to the intracellular kinase domain of ALK, a receptor-type protein tyrosine kinase. Constitutive dimerization of EML4-ALK mediated by a dimerization motif of EML4 results in kinase activation. Specific inhibitors of the kinase activity of ALK have been developed as therapeutic drugs for EML4-ALK-positive lung cancer, three of which (crizotinib, ceritinib, and alectinib) have already been approved for clinical use. An overall clinical response rate of 93.5% for alectinib has shown that agents that target essential growth drivers can become magic bullets for cancer treatment.

  1. The EML4-ALK oncogene: targeting an essential growth driver in human cancer

    PubMed Central

    MANO, Hiroyuki

    2015-01-01

    Targeting of essential growth drivers represents an ideal approach to cancer treatment. To identify such molecules in clinical specimens, we developed a highly sensitive functional screening system based on the preparation of retroviral cDNA expression libraries. By screening such a library of lung adenocarcinoma with a focus formation assay, we discovered the EML4-ALK fusion-type oncogene. A small chromosomal inversion thus leads to fusion of the amino-terminal portion of the microtubule-associated protein EML4 to the intracellular kinase domain of ALK, a receptor-type protein tyrosine kinase. Constitutive dimerization of EML4-ALK mediated by a dimerization motif of EML4 results in kinase activation. Specific inhibitors of the kinase activity of ALK have been developed as therapeutic drugs for EML4-ALK–positive lung cancer, three of which (crizotinib, ceritinib, and alectinib) have already been approved for clinical use. An overall clinical response rate of 93.5% for alectinib has shown that agents that target essential growth drivers can become magic bullets for cancer treatment. PMID:25971657

  2. Molecular cloning, expression, functional characterization, chromosomal localization, and gene structure of junctate, a novel integral calcium binding protein of sarco(endo)plasmic reticulum membrane.

    PubMed

    Treves, S; Feriotto, G; Moccagatta, L; Gambari, R; Zorzato, F

    2000-12-15

    Screening a cDNA library from human skeletal muscle and cardiac muscle with a cDNA probe derived from junctin led to the isolation of two groups of cDNA clones. The first group displayed a deduced amino acid sequence that is 84% identical to that of dog heart junctin, whereas the second group had a single open reading frame that encoded a polypeptide with a predicted mass of 33 kDa, whose first 78 NH(2)-terminal residues are identical to junctin whereas its COOH terminus domain is identical to aspartyl beta-hydroxylase, a member of the alpha-ketoglutarate-dependent dioxygenase family. We named the latter amino acid sequence junctate. Northern blot analysis indicates that junctate is expressed in a variety of human tissues including heart, pancreas, brain, lung, liver, kidney, and skeletal muscle. Fluorescence in situ hybridization analysis revealed that the genetic loci of junctin and junctate map to the same cytogenetic band on human chromosome 8. Analysis of intron/exon boundaries of the genomic BAC clones demonstrate that junctin, junctate, and aspartyl beta-hydroxylase result from alternative splicing of the same gene. The predicted lumenal portion of junctate is enriched in negatively charged residues and is able to bind calcium. Scatchard analysis of equilibrium (45)Ca(2+) binding in the presence of a physiological concentration of KCl demonstrate that junctate binds 21.0 mol of Ca(2+)/mol protein with a k(D) of 217 +/- 20 microm (n = 5). Tagging recombinant junctate with green fluorescent protein and expressing the chimeric polypeptide in COS-7-transfected cells indicates that junctate is located in endoplasmic reticulum membranes and that its presence increases the peak amplitude and transient calcium released by activation of surface membrane receptors coupled to InsP(3) receptor activation. Our study shows that alternative splicing of the same gene generates the following functionally distinct proteins: an enzyme (aspartyl beta-hydroxylase), a structural protein of SR (junctin), and a membrane-bound calcium binding protein (junctate).

  3. Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

    PubMed Central

    Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

    1998-01-01

    Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

  4. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    PubMed

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  5. Characterization of mouse and human GTP cyclohydrolase I genes. Mutations in patients with GTP cyclohydrolase I deficiency.

    PubMed

    Ichinose, H; Ohye, T; Matsuda, Y; Hori, T; Blau, N; Burlina, A; Rouse, B; Matalon, R; Fujita, K; Nagatsu, T

    1995-04-28

    GTP cyclohydrolase I is the first and rate-limiting enzyme for the biosynthesis of tetrahydrobiopterin in mammals. Previously, we reported three species of human GTP cyclohydrolase I cDNA in a human liver cDNA library (Togari, A., Ichinose, H., Matsumoto, S., Fujita, K., and Nagatsu, T. (1992) Biochem. Biophys. Res. Commun. 187, 359-365). Furthermore, very recently, we found that the GTP cyclohydrolase I gene is causative for hereditary progressive dystonia with marked diurnal fluctuation, also known as DOPA-responsive dystonia (Ichinose, H., Ohye, T., Takahashi, E., Seki, N., Hori, T., Segawa, M., Nomura, Y., Endo, K., Tanaka, H., Tsuji, S., Fujita, K., and Nagatsu, T. (1994) Nature Genetics 8, 236-242). To clarify the mechanisms that regulate transcription of the GTP cyclohydrolase I gene and to generate multiple species of mRNA, we isolated genomic DNA clones for the human and mouse GTP cyclohydrolase I genes. Structural analysis of the isolated clones revealed that the GTP cyclohydrolase I gene is encoded by a single copy gene and is composed of six exons spanning approximately 30 kilobases. We sequenced all exon/intron boundaries of the human and mouse genes. Structural analysis also demonstrated that the heterogeneity of GTP cyclohydrolase I mRNA is caused by an alternative usage of the splicing acceptor site at the sixth exon. The transcription start site of the mouse GTP cyclohydrolase I gene and the 5'-flanking sequences of the mouse and human genes were determined. We performed regional mapping of the mouse gene by fluorescence in situ hybridization, and the mouse GTP cyclohydrolase I gene was assigned to region C2-3 of mouse chromosome 14. We identified missense mutations in patients with GTP cyclohydrolase I deficiency and expressed mutated enzymes in Escherichia coli to confirm alterations in the enzyme activity.

  6. The over-expression of the β2 catalytic subunit of the proteasome decreases homologous recombination and impairs DNA double-strand break repair in human cells.

    PubMed

    Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro

    2011-01-01

    By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

  7. The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

    PubMed Central

    Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro

    2011-01-01

    By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p. PMID:21660142

  8. BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction.

    PubMed

    Townsley, Brad T; Covington, Michael F; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R

    2015-01-01

    Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.

  9. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

    PubMed

    Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

  10. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Yun-Ling; Li, Li; Wu, Keqiang

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Song, Hae Jin; Park, Joongkyu; Seo, Su Ryeon

    Down syndrome is mainly caused by a trisomy of chromosome 21. The Down syndrome critical region 2 (DSCR2) gene is located within a part of chromosome 21, the Down syndrome critical region (DSCR). To investigate the function of DSCR2, we sought to identify DSCR2-interacting proteins using yeast two-hybrid assays. A human fetal brain cDNA library was screened, and DSCR2 was found to interact with a member of the nuclear receptor superfamily, peroxisome proliferator-activated receptor {beta}, (PPAR{beta}). A co-immunoprecipitation assay demonstrated that DSCR2 physically interacts with PPAR{beta} in mammalian HEK293 cells. DSCR2 also inhibited the ligand-induced transcriptional activity of PPAR{beta}. Furthermore,more » PPAR{beta} also decreased the solubility of DSCR2, which increased levels of insoluble DSCR2.« less

  12. Construction and characterization of normalized cDNA libraries by 454 pyrosequencing and estimation of DNA methylation levels in three distantly related termite species.

    PubMed

    Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

    2013-01-01

    In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.

  13. Construction and Characterization of Normalized cDNA Libraries by 454 Pyrosequencing and Estimation of DNA Methylation Levels in Three Distantly Related Termite Species

    PubMed Central

    Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

    2013-01-01

    In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800

  14. Microarray analysis identified Puccinia striiformis f. sp. tritici genes involved in infection and sporulation.

    USDA-ARS?s Scientific Manuscript database

    Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...

  15. A database of expressed genes from the new world screwworm, Cochliomyia hominivorax (Coquerel) (Diptera: Calliphoridae)

    USDA-ARS?s Scientific Manuscript database

    We used an expressed sequence tag and 454 pyrosequencing approach to initiate a study of the genome of the New World Screwworm, Cochliomyia hominivorax (Coquerel). Two normalized cDNA libraries were constructed from RNA isolated from embryos and 2nd instar larvae from the Panama 95 strain. Approxima...

  16. DNA sequences of Pima (Gossypium barbadense L.) cotton leaf for examining transcriptome diversity and SNP biomarker discovery

    USDA-ARS?s Scientific Manuscript database

    As an initial step to explore the transcriptome genetic diversity and to discover single nucleotide polymorphic (SNP)-biomarkers for marker assisted breeding within Pima (Gossypium barbadense L.) cotton, leaves from 25 day plants of three diverse genotypes were used to develop cDNA libraries. Using ...

  17. A novel protein involved in heart development in Ambystoma mexicanum is localized in endoplasmic reticulum.

    PubMed

    Jia, P; Zhang, C; Huang, X P; Poda, M; Akbas, F; Lemanski, S L; Erginel-Unaltuna, N; Lemanski, L F

    2008-11-01

    The discovery of the naturally occurring cardiac non-function (c) animal strain in Ambystoma mexicanum (axolotl) provides a valuable animal model to study cardiomyocyte differentiation. In homozygous mutant animals (c/c), rhythmic contractions of the embryonic heart are absent due to a lack of organized myofibrils. We have previously cloned a partial sequence of a peptide cDNA (N1) from an anterior-endoderm-conditioned-medium RNA library that had been shown to be able to rescue the mutant phenotype. In the current studies we have fully cloned the N1 full length cDNA sequence from the library. N1 protein has been detected in both adult heart and skeletal muscle but not in any other adult tissues. GFP-tagged expression of the N1 protein has revealed localization of the N1 protein in the endoplasmic reticulum (ER). Results from in situ hybridization experiments have confirmed the dramatic decrease of expression of N1 mRNA in mutant (c/c) embryos indicating that the N1 gene is involved in heart development.

