Sample records for human cdna sequencing

  1. Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-02-01

    The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

  2. Brain cDNA clone for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McTiernan, C.; Adkins, S.; Chatonnet, A.

    1987-10-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

  3. Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

    PubMed

    Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

    1996-02-01

    There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

  4. Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

    PubMed

    Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

    1991-03-01

    We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

  5. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  6. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  7. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  8. Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

    PubMed

    Lu, L; Komada, M; Kitamura, N

    1998-06-15

    Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

  9. Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

    PubMed Central

    Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

    1998-01-01

    Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

  10. The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

    PubMed Central

    2004-01-01

    The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

  11. Sequence and pattern of expression of a bovine homologue of a human mitochondrial transport protein associated with Grave's disease.

    PubMed

    Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F

    1992-01-01

    A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.

  12. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    PubMed

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  13. cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoefler, G.; Forstner, M.; Hulla, W.

    1994-01-01

    Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

  14. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  15. The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

    PubMed

    Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

    1990-01-05

    We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

  16. Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

    PubMed

    Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

    2010-04-01

    We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

  17. Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

    PubMed Central

    Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

  18. High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hadano, S.; Ishida, Y.; Tomiyasu, H.

    1994-09-01

    To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

  19. Sequence verification as quality-control step for production of cDNA microarrays.

    PubMed

    Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

    2001-07-01

    To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

  20. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

  1. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  2. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  3. HUNT: launch of a full-length cDNA database from the Helix Research Institute.

    PubMed

    Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

    2001-01-01

    The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

  4. Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

    PubMed Central

    Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

    1991-01-01

    Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

  5. Comprehensive red blood cell and platelet antigen prediction from whole genome sequencing: proof of principle

    PubMed Central

    Westhoff, Connie M.; Uy, Jon Michael; Aguad, Maria; Smeland‐Wagman, Robin; Kaufman, Richard M.; Rehm, Heidi L.; Green, Robert C.; Silberstein, Leslie E.

    2015-01-01

    BACKGROUND There are 346 serologically defined red blood cell (RBC) antigens and 33 serologically defined platelet (PLT) antigens, most of which have known genetic changes in 45 RBC or six PLT genes that correlate with antigen expression. Polymorphic sites associated with antigen expression in the primary literature and reference databases are annotated according to nucleotide positions in cDNA. This makes antigen prediction from next‐generation sequencing data challenging, since it uses genomic coordinates. STUDY DESIGN AND METHODS The conventional cDNA reference sequences for all known RBC and PLT genes that correlate with antigen expression were aligned to the human reference genome. The alignments allowed conversion of conventional cDNA nucleotide positions to the corresponding genomic coordinates. RBC and PLT antigen prediction was then performed using the human reference genome and whole genome sequencing (WGS) data with serologic confirmation. RESULTS Some major differences and alignment issues were found when attempting to convert the conventional cDNA to human reference genome sequences for the following genes: ABO, A4GALT, RHD, RHCE, FUT3, ACKR1 (previously DARC), ACHE, FUT2, CR1, GCNT2, and RHAG. However, it was possible to create usable alignments, which facilitated the prediction of all RBC and PLT antigens with a known molecular basis from WGS data. Traditional serologic typing for 18 RBC antigens were in agreement with the WGS‐based antigen predictions, providing proof of principle for this approach. CONCLUSION Detailed mapping of conventional cDNA annotated RBC and PLT alleles can enable accurate prediction of RBC and PLT antigens from whole genomic sequencing data. PMID:26634332

  6. Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

    PubMed Central

    Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

    1992-01-01

    cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

  7. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

    1987-06-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

  8. Human somatostatin I: sequence of the cDNA.

    PubMed Central

    Shen, L P; Pictet, R L; Rutter, W J

    1982-01-01

    RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

  9. Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

    PubMed

    Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

    2005-12-02

    cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

  10. The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

    PubMed Central

    Allison, J; Hall, L; MacIntyre, I; Craig, R K

    1981-01-01

    (1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

  11. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    PubMed

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  12. Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

    PubMed Central

    Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

    1994-01-01

    Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

  13. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

    PubMed Central

    Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

  14. [Multiplexing mapping of human cDNAs]. Final report, September 1, 1991--February 28, 1994

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    Using PCR with automated product analysis, 329 human brain cDNA sequences have been assigned to individual human chromosomes. Primers were designed from single-pass cDNA sequences expressed sequence tags (ESTs). Primers were used in PCR reactions with DNA from somatic cell hybrid mapping panels as templates, often with multiplexing. Many ESTs mapped match sequence database records. To evaluate of these matches, the position of the primers relative to the matching region (In), the BLAST scores and the Poisson probability values of the EST/sequence record match were determined. In cases where the gene product was stringently identified by the sequence match hadmore » already been mapped, the gene locus determined by EST was consistent with the previous position which strongly supports the validity of assigning unknown genes to human chromosomes based on the EST sequence matches. In the present cases mapping the ESTs to a chromosome can also be considered to have mapped the known gene product: rolipram-sensitive cAMP phosphodiesterase, chromosome 1; protein phosphatase 2A{beta}, chromosome 4; alpha-catenin, chromosome 5; the ELE1 oncogene, chromosome 10q11.2 or q2.1-q23; MXII protein, chromosome l0q24-qter; ribosomal protein L18a homologue, chromosome 14; ribosomal protein L3, chromosome 17; and moesin, Xp11-cen. There were also ESTs mapped that were closely related to non-human sequence records. These matches therefore can be considered to identify human counterparts of known gene products, or members of known gene families. Examples of these include membrane proteins, translation-associated proteins, structural proteins, and enzymes. These data then demonstrate that single pass sequence information is sufficient to design PCR primers useful for assigning cDNA sequences to human chromosomes. When the EST sequence matches previous sequence database records, the chromosome assignments of the EST can be used to make preliminary assignments of the human gene to a chromosome.« less

  15. Comparison of the canine and human acid {beta}-galactosidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

    Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

  16. A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.

    PubMed

    Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S

    2003-06-01

    The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.

  17. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  18. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1987-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  19. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1990-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  20. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1988-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  1. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1989-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  2. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    PubMed

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  3. cDNA cloning of the human monocarboxylate transporter 1 and chromosomal localization of the SLC16A1 locus to 1p13.2-p12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garcia, C.K.; Li, X.; Luna, J.

    1994-09-15

    Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.

  4. Structure and chromosomal localization of the human PD-1 gene (PDCD1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shinohara, T.; Ishida, Y.; Kawaichi, M.

    1994-10-01

    A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

  5. Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

    PubMed Central

    Huebner, K; Druck, T; Croce, C M; Thiesen, H J

    1991-01-01

    cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

  6. Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

    PubMed

    Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

    1997-06-05

    We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

  7. Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

    PubMed Central

    Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

    1999-01-01

    Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

  8. Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

    PubMed Central

    McWilliams, D; Callahan, R C; Boime, I

    1977-01-01

    A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

  9. Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

    PubMed Central

    Grange, T; de Sa, C M; Oddos, J; Pictet, R

    1987-01-01

    We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

  10. In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

    PubMed Central

    Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

    2005-01-01

    The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

  11. Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mencinger, M.; Panagopoulos, I.; Andreasson, P.

    1997-05-01

    Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

  12. cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cool, D.E.; Tonks, N.K.; Charbonneau, H.

    1989-07-01

    A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

  13. Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

    PubMed

    Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

    1987-01-26

    Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

  14. Characterization and mapping of the human rhodopsin kinase gene and screening of the gene for mutations in patients with retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khani, S.C.; Lin, D.; Magovcevic, I.

