Identification and characterization of a novel serine-threonine kinase gene from the Xp22 region.

PubMed

Montini, E; Andolfi, G; Caruso, A; Buchner, G; Walpole, S M; Mariani, M; Consalez, G; Trump, D; Ballabio, A; Franco, B

1998-08-01

Eukaryotic protein kinases are part of a large and expanding family of proteins. Through our transcriptional mapping effort in the Xp22 region, we have isolated and sequenced the full-length transcript of STK9, a novel cDNA highly homologous to serine-threonine kinases. A number of human genetic disorders have been mapped to the region where STK9 has been localized including Nance-Horan (NH) syndrome, oral-facial-digital syndrome type 1 (OFD1), and a novel locus for nonsyndromic sensorineural deafness (DFN6). To evaluate the possible involvement of STK9 in any of the above-mentioned disorders, a 2416-bp full-length cDNA was assembled. The entire genomic structure of the gene, which is composed of 20 coding exons, was determined. Northern analysis revealed a transcript larger than 9.5 kb in several tissues including brain, lung, and kidney. The mouse homologue (Stk9) was identified and mapped in the mouse in the region syntenic to human Xp. This location is compatible with the location of the Xcat mutant, which shows congenital cataracts very similar to those observed in NH patients. Sequence homologies, expression pattern, and mapping information in both human and mouse make STK9 a candidate gene for the above-mentioned disorders. Copyright 1998 Academic Press.

kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system.

PubMed Central

Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B

1995-01-01

Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359

Anti-liver-kidney microsome antibody type 1 recognizes human cytochrome P450 db1.

PubMed

Gueguen, M; Yamamoto, A M; Bernard, O; Alvarez, F

1989-03-15

Anti-liver-kidney microsome antibody type 1 (LKM1), present in the sera of a group of children with autoimmune hepatitis, was recently shown to recognize a 50 kDa protein identified as rat liver cytochromes P450 db1 and db2. High homology between these two members of the rat P450 IID subfamily and human P450 db1 suggested that anti-LKM1 antibody is directed against this human protein. To test this hypothesis, a human liver cDNA expression library in phage lambda GT-11 was screened using rat P450 db1 cDNA as a probe. Two human cDNA clones were found to be identical to human P450 db1 by restriction mapping. Immunoblot analysis using as antigen, the purified fusion protein from one of the human cDNA clones showed that only anti-LKM1 with anti-50 kDa reactivity recognized the fusion protein. This fusion protein was further used to develop an ELISA test that was shown to be specific for sera of children with this disease. These results: 1) identify the human liver antigen recognized by anti-LKM1 auto-antibodies as cytochrome P450 db1, 2) allow to speculate that mutation on the human P450 db1 gene could alter its expression in the hepatocyte and make it auto-antigenic, 3) provide a simple and specific diagnostic test for this disease.

Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

PubMed

Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

1987-01-26

Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

The active gene that encodes human High Mobility Group 1 protein (HMG1) contains introns and maps to chromosome 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ferrari, S.; Finelli, P.; Rocchi, M.

The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mousemore » Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.« less

Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

DTIC Science & Technology

2000-04-01

Genes, LOH Mapping, Chromosome 17, Physical Mapping, Genetic Mapping, CDNA Screening, Humans, Anatomical 81 Samples, Mutation Detection, Breast Cancer...According to the established model for LOH involving tumor suppressor genes, the allele remaining in the tumor sample would harbor the deleterious mutation ...sequencing on an AB1373A sequencer (Applied Biosystems, Foster City, CA). As none of the samples we have sequenced have revealed any mutations , we have

[Cloning of human CD45 gene and its expression in Hela cells].

PubMed

Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

2015-11-01

To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

Characterization and phylogenetic epitope mapping of CD38 ADPR cyclase in the cynomolgus macaque

PubMed Central

Ferrero, Enza; Orciani, Monia; Vacca, Paola; Ortolan, Erika; Crovella, Sergio; Titti, Fausto; Saccucci, Franca; Malavasi, Fabio

2004-01-01

Background The CD38 transmembrane glycoprotein is an ADP-ribosyl cyclase that moonlights as a receptor in cells of the immune system. Both functions are independently implicated in numerous areas related to human health. This study originated from an inherent interest in studying CD38 in the cynomolgus monkey (Macaca fascicularis), a species closely related to humans that also represents a cogent animal model for the biomedical analysis of CD38. Results A cDNA was isolated from cynomolgus macaque peripheral blood leukocytes and is predicted to encode a type II membrane protein of 301 amino acids with 92% identity to human CD38. Both RT-PCR-mediated cDNA cloning and genomic DNA PCR surveying were possible with heterologous human CD38 primers, demonstrating the striking conservation of CD38 in these primates. Transfection of the cDNA coincided with: (i) surface expression of cynomolgus macaque CD38 by immunofluorescence; (ii) detection of ~42 and 84 kDa proteins by Western blot and (iii) the appearance of ecto-enzymatic activity. Monoclonal antibodies were raised against the cynomolgus CD38 ectodomain and were either species-specific or cross-reactive with human CD38, in which case they were directed against a common disulfide-requiring conformational epitope that was mapped to the C-terminal disulfide loop. Conclusion This multi-faceted characterization of CD38 from cynomolgus macaque demonstrates its high genetic and biochemical similarities with human CD38 while the immunological comparison adds new insights into the dominant epitopes of the primate CD38 ectodomain. These results open new prospects for the biomedical and pharmacological investigations of this receptor-enzyme. PMID:15383153

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-06-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies.

Characterization and mapping of the human rhodopsin kinase gene and screening of the gene for mutations in patients with retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khani, S.C.; Lin, D.; Magovcevic, I.

1994-09-01

Rhodopsin kinase (RK) is a cytosolic enzyme in rod photoreceptors that initiates the deactivation of the phototransductions cascade by phosphorylating photoactivated rhodopsin. Although the cDNA sequence of bovine RK has been determined previously, no human cDNA or genomic sequence has thus far been available for genetic studies. In order to investigate the possible role of this candidate gene in retinitis pigmentosa (RP) and allied diseases, we have isolated and characterized human cDNA and genomic clones derived from the RK locus. The coding sequence of the human gene is 1692 nucleotides in length and is split into seven exons. The humanmore » and the bovine sequence show 84% identity at the nucleotide level and 92% identity at the amino acid level. Thus far, the intronic sequences flanking each exon except for one have been determined. We have also mapped the human RK gene to chromosome 13q34 using fluorescence in situ hybridization. To our knowledge, no RP gene has as yet been linked to this region. However, since the substrate for RK (rhodopsin) and other members of the phototransduction cascade have been implicated in the pathogenesis of RP, it is conceivable that defects in RK can also cause some forms of this disease. We are evaluating this possibility by screening DNA from 173 patients with autosomal recessive RP and 190 patients with autosomal dominant RP. So far, we have found 11 patients with variant bands. In one patient with autosomal dominant RP we discovered the missense change Ser536Leu. Cosegregation studies and further sequencing of the variant bands are currently underway.« less

Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

1994-07-15

The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

Isolation and characterization of a cDNA clone specific for avian vitellogenin II.

PubMed Central

Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L

1982-01-01

A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed Central

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-01-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies. Images PMID:2987946

Comprehensive red blood cell and platelet antigen prediction from whole genome sequencing: proof of principle

PubMed Central

Westhoff, Connie M.; Uy, Jon Michael; Aguad, Maria; Smeland‐Wagman, Robin; Kaufman, Richard M.; Rehm, Heidi L.; Green, Robert C.; Silberstein, Leslie E.

2015-01-01

BACKGROUND There are 346 serologically defined red blood cell (RBC) antigens and 33 serologically defined platelet (PLT) antigens, most of which have known genetic changes in 45 RBC or six PLT genes that correlate with antigen expression. Polymorphic sites associated with antigen expression in the primary literature and reference databases are annotated according to nucleotide positions in cDNA. This makes antigen prediction from next‐generation sequencing data challenging, since it uses genomic coordinates. STUDY DESIGN AND METHODS The conventional cDNA reference sequences for all known RBC and PLT genes that correlate with antigen expression were aligned to the human reference genome. The alignments allowed conversion of conventional cDNA nucleotide positions to the corresponding genomic coordinates. RBC and PLT antigen prediction was then performed using the human reference genome and whole genome sequencing (WGS) data with serologic confirmation. RESULTS Some major differences and alignment issues were found when attempting to convert the conventional cDNA to human reference genome sequences for the following genes: ABO, A4GALT, RHD, RHCE, FUT3, ACKR1 (previously DARC), ACHE, FUT2, CR1, GCNT2, and RHAG. However, it was possible to create usable alignments, which facilitated the prediction of all RBC and PLT antigens with a known molecular basis from WGS data. Traditional serologic typing for 18 RBC antigens were in agreement with the WGS‐based antigen predictions, providing proof of principle for this approach. CONCLUSION Detailed mapping of conventional cDNA annotated RBC and PLT alleles can enable accurate prediction of RBC and PLT antigens from whole genomic sequencing data. PMID:26634332

The gene for human U2 snRNP auxiliary factor small 35-kDa subunit (U2AF1) maps to the progressive myoclonus epilepsy (EPM1) critical region on chromosome 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.

1996-04-15

We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of differentmore » factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.« less

Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

PubMed Central

Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

1998-01-01

The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.

PubMed

Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S

2003-06-01

The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.

Purification and cDNA cloning of SAPKK3, the major activator of RK/p38 in stress- and cytokine-stimulated monocytes and epithelial cells.

PubMed Central

Cuenda, A; Alonso, G; Morrice, N; Jones, M; Meier, R; Cohen, P; Nebreda, A R

1996-01-01

Two chromatographically distinct stress-activated protein kinase kinases (SAPKKs) have been identified in several mammalian cells, termed SAPKK2 and SAPKK3, which activate the MAP kinase family member RK/p38 but not JNK/SAPK in vitro. Here we demonstrate that SAPKK2 is identical or very closely related to the MAP kinase kinase family member MKK3. However, under our assay conditions, SAPKK3 was the major activator of RK/p38 detected in extracts prepared from stress- or interleukin-1-stimulated epithelial (KB) cells, from bacterial lipopolysaccharide and tumour necrosis factor alpha-stimulated THP1 monocytes or from rabbit skeletal muscle. The activated form of SAPKK3 was purified from muscle to near homogeneity, and tryptic peptide sequences were used to clone human and murine cDNAs encoding this enzyme. Human SAPKK3 comprised 334 amino acids and was 78% identical to MKK3. The murine and human SAPKK3 were 97% identical in their amino acid sequences. We also cloned a different murine cDNA that appears to encode a SAPKK3 protein truncated at the N-terminus. SAPKK3 is identical to the recently cloned MKK6. Images PMID:8861944

Cloning and characterization of mouse extracellular-signal-regulated protein kinase 3 as a unique gene product of 100 kDa.

PubMed

Turgeon, B; Saba-El-Leil, M K; Meloche, S

2000-02-15

MAP (mitogen-activated protein) kinases are a family of serine/threonine kinases that have a pivotal role in signal transduction. Here we report the cloning and characterization of a mouse homologue of extracellular-signal-regulated protein kinase (ERK)3. The mouse Erk3 cDNA encodes a predicted protein of 720 residues, which displays 94% identity with human ERK3. Transcription and translation of this cDNA in vitro generates a 100 kDa protein similar to the human gene product ERK3. Immunoblot analysis with an antibody raised against a unique sequence of ERK3 also recognizes a 100 kDa protein in mouse tissues. A single transcript of Erk3 was detected in every adult mouse tissue examined, with the highest expression being found in the brain. Interestingly, expression of Erk3 mRNA is acutely regulated during mouse development, with a peak of expression observed at embryonic day 11. The mouse Erk3 gene was mapped to a single locus on central mouse chromosome 9, adjacent to the dilute mutation locus and in a region syntenic to human chromosome 15q21. Finally, we provide several lines of evidence to support the existence of a unique Erk3 gene product of 100 kDa in mammalian cells.

Molecular Targeting of Prostate Cancer During Androgen Ablation: Inhibition of CHES1/FOXN3

DTIC Science & Technology

2013-05-01

the DNA sequences (~25^6 reads/sample) were mapped to the human genome reference sequence (hg19...tumor the AR has a genomic abnormality, placing the novel sequence 3’ of the transcriptional start site. However, it is unclear if a genomic alteration...exon/intron organization of the CHES1 gene was determined by BLAST analysis of the human genome using the 1,473-bp CHES1 cDNA sequence

Porcine MAP3K5 analysis: molecular cloning, characterization, tissue expression pattern, and copy number variations associated with residual feed intake.

PubMed

Pu, L; Zhang, L C; Zhang, J S; Song, X; Wang, L G; Liang, J; Zhang, Y B; Liu, X; Yan, H; Zhang, T; Yue, J W; Li, N; Wu, Q Q; Wang, L X

2016-08-12

Mitogen-activated protein kinase kinase kinase 5 (MAP3K5) is essential for apoptosis, proliferation, differentiation, and immune responses, and is a candidate marker for residual feed intake (RFI) in pig. We cloned the full-length cDNA sequence of porcine MAP3K5 by rapid-amplification of cDNA ends. The 5451-bp gene contains a 5'-untranslated region (UTR) (718 bp), a coding region (3738 bp), and a 3'-UTR (995 bp), and encodes a peptide of 1245 amino acids, which shares 97, 99, 97, 93, 91, and 84% sequence identity with cattle, sheep, human, mouse, chicken, and zebrafish MAP3K5, respectively. The deduced MAP3K5 protein sequence contains two conserved domains: a DUF4071 domain and a protein kinase domain. Phylogenetic analysis showed that porcine MAP3K5 forms a separate branch to vicugna and camel MAP3K5. Tissue expression analysis using real-time quantitative polymerase chain reaction (qRT-PCR) revealed that MAP3K5 was expressed in the heart, liver, spleen, lung, kidney, muscle, fat, pancrea, ileum, and stomach tissues. Copy number variation was detected for porcine MAP3K5 and validated by qRT-PCR. Furthermore, a significant increase in average copy number was detected in the low RFI group when compared to the high RFI group in a Duroc pig population. These results provide useful information regarding the influence of MAP3K5 on RFI in pigs.

Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.

PubMed Central

Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E

1987-01-01

We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

Human Genome Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1993-01-01

The DOE Human Genome program has grown tremendously, as shown by the marked increase in the number of genome-funded projects since the last workshop held in 1991. The abstracts in this book describe the genome research of DOE-funded grantees and contractors and invited guests, and all projects are represented at the workshop by posters. The 3-day meeting includes plenary sessions on ethical, legal, and social issues pertaining to the availability of genetic data; sequencing techniques, informatics support; and chromosome and cDNA mapping and sequencing.

Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

PubMed

Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

1989-05-01

Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

Description and physical localization of the bovine survival of motor neuron gene (SMN).

PubMed

Pietrowski, D; Goldammer, T; Meinert, S; Schwerin, M; Förster, M

1998-01-01

Proximal spinal muscular atrophy (SMA) is an autosomal recessive disease in humans and other mammals, characterized by degeneration of anterior horn cells of the spinal cord. In humans, the survival of motor neuron gene (SMN) has been recognized as the SMA-determining gene and has been mapped to 5q13. In cattle, SMA is a recurrent, inherited disease that plays an important economic role in breeding programs of Brown Swiss stock. Now we have identified the full- length cDNA sequence of the bovine SMN gene. Molecular analysis and characterization of the sequence documents 85% identity to its human counterpart and three evolutionarily conserved domains in different species. Physical mapping data reveals that bovine SMN is localized to chromosome region 20q12-->q13, supporting the conserved synteny of this chromosomal region between humans and cattle.

Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones

PubMed Central

Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio

2004-01-01

The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In addition, among 72,027 uniquely mapped SNPs and insertions/deletions localized within human genes, 13,215 nonsynonymous SNPs, 315 nonsense SNPs, and 452 indels occurred in coding regions. Together with 25 polymorphic microsatellite repeats present in coding regions, they may alter protein structure, causing phenotypic effects or resulting in disease. The H-InvDB platform represents a substantial contribution to resources needed for the exploration of human biology and pathology. PMID:15103394

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

A Linkage Map of the Asian Tiger Mosquito (Aedes albopictus) Based on cDNA Markers

PubMed Central

Sutherland, Ian W.; Mori, Akio; Montgomery, John; Fleming, Karen L.; Anderson, Jennifer M.; Valenzuela, Jesus G.; Severson, David W.

2011-01-01

The Asian tiger mosquito, Aedes (Stegomyia) albopictus (Skuse), is an important vector of a number of arboviruses, and populations exhibit extreme variation in adaptive traits such as egg diapause, cold hardiness, and autogeny (ability to mature a batch of eggs without blood feeding). The genetic basis of some of these traits has been established, but lack of a high-resolution linkage map has prevented in-depth genetic analyses of the genes underlying these complex traits. We report here on the breeding of 4 F1 intercross mapping families and the use of these to locate 35 cDNA markers to the A. albopictus linkage map. The present study increases the number of markers on the A. albopictus cDNA linkage map from 38 to 73 and the density of markers from 1 marker/5.7 cM to 1 marker/2.9 cM and adds 9, 16, and 10 markers to the 3 linkage groups, respectively. The overall lengths of the 3 linkage groups are 64.5, 76.5, and 71.6 cM, respectively, for a combined length of 212.6 cM. Despite conservation in the order of most genes among the 4 families and a previous mapping family, we found substantial heterogeneity in the amount of recombination among markers. This was most marked in linkage group I, which varied between 16.7 and 69.3 cM. A map integrating the results from these 4 families with an earlier cDNA linkage map is presented. PMID:21148282

Sequence, molecular properties, and chromosomal mapping of mouse lumican

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1995-01-01

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants.

PubMed

Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

2002-06-15

The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.

Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

PubMed Central

Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

1998-01-01

Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

PubMed

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

PubMed Central

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Structural characterization and chromosomal location of the mouse macrophage migration inhibitory factor gene and pseudogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bozza, M.; Gerard, C.; Kolakowski, L.F. Jr.

1995-06-10

Macrophage migration inhibitory factor, MIF, is a cytokine released by T-lymphocytes, macrophages, and the pituitary gland that serves to integrate peripheral and central inflammatory responses. Ubiquitous expression and developmental regulation suggest that MIF may have additional roles outside of the immune system. Here we report the structure and chromosomal location of the mouse Mif gene and the partial characterization of five Mif pseudogenes. The mouse Mif gene spans less than 0.7 kb of chromosomal DNA and is composed of three exons. A comparison between the mouse and the human genes shows a similar gene structure and common regulatory elements inmore » both promoter regions. The mouse Mif gene maps to the middle region of chromosome 10, between Bcr and S100b, which have been mapped to human chromosomes 22q11 and 21q22.3, respectively. The entire sequence of two pseudogenes demonstrates the absence of introns, the presence of the 5{prime} untranslated region of the cDNA, a 3{prime} poly(A) tail, and the lack of sequence similarity with untranscribed regions of the gene. The five pseudogenes are highly homologous to the cDNA, but contain a variable number of mutations that would produce mutated or truncated MIF-like proteins. Phylogenetic analyses of MIF genes and pseudogenes indicate several independent genetic events that can account for multiple genomic integrations. Three of the Mif pseudogenes were also mapped by interspecific backcross to chromosomes 1, 9, and 17. These results suggest that Mif pseudogenes originated by retrotransposition. 46 refs., 5 figs., 1 tab.« less

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

PubMed

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

A cosmid and cDNA fine physical map of a human chromosome 13q14 region frequently lost in B-cell chronic lymphocytic leukemia and identification of a new putative tumor suppressor gene, Leu5.

PubMed

Kapanadze, B; Kashuba, V; Baranova, A; Rasool, O; van Everdink, W; Liu, Y; Syomov, A; Corcoran, M; Poltaraus, A; Brodyansky, V; Syomova, N; Kazakov, A; Ibbotson, R; van den Berg, A; Gizatullin, R; Fedorova, L; Sulimova, G; Zelenin, A; Deaven, L; Lehrach, H; Grander, D; Buys, C; Oscier, D; Zabarovsky, E R; Einhorn, S; Yankovsky, N

1998-04-17

B-cell chronic lymphocytic leukemia (B-CLL) is a human hematological neoplastic disease often associated with the loss of a chromosome 13 region between RB1 gene and locus D13S25. A new tumor suppressor gene (TSG) may be located in the region. A cosmid contig has been constructed between the loci D13S1168 (WI9598) and D13S25 (H2-42), which corresponds to the minimal region shared by B-CLL associated deletions. The contig includes more than 200 LANL and ICRF cosmid clones covering 620 kb. Three cDNAs likely corresponding to three different genes have been found in the minimally deleted region, sequenced and mapped against the contigged cosmids. cDNA clone 10k4 as well as a chimeric clone 13g3, codes for a zinc-finger domain of the RING type and shares homology to some known genes involved in tumorigenesis (RET finger protein, BRCA1) and embryogenesis (MID1). We have termed the gene corresponding to 10k4/13g3 clones LEU5. This is the first gene with homology to known TSGs which has been found in the region of B-CLL rearrangements.

The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi

1993-01-01

Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less

Molecular cloning and expression of a chloride channel-associated protein pICln in human young red blood cells: association with actin.

PubMed

Schwartz, R S; Rybicki, A C; Nagel, R L

1997-10-15

We report the cloning and sequencing from human reticulocytes of cDNA coding for the Cl- channel-associated protein, pICln. Human reticulocyte pICln (HRpICln) cDNA encodes a protein (predicted molecular mass 26293Da) identical with human non-pigmented ciliary epithelial cell pICln. By using full-length HRpICln cDNA (approx. 1.2 kb) to probe human lymphocyte metaphase-chromosome spreads, the location of the human ICln gene was mapped to 11q13 by fluorescence in situ hybridization analysis. Polyclonal antibodies to recombinant HRpICln detected bands at approx. 43 kDa and approx. 37 kDa in both normal (AA) and sickle (SS) red blood cell (RBC) ghost membranes. In SS ghosts, and in ghosts from a patient with autoimmune haemolytic anaemia with 9.8% reticulocytes, the amount of HRpICln was increased compared with AA ghosts, suggesting that the expression or membrane assembly of HRpICln is cell age-dependent. Laser scanning confocal fluorescent microscopy immunolocalized HRpICln largely to the RBC membrane. The increased staining intensity of HRpICln in a reticulocyte-enriched AA RBC density-separated fraction is consistent with a dependence of HRpICln membrane content on cell age. HRpICln and beta-actin form stable complexes in vivo, demonstrated with the yeast two-hybrid system. Low-ionic-strength extraction of ghost membranes, which results in the extraction of the spectrin-actin cytoskeleton, also results in the extraction of HRpICln, consistent with the possibility for the association of these proteins in RBCs in vivo. The results presented here establish the presence of the Cl- channel-associated protein, pICln, in human RBCs, and raises the possibility that this protein has a role in RBC Cl- transport and volume regulation in young RBCs. Moreover the association of RBC pICln with actin offers a model in which to test interactions between RBC ion channels and the cytoskeleton.

Construction of a Transcription Map for Papillomaviruses using RACE, RNAse Protection and Primer Extension Assays

PubMed Central

Wang, Xiaohong; Zheng, Zhi-Ming

2016-01-01

Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map from each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in the genome structure, organization and gene expression among papillomaviruses. The focused methods are 5’- and 3’- rapid amplification of cDNA ends (RACE), which are the techniques commonly used in molecular biology to obtain the full length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281

Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Stetten, G.; Kearns, W.

1994-09-01

X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

Locations of the ets subfamily members net, elk1, and sap1 (ELK3, ELK1, and ELK4) on three homologous regions of the mouse and human genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giovane, A.; Sobieszczuk, P.; Mignon, C.

1995-10-10

Net, Elk1, and Sap1 are related members of the Ets oncoprotein family. We show by in situ hybridization on banded chromosomes with specific cDNA probes that their map positions on mouse and human chromosomes (respectively) are net, 10C-D1 and 12q22-q23 (now called ELK3), sap1, 1E3-G and 1q32 (ELK4), and elk1, XA1-A3 and Xp11.2-p11.1 (ELK1), as well as a second locus 14q32 (ELK2) unique to the human genome. The results for the mouse net, sap1, and elk1 and human ELK3 genes are new. The human elk1 mapping confirms a previous study. The human ELK4 localization agrees with data published during themore » preparation of the manuscript. Human ELK3 colocalizes with sap2, and we confirm that they are identical. These results firmly establish for the first time that Net, Elk1, and Sap1 are distinct gene products with different chromosomal localizations in both the mouse and the human genomes. Net, Elk1, and Sap1 are conserved and map to homologous regions of the mouse and human chromosomes. 19 refs., 1 fig., 1 tab.« less

Human mitochondrial pyrophosphatase: cDNA cloning and analysis of the gene in patients with mtDNA depletion syndromes.

PubMed

Curbo, Sophie; Lagier-Tourenne, Clotilde; Carrozzo, Rosalba; Palenzuela, Lluis; Lucioli, Simona; Hirano, Michio; Santorelli, Filippo; Arenas, Joaquin; Karlsson, Anna; Johansson, Magnus

2006-03-01

Pyrophosphatases (PPases) catalyze the hydrolysis of inorganic pyrophosphate generated in several cellular enzymatic reactions. A novel human pyrophosphatase cDNA encoding a 334-amino-acid protein approximately 60% identical to the previously identified human cytosolic PPase was cloned and characterized. The novel enzyme, named PPase-2, was enzymatically active and catalyzed hydrolysis of pyrophosphate at a rate similar to that of the previously identified PPase-1. A functional mitochondrial import signal sequence was identified in the N-terminus of PPase-2, which targeted the enzyme to the mitochondrial matrix. The human pyrophosphatase 2 gene (PPase-2) was mapped to chromosome 4q25 and the 1.4-kb mRNA was ubiquitously expressed in human tissues, with highest levels in muscle, liver, and kidney. The yeast homologue of the mitochondrial PPase-2 is required for mitochondrial DNA maintenance and yeast cells lacking the enzyme exhibit mitochondrial DNA depletion. We sequenced the PPA2 gene in 13 patients with mitochondrial DNA depletion syndromes (MDS) of unknown cause to determine if mutations in the PPA2 gene of these patients were associated with this disease. No pathogenic mutations were identified in the PPA2 gene of these patients and we found no evidence that PPA2 gene mutations are a common cause of MDS in humans.

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays

PubMed Central

2011-01-01

Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more fluorescent molecules per RNA fragment. PMID:21235785

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, W.; Emanuel, B.S.; Siegert, J.

1994-09-01

DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

Isolation of a Novel Human Gene, MARKL1, Homologous to MARK3 and Its Involvement in Hepatocellular Carcinogenesis1

PubMed Central

Kato, Tatsushi; Satoh, Seiji; Okabe, Hiroshi; Kitahara, Osamu; Ono, Kenji; Kihara, Chikashi; Tanaka, Toshihiro; Tsunoda, Tatsuhiko; Yamaoka, Yoshio; Nakamura, Yusuke; Furukawa, Yoichi

2001-01-01

Abstract Activation of the Wnt-signaling pathway is known to play a crucial role in carcinogenesis of various human organs including the colon, liver, prostate, and endometrium. To investigate the mechanisms underlying hepatocellular carcinogenesis, we attempted to identify genes regulated by β-catenin/Tcf complex in a human hepatoma cell line, HepG2, in which an activated form of β-catenin is expressed. By means of cDNA microarray, we isolated a novel human gene, termed MARKL1 (MAP/microtubule affinity-regulating kinase-like 1), whose expression was downregulated in response to decreased Tcf/LEF1 activity. The transcript expressed in liver consisted of 3529 nucleotides that contained an open reading frame of 2256 nucleotides, encoding 752 amino acids homologous to human MARK3 (MAP/microtubule affinity-regulating kinase 3). Expression levels of MARKL1 were markedly elevated in eight of nine HCCs in which nuclear accumulation of β-catenin was observed, which may suggest that MARKL1 plays some role in hepatocellular carcinogenesis. PMID:11326310

Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

PubMed

Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

1996-02-01

There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

Comparison of the canine and human acid {beta}-galactosidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

PubMed Central

Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

1989-01-01

We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).

PubMed

Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y

1996-02-01

Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.

Evidence for different origin of sex chromosomes in snakes, birds, and mammals and step-wise differentiation of snake sex chromosomes

PubMed Central

Matsubara, Kazumi; Tarui, Hiroshi; Toriba, Michihisa; Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Agata, Kiyokazu; Matsuda, Yoichi

2006-01-01

All snake species exhibit genetic sex determination with the ZZ/ZW type of sex chromosomes. To investigate the origin and evolution of snake sex chromosomes, we constructed, by FISH, a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 109 cDNA clones. Eleven of the 109 clones were localized to the Z chromosome. All human and chicken homologues of the snake Z-linked genes were located on autosomes, suggesting that the sex chromosomes of snakes, mammals, and birds were all derived from different autosomal pairs of the common ancestor. We mapped the 11 Z-linked genes of E. quadrivirgata to chromosomes of two other species, the Burmese python (Python molurus bivittatus) and the habu (Trimeresurus flavoviridis), to investigate the process of W chromosome differentiation. All and 3 of the 11 clones were localized to both the Z and W chromosomes in P. molurus and E. quadrivirgata, respectively, whereas no cDNA clones were mapped to the W chromosome in T. flavoviridis. Comparative mapping revealed that the sex chromosomes are only slightly differentiated in P. molurus, whereas they are fully differentiated in T. flavoviridis, and E. quadrivirgata is at a transitional stage of sex-chromosome differentiation. The differentiation of sex chromosomes was probably initiated from the distal region on the short arm of the protosex chromosome of the common ancestor, and then deletion and heterochromatization progressed on the sex-specific chromosome from the phylogenetically primitive boids to the more advanced viperids. PMID:17110446

Cloning of human cDNAs for Apg-1 and Apg-2, members of the Hsp110 family, and chromosomal assignment of their genes.

PubMed

Nonoguchi, K; Itoh, K; Xue, J H; Tokuchi, H; Nishiyama, H; Kaneko, Y; Tatsumi, K; Okuno, H; Tomiwa, K; Fujita, J

1999-09-03

In mice, the Hsp110/SSE family is composed of the heat shock protein (Hsp)110/105, Apg-1 and Apg-2. In humans, however, only the Hsp110/105 homolog has been identified as a member, and two cDNAs, Hsp70RY and HS24/p52, potentially encoding proteins structurally similar to, but smaller than, mouse Apg-2 have been reported. To clarify the membership of Hsp110 family in humans, we isolated Apg-1 and Apg-2 cDNAs from a human testis cDNA library. The human Apg-1 was 100% and 91.8% identical in length and amino acid (aa) sequence, respectively, to mouse Apg-1. Human Apg-2 was one aa shorter than and 95.5% identical in sequence to mouse Apg-2. In ECV304, human endothelial cells Apg-1 but not Apg-2 transcripts were induced in 2 h by a temperature shift from 32 degrees C to 39 degrees C. As found in mice, the response was stronger than that to a 37-42 degrees C shift. The human Apg-1 and Apg-2 genes were mapped to the chromosomal loci 4q28 and 5q23.3-q31.1, respectively, by fluorescence in-situ hybridization. We isolated cDNA and genomic clones encompassing the region critical for the difference between Apg-2 and HS24/p52. Although the primer sets used were derived from the sequences common to both cDNAs, all cDNA and genomic clones corresponded to Apg-2. Using a similar approach, the relationship between Apg-2 and Hsp70RY was assessed, and no clone corresponding to Hsp70RY was obtained. These results demonstrated that the Hsp110 family consists of at least three members, Apg-1, Apg-2 and Hsp110 in humans as well as in mice. The significance of HS24/p52 and Hsp70RY cDNAs previously reported remains to be determined.

Protein interactome analysis of 12 mitogen-activated protein kinase kinase kinase in rice using a yeast two-hybrid system.

PubMed

Singh, Raksha; Lee, Jae-Eun; Dangol, Sarmina; Choi, Jihyun; Yoo, Ran Hee; Moon, Jae Sun; Shim, Jae-Kyung; Rakwal, Randeep; Agrawal, Ganesh Kumar; Jwa, Nam-Soo

2014-01-01

The mitogen-activated protein kinase (MAPK) cascade is composed at least of MAP3K (for MAPK kinase kinase), MAP2K, and MAPK family modules. These components together play a central role in mediating extracellular signals to the cell and vice versa by interacting with their partner proteins. However, the MAP3K-interacting proteins remain poorly investigated in plants. Here, we utilized a yeast two-hybrid system and bimolecular fluorescence complementation in the model crop rice (Oryza sativa) to map MAP3K-interacting proteins. We identified 12 novel nonredundant interacting protein pairs (IPPs) representing 11 nonredundant interactors using 12 rice MAP3Ks (available as full-length cDNA in the rice KOME (http://cdna01.dna.affrc.go.jp/cDNA/) at the time of experimental design and execution) as bait and a rice seedling cDNA library as prey. Of the 12 MAP3Ks, only six had interacting protein partners. The established MAP3K interactome consisted of two kinases, three proteases, two forkhead-associated domain-containing proteins, two expressed proteins, one E3 ligase, one regulatory protein, and one retrotransposon protein. Notably, no MAP3K showed physical interaction with either MAP2K or MAPK. Seven IPPs (58.3%) were confirmed in vivo by bimolecular fluorescence complementation. Subcellular localization of 14 interactors, together involved in nine IPPs (75%) further provide prerequisite for biological significance of the IPPs. Furthermore, GO of identified interactors predicted their involvement in diverse physiological responses, which were supported by a literature survey. These findings increase our knowledge of the MAP3K-interacting proteins, help in proposing a model of MAPK modules, provide a valuable resource for developing a complete map of the rice MAPK interactome, and allow discussion for translating the interactome knowledge to rice crop improvement against environmental factors. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Suppression of HIV-1 Infection by APOBEC3 Proteins in Primary Human CD4+ T Cells Is Associated with Inhibition of Processive Reverse Transcription as Well as Excessive Cytidine Deamination

PubMed Central

Gillick, Kieran; Pollpeter, Darja; Phalora, Prabhjeet; Kim, Eun-Young; Wolinsky, Steven M.

2013-01-01

The Vif protein of human immunodeficiency virus type 1 (HIV-1) promotes viral replication by downregulation of the cell-encoded, antiviral APOBEC3 proteins. These proteins exert their suppressive effects through the inhibition of viral reverse transcription as well as the induction of cytidine deamination within nascent viral cDNA. Importantly, these two effects have not been characterized in detail in human CD4+ T cells, leading to controversies over their possible contributions to viral inhibition in the natural cell targets of HIV-1 replication. Here we use wild-type and Vif-deficient viruses derived from the CD4+ T cells of multiple donors to examine the consequences of APOBEC3 protein function at natural levels of expression. We demonstrate that APOBEC3 proteins impart a profound deficiency to reverse transcription from the initial stages of cDNA synthesis, as well as excessive cytidine deamination (hypermutation) of the DNAs that are synthesized. Experiments using viruses from transfected cells and a novel method for mapping the 3′ termini of cDNAs indicate that the inhibition of reverse transcription is not limited to a few specific sites, arguing that APOBEC3 proteins impede enzymatic processivity. Detailed analyses of mutation spectra in viral cDNA strongly imply that one particular APOBEC3 protein, APOBEC3G, provides the bulk of the antiviral phenotype in CD4+ T cells, with the effects of APOBEC3F and APOBEC3D being less significant. Taken together, we conclude that the dual mechanisms of action of APOBEC3 proteins combine to deliver more effective restriction of HIV-1 than either function would by itself. PMID:23152537

The Pekin duck programmed death-ligand 1: cDNA cloning, genomic structure, molecular characterization and mRNA expression analysis.

PubMed

Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S

2015-04-01

Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.

cDNA cloning of the human monocarboxylate transporter 1 and chromosomal localization of the SLC16A1 locus to 1p13.2-p12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, C.K.; Li, X.; Luna, J.

1994-09-15

Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

PubMed

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

Physical and genetic mapping of the dipeptidase gene DPEP1 to 16q24. 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Austruy, E.; Jeanpierre, C.; Junien, C.

1993-03-01

The authors report the subregional physical and genetic mapping on chromosome 16q of a cDNA clone selected as a potential tumor/growth suppressor sequence. By DNA sequencing and RNA expression pattern, this clone was identified as part of the renal dipeptidase gene (DPEP1). Using somatic cell hybrids carrying either different human chromosomes or chromosome 16 segments, they confirm and refine the physical mapping of DPEP1 to the chromosome 16 subregion q24.3. Two RFLPs, a biallelic polymorphism detected by TaqI and a VNTR detected by BamHI, EcoRI, and BglII, are described. Using the VNTR polymorphism, DPEP1 was shown to be linked tomore » D16S7 with a maximum lod score of 5.8 at a recombination fraction of 0.03. 14 refs., 2 figs., 2 tabs.« less

Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

PubMed

Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

2002-09-01

A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.

PubMed

Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu

2004-02-18

By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.

Cloning, genomic organization, and chromosomal localization of human citrate transport protein to the DiGeorge/velocardiofacial syndrome minimal critical region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldmuntz, E.; Budarf, M.L.; Wang, Zhili

1996-04-15

DiGeorge syndrome (DGS) and velocardiofacial syndrome have been shown to be associated with microdeletions of chromosomal region 22q11. More recently, patients with conotruncal anomaly face syndrome and some nonsyndromic patients with isolated forms of conotruncal cardiac defects have been found to have 22q11 microdeletions as well. The commonly deleted region, called the DiGeorge chromosomal region (DGCR), spans approximately 1.2 mb and is estimated to contain at least 30 genes. We report a computational approach for gene identification that makes use of large-scale sequencing of cosmids from a contig spanning the DGCR. Using this methodology, we have mapped the human homologmore » of a rodent citrate transport protein to the DGCR. We have isolated a partial cDNA containing the complete open reading frame and have determined the genomic structure by comparing the genomic sequence from the cosmid to the sequence of the cDNA clone. Whether the citrate transport protein can be implicated in the biological etiology of DGS or other 22q11 microdeletion syndromes remains to be defined. 36 refs., 3 figs., 1 tab.« less

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

[Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

PubMed

Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

2005-03-01

To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

USDA-ARS?s Scientific Manuscript database

Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective o...

Identification, characterization and leucocyte expression of Siglec-10, a novel human sialic acid-binding receptor.

PubMed Central

Munday, J; Kerr, S; Ni, J; Cornish, A L; Zhang, J Q; Nicoll, G; Floyd, H; Mattei, M G; Moore, P; Liu, D; Crocker, P R

2001-01-01

Here we characterize Siglec-10 as a new member of the Siglec family of sialic acid-binding Ig-like lectins. A full-length cDNA was isolated from a human spleen library and the corresponding gene identified. Siglec-10 is predicted to contain five extracellular Ig-like domains and a cytoplasmic tail containing three putative tyrosine-based signalling motifs. Siglec-10 exhibited a high degree of sequence similarity to CD33-related Siglecs and mapped to the same region, on chromosome 19q13.3. The expressed protein was able to mediate sialic acid-dependent binding to human erythrocytes and soluble sialoglycoconjugates. Using specific antibodies, Siglec-10 was detected on subsets of human leucocytes including eosinophils, monocytes and a minor population of natural killer-like cells. The molecular properties and expression pattern suggest that Siglec-10 may function as an inhibitory receptor within the innate immune system. PMID:11284738

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

PubMed Central

Woods, D E; Edge, M D; Colten, H R

1984-01-01

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

Localization and physical mapping of genes encoding the A+U-rich element RNA-binding protein AUF1 to human chromosomes 4 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagner, B.J.; Long, L.; Pettenati, M.J.

Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

JPRS Report, Science and Technology USSR: Life Sciences.

DTIC Science & Technology

1990-07-16

4 1 VETERINARY MEDICINE Primary Structure of RNA Polymerase Gene of Foot-and-Mouth Disease Virus ( FMDV ...neering were used to obtain cDNA corresponding to the Primary Structure of RNA Polymerase Gene of RNA polymerase gene to FMDV A 2 2 , with a map of the...Foot-and-Mouth Disease Virus ( FMDV ) A22 primary nucleotide sequence of the cDNA provided. 18400538F Moscow BIOORGANICHESKA YA Analysis of the data

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-12-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

Syntenic conservation of HSP70 genes in cattle and humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grosz, M.D.; Womack, J.E.; Skow, L.C.

1992-12-01

A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digestedmore » DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.« less

Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

PubMed Central

Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

1986-01-01

Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

Construction of a yeast artificial chromosome contig encompassing the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, V.; Bonnycastle, L.; Poorkai, P.

1994-09-01

We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contigmore » by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.« less

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

Sequencing and comparative genomic analysis of 1227 Felis catus cDNA sequences enriched for developmental, clinical and nutritional phenotypes

PubMed Central

2012-01-01

Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742

HUNT: launch of a full-length cDNA database from the Helix Research Institute.

PubMed

Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

2001-01-01

The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

Promoter-Based Theranostics for Prostate Cancer

DTIC Science & Technology

2016-06-01

diagnosis vector consists of the tumor-specific PEG-promoter (PEG-Prom) and cDNA of human chorionic gonadotropin β chain (βhCG) as a reporter. We...transfection efficiency. We also used CpG-free cDNA of Figure 5. pCpGfree-PEGwt-HSV1-tk-neo vector expressed functional thymidine kinase in human

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

Sequence and pattern of expression of a bovine homologue of a human mitochondrial transport protein associated with Grave's disease.

PubMed

Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F

1992-01-01

A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.

Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

NASA Astrophysics Data System (ADS)

Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

1990-10-01

The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

PubMed Central

McWilliams, D; Callahan, R C; Boime, I

1977-01-01

A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

Characterization of ROS1 cDNA from a human glioblastoma cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Birchmeier, C.; O'Neill, K.; Riggs, M.