  18. Cloning and characterization of a Candida albicans maltase gene involved in sucrose utilization.

    PubMed Central

    Geber, A; Williamson, P R; Rex, J H; Sweeney, E C; Bennett, J E

    1992-01-01

    In order to isolate the structural gene involved in sucrose utilization, we screened a sucrose-induced Candida albicans cDNA library for clones expressing alpha-glucosidase activity. The C. albicans maltase structural gene (CAMAL2) was isolated. No other clones expressing alpha-glucosidase activity. were detected. A genomic CAMAL2 clone was obtained by screening a size-selected genomic library with the cDNA clone. DNA sequence analysis reveals that CAMAL2 encodes a 570-amino-acid protein which shares 50% identity with the maltase structural gene (MAL62) of Saccharomyces carlsbergensis. The substrate specificity of the recombinant protein purified from Escherichia coli identifies the enzyme as a maltase. Northern (RNA) analysis reveals that transcription of CAMAL2 is induced by maltose and sucrose and repressed by glucose. These results suggest that assimilation of sucrose in C. albicans relies on an inducible maltase enzyme. The family of genes controlling sucrose utilization in C. albicans shares similarities with the MAL gene family of Saccharomyces cerevisiae and provides a model system for studying gene regulation in this pathogenic yeast. Images PMID:1400249

  19. Expressed sequence tags (ESTs) and phylogenetic analysis of floral genes from a paleoherb species, Asarum caudigerum.

    PubMed

    Zhao, Yinhe; Wang, Guoying; Zhang, Jinpeng; Yang, Junbo; Peng, Shang; Gao, Lianming; Li, Chengyun; Hu, Jinyong; Li, Dezhu; Gao, Lizhi

    2006-07-01

    Asarum caudigerum (Aristolochiaceae) is an important species of paleoherb in relation to understanding the origin and evolution of angiosperm flowers, due to its basal position in the angiosperms. The aim of this study was to isolate floral-related genes from A. caudigerum, and to infer evolutionary relationships among florally expression-related genes, to further illustrate the origin and diversification of flowers in angiosperms. A subtracted floral cDNA library was constructed from floral buds using suppression subtractive hybridization (SSH). The cDNA of floral buds and leaves at the seedling stage were used as a tester and a driver, respectively. To further identify the function of putative MADS-box transcription factors, phylogenetic trees were reconstructed in order to infer evolutionary relationships within the MADS-box gene family. In the forward-subtracted floral cDNA library, 1920 clones were randomly sequenced, from which 567 unique expressed sequence tags (ESTs) were obtained. Among them, 127 genes failed to show significant similarity to any published sequences in GenBank and thus are putatively novel genes. Phylogenetic analysis indicated that a total of 29 MADS-box transcription factors were members of the APETALA3(AP3) subfamily, while nine others were putative MADS-box transcription factors that formed a cluster with MADS-box genes isolated from Amborella, the basal-most angiosperm, and those from the gymnosperms. This suggests that the origin of A. caudigerum is intermediate between the angiosperms and gymnosperms.

  20. Gene expression in the pulp of ripening bananas. Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products and cDNA cloning of 25 different ripening-related mRNAs.

    PubMed Central

    Medina-Suárez, R; Manning, K; Fletcher, J; Aked, J; Bird, C R; Seymour, G B

    1997-01-01

    mRNA was extracted from the pulp and peel of preclimacteric (d 0) bananas (Musa AAA group, cv Grand Nain) and those exposed to ethylene gas for 24 h and stored in air alone for a further 1 (d 2) and 4 d (d 5). Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products from the pulp and peel of these fruits revealed significant up-regulation of numerous transcripts during ripening. The majority of the changes were initiated by d 2, with the level of these messages increasing during the remainder of the ripening period. Pulp tissue from d 2 was used for the construction of a cDNA library. This library was differentially screened for ripening-related clones using cDNA from d-0 and d-2 pulp by a novel microtiter plate method. In the primary screen 250 up- and down-regulated clones were isolated. Of these, 59 differentially expressed clones were obtained from the secondary screen. All of these cDNAs were partially sequenced and grouped into families after database searches. Twenty-five nonredundant groups of pulp clones were identified. These encoded enzymes were involved in ethylene biosynthesis, respiration, starch metabolism, cell wall degradation, and several other key metabolic events. We describe the analysis of these clones and their possible involvement in ripening. PMID:9342865

  1. Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

    PubMed Central

    van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

    2002-01-01

    Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

  2. Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

    PubMed

    Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

    1991-03-01

    We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

  3. Transcription profiling using RNA-Seq demonstrates expression differences in the body walls of juvenile albino and normal sea cucumbers Apostichopus japonicus

    NASA Astrophysics Data System (ADS)

    Ma, Deyou; Yang, Hongsheng; Sun, Lina; Chen, Muyan

    2014-01-01

    Sea cucumbers Apostichopus japonicus are one of the most important aquaculture species in China. Their normal body color is black to fit their surroundings. Wild albinos are rare and hard to breed. To understand the differences between albino and normal (control) sea cucumbers at the transcriptional level, we sequenced the transcriptomes in their body-wall tissues using RNA-Seq high-throughput sequencing. Approximately 4.876 million (M) and 4.884 M 200-nucleotide-long cDNA reads were produced in the cDNA libraries derived from the body walls of albino and control samples, respectively. A total of 9 561 (46.89%) putative genes were identified from among the RNA-Seq reads in both libraries. After filtering, 837 significantly differentially regulated genes were identified in the albino library compared with in the control library, and 3.6% of the differentially expressed genes (DEGs) were found to have changed those more than five-fold. The expression levels of 10 DEGs were checked by real-time PCR and the results were in full accord with the RNA-Seq expression trends, although the amplitude of the differences in expression levels was lower in all cases. A series of pathways were significantly enriched for the DEGs. These pathways were closely related to phagocytosis, the complement and coagulation cascades, apoptosis-related diseases, cytokine-cytokine receptor interaction, and cell adhesion. The differences in gene expression and enriched pathways between the albino and control sea cucumbers offer control targets for cultivating excellent albino A. japonicus strains in the future.

  4. Construction of a full-length cDNA Library from Chinese oak silkworm pupa and identification of a KK-42-binding protein gene in relation to pupa-diapause termination.

    PubMed

    Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai

    2009-06-24

    In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 x 10(5) cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination.

  5. Construction of a full-length cDNA Library from Chinese oak silkworm pupa and identification of a KK-42-binding protein gene in relation to pupa-diapause termination

    PubMed Central

    Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai

    2009-01-01

    In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 × 105 cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination. PMID:19564928

  6. The Relative Abundance and Transcriptional Activity of Marine Sponge-Associated Microorganisms Emphasizing Groups Involved in Sulfur Cycle.

    PubMed

    Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L

    2017-04-01

    During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.

  7. Isolation of expressed sequences from the region commonly deleted in Velo-cardio-facial syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sirotkin, H.; Morrow, B.; DasGupta, R.

    Velo-cardio-facial syndrome (VCFS) is a relatively common autosomal dominant genetic disorder characterized by cleft palate, cardiac abnormalities, learning disabilities and a characteristic facial dysmorphology. Most VCFS patients have interstitial deletions of 22q11 of 1-2 mb. In an effort to isolate the gene(s) responsible for VCFS we have utilized a hybrid selection protocol to recover expressed sequences from three non-overlapping YACs comprising almost 1 mb of the commonly deleted region. Total yeast genomic DNA or isolated YAC DNA was immobilized on Hybond-N filters, blocked with yeast and human ribosomal and human repetitive sequences and hybridized with a mixture of random primedmore » short fragment cDNA libraries. Six human short fragment libraries derived from total fetus, fetal brain, adult brain, testes, thymus and spleen have been used for the selections. Short fragment cDNAs retained on the filter were passed through a second round of selection and cloned into lambda gt10. cDNAs shown to originate from the YACs and from chromosome 22 are being used to isolate full length cDNAs. Three genes known to be present on these YACs, catechol-O-methyltransferase, tuple 1 and clathrin heavy chain have been recovered. Additionally, a gene related to the murine p120 gene and a number of novel short cDNAs have been isolated. The role of these genes in VCFS is being investigated.« less

  8. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    PubMed

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  9. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. cDNA encoding a polypeptide including a hev ein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  11. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  12. CDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  13. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  14. Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

    PubMed

    Yi, S Y; Yu, S H; Choi, D

    1999-06-30

    Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

  15. Identification of Differentially Expressed Thyroid Hormone Responsive Genes from the Brain of the Mexican Axolotl (Ambystoma mexicanum) ✧

    PubMed Central

    Huggins, P; Johnson, CK; Schoergendorfer, A; Putta, S; Bathke, AC; Stromberg, AJ; Voss, SR

    2011-01-01

    The Mexican axolotl (Ambystoma mexicanum) presents an excellent model to investigate mechanisms of brain development that are conserved among vertebrates. In particular, metamorphic changes of the brain can be induced in free-living aquatic juveniles and adults by simply adding thyroid hormone (T4) to rearing water. Whole brains were sampled from juvenile A. mexicanum that were exposed to 0, 8, and 18 days of 50 nM T4, and these were used to isolate RNA and make normalized cDNA libraries for 454 DNA sequencing. A total of 1,875,732 high quality cDNA reads were assembled with existing ESTs to obtain 5,884 new contigs for human RefSeq protein models, and to develop a custom Affymetrix gene expression array (Amby_002) with approximately 20,000 probe sets. The Amby_002 array was used to identify 303 transcripts that differed statistically (p < 0.05, fold change > 1.5) as a function of days of T4 treatment. Further statistical analyses showed that Amby_002 performed concordantly in comparison to an existing, small format expression array. This study introduces a new A. mexicanum microarray resource for the community and the first lists of T4-responsive genes from the brain of a salamander amphibian. PMID:21457787

  16. Identification of differentially expressed thyroid hormone responsive genes from the brain of the Mexican Axolotl (Ambystoma mexicanum).

    PubMed

    Huggins, P; Johnson, C K; Schoergendorfer, A; Putta, S; Bathke, A C; Stromberg, A J; Voss, S R

    2012-01-01

    The Mexican axolotl (Ambystoma mexicanum) presents an excellent model to investigate mechanisms of brain development that are conserved among vertebrates. In particular, metamorphic changes of the brain can be induced in free-living aquatic juveniles and adults by simply adding thyroid hormone (T4) to rearing water. Whole brains were sampled from juvenile A. mexicanum that were exposed to 0, 8, and 18 days of 50 nM T4, and these were used to isolate RNA and make normalized cDNA libraries for 454 DNA sequencing. A total of 1,875,732 high quality cDNA reads were assembled with existing ESTs to obtain 5884 new contigs for human RefSeq protein models, and to develop a custom Affymetrix gene expression array (Amby_002) with approximately 20,000 probe sets. The Amby_002 array was used to identify 303 transcripts that differed statistically (p<0.05, fold change >1.5) as a function of days of T4 treatment. Further statistical analyses showed that Amby_002 performed concordantly in comparison to an existing, small format expression array. This study introduces a new A. mexicanum microarray resource for the community and the first lists of T4-responsive genes from the brain of a salamander amphibian. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Elevation of Autoantibody in Patients with Ischemic Stroke.