    1994-09-01

    Rhodopsin kinase (RK) is a cytosolic enzyme in rod photoreceptors that initiates the deactivation of the phototransductions cascade by phosphorylating photoactivated rhodopsin. Although the cDNA sequence of bovine RK has been determined previously, no human cDNA or genomic sequence has thus far been available for genetic studies. In order to investigate the possible role of this candidate gene in retinitis pigmentosa (RP) and allied diseases, we have isolated and characterized human cDNA and genomic clones derived from the RK locus. The coding sequence of the human gene is 1692 nucleotides in length and is split into seven exons. The humanmore » and the bovine sequence show 84% identity at the nucleotide level and 92% identity at the amino acid level. Thus far, the intronic sequences flanking each exon except for one have been determined. We have also mapped the human RK gene to chromosome 13q34 using fluorescence in situ hybridization. To our knowledge, no RP gene has as yet been linked to this region. However, since the substrate for RK (rhodopsin) and other members of the phototransduction cascade have been implicated in the pathogenesis of RP, it is conceivable that defects in RK can also cause some forms of this disease. We are evaluating this possibility by screening DNA from 173 patients with autosomal recessive RP and 190 patients with autosomal dominant RP. So far, we have found 11 patients with variant bands. In one patient with autosomal dominant RP we discovered the missense change Ser536Leu. Cosegregation studies and further sequencing of the variant bands are currently underway.« less

  15. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

    The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

  16. Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

    NASA Technical Reports Server (NTRS)

    Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

    1997-01-01

    A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

  17. Demonstration of GTG as an endogenous initiation codon for a human mRNA transcript revealed by molecular cloning of the serpin endopin 2B.

    PubMed

    Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill; Hook, Vivian Y H

    2004-08-16

    This study demonstrates utilization of the novel GTG initiation codon for translation of a human mRNA transcript that encodes the serpin endopin 2B, a protease inhibitor. Molecular cloning revealed the nucleotide sequence of the human endopin 2B cDNA. Its deduced primary sequence shows high homology to bovine endopin 2A that possesses cross-class protease inhibition of elastase and papain. Notably, the human endopin 2B cDNA sequence revealed GTG as the predicted translation initiation codon; the predicted translation product of 46 kDa endopin 2B was produced by in vitro translation of 35S-endopin 2B with mammalian (rabbit) protein translation components. Importantly, bioinformatic studies demonstrated the presence of the entire human endopin 2B cDNA sequence with GTG as initiation codon within the human genome on chromosome 14. Further evidence for GTG as a functional initiation codon was illustrated by GTG-mediated in vitro translation of the heterologous protein EGFP, and by GTG-mediated expression of EGFP in mammalian PC12 cells. Mutagenesis of GTG to GTC resulted in the absence of EGFP expression in PC12 cells, indicating the function of GTG as an initiation codon. In addition, it was apparent that the GTG initiation codon produces lower levels of translated protein compared to ATG as initiation codon. Significantly, GTG-mediated translation of endopin 2B demonstrates a functional human gene product not previously predicted from initial analyses of the human genome. Further analyses based on GTG as an alternative initiation codon may predict new candidate genes of the human genome.

  18. cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

    PubMed

    Huang, Shengbing; Song, Wei; Lin, Qishui

    2005-08-01

    A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

  19. Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

    PubMed

    Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

    2002-09-01

    A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

  20. Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

    1992-01-01

    We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

  1. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  2. Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

    PubMed Central

    Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

    2011-01-01

    Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

  3. Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Montermini, L.; Zara, F.; Pandolfo, M.

    1994-09-01

    Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

  4. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  5. Rapid in silico cloning of genes using expressed sequence tags (ESTs).

    PubMed

    Gill, R W; Sanseau, P

    2000-01-01

    Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

  6. Cross-referencing yeast genetics and mammalian genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hieter, P.; Basset, D.; Boguski, M.

    1994-09-01

    We have initiated a project that will systematically transfer information about yeast genes onto the genetic maps of mice and human beings. Rapidly expanding human EST data will serve as a source of candidate human homologs that will be repeatedly searched using yeast protein sequence queries. Search results will be automatically reported to participating labs. Human cDNA sequences from which the ESTs are derived will be mapped at high resolution in the human and mouse genomes. The comparative mapping information cross-references the genomic position of novel human cDNAs with functional information known about the cognate yeast genes. This should facilitatemore » the initial identification of genes responsible for mammalian mutant phenotypes, including human disease. In addition, the identification of mammalian homologs of yeast genes provides reagents for determining evolutionary conservation and for performing direct experiments in multicellular eukaryotes to enhance study of the yeast protein`s function. For example, ESTs homologous to CDC27 and CDC16 were identified, and the corresponding cDNA clones were obtained from ATTC, completely sequenced, and mapped on human and mouse chromosomes. In addition, the CDC17hs cDNA has been used to raise antisera to the CDC27Hs protein and used in subcellular localization experiments and junctional studies in mammalian cells. We have received funding from the National Center for Human Genome Research to provide a community resource which will establish comprehensive cross-referencing among yeast, human, and mouse loci. The project is set up as a service and information on how to communicate with this effort will be provided.« less

  7. Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

    PubMed

    Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

    1995-04-03

    The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

  8. alpha-Mannosidosis in the guinea pig: cloning of the lysosomal alpha-mannosidase cDNA and identification of a missense mutation causing alpha-mannosidosis.

    PubMed

    Berg, Thomas; Hopwood, John J

    2002-03-16

    alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.

  9. Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

    PubMed

    Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

    2011-12-01

    Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

  10. Efficacy of vaccination with plasmid DNA encoding for HER2/neu or HER2/neu-eGFP fusion protein against prostate cancer in rats.

    PubMed

    Bhattachary, R; Bukkapatnam, R; Prawoko, I; Soto, J; Morgan, M; Salup, R R

    2002-05-01

    Despite early diagnosis and improved therapy, 31,500 men will die from prostate cancer (PC) this year. The HER2/neu oncoprotein is an important effector of cell growth found in the majority of high-grade prostatic tumors and is capable of rendering immunogenicity. The antigenicity of this oncoprotein might prove useful in the development of PC vaccines. Our goal is to prove the principle that a single DNA vaccine can provide reliable immunity against PC in the MatLyLu (MLL) translational tumor model. The parental rat MatLyLu PC cell line expresses low to moderate levels of the rat neu protein. To simulate in vivo human PC, MatLyLu cells were transfected with a truncated sequence of human HER2/neu cDNA cloned into the pCI-neo vector. This HER2/neu cDNA sequence encodes the first 433 amino acids of the extracellular domain (ECD). MatLyLu cells were also transfected with the same HER2/neu cDNA sequence cloned into the N1-terminal sequence of EGFP reporter gene to produce a fusion protein. The partial ECD sequence of HER2/neu includes five rat major histocompatibility (MHC)-II-restricted peptides with complete human-to-rat cross-species homology. The HER2/neu protein overexpression was documented by Western Blot analysis, and the expression of fusion protein was monitored by confocal microscopy and fluorimetry. Vaccination with a single injection of HER2/neu cDNA protected 50% of animals against HER2/neu-MatLyLu tumors (P < 0.01). When the tumor cells were engineered to express HER2/neu-EGFP fusion protein, the antitumor immunity was enhanced, as following vaccination with HER2/neu-EGFP cDNA, 80% of these rats rejected HER2/neu-EGFP-MatLyLu (P<0.001). Both vaccines induced HER2/neu-specific antibody titers. Rats vaccinated with EGFP-cDNA rejected 80% of EGFP-MatLyLu tumors and, interestingly, 40% of HER2/neu-MatLyLu tumors. None of the cDNA vaccines induced immunity against parental MatLyLu cells. Our data clearly demonstrate that a single injection of HER2/neu-EGFP cDNA is a very effective vaccine against PC tumors expressing the cognate tumor-associated antigen (TA). The antitumor immunity is significantly more pronounced if the tumors express xenogeneic HER2/neu-EGFP fusion protein as opposed to only the syngeneic HER2/neu oncoprotein. Our data suggests that the HER2/neu-EGFP-MatLyLu tumor is a potential animal tumor model for investigating therapeutic vaccine strategies against PC in vivo and demonstrates the limitations of a cDNA vaccine only encoding for MHC-II-restricted HER2/neu-ECD sequence peptides.