1990-06-01

The authors have isolated and characterized a human ROS1 cDNA from the glioblastoma cell line SW-1088. The cDNA, 8.3 kilobases long, has the potential to encode a transmembrane tyrosine-specific protein kinase with a predicted molecular mass of 259 kDa. The putative extracellular domain of ROS1 is homologous to the extracellular domain of the sevenless gene product from Drosophila. No comparable similarities in the extracellular domains were found between ROS1 and other receptor-type tyrosine kinases. Together, ROS1 and sevenless gene products define a distinct subclass of transmember tyrosine kinases.

Cloning of cDNA encoding the nuclear form of chicken sterol response element binding protein-2 (SREBP-2), chromosomal localization, and tissue expression of chicken SREBP-1 and -2 genes.

PubMed

Assaf, S; Hazard, D; Pitel, F; Morisson, M; Alizadeh, M; Gondret, F; Diot, C; Vignal, A; Douaire, M; Lagarrigue, S

2003-01-01

Sterol regulatory element binding protein-1 and -2 (SREBP-1 and -2) are key transcription factors involved in the biosynthesis of cholesterol and fatty adds. The SREBP have mainly been studied in rodents in which lipogenesis is regulated in both liver and adipose tissue. There is, however, a paucity of information on birds, in which lipogenesis occurs essentially in the liver as in humans. As a prelude to the investigation of the role of SREBP in lipid metabolism regulation in chicken, we sequenced the cDNA, encoding the mature nuclear form of chicken SREBP-2 protein, mapped SREBP-1 and -2 genes and studied their tissue expressions. The predicted chicken SREBP-2 amino acid sequence shows a 77 to 79% identity with human, mouse, and hamster homologues, with a nearly perfect conservation in all the important functional motifs, basic, helix-loop-helix, and leucine zipper (bHLH-Zip) region as well as cleavage sites. As in the human genome, SREBP-1 and SREBP-2 chicken genes are located on two separate chromosomes, respectively microchromosome 14 and macrochromosome 1. Tissue expression data show that SREBP-1 and SREBP-2 are expressed in a wide variety of tissues in chicken. However, unlike SREBP-2, SREBP-1 is expressed preferentially in the liver and uropygial gland, suggesting an important role of SREBP-1 in the regulation of lipogenesis in avian species.

Mouse TCOF1 is expressed widely, has motifs conserved in nucleolar phosphoproteins, and maps to chromosome 18.

PubMed

Paznekas, W A; Zhang, N; Gridley, T; Jabs, E W

1997-09-08

Mutations in the human TCOF1 gene have been identified in patients with Treacher Collins Syndrome (Mandibulofacial Dysostosis), an autosomal dominant condition affecting the craniofacial region. We report the isolation of the entire mouse Tcof1 coding sequence (3960 bp) by performing a computer-based search for mouse cDNA clones homologous to TCOF1 and generating overlapping RT-PCR products from mouse RNA. Tcof1 is a 1320 amino acid protein of 135 kd with 61.4% identity to TCOF1 and displays repeating motifs enriched for serine- and acidic amino acid-rich regions with potential phosphorylation sites and putative nuclear localization signals. Tcof1 maps to the mouse chromosome 18 region syntenic with human chromosome 5q32-->q33 which contains the TCOF1 locus. Northern blot hybridization indicates Tcof1 expression is ubiquitous in adult tissues and in the embryonic stage, is elevated at 11 dpc when the branchial arches and facial swellings are present in mouse. Our results are consistent with TCOF1 mutations leading to the Treacher Collins syndrome phenotype.

An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

Treesearch

Craig S. Echt; Surya Saha; Konstantin V. Krutovsky; Kokulapalan Wimalanathan; John E. Erpelding; Chun Liang; C Dana Nelson

2011-01-01

Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety...

Production of biologically active recombinant human factor H in Physcomitrella.

PubMed

Büttner-Mainik, Annette; Parsons, Juliana; Jérôme, Hanna; Hartmann, Andrea; Lamer, Stephanie; Schaaf, Andreas; Schlosser, Andreas; Zipfel, Peter F; Reski, Ralf; Decker, Eva L

2011-04-01

The human complement regulatory serum protein factor H (FH) is a promising future biopharmaceutical. Defects in the gene encoding FH are associated with human diseases like severe kidney and retinal disorders in the form of atypical haemolytic uremic syndrome (aHUS), membranoproliferative glomerulonephritis II (MPGN II) or age-related macular degeneration (AMD). There is a current need to apply intact full-length FH for the therapy of patients with congenital or acquired defects of this protein. Application of purified or recombinant FH (rFH) to these patients is an important and promising approach for the treatment of these diseases. However, neither protein purified from plasma of healthy individuals nor recombinant protein is currently available on the market. Here, we report the first stable expression of the full-length human FH cDNA and the subsequent production of this glycoprotein in a plant system. The moss Physcomitrella patens perfectly suits the requirements for the production of complex biopharmaceuticals as this eukaryotic system not only offers an outstanding genetical accessibility, but moreover, proteins can be produced safely in scalable photobioreactors without the need for animal-derived medium compounds. Transgenic moss lines were created, which express the human FH cDNA and target the recombinant protein to the culture supernatant via a moss-derived secretion signal. Correct processing of the signal peptide and integrity of the moss-produced rFH were verified via peptide mapping by mass spectrometry. Ultimately, we show that the rFH displays complement regulatory activity comparable to FH purified from plasma. © 2010 The Authors. Plant Biotechnology Journal © 2010 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

PubMed Central

Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

2014-01-01

The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

PubMed Central

Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

2015-01-01

Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed Central

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-01-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

PubMed Central

Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

1993-01-01

A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

PubMed Central

Allison, J; Hall, L; MacIntyre, I; Craig, R K

1981-01-01

(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

cDNA library construction of two human Demodexspecies.

PubMed

Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

2017-06-01

The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

1997-01-01

A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN CDNA MICROARRAY ANALYSES

EPA Science Inventory

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN cDNA MICROARRAY ANALYSES

B.S. Pukazhenthi1, J. C. Rockett2, M. Ouyang3, D.J. Dix2, J.G. Howard1, P. Georgopoulos4, W.J. J. Welsh3 and D. E. Wildt1

1Department of Reproductiv...

Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.

PubMed

Takano, T; Sahara, N; Yamanouchi, Y; Mori, H

1997-01-17

Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.

Candidate gene database and transcript map for peach, a model species for fruit trees.

PubMed

Horn, Renate; Lecouls, Anne-Claire; Callahan, Ann; Dandekar, Abhaya; Garay, Lilibeth; McCord, Per; Howad, Werner; Chan, Helen; Verde, Ignazio; Main, Doreen; Jung, Sook; Georgi, Laura; Forrest, Sam; Mook, Jennifer; Zhebentyayeva, Tatyana; Yu, Yeisoo; Kim, Hye Ran; Jesudurai, Christopher; Sosinski, Bryon; Arús, Pere; Baird, Vance; Parfitt, Dan; Reighard, Gregory; Scorza, Ralph; Tomkins, Jeffrey; Wing, Rod; Abbott, Albert Glenn

2005-05-01

Peach (Prunus persica) is a model species for the Rosaceae, which includes a number of economically important fruit tree species. To develop an extensive Prunus expressed sequence tag (EST) database for identifying and cloning the genes important to fruit and tree development, we generated 9,984 high-quality ESTs from a peach cDNA library of developing fruit mesocarp. After assembly and annotation, a putative peach unigene set consisting of 3,842 ESTs was defined. Gene ontology (GO) classification was assigned based on the annotation of the single "best hit" match against the Swiss-Prot database. No significant homology could be found in the GenBank nr databases for 24.3% of the sequences. Using core markers from the general Prunus genetic map, we anchored bacterial artificial chromosome (BAC) clones on the genetic map, thereby providing a framework for the construction of a physical and transcript map. A transcript map was developed by hybridizing 1,236 ESTs from the putative peach unigene set and an additional 68 peach cDNA clones against the peach BAC library. Hybridizing ESTs to genetically anchored BACs immediately localized 11.2% of the ESTs on the genetic map. ESTs showed a clustering of expressed genes in defined regions of the linkage groups. [The data were built into a regularly updated Genome Database for Rosaceae (GDR), available at (http://www.genome.clemson.edu/gdr/).].

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Zygote arrest 1 (Zar1) is an evolutionarily conserved gene expressed in vertebrate ovaries.

PubMed

Wu, Xuemei; Wang, Pei; Brown, Christopher A; Zilinski, Carolyn A; Matzuk, Martin M

2003-09-01

Zygote arrest 1 (ZAR1) is an ovary-specific maternal factor that plays essential roles during the oocyte-to-embryo transition. In mice, the Zar1 mRNA is detected as a 1.4-kilobase (kb) transcript that is synthesized exclusively in growing oocytes. To further understand the functions of ZAR1, we have cloned the orthologous Zar1 cDNA and/or genes for mouse, rat, human, frog, zebrafish, and pufferfish. The entire mouse Zar1 gene and a related pseudogene span approximately 4.0 kb, contain four exons, and map to adjacent loci on mouse chromosome 5. The human ZAR1 orthologous gene similarly consists of four exons and resides on human chromosome 4p12, which is syntenic with the mouse Zar1 chromosomal locus. Rat (Rattus norvegicus) and pufferfish (Fugu rubripes) Zar1 genes were recognized by database mining and deduced protein alignment analysis. The rat Zar1 gene also maps to a region that is syntenic with the mouse Zar1 gene locus on rat chromosome 14. Frog (Xenopus laevis) and zebrafish (Danio rerio) Zar1 orthologs were cloned by reverse transcription-polymerase chain reaction and rapid amplification of cDNA ends analysis of ovarian mRNA. Unlike mouse and human, the frog Zar1 is detected in multiple tissues, including lung, muscle, and ovary. The Zar1 mRNA appears in the cytoplasm of oocytes and persists until the tailbud stage during frog embryogenesis. Mouse, rat, human, frog, zebrafish, and pufferfish Zar1 genes encode proteins of 361, 361, 424, 295, 329, and 320 amino acids, respectively, and share 50.8%-88.1% amino acid identity. Regions of the N-termini of these ZAR1 orthologs show high sequence identity among these various proteins. However, the C-terminal 103 amino acids of these proteins, encoded by exons 2-4, contain an atypical eight-cysteine Plant Homeo Domain motif and are highly conserved, sharing 80.6%-98.1% identity among these species. These findings suggest that the carboxyl-termini of these ZAR1 proteins contain an important functional domain that is conserved through vertebrate evolution and that may be necessary for normal female reproduction in the transition from oocyte to embryonic life.

Pax1, a member of the paired box-containing class of developmental control genes, is mapped to human chromosome 20p11.2 by in situ hybridization (ISH and FISH).

PubMed

Schnittger, S; Rao, V V; Deutsch, U; Gruss, P; Balling, R; Hansmann, I

1992-11-01

Pax-1, a member of a murine multigene family, belongs to the paired box-containing class of developmental control genes first identified in Drosophila. The Pax-1 gene encodes a sequence-specific DNA-binding protein with transcriptional activating properties and has been found to be mutated in the autosomal recessive mutation undulated (un) on mouse chromosome 2 with vertebral anomalies along the entire rostrocaudal axis. By radioactive in situ hybridization (ISH) using a fragment from the murine Pax-1 paired box that is almost identical to the respective sequences from the cognate human gene HuP48 and fluorescence in situ hybridization (FISH) using a complete mouse Pax-1 cDNA, we have assigned the human homologue of murine Pax-1, the PAX1 locus, to chromosome 20p. The map position of PAX1 after FISH (FL-pter value of 0.34 +/- 0.04) corresponds to band p11.2. These results confirm the exceptional homology between human chromosome 20 and the distal segment of mouse chromosome 2, extending from bands F to G, and add PAX1 to the group of genes on 20p like PTPA, PRNP, SCG1, BMP2A, which are located in proximity on both chromosomes.

Identification and characterization of human GUKH2 gene in silico.

PubMed

Katoh, Masuko; Katoh, Masaru

2004-04-01

Drosophila Guanylate-kinase holder (Gukh) is an adaptor molecule bridging Discs large (Dlg) and Scribble (Scrib), which are implicated in the establishment and maintenance of epithelial polarity. Here, we searched for human homologs of Drosophila gukh by using bioinformatics, and identified GUKH1 and GUKH2 genes. GUKH1 was identical to Nance-Horan syndrome (NHS) gene, while GUKH2 was a novel gene. FLJ35425 (AK092744.1), DKFZp686P1949 (BX647246.1) and KIAA1357 (AB037778.1) cDNAs were derived from human GUKH2 gene. Nucleotide sequence of GUKH2 cDNA was determined by assembling 5'-part of FLJ35425 cDNA and entire region of DKFZp686P1949 cDNA. Human GUKH2 gene consists of 8 exons. Exon 5 (132 bp) of GUKH2 gene was spliced out in GUKH2 cDNA due to alternative splicing. GUKH2-REPS1 locus at human chromosome 6q24.1 and GUKH1-REPS2 locus at human chromosome Xp22.22-p22.13 are paralogous regions within the human genome. Mouse Gukh2 and zebrafish gukh2 genes were also identified. N-terminal part of human GUKH2, mouse Gukh2 and zebrafish gukh2 proteins were completely divergent from human GUKH1 protein. Human GUKH2 and GUKH1, consisting of eight GUKH homology (GKH1-GKH8) domains and Proline-rich domain, showed 28.5% total-amino-acid identity. GKH1, GKH4, GKH5, GKH7 and GKH8 domains were conserved among human GUKH1, human GUKH2 and Drosophila Gukh. Because human homologs of Drosophila dlg (DLG1-DLG7) as well as human homologs of Drosophila scrib (SCRIB, ERBB2IP and Densin-180) are cancer-associated genes, human homologs of Drosophila gukh (GUKH1 and GUKH2) are predicted cancer-associated genes.

Molecular cloning, expression, functional characterization, chromosomal localization, and gene structure of junctate, a novel integral calcium binding protein of sarco(endo)plasmic reticulum membrane.

PubMed

Treves, S; Feriotto, G; Moccagatta, L; Gambari, R; Zorzato, F

2000-12-15

Screening a cDNA library from human skeletal muscle and cardiac muscle with a cDNA probe derived from junctin led to the isolation of two groups of cDNA clones. The first group displayed a deduced amino acid sequence that is 84% identical to that of dog heart junctin, whereas the second group had a single open reading frame that encoded a polypeptide with a predicted mass of 33 kDa, whose first 78 NH(2)-terminal residues are identical to junctin whereas its COOH terminus domain is identical to aspartyl beta-hydroxylase, a member of the alpha-ketoglutarate-dependent dioxygenase family. We named the latter amino acid sequence junctate. Northern blot analysis indicates that junctate is expressed in a variety of human tissues including heart, pancreas, brain, lung, liver, kidney, and skeletal muscle. Fluorescence in situ hybridization analysis revealed that the genetic loci of junctin and junctate map to the same cytogenetic band on human chromosome 8. Analysis of intron/exon boundaries of the genomic BAC clones demonstrate that junctin, junctate, and aspartyl beta-hydroxylase result from alternative splicing of the same gene. The predicted lumenal portion of junctate is enriched in negatively charged residues and is able to bind calcium. Scatchard analysis of equilibrium (45)Ca(2+) binding in the presence of a physiological concentration of KCl demonstrate that junctate binds 21.0 mol of Ca(2+)/mol protein with a k(D) of 217 +/- 20 microm (n = 5). Tagging recombinant junctate with green fluorescent protein and expressing the chimeric polypeptide in COS-7-transfected cells indicates that junctate is located in endoplasmic reticulum membranes and that its presence increases the peak amplitude and transient calcium released by activation of surface membrane receptors coupled to InsP(3) receptor activation. Our study shows that alternative splicing of the same gene generates the following functionally distinct proteins: an enzyme (aspartyl beta-hydroxylase), a structural protein of SR (junctin), and a membrane-bound calcium binding protein (junctate).

Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

PubMed

Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

2010-04-01

We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

PubMed Central

Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

2010-01-01

Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

Human brain factor 1, a new member of the fork head gene family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, D.B.; Wiese, S.; Burfeind, P.

1994-06-01

Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cool, D.E.; Tonks, N.K.; Charbonneau, H.

1989-07-01

A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

Mapping Flagellar Genes in Chlamydomonas Using Restriction Fragment Length Polymorphisms

PubMed Central

Ranum, LPW.; Thompson, M. D.; Schloss, J. A.; Lefebvre, P. A.; Silflow, C. D.

1988-01-01

To correlate cloned nuclear DNA sequences with previously characterized mutations in Chlamydomonas and, to gain insight into the organization of its nuclear genome, we have begun to map molecular markers using restriction fragment length polymorphisms (RFLPs). A Chlamydomonas reinhardtii strain (CC-29) containing phenotypic markers on nine of the 19 linkage groups was crossed to the interfertile species Chlamydomonas smithii. DNA from each member of 22 randomly selected tetrads was analyzed for the segregation of RFLPs associated with cloned genes detected by hybridization with radioactive DNA probes. The current set of markers allows the detection of linkage to new molecular markers over approximately 54% of the existing genetic map. This study focused on mapping cloned flagellar genes and genes whose transcripts accumulate after deflagellation. Twelve different molecular clones have been assigned to seven linkage groups. The α-1 tubulin gene maps to linkage group III and is linked to the genomic sequence homologous to pcf6-100, a cDNA clone whose corresponding transcript accumulates after deflagellation. The α-2 tubulin gene maps to linkage group IV. The two β-tubulin genes are linked, with the β-1 gene being approximately 12 cM more distal from the centromere than the β-2 gene. A clone corresponding to a 73-kD dynein protein maps to the opposite arm of the same linkage group. The gene corresponding to the cDNA clone pcf6-187, whose mRNA accumulates after deflagellation, maps very close to the tightly linked pf-26 and pf-1 mutations on linkage group V. PMID:2906025

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Poly A- transcripts expressed in HeLa cells.

PubMed

Wu, Qingfa; Kim, Yeong C; Lu, Jian; Xuan, Zhenyu; Chen, Jun; Zheng, Yonglan; Zhou, Tom; Zhang, Michael Q; Wu, Chung-I; Wang, San Ming

2008-07-30

Transcripts expressed in eukaryotes are classified as poly A+ transcripts or poly A- transcripts based on the presence or absence of the 3' poly A tail. Most transcripts identified so far are poly A+ transcripts, whereas the poly A- transcripts remain largely unknown. We developed the TRD (Total RNA Detection) system for transcript identification. The system detects the transcripts through the following steps: 1) depleting the abundant ribosomal and small-size transcripts; 2) synthesizing cDNA without regard to the status of the 3' poly A tail; 3) applying the 454 sequencing technology for massive 3' EST collection from the cDNA; and 4) determining the genome origins of the detected transcripts by mapping the sequences to the human genome reference sequences. Using this system, we characterized the cytoplasmic transcripts from HeLa cells. Of the 13,467 distinct 3' ESTs analyzed, 24% are poly A-, 36% are poly A+, and 40% are bimorphic with poly A+ features but without the 3' poly A tail. Most of the poly A- 3' ESTs do not match known transcript sequences; they have a similar distribution pattern in the genome as the poly A+ and bimorphic 3' ESTs, and their mapped intergenic regions are evolutionarily conserved. Experiments confirmed the authenticity of the detected poly A- transcripts. Our study provides the first large-scale sequence evidence for the presence of poly A- transcripts in eukaryotes. The abundance of the poly A- transcripts highlights the need for comprehensive identification of these transcripts for decoding the transcriptome, annotating the genome and studying biological relevance of the poly A- transcripts.

APPLICATION OF CDNA MICROARRAY TO THE STUDY OF ARSENIC TOXICOLOGY AND CARCINOGENESIS

EPA Science Inventory

Arsenic (As) is a common environmental toxicant and known human carcinogen. Epidemiological studies link As exposure to various disorders and cancers. However, the molecular mechanisms for As toxicity and carcinogenicity are not completely known. The cDNA microarray, a high-th...

Genetic validation of whole-transcriptome sequencing for mapping expression affected by cis-regulatory variation.

PubMed

Babak, Tomas; Garrett-Engele, Philip; Armour, Christopher D; Raymond, Christopher K; Keller, Mark P; Chen, Ronghua; Rohl, Carol A; Johnson, Jason M; Attie, Alan D; Fraser, Hunter B; Schadt, Eric E

2010-08-13

Identifying associations between genotypes and gene expression levels using microarrays has enabled systematic interrogation of regulatory variation underlying complex phenotypes. This approach has vast potential for functional characterization of disease states, but its prohibitive cost, given hundreds to thousands of individual samples from populations have to be genotyped and expression profiled, has limited its widespread application. Here we demonstrate that genomic regions with allele-specific expression (ASE) detected by sequencing cDNA are highly enriched for cis-acting expression quantitative trait loci (cis-eQTL) identified by profiling of 500 animals in parallel, with up to 90% agreement on the allele that is preferentially expressed. We also observed widespread noncoding and antisense ASE and identified several allele-specific alternative splicing variants. Monitoring ASE by sequencing cDNA from as little as one sample is a practical alternative to expression genetics for mapping cis-acting variation that regulates RNA transcription and processing.

Characterization of mouse and human GTP cyclohydrolase I genes. Mutations in patients with GTP cyclohydrolase I deficiency.

PubMed

Ichinose, H; Ohye, T; Matsuda, Y; Hori, T; Blau, N; Burlina, A; Rouse, B; Matalon, R; Fujita, K; Nagatsu, T

1995-04-28

GTP cyclohydrolase I is the first and rate-limiting enzyme for the biosynthesis of tetrahydrobiopterin in mammals. Previously, we reported three species of human GTP cyclohydrolase I cDNA in a human liver cDNA library (Togari, A., Ichinose, H., Matsumoto, S., Fujita, K., and Nagatsu, T. (1992) Biochem. Biophys. Res. Commun. 187, 359-365). Furthermore, very recently, we found that the GTP cyclohydrolase I gene is causative for hereditary progressive dystonia with marked diurnal fluctuation, also known as DOPA-responsive dystonia (Ichinose, H., Ohye, T., Takahashi, E., Seki, N., Hori, T., Segawa, M., Nomura, Y., Endo, K., Tanaka, H., Tsuji, S., Fujita, K., and Nagatsu, T. (1994) Nature Genetics 8, 236-242). To clarify the mechanisms that regulate transcription of the GTP cyclohydrolase I gene and to generate multiple species of mRNA, we isolated genomic DNA clones for the human and mouse GTP cyclohydrolase I genes. Structural analysis of the isolated clones revealed that the GTP cyclohydrolase I gene is encoded by a single copy gene and is composed of six exons spanning approximately 30 kilobases. We sequenced all exon/intron boundaries of the human and mouse genes. Structural analysis also demonstrated that the heterogeneity of GTP cyclohydrolase I mRNA is caused by an alternative usage of the splicing acceptor site at the sixth exon. The transcription start site of the mouse GTP cyclohydrolase I gene and the 5'-flanking sequences of the mouse and human genes were determined. We performed regional mapping of the mouse gene by fluorescence in situ hybridization, and the mouse GTP cyclohydrolase I gene was assigned to region C2-3 of mouse chromosome 14. We identified missense mutations in patients with GTP cyclohydrolase I deficiency and expressed mutated enzymes in Escherichia coli to confirm alterations in the enzyme activity.

Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

PubMed Central

Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

1995-01-01

We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

PubMed

Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

2009-09-01

We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

IDENTIFICATION OF THE ROLE OF APOPTOSIS PATHWAYS POTENTIALLY INVOLVED IN FORMALDEHYDE-INDUCED CARCINOGENESIS USING CDNA ARRAYS

EPA Science Inventory

Identification of the Role of Apoptosis Pathways Potentially Involved in Formaldehyde- Induced Carcinogenesis Using cDNA Arrays.

Formaldehyde (FA) is a genotoxic chemical found in household, medicinal, and industrial products. Although the major source of human exposure is...

Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

PubMed

Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

2008-10-13

cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

PubMed Central

Sin, Jeong-Im

2009-01-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

PubMed

Sin, Jeong-Im

2009-09-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

NASA Astrophysics Data System (ADS)

Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

2008-09-01

We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Cloning, characterization, and chromosomal mapping of a human electroneutral Na(+)-driven Cl-HCO3 exchanger.

PubMed

Grichtchenko, I I; Choi, I; Zhong, X; Bray-Ward, P; Russell, J M; Boron, W F

2001-03-16

The electroneutral Na(+)-driven Cl-HCO3 exchanger is a key mechanism for regulating intracellular pH (pH(i)) in neurons, glia, and other cells. Here we report the cloning, tissue distribution, chromosomal location, and functional characterization of the cDNA of such a transporter (NDCBE1) from human brain (GenBank accession number AF069512). NDCBE1, which encodes 1044 amino acids, is 34% identical to the mammalian anion exchanger (AE2); approximately 50% to the electrogenic Na/HCO3 cotransporter (NBCe1) from salamander, rat, and humans; approximately 73% to mammalian electroneutral Na/HCO3 cotransporters (NBCn1); 71% to mouse NCBE; and 47% to a Na(+)-driven anion exchanger (NDAE1) from Drosophila. Northern blot analysis of NDCBE1 shows a robust approximately 12-kilobase signal in all major regions of human brain and in testis, and weaker signals in kidney and ovary. This human gene (SLC4A8) maps to chromosome 12q13. When expressed in Xenopus oocytes and running in the forward direction, NDCBE1 is electroneutral and mediates increases in both pH(i) and [Na(+)](i) (monitored with microelectrodes) that require HCO3(-) and are blocked by 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS). The pH(i) increase also requires extracellular Na(+). The Na(+):HCO3(-) stoichiometry is 1:2. Forward-running NDCBE1 mediates a 36Cl efflux that requires extracellular Na(+) and HCO3(-) and is blocked by DIDS. Running in reverse, NDCBE1 requires extracellular Cl(-). Thus, NDCBE1 encodes a human, electroneutral Na(+)-driven Cl-HCO3 exchanger.

Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

NASA Astrophysics Data System (ADS)

Kikuchi, Shoshi

2009-02-01

Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

cDNA cloning and characterization of the human THRAP2 gene which maps to chromosome 12q24, and its mouse ortholog Thrap2.

PubMed

Musante, Luciana; Bartsch, Oliver; Ropers, Hans-Hilger; Kalscheuer, Vera M

2004-05-12

Characterization of a balanced t(2;12)(q37;q24) translocation in a patient with suspicion of Noonan syndrome revealed that the chromosome 12 breakpoint lies in the vicinity of a novel human gene, thyroid hormone receptor-associated protein 2 (THRAP2). We therefore characterized this gene and its mouse counterpart in more detail. Human and mouse THRAP2/Thrap2 span a genomic region of about 310 and >170 kilobases (kb), and both contain 31 exons. Corresponding transcripts are approximately 9.5 kb long. Their open reading frames code for proteins of 2210 and 2203 amino acids, which are 93% identical. By northern blot analysis, human and mouse THRAP2/Thrap2 genes showed ubiquitous expression. Transcripts were most abundant in human skeletal muscle and in mouse heart. THRAP2 protein is 56% identical to human TRAP240, which belongs to the thyroid hormone receptor associated protein (TRAP) complex and is evolutionary conserved up to yeast. This complex is involved in transcriptional regulation and is believed to serve as adapting interface between regulatory proteins bound to specific DNA sequences and RNA polymerase II.

Characterization of the in vitro expressed autoimmune rippling muscle disease immunogenic domain of human titin encoded by TTN exons 248-249

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zelinka, L.; McCann, S.; Budde, J.

2011-08-05

Highlights: {yields} Affinity purification of the autoimmune rippling muscle disease immunogenic domain of titin. {yields} Partial sequence analysis confirms that the peptides is in the I band region of titin. {yields} This region of the human titin shows high degree of homology to mouse titin N2-A. -- Abstract: Autoimmune rippling muscle disease (ARMD) is an autoimmune neuromuscular disease associated with myasthenia gravis (MG). Past studies in our laboratory recognized a very high molecular weight skeletal muscle protein antigen identified by ARMD patient antisera as the titin isoform. These past studies used antisera from ARMD and MG patients as probes tomore » screen a human skeletal muscle cDNA library and several pBluescript clones revealed supporting expression of immunoreactive peptides. This study characterizes the products of subcloning the titin immunoreactive domain into pGEX-3X and the subsequent fusion protein. Sequence analysis of the fusion gene indicates the cloned titin domain (GenBank ID: (EU428784)) is in frame and is derived from a sequence of N2-A spanning the exons 248-250 an area that encodes the fibronectin III domain. PCR and EcoR1 restriction mapping studies have demonstrated that the inserted cDNA is of a size that is predicted by bioinformatics analysis of the subclone. Expression of the fusion protein result in the isolation of a polypeptide of 52 kDa consistent with the predicted inferred amino acid sequence. Immunoblot experiments of the fusion protein, using rippling muscle/myasthenia gravis antisera, demonstrate that only the titin domain is immunoreactive.« less

Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Livi, G.P.; McHale, M.J.; Sathe, G.M.

1990-06-01

The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

PubMed

Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

1996-05-16

A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

Characterization of a highly conserved human homolog to the chicken neural cell surface protein Bravo/Nr-CAM that maps to chromosome band 7q31

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lane, R.P.; Vielmetter, J.; Dreyer, W.J.

1996-08-01

The neuronal cell adhesion molecule Bravo/Nr-CAM is a cell surface protein of the immunoglobulin (Ig) superfamily and is closely related to the L1/NgCAM and neurofascin molecules, all of which contain six immunoglobulin domains, five fibronectin repeats, a transmembrane region, and an intracellular domain. Chicken Bravo/Nr-CAM has been shown to interact with other cell surface molecules of the Ig superfamily and has been implicated in specific pathfinding roles of axonal growth cones in the developing nervous system. We now report the characterization of cDNA clones encoding the human Bravo/Nr-CAM protein, which, like its chicken homolog, is composed of six V-like Igmore » domains and five fibronectin type III repeats. The human Bravo/Nr-CAM homolog also contains a transmembrane and intracellular domain, both of which are 100% conserved at the amino acid level compared to its chicken homolog. Overall, the human Bravo/Nr-CAM homolog is 82% identical to the chicken Bravo/Nr-CAM amino acid sequence. Independent cDNAs encoding four different isoforms were also identified, all of which contain alternatively spliced variants around the fifth fibronectin type III repeat, including one isoform that had been previously identified for chicken Bravo/Nr-CAM. Northern blot analysis reveals one mRNA species of approximately 7.0 kb in adult human brain tissue. Fluorescence in situ hybridization maps the gene for human Bravo/Nr-CAM to human chromosome 7q31.1-q31.2. This chromosomal locus has been previously identified as containing a tumore suppressor candidate gene commonly deleted in certain human cancer tissues. 38 refs., 5 figs.« less

Characterization of the human peroxisome proliferator activated receptor delta gene and its expression.

PubMed

Skogsberg, J; Kannisto, K; Roshani, L; Gagne, E; Hamsten, A; Larsson, C; Ehrenborg, E

2000-07-01

Peroxisome proliferator activated receptors (PPARs) are nuclear receptors regulating the expression of genes involved in lipid and glucose metabolism. Three different PPARs; alpha (PPARA), gamma (PPARG) and delta (PPARD) have been characterized and they are distinguished from each other by tissue distribution and cell activation. In this study, the structure and detailed chromosomal localization of the human PPARD gene was determined. Three genomic clones containing the PPARD gene was isolated from a human P1 library. The gene spans approximately 85 kb of DNA and consists of 9 exons and 8 introns with exons ranging in size from 84 bp to 2.3 kb and introns ranging from 180 bp to 50 kb. All splice acceptor and donor sites conform to the consensus sequences including the AG-GT motif. Although PPARD lacks a TATA box, the gene is transcribed from a unique start site located 380 bp upstream of the ATG initiation codon. The 5' and 3' ends were mapped by rapid amplification of cDNA ends and the mRNA size of PPARD based upon the structure of the gene is 3803 bp. In addition, the chromosomal sublocalization of PPARD was determined by radiation hybrid mapping. The PPARD gene is located at 14 cR from the colipase gene and 15 cR from the serine kinase gene at chromosomal region 6p21.2.

Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

1996-01-15

The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

Identification of actin binding protein, ABP-280, as a binding partner of human Lnk adaptor protein.

PubMed

He, X; Li, Y; Schembri-King, J; Jakes, S; Hayashi, J

2000-08-01

Human Lnk (hLnk) is an adaptor protein with multiple functional domains that regulates T cell activation signaling. In order to identify cellular Lnk binding partners, a yeast two-hybrid screening of human spleen cDNA library was carried out using human hLnk as bait. A polypeptide sequence identical to the C-terminal segment of the actin binding protein (ABP-280) was identified as a hLnk binding protein. The expressed hLnk and the FLAG tagged C-terminal 673 amino acid residues of ABP-280 or the endogenous ABP-280 in COS-7 cells could be co-immunoprecipitated using antibodies either to hLnk, FLAG or ABP-280, respectively. Furthermore, immunofluorescence confocal microscope showed that hLnk and ABP-280 co-localized at the plasma membrane and at juxtanuclear region of COS-7 cells. In Jurkat cells, the endogenous hLnk also associates with the endogenous ABP-280 indicating that the association of these two proteins is physiological. The interacting domains of both proteins were mapped using yeast two-hybrid assays. Our results indicate that hLnk binds to the residues 2006-2454 (repeats 19-23C) of ABP-280. The domain in hLnk that associates with ABP-280 was mapped to an interdomain region of 56 amino acids between pleckstrin homology and Src homology 2 domains. These results suggest that hLnk may exert its regulatory role through its association with ABP-280.

Complete sequence of HLA-B27 cDNA identified through the characterization of structural markers unique to the HLA-A, -B, and -C allelic series

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szoets, H.; Reithmueller, G.; Weiss, E.

1986-03-01

Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in positionmore » 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.« less

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Poly A- Transcripts Expressed in HeLa Cells

PubMed Central

Lu, Jian; Xuan, Zhenyu; Chen, Jun; Zheng, Yonglan; Zhou, Tom; Zhang, Michael Q.; Wu, Chung-I; Wang, San Ming

2008-01-01

Background Transcripts expressed in eukaryotes are classified as poly A+ transcripts or poly A- transcripts based on the presence or absence of the 3′ poly A tail. Most transcripts identified so far are poly A+ transcripts, whereas the poly A- transcripts remain largely unknown. Methodology/Principal Findings We developed the TRD (Total RNA Detection) system for transcript identification. The system detects the transcripts through the following steps: 1) depleting the abundant ribosomal and small-size transcripts; 2) synthesizing cDNA without regard to the status of the 3′ poly A tail; 3) applying the 454 sequencing technology for massive 3′ EST collection from the cDNA; and 4) determining the genome origins of the detected transcripts by mapping the sequences to the human genome reference sequences. Using this system, we characterized the cytoplasmic transcripts from HeLa cells. Of the 13,467 distinct 3′ ESTs analyzed, 24% are poly A-, 36% are poly A+, and 40% are bimorphic with poly A+ features but without the 3′ poly A tail. Most of the poly A- 3′ ESTs do not match known transcript sequences; they have a similar distribution pattern in the genome as the poly A+ and bimorphic 3′ ESTs, and their mapped intergenic regions are evolutionarily conserved. Experiments confirmed the authenticity of the detected poly A- transcripts. Conclusion/Significance Our study provides the first large-scale sequence evidence for the presence of poly A- transcripts in eukaryotes. The abundance of the poly A- transcripts highlights the need for comprehensive identification of these transcripts for decoding the transcriptome, annotating the genome and studying biological relevance of the poly A- transcripts. PMID:18665230

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kawagoe, Kazuyoshi; Takeda, Junji; Kinoshita, Taroh

Many membrane proteins are anchored to the cell membrane by glycosylphosphatidylinositol (GPI). The core structure and biosynthesis of the GPI anchor are well conserved in eukaryote cells. We previously cloned a human PIGA gene that participates in GPI anchor biosynthesis. We have now cloned complementary and genomic DNA of Pig-a, the murine homologue of PIGA, and compared its function and gene structure with those of PIGA. The deduced amino acid sequence of mouse PIG-A is 88% identical with that of human PIG-A. Transfection of Pig-a cDNA complemented the defects of both a PIG-A-deficient murine cell line and a PIG-A-deficient humanmore » cell line, demonstrating that functions of mouse and human PIG-A are conserved. Like human PIGA, the chromosomal Pig-a gene has six exons and spans approximately 16 kb. Moreover, Pig-a was mapped to X-F3/4, which is syntenic to human Xp22.1, where PIGA is located. Thus, murine Pig-a provides a good animal model to study paroxysmal nocturnal hemoglobinuria, a disease caused by a somatic mutation of PIGA. Database analysis demonstrated that a yeast gene, SPT14, is homologous to Pig-a and PIGA and that these genes are members of a glycosyltransferase gene family.« less

Genetic validation of whole-transcriptome sequencing for mapping expression affected by cis-regulatory variation

PubMed Central

2010-01-01

Background Identifying associations between genotypes and gene expression levels using microarrays has enabled systematic interrogation of regulatory variation underlying complex phenotypes. This approach has vast potential for functional characterization of disease states, but its prohibitive cost, given hundreds to thousands of individual samples from populations have to be genotyped and expression profiled, has limited its widespread application. Results Here we demonstrate that genomic regions with allele-specific expression (ASE) detected by sequencing cDNA are highly enriched for cis-acting expression quantitative trait loci (cis-eQTL) identified by profiling of 500 animals in parallel, with up to 90% agreement on the allele that is preferentially expressed. We also observed widespread noncoding and antisense ASE and identified several allele-specific alternative splicing variants. Conclusion Monitoring ASE by sequencing cDNA from as little as one sample is a practical alternative to expression genetics for mapping cis-acting variation that regulates RNA transcription and processing. PMID:20707912

Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiktorowicz, J.E.; Whitman, J.M.

1986-05-01

Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less

A Novel Locomotion-based Validation Assay for Candidate Drugs Using Drosophila DYT1 Disease Model

DTIC Science & Technology

2014-06-01

rescue the locomotion defects of Drosophila larvae caused by the expression of human torsinAΔE. These results demonstrated that human torsinA can... Drosophila dtorsin∆D transgenic lines dtorsin∆E and dtorsin∆D cDNA constructs were made from the wild type dtorsin cDNA using QuikChange II XL Site...After confirming mutated sequences , the insert was again cut out with EcoRI and NotI and inserted between EcoRI and NotI sites of pUAST [2] to produce

The chorionic gonadotropin alpha-subunit gene is on human chromosome 18 in JEG cells.

PubMed Central

Hardin, J W; Riser, M E; Trent, J M; Kohler, P O

1983-01-01

The gene for the alpha subunit of human chorionic gonadotropin (hCG) has been tentatively assigned to human chromosome 18. This localization was accomplished through the use of Southern blot analysis. A full-length cDNA probe for the hCG alpha subunit and DNA isolated from a series of somatic hybrids between mouse and human cells were utilized to make this assignment. In addition, in situ hybridization with normal human peripheral blood lymphocytes as a source of human chromosomes and with the same cDNA probe confirmed this result. The presence of human chromosome 18 was required for the detection of DNA fragments characteristic of the alpha-hCG gene. These results are consistent with our previous observation that human chromosomes 10 and 18 are required for the production of hCG in cultured cells. Images PMID:6578509

Physical mapping of the torsion dystonia region of human chromosome 9q34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozelius, L.J.; Hewett, J.; Shalish, C.

1994-09-01

Torsion dystonia is a syndrome characterized by loss of voluntary movements appearing as sustained muscle contractions and/or abnormal postures. The DYT1 gene is responsible for a subtype of torsion dystonia in which onset of symptoms tends to occur in a limb at an early age (mean 13 years) and to progress to a generalized state. Expression of the disease gene follows an autosomal dominant mode of inheritance with reduced penetrance. We initially mapped this gene to human chromosome 9q34 and have now defined its location to a < 1 cM region near the ASS locus based on historic recombination eventsmore » around a founder mutation in the Ashkenazic Jewish population. Using the CEPH YAC library and a chromosome 9 flow-sorted YAC library, we have generated a YAC contig spanning about 500 kb of this region. These YACs are being used to identify cosmids by direct hybridization to chromosome 9-specific cosmid libraries. Cosmids are being aligned by restriction digest patterns and by hybridization with oligonucleotide repeat probes. In addition, the cosmids are being {open_quotes}trapped{close_quotes} by exon amplification and these exons used to screen cDNA libraries. Thus far we have identified several candidate transcripts in this region.« less

Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas.

PubMed

Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C

1994-06-17

A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.

Mass spectrometry-based cDNA profiling as a potential tool for human body fluid identification.

PubMed

Donfack, Joseph; Wiley, Anissa

2015-05-01

Several mRNA markers have been exhaustively evaluated for the identification of human venous blood, saliva, and semen in forensic genetics. As new candidate human body fluid specific markers are discovered, evaluated, and reported in the scientific literature, there is an increasing trend toward determining the ideal markers for cDNA profiling of body fluids of forensic interest. However, it has not been determined which molecular genetics-based technique(s) should be utilized to assess the performance of these markers. In recent years, only a few confirmatory, mRNA/cDNA-based methods have been evaluated for applications in body fluid identification. The most frequently described methods tested to date include quantitative polymerase chain reaction (qPCR) and capillary electrophoresis (CE). However these methods, in particular qPCR, often favor narrow multiplex PCR due to the availability of a limited number of fluorescent dyes/tags. In an attempt to address this technological constraint, this study explored matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) for human body fluid identification via cDNA profiling of venous blood, saliva, and semen. Using cDNA samples at 20pg input phosphoglycerate kinase 1 (PGK1) amounts, body fluid specific markers for the candidate genes were amplified in their corresponding body fluid (i.e., venous blood, saliva, or semen) and absent in the remaining two (100% specificity). The results of this study provide an initial indication that MALDI-TOF MS is a potential fluorescent dye-free alternative method for body fluid identification in forensic casework. However, the inherent issues of low amounts of mRNA, and the damage caused to mRNA by environmental exposures, extraction processes, and storage conditions are important factors that significantly hinder the implementation of cDNA profiling into forensic casework. Published by Elsevier Ireland Ltd.