    PubMed

    Yoshida, Yoichi; Hiwasa, Takaki; Machida, Toshio; Kobayashi, Eiichi; Mine, Seiichiro; Matsushima, Jun; Takiguchi, Masaki; Iwadate, Yasuo

    2018-05-31

    Recent clinical research has revealed a significant correlation between atherosclerosis, one of the primary etiologies of ischemic stroke, and the immune system. Assuming that "disease-specific autoantibodies are produced in the sera of patients with ischemic stroke," we investigated multiple arteriosclerosis-related antibodies using the serological identification of antigens by recombinant cDNA expression cloning (SEREX), an established method for identifying antigenic proteins. We either screened a human aortic endothelial cell cDNA library or conducted protein array screening using the sera from patients with ischemic stroke, such as carotid artery stenosis or transient ischemic attack (TIA). Next, we measured serum antibody levels using amplified luminescent proximity homogeneous assay-linked immunosorbent assay (AlphaLISA) in patient/healthy donor (HD) cohorts and identified several antigens, the antibody levels of which were significantly higher in patients with ischemic stroke than in HDs. This review introduced the method of identifying antigens by the SEREX and protein microarray and summarized antigenic proteins. In particular, it focused on anti-replication protein A2 antibody and anti-programmed cell death 11 antibody, which are significantly related to atherosclerotic plaque and ischemic brain tissue, respectively, and proposed the mechanism of elevated autoantibody levels against them. Furthermore, this review suggests a possibility of clinical application as an atherosclerotic disease diagnostic marker for TIA or cerebral infarction.

  18. Complete sequence of HLA-B27 cDNA identified through the characterization of structural markers unique to the HLA-A, -B, and -C allelic series

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szoets, H.; Reithmueller, G.; Weiss, E.

    1986-03-01

    Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in positionmore » 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.« less

  19. Melanin biosynthesis in the fungus Curvularia lunata (teleomorph: Cochliobolus lunatus).

    PubMed

    Lanisnik Rizner, Tea; Wheeler, Michael H

    2003-02-01

    Curvularia lunata (teleomorph: Cochliobolus lunatus) is a known plant and human pathogen. Tricyclazole, a specific inhibitor of pentaketide melanin biosynthesis, blocked the biosynthesis of melanin in Curvularia lunata and caused the accumulation of the melanin metabolites flaviolin and 2-hydroxyjuglone. This showed that melanin in Curvularia lunata is produced by a pentaketide pathway from 1,8-dihydroxynaphthalene. The 1,3,8-trihydroxynaphthalene reductase (3HNR) gene, associated with the melanin pathway of Curvularia lunata, was identified and characterized. An alignment of 3HNR sequences enabled the design of primers covering conserved regions. A PCR-amplified fragment of Curvularia lunata genomic DNA was used for screening the cDNA library. Three independent cDNA clones revealed an 801-bp open reading frame encoding a 267 amino acid protein. The protein was expressed in Escherichia coli and purified to homogeneity. The predicted amino acid sequence of the 28.6-kDa protein demonstrated homology to other fungal 3HNR and other members of the short-chain dehydrogenase super family. Northern analyses revealed that 3HNR from Curvularia lunata is expressed synchronously with melanization after 3 days of Curvularia lunata growth in malt extract medium. No 3HNR reductase gene expression nor melanization was observed when Curvularia lunata was grown in yeast nitrogen base medium.

  20. A protein that interacts with members of the nuclear hormone receptor family: identification and cDNA cloning.

    PubMed Central

    Zeiner, M; Gehring, U

    1995-01-01

    In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784

  1. Overproduction and partial purification of the Norrie disease gene product, norrin, from a recombinant baculovirus.

    PubMed

    Shastry, Barkur S; Trese, Michael T

    2003-12-05

    Abnormal vascularization of the peripheral retina and retinal detachment are common clinical characteristics of Norrie disease (ND), familial exudative vitreoretinopathy, Coats' disease, and retinopathy of prematurity. Although little is known about the molecular basis of these diseases, studies have shown that all of these diseases are associated with mutations in the ND gene. In spite of this, little is known about norrin, its molecular mechanism of action, and its functional relationship with the development of abnormal retinal vasculature. To obtain a large quantity of norrin for structural and functional studies, we have overproduced it in insect cells. For this purpose, a cDNA fragment (869 bp) was isolated from a human retinal cDNA library by amplification and was cloned into an expression vector. The purified plasmid was co-transfected with wild-type linearized Bac-N-Blue DNA into S. frugiperda Sf21 insect cells. The recombinant virus plaques were purified and clones were selected based on the level of recombinant protein expressed in Sf21 cells infected with a purified recombinant virus. From these, a high-titer stock was generated and subsequently used to prepare a fused protein on a large scale. The protein was partially purified by the process of immobilized metal affinity chromatography and the use of ion exchange chromatography

  2. Characterization of the in vitro expressed autoimmune rippling muscle disease immunogenic domain of human titin encoded by TTN exons 248-249

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zelinka, L.; McCann, S.; Budde, J.

    2011-08-05

    Highlights: {yields} Affinity purification of the autoimmune rippling muscle disease immunogenic domain of titin. {yields} Partial sequence analysis confirms that the peptides is in the I band region of titin. {yields} This region of the human titin shows high degree of homology to mouse titin N2-A. -- Abstract: Autoimmune rippling muscle disease (ARMD) is an autoimmune neuromuscular disease associated with myasthenia gravis (MG). Past studies in our laboratory recognized a very high molecular weight skeletal muscle protein antigen identified by ARMD patient antisera as the titin isoform. These past studies used antisera from ARMD and MG patients as probes tomore » screen a human skeletal muscle cDNA library and several pBluescript clones revealed supporting expression of immunoreactive peptides. This study characterizes the products of subcloning the titin immunoreactive domain into pGEX-3X and the subsequent fusion protein. Sequence analysis of the fusion gene indicates the cloned titin domain (GenBank ID: (EU428784)) is in frame and is derived from a sequence of N2-A spanning the exons 248-250 an area that encodes the fibronectin III domain. PCR and EcoR1 restriction mapping studies have demonstrated that the inserted cDNA is of a size that is predicted by bioinformatics analysis of the subclone. Expression of the fusion protein result in the isolation of a polypeptide of 52 kDa consistent with the predicted inferred amino acid sequence. Immunoblot experiments of the fusion protein, using rippling muscle/myasthenia gravis antisera, demonstrate that only the titin domain is immunoreactive.« less

  3. Expression, Gene Cloning, and Characterization of Five Novel Phytases from Four Basidiomycete Fungi: Peniophora lycii, Agrocybe pediades, a Ceriporia sp., and Trametes pubescens

    PubMed Central

    Lassen, Søren F.; Breinholt, Jens; Østergaard, Peter R.; Brugger, Roland; Bischoff, Andrea; Wyss, Markus; Fuglsang, Claus C.

    2001-01-01

    Phytases catalyze the hydrolysis of phosphomonoester bonds of phytate (myo-inositol hexakisphosphate), thereby creating lower forms of myo-inositol phosphates and inorganic phosphate. In this study, cDNA expression libraries were constructed from four basidiomycete fungi (Peniophora lycii, Agrocybe pediades, a Ceriporia sp., and Trametes pubescens) and screened for phytase activity in yeast. One full-length phytase-encoding cDNA was isolated from each library, except for the Ceriporia sp. library where two different phytase-encoding cDNAs were found. All five phytases were expressed in Aspergillus oryzae, purified, and characterized. The phytases revealed temperature optima between 40 and 60°C and pH optima at 5.0 to 6.0, except for the P. lycii phytase, which has a pH optimum at 4.0 to 5.0. They exhibited specific activities in the range of 400 to 1,200 U · mg, of protein−1 and were capable of hydrolyzing phytate down to myo-inositol monophosphate. Surprisingly, 1H nuclear magnetic resonance analysis of the hydrolysis of phytate by all five basidiomycete phytases showed a preference for initial attack at the 6-phosphate group of phytic acid, a characteristic that was believed so far not to be seen with fungal phytases. Accordingly, the basidiomycete phytases described here should be grouped as 6-phytases (EC 3.1.3.26). PMID:11571175

  4. MytiBase: a knowledgebase of mussel (M. galloprovincialis) transcribed sequences

    PubMed Central

    Venier, Paola; De Pittà, Cristiano; Bernante, Filippo; Varotto, Laura; De Nardi, Barbara; Bovo, Giuseppe; Roch, Philippe; Novoa, Beatriz; Figueras, Antonio; Pallavicini, Alberto; Lanfranchi, Gerolamo

    2009-01-01

    Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST) sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel) challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01) was constructed as determined by the high rate of gene discovery (65.6%). Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database . Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels. PMID:19203376

  5. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

  6. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed Central

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-01-01

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes. Images PMID:1533935

  7. The midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum chagasi-infected sand flies.

    PubMed

    Jochim, Ryan C; Teixeira, Clarissa R; Laughinghouse, Andre; Mu, Jianbing; Oliveira, Fabiano; Gomes, Regis B; Elnaiem, Dia-Eldin; Valenzuela, Jesus G

    2008-01-14

    In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5), two peritrophin like proteins, a trypsin like protein (Lltryp1), two chymotrypsin like proteins (LuloChym1A and 2) and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3), a trypsin like protein (Lltryp2) and an astacin-like metalloprotease (LuloAstacin). Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5), a Chymotrypsin (LuloChym1A) and a carboxypeptidase (LuloCpepA1), among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1), a trypsin-like protein (Lltryp2) and an unknown protein. This transcriptome analysis represents the largest set of sequence data reported from a specific sand fly tissue and provides further information of the transcripts present in the sand fly Lutzomyia longipalpis. This analysis provides the detailed information of molecules present in the midgut of this sand fly and the transcripts potentially modulated by blood feeding and by the presence of the Leishmania parasite. More importantly, this analysis suggests that Leishmania infantum chagasi alters the expression profile of certain midgut transcripts in the sand fly during blood meal digestion and that this modulation may be relevant for the survival and establishment of the parasite in the gut of the fly. Moreover, this analysis suggests that these changes may be occurring during the digestion of the blood meal and not afterwards.

  8. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  9. Emerging techniques for the discovery and validation of therapeutic targets for skeletal diseases.