  11. Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

    PubMed

    Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

    2009-09-01

    We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

  12. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  13. Genomic clones for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kott, M.; Venta, P.J.; Larsen, J.

    1987-05-01

    A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

  14. Sequencing and comparative genomic analysis of 1227 Felis catus cDNA sequences enriched for developmental, clinical and nutritional phenotypes

    PubMed Central

    2012-01-01

    Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742

  15. Molecular Targeting of Prostate Cancer During Androgen Ablation: Inhibition of CHES1/FOXN3

    DTIC Science & Technology

    2013-05-01

    the DNA sequences (~25^6 reads/sample) were mapped to the human genome reference sequence (hg19...tumor the AR has a genomic abnormality, placing the novel sequence 3’ of the transcriptional start site. However, it is unclear if a genomic alteration...exon/intron organization of the CHES1 gene was determined by BLAST analysis of the human genome using the 1,473-bp CHES1 cDNA sequence

  16. Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

    1994-07-15

    The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

  17. Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

    PubMed

    Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

    2002-06-15

    To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

  18. Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

    PubMed Central

    Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

    1993-01-01

    A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

  19. Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.

    PubMed Central

    Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E

    1987-01-01

    We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261

  20. Localization of human coagulation factor VIII (hFVIII) in transgenic rabbit by FISH-TSA: identification of transgene copy number and transmission to the next generation.

    PubMed

    Krylov, V; Tlapáková, T; Mácha, J; Curlej, J; Ryban, L; Chrenek, P

    2008-01-01

    For chromosomal localization of the hFVIII human transgene in F2 and F3 generation of transgenic rabbits, FISH-TSA was applied. A short cDNA probe (1250 bp) targeted chromosomes 3, 7, 8, 9 and 18 of an F2 male (animal 1-3-8). Two transgenic offspring (F3) revealed signal positions in chromosome 3 and chromosomes 3 and 7, respectively. Sequencing and structure analysis of the rabbit orthologous gene revealed high similarity to its human counterpart. Part of the sequenced cDNA (1310 bp) served as a probe for FISH-TSA analysis. The rabbit gene was localized in the q arm terminus of the X chromosome. This result is in agreement with reciprocal chromosome painting between the rabbit and the human. The presented FISH-TSA method provides strong signals without any interspecies reactivity.

  1. Phylogenetic and Structural Analysis of the Pluripotency Factor Sex-Determining Region Y box2 Gene of Camelus dromedarius (cSox2).

    PubMed

    Alawad, Abdullah; Alharbi, Sultan; Alhazzaa, Othman; Alagrafi, Faisal; Alkhrayef, Mohammed; Alhamdan, Ziyad; Alenazi, Abdullah; Al-Johi, Hasan; Alanazi, Ibrahim O; Hammad, Mohamed

    2016-01-01

    Although the sequencing information of Sox2 cDNA for many mammalian is available, the Sox2 cDNA of Camelus dromedaries has not yet been characterized. The objective of this study was to sequence and characterize Sox2 cDNA from the brain of C. dromedarius (also known as Arabian camel). A full coding sequence of the Sox2 gene from the brain of C. dromedarius was amplified by reverse transcription PCRjmc and then sequenced using the 3730XL series platform Sequencer (Applied Biosystem) for the first time. The cDNA sequence displayed an open reading frame of 822 nucleotides, encoding a protein of 273 amino acids. The molecular weight and the isoelectric point of the translated protein were calculated as 29.825 kDa and 10.11, respectively, using bioinformatics analysis. The predicted cSox2 protein sequence exhibited high identity: 99% for Homo sapiens, Mus musculus, Bos taurus, and Vicugna pacos; 98% for Sus scrofa and 93% for Camelus ferus. A 3D structure was built based on the available crystal structure of the HMG-box domain of human stem cell transcription factor Sox2 (PDB: 2 LE4) with 81 residues and predicting bioinformatics software for 273 amino acid residues. The comparison confirms the presence of the HMG-box domain in the cSox2 protein. The orthologous phylogenetic analysis showed that the Sox2 isoform from C. dromedarius was grouped with humans, alpacas, cattle, and pigs. We believe that this genetic and structural information will be a helpful source for the annotation. Furthermore, Sox2 is one of the transcription factors that contributes to the generation-induced pluripotent stem cells (iPSCs), which in turn will probably help generate camel induced pluripotent stem cells (CiPSCs).

  2. Characterization of the gene encoding component C3 of the complement system from the spider Loxosceles laeta venom glands: Phylogenetic implications.

    PubMed

    Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V

    2016-09-01

    A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. Expression of glutathione peroxidase I gene in selenium-deficient rats.

    PubMed Central

    Reddy, A P; Hsu, B L; Reddy, P S; Li, N Q; Thyagaraju, K; Reddy, C C; Tam, M F; Tu, C P

    1988-01-01

    We have characterized a cDNA pGPX1211 encoding rat glutathione peroxidase I. The selenocysteine in the protein corresponded to a TGA codon in the coding region of the cDNA, similar to earlier findings in mouse and human genes, and a gene encoding the formate dehydrogenase from E. coli, another selenoenzyme. The rat GSH peroxidase I has a calculated subunit molecular weight of 22,155 daltons and shares 95% and 86% sequence homology with the mouse and human subunits, respectively. The 3'-noncoding sequence (greater than 930 bp) in pGPX1211 is much longer than that of the human sequences. We found that glutathione peroxidase I mRNA, but not the polypeptide, was expressed under nutritional stress of selenium deficiency where no glutathione peroxidase I activity can be detected. The failure of detecting any apoprotein for the glutathione peroxidase I under selenium deficiency and results published from other laboratories supports the proposal that selenium may be incorporated into the glutathione peroxidase I co-translationally. Images PMID:2838821

  4. cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Codina, J.; Olate, J.; Abramowitz, J.

    1988-05-15

    cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted aminomore » acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.« less

  5. Bovine adipose triglyceride lipase is not altered and adipocyte fatty acid binding protein is increased by dietary flaxseed

    USDA-ARS?s Scientific Manuscript database

    In this paper, we report the full length coding sequence of bovine ATGL cDNA are reported and analyze its expression in bovine tissues. Similar to human, mouse, and pig ATGL sequences, bovine ATGL has a highly conserved patatin domain that is necessary for lipolytic function in mice and humans. Thi...

  6. Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

    PubMed

    Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

    2008-10-13

    cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

  7. Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

    PubMed

    Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

    1997-11-01

    Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

  8. A Novel Locomotion-based Validation Assay for Candidate Drugs Using Drosophila DYT1 Disease Model

    DTIC Science & Technology

    2014-06-01

    rescue the locomotion defects of Drosophila larvae caused by the expression of human torsinAΔE. These results demonstrated that human torsinA can... Drosophila dtorsin∆D transgenic lines dtorsin∆E and dtorsin∆D cDNA constructs were made from the wild type dtorsin cDNA using QuikChange II XL Site...After confirming mutated sequences , the insert was again cut out with EcoRI and NotI and inserted between EcoRI and NotI sites of pUAST [2] to produce

  9. Construction of a cDNA library for miniature pig mandibular deciduous molars

    PubMed Central

    2014-01-01

    Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

  10. Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.