Impairment of Human Immunodeficiency Virus Type-1 Integrase SUMOylation Correlates with an Early Replication Defect*

PubMed Central

Zamborlini, Alessia; Coiffic, Audrey; Beauclair, Guillaume; Delelis, Olivier; Paris, Joris; Koh, Yashuiro; Magne, Fabian; Giron, Marie-Lou; Tobaly-Tapiero, Joelle; Deprez, Eric; Emiliani, Stephane; Engelman, Alan; de Thé, Hugues; Saïb, Ali

2011-01-01

HIV-1 integrase (IN) orchestrates the integration of the reverse transcribed viral cDNA into the host cell genome and participates also in other steps of HIV-1 replication. Cellular and viral factors assist IN in performing its multiple functions, and post-translational modifications contribute to modulate its activities. Here, we show that HIV-1 IN is modified by SUMO proteins and that phylogenetically conserved SUMOylation consensus motifs represent major SUMO acceptor sites. Viruses harboring SUMOylation site IN mutants displayed a replication defect that was mapped during the early stages of infection, before integration but after reverse transcription. Because SUMOylation-defective IN mutants retained WT catalytic activity, we hypothesize that SUMOylation might regulate the affinity of IN for co-factors, contributing to efficient HIV-1 replication. PMID:21454548

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Molecular identification and functional expression of mu 3, a novel alternatively spliced variant of the human mu opiate receptor gene.

PubMed

Cadet, Patrick; Mantione, Kirk J; Stefano, George B

2003-05-15

Studies from our laboratory have revealed a novel mu opiate receptor, mu 3, which is expressed in both vascular tissues and leukocytes. The mu 3 receptor is selective for opiate alkaloids and is insensitive to opioid peptides. We now identify the mu 3 receptor at the molecular level using a 441-bp conserved region of the mu 1 receptor. Sequence analysis of the isolated cDNA suggests that it is a novel, alternatively spliced variant of the mu opiate receptor gene. To determine whether protein expressed from this cDNA exhibits the biochemical characteristics expected of the mu 3 receptor, the cDNA clone was expressed in a heterologous system. At the functional level, COS-1 cells transfected with the mu 3 receptor cDNA exhibited dose-dependent release of NO following treatment with morphine, but not opioid peptides (i.e., Met-enkephalin). Naloxone was able to block the effect of morphine on COS-1 transfected cells. Nontransfected COS-1 cells did not produce NO in the presence of morphine or the opioid peptides at similar concentrations. Receptor binding analysis with [(3)H]dihydromorphine further supports the opiate alkaloid selectivity and opioid peptide insensitivity of this receptor. These data suggest that this new mu opiate receptor cDNA encodes the mu 3 opiate receptor, since it exhibits biochemical characteristics known to be unique to this receptor (opiate alkaloid selective and opioid peptide insensitive). Furthermore, using Northern blot, RT-PCR, and sequence analysis, we have demonstrated the expression of this new mu variant in human vascular tissue, mononuclear cells, polymorphonuclear cells, and human neuroblastoma cells.

Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montermini, L.; Zara, F.; Pandolfo, M.

1994-09-01

Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

Identification of RFLP and NBS/PK profiling markers for disease resistance loci in genetic maps of oats.

PubMed

Sanz, M J; Loarce, Y; Fominaya, A; Vossen, J H; Ferrer, E

2013-01-01

Two of the domains most widely shared among R genes are the nucleotide binding site (NBS) and protein kinase (PK) domains. The present study describes and maps a number of new oat resistance gene analogues (RGAs) with two purposes in mind: (1) to identify genetic regions that contain R genes and (2) to determine whether RGAs can be used as molecular markers for qualitative loci and for QTLs affording resistance to Puccinia coronata. Such genes have been mapped in the diploid A. strigosa × A. wiestii (Asw map) and the hexaploid MN841801-1 × Noble-2 (MN map). Genomic and cDNA NBS-RGA probes from oat, barley and wheat were used to produce RFLPs and to obtain markers by motif-directed profiling based on the NBS (NBS profiling) and PK (PK profiling) domains. The efficiency of primers used in NBS/PK profiling to amplify RGA fragments was assessed by sequencing individual marker bands derived from genomic and cDNA fragments. The positions of 184 markers were identified in the Asw map, while those for 99 were identified in the MN map. Large numbers of NBS and PK profiling markers were found in clusters across different linkage groups, with the PK profiling markers more evenly distributed. The location of markers throughout the genetic maps and the composition of marker clusters indicate that NBS- and PK-based markers cover partly complementary regions of oat genomes. Markers of the different classes obtained were found associated with the two resistance loci, PcA and R-284B-2, mapped on Asw, and with five out of eight QTLs for partial resistance in the MN map. 53 RGA-RFLPs and 187 NBS/PK profiling markers were also mapped on the hexaploid map A. byzantina cv. Kanota × A. sativa cv. Ogle. Significant co-localization was seen between the RGA markers in the KO map and other markers closely linked to resistance loci, such as those for P. coronata and barley yellow dwarf virus (Bydv) that were previously mapped in other segregating populations.

Cloning and characterization of the human 5,10-methenyltetrahydrofolate synthetase-encoding cDNA.

PubMed

Dayan, A; Bertrand, R; Beauchemin, M; Chahla, D; Mamo, A; Filion, M; Skup, D; Massie, B; Jolivet, J

1995-11-20

Methenyltetrahydrofolate synthetase (MTHFS) catalyses the obligatory initial metabolic step in the intracellular conversion of 5-formyltetrahydrofolate to other reduced folates. We have isolated and sequenced a human MTHFS cDNA which is 872-bp long and codes for a 203-amino-acid protein of 23,229 Da. Escherichia coli BL21(DE3), transfected with pET11c plasmids containing an open reading frame encoding MTHFS, showed a 100-fold increase in MTHFS activity in bacterial extracts after IPTG induction. Northern blot studies of human tissues determined that the MTHFS mRNA was expressed preferentially in the liver and Southern blot analysis of human genomic DNA suggested the presence of a single-copy gene.

The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, C.F. Jr.; Clancy, T.E.; Quan, R.

1995-04-10

The human oxytocin receptor regulates parturition and myometrial contractility, breast milk let-down, and reproductive behaviors in the mammalian central nervous system. Kimura et al. recently identified a human oxytocin receptor cDNA by means of expression cloning from a human myometrial cDNA library. To elucidate further the molecular mechanisms that regulate oxytocin receptor gene expression and to define the expected Mendelian inheritance of possible human disease states, we must determine the number of genes, their localization, and their organization and structure. We summarize below our data indicating that the human oxytocin receptor gene is localized to 3p25 and exists as amore » single copy in the haploid genome. 9 refs., 2 figs.« less

Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

PubMed

Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

2006-10-01

Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

The structure of the human interferon alpha/beta receptor gene.

PubMed

Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

1992-02-05

Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

PubMed

Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

1990-01-05

We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Effects of Nickel Treatment on H3K4 Trimethylation and Gene Expression

PubMed Central

Tchou-Wong, Kam-Meng; Kluz, Thomas; Arita, Adriana; Smith, Phillip R.; Brown, Stuart; Costa, Max

2011-01-01

Occupational exposure to nickel compounds has been associated with lung and nasal cancers. We have previously shown that exposure of the human lung adenocarcinoma A549 cells to NiCl2 for 24 hr significantly increased global levels of trimethylated H3K4 (H3K4me3), a transcriptional activating mark that maps to the promoters of transcribed genes. To further understand the potential epigenetic mechanism(s) underlying nickel carcinogenesis, we performed genome-wide mapping of H3K4me3 by chromatin immunoprecipitation and direct genome sequencing (ChIP-seq) and correlated with transcriptome genome-wide mapping of RNA transcripts by massive parallel sequencing of cDNA (RNA-seq). The effect of NiCl2 treatment on H3K4me3 peaks within 5,000 bp of transcription start sites (TSSs) on a set of genes highly induced by nickel in both A549 cells and human peripheral blood mononuclear cells were analyzed. Nickel exposure increased the level of H3K4 trimethylation in both the promoters and coding regions of several genes including CA9 and NDRG1 that were increased in expression in A549 cells. We have also compared the extent of the H3K4 trimethylation in the absence and presence of formaldehyde crosslinking and observed that crosslinking of chromatin was required to observe H3K4 trimethylation in the coding regions immediately downstream of TSSs of some nickel-induced genes including ADM and IGFBP3. This is the first genome-wide mapping of trimethylated H3K4 in the promoter and coding regions of genes induced after exposure to NiCl2. This study may provide insights into the epigenetic mechanism(s) underlying the carcinogenicity of nickel compounds. PMID:21455298

Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

PubMed Central

Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

2011-01-01

To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Claffey, K.P.; Herrera, V.L.; Brecher, P.

1987-12-01

A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

PubMed

Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

2011-11-25

Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

Characterization of human septic sera induced gene expression modulation in human myocytes

PubMed Central

Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem

2009-01-01

To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

PubMed Central

Kirkegaard, K; Nelsen, B

1990-01-01

Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

Altered metabolomic-genomic signature: A potential noninvasive biomarker of epilepsy.

PubMed

Wu, Helen C; Dachet, Fabien; Ghoddoussi, Farhad; Bagla, Shruti; Fuerst, Darren; Stanley, Jeffrey A; Galloway, Matthew P; Loeb, Jeffrey A

2017-09-01

This study aimed to identify noninvasive biomarkers of human epilepsy that can reliably detect and localize epileptic brain regions. Having noninvasive biomarkers would greatly enhance patient diagnosis, patient monitoring, and novel therapy development. At the present time, only surgically invasive, direct brain recordings are capable of detecting these regions with precision, which severely limits the pace and scope of both clinical management and research progress in epilepsy. We compared high versus low or nonspiking regions in nine medically intractable epilepsy surgery patients by performing integrated metabolomic-genomic-histological analyses of electrically mapped human cortical regions using high-resolution magic angle spinning proton magnetic resonance spectroscopy, cDNA microarrays, and histological analysis. We found a highly consistent and predictive metabolite logistic regression model with reduced lactate and increased creatine plus phosphocreatine and choline, suggestive of a chronically altered metabolic state in epileptic brain regions. Linking gene expression, cellular, and histological differences to these key metabolites using a hierarchical clustering approach predicted altered metabolic vascular coupling in the affected regions. Consistently, these predictions were validated histologically, showing both neovascularization and newly discovered, millimeter-sized microlesions. Using a systems biology approach on electrically mapped human cortex provides new evidence for spatially segregated, metabolic derangements in both neurovascular and synaptic architecture in human epileptic brain regions that could be a noninvasively detectable biomarker of epilepsy. These findings both highlight the immense power of a systems biology approach and identify a potentially important role that magnetic resonance spectroscopy can play in the research and clinical management of epilepsy. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

Overexpression of peptide deformylase in breast, colon, and lung cancers.

PubMed

Randhawa, Harsharan; Chikara, Shireen; Gehring, Drew; Yildirim, Tuba; Menon, Jyotsana; Reindl, Katie M

2013-07-01

Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and prostate cell lines were determined using the CyQUANT assay. PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer samples while MAP1D mRNA levels were increased in just colon cancers. The expression of PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR, pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines. Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and prostate cancer cell proliferation than non-cancer cell lines. This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers, and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to promote cancer cell proliferation.

Overexpression of peptide deformylase in breast, colon, and lung cancers

PubMed Central

2013-01-01

Background Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. Methods The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and prostate cell lines were determined using the CyQUANT assay. Results PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer samples while MAP1D mRNA levels were increased in just colon cancers. The expression of PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR, pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines. Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and prostate cancer cell proliferation than non-cancer cell lines. Conclusions This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers, and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to promote cancer cell proliferation. PMID:23815882

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

PubMed Central

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-01-01

AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray.

PubMed

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-03-01

To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.

Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

PubMed Central

Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

1994-01-01

We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, L.; Desbarats, M.; Viel, J.

1996-08-15

The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reilly, D.S.; Nussbaum, R.L.

1994-09-01

The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

Expression cloning and chromosomal mapping of the leukocyte activation antigen CD97, a new seven-span transmembrane molecule of the secretin receptor superfamily with an unusual extracellular domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamann, J.; Hamann, D.; Lier, R.A.W.

1995-08-15

CD97 is a monomeric glycoprotein of 75 to 85 kDa that is induced rapidly on the surface of most leukocytes upon activation. We herein report the isolation of a cDNA encoding human CD97 by expression cloning in COS cells. The 3-kb cDNA clone encodes a mature polypeptide chain of 722 amino acids with a predicted molecular mass of 79 kDa. Within the C-terminal part of the protein, a region with seven hydrophobic segments was identified, suggesting that CD97 is a seven-span transmembrane molecule. Sequence comparison indicates that CD97 is the first leukocyte Ag in a recently described superfamily that includesmore » the receptors for secretin, calcitonin, and other mammalian and insect peptide hormones. Different from these receptors, CD97 has an extended extracellular region of 433 amino acids that possesses three N-terminal epidermal growth factor-like domains, two of them with a calcium-binding site, and single Arg-Gly-Asp (RGD) motif. The existence of structural elements characteristic for extracellular matrix proteins in a seven-span transmembrane molecule makes CD97 a receptor potentially involved in both adhesion and signaling processes early after leukocyte activation. The gene encoding CD97 is localized on chromosome 19 (19p13.12-13.2).« less

cDNA cloning, expression pattern, and chromosomal localization of Mlf1, murine homologue of a gene involved in myelodysplasia and acute myeloid leukemia.

PubMed

Hitzler, J K; Witte, D P; Jenkins, N A; Copeland, N G; Gilbert, D J; Naeve, C W; Look, A T; Morris, S W

1999-07-01

The NPM-MLF1 fusion protein is expressed in blasts from patients with myelodysplasia/acute myeloid leukemia (MDS/AML) containing the t(3;5) chromosomal rearrangement. Nucleophosmin (NPM), a previously characterized nucleolar phosphoprotein, contributes to two other fusion proteins found in lympho-hematopoietic malignancies, anaplastic large cell lymphoma (NPM-ALK) and acute promyelocytic leukemia (NPM-RARalpha). By contrast, the function of the carboxy-terminal fusion partner, myelodysplasia/myeloid leukemia factor 1 (MLF1), is unknown. To aid in understanding normal MLF1 function, we isolated the murine cDNA, determined the chromosomal localization of Mlf1, and defined its tissue expression by in situ hybridization. Mlf1 was highly similar to its human homologue (86% and 84% identical nucleotide and amino acid sequence, respectively) and mapped to the central region of chromosome 3, within a segment lacking known mouse mutations. Mlf1 tissue distribution was restricted during both development and postnatal life, with high levels present only in skeletal, cardiac, and selected smooth muscle, gonadal tissues, and rare epithelial tissues including the nasal mucosa and the ependyma/choroid plexus in the brain. Mlf1 transcripts were undetectable in the lympho-hematopoietic organs of both the embryonic and adult mouse, suggesting that NPM-MLF1 contributes to the genesis of MDS/AML in part by enforcing the ectopic overexpression of MLF1 within hematopoietic tissues.

Inheritance of RFLP loci in a loblolly pine three-generation pedigree

Treesearch

M.D. Devey; K.D. Jermstad; C.G. Tauer; D.B. Neale

1991-01-01

A high-density restriction fragment length polymorphism (RFLP) linkage map is being constructed for loblolly pine (Pinus taeda L.). Loblolly pine cDNA and genomic DNA clones were used as probes in hybridizations to genomic DNAs prepared from grandparents, parents, and progeny of a three-generation outbred pedigree. Approximately 200 probes were...

Analysis of large-scale gene expression data.

PubMed

Sherlock, G

2000-04-01

The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

Cloning and characterization of murine fanconi anemia group A gene: Fanca protein is expressed in lymphoid tissues, testis, and ovary.

PubMed

van de Vrugt, H J; Cheng, N C; de Vries, Y; Rooimans, M A; de Groot, J; Scheper, R J; Zhi, Y; Hoatlin, M E; Joenje, H; Arwert, F

2000-04-01

Fanconi anemia (FA) is an autosomal recessive disorder in humans characterized by bone marrow failure, cancer predisposition, and cellular hypersensitivity to cross-linking agents such as mitomycin C and diepoxybutane. FA genes display a caretaker function essential for maintenance of genomic integrity. We have cloned the murine homolog of FANCA, the gene mutated in the major FA complementation group (FA-A). The full-length mouse Fanca cDNA consists of 4503 bp and encodes a protein with a predicted molecular weight of 161 kDa. The deduced Fanca mouse protein shares 81% amino acid sequence similarity and 66% identity with the human protein. The nuclear localization signal and partial leucine zipper consensus motifs found in the human FANCA protein were also present in the murine homolog. In spite of the species difference, the murine Fanca cDNA was capable of correcting the cross-linker sensitive phenotype of human FA-A cells, suggesting functional conservation. Based on Northern as well as Western blots, Fanca was mainly expressed in lymphoid tissues, testis, and ovary. This expression pattern correlates with some of the clinical symptoms observed in FA patients. The availability of the murine Fanca cDNA now allows the gene to be studied in experimental mouse models.

Isolation and genetic mapping of a Coffea canephora phenylalanine ammonia-lyase gene (CcPAL1) and its involvement in the accumulation of caffeoyl quinic acids.

PubMed

Mahesh, Venkataramaiah; Rakotomalala, Jean Jacques; Le Gal, Lénaïg; Vigne, Hélène; de Kochko, Alexandre; Hamon, Serge; Noirot, Michel; Campa, Claudine

2006-09-01

Biosynthesis of caffeoylquinic acids occurs via the phenylpropanoid pathway in which the phenylalanine ammonia-lyase (PAL) acts as a key-control enzyme. A full-length cDNA (pF6), corresponding to a PAL gene (CcPAL1), was isolated by screening a Coffea canephora fruit cDNA library and its corresponding genomic sequence was characterized. Amplification of total DNA from seven Coffea species revealed differences in intronic length. This interspecific polymorphism was used to locate the gene on a genetic map established for a backcross progeny between Coffea pseudozanguebariae and C. dewevrei. The CcPAL1 gene was found on the same linkage group, but genetically independent, as a caffeoyl-coenzyme A-O-methyltransferase gene, another gene intervening in the phenylpropanoid pathway. In the same backcross, a lower caffeoylquinic acid content was observed in seeds harvested from plants harbouring the C. pseudozanguebariae CcPAL1 allele. Involvement of the CcPAL1 allelic form in the differential accumulation of caffeoylquinic acids in coffee green beans is then discussed.

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schriner, J.E.; Yi, W.; Hofmann, S.L.

Palmitoyl-protein thioesterase (PPT) is a small glycoprotein that removes palmitate groups from cysteine residues in lipid-modified proteins. We recently reported mutations in PPT in patients with infantile neuronal ceroid lipofuscinosis (INCL), a severe neurodegenerative disorder. INCL is characterized by the accumulation of proteolipid storage material in brain and other tissues, suggesting that the disease is a consequence of abnormal catabolism of acylated proteins. In the current paper, we report the sequence of the human PPT cDNA and the structure of the human PPT gene. The cDNA predicts a protein of 306 amino acids that contains a 25-amino-acid signal peptide, threemore » N-linked glycosylation sites, and consensus motifs characteristic of thioesterases. Northern analysis of a human tissue blot revealed ubiquitous expression of a single 2.5-kb mRNA, with highest expression in lung, brain, and heart. The human PPT gene spans 25 kb and is composed of seven coding exons and a large eighth exon, containing the entire 3{prime}-untranslated region of 1388 bp. An Alu repeat and promoter elements corresponding to putative binding sites for several general transcription factors were identified in the 1060 nucleotides upstream of the transcription start site. The human PPT cDNA sequence and gene structure will provide the means for the identification of further causative mutations in INCL and facilitate genetic screening in selected high-risk populations. 31 refs., 5 figs., 1 tab.« less

Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.

1991-02-15

The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFImore » may have conserved only a subset of hIL-10 activities.« less

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.

PubMed

Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka

2008-04-01

The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.

Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

1992-01-01

We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

Screening and analyzing genes associated with Amur tiger placental development.

PubMed

Li, Q; Lu, T F; Liu, D; Hu, P F; Sun, B; Ma, J Z; Wang, W J; Wang, K F; Zhang, W X; Chen, J; Guan, W J; Ma, Y H; Zhang, M H

2014-09-26

The Amur tiger is a unique endangered species in the world, and thus, protection of its genetic resources is extremely important. In this study, an Amur tiger placenta cDNA library was constructed using the SMART cDNA Library Construction kit. A total of 508 colonies were sequenced, in which 205 (76%) genes were annotated and mapped to 74 KEGG pathways, including 29 metabolism, 29 genetic information processing, 4 environmental information processing, 7 cell motility, and 5 organismal system pathways. Additionally, PLAC8, PEG10 and IGF-II were identified after screening genes from the expressed sequence tags, and they were associated with placental development. These findings could lay the foundation for future functional genomic studies of the Amur tiger.

Cloning, expression, and mapping of allergenic determinants of alphaS1-casein, a major cow's milk allergen.

PubMed

Schulmeister, Ulrike; Hochwallner, Heidrun; Swoboda, Ines; Focke-Tejkl, Margarete; Geller, Beate; Nystrand, Mats; Härlin, Annika; Thalhamer, Josef; Scheiblhofer, Sandra; Keller, Walter; Niggemann, Bodo; Quirce, Santiago; Ebner, Christoph; Mari, Adriano; Pauli, Gabrielle; Herz, Udo; Valenta, Rudolf; Spitzauer, Susanne

2009-06-01

Milk is one of the first components introduced into human diet. It also represents one of the first allergen sources, which induces IgE-mediated allergies in childhood ranging from gastrointestinal, skin, and respiratory manifestations to severe life-threatening manifestations, such as anaphylaxis. Here we isolated a cDNA coding for a major cow's milk allergen, alphaS1-casein, from a bovine mammary gland cDNA library with allergic patients' IgE Abs. Recombinant alphaS1-casein was expressed in Escherichia coli, purified, and characterized by circular dichroism as a folded protein. IgE epitopes of alphaS1-casein were determined with recombinant fragments and synthetic peptides spanning the alphaS1-casein sequence using microarrayed components and sera from 66 cow's milk-sensitized patients. The allergenic activity of ralphaS1-casein and the alphaS1-casein-derived peptides was determined using rat basophil leukemia cells transfected with human FcepsilonRI, which had been loaded with the patients' serum IgE. Our results demonstrate that ralphaS1-casein as well as alphaS1-casein-derived peptides exhibit IgE reactivity, but mainly the intact ralphaS1-casein induced strong basophil degranulation. These results suggest that primarily intact alphaS1-casein or larger IgE-reactive portions thereof are responsible for IgE-mediated symptoms of food allergy. Recombinant alphaS1-casein as well as alphaS1-casein-derived peptides may be used in clinical studies to further explore pathomechanisms of food allergy as well as for the development of new diagnostic and therapeutic strategies for milk allergy.

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

PubMed

Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

2008-10-15

The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

[Role of phosphorylation of MARCKS-PSD in the secretion of MUC5AC induced by cold temperatures in human airway epithelial cells].

PubMed

Li, Minchao; Perelman, Juliy M; Zhou, Xiangdong

2012-05-01

To construct phosphorylation sites domain (PSD) mutant of myristoylated alaninerich C kinase substrate (MARCKS) and explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) and MARCKS in cold-induced synthesis and exocytosis of mucin (MUC) 5AC. Human placental cDNA was used as a template to amplify the full coding region of MARCKS cDNA by PCR. Ser159, Ser 163, Ser 167, Ser 170 in the PSD were mutated to aspartic acids by an overlap PCR method. The resultant PSD mutant cDNA and the wild-type MARCKS cDNA were each subcloned into a mammalian expression vector pcDNA3.0. Recombinant constructs were confirmed by restriction enzyme digestion analysis and DNA sequencing. In intervention experiments, cells were pretreated with the TRPM8 channel antagonist BCTC and transfected with MARCKS-PSD mutant cDNA, and thereafter cold stimulation was applied. The levels of MUC5AC were measured by immunofluorescence and ELISA to clarify the roles of TRPM8 and PSD mutant on the synthesis and secretion of MUC5AC induced by cold, respectively. Restriction enzyme digestion analysis and DNA sequencing revealed that the pcDNA3.0- MARCKS and pcDNA3.0-MARCKS-PSD mutants were successfully constructed. The levels of intracellular and secreted MUC5AC of cold treated group were significantly higher than those of control group (P<0.05). BCTC attenuated the cold-induced synthesis and secretion of MUC5AC when compared with cold treated group (P<0.05). Transfection of 16HBE cells with the MARCKS-PSD mutant cDNA resulted in significant inhibition of mucin secretion in response to cold, and significantly higher level of intracellular MUC5AC than that of control group (P<0.01), whereas transfection with the vector DNA or the wild-type MARCKS cDNA had no effect on the mucin synthesis and secretion in response to cold (P>0.05). TRPM8 and phosphorylation of MARCKS-PSD mediates the cold-induced exocytosis of MUC5AC by airway epithelial cells.

Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.

PubMed Central

Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I

1991-01-01

The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129

Targeting GPR110 in HER2-Overexpressing Breast Cancers

DTIC Science & Technology

2015-10-01

lentiviral plasmids containing GPR110 cDNA using the pHAGE system, which includes the HA tag, under the control of inducible Tet-on promoter. The map of... pHAGE lentiviral plasmid is shown in Figure 3A. Using this, the BT474 and SKBR3 parental cells were stably infected with the lentiviral plasmid...in HER2+ breast cancer. Figure𔃽.’GPR110/overexpression’using’pHAGE’len:viral’mediated’infec:on’of’BT474’cells.’ A.#Map#of# pHAGE # len/viral

Demonstration of GTG as an endogenous initiation codon for a human mRNA transcript revealed by molecular cloning of the serpin endopin 2B.

PubMed

Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill; Hook, Vivian Y H

2004-08-16

This study demonstrates utilization of the novel GTG initiation codon for translation of a human mRNA transcript that encodes the serpin endopin 2B, a protease inhibitor. Molecular cloning revealed the nucleotide sequence of the human endopin 2B cDNA. Its deduced primary sequence shows high homology to bovine endopin 2A that possesses cross-class protease inhibition of elastase and papain. Notably, the human endopin 2B cDNA sequence revealed GTG as the predicted translation initiation codon; the predicted translation product of 46 kDa endopin 2B was produced by in vitro translation of 35S-endopin 2B with mammalian (rabbit) protein translation components. Importantly, bioinformatic studies demonstrated the presence of the entire human endopin 2B cDNA sequence with GTG as initiation codon within the human genome on chromosome 14. Further evidence for GTG as a functional initiation codon was illustrated by GTG-mediated in vitro translation of the heterologous protein EGFP, and by GTG-mediated expression of EGFP in mammalian PC12 cells. Mutagenesis of GTG to GTC resulted in the absence of EGFP expression in PC12 cells, indicating the function of GTG as an initiation codon. In addition, it was apparent that the GTG initiation codon produces lower levels of translated protein compared to ATG as initiation codon. Significantly, GTG-mediated translation of endopin 2B demonstrates a functional human gene product not previously predicted from initial analyses of the human genome. Further analyses based on GTG as an alternative initiation codon may predict new candidate genes of the human genome.

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE PAGES

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.; ...

2015-01-14

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

PubMed

Huang, Shengbing; Song, Wei; Lin, Qishui

2005-08-01

A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

Isolation and expression of homeobox genes from the embryonic chicken eye.

PubMed

Dhawan, R R; Schoen, T J; Beebe, D C

1997-06-11

To identify homeobox-containing genes that may play a role in the differentiation of ocular tissues. Total RNA was isolated from microdissected chicken embryo eye tissues at 3.5 days of development (embryonic day 3.5; E3.5). An "anchor-oligo-dT primer" was used for the synthesis of cDNA. Degenerate oligonucleotides designed from highly-conserved sequences in the third helix of the homeobox and the "anchor-primer" were used to amplify cDNAs by polymerase chain reaction (PCR). PCR products were cloned and sequenced. The spatial and temporal expression of selected transcripts was mapped by whole-mount in situ hybridization and northern blot analysis. After sequencing eighteen clones we identified a member of the distal-less family (dlx-3) in cDNA from presumptive neural retina and three chicken homologs of the Xenopus "anterior neural fold" (Xanf-1) in cDNA from anterior eye tissue. Dlx transcripts were mapped by in situ hybridization. Expression began at Hamburger and Hamilton stage 14 (E2.5) and was widely distributed in embryonic mesenchyme on E3 and E4. Expression increased in the retina during early development and persisted until after hatching. The one anf clone selected for further study was not detected by in situ or northern blot analysis. It is feasible to isolate homeobox cDNAs directly from microdissected embryonic tissues. Chicken dlx-3 mRNA has a wider distribution in the embryo than expected, based on the expression of the mouse homolog. Dlx-3 may play a role in establishing or maintaining the differentiation of the retina.

Construction of a cDNA library for miniature pig mandibular deciduous molars

PubMed Central

2014-01-01

Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

PubMed

Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

1994-03-01

Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

Cross-species transferability and mapping of genomic and cDNA SSRs in pines

Treesearch

D. Chagne; P. Chaumeil; A. Ramboer; C. Collada; A. Guevara; M. T. Cervera; G. G. Vendramin; V. Garcia; J-M. Frigerio; Craig Echt; T. Richardson; Christophe Plomion

2004-01-01

Two unigene datasets of Pinus taeda and Pinus pinaster were screened to detect di-, tri and tetranucleotide repeated motifs using the SSRIT script. A total of 419 simple sequence repeats (SSRs) were identified, from which only 12.8% overlapped between the two sets. The position of the SSRs within the coding sequence were predicted...

Partial DNA sequencing of Douglas-fir cDNAs used in RFLP mapping

Treesearch

K.D. Jermstad; D.L. Bassoni; C.S. Kinlaw; D.B. Neale

1998-01-01

DNA sequences from 87 Douglas-fir (Pseudotsuga menziesii [Mirb.] Franco) cDNA RFLP probes were determined. Sequences were submitted to the GenBank dbEST database and searched for similarity against nucleotide and protein databases using the BLASTn and BLASTx programs. Twenty-one sequences (24%) were assigned putative functions; 18 of which...

Genotypic variation in sulfur assimilation and metabolism of onion (Allium cepa L.) III. Characterization of sulfite reductase

USDA-ARS?s Scientific Manuscript database

Genomic and cDNA sequences corresponding to a ferredoxin-sulfite reductase (SiR) have been cloned from bulb onion (Allium cepa L.) and the expression of the gene and activity of the enzyme characterised with respect to sulfur (S) supply. Cloning, mapping and expression studies revealed that onion ha...

Characterization of the human pH- and PKA-activated ClC-2G(2 alpha) Cl- channel.

PubMed

Sherry, A M; Stroffekova, K; Knapp, L M; Kupert, E Y; Cuppoletti, J; Malinowska, D H

1997-08-01

A ClC-2G(2 alpha) Cl- channel was identified to be present in human lung and stomach, and a partial cDNA for this Cl- channel was cloned from a human fetal lung library. A full-length expressible human ClC-2G(2 alpha) cDNA was constructed by ligation of mutagenized expressible rabbit ClC-2G(2 alpha) cDNA with the human lung ClC-2G(2 alpha) cDNA, expressed in oocytes, and characterized at the single-channel level. Adenosine 3',5'-cyclic monophosphate-dependent protein kinase (PKA) treatment increased the probability of opening of the channel (Po). After PKA activation, the channel exhibited a linear (r = 0.99) current-voltage curve with a slope conductance of 22.1 +/- 0.8 pS in symmetric 800 mM tetraethylammonium chloride (TEACl; pH 7.4). Under fivefold gradient conditions of TEACl, a reversal potential of +21.5 +/- 2.8 mV was measured demonstrating anion-to-cation discrimination. As previously demonstrated for the rabbit ClC-2G(2 alpha) Cl- channel, the human analog, hClC-2G(2 alpha), was active at pH 7.4 as well as when the pH of the extracellular face of the channel (trans side of the bilayer; pHtrans) was asymmetrically reduced to pH 3.0. The extent of PKA activation was dependent on pHtrans. With PKA treatment, Po increased fourfold with a pHtrans of 7.4 and eightfold with a pHtrans of 3.0. Effects of sequential PKA addition followed by pHtrans reduction on the same channel suggested that the PKA- and pH-dependent increases in channel Po were separable and cumulative. Northern analysis showed ClC-2G(2 alpha) mRNA to be present in human adult and fetal lung and adult stomach, and quantitative reverse transcriptase-polymerase chain reaction showed this channel to be present in the adult human lung and stomach at about one-half the level found in fetal lung. The findings of the present study suggest that the ClC-2G(2 alpha) Cl- channel may play an important role in Cl- transport in the fetal and adult human lung.

Characterization and chromosomal localization of the gene for human rhodopsin kinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khani, S.C.; Yamamoto, S.; Dryja, T.P.

1996-08-01

G-protein-dependent receptor kinases (GRKs) play a key role in the adapatation of receptors to persistent stimuli. In rod photoreceptors rhodopsin kinase (RK) mediates rapid densensitization of rod photoreceptors to light by catalyzing phosphorylation of the visual pigment rhodopsin. To study the structure and mechanism of FRKs in human photoreceptors, we have isolated and characterized cDNA and genomic clones derived from the human RK locus using a bovine rhodopsin kinase cDNA fragment as a probe. The RK locus, assigned to chromosome 13 band q34, is composed of seven exons that encode a protein 92% identical in amino acid sequence to bovinemore » rhodopsin kinase. The marked difference between the structure of this gene and that of another recently clone human GRK gene suggests the existence of a wide evolutionary gap between members of the GRK gene family. 39 refs., 3 figs.« less

Localization of human coagulation factor VIII (hFVIII) in transgenic rabbit by FISH-TSA: identification of transgene copy number and transmission to the next generation.

PubMed

Krylov, V; Tlapáková, T; Mácha, J; Curlej, J; Ryban, L; Chrenek, P

2008-01-01

For chromosomal localization of the hFVIII human transgene in F2 and F3 generation of transgenic rabbits, FISH-TSA was applied. A short cDNA probe (1250 bp) targeted chromosomes 3, 7, 8, 9 and 18 of an F2 male (animal 1-3-8). Two transgenic offspring (F3) revealed signal positions in chromosome 3 and chromosomes 3 and 7, respectively. Sequencing and structure analysis of the rabbit orthologous gene revealed high similarity to its human counterpart. Part of the sequenced cDNA (1310 bp) served as a probe for FISH-TSA analysis. The rabbit gene was localized in the q arm terminus of the X chromosome. This result is in agreement with reciprocal chromosome painting between the rabbit and the human. The presented FISH-TSA method provides strong signals without any interspecies reactivity.

Transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to gelatin.

PubMed

Kubo, Miyoko; Clark, Richard A F; Katz, Anne B; Taichman, Lorne B; Jin, Zaishun; Zhao, Ying; Moriguchi, Takahiko

2007-04-01

alphavbeta3 is a multiligand integrin receptor that interacts with fibrinogen (FG), fibrin (FB), fibronectin (FN), vitronectin (VN), and denatured collagen. We previously reported that cultured normal human keratinocytes, like in vivo keratinocytes, do not express alphavbeta3 on the cell surface, and do not adhere to and migrate on FG and FB. Furthermore, we reported that human keratinocytes transduced with beta3 integrin subunit cDNA by a retrovirus-mediated transduction method express alphavbeta3 on the cell surface and adhere to FG, FB, FN, and VN significantly compared with beta-galactosidase (beta-gal) cDNA-transduced keratinocytes (control). In this study, we determined whether these beta3 integrin subunit cDNA-transduced keratinocytes or normal human keratinocytes adhere to denatured collagen (gelatin) using a 1 h cell adhesion assay. beta3 cDNA-transduced keratinocytes adhered to gelatin, whereas no significant adhesion was observed with the control cells (beta-gal cDNA-transduced keratinocytes and normal human keratinocytes). The adhesion to gelatin was inhibited by LM609, a monoclonal antibody to alphavbeta3, and RGD peptides but not by normal mouse IgG1 nor RGE peptides. Thus, transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to denatured collagen (gelatin) as well as to FG, FB, VN, and FN. Otherwise, normal human keratinocytes do not adhere to gelatin. These data support the idea that beta3 cDNA-transduced human keratinocytes can be a good material for cultured epithelium to achieve better take rate with acute or chronic wounds, in which FG, FB, and denatured collagen are abundantly present.

Sulfation of minoxidil by multiple human cytosolic sulfotransferases.

PubMed

Anderson, R J; Kudlacek, P E; Clemens, D L

1998-02-20

Minoxidil is an antihypertensive agent and hair growth promoter that is metabolized by sulfation to the active compound, minoxidil sulfate. Thermostable phenol sulfotransferase (TS PST or P-PST) was initially thought to catalyze the reaction, and the enzyme was designated minoxidil sulfotransferase (MNX-ST). Information about human ST activities toward minoxidil would be useful in developing the capacity to predict individual responses to minoxidil based on tissue levels of STs. Therefore, human STs were studied from platelet homogenates, partially purified platelets, scalp skin high speed supernatants and COS-1 cell cDNA expressed preparations using a radiochemical enzymatic assay with minoxidil as the substrate. Studies showed the presence of TS PST, TL (thermolabile) PST and MNX-ST activities in human scalp skin. Biochemical properties and correlation studies suggested that in addition to TS PST, the TL PST activity, another ST activity or both were involved in the reaction. Partially purified human platelet TL PST tested with minoxidil and dopamine showed identical thermal stabilities and similar responses to the inhibitors 2,6-dichloro-4-nitrophenol (DCNP) and NaCl. To characterize the activity of TL PST toward minoxidil, several biochemical properties of the enzyme expressed from a human liver cDNA clone were investigated. When assayed with minoxidil and dopamine, thermal stabilities of the expressed enzyme were identical and IC50 values for the inhibitors DCNP and NaCl were similar. It was also demonstrated that cDNA encoded human liver dehydroepiandrosterone sulfotransferase and estrogen sulfotransferase contributed to the sulfation of minoxidil. The results confirm that at least four human STs contribute to minoxidil sulfation. MNX-ST activity represents a combination of ST activities. The data indicate that multiple ST activities should be taken into account in attempts to predict the regulation of minoxidil sulfation and individual responses to minoxidil.

Identification and characterization of a new multigene family in the human MHC: A candidate autoimmune disease susceptibility element (3.8-1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, J.M.; Venditti, C.P.; Chorney, M.J.

1994-09-01

An association between idiopathic hemochromatosis (HFE) and the HLA-A3 locus has been previously well-established. In an attempt to identify potential HFE candidate genes, a genomic DNA fragment distal to the HLA-A9 breakpoint was used to screen a B cell cDNA library; a member (3.8-1) of a new multigene family, composed of five distinct genomic cross-reactive fragments, was identified. Clone 3.8-1 represents the 3{prime} end of 9.6 kb transcript which is expressed in multiple tissues including the spleen, thymus, lung and kidney. Sequencing and genome database analysis indicate that 3.8-1 is unique, with no homology to any known entries. The genomicmore » residence of 3-8.1, defined by polymorphism analysis and physical mapping using YAC clones, appears to be absent from the genomes of higher primates, although four other cross-reactivities are maintained. The absence of this gene as well as other probes which map in the TNF to HLA-B interval, suggest that this portion of the human HMC, located between the Class I and Class III regions, arose in humans as the result of a post-speciation insertional event. The large size of the 3.8-1 gene and the possible categorization of 3.8-1 as a human-specific gene are significant given the genetic data that place an autoimmune susceptibility element for IDDM and myasthenia gravis in the precise region where this gene resides. In an attempt to isolate the 5{prime} end of this large transcript, we have constructed a cosmid contig which encompasses the genomic locus of this gene and are progressively isolating coding sequences by exon trapping.« less

Prediction of constitutive A-to-I editing sites from human transcriptomes in the absence of genomic sequences

PubMed Central

2013-01-01

Background Adenosine-to-inosine (A-to-I) RNA editing is recognized as a cellular mechanism for generating both RNA and protein diversity. Inosine base pairs with cytidine during reverse transcription and therefore appears as guanosine during sequencing of cDNA. Current approaches of RNA editing identification largely depend on the comparison between transcriptomes and genomic DNA (gDNA) sequencing datasets from the same individuals, and it has been challenging to identify editing candidates from transcriptomes in the absence of gDNA information. Results We have developed a new strategy to accurately predict constitutive RNA editing sites from publicly available human RNA-seq datasets in the absence of relevant genomic sequences. Our approach establishes new parameters to increase the ability to map mismatches and to minimize sequencing/mapping errors and unreported genome variations. We identified 695 novel constitutive A-to-I editing sites that appear in clusters (named “editing boxes”) in multiple samples and which exhibit spatial and dynamic regulation across human tissues. Some of these editing boxes are enriched in non-repetitive regions lacking inverted repeat structures and contain an extremely high conversion frequency of As to Is. We validated a number of editing boxes in multiple human cell lines and confirmed that ADAR1 is responsible for the observed promiscuous editing events in non-repetitive regions, further expanding our knowledge of the catalytic substrate of A-to-I RNA editing by ADAR enzymes. Conclusions The approach we present here provides a novel way of identifying A-to-I RNA editing events by analyzing only RNA-seq datasets. This method has allowed us to gain new insights into RNA editing and should also aid in the identification of more constitutive A-to-I editing sites from additional transcriptomes. PMID:23537002

Molecular cloning and chromosomal localization of a pseudogene related to the human Acyl-CoA binding protein/diazepam binding inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gersuk, V.H.; Rose, T.M.; Todaro, G.J.