    PubMed

    Cho, Christine H; Nuttall, Mark E

    2002-12-01

    Advances in genomics and proteomics have revolutionised the drug discovery process and target validation. Identification of novel therapeutic targets for chronic skeletal diseases is an extremely challenging process based on the difficulty of obtaining high-quality human diseased versus normal tissue samples. The quality of tissue and genomic information obtained from the sample is critical to identifying disease-related genes. Using a genomics-based approach, novel genes or genes with similar homology to existing genes can be identified from cDNA libraries generated from normal versus diseased tissue. High-quality cDNA libraries are prepared from uncontaminated homogeneous cell populations harvested from tissue sections of interest. Localised gene expression analysis and confirmation are obtained through in situ hybridisation or immunohistochemical studies. Cells overexpressing the recombinant protein are subsequently designed for primary cell-based high-throughput assays that are capable of screening large compound banks for potential hits. Afterwards, secondary functional assays are used to test promising compounds. The same overexpressing cells are used in the secondary assay to test protein activity and functionality as well as screen for small-molecule agonists or antagonists. Once a hit is generated, a structure-activity relationship of the compound is optimised for better oral bioavailability and pharmacokinetics allowing the compound to progress into development. Parallel efforts from proteomics, as well as genetics/transgenics, bioinformatics and combinatorial chemistry, and improvements in high-throughput automation technologies, allow the drug discovery process to meet the demands of the medicinal market. This review discusses and illustrates how different approaches are incorporated into the discovery and validation of novel targets and, consequently, the development of potentially therapeutic agents in the areas of osteoporosis and osteoarthritis. While current treatments exist in the form of hormone replacement therapy, antiresorptive and anabolic agents for osteoporosis, there are no disease-modifying therapies for the treatment of the most common human joint disease, osteoarthritis. A massive market potential for improved options with better safety and efficacy still remains. Therefore, the application of genomics and proteomics for both diseases should provide much needed novel therapeutic approaches to treating these major world health problems.

  10. Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

    PubMed

    Yi, S Y; Hwang, B K

    1998-10-31

    Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

  11. Eimeria tenella enolase and pyruvate kinase: a likely role in glycolysis and in others functions.

    PubMed

    Labbé, Marie; Péroval, Marylène; Bourdieu, Christiane; Girard-Misguich, Fabienne; Péry, Pierre

    2006-12-01

    Two cDNA codings for glycolytic enzymes were cloned from a cDNA library constructed from the schizont stage of the avian parasite Eimeria tenella. Enolase and pyruvate kinase cDNA were fully sequenced and compared with sequences of enzymes from other organisms. Although these enzymes were already detected in the sporozoite stage, their expression was enhanced during the first schizogony in accordance with the anaerobic conditions of this part of the life cycle of the parasite. Under activating conditions, microscopic observations suggest that these glycolytic enzymes were relocalised inside sporozoites and moreover were in part secreted. The enzymes were also localised at the apex of the first generation of merozoites. Enolase was partly observed inside the nucleus of sporozoites and schizonts. Taken together, these results suggest that glycolytic enzymes not only have a function in glycolysis during anaerobic intracellular stages but may also participate in the invasion process and, for enolase, in the control of gene regulation.

  12. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    NASA Technical Reports Server (NTRS)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  13. Molecular analysis of ARF1 expression profiles during development of physic nut (Jatropha curcas L.).

    PubMed

    Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang

    2011-03-01

    A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.

  14. Transcriptome identification of putative genes involved in protein catabolism and innate immune response in human body louse (Pediculicidae: Pediculus humanus).

    PubMed

    Pedra, Joao H F; Brandt, Amanda; Li, Hong-Mei; Westerman, Rick; Romero-Severson, Jeanne; Pollack, Richard J; Murdock, Larry L; Pittendrigh, Barry R

    2003-11-01

    Genomics information relating to human body lice is surprisingly scarce, and this has constrained studies of their physiology, immunology and vector biology. To identify novel body louse genes, we used engorged adult lice to generate a cDNA library. Initially, 1152 clones were screened for inserts, edited for removal of vector sequences and base pairs of poor quality, and viewed for splicing variations, gene families and polymorphism. Computational methods identified 506 inferred open reading frames including the first predicted louse defensin. The inferred defensin aligns well with other insect defensins and has highly conserved cysteine residues, as are known for other defensin sequences. Two cysteine and five serine proteinases were categorized according to their inferred catalytic sites. We also discovered seven putative ubiquitin-pathway genes and four iron metabolizing deduced enzymes. Finally, glutathione-S-transferases and cytochrome P450 genes were among the detoxification enzymes found. Results from this first systematic effort to discover human body louse genes should promote further studies in Phthiraptera and lice.

  15. Identification of differentially expressed genes in human lung squamous cell carcinoma using suppression subtractive hybridization.

    PubMed

    Sun, Wenyue; Zhang, Kaitai; Zhang, Xinyu; Lei, Wendong; Xiao, Ting; Ma, Jinfang; Guo, Suping; Shao, Shujuan; Zhang, Husheng; Liu, Yan; Yuan, Jinsong; Hu, Zhi; Ma, Ying; Feng, Xiaoli; Hu, Songnian; Zhou, Jun; Cheng, Shujun; Gao, Yanning

    2004-08-20

    Lung cancer is one of the major causes of cancer-related deaths. Over the past decade, much has been known about the molecular changes associated with lung carcinogenesis; however, our understanding to lung tumorigenesis is still incomplete. To identify genes that are differentially expressed in squamous cell carcinoma (SCC) of the lung, we compared the expression profiles between primarily cultured SCC tumor cells and bronchial epithelial cells derived from morphologically normal bronchial epithelium of the same patient. Using suppression subtractive hybridization (SSH), two cDNA libraries containing up- and down-regulated genes in the tumor cells were constructed, named as LCTP and LCBP. The two libraries comprise 258 known genes and 133 unknown genes in total. The known up-regulated genes in the library LCTP represented a variety of functional groups; including metabolism-, cell adhesion and migration-, signal transduction-, and anti-apoptosis-related genes. Using semi-quantitative reverse transcription-polymerase chain reaction, seven genes chosen randomly from the LCTP were analyzed in the tumor tissue paired with its corresponding adjacent normal lung tissue derived from 16 cases of the SCC. Among them, the IQGAP1, RAP1GDS1, PAICS, MLF1, and MARK1 genes showed a consistent expression pattern with that of the SSH analysis. Identification and further characterization of these genes may allow a better understanding of lung carcinogenesis.

  16. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika

    2010-01-27

    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less

  17. Expression cloning of a gibberellin 20-oxidase, a multifunctional enzyme involved in gibberellin biosynthesis.

    PubMed Central

    Lange, T; Hedden, P; Graebe, J E

    1994-01-01

    In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921

  18. Transcriptional profiling reveals the expression of novel genes in response to various stimuli in the human dermatophyte Trichophyton rubrum

    PubMed Central

    2010-01-01

    Background Cutaneous mycoses are common human infections among healthy and immunocompromised hosts, and the anthropophilic fungus Trichophyton rubrum is the most prevalent microorganism isolated from such clinical cases worldwide. The aim of this study was to determine the transcriptional profile of T. rubrum exposed to various stimuli in order to obtain insights into the responses of this pathogen to different environmental challenges. Therefore, we generated an expressed sequence tag (EST) collection by constructing one cDNA library and nine suppression subtractive hybridization libraries. Results The 1388 unigenes identified in this study were functionally classified based on the Munich Information Center for Protein Sequences (MIPS) categories. The identified proteins were involved in transcriptional regulation, cellular defense and stress, protein degradation, signaling, transport, and secretion, among other functions. Analysis of these unigenes revealed 575 T. rubrum sequences that had not been previously deposited in public databases. Conclusion In this study, we identified novel T. rubrum genes that will be useful for ORF prediction in genome sequencing and facilitating functional genome analysis. Annotation of these expressed genes revealed metabolic adaptations of T. rubrum to carbon sources, ambient pH shifts, and various antifungal drugs used in medical practice. Furthermore, challenging T. rubrum with cytotoxic drugs and ambient pH shifts extended our understanding of the molecular events possibly involved in the infectious process and resistance to antifungal drugs. PMID:20144196

  19. Promoter-Based Theranostics for Prostate Cancer

    DTIC Science & Technology

    2016-06-01

    diagnosis vector consists of the tumor-specific PEG-promoter (PEG-Prom) and cDNA of human chorionic gonadotropin β chain (βhCG) as a reporter. We...transfection efficiency. We also used CpG-free cDNA of Figure 5. pCpGfree-PEGwt-HSV1-tk-neo vector expressed functional thymidine kinase in human

  20. Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

    PubMed Central

    Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

  1. Identification of UQCRB as an oxymatrine recognizing protein using a T7 phage display screen.

    PubMed

    Sun, Yan-Hui; Zhang, Xiao-Yuan; Xie, Wei-Qun; Liu, Guang-Jian; He, Xi-Xin; Huang, Ya-Li; Zhang, Guang-Xian; Wang, Jian; Kuang, Zao-Yuan; Zhang, Ren

    2016-12-04

    Sophora flavescens Aiton (Radix Sophorae Flavescentis, Kushen) is used in traditional Chinese medicine to treat chronic hepatitis B (CHB), and has the ability to clear heat and dampness from the body. Oxymatrine is one of the major bioactive compounds extracted from Sophora flavescens Aiton and constitutes more than 90% of the oxymatrine injection commonly used for CHB treatment in clinics in China. We aim to analyze the protein binding target of oxymatrine in treating CHB by screening a T7 phage display cDNA library of human CHB and examine the biochemistry of protein-ligand binding between oxymatrine and its ligands. A T7 phage cDNA library of human CHB was biopanned by affinity selection using oxymatrine as bait. The interaction of oxymatrine with its candidate binding protein was investigated by affinity assay, molecular docking, Isothermal Titration Calorimetry (ITC) and Surface Plasmon Resonance (SPR). A library of potential oxymatrine binding peptides was generated. Ubiquinol-cytochrome c reductase binding protein (UQCRB) was one of the candidate binding proteins of oxymatrine. UQCRB-displaying T7 phage binding numbers in the oxymatrine group were significantly higher than that in the control group, biotin group, and matrine group (p<0.05 or p<0.01). Three-dimensional structure modeling of the UQCRB with oxymatrine showed that their binding interfaces matched and oxymatrine inserted into a deeper pocket of UQCRB, which mainly involved amino acid residues Tyr21, Arg33, Tyr83, Glu84, Asp86, Pro88, and Glu91. The binding affinity constant (Kb) from SPR was 4.2mM. The Kb from ITC experiment was 3.9mM and stoichiometry was fixed as 1, which fit very well with the result of SPR. The binding of oxymatrine to UQCRB was driven by strong enthalpy forces such as hydrogen bonds and polar interactions as the heat released was about 157kcal/mol and ΔG was less than zero. In this study, using the T7 phage display system, we have identified UQCRB as a direct binding protein of oxymatrine. Furthermore, the specificity and molecular interaction of oxymatrine with UQCRB were also determined. The binding of UQCRB to oxymatrine suggests that UQCRB is a potential target of oxymatrine in treating CHB. These results provide new understanding into the mechanism of oxymatrine and insights into the strategy on the treatment of CHB. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. A universal next generation sequencing protocol to generate non-infectious barcoded cDNA libraries from high containment RNA viruses

    USDA-ARS?s Scientific Manuscript database

    Several biosafety level (BSL)-3/4 pathogens are high consequence, single-stranded RNA viruses and their genomes, when introduced into permissive cells, are infectious. Moreover many of these viruses are Select Agents (SAs), and their genomes are also considered SAs. For this reason cDNAs and/or th...