    PubMed Central

    Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E

    1994-01-01

    A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404

  11. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  12. Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

    1994-12-01

    The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

  13. [Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

    PubMed

    Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

    2005-03-01

    To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

  14. Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

    PubMed Central

    Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

    2011-01-01

    To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

  15. Molecular Cloning, Bioinformatics Analysis and Expression of Insulin-Like Growth Factor 2 from Tianzhu White Yak, Bos grunniens

    PubMed Central

    Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu

    2014-01-01

    The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317

  16. Molecular identification and functional expression of mu 3, a novel alternatively spliced variant of the human mu opiate receptor gene.

    PubMed

    Cadet, Patrick; Mantione, Kirk J; Stefano, George B

    2003-05-15

    Studies from our laboratory have revealed a novel mu opiate receptor, mu 3, which is expressed in both vascular tissues and leukocytes. The mu 3 receptor is selective for opiate alkaloids and is insensitive to opioid peptides. We now identify the mu 3 receptor at the molecular level using a 441-bp conserved region of the mu 1 receptor. Sequence analysis of the isolated cDNA suggests that it is a novel, alternatively spliced variant of the mu opiate receptor gene. To determine whether protein expressed from this cDNA exhibits the biochemical characteristics expected of the mu 3 receptor, the cDNA clone was expressed in a heterologous system. At the functional level, COS-1 cells transfected with the mu 3 receptor cDNA exhibited dose-dependent release of NO following treatment with morphine, but not opioid peptides (i.e., Met-enkephalin). Naloxone was able to block the effect of morphine on COS-1 transfected cells. Nontransfected COS-1 cells did not produce NO in the presence of morphine or the opioid peptides at similar concentrations. Receptor binding analysis with [(3)H]dihydromorphine further supports the opiate alkaloid selectivity and opioid peptide insensitivity of this receptor. These data suggest that this new mu opiate receptor cDNA encodes the mu 3 opiate receptor, since it exhibits biochemical characteristics known to be unique to this receptor (opiate alkaloid selective and opioid peptide insensitive). Furthermore, using Northern blot, RT-PCR, and sequence analysis, we have demonstrated the expression of this new mu variant in human vascular tissue, mononuclear cells, polymorphonuclear cells, and human neuroblastoma cells.

  17. cDNA cloning of an intracellular form of the human interleukin 1 receptor antagonist associated with epithelium.

    PubMed Central

    Haskill, S; Martin, G; Van Le, L; Morris, J; Peace, A; Bigler, C F; Jaffe, G J; Hammerberg, C; Sporn, S A; Fong, S

    1991-01-01

    A cDNA encoding a receptor antagonist of interleukin 1 (IL-1ra), secreted from human monocytes, has recently been isolated and sequenced [Eisenberg, S. P., Evans, R. J., Arend, W. P., Verderber, E., Brewer, M. T., Hannum, C. H. & Thompson, R. C. (1990) Nature (London) 343, 341-346]. We have identified another version of this IL-1ra, which is predominantly expressed in epithelial cells. This IL-1ra lacks a leader sequence and, thus, is probably intracellular. Both proteins are derived from the same gene through use of an alternative transcriptional start site and internal splice-acceptor site. Expression of intracellular IL-1ra cDNA in COS cells demonstrated that the intracellular product specifically inhibited exogenous interleukin 1-dependent responses. Keratinocytes were shown to contain significant amounts of nonsecreted IL-1ra protein. Constitutive expression of the intracellular IL-1ra may be an intracellular defensive mechanism in exposed epithelial cells and/or may serve to regulate autocrine interleukin 1-mediated pathways of differentiation. Images PMID:1827201

  18. Human MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-01-07

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  19. Human MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1997-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  20. Chromosomal mapping of the human M6 genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olinsky, S.; Loop, B.T.; DeKosky, A.

    1996-05-01

    M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis.more » We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.« less

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schriner, J.E.; Yi, W.; Hofmann, S.L.

    Palmitoyl-protein thioesterase (PPT) is a small glycoprotein that removes palmitate groups from cysteine residues in lipid-modified proteins. We recently reported mutations in PPT in patients with infantile neuronal ceroid lipofuscinosis (INCL), a severe neurodegenerative disorder. INCL is characterized by the accumulation of proteolipid storage material in brain and other tissues, suggesting that the disease is a consequence of abnormal catabolism of acylated proteins. In the current paper, we report the sequence of the human PPT cDNA and the structure of the human PPT gene. The cDNA predicts a protein of 306 amino acids that contains a 25-amino-acid signal peptide, threemore » N-linked glycosylation sites, and consensus motifs characteristic of thioesterases. Northern analysis of a human tissue blot revealed ubiquitous expression of a single 2.5-kb mRNA, with highest expression in lung, brain, and heart. The human PPT gene spans 25 kb and is composed of seven coding exons and a large eighth exon, containing the entire 3{prime}-untranslated region of 1388 bp. An Alu repeat and promoter elements corresponding to putative binding sites for several general transcription factors were identified in the 1060 nucleotides upstream of the transcription start site. The human PPT cDNA sequence and gene structure will provide the means for the identification of further causative mutations in INCL and facilitate genetic screening in selected high-risk populations. 31 refs., 5 figs., 1 tab.« less

  2. Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

    NASA Astrophysics Data System (ADS)

    Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

    2008-09-01

    We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

  3. cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Du, L.; Desbarats, M.; Viel, J.

    1996-08-15

    The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

  4. Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

    PubMed Central

    Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

    1993-01-01

    Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

  5. A transcription map of the regions surrounding the CSF1R locus on human chromosome 5q31: Candidate genes for diastrophic dysplasia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clines, G.; Lovett, M.

    1994-09-01

    Diastrophic dysplasia (DTD) is an autosomal recessive disorder of unknown pathogenesis that is characterized by abnormal skeletal and cartilage growth. Phenotypic characteristics of the disorder include short stature, scoliosis, and deformation of the first metacarpal. The diastrophic dysplasia gene has been localized to chromosome 5q31-33, within {approximately}60 kb of the colony stimulating factor 1 receptor gene (CSF1R). We have used direct cDNA selection to build a transcription map across {approximately}250 kb surrounding and including the CSF1R locus. cDNA pools from human placenta, activated T cells, cerebellum, Hela cells, fetal brain, chondrocytes, chondrosarcomas and osteosarcomas were multiplexed in these selections. Aftermore » two rounds of selection, an analysis revealed that {approximately}70% of the selected cDNAs were contained within the contig. DNA sequencing and cosmid mapping data from a collection of 310 clones revealed the presence of three new genes in this region that show no appreciable homologies on sequence database searches, as well as cDNA clones from the CSF1R and the PDGFRB loci (another of the known genes in the region). An additional cDNA was found with 100% homology to the gene encoding human ribosomal protein L7 (RPL7). This cDNA comprised {approximately}25% of all selected clones. However, further analysis of the genomic contig revealed the presence of an RPL7 processed pseudogene in very close proximity to the CSF1R and PDGFRB genes. The selection of processed pseudogenes is one previously anticipated artifact of selection metholodolgies, but has not been previously observed. Mutational analysis of the three new genes is underway in diastrophic dysplasia families, as is derivation of full length cDNA clones and the expansion of this detailed transcription map into a larger genomic contig.« less

  6. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution

    PubMed Central

    Modahl, Cassandra M.; Mackessy, Stephen P.