The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

PubMed

Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

2016-08-24

To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

The human mu opioid receptor: modulation of functional desensitization by calcium/calmodulin-dependent protein kinase and protein kinase C.

PubMed

Mestek, A; Hurley, J H; Bye, L S; Campbell, A D; Chen, Y; Tian, M; Liu, J; Schulman, H; Yu, L

1995-03-01

Opioids are some of the most efficacious analgesics used in humans. Prolonged administration of opioids, however, often causes the development of drug tolerance, thus limiting their effectiveness. To explore the molecular basis of those mechanisms that may contribute to opioid tolerance, we have isolated a cDNA for the human mu opioid receptor, the target of such opioid narcotics as morphine, codeine, methadone, and fentanyl. The receptor encoded by this cDNA is 400 amino acids long with 94% sequence similarity to the rat mu opioid receptor. Transient expression of this cDNA in COS-7 cells produced high-affinity binding sites to mu-selective agonists and antagonists. This receptor displays functional coupling to a recently cloned G-protein-activated K+ channel. When both proteins were expressed in Xenopus oocytes, functional desensitization developed upon repeated stimulation of the mu opioid receptor, as observed by a reduction in K+ current induced by the second mu receptor activation relative to that induced by the first. The extent of desensitization was potentiated by both the multifunctional calcium/calmodulin-dependent protein kinase and protein kinase C. These results demonstrate that kinase modulation is a molecular mechanism by which the desensitization of mu receptor signaling may be regulated at the cellular level, suggesting that this cellular mechanism may contribute to opioid tolerance in humans.

Efficacy of vaccination with plasmid DNA encoding for HER2/neu or HER2/neu-eGFP fusion protein against prostate cancer in rats.

PubMed

Bhattachary, R; Bukkapatnam, R; Prawoko, I; Soto, J; Morgan, M; Salup, R R

2002-05-01

Despite early diagnosis and improved therapy, 31,500 men will die from prostate cancer (PC) this year. The HER2/neu oncoprotein is an important effector of cell growth found in the majority of high-grade prostatic tumors and is capable of rendering immunogenicity. The antigenicity of this oncoprotein might prove useful in the development of PC vaccines. Our goal is to prove the principle that a single DNA vaccine can provide reliable immunity against PC in the MatLyLu (MLL) translational tumor model. The parental rat MatLyLu PC cell line expresses low to moderate levels of the rat neu protein. To simulate in vivo human PC, MatLyLu cells were transfected with a truncated sequence of human HER2/neu cDNA cloned into the pCI-neo vector. This HER2/neu cDNA sequence encodes the first 433 amino acids of the extracellular domain (ECD). MatLyLu cells were also transfected with the same HER2/neu cDNA sequence cloned into the N1-terminal sequence of EGFP reporter gene to produce a fusion protein. The partial ECD sequence of HER2/neu includes five rat major histocompatibility (MHC)-II-restricted peptides with complete human-to-rat cross-species homology. The HER2/neu protein overexpression was documented by Western Blot analysis, and the expression of fusion protein was monitored by confocal microscopy and fluorimetry. Vaccination with a single injection of HER2/neu cDNA protected 50% of animals against HER2/neu-MatLyLu tumors (P < 0.01). When the tumor cells were engineered to express HER2/neu-EGFP fusion protein, the antitumor immunity was enhanced, as following vaccination with HER2/neu-EGFP cDNA, 80% of these rats rejected HER2/neu-EGFP-MatLyLu (P<0.001). Both vaccines induced HER2/neu-specific antibody titers. Rats vaccinated with EGFP-cDNA rejected 80% of EGFP-MatLyLu tumors and, interestingly, 40% of HER2/neu-MatLyLu tumors. None of the cDNA vaccines induced immunity against parental MatLyLu cells. Our data clearly demonstrate that a single injection of HER2/neu-EGFP cDNA is a very effective vaccine against PC tumors expressing the cognate tumor-associated antigen (TA). The antitumor immunity is significantly more pronounced if the tumors express xenogeneic HER2/neu-EGFP fusion protein as opposed to only the syngeneic HER2/neu oncoprotein. Our data suggests that the HER2/neu-EGFP-MatLyLu tumor is a potential animal tumor model for investigating therapeutic vaccine strategies against PC in vivo and demonstrates the limitations of a cDNA vaccine only encoding for MHC-II-restricted HER2/neu-ECD sequence peptides.

An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

PubMed Central

Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

2015-01-01

The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

1991-05-01

The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

Molecular cloning and characterization of an SRCAP chromatin remodeling homologue in Toxoplasma gondii.

PubMed

Sullivan, William J; Monroy, M Alexandra; Bohne, Wolfgang; Nallani, Karuna C; Chrivia, John; Yaciuk, Peter; Smith, Charles K; Queener, Sherry F

2003-05-01

We have identified and mapped a gene in Toxoplasma gondii that encodes a homologue of SRCAP (Snf2-related CBP activator protein), a member of the SNF/SWI family of chromatin remodeling factors. The genomic locus (TgSRCAP) is present as a single copy and contains 16 introns. The predicted cDNA contains an open reading frame of 8,775 bp and encodes a protein of 2,924 amino acids. We have identified additional SRCAP-like sequences in Apicomplexa for comparison by screening genomic databases. An analysis of SRCAP homologues between species reveals signature features that may be indicative of SRCAP members. Expression of mRNA encoding TgSRCAP is upregulated when tachyzoite (invasive form) parasites are induced to differentiate into bradyzoites (encysted form) in vitro. Recombinant TgSRCAP protein is functionally equivalent to the human homologue, being capable of increasing transcription mediated by CREB.

Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

PubMed Central

Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

1996-01-01

Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.

PubMed

Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo

2014-01-01

To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

cDNA cloning, tissue distribution, and chromosomal localization of myelodysplasia/myeloid leukemia factor 2 (MLF2).

PubMed

Kuefer, M U; Look, A T; Williams, D C; Valentine, V; Naeve, C W; Behm, F G; Mullersman, J E; Yoneda-Kato, N; Montgomery, K; Kucherlapati, R; Morris, S W

1996-07-15

A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, the MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal region frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements.

Extremely High Peak Power Pulsed RF and UWB EMR Effects on Genomic Transcription - Microarray Assessment

DTIC Science & Technology

2008-06-26

Homo sapiens decorin variant C mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA...mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA sequence. 2.076 SEC23B...RAS oncogene family ; RAB33B, member RAS oncogene family 205300_s_at 0.37 U1SNRNPBP U11/U12 snRNP 35K 220728_at 0.349 218689_at 0.342 FANCF Fanconi

[Effects of adenoviral vector containing human angiotensin II type 1 receptor antisense cDNA on biological action of human pulmonary artery smooth muscle cells].

PubMed

Tu, Ming-li; Wang, Han-qin; Lei, Huai-ding; Luo, Guo-shi; Liu, Xian-jun; Liu, Wei-shun; Xiong, Chang; Liu, Yu-quan; Ren, Si-qun

2005-04-01

To investigate the effect of human angiotensin II (AngII) type 1 receptor (AT(1)R) antisense cDNA (ahAT(1)) on migration, proliferation, and apoptosis of cultured human pulmonary artery smooth muscle cells (PASMC). Two recombinant adenoviral vectors, AdCMVahAT(1) containing full length antisense cDNA targeting to human AT(1)R mRNA, and AdCMVLacZ containing LacZ, were constructed by orientation clone technology and homologous recombination. The PASMC was divided into 3 groups (DMEM, AdCMVLacZ, AdCMVahAT(1)) and different interventions were given to different groups. AT(1)R expression was detected by RT-PCR and immunohistochemistry method; migration of PASMC was measured by Boyden's Chamer method. Other PASMC was divided into 4 groups (DMEM, AngII, AdCMVLacZ + AngII and AdCMVahAT(1) + AngII), and only the last 2 groups were respectively transfected with AdCMVLacZ and AdCMVahAT(1) before administration of AngII. From 6 h to 96 h after stimulation by AngII (10(-7) mol/L), proliferation index (PI) and apoptosis of PASMC were determined by flow cytometry. At the 48 h the level of AT(1)R mRNA was significantly less in PASMC transfected AdCMVahAT(1) than that in group DMEM and in group AdCMVLacZ. The protein level showed a same difference (P < 0.01). At 24 h the migration distance of PASMC also was significantly less in group AdCMVahAT(1) than that in group DMEM and Group AdCMVLacZ (P < 0.01). Stimulated by AngII for 48 h, in group AngII the PI of PASMC markedly increased (P < 0.01 vs group DMEM). But in Group AdCMVahAT(1) + AngII PI of PASMC clearly decreased (P < 0.01 vs group AngII and group DMEM respectively). There was no statistic difference of PI between group AdCMVLacZ + AngII and group AngII. Moreover, apoptosis peak emerged only in group AdCMVahAT(1) + AngII. The rate of apoptosis in those PASMC used AdCMVahAT(1) and AngII was 24.70 +/- 4.04 (P < 0.01 vs the other 3 groups respectively). These results indicate that AngII stimulates proliferation via AT(1) receptors in human PASMC, and antisense cDNA targeting to human AT(1)R transfection mediated by adenoviral vector has powerful inhibitory effects on AngII-induced migration and proliferation of human PASMC by attenuating AT(1)R mRNA and protein expression. Also, it can promote apoptosis of human PASMC. That demonstrate that AT(1)R antisense cDNA is a potent inhibitors of the actions of AngII on PASMC. Antisense inhibition targeting to AT(1)R has therapeutic potential for the treatment of pulmonary vascular diseases.

Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

NASA Astrophysics Data System (ADS)

Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

1995-12-01

Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

Chromosomal localization of actin genes in the malaria mosquito Anopheles darlingi

PubMed Central

BRIDI, L. C.; SHARAKHOVA, M. V.; SHARAKHOV, I. V.; CORDEIRO, J.; AZEVEDO, G. M.; TADEI, W. P.; RAFAEL, M. S.

2012-01-01

Physical and genetic maps have been used for chromosomal localization of genes in vectors of infectious diseases. The availability of polytene chromosomes in malaria mosquitoes provides a unique opportunity to precisely map genes of interest. We report physical mapping of two actin genes on polytene chromosomes of the major malaria vector in Amazon Anopheles darlingi. The clones with the actin genes sequences were obtained from a cDNA library constructed from RNA isolated from adult females and males of An. darlingi. Each of the two clones was mapped to a unique site on the chromosomal arm 2L in subdivisions 21A (clone pl05-A04) and 23B (clone pl17-G06). The obtained results together with previous mapping data provide a suitable basis for comparative genomics and for establishing chromosomal homologies among major malaria vectors. PMID:22804344

alpha-Mannosidosis in the guinea pig: cloning of the lysosomal alpha-mannosidase cDNA and identification of a missense mutation causing alpha-mannosidosis.

PubMed

Berg, Thomas; Hopwood, John J

2002-03-16

alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.

cDNA cloning of an intracellular form of the human interleukin 1 receptor antagonist associated with epithelium.

PubMed Central

Haskill, S; Martin, G; Van Le, L; Morris, J; Peace, A; Bigler, C F; Jaffe, G J; Hammerberg, C; Sporn, S A; Fong, S

1991-01-01

A cDNA encoding a receptor antagonist of interleukin 1 (IL-1ra), secreted from human monocytes, has recently been isolated and sequenced [Eisenberg, S. P., Evans, R. J., Arend, W. P., Verderber, E., Brewer, M. T., Hannum, C. H. & Thompson, R. C. (1990) Nature (London) 343, 341-346]. We have identified another version of this IL-1ra, which is predominantly expressed in epithelial cells. This IL-1ra lacks a leader sequence and, thus, is probably intracellular. Both proteins are derived from the same gene through use of an alternative transcriptional start site and internal splice-acceptor site. Expression of intracellular IL-1ra cDNA in COS cells demonstrated that the intracellular product specifically inhibited exogenous interleukin 1-dependent responses. Keratinocytes were shown to contain significant amounts of nonsecreted IL-1ra protein. Constitutive expression of the intracellular IL-1ra may be an intracellular defensive mechanism in exposed epithelial cells and/or may serve to regulate autocrine interleukin 1-mediated pathways of differentiation. Images PMID:1827201

Cloning of human cDNA encoding a novel heptahelix receptor expressed in Burkitt's lymphoma and widely distributed in brain and peripheral tissues.

PubMed

Owman, C; Blay, P; Nilsson, C; Lolait, S J

1996-11-12

Using PCR with degenerate primers and screening of a human B-cell lymphoblast cDNA library, a full-length cDNA encoding a 375-amino-acid protein was isolated. It contains seven regions of hydrophobic amino acids probably representing membrane-spanning domains of a novel heptahelix receptor, tentatively named CMKRL2. It shows nearly 30% overall identity with the high-affinity IL8 receptor and similar degree of homology with other chemoattractant receptors, including the "fusin" coreceptors for HIV1. Measurements of various transduction pathways following application of a panel of chemokines to transfected cells failed to evoke any reproducible response. Although the natural ligand for CMKRL2 could, thus, not be identified, receptor expression in spleen and lymph nodes as well as in Burkitt's lymphoma (irrespective of EBV status) supports a functional role in activated B-cells. Receptor message was ubiquitously distributed in normal peripheral tissues and CNS, suggesting that CMKRL2 is expressed in widespread cell populations, such as macrophages and neuroglia.

Microarray-Based Mapping for the Detection of Molecular Markers in Response to Aspergillus flavus Infection in Susceptible and Resistant Maize Lines

USDA-ARS?s Scientific Manuscript database

The objectives of this study were (1) to evaluate differential gene expression levels for resistance to A. flavus kernel infection in susceptible (Va35) and resistant (Mp313E) maize lines using Oligonucleotide and cDNA microarray analysis, (2) to evaluate differences in A. flavus accumulation betwee...

Towards isolation of the gene for X-linked retinitis pigmentosa (RP3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dry, K.L.; Aldred, M.A.; Hardwick, L.J.

1994-09-01

Until recently the region of interest containing the gene for X-linked retinitis pigmentosa (RP3) was thought to lie between CYBB (Xp21.1) and the proximal end of the deletion in patient BB (JBBprox). This region was thought to span 100-150 kb. Here we present new mapping data to show that the distance between the 5{prime} (most proximal) end of CYBB and JBBprox is only 50 kb. Recently Roux et al. (1994) have described the isolation of a gene within this region but this showed no disease-associated changes. Further evidence from mapping the deletion in patient NF (who suffered from McLead`s syndromemore » and CGD but not RP) and from linkage analysis of our RP3 families with a new dinucleotide repeat suggests that the gene must extend proximally from JBBprox. In order to extend the region of search we have constructed a YAC contig spanning 800 kb to OTC. We are continuing our search for the RP3 gene using a variety of strategies including exon trapping and cDNA enrichment as well as direct screening of cDNA libraries with subclones from this region.« less

Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

PubMed Central

Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

1999-01-01

Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

cDNA Cloning, Expression Pattern, and Chromosomal Localization of Mlf1, Murine Homologue of a Gene Involved in Myelodysplasia and Acute Myeloid Leukemia

PubMed Central

Hitzler, Johann K.; Witte, David P.; Jenkins, Nancy A.; Copeland, Neal G.; Gilbert, Debra J.; Naeve, Clayton W.; Look, A. Thomas; Morris, Stephan W.

1999-01-01

The NPM-MLF1 fusion protein is expressed in blasts from patients with myelodysplasia/acute myeloid leukemia (MDS/AML) containing the t(3;5) chromosomal rearrangement. Nucleophosmin (NPM), a previously characterized nucleolar phosphoprotein, contributes to two other fusion proteins found in lympho-hematopoietic malignancies, anaplastic large cell lymphoma (NPM-ALK) and acute promyelocytic leukemia (NPM-RARα). By contrast, the function of the carboxy-terminal fusion partner, myelodysplasia/myeloid leukemia factor 1 (MLF1), is unknown. To aid in understanding normal MLF1 function, we isolated the murine cDNA, determined the chromosomal localization of Mlf1, and defined its tissue expression by in situ hybridization. Mlf1 was highly similar to its human homologue (86% and 84% identical nucleotide and amino acid sequence, respectively) and mapped to the central region of chromosome 3, within a segment lacking known mouse mutations. Mlf1 tissue distribution was restricted during both development and postnatal life, with high levels present only in skeletal, cardiac, and selected smooth muscle, gonadal tissues, and rare epithelial tissues including the nasal mucosa and the ependyma/choroid plexus in the brain. Mlf1 transcripts were undetectable in the lympho-hematopoietic organs of both the embryonic and adult mouse, suggesting that NPM-MLF1 contributes to the genesis of MDS/AML in part by enforcing the ectopic overexpression of MLF1 within hematopoietic tissues. PMID:10393836

De novo amplification within a silent human cholinesterase gene in a family subjected to prolonged exposure to organophosphorus insecticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Dreyfus, P.; Soreq, H.

1989-01-01

A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genesmore » in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor.« less

Role of cytochrome P450 IA2 in acetanilide 4-hydroxylation as determined with cDNA expression and monoclonal antibodies.

PubMed

Liu, G; Gelboin, H V; Myers, M J

1991-02-01

The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.

Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

PubMed

Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

2015-10-26

Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

Four subunits that are shared by the three classes of RNA polymerase are functionally interchangeable between Homo sapiens and Saccharomyces cerevisiae.

PubMed Central

Shpakovski, G V; Acker, J; Wintzerith, M; Lacroix, J F; Thuriaux, P; Vigneron, M

1995-01-01

Four cDNAs encoding human polypeptides hRPB7.0, hRPB7.6, hRPB17, and hRPB14.4 (referred to as Hs10 alpha, Hs10 beta, Hs8, and Hs6, respectively), homologous to the ABC10 alpha, ABC10 beta, ABC14.5, and ABC23 RNA polymerase subunits (referred to as Sc10 alpha, Sc10 beta, Sc8, and Sc6, respectively) of Saccharomyces cerevisiae, were cloned and characterized for their ability to complement defective yeast mutants. Hs10 alpha and the corresponding Sp10 alpha of Schizosaccharomyces pombe can complement an S. cerevisiae mutant (rpc10-delta::HIS3) defective in Sc10 alpha. The peptide sequences are highly conserved in their carboxy-terminal halves, with an invariant motif CX2CX12RCX2CGXR corresponding to a canonical zinc-binding domain. Hs10 beta, Sc10 beta, and the N subunit of archaeal RNA polymerase are homologous. An invariant CX2CGXnCCR motif presumably forms an atypical zinc-binding domain. Hs10 beta, but not the archaeal subunit, complemented an S. cerevisiae mutant (rpb10-delta 1::HIS3) lacking Sc10 beta. Hs8 complemented a yeast mutant (rpb8-delta 1::LYS2) defective in the corresponding Sc8 subunit, although with a strong thermosensitive phenotype. Interspecific complementation also occurred with Hs6 and with the corresponding Dm6 cDNA of Drosophila melanogaster. Hs6 cDNA and the Sp6 cDNA of S. pombe are dosage-dependent suppressors of rpo21-4, a mutation generating a slowly growing yeast defective in the largest subunit of RNA polymerase II. Finally, a doubly chimeric S. cerevisiae strain bearing the Sp6 cDNA and the human Hs10 beta cDNA was also viable. No interspecific complementation was observed for the human hRPB25 (Hs5) homolog of the yeast ABC27 (Sc5) subunit. PMID:7651387

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

PubMed

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

PubMed Central

2013-01-01

Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

A large-scale full-length cDNA analysis to explore the budding yeast transcriptome

PubMed Central

Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi

2006-01-01

We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987

Production of Human Albumin in Pigs Through CRISPR/Cas9-Mediated Knockin of Human cDNA into Swine Albumin Locus in the Zygotes.

PubMed

Peng, Jin; Wang, Yong; Jiang, Junyi; Zhou, Xiaoyang; Song, Lei; Wang, Lulu; Ding, Chen; Qin, Jun; Liu, Liping; Wang, Weihua; Liu, Jianqiao; Huang, Xingxu; Wei, Hong; Zhang, Pumin

2015-11-12

Precise genome modification in large domesticated animals is desirable under many circumstances. In the past it is only possible through lengthy and burdensome cloning procedures. Here we attempted to achieve that goal through the use of the newest genome-modifying tool CRISPR/Cas9. We set out to knockin human albumin cDNA into pig Alb locus for the production of recombinant human serum albumin (rHSA). HSA is a widely used human blood product and is in high demand. We show that homologous recombination can occur highly efficiently in swine zygotes. All 16 piglets born from the manipulated zygotes carry the expected knockin allele and we demonstrated the presence of human albumin in the blood of these piglets. Furthermore, the knockin allele was successfully transmitted through germline. This success in precision genomic engineering is expected to spur exploration of pigs and other large domesticated animals to be used as bioreactors for the production of biomedical products or creation of livestock strains with more desirable traits.

Minimap2: pairwise alignment for nucleotide sequences.

PubMed

Li, Heng

2018-05-10

Recent advances in sequencing technologies promise ultra-long reads of ∼100 kilo bases (kb) in average, full-length mRNA or cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in length. Existing alignment programs are unable or inefficient to process such data at scale, which presses for the development of new alignment algorithms. Minimap2 is a general-purpose alignment program to map DNA or long mRNA sequences against a large reference database. It works with accurate short reads of ≥ 100bp in length, ≥1kb genomic reads at error rate ∼15%, full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely related full chromosomes of hundreds of megabases in length. Minimap2 does split-read alignment, employs concave gap cost for long insertions and deletions (INDELs) and introduces new heuristics to reduce spurious alignments. It is 3-4 times as fast as mainstream short-read mappers at comparable accuracy, and is ≥30 times faster than long-read genomic or cDNA mappers at higher accuracy, surpassing most aligners specialized in one type of alignment. https://github.com/lh3/minimap2. hengli@broadinstitute.org.

Expressed sequence tag analysis of adult human optic nerve for NEIBank: Identification of cell type and tissue markers

PubMed Central

Bernstein, Steven L; Guo, Yan; Peterson, Katherine; Wistow, Graeme

2009-01-01

Background The optic nerve is a pure white matter central nervous system (CNS) tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR) and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data provide an initial overview of gene expression patterns in this tissue. The data provide clues for tissue-specific and species-specific properties of human ON that will help in design of therapeutic models. PMID:19778450

Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

Expression and kinetic properties of a recombinant 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzyme of human liver.

PubMed

Deyashiki, Y; Tamada, Y; Miyabe, Y; Nakanishi, M; Matsuura, K; Hara, A

1995-08-01

Human liver cytosol contains multiple forms of 3 alpha-hydroxysteroid dehydrogenase and dihydrodiol dehydrogenase with hydroxysteroid dehydrogenase activity, and multiple cDNAs for the enzymes have been cloned from human liver cDNA libraries. To understand the relationship of the multiple enzyme froms to the genes, a cDNA, which has been reported to code for an isoenzyme of human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase, was expressed in Escherichia coli. The recombinant enzyme showed structural and functional properties almost identical to those of the isoenzyme purified from human liver. In addition, the recombinant isoenzyme efficiently reduced 5 alpha-dihydrotestosterone and 5 beta-dihydrocortisone, the known substrates of human liver 3 alpha-hydroxysteroid dehydrogenase and chlordecone reductase previously purified, which suggests that these human liver enzymes are identical. Furthermore, the steady-state kinetic data for NADP(+)-linked (S)-1-indanol oxidation by the recombinant isoenzyme were consistent with a sequential ordered mechanism in which NADP+ binds first. Phenolphthalein inhibited this isoenzyme much more potently than it did the other human liver dihydrodiol dehydrogenases, and was a competitive inhibitor (Ki = 20 nM) that bound to the enzyme-NADP+ complex.

Characterization of recombinant human HBP/CAP37/azurocidin, a pleiotropic mediator of inflammation-enhancing LPS-induced cytokine release from monocytes.

PubMed

Rasmussen, P B; Bjørn, S; Hastrup, S; Nielsen, P F; Norris, K; Thim, L; Wiberg, F C; Flodgaard, H

1996-07-15

Neutrophil-derived heparin-binding protein (HBP) is a strong chemoattractant for monocytes. We report here for the first time the expression of recombinant HBP. A baculovirus containing the human HBP cDNA mediated in insect cells the secretion of a 7-residue N-terminally extended HBP form (pro-HBP). Deletion of the pro-peptide-encoding cDNA sequence resulted in correctly processed HBP at the N-terminus. Electrospray mass spectrum analysis of recombinant HBP yielded a molecular weight of 27.237 +/- 3 amu. Consistent with this mass is a HBP form of 225 amino acids (mature part +3 amino acid C-terminal extension). The biological activity of recombinant HBP was confirmed by its chemotactic action towards monocytes. Furthermore, we have shown that recombinant HBP stimulates in a dose-dependent manner the lipopolysaccharide (LPS)-induced cytokine release from human monocytes.

Fractal landscape analysis of DNA walks

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

1992-01-01

By mapping nucleotide sequences onto a "DNA walk", we uncovered remarkably long-range power law correlations [Nature 356 (1992) 168] that imply a new scale invariant property of DNA. We found such long-range correlations in intron-containing genes and in non-transcribed regulatory DNA sequences, but not in cDNA sequences or intron-less genes. In this paper, we present more explicit evidences to support our findings.

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

Characterization of tumor differentiation factor (TDF) and its receptor (TDF-R).

PubMed

Sokolowska, Izabela; Woods, Alisa G; Gawinowicz, Mary Ann; Roy, Urmi; Darie, Costel C

2013-08-01

Tumor differentiation factor (TDF) is an under-investigated protein produced by the pituitary with no definitive function. TDF is secreted into the bloodstream and targets the breast and prostate, suggesting that it has an endocrine function. Initially, TDF was indirectly discovered based on the differentiation effect of alkaline pituitary extracts of the mammosomatotropic tumor MtTWlO on MTW9/PI rat mammary tumor cells. Years later, the cDNA clone responsible for this differentiation activity was isolated from a human pituitary cDNA library using expression cloning. The cDNA encoded a 108-amino-acid polypeptide that had differentiation activity on MCF7 breast cancer cells and on DU145 prostate cancer cells in vitro and in vivo. Recently, our group focused on identification of the TDF receptor (TDF-R). As potential TDF-R candidates, we identified the members of the Heat Shock 70-kDa family of proteins (HSP70) in both MCF7 and BT-549 human breast cancer cells (HBCC) and PC3, DU145, and LNCaP human prostate cancer cells (HPCC), but not in HeLa cells, NG108 neuroblastoma, or HDF-a and BLK CL.4 cells fibroblasts or fibroblast-like cells. Here we review the current advances on TDF, with particular focus on the structural investigation of its receptor and on its functional effects on breast and prostate cells.

Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.

PubMed Central

Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E

1994-01-01

A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404

Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

PubMed Central

Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

1987-01-01

The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

Clone and genomic repositories at the American Type Culture Collection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maglott, D.R.; Nierman, W.C.

1990-01-01

The American Type Culture Collection (ATCC) has a long history of characterizing, preserving, and distributing biological resource materials for the scientific community. Starting in 1925 as a repository for standard bacterial and fungal strains, its collections have diversified with technologic advances and in response to the requirements of its users. To serve the needs of the human genetics community, the National Institute of Child Health and Human Development (NICHD), National Institutes of Health (NIH), established an international Repository of Human DNA Probes and Libraries at the ATCC in 1985. This repository expanded the existing collections of recombinant clones and librariesmore » at the ATCC, with the specific purposes of (1) obtaining, amplifying, and distribution probes detecting restriction fragment length polymorphisms (RFLPs); (2) obtaining, amplifying, and distributing genomic and cDNA clones from known genes independent of RFLP detection; (3) distributing the chromosome-specific libraries generated by the National Laboratory Gene Library Project at the Lawrence Livermore and Los Alamos National Laboratories and (4) maintaining a public, online database describing the repository materials. Because it was recognized that animal models and comparative mapping can be crucial to genomic characterization, the scope of the repository was broadened in February 1989 to include probes from the mouse genome.« less

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

An overview of technical considerations when using quantitative real-time PCR analysis of gene expression in human exercise research

PubMed Central

Yan, Xu; Bishop, David J.

2018-01-01

Gene expression analysis by quantitative PCR in skeletal muscle is routine in exercise studies. The reproducibility and reliability of the data fundamentally depend on how the experiments are performed and interpreted. Despite the popularity of the assay, there is a considerable variation in experimental protocols and data analyses from different laboratories, and there is a lack of consistency of proper quality control steps throughout the assay. In this study, we present a number of experiments on various steps of quantitative PCR workflow, and demonstrate how to perform a quantitative PCR experiment with human skeletal muscle samples in an exercise study. We also tested some common mistakes in performing qPCR. Interestingly, we found that mishandling of muscle for a short time span (10 mins) before RNA extraction did not affect RNA quality, and isolated total RNA was preserved for up to one week at room temperature. Demonstrated by our data, use of unstable reference genes lead to substantial differences in the final results. Alternatively, cDNA content can be used for data normalisation; however, complete removal of RNA from cDNA samples is essential for obtaining accurate cDNA content. PMID:29746477

Electrotransfer of the full-length dog dystrophin into mouse and dystrophic dog muscles.

PubMed

Pichavant, Christophe; Chapdelaine, Pierre; Cerri, Daniel G; Bizario, Joao C S; Tremblay, Jacques P

2010-11-01

Duchenne muscular dystrophy (DMD) is an X-linked genetic disease characterized by the absence of dystrophin (427 kDa). An approach to eventually restore this protein in patients with DMD is to introduce into their muscles a plasmid encoding dystrophin cDNA. Because the phenotype of the dystrophic dog is closer to the human phenotype than is the mdx mouse phenotype, we have studied the electrotransfer of a plasmid carrying the full-length dog dystrophin (FLDYS(dog)) in dystrophic dog muscle. To achieve this nonviral delivery, the FLDYS(dog) cDNA was cloned in two plasmids containing either a cytomegalovirus or a muscle creatine kinase promoter. In both cases, our results showed that the electrotransfer of these large plasmids (∼17 kb) into mouse muscle allowed FLDYS(dog) expression in the treated muscle. The electrotransfer of pCMV.FLDYS(dog) in a dystrophic dog muscle also led to the expression of dystrophin. In conclusion, introduction of the full-length dog dystrophin cDNA by electrotransfer into dystrophic dog muscle is a potential approach to restore dystrophin in patients with DMD. However, the electrotransfer procedure should be improved before applying it to humans.

SPLASH (PLA2IID), a novel member of phospholipase A2 family, is associated with lymphotoxin deficiency.

PubMed

Shakhov, A N; Rubtsov, A V; Lyakhov, I G; Tumanov, A V; Nedospasov, S A

2000-02-01

Lymphotoxin (LT) deficient mice have profound defects in the splenic microarchitecture associated with defective expression on certain gene products, including chemokines. By using subtraction cloning of splenic cDNA from wild-type and LT alpha or TNF/LT alpha double deficient mice we isolated a novel murine gene encoding a secretory type phospholipase A2, called SPLASH. The two major alternative transcripts of SPLASH gene are predominantly expressed in lymphoid tissues, such as spleen and lymph nodes. SPLASH maps to the distal part of chromosome 4, to which several cancer-related loci have been also mapped.

Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli

NASA Astrophysics Data System (ADS)

Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz

1981-02-01

Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

PubMed Central

Oduru, Sreedhar; Campbell, Janee L; Karri, SriTulasi; Hendry, William J; Khan, Shafiq A; Williams, Simon C

2003-01-01

Background Complete genome annotation will likely be achieved through a combination of computer-based analysis of available genome sequences combined with direct experimental characterization of expressed regions of individual genomes. We have utilized a comparative genomics approach involving the sequencing of randomly selected hamster testis cDNAs to begin to identify genes not previously annotated on the human, mouse, rat and Fugu (pufferfish) genomes. Results 735 distinct sequences were analyzed for their relatedness to known sequences in public databases. Eight of these sequences were derived from previously unidentified genes and expression of these genes in testis was confirmed by Northern blotting. The genomic locations of each sequence were mapped in human, mouse, rat and pufferfish, where applicable, and the structure of their cognate genes was derived using computer-based predictions, genomic comparisons and analysis of uncharacterized cDNA sequences from human and macaque. Conclusion The use of a comparative genomics approach resulted in the identification of eight cDNAs that correspond to previously uncharacterized genes in the human genome. The proteins encoded by these genes included a new member of the kinesin superfamily, a SET/MYND-domain protein, and six proteins for which no specific function could be predicted. Each gene was expressed primarily in testis, suggesting that they may play roles in the development and/or function of testicular cells. PMID:12783626

Rapid in silico cloning of genes using expressed sequence tags (ESTs).

PubMed

Gill, R W; Sanseau, P

2000-01-01

Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

PubMed

Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

1997-11-01

Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

Evaluation of Genomic Instability in the Abnormal Prostate

DTIC Science & Technology

2006-12-01

array CGH maps copy number aberrations relative to the genome sequence by using arrays of BAC or cDNA clones as the hybridization target instead of...data produced from these analyses complicate the interpretation of results . For these reasons, and as outlined by Davies et al., 22 it is desirable...There have been numerous studies of these abnormalities and several techniques, including 9 chromosome painting, array CGH and SNP arrays , have

The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Brody, L.C.; Martin, L.S.

1993-05-01

Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less

A neurotransmitter transporter encoded by the Drosophila inebriated gene

PubMed Central

Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

1996-01-01

Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome.

PubMed

Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z

2011-02-01

We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.

cDNA Microarray Gene Expression Profiling of Hedgehog Signaling Pathway Inhibition in Human Colon Cancer Cells

PubMed Central

Shi, Ting; Mazumdar, Tapati; DeVecchio, Jennifer; Duan, Zhong-Hui; Agyeman, Akwasi; Aziz, Mohammad; Houghton, Janet A.

2010-01-01

Background Hedgehog (HH) signaling plays a critical role in normal cellular processes, in normal mammalian gastrointestinal development and differentiation, and in oncogenesis and maintenance of the malignant phenotype in a variety of human cancers. Increasing evidence further implicates the involvement of HH signaling in oncogenesis and metastatic behavior of colon cancers. However, genomic approaches to elucidate the role of HH signaling in cancers in general are lacking, and data derived on HH signaling in colon cancer is extremely limited. Methodology/Principal Findings To identify unique downstream targets of the GLI genes, the transcriptional regulators of HH signaling, in the context of colon carcinoma, we employed a small molecule inhibitor of both GLI1 and GLI2, GANT61, in two human colon cancer cell lines, HT29 and GC3/c1. Cell cycle analysis demonstrated accumulation of GANT61-treated cells at the G1/S boundary. cDNA microarray gene expression profiling of 18,401 genes identified Differentially Expressed Genes (DEGs) both common and unique to HT29 and GC3/c1. Analyses using GenomeStudio (statistics), Matlab (heat map), Ingenuity (canonical pathway analysis), or by qRT-PCR, identified p21Cip1 (CDKN1A) and p15Ink4b (CDKN2B), which play a role in the G1/S checkpoint, as up-regulated genes at the G1/S boundary. Genes that determine further cell cycle progression at G1/S including E2F2, CYCLIN E2 (CCNE2), CDC25A and CDK2, and genes that regulate passage of cells through G2/M (CYCLIN A2 [CCNA2], CDC25C, CYCLIN B2 [CCNB2], CDC20 and CDC2 [CDK1], were down-regulated. In addition, novel genes involved in stress response, DNA damage response, DNA replication and DNA repair were identified following inhibition of HH signaling. Conclusions/Significance This study identifies genes that are involved in HH-dependent cellular proliferation in colon cancer cells, and following its inhibition, genes that regulate cell cycle progression and events downstream of the G1/S boundary. PMID:20957031

Cloning of the cDNA for a hematopoietic cell-specific protein related to CD20 and the {beta} subunit of the high-affinity IgE receptor: Evidence for a family of proteins with four membrane-spanning regions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adra, C.N.; Morrison, P.; Lim, B.

1994-10-11

The authors report the cloning of the cDNA for a human gene whose mRNA is expressed specifically in hematopoietic cells. A long open reading frame in the 1.7-kb mRNA encodes a 214-aa protein of 25 kDa with four hydrophobic regions consistent with a protein that traverses the membrane four times. To reflect the structure and expression of this gene in diverse hematopoietic lineages of lymphoid and myeloid origin, the authors named the gene HTm{sub 4}. The protein is about 20% homologous to two other {open_quotes}four-transmembrane{close_quotes} proteins; the B-cell-specific antigen CD20 and the {beta} subunit of the high-affinity receptor for IgE,more » Fc{sub {epsilon}}RI{beta}. The highest homologies among the three proteins are found in the transmembrane domains, but conserved residues are also recognized in the inter-transmembrane domains and in the N and C termini. Using fluorescence in situ hybridization, they localized HTm{sub 4} to human chromosome 11q12-13.1, where the CD20 and Fc{sub {epsilon}}RI{beta} genes are also located. Both the murine homologue for CD20, Ly-44, and the murine Fc{sub {epsilon}}RI{beta} gene map to the same region in murine chromosome 19. The authors propose that the HTm{sub 4}, CD20, and Fc{sub {epsilon}}RI{beta} genes evolved from the same ancestral gene to form a family of four-transmembrane proteins. It is possible that other related members exist. Similar to CD20 and Fc{sub {epsilon}}RI{beta}, it is likely that Htm{sub 4} has a role in signal transduction and, like Fc{sub {epsilon}}RI{beta}, might be a subunit associated with receptor complexes.« less

Myelin-oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pham-Dinh, D.; Dautigny, A.; Mattei, M.G.

1993-09-01

Myelin/oligodendrocyte glycoprotein (MOG) is found on the surface of myelinating oligodendrocytes and external lamellae of myelin sheaths in the central nervous system, and it is target antigen in experimental autoimmune encephalomyelitis and multiple sclerosis. The authors have isolated bovine, mouse, and rat MOG cDNA clones and shown that the developmental pattern of MOG expression in the rat central nervous system coincides with the late stages of myelination. The amino-terminal, extracellular domain of MOG has characteristics of an immunoglobulin variable domain and is 46% and 41% identical with the amino terminus of bovine butyrophilin (expressed in the lactating mammary gland) andmore » B-G antigens of the chicken major histocompatibility complex (MHC), respectively; these proteins thus form a subset of the immunoglobulin superfamily. The homology between MOG and B-G extends beyond their structure and genetic mapping to their ability to induce strong antibody responses and has implications for the role of MOG in pathological, autoimmune conditions. The authors colocalized the MOG and BT genes to the human MHC on chromosome 6p21.3-p22. The mouse MOG gene was mapped to the homologous band C of chromosome 17, within the M region of the mouse MHC. 38 refs., 6 figs.« less

cDNA cloning, tissue distribution, and chromosomal localization of myelodysplasia/Myeloid Leukemia Factor 2 (MLF2)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuefer, M.U.; Valentine, V.; Behm, F.G.

A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, and MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal regionmore » frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements. 19 refs., 2 figs.« less

The use of enzymopathic human red cells in the study of malarial parasite glucose metabolism.

PubMed

Roth, E; Joulin, V; Miwa, S; Yoshida, A; Akatsuka, J; Cohen-Solal, M; Rosa, R

1988-05-01

The in vitro growth of Plasmodium falciparum malaria parasites was assayed in mutant red cells deficient in either diphosphoglycerate mutase (DPGM) or phosphoglycerate kinase (PGK). In addition, cDNA probes developed for human DNA sequences coding for these enzymes were used to examine the parasite genome by means of restriction endonuclease digestion and Southern blot analysis of parasite DNA. In both types of enzymopathic red cells, parasite growth was normal. In infected DPGM deficient red cells, no DPGM activity could be detected, and in normal red cells, DPGM activity declined slightly in a manner suggestive of parasite catabolism of host protein. However, in infected PGK deficient red cells, there was a 100-fold increase in PGK activity, and in normal red cells, a threefold increase in PGK activity was observed. Parasite PGK could be recovered from isolated parasites, and a marked increase in heat instability of parasite PGK as compared with the host cell enzyme was noted. Neither cDNA probe was found to cross-react with DNA sequences in the parasite genome. It is concluded that the parasite has no requirement for DPGM, and probably has no gene for this enzyme. On the other hand, the parasite does require PGK, (an adenosine triphosphate [ATP] generating enzyme) and synthesizes its own enzyme, which must have been encoded in the parasite genome. The parasite PGK gene most likely lacks sufficient homology to be detected by a human cDNA probe. Enzymopathic red cells are useful tools for elucidating the glycolytic enzymology of parasites and their co-evolution with their human hosts.

Yeast two-hybrid cloning of a novel zinc finger protein that interacts with the multifunctional transcription factor YY1.