  3. Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

    USDA-ARS?s Scientific Manuscript database

    Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

  4. Construction and analysis of cDNA libraries from the antennae of Batocera horsfieldi and expression pattern of putative odorant binding proteins

    USDA-ARS?s Scientific Manuscript database

    In the natural environment, the longhorned beetle, Batocera horsfieldi (Hope) (Coleoptera: Cerambycidae), finds it’s maturation-feeding and host plants by using chemical cues. In this study, we described the identification and characterization of four new cDNAs that encode Minus-C odorant binding pr...

  5. Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

    USDA-ARS?s Scientific Manuscript database

    Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by multiple ESTs derived only from the oocyte c...

  6. A protein from the salivary glands of the pea aphid, Acyrthosiphon pisum, is essential in feeding on a host plant

    USDA-ARS?s Scientific Manuscript database

    In feeding, aphids inject saliva into plant tissues, gaining access to phloem sap and eliciting (and sometimes overcoming) plant responses. We are examining the involvement, in this aphid-plant interaction, of individual aphid proteins and enzymes, as identified in a salivary gland cDNA library. Her...

  7. Design and construction of a first-generation high-throughput integrated robotic molecular biology platform for bioenergy applications

    USDA-ARS?s Scientific Manuscript database

    The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-based clones to expres...

  8. Probe-Directed Degradation (PDD) for Flexible Removal of Unwanted cDNA Sequences from RNA-Seq Libraries.

    PubMed

    Archer, Stuart K; Shirokikh, Nikolay E; Preiss, Thomas

    2015-04-01

    Most applications for RNA-seq require the depletion of abundant transcripts to gain greater coverage of the underlying transcriptome. The sequences to be targeted for depletion depend on application and species and in many cases may not be supported by commercial depletion kits. This unit describes a method for generating RNA-seq libraries that incorporates probe-directed degradation (PDD), which can deplete any unwanted sequence set, with the low-bias split-adapter method of library generation (although many other library generation methods are in principle compatible). The overall strategy is suitable for applications requiring customized sequence depletion or where faithful representation of fragment ends and lack of sequence bias is paramount. We provide guidelines to rapidly design specific probes against the target sequence, and a detailed protocol for library generation using the split-adapter method including several strategies for streamlining the technique and reducing adapter dimer content. Copyright © 2015 John Wiley & Sons, Inc.

  9. Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

    NASA Astrophysics Data System (ADS)

    Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

    1990-10-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

  10. cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoefler, G.; Forstner, M.; Hulla, W.

    1994-01-01

    Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

  11. Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

    PubMed Central

    McWilliams, D; Callahan, R C; Boime, I

    1977-01-01

    A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

  12. Characterization of ROS1 cDNA from a human glioblastoma cell line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Birchmeier, C.; O'Neill, K.; Riggs, M.

    1990-06-01

    The authors have isolated and characterized a human ROS1 cDNA from the glioblastoma cell line SW-1088. The cDNA, 8.3 kilobases long, has the potential to encode a transmembrane tyrosine-specific protein kinase with a predicted molecular mass of 259 kDa. The putative extracellular domain of ROS1 is homologous to the extracellular domain of the sevenless gene product from Drosophila. No comparable similarities in the extracellular domains were found between ROS1 and other receptor-type tyrosine kinases. Together, ROS1 and sevenless gene products define a distinct subclass of transmember tyrosine kinases.

  13. From biomedicine to natural history research: EST resources for ambystomatid salamanders

    PubMed Central

    Putta, Srikrishna; Smith, Jeramiah J; Walker, John A; Rondet, Mathieu; Weisrock, David W; Monaghan, James; Samuels, Amy K; Kump, Kevin; King, David C; Maness, Nicholas J; Habermann, Bianca; Tanaka, Elly; Bryant, Susan V; Gardiner, David M; Parichy, David M; Voss, S Randal

    2004-01-01

    Background Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (Ambystoma mexicanum) and Eastern tiger salamander (A. tigrinum tigrinum), species with deep and diverse research histories. Results Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences for A. mexicanum were processed to yield 35,413 and 20,599 high quality ESTs for A. mexicanum and A. t. tigrinum, respectively. Because the A. t. tigrinum ESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human – Ambystoma synteny group with marker loci, and extended PCR primer sets designed for A. mexicanum / A. t. tigrinum orthologues to a related tiger salamander species. Conclusions Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research. PMID:15310388

  14. Identification of host cell proteins which interact with herpes simplex virus type 1 tegument protein pUL37.

    PubMed

    Kelly, Barbara J; Diefenbach, Eve; Fraefel, Cornel; Diefenbach, Russell J

    2012-01-20

    The herpes simplex virus type 1 (HSV-1) structural tegument protein pUL37, which is conserved across the Herpesviridae family, is known to be essential for secondary envelopment during the egress of viral particles. To shed light on additional roles of pUL37 during viral replication a yeast two-hybrid screen of a human brain cDNA library was undertaken. This screen identified ten host cell proteins as potential pUL37 interactors. One of the interactors, serine threonine kinase TAOK3, was subsequently confirmed to interact with pUL37 using an in vitro pulldown assay. Such host cell/pUL37 interactions provide further insights into the multifunctional role of this herpesviral tegument protein. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Identification and expression analysis of a novel R-type lectin from the coleopteran beetle, Tenebrio molitor.

    PubMed

    Kim, Dong Hyun; Patnaik, Bharat Bhusan; Seo, Gi Won; Kang, Seong Min; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo

    2013-11-01

    We have identified novel ricin-type (R-type) lectin by sequencing of random clones from cDNA library of the coleopteran beetle, Tenebrio molitor. The cDNA sequence is comprised of 495 bp encoding a protein of 164 amino acid residues and shows 49% identity with galectin of Tribolium castaneum. Bioinformatics analysis shows that the amino acid residues from 35 to 162 belong to ricin-type beta-trefoil structure. The transcript was significantly upregulated after early hours of injection with peptidoglycans derived from Gram (+) and Gram (-) bacteria, beta-1, 3 glucan from fungi and an intracellular pathogen, Listeria monocytogenes suggesting putative function in innate immunity. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Cloning and characterization of cDNAs encoding human gastrin-releasing peptide.

    PubMed Central

    Spindel, E R; Chin, W W; Price, J; Rees, L H; Besser, G M; Habener, J F

    1984-01-01

    We have prepared and cloned cDNAs derived from poly(A)+ RNA from a human pulmonary carcinoid tumor rich in immunoreactivity to gastrin-releasing peptide, a peptide closely related in structure to amphibian bombesin. Mixtures of synthetic oligodeoxyribonucleotides corresponding to amphibian bombesin were used as hybridization probes to screen a cDNA library prepared from the tumor RNA. Sequencing of the recombinant plasmids shows that human gastrin-releasing peptide (hGRP) mRNA encodes a precursor of 148 amino acids containing a typical signal sequence, hGRP consisting of 27 or 28 amino acids, and a carboxyl-terminal extension peptide. hGRP is flanked at its carboxyl terminus by two basic amino acids, following a glycine used for amidation of the carboxyl-terminal methionine. RNA blot analyses of tumor RNA show a major mRNA of 900 bases and a minor mRNA of 850 bases. Blot hybridization analyses using human genomic DNA are consistent with a single hGRP-encoding gene. The presence of two mRNAs encoding the hGRP precursor protein in the face of a single hGRP gene raises the possibility of alternative processing of the single RNA transcript. Images PMID:6207529

  17. Identification of tissue-specific, abiotic stress-responsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets

    PubMed Central

    2011-01-01

    Background Abiotic stresses, such as water deficit and soil salinity, result in changes in physiology, nutrient use, and vegetative growth in vines, and ultimately, yield and flavor in berries of wine grape, Vitis vinifera L. Large-scale expressed sequence tags (ESTs) were generated, curated, and analyzed to identify major genetic determinants responsible for stress-adaptive responses. Although roots serve as the first site of perception and/or injury for many types of abiotic stress, EST sequencing in root tissues of wine grape exposed to abiotic stresses has been extremely limited to date. To overcome this limitation, large-scale EST sequencing was conducted from root tissues exposed to multiple abiotic stresses. Results A total of 62,236 expressed sequence tags (ESTs) were generated from leaf, berry, and root tissues from vines subjected to abiotic stresses and compared with 32,286 ESTs sequenced from 20 public cDNA libraries. Curation to correct annotation errors, clustering and assembly of the berry and leaf ESTs with currently available V. vinifera full-length transcripts and ESTs yielded a total of 13,278 unique sequences, with 2302 singletons and 10,976 mapped to V. vinifera gene models. Of these, 739 transcripts were found to have significant differential expression in stressed leaves and berries including 250 genes not described previously as being abiotic stress responsive. In a second analysis of 16,452 ESTs from a normalized root cDNA library derived from roots exposed to multiple, short-term, abiotic stresses, 135 genes with root-enriched expression patterns were identified on the basis of their relative EST abundance in roots relative to other tissues. Conclusions The large-scale analysis of relative EST frequency counts among a diverse collection of 23 different cDNA libraries from leaf, berry, and root tissues of wine grape exposed to a variety of abiotic stress conditions revealed distinct, tissue-specific expression patterns, previously unrecognized stress-induced genes, and many novel genes with root-enriched mRNA expression for improving our understanding of root biology and manipulation of rootstock traits in wine grape. mRNA abundance estimates based on EST library-enriched expression patterns showed only modest correlations between microarray and quantitative, real-time reverse transcription-polymerase chain reaction (qRT-PCR) methods highlighting the need for deep-sequencing expression profiling methods. PMID:21592389

  18. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    PubMed

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss-cDNAs. This strategy is referred to as SLIC for single-strand ligation to ss-cDNA (8).

  19. Temporal and Spatial Expression of a Polygalacturonase during Leaf and Flower Abscission in Oilseed Rape and Arabidopsis1

    PubMed Central

    González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan

    2002-01-01

    During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157

  20. Retrospective MicroRNA Sequencing: Complementary DNA Library Preparation Protocol Using Formalin-fixed Paraffin-embedded RNA Specimens.