    2016-01-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides access to cDNA sequences in the absence of living specimens, even from commercial venom sources, to evaluate important regional differences in venom composition and to study snake venom protein evolution. PMID:27280639

  7. Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.

    PubMed Central

    Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I

    1991-01-01

    The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129

  8. Horse cDNA clones encoding two MHC class I genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbis, D.P.; Maher, J.K.; Stanek, J.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  9. Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

    PubMed

    Yokozaki, H; Tahara, H; Oue, N; Tahara, E

    2000-01-01

    A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

  10. An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

    PubMed

    Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

    2004-01-21

    We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

  11. [cDNA library construction from panicle meristem of finger millet].

    PubMed

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  12. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    PubMed Central

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  13. Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

    PubMed

    Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

    1994-08-02

    Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

  14. Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas.

    PubMed

    Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C

    1994-06-17

    A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.

  15. cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

    PubMed

    Simon, J W; Slabas, A R

    1998-09-18

    The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

  16. Human HST1 (HSTF1) gene maps to chromosome band 11q13 and coamplifies with the INT2 gene in human cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi

    1988-07-01

    The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less

  17. Differences in expression of retinal pigment epithelium mRNA between normal canines

    PubMed Central

    2004-01-01

    Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

  18. A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

    PubMed

    Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

    2011-09-01

    Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

  19. Cloning and characterization of the human 5,10-methenyltetrahydrofolate synthetase-encoding cDNA.

    PubMed

    Dayan, A; Bertrand, R; Beauchemin, M; Chahla, D; Mamo, A; Filion, M; Skup, D; Massie, B; Jolivet, J

    1995-11-20

    Methenyltetrahydrofolate synthetase (MTHFS) catalyses the obligatory initial metabolic step in the intracellular conversion of 5-formyltetrahydrofolate to other reduced folates. We have isolated and sequenced a human MTHFS cDNA which is 872-bp long and codes for a 203-amino-acid protein of 23,229 Da. Escherichia coli BL21(DE3), transfected with pET11c plasmids containing an open reading frame encoding MTHFS, showed a 100-fold increase in MTHFS activity in bacterial extracts after IPTG induction. Northern blot studies of human tissues determined that the MTHFS mRNA was expressed preferentially in the liver and Southern blot analysis of human genomic DNA suggested the presence of a single-copy gene.

  20. Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

    PubMed

    Hu, B; Li, J; Yu, W; Fang, J

    1993-01-01

    Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

  1. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  2. Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reilly, D.S.; Nussbaum, R.L.

    1994-09-01

    The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

  3. cDNA library construction of two human Demodexspecies.

    PubMed

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  4. Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

    PubMed

    Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

    1995-12-12

    Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

  5. Expressed sequence tag analysis of adult human optic nerve for NEIBank: Identification of cell type and tissue markers

    PubMed Central

    Bernstein, Steven L; Guo, Yan; Peterson, Katherine; Wistow, Graeme

    2009-01-01

    Background The optic nerve is a pure white matter central nervous system (CNS) tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR) and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data provide an initial overview of gene expression patterns in this tissue. The data provide clues for tissue-specific and species-specific properties of human ON that will help in design of therapeutic models. PMID:19778450

  6. Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai

    PubMed Central

    Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

    2016-01-01

    An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His69, Asp117, and Ser216. The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5′ donor splice (GT) and 3′ acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai. PMID:27399771

  7. Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai.

    PubMed

    Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

    2016-07-05

    An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His(69), Asp(117), and Ser(216). The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5' donor splice (GT) and 3' acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai.

  8. Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

    PubMed

    Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

    1989-05-01

    Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

  9. Diagnostic method employing MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1998-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  10. Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geraghty, M.T.; Stetten, G.; Kearns, W.

    1994-09-01

    X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

  11. [Cloning and sequence analysis of full-length cDNA of secoisolariciresinol dehydrogenase of Dysosma versipellis].

    PubMed

    Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen

    2009-06-01

    To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.

  12. Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank

    PubMed Central

    Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.

    2008-01-01

    Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676

  13. Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-CDNA.

    PubMed Central

    Sung, W L; Hsiung, H M; Brousseau, R; Michniewicz, J; Wu, R; Narang, S A

    1979-01-01

    The purification of protected deoxyribooligonucleotides containing phosphotriester internucleotidic linkages has been improved by developing a deactivated silica gel chromatographic technique. The efficiency of this technique as applied in the modified phosphotriester approach has been demonstrated in the rapid synthesis of seventeen pure fragments constituting the sequence of human insulin B and mini-C DNA. The sequence of each oligomer was confirmed by the two-dimensional mobility shift method of fingerprinting. Images PMID:230464

  14. Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

    PubMed

    Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

    2007-06-01

    The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

  15. Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

    PubMed

    Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

    2006-10-01

    Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

  16. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    PubMed

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  17. Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

    In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

  18. Unit-length line-1 transcripts in human teratocarcinoma cells.

    PubMed Central

    Skowronski, J; Fanning, T G; Singer, M F

    1988-01-01

    We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389

  19. Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner.

    PubMed

    Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan; Brent, Michael R

    2009-07-01

    The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than heuristics. We present Pairagon, a pair hidden Markov model based cDNA-to-genome alignment program, as the most accurate aligner for sequences with high- and low-identity levels. We conducted a series of experiments testing alignment accuracy with varying sequence identity. We first created 'perfect' simulated cDNA sequences by splicing the sequences of exons in the reference genome sequences of fly and human. The complete reference genome sequences were then mutated to various degrees using a realistic mutation simulator and the perfect cDNAs were aligned to them using Pairagon and 12 other aligners. To validate these results with natural sequences, we performed cross-species alignment using orthologous transcripts from human, mouse and rat. We found that aligner accuracy is heavily dependent on sequence identity. For sequences with 100% identity, Pairagon achieved accuracy levels of >99.6%, with one quarter of the errors of any other aligner. Furthermore, for human/mouse alignments, which are only 85% identical, Pairagon achieved 87% accuracy, higher than any other aligner. Pairagon source and executables are freely available at http://mblab.wustl.edu/software/pairagon/

  20. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

    PubMed Central

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

    2015-01-01

    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  1. Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

    PubMed Central

    Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

    2016-01-01

    A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

  2. Diagnostic method employing MSH2 nucleic acids

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1997-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  3. Diagnostic method employing MSH2 nucleic acids

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-12-02

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +}(RER{sup +}) tumor cells. 19 figs.

  4. Diagnostic method employing MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1998-11-17

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  5. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA

    DTIC Science & Technology

    1989-04-01

    strain-specific identification of HAV in human fecal samples was a major aim of the original contract application, as clinical trials of live and...derived materials and human and primate fecal specimens. 4. We molecularly cloned and partially sequenced the genome of PA21 strain HAV, a virus...antibody. This approach revealed that 99% of the infectious virus particles present in disrupted cell lysates from the 23rd passage of persistently

  6. Human Genome Program

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1993-01-01

    The DOE Human Genome program has grown tremendously, as shown by the marked increase in the number of genome-funded projects since the last workshop held in 1991. The abstracts in this book describe the genome research of DOE-funded grantees and contractors and invited guests, and all projects are represented at the workshop by posters. The 3-day meeting includes plenary sessions on ethical, legal, and social issues pertaining to the availability of genetic data; sequencing techniques, informatics support; and chromosome and cDNA mapping and sequencing.

  7. Mutator gene and hereditary non-polyposis colorectal cancer

    DOEpatents

    de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD

    2008-02-05

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  8. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    PubMed

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  9. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

  10. [Cloning of human CD45 gene and its expression in Hela cells].