PubMed Central

Kalenik, J L; Chen, D; Bradley, M E; Chen, S J; Lee, T C

1997-01-01

Muscle-restricted transcription of sarcomeric actin genes is negatively controlled by the zinc finger protein YY1, which is down-regulated at the protein level during myogenic differentiation. To identify cellular proteins that might mediate the function/stability of YY1 in muscle cells, we screened an adult human muscle cDNA library using the yeast two-hybrid cloning system. We report the isolation and characterization of a novel protein termed YAF2 (YY1- associated factor 2) that interacts with YY1. The YAF2 cDNA encodes a 180 amino acid basic protein (pI 10.5) containing a single N-terminal C2-X10-C2 zinc finger. Lysine clusters are present that may function as a nuclear localization signal. Domain mapping analysis shows that the first and second zinc fingers of YY1 are targeted for YAF2 protein interaction. In contrast to the down-regulation of YY1, YAF2 message levels increase during in vitro differentiation of both rat skeletal and cardiac muscle cells. YAF2 appears to have a promyogenic regulatory role, since overexpression of YAF2 in C2 myoblasts stimulates myogenic promoter activity normally restricted by YY1. Co-transfection of YY1 reverses the stimulatory effect of YAF2. YAF2 also greatly potentiates proteolytic cleavage of YY1 by the calcium- activated protease m-calpain. The isolation of YAF2 may help in understanding the mechanisms through which inhibitors of myogenic transcription may be antagonized or eliminated by proteolysis during muscle development. PMID:9016636

Myozenin: An α-actinin- and γ-filamin-binding protein of skeletal muscle Z lines

PubMed Central

Takada, Fumio; Woude, Douglas L. Vander; Tong, Hui-Qi; Thompson, Terri G.; Watkins, Simon C.; Kunkel, Louis M.; Beggs, Alan H.

2001-01-01

To better understand the structure and function of Z lines, we used sarcomeric isoforms of α-actinin and γ-filamin to screen a human skeletal muscle cDNA library for interacting proteins by using the yeast two-hybrid system. Here we describe myozenin (MYOZ), an α-actinin- and γ-filamin-binding Z line protein expressed predominantly in skeletal muscle. Myozenin is predicted to be a 32-kDa, globular protein with a central glycine-rich domain flanked by α-helical regions with no strong homologies to any known genes. The MYOZ gene has six exons and maps to human chromosome 10q22.1-q22.2. Northern blot analysis demonstrated that this transcript is expressed primarily in skeletal muscle with significantly lower levels of expression in several other tissues. Antimyozenin antisera stain skeletal muscle in a sarcomeric pattern indistinguishable from that seen by using antibodies for α-actinin, and immunogold electron microscopy confirms localization specifically to Z lines. Thus, myozenin is a skeletal muscle Z line protein that may be a good candidate gene for limb-girdle muscular dystrophy or other neuromuscular disorders. PMID:11171996

Characterization and cloning of tripeptidyl peptidase II from the fruit fly, Drosophila melanogaster.

PubMed

Renn, S C; Tomkinson, B; Taghert, P H

1998-07-24

We describe the characterization, cloning, and genetic analysis of tripeptidyl peptidase II (TPP II) from Drosophila melanogaster. Mammalian TPP II removes N-terminal tripeptides, has wide distribution, and has been identified as the cholecystokinin-degrading peptidase in rat brain. Size exclusion and ion exchange chromatography produced a 70-fold purification of dTPP II activity from Drosophila tissue extracts. The substrate specificity and the inhibitor sensitivity of dTPP II is comparable to that of the human enzyme. In particular, dTPP II is sensitive to butabindide, a specific inhibitor of the rat cholecystokinin-inactivating activity. We isolated a 4309-base pair dTPP II cDNA which predicts a 1354-amino acid protein. The deduced human and Drosophila TPP II proteins display 38% overall identity. The catalytic triad, its spacing, and the sequences that surround it are highly conserved; the C-terminal end of dTPP II contains a 100-amino acid insert not found in the mammalian proteins. Recombinant dTPP II displays the predicted activity following expression in HEK cells. TPP II maps to cytological position 49F4-7; animals deficient for this interval show reduced TPP II activity.

Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

NASA Astrophysics Data System (ADS)

Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

1996-06-01

cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

PubMed

Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

2002-06-15

To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

Expression of a ripening-related cytochrome P450 cDNA in Cavendish banana (Musa acuminata cv. Williams).

PubMed

Pua, Eng-Chong; Lee, Yi-Chuan

2003-02-13

As part of a study to understand the molecular basis of fruit ripening, this study reports the isolation and characterization of a banana cytochrome P450 (P450) cDNA, designated as MAP450-1, which was associated with fruit ripening of banana. MAP450-1 encoded a single polypeptide of 507 amino acid residues that shared an overall identity of 27-45% with that of several plant P450s, among which MAP450-1 was most related phylogenetically to the avocado P450 CYP71A1. The polypeptide that possessed residue domains conserved in all P450s was classified as CYP71N1. Expression of CYP71N1 varied greatly between banana organs. Transcripts were detected only in peel and pulp of the ripening fruit and not in unripe fruit tissues at all developmental stages or other organs (root, leaf, ovary and flower). During ripening, transcripts were barely detectable in pre-climacteric and climacteric fruits but, as ripening progressed, they began to accumulate and reached a maximum in post-climacteric fruits. CYP71N1 expression in pre-climacteric fruit could be upregulated by exogenous application of ethylene (1-5 ppm) and treatment of overripe fruit with exogenous sucrose (50-300 mM) but not glucose downregulated the expression. These results indicate that P450s may not play a role in fruit development and its expression is associated with ripening, which may be regulated, in part, by ethylene and/or sucrose, at the transcript level.

Ornithine aminotransferase (OAT): recombination between an X-linked OAT sequence (7.5 kb) and the Norrie disease locus.

PubMed

Ngo, J T; Bateman, J B; Spence, M A; Cortessis, V; Sparkes, R S; Kivlin, J D; Mohandas, T; Inana, G

1990-01-01

A human ornithine aminotransferase (OAT) locus has been mapped to the Xp11.2, as has the Norrie disease locus. We used a cDNA probe to investigate a 3-generation UCLA family with Norrie disease; a 4.2-kb RFLP was detected and a maximum lod score of 0.602 at zero recombination fraction was calculated. We used the same probe to study a second multigeneration family with Norrie disease from Utah. A different RFLP of 7.5 kb in size was identified and a recombinational event between the OAT locus represented by this RFLP and the disease loci was observed. Linkage analysis of these two loci in this family revealed a maximum load score of 1.88 at a recombination fraction of 0.10. Although both families have affected members with the same disease, the lod scores are reported separately because the 4.2- and 7.5-kb RFLPs may represent two different loci for the X-linked OAT.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Distribution of cholecystokinin mRNA and peptides in the human brain.

PubMed

Lindefors, N; Brené, S; Kopp, J; Lindén, A; Brodin, E; Sedvall, G; Persson, H

1991-01-01

Expression of preprocholecystokinin mRNA was studied in regions of post mortem human brain using RNA blot analysis (Northern blot) and in situ hybridization. Northern blot analysis using a cDNA probe showed high levels of an approximately 0.8 kb preprocholecystokinin mRNA in all regions of neocortex examined. Lower levels of preprocholecystokinin mRNA were detected in amygdaloid body and thalamus. In situ hybridization analysis using the same cDNA probe revealed numerous weakly labelled neurons in different areas of human neocortex and less numerous neurons in hippocampus and amygdaloid body. High-performance liquid-chromatography and gel-chromatography combined with radioimmunoassay of cholecystokinin-like immunoreactivity from human cerebral cortex and caudate nucleus revealed two major forms, one coeluting with sulphated cholecystokinin-8 and the other coeluting with sulphated cholecystokinin-58. Two minor components coeluting with cholecystokinin-4 and cholecystokinin-5 were also detected. The finding of cholecystokinin-like immunoreactivity corresponding to cholecystokinin-8 and cholecystokinin-58 in caudate nucleus where no preprocholecystokinin mRNA was found, indicates the presence of these peptides in afferent nerve terminals.

Combined histochemical staining, RNA amplification, regional, and single cell cDNA analysis within the hippocampus.

PubMed

Ginsberg, Stephen D; Che, Shaoli

2004-08-01

The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.

cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Codina, J.; Olate, J.; Abramowitz, J.

1988-05-15

cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted aminomore » acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.« less

Expression of glutathione peroxidase I gene in selenium-deficient rats.

PubMed Central

Reddy, A P; Hsu, B L; Reddy, P S; Li, N Q; Thyagaraju, K; Reddy, C C; Tam, M F; Tu, C P

1988-01-01

We have characterized a cDNA pGPX1211 encoding rat glutathione peroxidase I. The selenocysteine in the protein corresponded to a TGA codon in the coding region of the cDNA, similar to earlier findings in mouse and human genes, and a gene encoding the formate dehydrogenase from E. coli, another selenoenzyme. The rat GSH peroxidase I has a calculated subunit molecular weight of 22,155 daltons and shares 95% and 86% sequence homology with the mouse and human subunits, respectively. The 3'-noncoding sequence (greater than 930 bp) in pGPX1211 is much longer than that of the human sequences. We found that glutathione peroxidase I mRNA, but not the polypeptide, was expressed under nutritional stress of selenium deficiency where no glutathione peroxidase I activity can be detected. The failure of detecting any apoprotein for the glutathione peroxidase I under selenium deficiency and results published from other laboratories supports the proposal that selenium may be incorporated into the glutathione peroxidase I co-translationally. Images PMID:2838821

Novel splice-site and missense mutations in the ALDH1A3 gene underlying autosomal recessive anophthalmia/microphthalmia.

PubMed

Semerci, C Nur; Kalay, Ersan; Yıldırım, Cem; Dinçer, Tuba; Olmez, Akgün; Toraman, Bayram; Koçyiğit, Ali; Bulgu, Yunus; Okur, Volkan; Satıroğlu-Tufan, Lale; Akarsu, Nurten A

2014-06-01

This study aimed to identify the underlying genetic defect responsible for anophthalmia/microphthalmia. In total, two Turkish families with a total of nine affected individuals were included in the study. Affymetrix 250 K single nucleotide polymorphism genotyping and homozygosity mapping were used to identify the localisation of the genetic defect in question. Coding region of the ALDH1A3 gene was screened via direct sequencing. cDNA samples were generated from primary fibroblast cell cultures for expression analysis. Reverse transcriptase PCR (RT-PCR) analysis was performed using direct sequencing of the obtained fragments. The causative genetic defect was mapped to chromosome 15q26.3. A homozygous G>A substitution (c.666G>A) at the last nucleotide of exon 6 in the ALDH1A3 gene was identified in the first family. Further cDNA sequencing of ALDH1A3 showed that the c.666G>A mutation caused skipping of exon 6, which predicted in-frame loss of 43 amino acids (p.Trp180_Glu222del). A novel missense c.1398C>A mutation in exon 12 of ALDH1A3 that causes the substitution of a conserved asparagine by lysine at amino acid position 466 (p.Asn466Lys) was observed in the second family. No extraocular findings-except for nevus flammeus in one affected individual and a variant of Dandy-Walker malformation in another affected individual-were observed. Autistic-like behaviour and mental retardation were observed in three cases. In conclusion, novel ALDH1A3 mutations identified in the present study confirm the pivotal role of ALDH1A3 in human eye development. Autistic features, previously reported as an associated finding, were considered to be the result of social deprivation and inadequate parenting during early infancy in the presented families. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Chromosomal localization and cDNA cloning of the human DBP and TEF genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khatib, Z.A.; Inaba, T.; Valentine, M.

1994-09-15

The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less

The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

PubMed

Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

1992-12-01

Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

Purification and characterization of an antifungal protein, C-FKBP, from Chinese cabbage.

PubMed

Park, Seong-Cheol; Lee, Jung Ro; Shin, Sun-Oh; Jung, Ji Hyun; Lee, Young Mee; Son, Hyosuk; Park, Yoonkyung; Lee, Sang Yeol; Hahm, Kyung-Soo

2007-06-27

An antifungal protein was isolated from Chinese cabbage (Brassica campestris L. ssp. pekinensis) by buffer-soluble extraction and two chromatographic procedures. The results of matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry revealed that the isolated Chinese cabbage protein was identical to human FK506-binding protein (FKBP). A cDNA encoding FKBP was isolated from a Chinese cabbage leaf cDNA library and named C-FKBP. The open reading frame of the gene encoded a 154-amino acid polypeptide. The amino acid sequence of C-FKBP exhibits striking degrees of identity with the corresponding mouse (61%), human (60%), and yeast (56%) proteins. Genomic Southern blot analyses using the full-length C-FKBP cDNA probe revealed a multigene family in the Chinese cabbage genome. The C-FKBP mRNA was highly expressed in vegetative tissues. We also analyzed the antifungal and peptidyl-prolyl cis-trans isomerase activity of recombinant C-FKBP protein expressed in Escherichia coli. This protein inhibited pathogenic fungal strains, including Candida albicans, Botrytis cinerea, Rhizoctonia solani, and Trichoderma viride, whereas it exhibited no activity against E. coli and Staphylococcus aureus. These results suggest that recombinant C-FKBP is an excellent candidate as a lead compound for the development of antifungal agents.

An evaluation of tyramide signal amplification and archived fixed and frozen tissue in microarray gene expression analysis

PubMed Central

Karsten, Stanislav L.; Van Deerlin, Vivianna M. D.; Sabatti, Chiara; Gill, Lisa H.; Geschwind, Daniel H.

2002-01-01

Archival formalin-fixed, paraffin-embedded and ethanol-fixed tissues represent a potentially invaluable resource for gene expression analysis, as they are the most widely available material for studies of human disease. Little data are available evaluating whether RNA obtained from fixed (archival) tissues could produce reliable and reproducible microarray expression data. Here we compare the use of RNA isolated from human archival tissues fixed in ethanol and formalin to frozen tissue in cDNA microarray experiments. Since an additional factor that can limit the utility of archival tissue is the often small quantities available, we also evaluate the use of the tyramide signal amplification method (TSA), which allows the use of small amounts of RNA. Detailed analysis indicates that TSA provides a consistent and reproducible signal amplification method for cDNA microarray analysis, across both arrays and the genes tested. Analysis of this method also highlights the importance of performing non-linear channel normalization and dye switching. Furthermore, archived, fixed specimens can perform well, but not surprisingly, produce more variable results than frozen tissues. Consistent results are more easily obtainable using ethanol-fixed tissues, whereas formalin-fixed tissue does not typically provide a useful substrate for cDNA synthesis and labeling. PMID:11788730

Isolation and functional expression of human COQ2, a gene encoding a polyprenyl transferase involved in the synthesis of CoQ.

PubMed

Forsgren, Margareta; Attersand, Anneli; Lake, Staffan; Grünler, Jacob; Swiezewska, Ewa; Dallner, Gustav; Climent, Isabel

2004-09-01

The COQ2 gene in Saccharomyces cerevisiae encodes a Coq2 (p-hydroxybenzoate:polyprenyl transferase), which is required in the biosynthetic pathway of CoQ (ubiquinone). This enzyme catalyses the prenylation of p-hydroxybenzoate with an all-trans polyprenyl group. We have isolated cDNA which we believe encodes the human homologue of COQ2 from a human muscle and liver cDNA library. The clone contained an open reading frame of length 1263 bp, which encodes a polypeptide that has sequence homology with the Coq2 homologues in yeast, bacteria and mammals. The human COQ2 gene, when expressed in yeast Coq2 null mutant cells, rescued the growth of this yeast strain in the absence of a non-fermentable carbon source and restored CoQ biosynthesis. However, the rate of CoQ biosynthesis in the rescued cells was lower when compared with that in cells rescued with the yeast COQ2 gene. CoQ formed when cells were incubated with labelled decaprenyl pyrophosphate and nonaprenyl pyrophosphate, showing that the human enzyme is active and that it participates in the biosynthesis of CoQ.

Tumorigenic Potential of Extracellular Matrix Metalloproteinase Inducer

PubMed Central

Zucker, Stanley; Hymowitz, Michelle; Rollo, Ellen E.; Mann, Richard; Conner, Cathleen E.; Cao, Jian; Foda, Hussein D.; Tompkins, David C.; Toole, Bryan P.

2001-01-01

Extracellular matrix metalloproteinase inducer (EMMPRIN), a glycoprotein present on the cancer cell plasma membrane, enhances fibroblast synthesis of matrix metalloproteinases (MMPs). The demonstration that peritumoral fibroblasts synthesize most of the MMPs in human tumors rather than the cancer cells themselves has ignited interest in the role of EMMPRIN in tumor dissemination. In this report we have demonstrated a role for EMMPRIN in cancer progression. Human MDA-MB-436 breast cancer cells, which are tumorigenic but slow growing in vivo, were transfected with EMMPRIN cDNA and injected orthotopically into mammary tissue of female NCr nu/nu mice. Green fluorescent protein was used to visualize metastases. In three experiments, breast cancer cell clones transfected with EMMPRIN cDNA were considerably more tumorigenic and invasive than plasmid-transfected cancer cells. Increased gelatinase A and gelatinase B expression (demonstrated by in situ hybridization and gelatin substrate zymography) was demonstrated in EMMPRIN-enhanced tumors. In contrast to de novo breast cancers in humans, human tumors transplanted into mice elicited minimal stromal or inflammatory cell reactions. Based on these experimental studies and our previous demonstration that EMMPRIN is prominently displayed in human cancer tissue, we propose that EMMPRIN plays an important role in cancer progression by increasing synthesis of MMPs. PMID:11395366

Genomic structure and chromosomal mapping of the human CD22 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, G.L.; Kozlow, E.; Kehrl, J.H.

1993-06-01

The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin

PubMed Central

Loit, Evelin; Melnyk, Charles W; MacFarlane, Amanda J; Scott, Fraser W; Altosaar, Illimar

2009-01-01

Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D). Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s) encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health. PMID:19615078

Effectiveness of liquid soap and hand sanitizer against Norwalk virus on contaminated hands.

PubMed

Liu, Pengbo; Yuen, Yvonne; Hsiao, Hui-Mien; Jaykus, Lee-Ann; Moe, Christine

2010-01-01

Disinfection is an essential measure for interrupting human norovirus (HuNoV) transmission, but it is difficult to evaluate the efficacy of disinfectants due to the absence of a practicable cell culture system for these viruses. The purpose of this study was to screen sodium hypochlorite and ethanol for efficacy against Norwalk virus (NV) and expand the studies to evaluate the efficacy of antibacterial liquid soap and alcohol-based hand sanitizer for the inactivation of NV on human finger pads. Samples were tested by real-time reverse transcription-quantitative PCR (RT-qPCR) both with and without a prior RNase treatment. In suspension assay, sodium hypochlorite concentrations of >or=160 ppm effectively eliminated RT-qPCR detection signal, while ethanol, regardless of concentration, was relatively ineffective, giving at most a 0.5 log(10) reduction in genomic copies of NV cDNA. Using the American Society for Testing and Materials (ASTM) standard finger pad method and a modification thereof (with rubbing), we observed the greatest reduction in genomic copies of NV cDNA with the antibacterial liquid soap treatment (0.67 to 1.20 log(10) reduction) and water rinse only (0.58 to 1.58 log(10) reduction). The alcohol-based hand sanitizer was relatively ineffective, reducing the genomic copies of NV cDNA by only 0.14 to 0.34 log(10) compared to baseline. Although the concentrations of genomic copies of NV cDNA were consistently lower on finger pad eluates pretreated with RNase compared to those without prior RNase treatment, these differences were not statistically significant. Despite the promise of alcohol-based sanitizers for the control of pathogen transmission, they may be relatively ineffective against the HuNoV, reinforcing the need to develop and evaluate new products against this important group of viruses.

Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

PubMed Central

Suard, Y M; Tosi, M; Kraehenbuhl, J P

1982-01-01

Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

Comparison of next generation sequencing technologies for transcriptome characterization

PubMed Central

2009-01-01

Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG) ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19). We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica) and the magnoliid avocado (Persea americana) using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB), 119,518 (88.7%) mapped exactly to known exons, while 1,117 (0.8%) mapped to introns, 11,524 (8.6%) spanned annotated intron/exon boundaries, and 3,066 (2.3%) extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance over capillary-based sequencing, but NG sequencing also presents significant challenges in assembly and sequence accuracy due to short read lengths, method-specific sequencing errors, and the absence of physical clones. These problems may be overcome by hybrid sequencing strategies using a mixture of sequencing methodologies, by new assemblers, and by sequencing more deeply. Sequencing and microarray outcomes from multiple experiments suggest that our simulator will be useful for guiding NG transcriptome sequencing projects in a wide range of organisms. PMID:19646272

Up-regulation of microtubule-associated protein 2 accompanying the filial imprinting of domestic chicks (Gallus gallus domesticus).

PubMed

Yamaguchi, Shinji; Fujii-Taira, Ikuko; Murakami, Akio; Hirose, Naoki; Aoki, Naoya; Izawa, Ei-Ichi; Fujimoto, Yasuyuki; Takano, Tatsuya; Matsushima, Toshiya; Homma, Koichi J

2008-06-15

Using cDNA microarrays, we have identified elsewhere the genes of microtubule-associated proteins as a group up-regulated in newly hatched chick brains after filial imprinting training. Here we show by in situ hybridization that the mRNA for the microtubule-associated protein 2 (MAP2) gene was enriched in the mesopallium and the hippocampus in the trained chick brain. The regionally specific enrichments of MAP2 mRNA were not observed in the brain of dark-reared or light-exposed chick as controls, implying an association between the degree of expression and the strength of the learned preference. In agreement with the gene expression, MAP2 protein was accumulated in the mesopallium of the trained chick brain, but not in the brains of the controls. The accumulation of MAP2 was found in the cytosol of neurons and co-localized with beta-tubulin, suggesting a change in microtubule assembly. Our results suggest a postnatal reorganization of cytoskeleton following filial imprinting.

Canine TCOF1; cloning, chromosome assignment and genetic analysis in dogs with different head types.

PubMed

Haworth, K E; Islam, I; Breen, M; Putt, W; Makrinou, E; Binns, M; Hopkinson, D; Edwards, Y

2001-08-01

We describe the construction of a dog embryonic head/neck cDNA library and the isolation of the dog homolog of the Treacher Collins Syndrome gene, TCOF1. The protein shows a similar three-domain structure to that described for human TCOF1, but the dog gene lacks exon 10 and contains two exons not present in the human sequence. In addition, exon 19 is differentially spliced in the dog. How these structural differences relate to TCOF1 phosphorylation is discussed. Isolation of a genomic clone allowed the exon/intron boundaries to be characterized and the dog TCOF1 gene to be mapped to CF Chr 4q31, a region syntenic to human Chr 5. Genetic analysis of DNA of dogs from 13 different breeds identified nine DNA sequence variants, three of which gave rise to amino acid substitutions. Grouping dogs according to head type showed that a C396T variant, leading to a Pro117Ser substitution, is associated with skull/face shape in our dog panel. The numbers are small, but the association between the T allele and brachycephaly, broad skull/short face, was highly significant (p = 0.000024). The short period of time during which the domestic dog breeds have been established suggests that this mutation has arisen only once in the history of dog domestication.

Genome-Wide Screening of Genes Showing Altered Expression in Liver Metastases of Human Colorectal Cancers by cDNA Microarray1

PubMed Central

Yanagawa, Rempei; Furukawa, Yoichi; Tsunoda, Tatsuhiko; Kitahara, Osamu; Kameyama, Masao; Murata, Kohei; Ishikawa, Osamu; Nakamura, Yusuke

2001-01-01

Abstract In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions. PMID:11687950

Cloning of the cocaine-sensitive bovine dopamine transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usdin, T.B.; Chen, C.; Brownstein, M.J.

1991-12-15

A cDNA encoding the dopamine transporter from bovine brain substantia nigra was identified on the basis of its structural homology to other, recently cloned, neurotransmitter transporters. The sequence of the 693-amino acid protein is quite similar to those of the rat {gamma}-aminobutyric acid, human norepinephrine, and rat serotonin transporters. Dopamine transporter mRNA was detected by in situ hybridization in the substantia nigra but not in the locus coeruleus, raphe, caudate, or other brain areas. ({sup 3}H)Dopamine accumulation in tissue culture cells transfected with the cDNA was inhibited by amphetamine, cocaine, and specific inhibitors of dopamine transports, including GBR12909.

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Intra-genomic GC heterogeneity in sauropsids: evolutionary insights from cDNA mapping and GC3 profiling in snake

PubMed Central

2012-01-01

Background Extant sauropsids (reptiles and birds) are divided into two major lineages, the lineage of Testudines (turtles) and Archosauria (crocodilians and birds) and the lineage of Lepidosauria (tuatara, lizards, worm lizards and snakes). Karyotypes of these sauropsidan groups generally consist of macrochromosomes and microchromosomes. In chicken, microchromosomes exhibit a higher GC-content than macrochromosomes. To examine the pattern of intra-genomic GC heterogeneity in lepidosaurian genomes, we constructed a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 183 cDNA clones by fluorescence in situ hybridization, and examined the correlation between the GC-content of exonic third codon positions (GC3) of the genes and the size of chromosomes on which the genes were localized. Results Although GC3 distribution of snake genes was relatively homogeneous compared with those of the other amniotes, microchromosomal genes showed significantly higher GC3 than macrochromosomal genes as in chicken. Our snake cytogenetic map also identified several conserved segments between the snake macrochromosomes and the chicken microchromosomes. Cross-species comparisons revealed that GC3 of most snake orthologs in such macrochromosomal segments were GC-poor (GC3 < 50%) whereas those of chicken orthologs in microchromosomes were relatively GC-rich (GC3 ≥ 50%). Conclusion Our results suggest that the chromosome size-dependent GC heterogeneity had already occurred before the lepidosaur-archosaur split, 275 million years ago. This character was probably present in the common ancestor of lepidosaurs and but lost in the lineage leading to Anolis during the diversification of lepidosaurs. We also identified several genes whose GC-content might have been influenced by the size of the chromosomes on which they were harbored over the course of sauropsid evolution. PMID:23140509

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed Central

Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

1994-01-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed

Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

1994-05-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA from disk abalone Haliotis discus discus.

PubMed

Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee

2010-11-01

A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.

Purification and characterization of bovine cone arrestin (cArr).

PubMed

Maeda, T; Ohguro, H; Sohma, H; Kuroki, Y; Wada, H; Okisaka, S; Murakami, A

2000-03-31

To elucidate the quenching mechanism of phototransduction in vertebrate cone photoreceptors, a cDNA clone encoding cone specific arrestin (cArr) was isolated from a bovine retinal cDNA library using a human cArr cDNA probe. Affinity-purified anti-peptide antibody specific to cArr was prepared. Immunohistochemical staining displayed specific labeling of cArr in cone photoreceptors and immunoblotting identified a 46 kDa protein band. We purified cArr from bovine retinas by sequential column chromatography using DEAE-cellulose, gel filtration and mono Q columns. Binding studies revealed no binding of cArr to rhodopsin regardless of whether it was bleached and/or phosphorylated. cArr also failed to bind to heparin-Sepharose under conditions which rod arrestin (rArr) bound to the column. The present data suggest that cArr may play a role in the quenching of phototransduction in cone photoreceptors and that its activity therein is different to that of rArr.

Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

PubMed Central

Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

2016-01-01

A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

The "grep" command but not FusionMap, FusionFinder or ChimeraScan captures the CIC-DUX4 fusion gene from whole transcriptome sequencing data on a small round cell tumor with t(4;19)(q35;q13).

PubMed

Panagopoulos, Ioannis; Gorunova, Ludmila; Bjerkehagen, Bodil; Heim, Sverre

2014-01-01

Whole transcriptome sequencing was used to study a small round cell tumor in which a t(4;19)(q35;q13) was part of the complex karyotype but where the initial reverse transcriptase PCR (RT-PCR) examination did not detect a CIC-DUX4 fusion transcript previously described as the crucial gene-level outcome of this specific translocation. The RNA sequencing data were analysed using the FusionMap, FusionFinder, and ChimeraScan programs which are specifically designed to identify fusion genes. FusionMap, FusionFinder, and ChimeraScan identified 1017, 102, and 101 fusion transcripts, respectively, but CIC-DUX4 was not among them. Since the RNA sequencing data are in the fastq text-based format, we searched the files using the "grep" command-line utility. The "grep" command searches the text for specific expressions and displays, by default, the lines where matches occur. The "specific expression" was a sequence of 20 nucleotides from the coding part of the last exon 20 of CIC (Reference Sequence: NM_015125.3) chosen since all the so far reported CIC breakpoints have occurred here. Fifteen chimeric CIC-DUX4 cDNA sequences were captured and the fusion between the CIC and DUX4 genes was mapped precisely. New primer combinations were constructed based on these findings and were used together with a polymerase suitable for amplification of GC-rich DNA templates to amplify CIC-DUX4 cDNA fragments which had the same fusion point found with "grep". In conclusion, FusionMap, FusionFinder, and ChimeraScan generated a plethora of fusion transcripts but did not detect the biologically important CIC-DUX4 chimeric transcript; they are generally useful but evidently suffer from imperfect both sensitivity and specificity. The "grep" command is an excellent tool to capture chimeric transcripts from RNA sequencing data when the pathological and/or cytogenetic information strongly indicates the presence of a specific fusion gene.

Cell cycle dependent intracellular distribution of two spliced isoforms of TCP/ILF3 proteins.

PubMed

Xu, You Hai; Leonova, Tatyana; Grabowski, Gregory A

2003-12-01

TCP80 is an approximately 80kDa mammalian cytoplasmic protein that binds to a set of mRNAs and inhibits their translation in vitro and ex vivo. This protein has high sequence similarity to interleukin-2 enhancer-binding factors (NF90/ILF3) and the M-phase phosphoprotein (MPP4)/DRBP76. A 110kDa immunologic isoform of TCP80/NF90/MPP4/DRBP76, termed TCP110, also is present in cytoplasm and nuclei of many types of cells. A cDNA sequence coding for TCP110 was derived by 5(')RACE. The TCP110 sequence is identical to ILF3. The gene coding for TCP110/ILF3 mapped to human chromosome 19 and the gene organization was analyzed using TCP80 and TCP110/ILF3 cDNA sequences. The TCP/ILF3 gene spans >34.8kb and contains 21 exons. At least one alternatively spliced product involving exons 19-21 exists and predicts the formation of either TCP80 or TCP110/ILF3. However, the functional relationships of TCP80 and TCP110/ILF3 required elucidation. The metabolic turnover rates and subcellular distribution of TCP80 and TCP110/ILF3 during the cell cycle showed TCP80 to be relatively stable (t(1/2)=5 days) in the cytoplasmic compartment. In comparison, TCP110/ILF3 migrated between the cytoplasmic and nuclear compartments during the cell cycle. The TCP110 C-terminal segment contains an additional nuclear localizing signal that plays a role in its nuclear translocation. This study indicates that the multiple cellular functions, i.e., translation control, interleukin-2 enhancer binding, or cell division, of TCP/ILF3 are fulfilled by alternatively spliced isoforms.

Characterization of the gene encoding component C3 of the complement system from the spider Loxosceles laeta venom glands: Phylogenetic implications.

PubMed

Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V

2016-09-01

A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.

Molecular characterization of Coriolus versicolor PSP-induced apoptosis in human promyelotic leukemic HL-60 cells using cDNA microarray.

PubMed

Zeng, Fanya; Hon, Chung-Chau; Sit, Wai-Hung; Chow, Ken Yan-Ching; Hui, Raymond Kin-Hi; Law, Ivy Ka-Man; Ng, Victor Wai-Lap; Yang, Xiao-Tong; Leung, Frederick Chi-Ching; Wan, Jennifer Man-Fan

2005-08-01

Proteins and peptide bound polysaccharides (PSP) extracted from Basidiomycetous fungi are widely used in cancer immunotherapy and recently demonstrated to induce apoptosis in cancer cells in vitro. In order to provide the molecular pharmacological mechanisms of PSP on human cancer cells, we investigated the gene expression profiles of PSP-treated apoptotic human promyelotic leukemic HL-60 cells using ResGen 40k IMAGE printed cDNA microarray. In total 378 and 111 transcripts were identified as differentially expressed in the apoptotic cells by at least a factor of 2 or 3, respectively. Our data show that PSP-induced apoptosis in HL-60 cells might be mediated by up-regulation of early transcription factors such as AP-1, EGR1, IER2 and IER5, and down-regulation of NF-kappaB transcription pathways. Other gene expression changes, including the increase of several apoptotic or anti-proliferation genes, such as GADD45A/B and TUSC2, and the decrease of a batch of phosphatase and kinase genes, may also provide further evidences in supporting the process of PSP induced apoptosis in cancer cells. Some of the well-characterized carcinogenesis-related gene transcripts such as SAT, DCT, Melan-A, uPA and cyclin E1 were also alternated by PSP in the HL-60 cells. These transcripts can be employed as markers for quality control of PSP products on functional levels. The present study provides new insight into the molecular mechanisms involved in PSP-induced apoptosis in leukemic HL-60 cells analyzed by cDNA microarray.

Transduction of human IL-9 receptor cDNA into TF1 cells induces IL-9 dependency and erythroid differentiation.

PubMed

Xiao, M; Luo, Z; Mantel, C; Broxmeyer, H E; Lu, L

2000-02-01

Human growth factor-dependent cell line TF1, which lacks interleukin (IL)-9 receptors (R) and does not grow in IL-9, was transduced with a retroviral vector containing human IL-9R cDNA and a selection marker. An IL-9-dependent TF1 cell line, which could also grow in other cytokines, was established after selection in G418 and could produce mature RBC in response to cytokine stimulation. TF1 cells transduced with the same viral vector without the IL-9R insert cDNA (mock control) and then selected responded the same as nontransduced TF1 cells. They failed to grow in response to IL-9 and did not generate RBC. An increased number and size of burst-forming units-erythroid (BFU-E)-like colonies were detected from IL-9R-transduced TF1 cells, compared with mock-transduced cells, in response to erythropoietin (EPO) and IL-9. To evaluate self-renewal and differentiation capacity, colony-replating assays were performed in the presence of IL-3, GM-CSF, IL-9, and EPO. After four replatings, the cloning efficiency of IL-9R-transduced TF1 cells decreased from 98% to 38%, most likely due to terminal erythroid cell differentiation. In contrast, no change in replating efficiency was detected in mock-transduced cells. TF1 cells stably expressing IL-9R and responding to IL-9 can serve as a cell line model to study the intracellular signals mediating IL-9-induced erythroid cell proliferation and differentiation.

Isolation and expression of the human gametocyte-specific factor 1 gene (GTSF1) in fetal ovary, oocytes, and preimplantation embryos.

PubMed

Huntriss, John; Lu, Jianping; Hemmings, Karen; Bayne, Rosemary; Anderson, Richard; Rutherford, Anthony; Balen, Adam; Elder, Kay; Picton, Helen M

2017-01-01

Gametocyte-specific factor 1 has been shown in other species to be required for the silencing of retrotransposons via the Piwi-interacting RNA (piRNA) pathway. In this study, we aimed to isolate and assess expression of transcripts of the gametocyte-specific factor 1 (GTSF1) gene in the human female germline and in preimplantation embryos. Complementary DNA (cDNA) libraries from human fetal ovaries and testes, human oocytes and preimplantation embryos and ovarian follicles isolated from an adult ovarian cortex biopsy were used to as templates for PCR, cloning and sequencing, and real time PCR experiments of GTSF1 expression. GTSF1 cDNA clones that covered the entire coding region were isolated from human oocytes and preimplantation embryos. GTSF1 mRNA expression was detected in archived cDNAs from staged human ovarian follicles, germinal vesicle (GV) stage oocytes, metaphase II oocytes, and morula and blastocyst stage preimplantation embryos. Within the adult female germline, expression was highest in GV oocytes. GTSF1 mRNA expression was also assessed in human fetal ovary and was observed to increase during gestation, from 8 to 21 weeks, during which time oogonia enter meiosis and primordial follicle formation first occurs. In human fetal testis, GTSF1 expression also increased from 8 to 19 weeks. To our knowledge, this report is the first to describe the expression of the human GTSF1 gene in human gametes and preimplantation embryos.

Cell-free identification of novel N-myristoylated proteins from complementary DNA resources using bioorthogonal myristic acid analogues.

PubMed

Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko

2014-11-01

To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.

Genomic organization and mutational analysis of the human UCP2 gene, a prime candidate gene for human obesity.

PubMed

Lentes, K U; Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M

1999-01-01

Uncoupling proteins (UCPs) are mitochondrial membrane transporters which are involved in dissipating the proton electrochemical gradient thereby releasing stored energy as heat. This implies a major role of UCPs in energy metabolism and thermogenesis which when deregulated are key risk factors for the development of obesity and other eating disorders. Recent studies have shown that the sympathetic nervous system, via norepinephrine (beta-adrenoceptors) and cAMP, as well as thyroid hormones and PPAR gamma ligands seem to be major regulators of UCP expression. From the three different UCPs identified so far by gene cloning UCP1 is expressed exclusively in brown adipocytes while UCP2 is widely expressed. The third analogue, UCP3, is expressed predominantly in human skeletal muscle and was found to exist in a long and a short form. At the amino acid level UCP2 has about 59% homology to UCP1 while UCP3 is 73% identical to UCP2. Both UCP2 and UCP3 were mapped in close proximity (75-150 kb) to regions of human chromosome 11 (11q13) that have been linked to obesity and hyper-insulinaemia. Furthermore, there is strong evidence that UCP2, by virtue of its ubiquitous expression, may be important for determining basal metabolic rate. Based on the published full-length cDNA sequence we have deduced the genomic structure of the human UCP2 (hUCP2) gene by PCR and direct sequence analysis. The hUCP2 gene spans over 8.4 kb distributed on 8 exons. The localization of the exon/intron boundaries within the coding region matches precisely the one found in the human UCP1 gene and is almost conserved in the recently discovered UCP3 gene as well. However, the size of each of the introns in the hUCP2 gene differs from its UCP1 and UCP3 counterparts. It varies from 81 bp (intron 5) to about 3 kb (intron 2). The high degree of homology at the nucleotide level and the conservation of the exon/intron boundaries among the three UCP genes suggests that they may have evolved from a common ancestor or are the result from gene duplication events. Mutational analysis of the hUCP2 gene in a cohort of 25 children of caucasian origin (aged 7-13) characterized by low BMR values revealed a point mutation in exon 4 (C to T transition at position 164 of the corresponding cDNA resulting in the substitution of an alanine residue by a valine at codon 55) and an insertion polymorphism in exon 8. The insertion polymorphism consists of a 45 bp repeat located 150 bp downstream of the stop codon in the 3'-UTR. The allele frequencies were 0.61 and 0.39 for the alanine and valine encoded alleles, respectively, and 0.71 versus 0.29 for the insertion polymorphism. Expression studies of the wildtype and mutant forms of UCP2 should clarify the functional consequences these mutations may have on energy metabolism and body weight regulation. In addition, mapping of the promoter region and the identification of putative promoter regulatory sequences should give insight into the transcriptional regulation of UCP2 expression--in particular by anyone of the above mentioned factors--in vitro and in vivo.

GLUT-1-independent infection of the glioblastoma/astroglioma U87 cells by the human T cell leukemia virus type 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin Qingwen; Agrawal, Lokesh; Walther Cancer Institute, Indianapolis, IN 46208

2006-09-15

The human glucose transporter protein 1 (GLUT-1) functions as a receptor for human T cell leukemia virus (HTLV). GLUT-1 is a twelve-transmembrane cell surface receptor with six extracellular (ECL) and seven intracellular domains. To analyze HTLV-1 cytotropism, we utilized polyclonal antibodies to a synthetic peptide corresponding to the large extracellular domain of GLUT-1. The antibodies caused significant blocking of envelope (Env)-mediated fusion and pseudotyped virus infection of HeLa cells but had no significant effect on infection of U87 cells. This differential effect correlated with the detection of high-level surface expression of GLUT-1 on HeLa cells and very weak staining ofmore » U87 cells. To investigate this in terms of viral cytotropism, we cloned GLUT-1 cDNA from U87 cells and isolated two different versions of cDNA clones: the wild-type sequence (encoding 492 residues) and a mutant cDNA with a 5-base pair deletion (GLUT-1{delta}5) between nucleotides 1329 and 1333. The deletion, also detected in genomic DNA, resulted in a frame-shift and premature termination producing a truncated protein of 463 residues. Transfection of the wild-type GLUT-1 but not GLUT-1{delta}5 cDNA into CHO cells resulted in efficient surface expression of the human GLUT-1. Co-expression of GLUT-1 with GLUT-1{delta}5 produces a trans-inhibition by GLUT-1{delta}5 of GLUT-1-mediated HTLV-1 envelope (Env)-mediated fusion. Co-immunoprecipitation experiments demonstrated physical interaction of the wild-type and mutant proteins. Northern blot and RT-PCR analyses demonstrated lower GLUT-1 RNA expression in U87 cells. We propose two mechanisms to account for the impaired cell surface expression of GLUT-1 on U87 cells: low GLUT-1 RNA expression and the formation of GLUT-1/GLUT-1{delta}5 heterodimers that are retained intracellularly. Significant RNAi-mediated reduction of endogenous GLUT-1 expression impaired HTLV-1 Env-mediated fusion with HeLa cells but not with U87 cells. We propose a GLUT-1-independent mechanism of HTLV-1 infection of U87 cells. The results may have important implications for HTLV-1 neurotropism and pathogenesis.« less

Characterization of a human X-linked gene from the DXS732E locus in the candidate region for the anhidrotic ectodermal dysplasia (EDA) gene (Xq13.1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gault, J.; Zonana, J.; Zeltinger, J.

A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at itsmore » 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.« less

Sperm flagella protein components: Human meichroacidin constructed by the membrane occupation and recognition nexus motif

PubMed Central

MATSUOKA, YASUHIRO; NISHIMURA, HIROMI; NUMAZAWA, KAHORI; TSUCHIDA, JUNJI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; MATSUMIYA, KIYOMI; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

2005-01-01

Background and Aims:   In a previous study, the authors of the present study cloned mouse meichroacidin (MCA), which is expressed in stages of spermatogenesis from pachytene spermatocytes through round spermatid germ cells. MCA protein contains the membrane occupation and recognition nexus (MORN) motif and localizes to a male meiotic metaphase chromosome. Recently, a MCA homolog of carp (Cyprinus carpio), MORN motif‐containing sperm‐specific axonemal protein (MSAP), was reportedly identified and localized in sperm flagella. Present knowledge of human spermiogenesis requires the identification of proteins in human sperm. The present study identified the human orthologue of MCA. Methods:   Colony hybridization using a human testis plasmid cDNA library was carried out to clone human MCA (h‐MCA) cDNA. Northern blot, Western blot, and immunohistochemical analyses were carried out. Results:   h‐MCA was found to be specifically expressed in the testes. The h‐MCA amino acid sequence shared 79.8% identity with mouse MCA and contained MORN motifs. h‐MCA localized in the sperm flagellum and basal body, as does MSAP in carp. Conclusion:   Expression and localization analyses showed that h‐MCA is a component of the sperm flagellum and basal body and might play an important role in the development of the sperm flagellum in humans. (Reprod Med Biol 2005; 4: 213–219) PMID:29699225

Virtual Northern analysis of the human genome.