    PubMed

    Loudig, Olivier; Liu, Christina; Rohan, Thomas; Ben-Dov, Iddo Z

    2018-05-05

    -Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of cancer development. By using non-invasive or pre-malignant lesions from patients who later develop invasive disease, gene expression analyses may help identify early molecular alterations that predispose to cancer risk. It has been well described that nucleic acids recovered from FFPE tissues have undergone severe physical damage and chemical modifications, which make their analysis difficult and generally requires adapted assays. MicroRNAs (miRNAs), however, which represent a small class of RNA molecules spanning only up to ~18-24 nucleotides, have been shown to withstand long-term storage and have been successfully analyzed in FFPE samples. Here we present a 3' barcoded complementary DNA (cDNA) library preparation protocol specifically optimized for the analysis of small RNAs extracted from archived tissues, which was recently demonstrated to be robust and highly reproducible when using archived clinical specimens stored for up to 35 years. This library preparation is well adapted to the multiplex analysis of compromised/degraded material where RNA samples (up to 18) are ligated with individual 3' barcoded adapters and then pooled together for subsequent enzymatic and biochemical preparations prior to analysis. All purifications are performed by polyacrylamide gel electrophoresis (PAGE), which allows size-specific selections and enrichments of barcoded small RNA species. This cDNA library preparation is well adapted to minute RNA inputs, as a pilot polymerase chain reaction (PCR) allows determination of a specific amplification cycle to produce optimal amounts of material for next-generation sequencing (NGS). This approach was optimized for the use of degraded FFPE RNA from specimens archived for up to 35 years and provides highly reproducible NGS data.

  1. Development and experimental validation of a 20K Atlantic cod (Gadus morhua) oligonucleotide microarray based on a collection of over 150,000 ESTs.

    PubMed

    Booman, Marije; Borza, Tudor; Feng, Charles Y; Hori, Tiago S; Higgins, Brent; Culf, Adrian; Léger, Daniel; Chute, Ian C; Belkaid, Anissa; Rise, Marlies; Gamperl, A Kurt; Hubert, Sophie; Kimball, Jennifer; Ouellette, Rodney J; Johnson, Stewart C; Bowman, Sharen; Rise, Matthew L

    2011-08-01

    The collapse of Atlantic cod (Gadus morhua) wild populations strongly impacted the Atlantic cod fishery and led to the development of cod aquaculture. In order to improve aquaculture and broodstock quality, we need to gain knowledge of genes and pathways involved in Atlantic cod responses to pathogens and other stressors. The Atlantic Cod Genomics and Broodstock Development Project has generated over 150,000 expressed sequence tags from 42 cDNA libraries representing various tissues, developmental stages, and stimuli. We used this resource to develop an Atlantic cod oligonucleotide microarray containing 20,000 unique probes. Selection of sequences from the full range of cDNA libraries enables application of the microarray for a broad spectrum of Atlantic cod functional genomics studies. We included sequences that were highly abundant in suppression subtractive hybridization (SSH) libraries, which were enriched for transcripts responsive to pathogens or other stressors. These sequences represent genes that potentially play an important role in stress and/or immune responses, making the microarray particularly useful for studies of Atlantic cod gene expression responses to immune stimuli and other stressors. To demonstrate its value, we used the microarray to analyze the Atlantic cod spleen response to stimulation with formalin-killed, atypical Aeromonas salmonicida, resulting in a gene expression profile that indicates a strong innate immune response. These results were further validated by quantitative PCR analysis and comparison to results from previous analysis of an SSH library. This study shows that the Atlantic cod 20K oligonucleotide microarray is a valuable new tool for Atlantic cod functional genomics research.

  2. Gene Expression Differences in Infected and Noninfected Middle Ear Complementary DNA Libraries

    PubMed Central

    Kerschner, Joseph E.; Horsey, Edward; Ahmed, Azad; Erbe, Christy; Khampang, Pawjai; Cioffi, Joseph; Hu, Fen Ze; Post, James Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives To investigate genetic differences in middle ear mucosa (MEM) with nontypeable Haemophilus influenzae (NTHi) infection. Genetic upregulation and downregulation occurs in MEM during otitis media (OM) pathogenesis. A comprehensive assessment of these genetic differences using the techniques of complementary DNA (cDNA) library creation has not been performed. Design The cDNA libraries were constructed from NTHi-infected and noninfected chinchilla MEM. Random clones were picked, sequenced bidirectionally, and submitted to the National Center for Biotechnology Information (NCBI) Expressed Sequence Tags database, where they were assigned accession numbers. These numbers were used with the basic local alignment search tool (BLAST) to align clones against the nonredundant nucleotide database at NCBI. Results Analysis with the Web-based statistical program FatiGO identified several biological processes with significant differences in numbers of represented genes. Processes involved in immune, stress, and wound responses were more prevalent in the NTHi-infected library. S100 calcium-binding protein A9 (S100A9); secretory leukoprotease inhibitor (SLPI); β2-microglobulin (B2M); ferritin, heavy-chain polypeptide 1 (FTH1); and S100 calcium-binding protein A8 (S100A8) were expressed at significantly higher levels in the NTHi-infected library. Calcium-binding proteins S100A9 and S100A8 serve as markers for inflammation and have antibacterial effects. Secretory leukoprotease inhibitor is an antibacterial protein that inhibits stimuli-induced MUC1, MUC2, and MUC5AC production. Conclusions A number of genes demonstrate changes during the pathogenesis of OM, including SLPI, which has an impact on mucin gene expression; this expression is known to be an important regulator in OM. The techniques described herein provide a framework for future investigations to more thoroughly understand molecular changes in the middle ear, which will likely be important in developing new therapeutic and intervention strategies. PMID:19153305

  3. Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Claffey, K.P.; Herrera, V.L.; Brecher, P.

    1987-12-01

    A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

  4. Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

    PubMed Central

    Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

    1995-01-01

    Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

  5. Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

    PubMed Central

    Newsome, A L; McLean, J W; Lively, M O

    1992-01-01

    Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

  6. Amplification of chromosomal DNA in situ

    DOEpatents

    Christian, Allen T.; Coleman, Matthew A.; Tucker, James D.

    2002-01-01

    Amplification of chromosomal DNA in situ to increase the amount of DNA associated with a chromosome or chromosome region is described. The amplification of chromosomal DNA in situ provides for the synthesis of Fluorescence in situ Hybridization (FISH) painting probes from single dissected chromosome fragments, the production of cDNA libraries from low copy mRNAs and improved in Comparative Genomic Hybridization (CGH) procedures.

  7. Molecular cloning of toxins expressed by the venom gland of Lasiodora sp.

    PubMed

    Vieira, A L G; Moura, M B; Babá, E H; Chávez-Olórtegui, C; Kalapothakis, E; Castro, I M

    2004-12-15

    The present work describes the identification of toxins expressed by the venom gland of the spider Lasiodora sp. The toxins LTx1, LTx2 and LTx3 were identified by the screening of a cDNA library. These toxins showed significant similarity at the amino acid level with spider toxins from Lasiodora parahybana, Eurypelma californicum, Brachypelma smithii, Selenocosmia huwena.

  8. Selective interaction between Chloroplast B ATPase and TGB1 retards severe symptoms caused by Alternanthera mosaic virus infection

    USDA-ARS?s Scientific Manuscript database

    The multifunctional triple gene block protein 1 (TGB1) of the Potexvirus Alternanthera mosaic virus (AltMV) has been reported to have silencing suppressor, cell-to-cell movement, and helicase functions. Yeast two hybrid screening using an Arabidopsis thaliana cDNA library with TGB1 as bait, and co-p...

  9. Male- and female-biased gene expression of olfactory-related genes in the antennae of Asian corn borer, Ostrinia furnacalis (Guenée) (Lepidoptera: Crambidae)

    USDA-ARS?s Scientific Manuscript database

    The Asian corn borer (ACB), Ostrinia furnacalis (Guenée), is a destructive pest insect of cultivated corn crops, for which antennal-expressed receptors are important to detect olfactory cues for mate attraction and oviposition. Non-normalized male and female O. furnacalis antennal cDNA libraries we...

  10. Identification of a novel pathway involving a GATA transcription factor in yeast and possibly plant Zn uptake and homeostasis

    USDA-ARS?s Scientific Manuscript database

    To gain a better understanding of the regulation of Zn homeostasis in plants and the degree of conservation of Zn homeostasis between plants and yeast, a cDNA library from the Zn/Cd hyperaccumulating plant species, Nocceae caerulescens, was screened for its ability to restore growth under Zn limitin...

  11. The effect of boron deficiency on gene expression and boron compartmentalization in sugarbeet

    USDA-ARS?s Scientific Manuscript database

    NIP5, BOR1, NIP6, and WRKY6 genes were investigated for their role in boron deficiency in sugar beet, each with a proposed role in boron use in model plant species. All genes showed evidence of polymorphism in fragment size and gene expression in the target genomic DNA and cDNA libraries, with no co...

  12. Design and construction of a first-generation high-throughput integrated molecular biology platform for production of optimized synthetic genes and improved industrial strains

    USDA-ARS?s Scientific Manuscript database

    The molecular biological techniques for plasmid-based assembly and cloning of synthetic assembled gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-bas...

  13. The Regulation of Gene Expression in Cnidarian-Algal Associations.

    DTIC Science & Technology

    1998-07-13

    symbiotic cnidarians , Aiptasia pallida, Anthopleura eligantissima, synbiosis-specific proteins, cDNA libraries, O. SECURITY CLASSIFICATION OP REPORT...gene expression in cnidarian -algal associations Award Period: 1 July 1995-30 June 1998 Objectives: A. To identify and characterize heat shock...Exploring Symbiosis-Specific Gene Expression in Cnidarian /Algal Associations. In: Molecular Approaches to the Study of the Ocean.. Ed. K. Cooksey, Chapman

  14. A computational search for box C/D snoRNA genes in the Drosophila melanogaster genome.

    PubMed

    Accardo, M C; Giordano, E; Riccardo, S; Digilio, F A; Iazzetti, G; Calogero, R A; Furia, M

    2004-12-12

    In eukaryotes, the family of non-coding RNA genes includes a number of genes encoding small nucleolar RNAs (mainly C/D and H/ACA snoRNAs), which act as guides in the maturation or post-transcriptional modifications of target RNA molecules. Since in Drosophila melanogaster (Dm) only few examples of snoRNAs have been identified so far by cDNA libraries screening, integration of the molecular data with in silico identification of these types of genes could throw light on their organization in the Dm genome. We have performed a computational screening of the Dm genome for C/D snoRNA genes, followed by experimental validation of the putative candidates. Few of the 26 confirmed snoRNAs had been recognized by cDNA library analysis. Organization of the Dm genome was also found to be more variegated than previously suspected, with snoRNA genes nested in both the introns and exons of protein-coding genes. This finding suggests that the presence of additional mechanisms of snoRNA biogenesis based on the alternative production of overlapping mRNA/snoRNA molecules. Additional information is available at http://www.bioinformatica.unito.it/bioinformatics/snoRNAs.