    PubMed

    Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

    2015-11-01

    To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

  11. cDNA, deduced polypeptide structure and chromosomal assignment of human pulmonary surfactant proteolipid, SPL(pVal)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Glasser, S.W.; Korfhagen, T.R.; Weaver, T.E.

    1988-01-05

    In hyaline membrane disease of premature infants, lack of surfactant leads to pulmonary atelectasis and respiratory distress. Hydrophobic surfactant proteins of M/sub r/ = 5000-14,000 have been isolated from mammalian surfactants which enhance the rate of spreading and the surface tension lowering properties of phospholipids during dynamic compression. The authors have characterized the amino-terminal amino acid sequence of pulmonary proteolipids from ether/ethanol extracts of bovine, canine, and human surfactant. Two distinct peptides were identified and termed SPL(pVal) and SPL(Phe). An oligonucleotide probe based on the valine-rich amino-terminal amino acid sequence of SPL(pVal) was utilized to isolate cDNA and genomic DNAmore » encoding the human protein, termed surfactant proteolipid SPL(pVal) on the basis of its unique polyvaline domain. The primary structure of a precursor protein of 20,870 daltons, containing the SPL(pVal) peptide, was deduced from the nucleotide sequence of the cDNAs. Hybrid-arrested translation and immunoprecipitation of labeled translation products of human mRNA demonstrated a precursor protein, the active hydrophobic peptide being produced by proteolytic processing. Two classes of cDNAs encoding SPL(pVal) were identified. Human SPL(pVal) mRNA was more abundant in the adult than in fetal lung. The SPL(pVal) gene locus was assigned to chromosome 8.« less

  12. Molecular cloning of human protein 4.2: a major component of the erythrocyte membrane.

    PubMed Central

    Sung, L A; Chien, S; Chang, L S; Lambert, K; Bliss, S A; Bouhassira, E E; Nagel, R L; Schwartz, R S; Rybicki, A C

    1990-01-01

    Protein 4.2 (P4.2) comprises approximately 5% of the protein mass of human erythrocyte (RBC) membranes. Anemia occurs in patients with RBCs deficient in P4.2, suggesting a role for this protein in maintaining RBC stability and integrity. We now report the molecular cloning and characterization of human RBC P4.2 cDNAs. By immunoscreening a human reticulocyte cDNA library and by using the polymerase chain reaction, two cDNA sequences of 2.4 and 2.5 kilobases (kb) were obtained. These cDNAs differ only by a 90-base-pair insert in the longer isoform located three codons downstream from the putative initiation site. The 2.4- and 2.5-kb cDNAs predict proteins of approximately 77 and approximately 80 kDa, respectively, and the authenticity was confirmed by sequence identity with 46 amino acids of three cyanogen bromide-cleaved peptides of P4.2. Northern blot analysis detected a major 2.4-kb RNA species in reticulocytes. Isolation of two P4.2 cDNAs implies existence of specific regulation of P4.2 expression in human RBCs. Human RBC P4.2 has significant homology with human factor XIII subunit a and guinea pig liver transglutaminase. Sequence alignment of P4.2 with these two transglutaminases, however, revealed that P4.2 lacks the critical cysteine residue required for the enzymatic crosslinking of substrates. Images PMID:1689063

  13. An annotated cDNA library of juvenile Euprymna scolopes with and without colonization by the symbiont Vibrio fischeri

    PubMed Central

    Chun, Carlene K; Scheetz, Todd E; Bonaldo, Maria de Fatima; Brown, Bartley; Clemens, Anik; Crookes-Goodson, Wendy J; Crouch, Keith; DeMartini, Tad; Eyestone, Mari; Goodson, Michael S; Janssens, Bernadette; Kimbell, Jennifer L; Koropatnick, Tanya A; Kucaba, Tamara; Smith, Christina; Stewart, Jennifer J; Tong, Deyan; Troll, Joshua V; Webster, Sarahrose; Winhall-Rice, Jane; Yap, Cory; Casavant, Thomas L; McFall-Ngai, Margaret J; Soares, M Bento

    2006-01-01

    Background Biologists are becoming increasingly aware that the interaction of animals, including humans, with their coevolved bacterial partners is essential for health. This growing awareness has been a driving force for the development of models for the study of beneficial animal-bacterial interactions. In the squid-vibrio model, symbiotic Vibrio fischeri induce dramatic developmental changes in the light organ of host Euprymna scolopes over the first hours to days of their partnership. We report here the creation of a juvenile light-organ specific EST database. Results We generated eleven cDNA libraries from the light organ of E. scolopes at developmentally significant time points with and without colonization by V. fischeri. Single pass 3' sequencing efforts generated 42,564 expressed sequence tags (ESTs) of which 35,421 passed our quality criteria and were then clustered via the UIcluster program into 13,962 nonredundant sequences. The cDNA clones representing these nonredundant sequences were sequenced from the 5' end of the vector and 58% of these resulting sequences overlapped significantly with the associated 3' sequence to generate 8,067 contigs with an average sequence length of 1,065 bp. All sequences were annotated with BLASTX (E-value < -03) and Gene Ontology (GO). Conclusion Both the number of ESTs generated from each library and GO categorizations are reflective of the activity state of the light organ during these early stages of symbiosis. Future analyses of the sequences identified in these libraries promise to provide valuable information not only about pathways involved in colonization and early development of the squid light organ, but also about pathways conserved in response to bacterial colonization across the animal kingdom. PMID:16780587

  14. Cloning of human cDNAs for Apg-1 and Apg-2, members of the Hsp110 family, and chromosomal assignment of their genes.

    PubMed

    Nonoguchi, K; Itoh, K; Xue, J H; Tokuchi, H; Nishiyama, H; Kaneko, Y; Tatsumi, K; Okuno, H; Tomiwa, K; Fujita, J

    1999-09-03

    In mice, the Hsp110/SSE family is composed of the heat shock protein (Hsp)110/105, Apg-1 and Apg-2. In humans, however, only the Hsp110/105 homolog has been identified as a member, and two cDNAs, Hsp70RY and HS24/p52, potentially encoding proteins structurally similar to, but smaller than, mouse Apg-2 have been reported. To clarify the membership of Hsp110 family in humans, we isolated Apg-1 and Apg-2 cDNAs from a human testis cDNA library. The human Apg-1 was 100% and 91.8% identical in length and amino acid (aa) sequence, respectively, to mouse Apg-1. Human Apg-2 was one aa shorter than and 95.5% identical in sequence to mouse Apg-2. In ECV304, human endothelial cells Apg-1 but not Apg-2 transcripts were induced in 2 h by a temperature shift from 32 degrees C to 39 degrees C. As found in mice, the response was stronger than that to a 37-42 degrees C shift. The human Apg-1 and Apg-2 genes were mapped to the chromosomal loci 4q28 and 5q23.3-q31.1, respectively, by fluorescence in-situ hybridization. We isolated cDNA and genomic clones encompassing the region critical for the difference between Apg-2 and HS24/p52. Although the primer sets used were derived from the sequences common to both cDNAs, all cDNA and genomic clones corresponded to Apg-2. Using a similar approach, the relationship between Apg-2 and Hsp70RY was assessed, and no clone corresponding to Hsp70RY was obtained. These results demonstrated that the Hsp110 family consists of at least three members, Apg-1, Apg-2 and Hsp110 in humans as well as in mice. The significance of HS24/p52 and Hsp70RY cDNAs previously reported remains to be determined.