PubMed

Hurowitz, Evan H; Drori, Iddo; Stodden, Victoria C; Donoho, David L; Brown, Patrick O

2007-05-23

We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes.

Bovine adipose triglyceride lipase is not altered and adipocyte fatty acid binding protein is increased by dietary flaxseed

USDA-ARS?s Scientific Manuscript database

In this paper, we report the full length coding sequence of bovine ATGL cDNA are reported and analyze its expression in bovine tissues. Similar to human, mouse, and pig ATGL sequences, bovine ATGL has a highly conserved patatin domain that is necessary for lipolytic function in mice and humans. Thi...

Human parainfluenza virus type 3 (HPIV-3); Construction and rescue of an infectious, recombinant virus expressing the enhanced green fluorescent protein (EGFP).

USDA-ARS?s Scientific Manuscript database

The ability to rescue an infectious, recombinant, RNA virus from a cDNA clone, has led to new opportunities for measuring viral replication from a viral expressed reporter gene. In this protocol, the process of inserting enhanced green fluorescent protein (EGFP) gene into the human parainfluenza vi...

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

PubMed Central

Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

1993-01-01

A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

Molecular Cloning, Bioinformatics Analysis and Expression of Insulin-Like Growth Factor 2 from Tianzhu White Yak, Bos grunniens

PubMed Central

Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu

2014-01-01

The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317

Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

PubMed

Yokozaki, H; Tahara, H; Oue, N; Tahara, E

2000-01-01

A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.

PubMed

Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine

2005-08-01

Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

Generation and reactivation of T-cell receptor A joining region pseudogenes in primates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thiel, C.; Lanchbury, J.S.; Otting, N.

1996-06-01

Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications thatmore » differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.« less

Transcriptome analysis of Schistosoma mansoni larval development using serial analysis of gene expression (SAGE).

PubMed

Taft, A S; Vermeire, J J; Bernier, J; Birkeland, S R; Cipriano, M J; Papa, A R; McArthur, A G; Yoshino, T P

2009-04-01

Infection of the snail, Biomphalaria glabrata, by the free-swimming miracidial stage of the human blood fluke, Schistosoma mansoni, and its subsequent development to the parasitic sporocyst stage is critical to establishment of viable infections and continued human transmission. We performed a genome-wide expression analysis of the S. mansoni miracidia and developing sporocyst using Long Serial Analysis of Gene Expression (LongSAGE). Five cDNA libraries were constructed from miracidia and in vitro cultured 6- and 20-day-old sporocysts maintained in sporocyst medium (SM) or in SM conditioned by previous cultivation with cells of the B. glabrata embryonic (Bge) cell line. We generated 21 440 SAGE tags and mapped 13 381 to the S. mansoni gene predictions (v4.0e) either by estimating theoretical 3' UTR lengths or using existing 3' EST sequence data. Overall, 432 transcripts were found to be differentially expressed amongst all 5 libraries. In total, 172 tags were differentially expressed between miracidia and 6-day conditioned sporocysts and 152 were differentially expressed between miracidia and 6-day unconditioned sporocysts. In addition, 53 and 45 tags, respectively, were differentially expressed in 6-day and 20-day cultured sporocysts, due to the effects of exposure to Bge cell-conditioned medium.

Chromosomal localization of the human V3 pituitary vasopressin receptor gene (AVPR3) to 1q32

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rousseau-Merck, M.F.; Derre, J.; Berger, R.

1995-11-20

Vasopressin exerts its physiological effects on liver metabolism, fluid osmolarity, and corticotrophic response to stress through a set of at least three receptors, V1a, V2, and V3 (also called V1b), respectively. These receptors constitute a distinct group of the superfamily of G-protein-coupled cell surface receptors. When bound to vasopressin, they couple to G proteins activating phospholipase C for the V1a and V3 types and adenylate cyclase for the V2. The vasopressin receptor subfamily also includes the receptor for oxytocin, a structurally related hormone that signals through the activation of phospholipase C. The chromosomal position of the V2 receptor gene hasmore » been assigned to Xq28-qter by PCR-based screening of somatic cell hybrids, whereas the oxytocin receptor gene has been mapped to chromosome 3q26.2 by fluorescence in situ hybridization (FISH). The chromosomal location of the V1a gene is currently unknown. We recently cloned the cDNA and the gene coding for the human pituitary-specific V3 receptor (HGMW-approved symbol AVPR3). We report here the chromosomal localization of this gene by two distinct in situ hybridization techniques using radioactive and fluorescent probes. 11 refs., 1 fig.« less

STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.

PubMed Central

Small, D; Levenstein, M; Kim, E; Carow, C; Amin, S; Rockwell, P; Witte, L; Burrow, C; Ratajczak, M Z; Gewirtz, A M

1994-01-01

We cloned the cDNA for stem cell tyrosine kinase 1 (STK-1), the human homolog of murine Flk-2/Flt-3, from a CD34+ hematopoietic stem cell-enriched library and investigated its expression in subsets of normal human bone marrow. The cDNA encodes a protein of 993 aa with 85% identity and 92% similarity to Flk-2/Flt-3. STK-1 is a member of the type III receptor tyrosine kinase family that includes KIT (steel factor receptor), FMS (colony-stimulating factor 1R), and platelet-derived growth factor receptor. STK-1 expression in human blood and marrow is restricted to CD34+ cells, a population greatly enriched for stem/progenitor cells. Anti-STK-1 antiserum recognizes polypeptides of 160 and 130 kDa in several STK-1-expressing cell lines and in 3T3 cells transfected with a STK-1 expression vector. Antisense oligonucleotides directed against STK-1 sequences inhibited hematopoietic colony formation, most strongly in long-term bone marrow cultures. These data suggest that STK-1 may function as a growth factor receptor on hematopoietic stem and/or progenitor cells. Images Fig. 2 Fig. 3 Fig. 4 PMID:7507245

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Human MSH2 protein

DOEpatents

Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

1997-01-07

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

Human MSH2 protein

DOEpatents

de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

1997-01-01

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

hEcd, A Novel Regulator of Mammary Epithelial Cell Survival

DTIC Science & Technology

2009-09-01

theYeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient oncogene to immortalize hMECs in vitro) as a bait and mammary...transformation. We have identified a novel protein us ing the Yeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient...epithelial cell cDNA library, we identified hEcd ( human orthologue of Drosophila Ecdysoneless) as a novel E6 binding partner. To study the cellular

LIFEdb: a database for functional genomics experiments integrating information from external sources, and serving as a sample tracking system

PubMed Central

Bannasch, Detlev; Mehrle, Alexander; Glatting, Karl-Heinz; Pepperkok, Rainer; Poustka, Annemarie; Wiemann, Stefan

2004-01-01

We have implemented LIFEdb (http://www.dkfz.de/LIFEdb) to link information regarding novel human full-length cDNAs generated and sequenced by the German cDNA Consortium with functional information on the encoded proteins produced in functional genomics and proteomics approaches. The database also serves as a sample-tracking system to manage the process from cDNA to experimental read-out and data interpretation. A web interface enables the scientific community to explore and visualize features of the annotated cDNAs and ORFs combined with experimental results, and thus helps to unravel new features of proteins with as yet unknown functions. PMID:14681468

Reverse Transcriptase Activity in Mature Spermatozoa of Mouse

PubMed Central

Giordano, Roberto; Magnano, Anna Rosa; Zaccagnini, Germana; Pittoggi, Carmine; Moscufo, Nicola; Lorenzini, Rodolfo; Spadafora, Corrado

2000-01-01

We show here that a reverse transcriptase (RT) activity is present in murine epididymal spermatozoa. Sperm cells incubated with human poliovirus RNA can take up exogenous RNA molecules and internalize them in nuclei. Direct PCR amplification of DNA extracted from RNA-incubated spermatozoa indicate that poliovirus RNA is reverse-transcribed in cDNA fragments. PCR analysis of two-cell embryos shows that poliovirus RNA-challenged spermatozoa transfer retrotranscribed cDNA molecules into eggs during in vitro fertilization. Finally, RT molecules can be visualized on sperm nuclear scaffolds by immunogold electron microscopy. These results, therefore, reveal a novel metabolic function in spermatozoa, which may play a role during early embryonic development. PMID:10725323

Generation and characterization of a human-mouse chimeric high-affinity antibody that detects the DYKDDDDK FLAG peptide.

PubMed

Ikeda, Koki; Koga, Tomoaki; Sasaki, Fumiyuki; Ueno, Ayumi; Saeki, Kazuko; Okuno, Toshiaki; Yokomizo, Takehiko

2017-05-13

DYKDDDDK peptide (FLAG) is a useful tool for investigating the function and localization of proteins whose antibodies (Abs) are not available. We recently established a high-affinity monoclonal antibody (mAb) for FLAG (clone 2H8). The 2H8 Ab is highly sensitive for detecting FLAG-tagged proteins by flowcytometry and immunoprecipitation, but it can yield nonspecific signals in immunohistochemistry of mouse tissues because it is of mouse origin. In this study, we reduced nonspecific signals by generating a chimeric 2H8 Ab with Fc fragments derived from human immunoglobulin. We fused a 5' terminal cDNA fragments for the Fab region of 2H8 mAb with 3' terminal cDNA fragments for Fc region of human IgG1. We transfected both chimeric plasmids and purified the resulting human-mouse chimeric 2H8. The chimeric 2H8 Ab successfully detected FLAG-tagged proteins in flowcytometry with anti-human IgG secondary Ab with comparable sensitivity to 2H8 mAb. Importantly, chimeric 2H8 detected specific FLAG peptide signals without nonspecific signals in immunohistochemical analysis with mouse tissues. This human-mouse chimeric high-affinity anti-FLAG Ab will prove useful for future immunohistochemical analysis of mouse tissues. Copyright © 2017 Elsevier Inc. All rights reserved.

An anti-tumor protein produced by Trichinella spiralis and identified by screening a T7 phage display library, induces apoptosis in human hepatoma H7402 cells

USDA-ARS?s Scientific Manuscript database

Trichinella spiralis infection confers effective resistance to tumor cell expansion. In this study, a T7 phage cDNA display library was constructed to express genes encoded by T. spiralis. Organic phase multi-cell screening was used to sort through candidate proteins in a transfected human chronic m...

The human serotonin 5-HT{sub 2C} receptor: Complete cDNA, genomic structure, and alternatively spliced variant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun

1996-08-01

The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less

Cholesterol biosynthesis from lanosterol: molecular cloning, chromosomal localization, functional expression and liver-specific gene regulation of rat sterol delta8-isomerase, a cholesterogenic enzyme with multiple functions.

PubMed Central

Bae, S; Seong, J; Paik, Y

2001-01-01

Sterol Delta(8)-isomerase (SI) (EC 5.3.3.5), also known as emopamil binding protein or sigma receptor, catalyses the conversion of the 8-ene isomer into the 7-ene isomer in the cholesterol biosynthetic pathway in mammals. Recently, mutations of SI have been found to be associated with Conradi-Hünermann syndrome in humans. To investigate the in vitro and in vivo modes of molecular regulation of SI and its role in cholesterol biosynthesis in mammals, we isolated a full-length cDNA encoding rat SI. The deduced amino-acid sequence of rat SI predicts a 230-residue protein (26737 Da) with 87% and 80% amino-acid identity to mouse and human counterparts. The rat SI gene was mapped to chromosome 12q1.2 using fluorescence in situ hybridization (FISH). The biological function of the cloned rat SI cDNA was verified by overexpressing recombinant Myc-SI in Saccharomyces cerevisiae. It showed a characteristic pattern of inhibition on exposure to trans-2-[4-(1,2-diphenylbuten-1-yl)phenoxy]-N,N-dimethylethylamine (tamoxifen; IC(50)=11.2 microM) and 3beta-[2-(diethylamino)ethoxy]androst-5-en-17-one (U18666A; IC(50)=4.2 microM), two well known potent inhibitors of SI. Northern-blot analysis of 3-week-old rats compared with 2-year-old rats showed that SI mRNA expression in both age groups was restricted to liver, where a 70% reduction in mRNA levels was observed in 2-year-old rats. The FISH studies revealed ubiquitous expression of SI mRNA in rat hepatocytes. The in vitro studies showed that the SI mRNA was highly suppressed by 25-hydroxycholesterol in H4IIE cells. Treatment of H4IIE cells grown in medium supplemented with fetal bovine serum with tamoxifen for 24 h resulted in a dose-dependent induction of SI mRNA, with a concomitant suppression of sterol regulatory element binding protein-1 mRNA. Interestingly, this effect was not seen in emopamil-treated cells. The in vivo experiments also indicate that both mRNA expression and enzymic activity of SI in liver were induced approx. 3-fold in rats fed 5% (w/w) cholestyramine plus 0.1% (w/w) lovastatin in normal chow for 2 weeks. With this newly cloned rat SI cDNA, it becomes possible to gain molecular understanding of previously unknown and tamoxifen-mediated gene regulation of SI that is involved in cholesterol metabolism, ischaemia and genetic diseases. PMID:11171067

Purification and cDNA cloning of a protein derived from Flammulina velutipes that increases the permeability of the intestinal Caco-2 cell monolayer.

PubMed

Watanabe, H; Narai, A; Shimizu, M

1999-06-01

A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.

A novel RET rearrangement (ACBD5/RET) by pericentric inversion, inv(10)(p12.1;q11.2), in papillary thyroid cancer from an atomic bomb survivor exposed to high-dose radiation.

PubMed

Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro

2014-11-01

During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.

Molecular cloning and expression of rat liver bile acid CoA ligase.

PubMed

Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen

2002-12-01

Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.

The gene for fibroblast activation protein {alpha} (FAP), a putative cell surface-bound serine protease expressed in cancer stroma and wound healing, maps to chromosome band 2q23

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mathew, S.; Murty, V.V.V.S.; Chaganti, R.S.K.

The human fibroblast activation protein {alpha} (FAP{alpha}) is an inducible cell surface glycoprotein of M{sub r} 95,000 recognized by a number of monoclonal antibodies (mAbs), including the prototype mAb F19. Immunohistochemical studies have shown that FAP{alpha} expression in vivo is tightly regulated, with transient expression in some fetal mesenchymal tissues but absence of expression in most normal adult tissues. Reexpression of FAP{alpha} is observed in the reactive stromal fibroblasts of several common types of epithelial cancers, including >90% of breast, colorectal, and lung carcinomas and healing wounds. Cloning and sequence analysis of an FAP{alpha}-specific cDNA has revealed that the moleculemore » is encoded by a novel gene, FAP, which shows sequence similarity to members of the serine protease family of integral membrane proteins, namely dipeptidyl peptidase IV (DPPIV, also known as lymphocyte activation antigen, CD26, or adenosine dearoinase binding protein) and DPPX, a DPPIV-related molecule of unknown function. 15 refs., 1 fig.« less

Characterization of a full-length infectious cDNA clone and a GFP reporter derivative of the oncolytic picornavirus SVV-001.

PubMed

Poirier, John T; Reddy, P Seshidhar; Idamakanti, Neeraja; Li, Shawn S; Stump, Kristine L; Burroughs, Kevin D; Hallenbeck, Paul L; Rudin, Charles M

2012-12-01

Seneca Valley virus (SVV-001) is an oncolytic picornavirus with selective tropism for a subset of human cancers with neuroendocrine differentiation. To characterize further the specificity of SVV-001 and its patterns and kinetics of intratumoral spread, bacterial plasmids encoding a cDNA clone of the full-length wild-type virus and a derivative virus expressing GFP were generated. The full-length cDNA of the SVV-001 RNA genome was cloned into a bacterial plasmid under the control of the T7 core promoter sequence to create an infectious cDNA clone, pNTX-09. A GFP reporter virus cDNA clone, pNTX-11, was then generated by cloning a fusion protein of GFP and the 2A protein from foot-and-mouth disease virus immediately following the native SVV-001 2A sequence. Recombinant GFP-expressing reporter virus, SVV-GFP, was rescued from cells transfected with in vitro RNA transcripts from pNTX-11 and propagated in cell culture. The proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable. The SVV-GFP reporter virus was used to determine that a subpopulation of permissive cells is present in small-cell lung cancer cell lines previously thought to lack permissivity to SVV-001. Finally, it was shown that SVV-GFP administered to tumour-bearing animals homes in to and infects tumours whilst having no detectable tropism for normal mouse tissues at 1×10(11) viral particles kg(-1), a dose equivalent to that administered in ongoing clinical trials. These infectious clones will be of substantial value in further characterizing the biology of this virus and as a backbone for the generation of additional oncolytic derivatives.

Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis

PubMed Central

Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S

2002-01-01

Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333

Improbability of Effective Vaccination Against Human Immunodeficiency Virus Because of Its Intracellular Transmission and Rectal Portal of Entry

NASA Astrophysics Data System (ADS)

Sabin, Albert B.

1992-09-01

The worldwide effort to produce a vaccine against AIDS continues to disregard the fact that even human immunodeficiency virus (HIV)-specific neutralizing antibodies and cell-mediated immunity are ineffective against virus within cells without viral antigens on the cell membrane-and that much of HIV infection is transmitted in this manner. According to a recent report, a simian immunodeficiency virus vaccine that protected monkeys against an intravenous challenge with cell-free virus was, as predicted, ineffective against an intravenous challenge with the same amount of virus in infected cells. Moreover, antibody and HIV have been found to coexist in cell-free plasma from asymptomatic and symptomatic patients. Excluding direct introduction of HIV into the bloodstream, the most common and efficient form of transmission of HIV infection is by receptive anal intercourse, and semen contains large numbers of infected cells per milliliter. Recent reports showing that colorectal cells can be persistently infected by HIV and that HIV RNA and cDNA are present in the cells of the colon of dead AIDS patients indicate that either cell-free or intracellular HIV has the capacity to multiply at the portal of entry in the colorectal area without interference from neutralizing antibodies. The available data provide no basis for testing any HIV vaccine in human beings either before or after infection. The main challenge is to find a way to kill cells with chromosomally integrated HIV cDNA without harming normal cells, perhaps by identifying repressor proteins that might be produced by the cells with integrated HIV cDNA and thus could become specific targets for cell-killing drugs.

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Phylogenetic and Structural Analysis of the Pluripotency Factor Sex-Determining Region Y box2 Gene of Camelus dromedarius (cSox2).

PubMed

Alawad, Abdullah; Alharbi, Sultan; Alhazzaa, Othman; Alagrafi, Faisal; Alkhrayef, Mohammed; Alhamdan, Ziyad; Alenazi, Abdullah; Al-Johi, Hasan; Alanazi, Ibrahim O; Hammad, Mohamed

2016-01-01

Although the sequencing information of Sox2 cDNA for many mammalian is available, the Sox2 cDNA of Camelus dromedaries has not yet been characterized. The objective of this study was to sequence and characterize Sox2 cDNA from the brain of C. dromedarius (also known as Arabian camel). A full coding sequence of the Sox2 gene from the brain of C. dromedarius was amplified by reverse transcription PCRjmc and then sequenced using the 3730XL series platform Sequencer (Applied Biosystem) for the first time. The cDNA sequence displayed an open reading frame of 822 nucleotides, encoding a protein of 273 amino acids. The molecular weight and the isoelectric point of the translated protein were calculated as 29.825 kDa and 10.11, respectively, using bioinformatics analysis. The predicted cSox2 protein sequence exhibited high identity: 99% for Homo sapiens, Mus musculus, Bos taurus, and Vicugna pacos; 98% for Sus scrofa and 93% for Camelus ferus. A 3D structure was built based on the available crystal structure of the HMG-box domain of human stem cell transcription factor Sox2 (PDB: 2 LE4) with 81 residues and predicting bioinformatics software for 273 amino acid residues. The comparison confirms the presence of the HMG-box domain in the cSox2 protein. The orthologous phylogenetic analysis showed that the Sox2 isoform from C. dromedarius was grouped with humans, alpacas, cattle, and pigs. We believe that this genetic and structural information will be a helpful source for the annotation. Furthermore, Sox2 is one of the transcription factors that contributes to the generation-induced pluripotent stem cells (iPSCs), which in turn will probably help generate camel induced pluripotent stem cells (CiPSCs).

Effectiveness of Liquid Soap and Hand Sanitizer against Norwalk Virus on Contaminated Hands▿

PubMed Central

Liu, Pengbo; Yuen, Yvonne; Hsiao, Hui-Mien; Jaykus, Lee-Ann; Moe, Christine

2010-01-01

Disinfection is an essential measure for interrupting human norovirus (HuNoV) transmission, but it is difficult to evaluate the efficacy of disinfectants due to the absence of a practicable cell culture system for these viruses. The purpose of this study was to screen sodium hypochlorite and ethanol for efficacy against Norwalk virus (NV) and expand the studies to evaluate the efficacy of antibacterial liquid soap and alcohol-based hand sanitizer for the inactivation of NV on human finger pads. Samples were tested by real-time reverse transcription-quantitative PCR (RT-qPCR) both with and without a prior RNase treatment. In suspension assay, sodium hypochlorite concentrations of ≥160 ppm effectively eliminated RT-qPCR detection signal, while ethanol, regardless of concentration, was relatively ineffective, giving at most a 0.5 log10 reduction in genomic copies of NV cDNA. Using the American Society for Testing and Materials (ASTM) standard finger pad method and a modification thereof (with rubbing), we observed the greatest reduction in genomic copies of NV cDNA with the antibacterial liquid soap treatment (0.67 to 1.20 log10 reduction) and water rinse only (0.58 to 1.58 log10 reduction). The alcohol-based hand sanitizer was relatively ineffective, reducing the genomic copies of NV cDNA by only 0.14 to 0.34 log10 compared to baseline. Although the concentrations of genomic copies of NV cDNA were consistently lower on finger pad eluates pretreated with RNase compared to those without prior RNase treatment, these differences were not statistically significant. Despite the promise of alcohol-based sanitizers for the control of pathogen transmission, they may be relatively ineffective against the HuNoV, reinforcing the need to develop and evaluate new products against this important group of viruses. PMID:19933337

Molecular characterization and expression analysis of osteopontin cDNA from lactating mammary gland in yak (Bos grunniens).

PubMed

Bai, W L; Yang, R J; Yin, R H; Jiang, W Q; Luo, G B; Yin, R L; Zhao, S J; Li, C; Zhao, Z H

2012-04-01

Osteopontin (OPN) is a secreted phosphorylated glycoprotein. It has an important role in mammary gland development and lactation, as well as, is thought to be a potential candidate gene for lactation traits. In the present work, we isolated and characterized a full-length open reading frame (ORF) of yak OPN cDNA from lactating mammary tissue, and examined its expression pattern in mammary gland during different stages of lactation, as well as, the recombinant OPN protein of yak was expressed successfully in E. coli. The sequencing results indicated that the isolated cDNA was 1132-bp in length containing a complete ORF of 837-bp. It encoded a precursor protein of yak OPN consisting of 278 amino acid with a signal peptide of 16 amino acids. Yak OPN has a predicted molecular mass of 29285.975 Da and an isoelectric point of 4.245. It had an identity of 65.50-99.16% in cDNA, identity of 52.06-98.56% and similarity of 65.40-98.56% in deduced amino acids with the corresponding sequences of cattle, buffalo, sheep, goat, pig, human, and rabbit. The phylogenetic analysis indicated that yak OPN had the closest evolutionary relationship with that of cattle, and next buffalo. In mammary gland, yak OPN was generally transcribed in a declining pattern from colostrum period to dry period with an apparent increase of OPN expression being present in the late period of lactation compared with peak period of lactation. Western blot analysis indicated that His-tagged yak OPN protein expressed in E. coli could be recognized not only by an anti-His-tag antibody but also by an anti-human OPN antibody. These results from the present work provided a foundation for further insight into the role of OPN gene in yak lactation.

Molecular cloning of human protein 4.2: a major component of the erythrocyte membrane.

PubMed Central

Sung, L A; Chien, S; Chang, L S; Lambert, K; Bliss, S A; Bouhassira, E E; Nagel, R L; Schwartz, R S; Rybicki, A C

1990-01-01

Protein 4.2 (P4.2) comprises approximately 5% of the protein mass of human erythrocyte (RBC) membranes. Anemia occurs in patients with RBCs deficient in P4.2, suggesting a role for this protein in maintaining RBC stability and integrity. We now report the molecular cloning and characterization of human RBC P4.2 cDNAs. By immunoscreening a human reticulocyte cDNA library and by using the polymerase chain reaction, two cDNA sequences of 2.4 and 2.5 kilobases (kb) were obtained. These cDNAs differ only by a 90-base-pair insert in the longer isoform located three codons downstream from the putative initiation site. The 2.4- and 2.5-kb cDNAs predict proteins of approximately 77 and approximately 80 kDa, respectively, and the authenticity was confirmed by sequence identity with 46 amino acids of three cyanogen bromide-cleaved peptides of P4.2. Northern blot analysis detected a major 2.4-kb RNA species in reticulocytes. Isolation of two P4.2 cDNAs implies existence of specific regulation of P4.2 expression in human RBCs. Human RBC P4.2 has significant homology with human factor XIII subunit a and guinea pig liver transglutaminase. Sequence alignment of P4.2 with these two transglutaminases, however, revealed that P4.2 lacks the critical cysteine residue required for the enzymatic crosslinking of substrates. Images PMID:1689063

Molecular cloning of a novel widely expressed human 80 kDa 17 beta-hydroxysteroid dehydrogenase IV.

PubMed Central

Adamski, J; Normand, T; Leenders, F; Monté, D; Begue, A; Stéhelin, D; Jungblut, P W; de Launoit, Y

1995-01-01

Reactions of oestrogens and androgens at position C-17 are catalysed by 17 beta-hydroxysteroid dehydrogenases (17 beta-HSDs). Cloning of the cDNA of a novel human 17 beta-HSD IV and expression of its mRNA are described. A probe derived from the recently discovered porcine 17 beta-oestradiol dehydrogenase (17 beta-EDH) was used to isolate a 2.6 kb human cDNA encoding a continuous protein of 736 amino acids of high (84%) similarity to the porcine 17 beta-EDH. The calculated molecular mass of the human enzyme is 79,595 Da. Other sequence similarities shared by the two enzymes are: an N-terminal sequence which is similar to that of members of the short-chain alcohol dehydrogenase family; amino acids 343-607 which are similar to the C-terminal domains of a trifunctional Candida tropicalis enzyme and the FOX2 gene product of Saccharomyces cerevisiae; amino acids 596-736 which are similar to human sterol carrier protein 2. The previously cloned human 17 beta-HSD I, II and III are less than 25% identical with 17 beta-HSD IV. mRNA for HSD IV is a single species of 3.0 kb, present in many tissues with highest concentrations in liver, heart, prostate and testes. When over-expressed in mammalian cells, the human 17 beta-HSD IV enzyme displays a specific unidirectional oxidative 17 beta-HSD activity. Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7487879

Virtual Northern Analysis of the Human Genome

PubMed Central

Hurowitz, Evan H.; Drori, Iddo; Stodden, Victoria C.; Donoho, David L.; Brown, Patrick O.

2007-01-01

Background We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. Methodology/Principal Findings We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Conclusions/Significance Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes. PMID:17520019

Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.

PubMed

Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei

2018-01-01

Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.

Genetic mutation underlying orthostatic intolerance and diagnostic and therapeutic methods relating thereto

NASA Technical Reports Server (NTRS)

Blakely, Randy D. (Inventor); Robertson, David (Inventor)

2006-01-01

Isolated polynucleotide molecules and peptides encoded by these molecules are used in the analysis of human norepinephrine (NE) transporter variants, as well as in diagnostic and therapeutic applications, relating to a human NE transporter polymorphism. By analyzing genomic DNA or amplified genomic DNA, or amplified cDNA derived from mRNA, it is possible to type a human NE transporter with regard to the human NE transporter polymorphism, for example, in the context of diagnosing and treating NE transport impairments, and disorders associated with NE transport impairments, such as orthostatic intolerance.

Characterization of transformation related genes in oral cancer cells.

PubMed

Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

1998-04-16

A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

PubMed

Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

1995-12-12

Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

Cloning of a new member of the insulin gene superfamily (INSL4) expressed in human placenta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chassin, D.; Laurent, A.; Janneau, J.L.

1995-09-20

A new member of the insulin gene superfamily was identified by screening a subtracted cDNA library of first-trimester human placenta and, hence, was tentatively named early placenta insulin-like peptide (EPIL). In this paper, we report the cloning and sequencing of the EPIL cDNA and the EPIL gene (INSL4). Comparison of the deduced amino acid sequence of the early placenta insulin-like peptide revealed significant overall and structural homologies with members of the insulin-like hormone superfamily. Moreover, the organization of the early placenta insulin-like gene, which is composed of two exons and one intron, is similiar to that of insulin and relaxin.more » By in situ hybridization, the INSL4 gene was assigned to band p24 of the short arm of chromosome 9. RT-PCR analysis of EPIL tissue distribution revealed that its transcripts are expressed in the placenta and uterus. 22 refs., 3 figs.« less

A fine structure genomic map of the region of 12q13 containing SAS and CDK4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linder, C.Y.; Elkahloun, A.G.; Su, Y.A.

1994-09-01

We have recently adapted a method, originally described by Rackwitz, to the rapid restriction mapping of multiple cosmid DNA samples. Linearization of the cosmids at the lambda cohesive site using lambda terminase is followed by partial digestion with selected restriction enzymes and hybridization to oligonucleotides specific for the right or left hand termini. Partial digestions are performed in a microtiter plate thus allowing up to 12 cosmid clones to be digested with one restriction enzyme. We have applied this rapid restriction mapping method to cosmids derived from a region of chromosome 12q13 that has recently been shown to be amplifiedmore » in a variety of cancers including malignant fibrous histiocytoma, fibrosarcoma, liposarcoma, osteosarcoma and brain tumors. A small segment of this amplification unit containing three genes, SAS (a membrane protein), CDK4 (a cyclin dependent kinase) and OS-9 (a recently described cDNA) has been analyzed with the system described above. This fine structure genomic map will be useful for completing the expression map of this region as well as characterizing its pattern of amplification in tumor specimens.« less

Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

PubMed

Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

1994-08-02

Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

Organization of the murine Cd22 locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.

1993-07-01

Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

Mapping the Interactions of Dengue Virus NS1 Protein with Human Liver Proteins Using a Yeast Two-Hybrid System: Identification of C1q as an Interacting Partner

PubMed Central

Allonso, Diego; Nogueira, Mauricio L.; Mohana-Borges, Ronaldo

2013-01-01

Dengue constitutes a global health concern. The clinical manifestation of this disease varies from mild febrile illness to severe hemorrhage and/or fatal hypovolemic shock. Flavivirus nonstructural protein 1 (NS1) is a secreted glycoprotein that is displayed on the surface of infected cells but is absent in viral particles. NS1 accumulates at high levels in the plasma of dengue virus (DENV)-infected patients, and previous reports highlight its involvement in immune evasion, dengue severity, liver dysfunction and pathogenesis. In the present study, we performed a yeast two-hybrid screen to search for DENV2 NS1-interacting partners using a human liver cDNA library. We identified fifty genes, including human complement component 1 (C1q), which was confirmed by coimmunoprecipitation, ELISA and immunofluorescence assays, revealing for the first time the direct binding of this protein to NS1. Furthermore, the majority of the identified genes encode proteins that are secreted into the plasma of patients, and most of these proteins are classified as acute-phase proteins (APPs), such as plasminogen, haptoglobin, hemopexin, α-2-HS-glycoprotein, retinol binding protein 4, transferrin, and C4. The results presented here confirm the direct interaction of DENV NS1 with a key protein of the complement system and suggest a role for this complement protein in the pathogenesis of DENV infection. PMID:23516407

A novel er1 allele and the development and validation of its functional marker for breeding pea (Pisum sativum L.) resistance to powdery mildew.

PubMed

Sun, Suli; Deng, Dong; Wang, Zhongyi; Duan, Canxing; Wu, Xiaofei; Wang, Xiaoming; Zong, Xuxiao; Zhu, Zhendong

2016-05-01

A novel er1 allele, er1 -7, conferring pea powdery mildew resistance was characterized by a 10-bp deletion in PsMLO1 cDNA, and its functional marker was developed and validated in pea germplasms. Pea powdery mildew caused by Erysiphe pisi DC is a major disease worldwide. Pea cultivar 'DDR-11' is an elite germplasm resistant to E. pisi. To identify the gene conferring resistance in DDR-11, the susceptible Bawan 6 and resistant DDR-11 cultivars were crossed to produce F1, F2, and F(2:3) populations. The phenotypic segregation patterns in the F2 and F(2:3) populations fit the 3:1 (susceptible:resistant) and 1:2:1 (susceptible homozygotes:heterozygotes:resistant homozygotes) ratios, respectively, indicating that resistance was controlled by a single recessive gene. Analysis of er1-linked markers in the F2 population suggested that the recessive resistance gene in DDR-11 was an er1 allele, which was mapped between markers ScOPE16-1600 and c5DNAmet. To further characterize er1 allele, the cDNA sequences of PsMLO1 from the parents were obtained and a novel er1 allele in DDR-11 was identified and designated as er1-7, which has a 10-bp deletion in position 111-120. The er1-7 allele caused a frame-shift mutation, resulting in a premature termination of translation of PsMLO1 protein. A co-dominant functional marker specific for er1-7 was developed, InDel111-120, which co-segregated with E. pisi resistance in the mapping population. The marker was able to distinguish between pea germplasms with and without the er1-7. Of 161 pea germplasms tested by InDel111-120, seven were detected containing resistance allele er1-7, which was verified by sequencing their PsMLO1 cDNA. Here, a novel er1 allele was characterized and its an ideal functional marker was validated, providing valuable genetic information and a powerful tool for breeding pea resistance to powdery mildew.

Molecular cloning of a human Ca2+-dependent cell-cell adhesion molecule homologous to mouse placental cadherin: its low expression in human placental tissues

PubMed Central

1989-01-01

P-cadherin is a subclass of Ca2+-dependent cell-cell adhesion molecules present in mouse placenta, where its localization suggests a function of connecting the embryo to the uterus (Nose, A., and M. Takeichi. 1986. J. Cell Biol. 103:2649-2658). We recently identified a human cadherin detected by an mAb capable of disrupting cell-cell adhesion of A-431 cells, and found that it was closely related immunochemically to mouse P-cadherin. Curiously, this cadherin was undetectable in human placenta by immunohistochemical examination (Shimoyama, Y., S. Hirohashi, S. Hirano, M. Noguchi, Y. Shimosato, M. Takeichi, and O. Abe. 1989. Cancer Res. 49:2128-2133). We here report the cloning and sequencing of cDNA clone encoding the human homologue of mouse P- cadherin. The deduced amino acid sequence of the human P-cadherin consists of 829 amino acid and shows striking homology with mouse P- cadherin. On Northern blot analysis, human P-cadherin was scarcely expressed in human placenta in contrast to mouse P-cadherin, which was abundantly expressed in mouse placenta throughout pregnancy, and it was shown that E-cadherin, but not P-cadherin, was the major cadherin molecule in human placenta. Moreover, NIH3T3 cells transfected with human P-cadherin cDNA expressed the functional cadherin molecule, which was identical to the cadherin we had previously identified using the mAb, showing that this molecule really does mediate cell-cell adhesion and that the cadherin we detected immunochemically is undoubtedly human P-cadherin. The results obtained in this study support the idea that P- cadherin plays little role, if any, in Ca2+-dependent cell-cell binding in human placental tissue at least after several weeks of pregnancy. PMID:2793940

Cloning of apg-2 encoding a novel member of heat shock protein 110 family.

PubMed

Kaneko, Y; Kimura, T; Kishishita, M; Noda, Y; Fujita, J

1997-04-11

Chinese hamster heat shock protein 110-encoding gene (hsp110), mouse apg-1 and human hsp70RY are structurally related genes, with the first two encoding about 110-kDa HSPs [Yoon et al. (1995) J. Biol. Chem. 270, 15725-15733; Kaneko et al. (1997) J. Biol. Chem., in press; Fathallah et al. (1993) J. Immunol. 151, 810-813]. Using apg-1 cDNA as a probe, we isolated a novel cDNA, apg-2 from a mouse testis cDNA library, which was highly homologous to human hsp70RY. However, the predicted amino acid (aa) sequence of APG-2 was longer (841 aa) than that of HSP70RY (701 aa) and comparable to those of HSP110 and APG-1. Northern blot analysis revealed that the expression of apg-2 transcripts was ubiquitous in various mouse tissues, and most abundant in the testis and ovary. While induction of hsp70 transcripts was observed in mouse TAMA26 Sertoli cells and NIH/3T3 fibroblasts on temperature shift from 37 degrees C to 42 degrees C (traditional heat shock) or from 32 degrees C to 39 degrees C, apg-2 transcripts were not induced under either condition. These results suggest that apg-2 is an isoform of mouse homolog of hsp70RY, but that it belongs to the hsp110 family instead of hsp70 family, and that it plays a role under non-stress conditions.

Complementary DNA libraries: an overview.

PubMed

Ying, Shao-Yao

2004-07-01

The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

PubMed

Ares, Manuel

2014-01-01

This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

1994-12-01

The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

cDNA, deduced polypeptide structure and chromosomal assignment of human pulmonary surfactant proteolipid, SPL(pVal)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glasser, S.W.; Korfhagen, T.R.; Weaver, T.E.

1988-01-05

In hyaline membrane disease of premature infants, lack of surfactant leads to pulmonary atelectasis and respiratory distress. Hydrophobic surfactant proteins of M/sub r/ = 5000-14,000 have been isolated from mammalian surfactants which enhance the rate of spreading and the surface tension lowering properties of phospholipids during dynamic compression. The authors have characterized the amino-terminal amino acid sequence of pulmonary proteolipids from ether/ethanol extracts of bovine, canine, and human surfactant. Two distinct peptides were identified and termed SPL(pVal) and SPL(Phe). An oligonucleotide probe based on the valine-rich amino-terminal amino acid sequence of SPL(pVal) was utilized to isolate cDNA and genomic DNAmore » encoding the human protein, termed surfactant proteolipid SPL(pVal) on the basis of its unique polyvaline domain. The primary structure of a precursor protein of 20,870 daltons, containing the SPL(pVal) peptide, was deduced from the nucleotide sequence of the cDNAs. Hybrid-arrested translation and immunoprecipitation of labeled translation products of human mRNA demonstrated a precursor protein, the active hydrophobic peptide being produced by proteolytic processing. Two classes of cDNAs encoding SPL(pVal) were identified. Human SPL(pVal) mRNA was more abundant in the adult than in fetal lung. The SPL(pVal) gene locus was assigned to chromosome 8.« less

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

STEAP: A prostate-specific cell-surface antigen highly expressed in human prostate tumors

PubMed Central

Hubert, Rene S.; Vivanco, Igor; Chen, Emily; Rastegar, Shiva; Leong, Kahan; Mitchell, Steve C.; Madraswala, Rashida; Zhou, Yanhong; Kuo, James; Raitano, Arthur B.; Jakobovits, Aya; Saffran, Douglas C.; Afar, Daniel E. H.

1999-01-01

In search of novel genes expressed in metastatic prostate cancer, we subtracted cDNA isolated from benign prostatic hypertrophic tissue from cDNA isolated from a prostate cancer xenograft model that mimics advanced disease. One novel gene that is highly expressed in advanced prostate cancer encodes a 339-amino acid protein with six potential membrane-spanning regions flanked by hydrophilic amino- and carboxyl-terminal domains. This structure suggests a potential function as a channel or transporter protein. This gene, named STEAP for six-transmembrane epithelial antigen of the prostate, is expressed predominantly in human prostate tissue and is up-regulated in multiple cancer cell lines, including prostate, bladder, colon, ovarian, and Ewing sarcoma. Immunohistochemical analysis of clinical specimens demonstrates significant STEAP expression at the cell–cell junctions of the secretory epithelium of prostate and prostate cancer cells. Little to no staining was detected at the plasma membranes of normal, nonprostate human tissues, except for bladder tissue, which expressed low levels of STEAP at the cell membrane. Protein analysis located STEAP at the cell surface of prostate-cancer cell lines. Our results support STEAP as a cell-surface tumor-antigen target for prostate cancer therapy and diagnostic imaging. PMID:10588738

Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.

PubMed

Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L

1986-09-01

The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.

[Growth inhibition effection of perlecan anti-sense cDNA on human laryngeal carcinoma xnograft in nude mice].

PubMed

Chen, Guangli; Gong, Shusheng; Chen, Pei; Luo, Linghui

2014-09-01

To observe growth inhibition effect of perlecan anti-sense cDNA (pAP) on human laryngeal carcinoma xnografted in nude mice. To vertify its antitumor effect and mechanism in vivo, and it may be useful as a biomarker in carcinoma of larynx cancer. Created the model of human laryngeal carcinoma xnograft in nude mice. To observe growth of those xnografts in nude mice and draw growth curve of xnografted. The expression of perlecan mRNA and portein in xnografts were examined by RT-PCR and immunohistochemistry. Volume of xnografts in the group transfected by the plasmids of pAP were significant small as compared with other two groups made by the wild type cells and phpApr-neol cells (P < 0.05). It was showed that the expression of perlecan mRNA and protein were significantly reduced in the tumor of pAP transfected Hep-2 cells as compared with the tumors transfected by the wild type cells and phβApr-neol cells (P < 0.01). These data raise the possibility that pAP many play key roles in the growth of those xnografts in nude mice.