  15. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    PubMed

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  16. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

    PubMed Central

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

    2015-01-01

    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  17. Light regulation of the abundance of mRNA encoding a nucleolin-like protein localized in the nucleoli of pea nuclei.

    PubMed Central

    Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J

    1997-01-01

    A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096

  18. Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni

    PubMed Central

    Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

    2008-01-01

    Background Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. Results We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1α and EF-2. Conclusion Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination. PMID:19114004

  19. Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni.

    PubMed

    Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

    2008-12-29

    Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1alpha and EF-2. Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination.

  20. HOXBES2: a novel epididymal HOXB2 homeoprotein and its domain-specific association with spermatozoa.

    PubMed

    Prabagaran, E; Bandivdekar, A H; Dighe, V; Raghavan, V P

    2007-02-01

    The sperm from the testis acquires complete fertilizing ability and forward progressive motility following its transit through the epididymis. Acquisition of these characteristics results from the modification of the sperm proteome following interactions with epididymal secretions. In our attempts to identify epididymis-specific sperm plasma membrane proteins, a partial 2.83-kb clone was identified by immunoscreening a monkey epididymal cDNA library with an agglutinating monoclonal antibody raised against washed human spermatozoa. The sequence of the 2.83-kb clone exhibited homology to the region between 1 and 1097 bp of the homeobox gene, Hoxb2. This sequence was found to be species conserved, as revealed by RT-PCR analysis. To obtain a full-length clone of the sequence, 5' RACE-PCR (rapid amplification of cDNA ends PCR) was carried out using rat epididymal RNA as the template. It resulted in a full-length 1.657-kb cDNA encoding a 32.9-kDa putative protein. The protein designated HOXBES2 exhibited homology to the conserved 61-amino acid homeodomain region of the HOXB2 homeoprotein. However, characteristic differences were noted in its amino and carboxyl termini compared with HOXB2. A putative 30-kDa protein was detected in the tissue extracts from adult rat epididymis and caudal spermatozoa, and a 37-kDa protein was detected in the rat embryo when probed with a polyclonal antibody against HOXB2 protein. Multiple tissue Western blot and immunohistochemical analysis further indicated its expression in the cytoplasm of the principal and basal epithelial cells, with maximal expression in the distal epididymal segments. Northern blot analysis detected a single approximately 2.5-kb transcript from the adult epididymis. Indirect immunofluorescence localized the protein to the acrosome, midpiece, and equatorial segments of rat caudal and ejaculated human and monkey spermatozoa, respectively. In conclusion, we have identified and characterized a novel epididymal homeoprotein different from HOXB2 protein and hereafter referred to as HOXBES2, (HOXB2 homeodomain containing epididymis-specific sperm protein) with a probable role in fertilization.

  1. The spindle kinesin-like protein HsEg5 is an autoantigen in systemic lupus erythematosus.

    PubMed

    Whitehead, C M; Winkfein, R J; Fritzler, M J; Rattner, J B

    1996-10-01

    Autoantibodies directed against the mitotic spindle apparatus (MSA) have been shown to target an antigen referred to as NuMA (nuclear mitotic apparatus). In this study, we identified a second MSA antigen as the spindle kinesin-like protein HsEg5. We studied the frequency of antibodies to HsEg5 in human sera that demonstrate the MSA pattern of staining, the frequency of autoantibodies to HsEg5 in patients with systemic lupus erythematosus (SLE), and the clinical features of patients with antibodies to HsEg5. A prototype serum from an SLE patient was used to isolate a 4.8-kilobase complementary DNA (cDNA) from a HeLa cDNA library. Western blot, immunoprecipitation, and sequence analysis revealed that the antigen was an approximately 130-kd protein, HsEg5. The frequency of autoantibodies to recombinant HsEg5 in 51 sera that demonstrated an MSA pattern of staining on HEp-2 and HeLa cells was detected by immunoblotting 2 constructs of the cDNA. The clinical features of patients with antibodies directed against HsEg5 was obtained by retrospective chart review. The antigen responsible for the MSA-35 pattern was identified as the human kinesin-like protein HsEg5. Seven of 51 sera (14%) that demonstrated an MSA pattern of staining reacted with recombinant HsEg5. Six of 7 of the HsEg5-positive patients (86%) had SLE, and 1 had Sjögren's syndrome. The indirect immunofluorescent staining pattern of sera that reacted with HsEg5 could be distinguished from the other sera that reacted with NuMA. In an unselected cohort of 52 SLE patients, 3 (6%) had autoantibodies reactive with the recombinant HsEg5. Autoantibodies to MSA fall into 2 major classes: those reactive with NuMA and those reactive with HsEg5. Autoantibodies to HsEg5 are found in a lower frequency than NuMA in sera that demonstrate the MSA pattern of staining and appear to be specifically associated with SLE. HsEg5 can be distinguished from NuMA by indirect immunofluorescence and Western blotting.

  2. Production of insulin-like growth factor binding proteins by small-cell lung cancer cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaques, G.; Kiefer, P.; Rotsch, M.

    1989-10-01

    Conditioned serum-free media (CM) from small-cell lung cancer (SCLC) cell lines were examined for the presence of insulin-like growth-factor-binding proteins (IGF-BP). 6/9 SCLC cell lines secreted binding proteins with high affinity for IGFs. When ({sup 125}I)IGF-1 or ({sup 125}I)IGF-II was incubated with the CMs, complexes of tracer with proteins could be demonstrated by gel filtration, by precipitation with polyethylenglycol, and after adsorption of unbound tracer with activated charcoal. Analysis of binding data according to the method of Scatchard resulted in linear plots for IGF-I and IGF-II. Cross-linking of ({sup 125}I)IGF-I or ({sup 125}I)IGF-II to the CMs followed by sodium dodecylmore » sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under nonreducing conditions revealed the presence of IGF-BPs with molecular masses in the range of 24-32 kDa. Northern blot hybridization with an IGF-BP cDNA probe encoding a low-molecular-weight IGF-BP from a human placenta cDNA library and Western blot analysis with a corresponding polyclonal antibody showed no expression of this gene. These data demonstrate that SCLC cell lines release IGF-BPs in culture supernatants, which differ from IGF-BPs detected in liver and placenta. These IGF-BPs might be important mediators in the autocrine/paracrine growth regulation of IGFs in SCLC.« less

  3. GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN CDNA MICROARRAY ANALYSES

    EPA Science Inventory

    GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN cDNA MICROARRAY ANALYSES

    B.S. Pukazhenthi1, J. C. Rockett2, M. Ouyang3, D.J. Dix2, J.G. Howard1, P. Georgopoulos4, W.J. J. Welsh3 and D. E. Wildt1

    1Department of Reproductiv...

  4. Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

    PubMed

    Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

    1993-03-31

    Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

  5. Subtractive cloning of cDNA from Aspergillus oryzae differentially regulated between solid-state culture and liquid (submerged) culture.

    PubMed

    Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu

    2002-07-01

    In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.

  6. An open reading frame in intron seven of the sea urchin DNA-methyltransferase gene codes for a functional AP1 endonuclease.

    PubMed

    Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita

    2002-08-01

    Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.

  7. Molecular cloning of a small prostate protein, known as beta-microsemenoprotein, PSP94 or beta-inhibin, and demonstration of transcripts in non-genital tissues.

    PubMed

    Ulvsbäck, M; Lindström, C; Weiber, H; Abrahamsson, P A; Lilja, H; Lundwall, A

    1989-11-15

    In order to study the gene expression of the seminal plasma protein beta-microseminoprotein, also known as PSP94 and beta-inhibin, clones encoding this protein were isolated from a cDNA library constructed in lambda gt11. Nucleotide sequencing confirmed the structure of a previously cloned cDNA. By northern blot analysis identical sized transcripts were demonstrated in the prostate, the respiratory (tracheal, bronchial and lung) tissues and the antrum part of the gastric mucosa. Thus, the protein is not primarily associated with male reproductive function. Although probably of no physiological significance, a slight structural similarity to the ovarian inhibin beta-chains was identified in the C-terminal half of the molecule.

  8. An insight into the sialome of the blood-sucking bug Triatoma infestans, a vector of Chagas' disease

    PubMed Central

    Assumpção, Teresa C. F.; Francischetti, Ivo M. B.; Andersen, John F.; Schwarz, Alexandra; Santana, Jaime M.; Ribeiro, José M. C.

    2008-01-01

    Triatoma infestans is a hemiptera, vector of Chagas’ disease, that feeds exclusively on vertebrate blood in all life stages. Hematophagous insects’ salivary glands (SG) produce potent pharmacological compounds that counteract host hemostasis, including anti-clotting, anti-platelet, and vasodilatory molecules. To obtain a further insight into the salivary biochemical and pharmacological complexity of this insect, a cDNA library from its salivary glands was randomly sequenced. Also, salivary proteins were submitted to two dimentional gel (2D-gel) electrophoresis followed by MS analysis. We present the analysis of a set of 1,534 (SG) cDNA sequences, 645 of which coded for proteins of a putative secretory nature. Most salivary proteins described as lipocalins matched peptide sequences obtained from proteomic results. PMID:18207082

  9. Phage Display Breast Carcinoma cDNA Libraries: Isolation of Clones Which Specifically Bind to Membrane Glycoproteins, Mucins, and Endothelial Cell Surface

    DTIC Science & Technology

    1999-07-01

    nutrients and waste and UV 2237 fibrosarcoma sublines (17). Expression of elimination, cell surfaces are also important for the galectin-1, another member of...10B capsid protein. Therefore, this GAG CGG AAA ATG GCA GAC AAT TTT TCG CTC CAT ... vector was chosen to assess the feasibility of phage met Ala Asp

  10. Two small secreted proteins from Puccinia triticina induce reduction of ß-glucoronidase transient expression in wheat isolines containing Lr9, Lr24, and Lr26

    USDA-ARS?s Scientific Manuscript database

    Little is known about the molecular interaction of wheat and leaf rust (Puccinia triticina Eriks). However, genomic tools are now becoming available so that the host-pathogen interaction can be understood. In this work, a cDNA library was made from haustoria isolated from P. triticina race PBJL inf...