  15. Extremely High Peak Power Pulsed RF and UWB EMR Effects on Genomic Transcription - Microarray Assessment

    DTIC Science & Technology

    2008-06-26

    Homo sapiens decorin variant C mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA...mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA sequence. 2.076 SEC23B...RAS oncogene family ; RAB33B, member RAS oncogene family 205300_s_at 0.37 U1SNRNPBP U11/U12 snRNP 35K 220728_at 0.349 218689_at 0.342 FANCF Fanconi

  16. [Role of phosphorylation of MARCKS-PSD in the secretion of MUC5AC induced by cold temperatures in human airway epithelial cells].

    PubMed

    Li, Minchao; Perelman, Juliy M; Zhou, Xiangdong

    2012-05-01

    To construct phosphorylation sites domain (PSD) mutant of myristoylated alaninerich C kinase substrate (MARCKS) and explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) and MARCKS in cold-induced synthesis and exocytosis of mucin (MUC) 5AC. Human placental cDNA was used as a template to amplify the full coding region of MARCKS cDNA by PCR. Ser159, Ser 163, Ser 167, Ser 170 in the PSD were mutated to aspartic acids by an overlap PCR method. The resultant PSD mutant cDNA and the wild-type MARCKS cDNA were each subcloned into a mammalian expression vector pcDNA3.0. Recombinant constructs were confirmed by restriction enzyme digestion analysis and DNA sequencing. In intervention experiments, cells were pretreated with the TRPM8 channel antagonist BCTC and transfected with MARCKS-PSD mutant cDNA, and thereafter cold stimulation was applied. The levels of MUC5AC were measured by immunofluorescence and ELISA to clarify the roles of TRPM8 and PSD mutant on the synthesis and secretion of MUC5AC induced by cold, respectively. Restriction enzyme digestion analysis and DNA sequencing revealed that the pcDNA3.0- MARCKS and pcDNA3.0-MARCKS-PSD mutants were successfully constructed. The levels of intracellular and secreted MUC5AC of cold treated group were significantly higher than those of control group (P<0.05). BCTC attenuated the cold-induced synthesis and secretion of MUC5AC when compared with cold treated group (P<0.05). Transfection of 16HBE cells with the MARCKS-PSD mutant cDNA resulted in significant inhibition of mucin secretion in response to cold, and significantly higher level of intracellular MUC5AC than that of control group (P<0.01), whereas transfection with the vector DNA or the wild-type MARCKS cDNA had no effect on the mucin synthesis and secretion in response to cold (P>0.05). TRPM8 and phosphorylation of MARCKS-PSD mediates the cold-induced exocytosis of MUC5AC by airway epithelial cells.

  17. Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pennacchio, L.A.

    1994-05-06

    We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

  18. Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

    PubMed Central

    LaPolla, R J; Mayne, K M; Davidson, N

    1984-01-01

    A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

  19. Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

    DTIC Science & Technology

    2000-04-01

    Genes, LOH Mapping, Chromosome 17, Physical Mapping, Genetic Mapping, CDNA Screening, Humans, Anatomical 81 Samples, Mutation Detection, Breast Cancer...According to the established model for LOH involving tumor suppressor genes, the allele remaining in the tumor sample would harbor the deleterious mutation ...sequencing on an AB1373A sequencer (Applied Biosystems, Foster City, CA). As none of the samples we have sequenced have revealed any mutations , we have

  20. Isolation and cloning of a metalloproteinase from king cobra snake venom.

    PubMed

    Guo, Xiao-Xi; Zeng, Lin; Lee, Wen-Hui; Zhang, Yun; Jin, Yang

    2007-06-01

    A 50 kDa fibrinogenolytic protease, ohagin, from the venom of Ophiophagus hannah was isolated by a combination of gel filtration, ion-exchange and heparin affinity chromatography. Ohagin specifically degraded the alpha-chain of human fibrinogen and the proteolytic activity was completely abolished by EDTA, but not by PMSF, suggesting it is a metalloproteinase. It dose-dependently inhibited platelet aggregation induced by ADP, TMVA and stejnulxin. The full sequence of ohagin was deduced by cDNA cloning and confirmed by protein sequencing and peptide mass fingerprinting. The full-length cDNA sequence of ohagin encodes an open reading frame of 611 amino acids that includes signal peptide, proprotein and mature protein comprising metalloproteinase, disintegrin-like and cysteine-rich domains, suggesting it belongs to P-III class metalloproteinase. In addition, P-III class metalloproteinases from the venom glands of Naja atra, Bungarus multicinctus and Bungarus fasciatus were also cloned in this study. Sequence analysis and phylogenetic analysis indicated that metalloproteinases from elapid snake venoms form a new subgroup of P-III SVMPs.

  1. Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Livi, G.P.; McHale, M.J.; Sathe, G.M.

    1990-06-01

    The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

  2. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.

    1991-02-15

    The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFImore » may have conserved only a subset of hIL-10 activities.« less

  3. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  4. Generation and reactivation of T-cell receptor A joining region pseudogenes in primates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thiel, C.; Lanchbury, J.S.; Otting, N.

    1996-06-01

    Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications thatmore » differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.« less

  5. The Pekin duck programmed death-ligand 1: cDNA cloning, genomic structure, molecular characterization and mRNA expression analysis.

    PubMed

    Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S

    2015-04-01

    Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.

  6. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  7. Cloning of a new member of the insulin gene superfamily (INSL4) expressed in human placenta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chassin, D.; Laurent, A.; Janneau, J.L.

    1995-09-20

    A new member of the insulin gene superfamily was identified by screening a subtracted cDNA library of first-trimester human placenta and, hence, was tentatively named early placenta insulin-like peptide (EPIL). In this paper, we report the cloning and sequencing of the EPIL cDNA and the EPIL gene (INSL4). Comparison of the deduced amino acid sequence of the early placenta insulin-like peptide revealed significant overall and structural homologies with members of the insulin-like hormone superfamily. Moreover, the organization of the early placenta insulin-like gene, which is composed of two exons and one intron, is similiar to that of insulin and relaxin.more » By in situ hybridization, the INSL4 gene was assigned to band p24 of the short arm of chromosome 9. RT-PCR analysis of EPIL tissue distribution revealed that its transcripts are expressed in the placenta and uterus. 22 refs., 3 figs.« less

  8. The use of enzymopathic human red cells in the study of malarial parasite glucose metabolism.

    PubMed

    Roth, E; Joulin, V; Miwa, S; Yoshida, A; Akatsuka, J; Cohen-Solal, M; Rosa, R

    1988-05-01

    The in vitro growth of Plasmodium falciparum malaria parasites was assayed in mutant red cells deficient in either diphosphoglycerate mutase (DPGM) or phosphoglycerate kinase (PGK). In addition, cDNA probes developed for human DNA sequences coding for these enzymes were used to examine the parasite genome by means of restriction endonuclease digestion and Southern blot analysis of parasite DNA. In both types of enzymopathic red cells, parasite growth was normal. In infected DPGM deficient red cells, no DPGM activity could be detected, and in normal red cells, DPGM activity declined slightly in a manner suggestive of parasite catabolism of host protein. However, in infected PGK deficient red cells, there was a 100-fold increase in PGK activity, and in normal red cells, a threefold increase in PGK activity was observed. Parasite PGK could be recovered from isolated parasites, and a marked increase in heat instability of parasite PGK as compared with the host cell enzyme was noted. Neither cDNA probe was found to cross-react with DNA sequences in the parasite genome. It is concluded that the parasite has no requirement for DPGM, and probably has no gene for this enzyme. On the other hand, the parasite does require PGK, (an adenosine triphosphate [ATP] generating enzyme) and synthesizes its own enzyme, which must have been encoded in the parasite genome. The parasite PGK gene most likely lacks sufficient homology to be detected by a human cDNA probe. Enzymopathic red cells are useful tools for elucidating the glycolytic enzymology of parasites and their co-evolution with their human hosts.