Genetic mapping of a food preference gene in the silkworm, Bombyx mori, using restriction fragment length polymorphisms (RFLPs).

PubMed

Mase, Keisuke; Iizuka, Tetsuya; Yamamoto, Toshio; Okada, Eiji; Hara, Wajirou

2007-06-01

The domesticated silkworm, Bombyx mori, has strict food preferences and grows by feeding on mulberry leaves. However, "Sawa-J", an abnormal feeding habit strain selected from the genetic stock, feeds on an artificial diet without mulberry leaf powder. In this study, the food preference gene in Sawa-J was genetically identified using restriction fragment length polymorphisms (RFLPs) of a cDNA clone on each linkage group. Taking advantage of a lack of genetic recombination in females, reciprocal backcrossed F1 (BC1) progenies were independently prepared using a non-feeding strain, C108, as a mating partner of Sawa-J. Our results of linkage analysis and mapping proved that the feeding behavior is primarily controlled by a major recessive gene mapped at 20.2 cM on RFLP linkage group 9 (RFLG9), and clone e73 at a distance of 4.2 cM was found as the first linked molecular marker.

Selective stabilization of tau in axons and microtubule-associated protein 2C in cell bodies and dendrites contributes to polarized localization of cytoskeletal proteins in mature neurons.

PubMed

Hirokawa, N; Funakoshi, T; Sato-Harada, R; Kanai, Y

1996-02-01

In mature neurons, tau is abundant in axons, whereas microtubule-associated protein 2 (MAP2) and MAP2C are specifically localized in dendrites. Known mechanisms involved in the compartmentalization of these cytoskeletal proteins include the differential localization of mRNA (MAP2 mRNA in dendrites, MAP2C mRNA in cell body, and Tau mRNA in proximal axon revealed by in situ hybridization) (Garner, C.C., R.P. Tucker, and A. Matus. 1988. Nature (Lond.). 336:674-677; Litman, P., J. Barg, L. Rindzooski, and I. Ginzburg. 1993. Neuron. 10:627-638), suppressed transit of MAP2 into axons (revealed by cDNA transfection into neurons) (Kanai, Y., and N. Hirokawa. 1995. Neuron. 14:421-432), and differential turnover of MAP2 in axons vs dendrites (Okabe, S., and N. Hirokawa. 1989. Proc. Natl. Acad. Sci. USA. 86:4127-4131). To investigate whether differential turnover of MAPs contributes to localization of other major MAPs in general, we microinjected biotinylated tau, MAP2C, or MAP2 into mature spinal cord neurons in culture (approximately 3 wk) and then analyzed their fates by antibiotin immunocytochemistry. Initially, each was detected in axons and dendrites, although tau persisted only in axons, whereas MAP2C and MAP2 were restricted to cell bodies and dendrites. Injected MAP2C and MAP2 bound to dendritic microtubules more firmly than to microtubules in axons, while injected tau bound to axonal microtubules more firmly than to microtubules in dendrites. Thus, beyond contributions from mRNA localization and selective axonal transport, compartmentalization of each of the three major MAPs occurs through local differential turnover.

Induction of Human Blood Group A Antigen Expression on Mouse Cells, Using Lentiviral Gene Transduction

PubMed Central

Fan, Xiaohu; Lang, Haili; Zhou, Xianpei; Zhang, Li; Yin, Rong; Maciejko, Jessica; Giannitsos, Vasiliki; Motyka, Bruce; Medin, Jeffrey A.; Platt, Jeffrey L.

2010-01-01

Abstract The ABO histo-blood group system is the most important antigen system in transplantation medicine, yet no small animal model of the ABO system exists. To determine the feasibility of developing a murine model, we previously subcloned the human α-1,2-fucosyltransferase (H-transferase, EC 2.4.1.69) cDNA and the human α-1,3-N-acetylgalactosaminyltransferase (A-transferase, EC 2.4.1.40) cDNA into lentiviral vectors to study their ability to induce human histo-blood group A antigen expression on mouse cells. Herein we investigated the optimal conditions for human A and H antigen expression in murine cells. We determined that transduction of a bicistronic lentiviral vector (LvEF1-AH-trs) resulted in the expression of A antigen in a mouse endothelial cell line. We also studied the in vivo utility of this vector to induce human A antigen expression in mouse liver. After intrahepatic injection of LvEF1-AH-trs, A antigen expression was observed on hepatocytes as detected by immunohistochemistry and real-time RT-PCR. In human group A erythrocyte-sensitized mice, A antigen expression in the liver was associated with tissue damage, and deposition of antibody and complement. These results suggest that this gene transfer strategy can be used to simulate the human ABO blood group system in a murine model. This model will facilitate progress in the development of interventions for ABO-incompatible transplantation and transfusion scenarios, which are difficult to develop in clinical or large animal settings. PMID:20163247

Cloning and characterization of two novel zebrafish P2X receptor subunits.

PubMed

Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M

2002-07-26

In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.

Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

PubMed Central

2011-01-01

Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934

Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro.

PubMed

Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L

1999-12-17

Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

Site-specific microtubule-associated protein 4 dephosphorylation causes microtubule network densification in pressure overload cardiac hypertrophy.

PubMed

Chinnakkannu, Panneerselvam; Samanna, Venkatesababa; Cheng, Guangmao; Ablonczy, Zsolt; Baicu, Catalin F; Bethard, Jennifer R; Menick, Donald R; Kuppuswamy, Dhandapani; Cooper, George

2010-07-09

In severe pressure overload-induced cardiac hypertrophy, a dense, stabilized microtubule network forms that interferes with cardiocyte contraction and microtubule-based transport. This is associated with persistent transcriptional up-regulation of cardiac alpha- and beta-tubulin and microtubule-stabilizing microtubule-associated protein 4 (MAP4). There is also extensive microtubule decoration by MAP4, suggesting greater MAP4 affinity for microtubules. Because the major determinant of this affinity is site-specific MAP4 dephosphorylation, we characterized this in hypertrophied myocardium and then assessed the functional significance of each dephosphorylation site found by mimicking it in normal cardiocytes. We first isolated MAP4 from normal and pressure overload-hypertrophied feline myocardium; volume-overloaded myocardium, which has an equal degree and duration of hypertrophy but normal functional and cytoskeletal properties, served as a control for any nonspecific growth-related effects. After cloning cDNA-encoding feline MAP4 and obtaining its deduced amino acid sequence, we characterized by mass spectrometry any site-specific MAP4 dephosphorylation. Solely in pressure overload-hypertrophied myocardium, we identified striking MAP4 dephosphorylation at Ser-472 in the MAP4 N-terminal projection domain and at Ser-924 and Ser-1056 in the assembly-promoting region of the C-terminal microtubule-binding domain. Site-directed mutagenesis of MAP4 cDNA was then used to switch each serine to non-phosphorylatable alanine. Wild-type and mutated cDNAs were used to construct adenoviruses; microtubule network density, stability, and MAP4 decoration were assessed in normal cardiocytes following an equivalent level of MAP4 expression. The Ser-924 --> Ala MAP4 mutant produced a microtubule phenotype indistinguishable from that seen in pressure overload hypertrophy, such that Ser-924 MAP4 dephosphorylation during pressure overload hypertrophy may be central to this cytoskeletal abnormality.

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

Possible involvement of MSX-2 homeoprotein in v-ras-induced transformation.

PubMed

Takahashi, C; Akiyama, N; Kitayama, H; Takai, S; Noda, M

1997-04-01

A truncated MSX-2 homeoprotein was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in untransformed cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a full-length human MSX-2 cDNA and tested its activities in two cell systems: fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated MSX-2 cDNA interfered with the transforming activities of both v-Ki-ras and v-raf oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and truncated MSX-2 cDNA was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that the truncated version MSX-2 may act as a dominant suppressor of intact MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai

PubMed Central

Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

2016-01-01

An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His69, Asp117, and Ser216. The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5′ donor splice (GT) and 3′ acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai. PMID:27399771

Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai.

PubMed

Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

2016-07-05

An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His(69), Asp(117), and Ser(216). The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5' donor splice (GT) and 3' acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai.

The identification of cellular targets of 17β estradiol using a lytic (T7) cDNA phage display approach.

PubMed

Van Dorst, Bieke; Mehta, Jaytry; Rouah-Martin, Elsa; De Coen, Wim; Blust, Ronny; Robbens, Johan

2011-02-01

To unravel the mechanism of action of chemical compounds, it is crucial to know their cellular targets. A novel in vitro tool that can be used as a fast, simple and cost effective alternative is cDNA phage display. This tool is used in our study to select cellular targets of 17β estradiol (E2). It was possible to select two potential cellular targets of E2 out of the T7 Select™ Human Breast cDNA phage library. The selected cellular targets, autophagy/beclin-1 regulator 1 (beclin 1) and ATP synthase F(0) subunit 6 (ATP6) have so far been unknown as binding proteins of E2. To confirm the E2 binding properties of these selected proteins, surface plasmon resonance (SPR) was used. With SPR the K(d) values were determined to be 0.178±0.031 and 0.401±0.142 nM for the ATP6 phage and beclin 1 phage, respectively. These K(d) values in the low nM range verify that the selected cellular proteins are indeed binding proteins for E2. The selection and identification of these two potential cellular targets of E2, can enhance our current understanding of its mechanism of action. This illustrates the potential of lytic (T7) cDNA phage display in toxicology, to provide important information about cellular targets of chemical compounds. Copyright © 2010 Elsevier Ltd. All rights reserved.

Nectinepsin: a new extracellular matrix protein of the pexin family. Characterization of a novel cDNA encoding a protein with an RGD cell binding motif.

PubMed

Blancher, C; Omri, B; Bidou, L; Pessac, B; Crisanti, P

1996-10-18

We report the isolation and characterization of a novel cDNA from quail neuroretina encoding a putative protein named nectinepsin. The nectinepsin cDNA identifies a major 2.2-kilobase mRNA that is detected from ED 5 in neuroretina and is increasingly abundant during embryonic development. A nectinepsin mRNA is also found in quail liver, brain, and intestine and in mouse retina. The deduced nectinepsin amino acid sequence contains the RGD cell binding motif of integrin ligands. Furthermore, nectinepsin shares substantial homologies with vitronectin and structural protein similarities with most of the matricial metalloproteases. However, the presence of a specific sequence and the lack of heparin and collagen binding domains of the vitronectin indicate that nectinepsin is a new extracellular matrix protein. Furthermore, genomic Southern blot studies suggest that nectinepsin and vitronectin are encoded by different genes. Western blot analysis with an anti-human vitronectin antiserum revealed, in addition to the 65- and 70-kDa vitronectin bands, an immunoreactive protein of about 54 kDa in all tissues containing nectinepsin mRNA. It seems likely that the form of vitronectin found in chick egg yolk plasma by Nagano et al. ((1992) J. Biol. Chem. 267, 24863-24870) is the protein that corresponds to the nectinepsin cDNA. This new protein could be an important molecule involved in the early steps of the development.

BIOMONITORING THE TOXICOGENOMIC RESPONSE TO ENDOCRINE DISRUPTING CHEMICALS IN HUMANS, LABORATORY SPECIES AND WILDLIFE

EPA Science Inventory

With the advent of sequence information for entire eukaryotic genomes, it is now possible to analyze gene expression on a genomic scale. The primary tool for genomic analysis of gene expression is the gene microarray. We have used commercially available and custom cDNA microarray...

HUMAN GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE-2 (GAPD2) GENE IS EXPRESSED SPECIFICALLY IN SPERMATOGENIC CELLS

EPA Science Inventory

Although the process of glycolysis is highly conserved in eukaryotes, several glycolytic enzymes have unique structural or functional features in spermatogenic cells. We previously identified and characterized the mouse complementary DNA (cDNA) and a gene for 1 of these enzymes, ...

Molecular cloning, expression and immunolocalization of a novel human cementum-derived protein (CP-23).

PubMed

Alvarez-Pérez, Marco Antonio; Narayanan, Sampath; Zeichner-David, Margarita; Rodríguez Carmona, Bruno; Arzate, Higinio

2006-03-01

Cementum is a unique mineralized connective tissue that covers the root surfaces of the teeth. The cementum is critical for appropriate maturation of the periodontium, both during development as well as that associated with regeneration of periodontal tissues, IU; however, one major impediment to understand the molecular mechanisms that regulate periodontal regeneration is the lack of cementum markers. Here we report on the identification and characterization of one such differentially human expressed gene, termed "cementum protein-23" (CP-23) that appears to be periodontal ligament and cementum-specific. We screened human cementum tumor-derived cDNA libraries by transient expression in COS-7 cells and "panning" with a rabbit polyclonal antibody against a cementoblastoma conditioned media-derived protein (CP). One isolated cDNA, CP-23, was expressed in E. coli and polyclonal antibodies against the recombinant human CP-23 were produced. Expression of CP-23 protein by cells of the periodontium was examined by Northern blot and in situ hybridization. Expression of CP-23 transcripts in human cementoblastoma-derived cells, periodontal ligament cells, human gingival fibroblasts and alveolar bone-derived cells was determined by RT-PCR. Our results show that we have isolated a 1374-bp human cDNA containing an open reading frame that encodes a polypeptide with 247 amino acid residues, with a predicted molecular mass of 25.9 kDa that represents CP species. The recombinant human CP-23 protein cross-reacted with antibodies against CP and type X collagen. Immunoscreening of human periodontal tissues revealed that CP-23 gene product is localized to the cementoid matrix of cementum and cementoblasts throughout the entire surface of the root, cell subpopulations of the periodontal ligament as well as cells located paravascularly to the blood vessels into the periodontal ligament. Furthermore, 98% of putative cementoblasts and 15% of periodontal ligament cells cultured in vitro expressed CP-23 gene product. Cementoblastoma cells and periodontal ligament cells contained a 5.0 kb CP-23 mRNA. In situ hybridization showed strong expression of CP-23 mRNA on cementoblast, cell subpopulations of the periodontal ligament and cells located around blood vessels into the periodontal ligament. Our results demonstrate that CP-23 represents a novel, tissue-specific-gene product being expressed by periodontal ligament subpopulations and cementoblasts. These findings offer the possibility to determine the cellular and molecular events that regulate the cementogenesis process during root development. Furthermore, it might provide new venues for the design of translational studies aimed at achieving predictable new cementogenesis and regeneration of the periodontal tissues.

Role of mp 17O Seprase in Breast Cancer.

DTIC Science & Technology

1998-07-01

identical subunits of MT 97 kDa. Recent evidence indicated that the Seprase subunit is identical to Fibroblast Activation Protein a ( FAPa ). To characterize...and define the role of this molecule in cancer, human Seprase/ FAPa cDNA was cloned and stable transfected in two human epithelial carcinoma cell lines...SW-13 and MCF-7. Unexpectedly, overexpression of Seprase/ FAPa has no apparent effect on the proliferation, matrix adhesion and matrigel invasion of

Cloning and Characterization of the Scalloped Region of Drosophila Melanogaster

PubMed Central

Campbell, S. D.; Duttaroy, A.; Katzen, A. L.; Chovnick, A.

1991-01-01

Viable mutants of the scalloped gene (sd) of Drosophila melanogaster exhibit defects that can include gapping of the wing margin and ectopic bristle formation on the wing. Lethal sd alleles characterized in the present study now implicate this gene in a genetic function essential for normal development. In order to further characterize the developmental role of this gene, we have undertaken to clone and characterize the region where sd maps. A P[ry(+)] transposon insertion at 13F associated with sd([ry+2216]) served as the starting point for a 42-kb chromosomal walk. Molecular lesions associated with viable and lethal sd alleles were characterized by genomic hybridization analysis as a means of defining the extent of the gene. DNA rearrangements associated with 11 viable sd alleles map to a 2-kb interval which appears to be a ``hot spot'' for P element activity. Four of five recessive lethal sd mutations were mapped by denaturing gradient gel electrophoresis to a region 12-14 kb away from the region of viable lesions. In a sd(+) genotype, at least two structurally related and developmentally regulated transcripts hybridize to the genomic region where several sd lethal alleles have been localized. A viable mutation, sd(58), used for comparison in the transcript analysis, makes at least two slightly smaller transcripts that also hybridize to this region. Preliminary analysis of cDNA clones has identified three structurally related transcripts that hybridize to this genomic region. The 5' end of these transcripts extends into the 2-kb genomic region wherein DNA rearrangements were seen in the P element rearrangements. We favor the view that the transcripts represented by these cDNA clones are products of the sd gene. If this is true, the sd gene would include genomic sequences extending over at least 14 kb of the described chromosomal walk, and would appear to be subject to alternative splicing. PMID:1706292

Towards the isolation of the idiopathic hemochromatosis disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chorney, M.J.; Venditti, C.P.; Harris, J.M.

1994-09-01

Despite the existence of many useful reagents which exist to aid in the positional cloning of the idiopathic hermochromatosis disease gene (HFE), the nature and precise location of this common genetic disease has remained elusive. Our group has pursued an MHC-based positional cloning approach which has centered on the precise physical definition of HLA-A variant chromosomes. Using deletion breakpoint locations in combination with genetic data derived from the Brittany founder population, we have used cDNA selection techniques to isolate new members of distinct multigene families which reside in the HFE critical region (distal to the HLA-A9 breakpoint/proximal to HLA-F). Wemore » have also initiated an independent set of cytogenetic and physical mapping studies to position the marker D6S105 with respect to the telomeric end of the class I subregion. Toward this end, we have performed double labelling FISH experiments which have allowed the localization of D6S105-containing YACs with respect to the HLA-A subregion and to the major G-bands which contain these loci. We have also derived single-copy probes, cosmids and cDNA clones from the region which have been used to create a physical map around D6S105. The combination of the cytogenetic and physical mapping data indicate that D6S105 is at least 2 Mb from HLA-A and that the distal limit of the MHC class I region may extend much further into the the euchromatic region of 6p21.3 than previously expected. A mega-YAC walk is now in progress to link the two loci. Finally, we have identified and characterized a family which is segregating a balanced inversion in phase with HFE. The breakpoint locations of this mutant chromosome may be important in the precise positioning of the HFE gene and attempts to define coding sequences in the proximity of this rearrangement are underway.« less

Cytochrome b in human complex II (succinate-ubiquinone oxidoreductase): cDNA cloning of the components in liver mitochondria and chromosome assignment of the genes for the large (SDHC) and small (SDHD) subunits to 1q21 and 11q23.

PubMed

Hirawake, H; Taniwaki, M; Tamura, A; Kojima, S; Kita, K

1997-01-01

Complex II (succinate-ubiquinone oxidoreductase) is an important enzyme complex in both the tricarboxylic acid cycle and the aerobic respiratory chains of mitochondria in eukaryotic cells and prokaryotic organisms. In this study, the amino acid sequences of the large (cybL) and small (cybS) subunits of cytochrome b in human liver complex II were deduced from cDNAs isolated by homology probing with mixed primers for the polymerase chain reaction. The mature cybL and cybS contain 140 and 103 amino acids, respectively, and show little similarity to the amino acid sequences of the subunits from other species in contrast to the highly conserved features of the flavoprotein (Fp) subunit and iron-sulfur protein (Ip) subunit. From hydrophobicity analysis, both cybL and cybS appear to have three transmembrane segments, indicating their role as membrane-anchors for the enzyme complex. Histidine residues, which are possible heme axial ligands in cytochrome b of complex II, were found in the second transmembrane segment of each subunit. The genes for cybL (SDHC) and cybS (SDHD) were mapped to chromosome 1q21 and 11q23, respectively by fluorescent in situ hybridization (FISH).

Production and structural characterization of amino terminally histidine tagged human oncostatin M in E. coli.

PubMed

Sporeno, E; Barbato, G; Graziani, R; Pucci, P; Nitti, G; Paonessa, G

1994-05-01

Oncostatin M is a cytokine that acts as a growth regulator on a wide variety of cells and has diverse biological activities including acute phase protein induction, LDL receptor up-regulation and cell-specific gene expression. In order to gather information about the Onc M structure, we established a protocol for large scale production and single step purification of this functional cytokine from bacterial cells. The cDNA of human Onc M was cloned by RT-PCR from total RNA of PMA induced U937 cells. After the addition of a six histidine tag at the N-terminus, the coding region of mature Onc M was cloned in the pT7.7 expression vector. Histidine tagged Onc M was overexpressed in bacterial cells and purified to homogeneity in one step on a metal chelating column. We found that recombinant 6xHis-OncM remains fully active in a growth inhibition assay. Structural characterization of the purified protein was performed by electrospray mass spectrometry, automated Edman degradation and peptide mapping by high-pressure liquid chromatography/fast-atom-bombardment mass spectrometry. Thermal and pH stability dependence of Onc M was assessed by circular dichroism spectroscopy; the helical content is about 50%, in agreement with the four helix bundle fold postulated for cytokines that bind haematopoietic receptors of type I.

Inhibition of beta-adrenergic receptor trafficking in adult cardiocytes by MAP4 decoration of microtubules.

PubMed

Cheng, Guangmao; Qiao, Fei; Gallien, Thomas N; Kuppuswamy, Dhandapani; Cooper, George

2005-03-01

Decreased beta-adrenergic receptor (beta-AR) number occurs both in animal models of cardiac hypertrophy and failure and in patients. beta-AR recycling is an important mechanism for the beta-AR resensitization that maintains a normal complement of cell surface beta-ARs. We have shown that 1) in severe pressure overload cardiac hypertrophy, there is extensive microtubule-associated protein 4 (MAP4) decoration of a dense microtubule network; and 2) MAP4 microtubule decoration inhibits muscarinic acetylcholine receptor recycling in neuroblastoma cells. We asked here whether MAP4 microtubule decoration inhibits beta-AR recycling in adult cardiocytes. [(3)H]CGP-12177 was used as a beta-AR ligand, and feline cardiocytes were isolated and infected with adenovirus containing MAP4 (AdMAP4) or beta-galactosidase (Adbeta-gal) cDNA. MAP4 decorated the microtubules extensively only in AdMAP4 cardiocytes. beta-AR agonist exposure reduced cell surface beta-AR number comparably in AdMAP4 and Adbeta-gal cardiocytes; however, after agonist withdrawal, the cell surface beta-AR number recovered to 78.4 +/- 2.9% of the pretreatment value in Adbeta-gal cardiocytes but only to 56.8 +/- 1.4% in AdMAP4 cardiocytes (P < 0.01). This result was confirmed in cardiocytes isolated from transgenic mice having cardiac-restricted MAP4 overexpression. In functional terms of cAMP generation, beta-AR agonist responsiveness of AdMAP4 cells was 47% less than that of Adbeta-gal cells. We conclude that MAP4 microtubule decoration interferes with beta-AR recycling and that this may be one mechanism for beta-AR downregulation in heart failure.

Gene expression pattern recognition algorithm inferences to classify samples exposed to chemical agents

NASA Astrophysics Data System (ADS)

Bushel, Pierre R.; Bennett, Lee; Hamadeh, Hisham; Green, James; Ableson, Alan; Misener, Steve; Paules, Richard; Afshari, Cynthia

2002-06-01

We present an analysis of pattern recognition procedures used to predict the classes of samples exposed to pharmacologic agents by comparing gene expression patterns from samples treated with two classes of compounds. Rat liver mRNA samples following exposure for 24 hours with phenobarbital or peroxisome proliferators were analyzed using a 1700 rat cDNA microarray platform. Sets of genes that were consistently differentially expressed in the rat liver samples following treatment were stored in the MicroArray Project System (MAPS) database. MAPS identified 238 genes in common that possessed a low probability (P < 0.01) of being randomly detected as differentially expressed at the 95% confidence level. Hierarchical cluster analysis on the 238 genes clustered specific gene expression profiles that separated samples based on exposure to a particular class of compound.

Human XPA and XRCC1 DNA repair proteins expressed in yeast, Saccharomyces cerevisiae.

PubMed

Pushnova, E A; Ostanin, K; Thelen, M P

2001-11-01

Human XPA and XRCC1 DNA repair proteins have been expressed in a series of novel yeast episomal vectors. Expression of XPA cDNA resulted in synthesis of anti-XPA crossreacting polypeptides of 40 and 42 kDa, the status of the native protein found in human cells. Likewise, the majority of the recombinant XRCC1 found in the yeast intracellular fraction corresponded to the molecular mass of the full-length human protein. Recombinant XPA protein expressed as an NH(2)-terminal polyhistidine fusion could be affinity purified using Ni(2+) agarose. Copyright 2001 Academic Press.

Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.

1989-08-01

ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two,more » and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.« less

A consensus genetic map of cowpea [Vigna unguiculata (L) Walp.] and synteny based on EST-derived SNPs.

PubMed

Muchero, Wellington; Diop, Ndeye N; Bhat, Prasanna R; Fenton, Raymond D; Wanamaker, Steve; Pottorff, Marti; Hearne, Sarah; Cisse, Ndiaga; Fatokun, Christian; Ehlers, Jeffrey D; Roberts, Philip A; Close, Timothy J

2009-10-27

Consensus genetic linkage maps provide a genomic framework for quantitative trait loci identification, map-based cloning, assessment of genetic diversity, association mapping, and applied breeding in marker-assisted selection schemes. Among "orphan crops" with limited genomic resources such as cowpea [Vigna unguiculata (L.) Walp.] (2n = 2x = 22), the use of transcript-derived SNPs in genetic maps provides opportunities for automated genotyping and estimation of genome structure based on synteny analysis. Here, we report the development and validation of a high-throughput EST-derived SNP assay for cowpea, its application in consensus map building, and determination of synteny to reference genomes. SNP mining from 183,118 ESTs sequenced from 17 cDNA libraries yielded approximately 10,000 high-confidence SNPs from which an Illumina 1,536-SNP GoldenGate genotyping array was developed and applied to 741 recombinant inbred lines from six mapping populations. Approximately 90% of the SNPs were technically successful, providing 1,375 dependable markers. Of these, 928 were incorporated into a consensus genetic map spanning 680 cM with 11 linkage groups and an average marker distance of 0.73 cM. Comparison of this cowpea genetic map to reference legumes, soybean (Glycine max) and Medicago truncatula, revealed extensive macrosynteny encompassing 85 and 82%, respectively, of the cowpea map. Regions of soybean genome duplication were evident relative to the simpler diploid cowpea. Comparison with Arabidopsis revealed extensive genomic rearrangement with some conserved microsynteny. These results support evolutionary closeness between cowpea and soybean and identify regions for synteny-based functional genomics studies in legumes.

Molecular evidence that the p55 gene is not responsible for either of two Xq28-linked disorders: Emery-Deifuss muscular dystrophy and dyskeratosis congenita

DOE Office of Scientific and Technical Information (OSTI.GOV)

Metzenberg, A.B.; Pan, Y.; Das, S.

1994-05-01

Mapping studies have indicated that over two dozen genetic diseases lie on Xq28, the distal long arm of the X chromosome. In most cases the responsible gene has not yet been isolated. Most of these diseases occur at low frequency, and together with small family sizes and the lack of associated cytogenetic aberrations, this characteristic has made isolation of the genes difficult. Identification of the genes responsible for inherited disorders should eventually lead to a greater understanding of biochemical and developmental pathways. We and others are attempting to find these genes by examining genes that are candidates by virtue ofmore » their map location. One candidate is the Xq28-linked gene MPP-1, which encodes the p55 protein. In this study, we asked whether mutations in the p55 gene are present in patients affected with the Xq28-linked disorders dyskeratosis congenita and Emergy-Dreifuss muscular dystrophy. The p55 cDNA is [approx]2 kb in length. The strategy for mutation detection in this sequence involved reverse transciption (RT)-PCR amplification of patient and control cDNA, yielding five sets of overlapping fragments, each set consisting of 400 bp, followed by SSCP analysis of each fragment. In no case was a true mutation in the p55 gene discovered. Therefore, it is highly unlikely that mutations in the p55 gene are responsible for any cases of dyskeratosis congenita or Emergy-Dreifuss muscular dystrophy.« less

Chromosome-specific physical localisation of expressed sequence tag loci in Corchorus olitorius L.

PubMed

Joshi, A; Das, S K; Samanta, P; Paria, P; Sen, S K; Basu, A

2014-11-01

Jute (Corchorus spp.), as a natural fibre-producing species, ranks next only to cotton. Inadequate understanding of its genetic architecture is a major lacuna for genetic improvement of this crop in terms of yield and quality. Establishment of a physical map provides a genomic tool that helps in positional cloning of valuable genes. In this report, an attempt was initiated to study association and localisation of single copy expressed sequence tag (EST) loci in the genome of Corchorus olitorius. The chromosome-specific association of EST was determined based on the appearance of an extra signal for a single copy cDNA probe in mitotic interphase nuclei of specific trisomic(s) for fluorescence in situ hybridisation, and validated using a cDNA fragment of the 26S rRNA gene (600 bp) as molecular probe. The probe exhibited three signals in meiotic interphase nuclei of trisomic 5, instead of two as observed in diploids and other trisomics, indicating its association with chromosome 5. Subsequent hybridisation of the same probe on the pachytene chromosomes of diploids confirmed that 26S rRNA occupies the terminal end of the short arm of chromosome 5 in C. olitorius. Subsequently, chromosome-specific association of 63 single copy EST and their physical localisation were determined on chromosomes 2, 4, 5 and 7. The study describes chromosome-specific physical localisation of genes in jute. The approach used here could be a step towards construction of genome-wide physical maps for any recalcitrant plant species like jute. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-CDNA.

PubMed Central

Sung, W L; Hsiung, H M; Brousseau, R; Michniewicz, J; Wu, R; Narang, S A

1979-01-01

The purification of protected deoxyribooligonucleotides containing phosphotriester internucleotidic linkages has been improved by developing a deactivated silica gel chromatographic technique. The efficiency of this technique as applied in the modified phosphotriester approach has been demonstrated in the rapid synthesis of seventeen pure fragments constituting the sequence of human insulin B and mini-C DNA. The sequence of each oligomer was confirmed by the two-dimensional mobility shift method of fingerprinting. Images PMID:230464

A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

NASA Technical Reports Server (NTRS)

Reddy, A. S.; Reddy, V. S.; Golovkin, M.

2000-01-01

Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

Effects of tissue factor, PAR-2 and MMP-9 expression on human breast cancer cell line MCF-7 invasion.

PubMed

Lin, Zeng-Mao; Zhao, Jian-Xin; Duan, Xue-Ning; Zhang, Lan-Bo; Ye, Jing-Ming; Xu, Ling; Liu, Yin-Hua

2014-01-01

This study aimed to explore the expression of tissue factor (TF), protease activated receptor-2 (PAR-2), and matrix metalloproteinase-9 (MMP-9) in the MCF-7 breast cancer cell line and influence on invasiveness. Stable MCF-7 cells transfected with TF cDNA and with TF ShRNA were established. TF, PAR-2, and MMP-9 protein expression was analyzed using indirect immunofluorescence and invasiveness was evaluated using a cell invasion test. Effects of an exogenous PAR-2 agonist were also examined. TF protein expression significantly differed between the TF cDNA and TF ShRNA groups. MMP-9 protein expression was significantly correlated with TF protein expression, but PAR-2 protein expression was unaffected. The PAR- 2 agonist significantly enhanced MMP-9 expression and slightly increased TF and PAR-2 expression in the TF ShRNA group, but did not significantly affect protein expression in MCF-7 cells transfected with TF cDNA. TF and MMP-9 expression was positively correlated with the invasiveness of tumor cells. TF, PAR-2, and MMP-9 affect invasiveness of MCF-7 cells. TF may increase MMP-9 expression by activating PAR-2.

Molecular Cloning and Characterization of a Xanthone Prenyltransferase from Hypericum calycinum Cell Cultures.

PubMed

Fiesel, Tobias; Gaid, Mariam; Müller, Andreas; Bartels, Joana; El-Awaad, Islam; Beuerle, Till; Ernst, Ludger; Behrends, Sönke; Beerhues, Ludger

2015-08-27

In plants, prenylation of metabolites is widely distributed to generate compounds with efficient defense potential and distinct pharmacological activities profitable to human health. Prenylated compounds are formed by members of the prenyltransferase (PT) superfamily, which catalyze the addition of prenyl moieties to a variety of acceptor molecules. Cell cultures of Hypericum calycinum respond to elicitor treatment with the accumulation of the prenylated xanthone hyperxanthone E. A cDNA encoding a membrane-bound PT (HcPT) was isolated from a subtracted cDNA library and transcript preparations of H. calycinum. An increase in the HcPT transcript level preceded hyperxanthone E accumulation in cell cultures of H. calycinum treated with elicitor. The HcPT cDNA was functionally characterized by expression in baculovirus-infected insect cells. The recombinant enzyme catalyzed biosynthesis of 1,3,6,7-tetrahydroxy-8-prenylxanthone through regiospecific C-8 prenylation of 1,3,6,7-tetrahydroxyxanthone, indicating its involvement in hyperxanthone E formation. The enzymatic product shared significant structural features with the previously reported cholinesterase inhibitor γ-mangostin. Thus, our findings may offer a chance for semisynthesis of new active agents to be involved in the treatment of Alzheimer's disease.

Cloning and expression of cyclophilin from Platanus orientalis pollens in Escherichia coli

PubMed Central

Sankian, Mojtaba; Vahedi, Fatemeh; Pazouki, Nazanin; Moghadam, Malihe; Jabbari Azad, Farahzad; Varasteh, Abdol-Reza

2012-01-01

Background: Allergy is a clinical disorder affecting the human population with wide geographical distribution. Platanus orientalis (P. orientalis) trees are planted in many countries and their pollen causes allergic reactions. Cyclophilin has recently been identified as one of the most important allergens of P. orientalis pollen. We aimed to clone and purify this allergen in Escherichia coli for further studies and therapeutic and diagnostic purposes for allergy to P. orientalis. Methods: RNA was extracted from P. orientalis. A full-length fragment encoding cyclophilin was prepared by polymerase chain reaction amplification of the first-strand cDNA synthesized from P. orientalis RNA. The cDNA was inserted into the pET32b (+) vector, and the construct transformed into E. coli Top10 and BL21 cells. The expressed protein was purified by the CuSO4 method. Results: The cDNA for the cyclophilin of P. orientalis pollen was cloned, and a specific reactivity of recombinant cyclophin was confirmed by immunoblotting using sera from patients allergic to P. orientalis pollen. Conclusion: The recombinant cyclophilin has a potential for immunologic assays for evaluation of allergy to P. orientalis pollen. PMID:26989705

Defective membrane expression of human growth hormone (GH) receptor causes Laron-type GH insensitivity syndrome.

PubMed Central

Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M

1991-01-01

Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554

Rat organic solute carrier protein 1 (rOscp1) mediated the transport of organic solutes in Xenopus laevis oocytes: isolation and pharmacological characterization of rOscp1.

PubMed

Izuno, Hisanori; Kobayashi, Yasuna; Sanada, Yutaka; Nihei, Daisuke; Suzuki, Masako; Kohyama, Noriko; Ohbayashi, Masayuki; Yamamoto, Toshinori

2007-09-22

Rat organic solute carrier protein 1 (rOscp1) was isolated from a rat testis cDNA library. Isolated rOscp1 cDNA consisted of 1089 base pairs that encoded a 363-amino acid protein, and the amino acid sequence was 88% and 93% identical to that of human OSCP1 (hOSCP1) and mouse Oscp1 (mOscp1), respectively. The message for rOscp1 is highly detected in rat testis. When expressed in X. oocytes, rOscp1 mediated the high affinity transport of p-aminohippurate (PAH) with a Km value of 15.7+/-1.9 microM, and rOscp1-mediated organic solutes were exhibited in time- and Na+-independent manners. rOscp1 also transported various structurally heterogenous compounds such as testosterone, dehydroepiandrosterone sulfate (DHEA-S), and taurocholate with some differences in substrate specificity compared with hOSCP1. Immunohistochemical analysis revealed that the rOscp1 protein is localized in the basal membrane side of Sertoli cells as observed in mouse testis [Kobayashi et al., 2007; Kobayashi, Y., Tsuchiya, A., Hayashi, T., Kohyama, N., Ohbayashi, M., Yamamoto, T., 2007. Isolation and characterization of polyspecific mouse organic solute carrier protein 1 (mOscp1). Drug Metabolism and Disposition 35 (7), 1239-1245]. Thus, the present results indicate that a newly isolated cDNA clone, rOscp1, is a polyspecific organic solute carrier protein with some differences in substrate specificity compared with human and mouse OSCP1.

Differences in expression of retinal pigment epithelium mRNA between normal canines

PubMed Central

2004-01-01

Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

PubMed

Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

2018-01-01

Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

Cancer.gov

The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

Diagnostic method employing MSH2 protein

DOEpatents

de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

1998-01-01

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

Rhipicephalus (Boophilus) microplus aquaporin as an effective vaccine antigen to protect against cattle tick infestations

USDA-ARS?s Scientific Manuscript database

A cDNA encoding an aquaporin from the cattle tick, Rhipicephalus microplus, was isolated from transcriptomic studies. Bioinformatic analysis indicates this aquaporin, designated RmAQP1, shows greatest amino acid similarity to the human aquaporin 7 family. Members of this family of water-conducting c...

Novel Plant-Derived Recombinant Human Interferons with Broad Spectrum Antiviral Activity

DTIC Science & Technology

2011-10-14

Ikegami et al., 2006) virus was kindly provided by Dr. Shinji Makino of the University of Texas Medical Branch at Galveston. The GFP-tagged Zaire...Arch. Virol. 156, 1877–1881. Ikegami , T., Won, S., Peters, C.J., Makino, S., 2006. Rescue of infectious rift valley fever virus entirely from cDNA

Generation of a recombinant West Nile virus stably expressing the Gaussia luciferase for neutralization assay.

PubMed

Zhang, Pan-Tao; Shan, Chao; Li, Xiao-Dan; Liu, Si-Qing; Deng, Cheng-Lin; Ye, Han-Qing; Shang, Bao-Di; Shi, Pei-Yong; Lv, Ming; Shen, Bei-Fen; Qin, Cheng-Feng; Zhang, Bo

2016-01-04

West Nile virus (WNV) is a neurotropic human pathogen that has caused increasing infected cases over recent years. There is currently no licensed vaccine or effective drug for prevention and treatment of WNV infection in humans. To facilitate antiviral drug discovery and neutralizing antibody detection, a WNV cDNA clone containing a luciferase reporter gene was constructed through incorporating Gaussia luciferase (Gluc) gene within the capsid-coding region of WNV genome. Transfection of BHK-21 cells with the cDNA clone-derived RNA generated luciferase reporter WNV (WNV-Gluc) and the stable WNV-Gluc with high titers (>10(7)PFU/ml) was obtained through plaque purification. Luciferase activity was used to effectively quantify the viral production of WNV-Gluc. Using the reporter virus WNV-Gluc, we developed a luciferase based assay in a 12-well format for evaluating neutralizing antibodies. The reporter virus could be a powerful tool for epidemiological investigation of WNV, vaccine evaluation, antiviral drug screening, and the study of WNV replication and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization and simulation of cDNA microarray spots using a novel mathematical model

PubMed Central

Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk

2007-01-01

Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047

Genomic, cDNA and embryonic expression analysis of zebrafish IRF6, the gene mutated in the human oral clefting disorders Van der Woude and popliteal pterygium syndromes.

PubMed

Ben, Jin; Jabs, Ethylin Wang; Chong, Samuel S

2005-06-01

Van der Woude syndrome (VWS) and popliteal pterygium syndrome (PPS) are autosomal dominant clefting disorders recently discovered to be caused by mutations in the IRF6 (Interferon Regulatory Factor 6) gene. The IRF gene family consists of nine members encoding transcription factors that share a highly conserved helix-turn-helix DNA-binding domain and a less conserved protein-binding domain. Most IRFs regulate the expression of interferon-alpha and -beta after viral infection, but the function of IRF6 remains unknown. We have isolated a full-length zebrafish irf6 cDNA, which encodes a 492 amino acid protein that contains a Smad-IRF interaction motif and a DNA-binding domain. The zebrafish irf6 gene consists of eight exons and maps to linkage group 22 closest to marker unp1375. By in situ hybridization analysis of embryo whole-mounts and cryosections, we demonstrate that irf6 is first expressed as a maternal transcript. During gastrulation, irf6 expression was concentrated in the forerunner cells. From the bud stage to the 3-somite stage, irf6 expression was observed in the Kupffer's vesicle. No expression could be detected at the 6-somite and 10-somite stages. At the 14-somite stage, expression was detected in the otic placode. At the 17-somite stage, strong expression was also observed in the cloaca. During the pharyngula, hatch and larva periods up to 5 days post-fertilization, irf6 was expressed in the pharyngeal arches, olfactory and otic placodes, and in the epithelial cells of endoderm derived tissues. The latter tissues include the mouth, pharynx, esophagus, endodermal lining of swim bladder, liver, exocrine pancreas, and associated ducts. Overall, the zebrafish expression data are consistent with the observations of lip pits in VWS patients, as well as more recent reports of alae nasi, otitis media and sensorineural hearing loss documented in some patients.

Hydrocortisone-induced anti-inflammatory effects in immature human enterocytes depend on the timing of exposure.