  11. Peptidomics combined with cDNA library unravel the diversity of centipede venom.

    PubMed

    Rong, Mingqiang; Yang, Shilong; Wen, Bo; Mo, Guoxiang; Kang, Di; Liu, Jie; Lin, Zhilong; Jiang, Wenbin; Li, Bowen; Du, Chaoqin; Yang, Shuanjuan; Jiang, Hui; Feng, Qiang; Xu, Xun; Wang, Jun; Lai, Ren

    2015-01-30

    Centipedes are one of the oldest venomous arthropods using toxin as their weapon to capture prey. But little attention was focused on them and only few centipede toxins were demonstrated with activity on ion channels. Therefore, more deep works are needed to understand the diversity of centipede venom. In the present study, we use peptidomics combined with cDNA library to uncover the diversity of centipede Scolopendra subspinipes mutilans L. Koch. 192 peptides were identified by LC-MS/MS and 79 precursors were deduced by cDNA library. Surprisingly, the signal peptides of centipede toxins were more complicated than any other animal toxins and even exhibited large differences in homologues. Meanwhile, a large number of variants generated by alternative cleavage sites were detected by mass spectra. Odd number of cystein (3, 5, 7) found in the mature peptides were seldom seen in peptide toxins. In additional, two novel cysteine frameworks (C-C-C-CCC, C-C-C-C-CC-CC) were identified from 16 different cysteine frameworks from centipede peptides. Only 29 precursors have clear targets, while others may provide a potential diversity function for centipede. These findings highlight the extensive diversity of centipede toxins and provide powerful tools to understand the capture and defense weapon of centipede. Peptide toxins from venomous animal have attracted increasing attentions due to their extraordinary chemical and pharmacological diversity. Centipedes are one of the most used Chinese traditional medicines, but little was known about the active components. The venom of Scolopendra subspinipes mutilans L. Koch is first deeply analyzed in this work and most of peptides were never discovered before. Interestingly, the number and arrangement of cysteine showed a larger different to known peptide toxins such spider or scorpion toxins. Moreover, only 29 peptides from this centipede venom were identified with known function. It suggested that our work not only important to understand the composition of centipede venom, but also provide many valuable peptides for potential biological functions. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Culbert, A.A.; Wallis, G.A.; Kadler, K.E.

    The brittleness of bone in people with lethal (type II) osteogenesis imperfecta, a heritable disorder caused by mutations in the type I collagen genes, arises from the deposition of abnormal collagen in the bone matrix. The inability of the abnormal collagen to participate in mineralization may be caused by its failure to interact with other bone proteins. Here, we have designed a strategy to isolate the genes important for mineralization of collagen during bone formation. Cells isolated from 16-day embryonic chick calvaria and seeded post-confluence in culture deposited a mineralized matrix over a period of 2 weeks. Chick skin fibroblastsmore » seeded and cultured under the same conditions did not mineralize. Using RT-PCR, we prepared short cDNAs ({approximately}300 bp) corresponding to the 3{prime} ends of mRNA from fibroblasts and separately from the mineralizing calvarial cells. Subtractive cDNA hybridization generated a pool of cDNAs that were specific to mineralizing calvarial cells but not to fibroblasts. Screening of 100,000 plaques of a chick bone ZAP Express cDNA library with this pool of mineralizing-specific cDNAs identified ten clones which comprised full-length cDNAs for the bone proteins osteopontin (eight of the ten positives), bone sialoprotein II (one of the ten positives), and cystatin (one of the ten positives). cDNAs for type I collagen, fibronectin, alkaline phosphatase, house-keeping genes, and other genes expressed in fibroblasts were not identified in this preliminary screen. The pool of short cDNAs is likely to comprise cDNAs for further bone-specific genes and will be used to screen the entire bone cDNA library of 4.2 million clones. 30 refs., 4 figs.« less

  13. Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

    PubMed

    Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

    2015-10-26

    Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

  14. An ordered EST catalogue and gene expression profiles of cassava (Manihot esculenta) at key growth stages.

    PubMed

    Li, You-Zhi; Pan, Ying-Hua; Sun, Chang-Bin; Dong, Hai-Tao; Luo, Xing-Lu; Wang, Zhi-Qiang; Tang, Ji-Liang; Chen, Baoshan

    2010-12-01

    A cDNA library was constructed from the root tissues of cassava variety Huanan 124 at the root bulking stage. A total of 9,600 cDNA clones from the library were sequenced with single-pass from the 5'-terminus to establish a catalogue of expressed sequence tags (ESTs). Assembly of the resulting EST sequences resulted in 2,878 putative unigenes. Blastn analysis showed that 62.6% of the unigenes matched with known cassava ESTs and the rest had no 'hits' against the cassava database in the integrative PlantGDB database. Blastx analysis showed that 1,715 (59.59%) of the unigenes matched with one or more GenBank protein entries and 1,163 (40.41%) had no 'hits'. A cDNA microarray with 2,878 unigenes was developed and used to analyze gene expression profiling of Huanan 124 at key growth stages including seedling, formation of root system, root bulking, and starch maturity. Array data analysis revealed that (1) the higher ratio of up-regulated ribosome-related genes was accompanied by a high ratio of up-regulated ubiquitin, proteasome-related and protease genes in cassava roots; (2) starch formation and degradation simultaneously occur at the early stages of root development but starch degradation is declined partially due to decrease in UDP-glucose dehydrogenase activity with root maturity; (3) starch may also be synthesized in situ in roots; (4) starch synthesis, translocation, and accumulation are also associated probably with signaling pathways that parallel Wnt, LAM, TCS and ErbB signaling pathways in animals; (5) constitutive expression of stress-responsive genes may be due to the adaptation of cassava to harsh environments during long-term evolution.

  15. Bovine mammary gene expression profiling during the onset of lactation.

    PubMed

    Gao, Yuanyuan; Lin, Xueyan; Shi, Kerong; Yan, Zhengui; Wang, Zhonghua

    2013-01-01

    Lactogenesis includes two stages. Stage I begins a few weeks before parturition. Stage II is initiated around the time of parturition and extends for several days afterwards. To better understand the molecular events underlying these changes, genome-wide gene expression profiling was conducted using digital gene expression (DGE) on bovine mammary tissue at three time points (on approximately day 35 before parturition (-35 d), day 7 before parturition (-7 d) and day 3 after parturition (+3 d)). Approximately 6.2 million (M), 5.8 million (M) and 6.1 million (M) 21-nt cDNA tags were sequenced in the three cDNA libraries (-35 d, -7 d and +3 d), respectively. After aligning to the reference sequences, the three cDNA libraries included 8,662, 8,363 and 8,359 genes, respectively. With a fold change cutoff criteria of ≥ 2 or ≤-2 and a false discovery rate (FDR) of ≤ 0.001, a total of 812 genes were significantly differentially expressed at -7 d compared with -35 d (stage I). Gene ontology analysis showed that those significantly differentially expressed genes were mainly associated with cell cycle, lipid metabolism, immune response and biological adhesion. A total of 1,189 genes were significantly differentially expressed at +3 d compared with -7 d (stage II), and these genes were mainly associated with the immune response and cell cycle. Moreover, there were 1,672 genes significantly differentially expressed at +3 d compared with -35 d. Gene ontology analysis showed that the main differentially expressed genes were those associated with metabolic processes. The results suggest that the mammary gland begins to lactate not only by a gain of function but also by a broad suppression of function to effectively push most of the cell's resources towards lactation.

  16. Submesoscale characteristics and transcription of a fatty acid elongase gene from a freshwater green microalgae, Myrmecia incisa Reisigl

    NASA Astrophysics Data System (ADS)

    Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang

    2011-01-01

    Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.

  17. Identification of TPIT and other novel autoantigens in lymphocytic hypophysitis; immunoscreening of a pituitary cDNA library and development of immunoprecipitation assays

    PubMed Central

    Smith, Casey Jo Anne; Bensing, Sophie; Burns, Christine; Robinson, Phillip J; Kasperlik-Zaluska, Anna A; Scott, Rodney J; Kämpe, Olle; Crock, Patricia A

    2012-01-01

    Background Lymphocytic hypophysitis is an organ-specific autoimmune disease of the pituitary gland. A specific and sensitive serological test currently does not exist to aid in the diagnosis. Objective To identify target autoantigens in lymphocytic hypophysitis and develop a diagnostic assay for these proteins. Design/methods A pituitary cDNA expression library was immunoscreened using sera from four patients with lymphocytic hypophysitis. Relevant cDNA clones from screening, along with previously identified autoantigens pituitary gland-specific factor 1a and 2 (PGSF1a and PGSF2) and neuron-specific enolase (NSE) were tested in an in vitro transcription and translation immunoprecipitation assay. The corticotroph-specific transcription factor, TPIT, was investigated separately as a candidate autoantigen. Results Significantly positive autoantibody reactivity against TPIT was found in 9/86 hypophysitis patients vs 1/90 controls (P=0.018). The reactivity against TPIT was not specific for lymphocytic hypophysitis with autoantibodies detectable in the sera from patients with other autoimmune endocrine diseases. Autoantibodies were also detected against chromodomain-helicase-DNA binding protein 8, presynaptic cytomatrix protein (piccolo), Ca2+-dependent secretion activator, PGSF2 and NSE in serum samples from patients with lymphocytic hypophysitis, but at a frequency that did not differ from healthy controls. Importantly, 8/86 patients with lymphocytic hypophysitis had autoantibodies against any two autoantigens in comparison with 0/90 controls (P=0.0093). Conclusions TPIT, a corticotroph-specific transcription factor, was identified as a target autoantigen in 10.5% of patients with lymphocytic hypophysitis. Further autoantigens related to vesicle processing were also identified as potential autoantigens with different immunoreactivity patterns in patients and controls. PMID:22193973

  18. Signatures from Tissue-specific MPSS Libraries Identify Transcripts Preferentially Expressed in the Mouse Inner Ear

    PubMed Central

    Peters, Linda M.; Belyantseva, Inna A.; Lagziel, Ayala; Battey, James F.; Friedman, Thomas B.; Morell, Robert J.

    2007-01-01

    Specialization in cell function and morphology is influenced by the differential expression of mRNAs, many of which are expressed at low abundance and restricted to certain cell types. Detecting such transcripts in cDNA libraries may require sequencing millions of clones. Massively parallel signature sequencing (MPSS) is well-suited for identifying transcripts that are expressed in discrete cell types and in low abundance. We have made MPSS libraries from microdissections of three inner ear tissues. By comparing these MPSS libraries to those of 87 other tissues included in the Mouse Reference Transcriptome (MRT) online resource, we have identified genes that are highly enriched in, or specific to, the inner ear. We show by RT-PCR and in situ hybridization that signatures unique to the inner ear libraries identify transcripts with highly specific cell-type localizations. These transcripts serve to illustrate the utility of a resource that is available to the research community. Utilization of these resources will increase the number of known transcription units and expand our knowledge of the tissue-specific regulation of the transcriptome. PMID:17049805

  19. FragIdent--automatic identification and characterisation of cDNA-fragments.

    PubMed

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  20. Sequence, molecular properties, and chromosomal mapping of mouse lumican

    NASA Technical Reports Server (NTRS)

    Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

    1995-01-01

    PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Top