PubMed

Rautava, Samuli; Walker, W Allan; Lu, Lei

2016-06-01

The immature human gut has a propensity to exaggerated inflammatory responses that are thought to play a role in the pathogenesis of necrotizing enterocolitis (NEC). Prenatal exposure to corticosteroids has been reported to reduce the risk of NEC, while postnatal dexamethasone treatment is associated with adverse neurodevelopmental outcomes in preterm infants. The aim of this study was to investigate the direct role of hydrocortisone in gene expression patterns and inflammatory responses in immature human enterocytes. Time-dependent hydrocortisone effects in nontransformed primary human fetal intestinal epithelial cell line H4 were investigated by cDNA microarray. Fetal intestinal organ culture and cell culture experiments were conducted. Inflammatory responses were induced by stimulation with IL-1β and TNF-α with and without hydrocortisone. IL-8 and IL-6 expression and secretion were measured as functional readout. Here we report time-dependent hydrocortisone-induced changes in gene expression patterns detected by cDNA microarray. Hydrocortisone significantly attenuated IL-1β-induced inflammatory responses in the immature human gut when administered at the time of the proinflammatory insult: IL-1β-induced IL-8 and IL-6 secretion in the fetal ileum as well as H4 cells were significantly reduced. Hydrocortisone also inhibited IL-8 secretion in response to TNF-α. In contrast, TNF-α-induced IL-8 secretion was not reduced in cells treated with hydrocortisone for 48 h before stimulation. Our observations provide a physiological basis for understanding the differential clinical effects of corticosteroids in the immature human gut depending on the timing of treatment. Copyright © 2016 the American Physiological Society.

Hydrocortisone-induced anti-inflammatory effects in immature human enterocytes depend on the timing of exposure

PubMed Central

Rautava, Samuli; Lu, Lei

2016-01-01

The immature human gut has a propensity to exaggerated inflammatory responses that are thought to play a role in the pathogenesis of necrotizing enterocolitis (NEC). Prenatal exposure to corticosteroids has been reported to reduce the risk of NEC, while postnatal dexamethasone treatment is associated with adverse neurodevelopmental outcomes in preterm infants. The aim of this study was to investigate the direct role of hydrocortisone in gene expression patterns and inflammatory responses in immature human enterocytes. Time-dependent hydrocortisone effects in nontransformed primary human fetal intestinal epithelial cell line H4 were investigated by cDNA microarray. Fetal intestinal organ culture and cell culture experiments were conducted. Inflammatory responses were induced by stimulation with IL-1β and TNF-α with and without hydrocortisone. IL-8 and IL-6 expression and secretion were measured as functional readout. Here we report time-dependent hydrocortisone-induced changes in gene expression patterns detected by cDNA microarray. Hydrocortisone significantly attenuated IL-1β-induced inflammatory responses in the immature human gut when administered at the time of the proinflammatory insult: IL-1β-induced IL-8 and IL-6 secretion in the fetal ileum as well as H4 cells were significantly reduced. Hydrocortisone also inhibited IL-8 secretion in response to TNF-α. In contrast, TNF-α-induced IL-8 secretion was not reduced in cells treated with hydrocortisone for 48 h before stimulation. Our observations provide a physiological basis for understanding the differential clinical effects of corticosteroids in the immature human gut depending on the timing of treatment. PMID:27056727

Gasdermin (Gsdm) localizing to mouse Chromosome 11 is predominantly expressed in upper gastrointestinal tract but significantly suppressed in human gastric cancer cells.

PubMed

Saeki, N; Kuwahara, Y; Sasaki, H; Satoh, H; Shiroishi, T

2000-09-01

Amplification of proto-oncogenes associated with their over-expression is one of the critical carcinogenic events identified in human cancer cells. In many cases of human gastric cancer, a proto-oncogene ERBB-2 is co-amplified with CAB1 genes physically linked to ERBB-2, and both genes are over-expressed. The amplified region containing ERBB-2 and CAB1 was named 17q12 amplicon from its chromosomal location. The syntenic region corresponding to the 17q12 amplicon is well conserved in mouse. In this study we isolated and characterized a novel mouse gene that locates telomeric to the mouse syntenic region. Northern blot analysis using the mouse cDNA and a cloned partial cDNA of human homolog disclosed a unique expression pattern of the genes. They are expressed predominantly in the gastrointestinal (GI) tract and in the skin at a lower level. Moreover, in the GI tract, the expression is highly restricted to the esophagus and stomach. Thus, we named the mouse gene Gasdermin (Gsdm). This is the first report of a mammalian gene whose expression is restricted to both upper GI tract and skin. Interestingly, in spite of its expression in normal stomach, no transcript was detected by Northern blot analysis in human gastric cancer cells. These data suggest that the loss of the expression of the human homolog is required for the carcinogenesis of gastric tissue and that the gene has an activity adverse to malignant transformation of cells.

Molecular biology of myopia.

PubMed

Schaeffel, Frank; Simon, Perikles; Feldkaemper, Marita; Ohngemach, Sibylle; Williams, Robert W

2003-09-01

Experiments in animal models of myopia have emphasised the importance of visual input in emmetropisation but it is also evident that the development of human myopia is influenced to some degree by genetic factors. Molecular genetic approaches can help to identify both the genes involved in the control of ocular development and the potential targets for pharmacological intervention. This review covers a variety of techniques that are being used to study the molecular biology of myopia. In the first part, we describe techniques used to analyse visually induced changes in gene expression: Northern Blot, polymerase chain reaction (PCR) and real-time PCR to obtain semi-quantitative and quantitative measures of changes in transcription level of a known gene, differential display reverse transcription PCR (DD-RT-PCR) to search for new genes that are controlled by visual input, rapid amplification of 5' cDNA (5'-RACE) to extend the 5' end of sequences that are regulated by visual input, in situ hybridisation to localise the expression of a given gene in a tissue and oligonucleotide microarray assays to simultaneously test visually induced changes in thousands of transcripts in single experiments. In the second part, we describe techniques that are used to localise regions in the genome that contain genes that are involved in the control of eye growth and refractive errors in mice and humans. These include quantitative trait loci (QTL) mapping, exploiting experimental test crosses of mice and transmission disequilibrium tests (TDT) in humans to find chromosomal intervals that harbour genes involved in myopia development. We review several successful applications of this battery of techniques in myopia research.

( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Branchek, T.; Adham, N.; Macchi, M.

1990-11-01

The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

[Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

PubMed

Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

2012-12-01

Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

A pituitary gene encodes a protein that produces differentiation of breast and prostate cancer cells.

PubMed

Platica, Micsunica; Ivan, Elena; Holland, James F; Ionescu, Alin; Chen, Sheryl; Mandeli, John; Unger, Pamela D; Platica, Ovidiu

2004-02-10

A cDNA clone of 1.1 kb encoding a 108-aa polypeptide was isolated from a human pituitary cDNA library by expression cloning. This protein was named tumor differentiation factor (TDF). The recombinant TDF protein and a 20-aa peptide, P1, selected from the ORF of the gene, induced morphological and biochemical changes consistent with differentiation of human breast and prostate cancer cells. Fibroblast, kidney, hepatoma, and leukemic lymphocytic cell lines were unaffected. Breast and prostate cancer cells aggregated in spheroid-like structures within 24 h of exposure to TDF. This effect was abrogated by a specific affinity-purified rabbit polyclonal anti-P1 Ab. E-cadherin expression was increased in a dose-dependent manner by TDF. Treatment of MCF7 cells with TDF led to production of a lactalbumin-related protein. Peptide P1 significantly decreased the growth of androgen-independent DU145 prostate cancer in severe combined immunodeficient mice. The presence of TDF protein in human sera was detected by the anti-P1 Ab, suggesting a role of TDF in endocrine metabolism. The fact that all activities of TDF can be mimicked by a peptide derived from the encoding TDF sequence opens the possibility of therapeutic applications.

[DNA microarray reveals changes in gene expression of endothelial cells under shear stress].

PubMed

Cheng, Min; Zhang, Wensheng; Chen, Huaiqing; Wu, Wenchao; Huang, Hua

2004-04-01

cDNA microarray technology is used as a powerful tool for rapid, comprehensive, and quantitative analysis of gene profiles of cultured human umbilical vein endothelial cells(HUVECs) in the normal static group and the shear stressed (4.20 dyne/cm2, 2 h) group. The total RNA from normal static cultured HUVECs was labeled by Cy3-dCTP, and total RNA of HUVECs from the paired shear stressed experiment was labeled by Cy5-dCTP. The expression ratios reported are the average from the two separate experiments. After bioinformatics analysis, we identified a total of 108 genes (approximately 0.026%) revealing differential expression. Of these 53 genes expressions were up-regulated, the most enhanced ones being human homolog of yeast IPP isomerase, human low density lipoprotein receptor gene, Squalene epoxidase gene, 7-dehydrocholesterol reductase, and 55 were down-regulated, the most decreased ones being heat shock 70 kD protein 1, TCB gene encoding cytosolic thyroid hormone-binding protein in HUVECs exposed to low shear stress. These results indicate that the cDNA microarray technique is effective in screening the differentially expressed genes in endothelial cells induced by various experimental conditions and the data may serve as stimuli to further researches.

Bioinformatics and expressional analysis of cDNA clones from floral buds

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Cebula, Justyna; Hincha, Dirck; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2017-08-01

The application of genomic approaches may serve as an initial step in understanding the complexity of biochemical network and cellular processes responsible for regulation and execution of many developmental tasks. The molecular mechanism of sex expression in cucumber is still not elucidated. A study of differential expression was conducted to identify genes involved in sex determination and floral organ morphogenesis. Herein, we present generation of expression sequence tags (EST) obtained by differential hybridization (DH) and subtraction technique (cDNA-DSC) and their characteristic features such as molecular function, involvement in biology processes, expression and mapping position on the genome.

Cloning and expression of a Ca(2+)-inhibitable adenylyl cyclase from NCB-20 cells.

PubMed Central

Yoshimura, M; Cooper, D M

1992-01-01

A cDNA that encodes an adenylyl cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] has been cloned from NCB-20 cells, in which adenylyl cyclase activity is inhibited by Ca2+ at physiological concentrations. The cDNA clone (5.8 kilobases) was isolated by polymerase chain reaction (PCR) using degenerate primers designed by comparison of three adenylyl cyclase sequences (types I, II, and III) and subsequent library screening. Northern analysis revealed expression of mRNA (6.1 kilobases) corresponding to this cDNA in cardiac tissue, which is a prominent source of Ca(2+)-inhibitable adenylyl cyclase. The clone encodes a protein of 1165 amino acids, whose hydrophilicity profile was very similar to those of other mammalian adenylyl cyclases that have recently been cloned. A noticeable difference between this protein and other adenylyl cyclases was a lengthy aminoterminal region before the first transmembrane span. Transient expression of this cDNA in the human embryonic kidney cell line 293 revealed a 3-fold increase in cAMP production in response to forskolin compared with control transfected cells. In purified plasma membranes from transfected cells, increased adenylyl cyclase activity was also detected, which was susceptible to inhibition by submicromolar Ca2+. Thus, this adenylyl cyclase seems to represent the Ca(2+)-inhibitable form that is encountered in NCB-20 cells, cardiac tissue, and elsewhere. Its identification should permit a determination of the structural features that determine the mode of regulation of adenylyl cyclase by Ca2+. Images PMID:1379717

Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jian-Hua; Chen, Shi-Shu

2002-07-01

To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

PubMed Central

Matthews, R J; Cahir, E D; Thomas, M L

1990-01-01

Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

Molecular cloning and chromosomal mapping of bone marrow stromal cell surface gene, BST2, that may be involved in pre-B-cell growth

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishikawa, Jun; Kaisho, Tsuneyasu; Tomizawa, Hitoshi

1995-04-10

Bone marrow stromal cells regulate B-cell growth and development through their surface molecules and cytokines. In this study, we generated a mAb, RS38, that recognized a novel human membrane protein, BST-2, expressed on bone marrow stromal cell lines and synovial cell lines. We cloned a cDNA encoding BST-2 from a rheumatoid arthritis-derived synovial cell line. BST-2 is a 30- to 36-kDa type II transmembrane protein, consisting of 180 amino acids. The BST-2 gene (HGMW-approved symbol BST2) is located on chromosome 19p13.2. BST-2 is expressed not only on certain bone marrow stromal cell lines but also on various normal tissues, althoughmore » its expression pattern is different from that of another bone marrow stromal cell surface molecule, BST-1. BST-2 surface expression on fibroblast cell lines facilitated the stromal cell-dependent growth of a murine bone marrow-derived pre-B-cell line, DW34. The results suggest that BST-2 may be involved in pre-B-cell growth. 45 refs., 7 figs., 2 tabs.« less

Characterization of PsMPK2, the first C1 subgroup MAP kinase from pea (Pisum sativum L.).

PubMed

Ortiz-Masia, Dolores; Perez-Amador, Miguel A; Carbonell, Pablo; Aniento, Fernando; Carbonell, Juan; Marcote, Maria J

2008-05-01

Mitogen-activated protein kinase (MAPK) cascades play a key role in plant growth and development as well as in biotic and abiotic stress responses. They are classified according to their sequence homology into four major groups (A-D). A large amount of information about MAPKs in groups A and B is available but few data of the C group have been reported. In this study, a C1 subgroup MAP kinase cDNA, PsMPK2, was isolated from Pisum sativum. PsMPK2 is expressed in vegetative (root and leaf) and reproductive (stamen, pistil and fruit) organs. Expression of PsMPK2 in Arabidopsis thaliana shows that mechanical injury and other stress signals as abscisic acid, jasmonic acid and hydrogen peroxide increase its kinase activity, extending previous results indicating that C1 subgroup MAPKs may be involved in the response to stress.

Identification of Early Response Genes in Human Peripheral Leukocytes Infected with Orientia tsutsugamushi: The Emergent of a Unique Gene Expression Profile for Diagnosis of O. tsutsugamush Infection

DTIC Science & Technology

2010-01-01

dynein to move from the cell periphery to the microtubule organizing center [22]. Therefore, the initial interactions between host and intracellular...used to study host-pathogen interactions , mainly by identifying genes from pathogens that may be involved in pathogenecity and by surveying the scope...toward understanding the host-Orientia tsutsugamushi interaction at the molecular level, we used human cDNA microarray technology to examine in detail

Diagnostic method employing MSH2 nucleic acids

DOEpatents

de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

1997-01-01

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

Diagnostic method employing MSH2 nucleic acids

DOEpatents

Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

1997-12-02

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +}(RER{sup +}) tumor cells. 19 figs.

Diagnostic method employing MSH2 protein

DOEpatents

Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

1998-11-17

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA

DTIC Science & Technology

1989-04-01

strain-specific identification of HAV in human fecal samples was a major aim of the original contract application, as clinical trials of live and...derived materials and human and primate fecal specimens. 4. We molecularly cloned and partially sequenced the genome of PA21 strain HAV, a virus...antibody. This approach revealed that 99% of the infectious virus particles present in disrupted cell lysates from the 23rd passage of persistently

Mutator gene and hereditary non-polyposis colorectal cancer

DOEpatents

de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD

2008-02-05

The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

NcoI and TaqI RFLPs for human M creatine kinase (CKM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perryman, M.B.; Hejtmancik, J.F.; Ashizawa, Tetsuo

1988-09-12

Probe pHMCKUT contains a 135 bp cDNA fragment inserted into pGEM 3. The probe corresponds to nucleotides 1,201 to 1,336 located in the 3{prime} untranslated region of human M creatine kinase. The probe is specific for human M creatine kinase and does not hybridize to human B cretine kinase sequences. NcoI identifies a two allele polymorphism of a band at either 2.5 kb or 3.6 kb. TaqI identifies a two allele polymorphism at either 3.8 kb or 4.5 kb. Human M creatine has been localized to chromosome 19q. Autosomal co-dominant inheritance was shown in six informative Caucasian families.

ESTs and EST-linked polymorphisms for genetic mapping and phylogenetic reconstruction in the guppy, Poecilia reticulata

PubMed Central

Dreyer, Christine; Hoffmann, Margarete; Lanz, Christa; Willing, Eva-Maria; Riester, Markus; Warthmann, Norman; Sprecher, Andrea; Tripathi, Namita; Henz, Stefan R; Weigel, Detlef

2007-01-01

Background The guppy, Poecilia reticulata, is a well-known model organism for studying inheritance and variation of male ornamental traits as well as adaptation to different river habitats. However, genomic resources for studying this important model were not previously widely available. Results With the aim of generating molecular markers for genetic mapping of the guppy, cDNA libraries were constructed from embryos and different adult organs to generate expressed sequence tags (ESTs). About 18,000 ESTs were annotated according to BLASTN and BLASTX results and the sequence information from the 3' UTRs was exploited to generate PCR primers for re-sequencing of genomic DNA from different wild type strains. By comparison of EST-linked genomic sequences from at least four different ecotypes, about 1,700 polymorphisms were identified, representing about 400 distinct genes. Two interconnected MySQL databases were built to organize the ESTs and markers, respectively. A robust phylogeny of the guppy was reconstructed, based on 10 different nuclear genes. Conclusion Our EST and marker databases provide useful tools for genetic mapping and phylogenetic studies of the guppy. PMID:17686157

Cloning, expression and nuclear localization of human NPM3, a member of the nucleophosmin/nucleoplasmin family of nuclear chaperones

PubMed Central

Shackleford, Gregory M; Ganguly, Amit; MacArthur, Craig A

2001-01-01

Background Studies suggest that the related proteins nucleoplasmin and nucleophosmin (also called B23, NO38 or numatrin) are nuclear chaperones that mediate the assembly of nucleosomes and ribosomes, respectively, and that these activities are accomplished through the binding of basic proteins via their acidic domains. Recently discovered and less well characterized members of this family of acidic phosphoproteins include mouse nucleophosmin/nucleoplasmin 3 (Npm3) and Xenopus NO29. Here we report the cloning and initial characterization of the human ortholog of Npm3. Results Human genomic and cDNA clones of NPM3 were isolated and sequenced. NPM3 lies 5.5 kb upstream of FGF8 and thus maps to chromosome 10q24-26. In addition to amino acid similarities, NPM3 shares many physical characteristics with the nucleophosmin/nucleoplasmin family, including an acidic domain, multiple potential phosphorylation sites and a putative nuclear localization signal. Comparative analyses of 14 members of this family from various metazoans suggest that Xenopus NO29 is a candidate ortholog of human and mouse NPM3, and they further group both proteins closer with the nucleoplasmins than with the nucleophosmins. Northern blot analysis revealed that NPM3 was strongly expressed in all 16 human tissues examined, with especially robust expression in pancreas and testis; lung displayed the lowest level of expression. An analysis of subcellular fractions of NIH3T3 cells expressing epitope-tagged NPM3 revealed that NPM3 protein was localized solely in the nucleus. Conclusions Human NPM3 is an abundant and widely expressed protein with primarily nuclear localization. These biological activities, together with its physical relationship to the chaparones nucleoplasmin and nucleophosmin, are consistent with the proposed function of NPM3 as a molecular chaperone functioning in the nucleus. PMID:11722795

Identification of differentially-expressed genes potentially implicated in drought response in pitaya (Hylocereus undatus) by suppression subtractive hybridization and cDNA microarray analysis.

PubMed

Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng

2014-01-01

Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.

Correction of mouse ornithine transcarbamylase deficiency by gene transfer into the germ line.

PubMed Central

Cavard, C; Grimber, G; Dubois, N; Chasse, J F; Bennoun, M; Minet-Thuriaux, M; Kamoun, P; Briand, P

1988-01-01

The sparse fur with abnormal skin and hair (Spf-ash) mouse is a model for the human X-linked hereditary disorder, ornithine transcarbamylase (OTC) deficiency. In Spf-ash mice, both OTC mRNA and enzyme activity are 5% of control values resulting in hyperammonemia, pronounced orotic aciduria and an abnormal phenotype characterized by growth retardation and sparse fur. Using microinjection, we introduced a construction containing rat OTC cDNA linked to the SV40 early promoter into fertilized eggs of Spf-ash mice. The expression of the transgene resulted in the development of a transgenic mouse whose phenotype and orotic acid excretion are fully normalized. Thus, the possibility of correcting hereditary enzymatic defect by gene transfer of heterologous cDNA coding for the normal enzyme has been demonstrated. Images PMID:3162766

Thalassiolins A-C: new marine-derived inhibitors of HIV cDNA integrase.

PubMed

Rowley, David C; Hansen, Mark S T; Rhodes, Denise; Sotriffer, Christoph A; Ni, Haihong; McCammon, J Andrew; Bushman, Frederic D; Fenical, William

2002-11-01

Human immunodeficiency virus (HIV) replication requires integration of viral cDNA into the host genome, a process mediated by the viral enzyme integrase. We describe a new series of HIV integrase inhibitors, thalassiolins A-C (1-3), isolated from the Caribbean sea grass Thalassia testudinum. The thalassiolins are distinguished from other flavones previously studied by the substitution of a sulfated beta-D-glucose at the 7-position, a substituent that imparts increased potency against integrase in biochemical assays. The most active of these molecules, thalassiolin A (1), displays in vitro inhibition of the integrase catalyzed strand transfer reaction (IC50=0.4 microM) and an antiviral IC50 of 30 microM. Molecular modeling studies indicate a favorable binding mode is probable at the catalytic core domain of HIV-1 integrase.

Cloning, characterization and comparative analysis of pig plasma apolipoprotein A-IV.

PubMed

Navarro, María A; Acín, Sergio; Iturralde, María; Calleja, Lucía; Carnicer, Ricardo; Guzmán-García, Mario A; González-Ramón, Nieves; Mata, Pedro; Isabel, Beatriz; López-Bote, Clemente J; Lampreave, Fermín; Piñeiro, Andrés; Osada, Jesús

2004-01-21

Pig apolipoprotein (apo) A-IV cDNA was cloned, characterized and compared to the human ortholog. Mature porcine apo A-IV consists of 362 amino acids and displays a 75.6% sequence identity with human protein. Pig apo A-IV is the smallest reported mammalian apo A-IV because it lacks the repeated motifs of glutamine and glutamic acid at the carboxyl terminus. A phylogenic tree of apo A-IV mammalian proteins reveals that porcine apo A-IV is more closely related to humans and primates than to rodents. This protein is highly hydrophobic and is mainly associated with lipoproteins.

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Identification of Novel Targets of the Human Cell Cycle Regulatory Protein Cdc34

DTIC Science & Technology

1998-07-01

Bohman, for stains and plamids, J. La Baer for the cDNA library, C. Molina, H. P. Roest, J. Hoeijmaker, P. Sassone-Corsi for antisera, and to Shirong...mammalian CDC34 cell cycle gene. American Association of Cancer Research, 36, A191 (1995). Hershko, A., Role of ubiquitin-mediated proteolysis in cell

Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodyer, P.R.; Torban, E.; Dehbi, M.

1994-09-01

The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

PubMed

Hu, B; Li, J; Yu, W; Fang, J

1993-01-01

Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

Cloning and characterization of full-length mouse thymidine kinase 2: the N-terminal sequence directs import of the precursor protein into mitochondria.

PubMed Central

Wang, L; Eriksson, S

2000-01-01

The subcellular localization of mitochondrial thymidine kinase (TK2) has been questioned, since no mitochondrial targeting sequences have been found in cloned human TK2 cDNAs. Here we report the cloning of mouse TK2 cDNA from a mouse full-length enriched cDNA library. The mouse TK2 cDNA codes for a protein of 270 amino acids, with a 40-amino-acid presumed N-terminal mitochondrial targeting signal. In vitro translation and translocation experiments with purified rat mitochondria confirmed that the N-terminal sequence directed import of the precursor TK2 into the mitochondrial matrix. A single 2.4 kb mRNA transcript was detected in most tissues examined, except in liver, where an additional shorter (1.0 kb) transcript was also observed. There was no correlation between the tissue distribution of TK2 activity and the expression of TK2 mRNA. Full-length mouse TK2 protein and two N-terminally truncated forms, one of which corresponds to the mitochondrial form of TK2 and a shorter form corresponding to the previously characterized recombinant human TK2, were expressed in Escherichia coli and affinity purified. All three forms of TK2 phosphorylated thymidine, deoxycytidine and 2'-deoxyuridine, but with different kinetic efficiencies. A number of cytostatic pyrimidine nucleoside analogues were also tested and shown to be good substrates for the various forms of TK2. The active form of full-length mouse TK2 was a dimer, as judged by Superdex 200 chromatography. These results enhance our understanding of the structure and function of TK2, and may help to explain the mitochondrial disorder, mitochondrial neurogastrointestinal encephalomyopathy. PMID:11023833

Expression of a mutation causing hypertrophic cardiomyopathy disrupts sarcomere assembly in adult feline cardiac myocytes.

PubMed

Marian, A J; Yu, Q T; Mann, D L; Graham, F L; Roberts, R

1995-07-01

Mutations in the beta-myosin heavy chain (beta MyHC) induce hypertrophic cardiomyopathy (HCM), cardiac hypertrophy, and sarcomere disarray, with the latter being the characteristic hallmark. Thus, we sought to determine whether expression of mutant beta MyHC in adult feline cardiac myocytes, a species known to develop HCM with a phenotype identical to that in humans, induces sarcomere disarray. A full-length beta MyHC cDNA was cloned from a human heart cDNA library, and an HCM-causing mutation (Arg403Gln) was induced in the beta MyHC cDNA by site-directed mutagenesis using polymerase chain reaction (PCR). The normal and mutant beta MyHC cDNAs were cloned into p delta E1spIB shuttle vector, downstream from a cytomegalovirus (CMV) promoter. Replication-deficient recombinant adenoviral constructs (Ad5/CMV/beta MyHC-N and Ad5/CMV/beta MyHC-403) were generated through homologous recombination of p delta E1spIB/CMV/beta MyHC-N or Ad5/CMV/beta MyHC-403 and pBHG10 after cotransfection in 293 host cells. Infection of COS-1 cells with the beta MyHC construct resulted in the expression of a full-length myosin protein. Efficiency of infection of isolated adult cardiac myocytes was > 95%. Expression of the beta MyHC constructs into mRNA at 48 hours after infection of feline cardiac myocytes was confirmed by reverse transcription-PCR. The net total protein and beta-myosin synthesis were determined by using the amount of incorporation of [3H]phenylalanine into total protein and beta-myosin, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

Remapping of the stripe rust resistance gene Yr10 in common wheat.

PubMed

Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

2018-06-01

Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

Molecular cloning and immunochemical characterization of a novel major Japanese cedar pollen allergen belonging to the aspartic protease family.

PubMed

Ibrahim, Ahmed Ragaa Nour; Kawamoto, Seiji; Aki, Tsunehiro; Shimada, Yayoi; Rikimaru, Satoshi; Onishi, Nobukazu; Babiker, Elfadil Elfadl; Oiso, Isao; Hashimoto, Kunihiko; Hayashi, Takaharu; Ono, Kazuhisa

2010-01-01

Japanese cedar (Cryptomeria japonica) pollen is a major cause of seasonal pollinosis in Japan. Protease activity in the pollen grains may trigger pro-allergic responses but no such proteases have yet been identified as pollen allergens. We report the molecular cloning and immunochemical characterization of a novel C. japonica pollen allergen belonging to the aspartic protease family. We focused on the C. japonica pollen allergen spot No. 63 (CPA63, 47.5% IgE binding frequency) on our 2-dimensional IgE immunoblot map. The internal amino acid sequences were determined using time-of-flight mass spectrometry. Full-length cpa63 cDNA was cloned by rapid amplification of cDNA ends (RACE)-PCR. Recombinant CPA63 (r-CPA63) was expressed using the baculovirus-insect cell culture system and its IgE binding capacity was analyzed by enzyme-linked immunosorbent assay (ELISA). The proteolytic activity of r-CPA63 was also assessed using a putative mature enzyme produced upon autolysis. cpa63 cDNA encoded a 472 amino acid polypeptide showing about 40% sequence identity to members of the plant atypical aspartic protease family. ELISA showed that r-CPA63 was recognized by IgE antibodies in the serum of 58% (18/31) of Japanese cedar pollinosis patients. We also demonstrated an aspartic protease-like enzyme activity of the putative mature r-CPA63. We have identified the first plant aspartic protease allergen from Japanese cedar pollen. The availability of the CPA63 sequence and its recombinant allergen production system are useful not only for pharmaceutical applications but also for further examination of the role of protease activity in the pathogenesis of cedar pollinosis. 2010 S. Karger AG, Basel.

Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

PubMed Central

Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

1988-01-01

In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.

PubMed

Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M

2013-07-01

Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.

Functional characterization of two flap endonuclease-1 homologues in rice.

PubMed

Kimura, Seisuke; Furukawa, Tomoyuki; Kasai, Nobuyuki; Mori, Yoko; Kitamoto, Hiroko K; Sugawara, Fumio; Hashimoto, Junji; Sakaguchi, Kengo

2003-09-18

Flap endonuclease-1 (FEN-1) is an important enzyme involved in DNA replication and repair. Previously, we isolated and characterized a complementary DNA (cDNA) from rice (Oryza sativa) encoding a protein which shows homology with the eukaryotic flap endonuclease-1 (FEN-1). In this report, we found that rice (O. sativa L. cv. Nipponbare) possessed two FEN-1 homologues designated as OsFEN-1a and OsFEN-1b. The OsFEN-1a and OsFEN-1b genes were mapped to chromosome 5 and 3, respectively. Both genes contained 17 exons and 16 introns. Alignment of OsFEN-1a protein with OsFEN-1b protein showed a high degree of sequence similarity, particularly around the N and I domains. Northern hybridization and in situ hybridization analysis demonstrated preferential expression of OsFEN-1a and OsFEN-1b in proliferating tissues such as the shoot apical meristem or young leaves. The levels of OsFEN-1a and OsFEN-1b expression were significantly reduced when cell proliferation was temporarily halted by the removal of sucrose from the growth medium. When the growth-halted cells began to regrow following the addition of sucrose to the medium, both OsFEN-1a and OsFEN-1b were again expressed at high level. These results suggested that OsFEN-1a and OsFEN-1b are required for cell proliferation. Functional complementation assay suggested that OsFEN-1a cDNA had the ability to complement Saccharomyces cerevisiae rad27 null mutant. On the other hand, OsFEN-1b cDNA could not complement the rad27 mutant. The roles of OsFEN-1a and OsFEN-1b in plant DNA replication and repair are discussed.

The VBP and a1/EBP leucine zipper factors bind overlapping subsets of avian retroviral long terminal repeat CCAAT/enhancer elements.

PubMed

Smith, C D; Baglia, L A; Curristin, S M; Ruddell, A

1994-10-01

Two long terminal repeat (LTR) enhancer-binding proteins which may regulate high rates of avian leukosis virus (ALV) LTR-enhanced c-myc transcription during bursal lymphomagenesis have been identified (A. Ruddell, M. Linial, and M. Groudine, Mol. Cell. Biol. 9:5660-5668, 1989). The genes encoding the a1/EBP and a3/EBP binding factors were cloned by expression screening of a lambda gt11 cDNA library from chicken bursal lymphoma cells. The a1/EBP cDNA encodes a novel leucine zipper transcription factor (W. Bowers and A. Ruddell, J. Virol. 66:6578-6586, 1992). The partial a3/EBP cDNA clone encodes amino acids 84 to 313 of vitellogenin gene-binding protein (VBP), a leucine zipper factor that binds the avian vitellogenin II gene promoter (S. Iyer, D. Davis, and J. Burch, Mol. Cell. Biol. 11:4863-4875, 1991). Multiple VBP mRNAs are expressed in B cells in a pattern identical to that previously observed for VBP in other cell types. The LTR-binding activities of VBP, a1/EBP, and B-cell nuclear extract protein were compared and mapped by gel shift, DNase I footprinting, and methylation interference assays. The purified VBP and a1/EBP bacterial fusion proteins bind overlapping but distinct subsets of CCAAT/enhancer elements in the closely related ALV and Rous sarcoma virus (RSV) LTR enhancers. Protein binding to these CCAAT/enhancer elements accounts for most of the labile LTR enhancer-binding activity observed in B-cell nuclear extracts. VBP and a1/EBP could mediate the high rates of ALV and RSV LTR-enhanced transcription in bursal lymphoma cells and many other cell types.

Site-specific Microtubule-associated Protein 4 Dephosphorylation Causes Microtubule Network Densification in Pressure Overload Cardiac Hypertrophy*

PubMed Central

Chinnakkannu, Panneerselvam; Samanna, Venkatesababa; Cheng, Guangmao; Ablonczy, Zsolt; Baicu, Catalin F.; Bethard, Jennifer R.; Menick, Donald R.; Kuppuswamy, Dhandapani; Cooper, George

2010-01-01

In severe pressure overload-induced cardiac hypertrophy, a dense, stabilized microtubule network forms that interferes with cardiocyte contraction and microtubule-based transport. This is associated with persistent transcriptional up-regulation of cardiac α- and β-tubulin and microtubule-stabilizing microtubule-associated protein 4 (MAP4). There is also extensive microtubule decoration by MAP4, suggesting greater MAP4 affinity for microtubules. Because the major determinant of this affinity is site-specific MAP4 dephosphorylation, we characterized this in hypertrophied myocardium and then assessed the functional significance of each dephosphorylation site found by mimicking it in normal cardiocytes. We first isolated MAP4 from normal and pressure overload-hypertrophied feline myocardium; volume-overloaded myocardium, which has an equal degree and duration of hypertrophy but normal functional and cytoskeletal properties, served as a control for any nonspecific growth-related effects. After cloning cDNA-encoding feline MAP4 and obtaining its deduced amino acid sequence, we characterized by mass spectrometry any site-specific MAP4 dephosphorylation. Solely in pressure overload-hypertrophied myocardium, we identified striking MAP4 dephosphorylation at Ser-472 in the MAP4 N-terminal projection domain and at Ser-924 and Ser-1056 in the assembly-promoting region of the C-terminal microtubule-binding domain. Site-directed mutagenesis of MAP4 cDNA was then used to switch each serine to non-phosphorylatable alanine. Wild-type and mutated cDNAs were used to construct adenoviruses; microtubule network density, stability, and MAP4 decoration were assessed in normal cardiocytes following an equivalent level of MAP4 expression. The Ser-924 → Ala MAP4 mutant produced a microtubule phenotype indistinguishable from that seen in pressure overload hypertrophy, such that Ser-924 MAP4 dephosphorylation during pressure overload hypertrophy may be central to this cytoskeletal abnormality. PMID:20436166

Increase in the levels of chaperone proteins by exposure to beta-estradiol, bisphenol A and 4-methoxyphenol in human cells transfected with estrogen receptor alpha cDNA.

PubMed

Kita, Kazuko; Jin, Yuan-Hu; Sun, Zhuo; Chen, Shi-Ping; Sumiya, Yoko; Hongo, Toshio; Suzuki, Nobuo

2009-06-01

We examined changes in the levels of chaperone proteins to evaluate the toxic effects of environmental chemicals in human cells in vitro. Some chaperones are up-regulated by estrogenic chemicals, but the effect is not necessarily dependent on the receptor. Thus we also investigated whether a chemical-induced change in chaperone protein expression is human estrogen receptor (hER)-dependent or not, using cultured human cell lines transfected with hERalpha cDNA or an empty vector. In the hERalpha-expressed cells, the protein levels of the heat shock protein 27 (HSP27), the glucose-regulated protein 78 (GRP78/BiP), and GRP94 increased after exposure to beta-estradiol (E(2)) (from 10(-9)M to 10(-6)M) and bisphenol A (BPA) (from 10(-6)M to 10(-5)M). On the other hand, the increase was not observed in the cells without hERalpha expression. These results suggest that the E(2)- and BPA-induced increase in the protein levels were hERalpha dependent. We next examined the effect of four phenolic chemicals similar in structure to BPA, and found that among them, 4-methoxyphenol (from 10(-6)M to 10(-5)M) increased the levels of the chaperone proteins with hERalpha dependency. Thus the human cultured cells would be suitable for evaluating whether an increase in chaperone proteins occurs upon exposure to environmental chemicals and whether the effect is ER-dependent.

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

Identification of genes differentially expressed in association with acquired cisplatin resistance

PubMed Central

Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G

2000-01-01

The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653

NHE10, a novel osteoclast-specific member of the Na{sup +}/H{sup +} exchanger family, regulates osteoclast differentiation and survival

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Seoung Hoon; Kim, Taesoo; Park, Eui-Soon

2008-05-02

Bone homeostasis is tightly regulated by the balanced actions of osteoblasts (OBs) and osteoclasts (OCs). We previously analyzed the gene expression profile of OC differentiation using a cDNA microarray, and identified a novel osteoclastogenic gene candidate, clone OCL-1-E7 [J. Rho, C.R. Altmann, N.D. Socci, L. Merkov, N. Kim, H. So, O. Lee, M. Takami, A.H. Brivanlou, Y. Choi, Gene expression profiling of osteoclast differentiation by combined suppression subtractive hybridization (SSH) and cDNA microarray analysis, DNA Cell Biol. 21 (2002) 541-549]. In this study, we have isolated full-length cDNAs corresponding to this clone from mice and humans to determine the functionalmore » roles of this gene in osteoclastogenesis. The full-length cDNA of OCL-1-E7 encodes 12 membrane-spanning domains that are typical of isoforms of the Na{sup +}/H{sup +} exchangers (NHEs), indicating that this clone is a novel member of the NHE family (hereafter referred to as NHE10). Here, we show that NHE10 is highly expressed in OCs in response to receptor activator of nuclear factor-{kappa}B ligand signaling and is required for OC differentiation and survival.« less

Quantitation of apolipoprotein epsilon gene expression by competitive polymerase chain reaction in a patient with familial apolipoprotein E deficiency.

PubMed

Dobmeyer, J M; Rexin, M; Dobmeyer, T S; Klein, S A; Rossol, R; Feussner, G

1998-06-22

A simple method of obtaining semiquantitative and reliable data on apolipoprotein (apo) sigma gene expression is described. We detected apo sigma specific sequences by reverse transcription (rT)-PCR. For quantitative measurement, an apo sigma DNA standard was produced allowing the development of a competitive PCR-method. The efficiency of RNA extraction and cDNA synthesis was controlled by quantitation of a housekeeping gene (glyceraldehyde-3-phosphatedehydrogenase, G3PDH) in separate reactions. To imitate a defined induction of apo sigma gene expression, serial twofold dilutions of total RNA were reversely transcribed and the respective cDNAs used to perform a competitive apo sigma and G3PDH PCR. The change in apo sigma cDNA and G3PDH cDNA was 1.7-2.3-fold with an expected value of 2.0-fold. Standard deviations in three independently performed experiments were within a range of < 15% of the mean, indicating low intra-assay variation and high reproducibility. To illustrate this method, apo sigma gene expression was measured in a patient with complete lack of functional active apo E in comparison to healthy controls. The method presented here might be valuable in assessment of apo sigma gene expression in human disease.

Identifications of SUMO-1 cDNA and Its Expression Patterns in Pacific White Shrimp Litopeanaeus vannamei

PubMed Central

Laoong-u-thai, Yanisa; Zhao, Baoping; Phongdara, Amornrat; Ako, Harry; Yang, Jinzeng

2009-01-01

Small ubiquitin-like modifiers (SUMO) work in a similar way as ubiquitin to alter the biological properties of a target protein by conjugation. A shrimp SUMO cDNA named LvSUMO-1 was identified in Litopenaeus vannamei. LvSUMO-1 cDNA contains a coding sequence of 282 nucleotides with untranslated regions of 37 bp at 5'-end and 347 bp at 3'-end, respectively. The deduced 93 amino acids exhibit 83% identity with the Western Honeybee SUMO-1, and more than 65% homologies with human and mouse SUMO-1. LvSUMO-1 mRNA is expressed in most L. vannamei tissues with the highest level in hepatopancrease. The mRNA expression of LvSUMO-1 over development stages in L. Vammamei is distinguished by a low level in nauplius stage and relatively high level in postlarva stage with continuous expression until juvenile stage. The LvSUMO-1 protein and its conjugated proteins are detected in both cytoplasm and nucleus in several tissues. Interestingly, LvSUMO-1 mRNA levels are high in abdominal muscle during the premolt stage, wherein it has significant activities of protein degradation, suggesting its possible role in the regulation of shrimp muscle protein degradation. PMID:19240809

Infection and Propagation of Human Rhinovirus C in Human Airway Epithelial Cells

PubMed Central

Hao, Weidong; Bernard, Katie; Patel, Nita; Ulbrandt, Nancy; Feng, Hui; Svabek, Catherine; Wilson, Susan; Stracener, Christina; Wang, Kathy; Suzich, JoAnn; Blair, Wade

2012-01-01

Human rhinovirus species C (HRV-C) was recently discovered using molecular diagnostic techniques and is associated with lower respiratory tract disease, particularly in children. HRV-C cannot be propagated in immortalized cell lines, and currently sinus organ culture is the only system described that is permissive to HRV-C infection ex vivo. However, the utility of organ culture for studying HRV-C biology is limited. Here, we report that a previously described HRV-C derived from an infectious cDNA, HRV-C15, infects and propagates in fully differentiated human airway epithelial cells but not in undifferentiated cells. We demonstrate that this differentiated epithelial cell culture system supports infection and replication of a second virus generated from a cDNA clone, HRV-C11. We show that HRV-C15 virions preferentially bind fully differentiated airway epithelial cells, suggesting that the block to replication in undifferentiated cells is at the step of viral entry. Consistent with previous reports, HRV-C15 utilizes a cellular receptor other than ICAM-1 or LDLR for infection of differentiated epithelial cells. Furthermore, we demonstrate that HRV-C15 replication can be inhibited by an HRV 3C protease inhibitor (rupintrivir) but not an HRV capsid inhibitor previously under clinical development (pleconaril). The HRV-C cell culture system described here provides a powerful tool for studying the biology of HRV-C and the discovery and development of HRV-C inhibitors. PMID:23035218