  9. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  10. Comparison of Human and Guinea Pig Acetylcholinesterase Sequences and Rates of Oxime-Assisted Reactivation

    DTIC Science & Technology

    2010-01-01

    of appropriate animal model systems. For OP poisoning, the guinea pig (Cavia porcellus) is a commonly used animal model because guinea pigs more...endogenous bioscavenger in vivo. Although guinea pigs historically have been used to test OP poisoning therapies, it has been found recently that guinea pig AChE...transcribed mRNA encoding guinea pig AChE, amplified the resulting cDNA, and sequenced this product. The nucleotide and deduced amino acid sequences of

  11. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  12. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  13. HLA genotyping by next-generation sequencing of complementary DNA.

    PubMed

    Segawa, Hidenobu; Kukita, Yoji; Kato, Kikuya

    2017-11-28

    Genotyping of the human leucocyte antigen (HLA) is indispensable for various medical treatments. However, unambiguous genotyping is technically challenging due to high polymorphism of the corresponding genomic region. Next-generation sequencing is changing the landscape of genotyping. In addition to high throughput of data, its additional advantage is that DNA templates are derived from single molecules, which is a strong merit for the phasing problem. Although most currently developed technologies use genomic DNA, use of cDNA could enable genotyping with reduced costs in data production and analysis. We thus developed an HLA genotyping system based on next-generation sequencing of cDNA. Each HLA gene was divided into 3 or 4 target regions subjected to PCR amplification and subsequent sequencing with Ion Torrent PGM. The sequence data were then subjected to an automated analysis. The principle of the analysis was to construct candidate sequences generated from all possible combinations of variable bases and arrange them in decreasing order of the number of reads. Upon collecting candidate sequences from all target regions, 2 haplotypes were usually assigned. Cases not assigned 2 haplotypes were forwarded to 4 additional processes: selection of candidate sequences applying more stringent criteria, removal of artificial haplotypes, selection of candidate sequences with a relaxed threshold for sequence matching, and countermeasure for incomplete sequences in the HLA database. The genotyping system was evaluated using 30 samples; the overall accuracy was 97.0% at the field 3 level and 98.3% at the G group level. With one sample, genotyping of DPB1 was not completed due to short read size. We then developed a method for complete sequencing of individual molecules of the DPB1 gene, using the molecular barcode technology. The performance of the automatic genotyping system was comparable to that of systems developed in previous studies. Thus, next-generation sequencing of cDNA is a viable option for HLA genotyping.

  14. Characterization and chromosomal localization of the gene for human rhodopsin kinase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khani, S.C.; Yamamoto, S.; Dryja, T.P.

    1996-08-01

    G-protein-dependent receptor kinases (GRKs) play a key role in the adapatation of receptors to persistent stimuli. In rod photoreceptors rhodopsin kinase (RK) mediates rapid densensitization of rod photoreceptors to light by catalyzing phosphorylation of the visual pigment rhodopsin. To study the structure and mechanism of FRKs in human photoreceptors, we have isolated and characterized cDNA and genomic clones derived from the human RK locus using a bovine rhodopsin kinase cDNA fragment as a probe. The RK locus, assigned to chromosome 13 band q34, is composed of seven exons that encode a protein 92% identical in amino acid sequence to bovinemore » rhodopsin kinase. The marked difference between the structure of this gene and that of another recently clone human GRK gene suggests the existence of a wide evolutionary gap between members of the GRK gene family. 39 refs., 3 figs.« less

  15. Cloning, structure, and chromosome localization of the mouse glutaryl-CoA dehydrogenase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koeller, D.M.; DiGiulio, A.; Frerman, F.E.

    Glutaryl-CoA dehydrogenase (GCDH) is a nuclear-encoded, mitochondrial matrix enzyme. In humans, deficiency of GCDH leads to glutaric acidemia type I, and inherited disorder of amino acid metabolism characterized by a progressive neurodegenerative disease. In this report we describe the cloning and structure of the mouse GCDH (Gcdh) gene and cDNA and its chromosomal localization. The mouse Gcdh cDNA is 1.75 kb long and contains and open reading frame of 438 amino acids. The amino acid sequences of mouse, human, and pig GCDH are highly conserved. The mouse Gcdh gene contains 11 exons and spans 7 kb of genomic DNA. Gcdhmore » was mapped by backcross analysis to mouse chromosome 8 within a region that is homologous to a region of human chromosome 19, where the human gene was previously mapped. 14 refs., 3 figs.« less

  16. Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

    PubMed Central

    Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

    2007-01-01

    Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

  17. Cloning, genomic organization, and chromosomal localization of human citrate transport protein to the DiGeorge/velocardiofacial syndrome minimal critical region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldmuntz, E.; Budarf, M.L.; Wang, Zhili

    1996-04-15

    DiGeorge syndrome (DGS) and velocardiofacial syndrome have been shown to be associated with microdeletions of chromosomal region 22q11. More recently, patients with conotruncal anomaly face syndrome and some nonsyndromic patients with isolated forms of conotruncal cardiac defects have been found to have 22q11 microdeletions as well. The commonly deleted region, called the DiGeorge chromosomal region (DGCR), spans approximately 1.2 mb and is estimated to contain at least 30 genes. We report a computational approach for gene identification that makes use of large-scale sequencing of cosmids from a contig spanning the DGCR. Using this methodology, we have mapped the human homologmore » of a rodent citrate transport protein to the DGCR. We have isolated a partial cDNA containing the complete open reading frame and have determined the genomic structure by comparing the genomic sequence from the cosmid to the sequence of the cDNA clone. Whether the citrate transport protein can be implicated in the biological etiology of DGS or other 22q11 microdeletion syndromes remains to be defined. 36 refs., 3 figs., 1 tab.« less

  18. Identification and characterization of human GUKH2 gene in silico.

    PubMed

    Katoh, Masuko; Katoh, Masaru

    2004-04-01

    Drosophila Guanylate-kinase holder (Gukh) is an adaptor molecule bridging Discs large (Dlg) and Scribble (Scrib), which are implicated in the establishment and maintenance of epithelial polarity. Here, we searched for human homologs of Drosophila gukh by using bioinformatics, and identified GUKH1 and GUKH2 genes. GUKH1 was identical to Nance-Horan syndrome (NHS) gene, while GUKH2 was a novel gene. FLJ35425 (AK092744.1), DKFZp686P1949 (BX647246.1) and KIAA1357 (AB037778.1) cDNAs were derived from human GUKH2 gene. Nucleotide sequence of GUKH2 cDNA was determined by assembling 5'-part of FLJ35425 cDNA and entire region of DKFZp686P1949 cDNA. Human GUKH2 gene consists of 8 exons. Exon 5 (132 bp) of GUKH2 gene was spliced out in GUKH2 cDNA due to alternative splicing. GUKH2-REPS1 locus at human chromosome 6q24.1 and GUKH1-REPS2 locus at human chromosome Xp22.22-p22.13 are paralogous regions within the human genome. Mouse Gukh2 and zebrafish gukh2 genes were also identified. N-terminal part of human GUKH2, mouse Gukh2 and zebrafish gukh2 proteins were completely divergent from human GUKH1 protein. Human GUKH2 and GUKH1, consisting of eight GUKH homology (GKH1-GKH8) domains and Proline-rich domain, showed 28.5% total-amino-acid identity. GKH1, GKH4, GKH5, GKH7 and GKH8 domains were conserved among human GUKH1, human GUKH2 and Drosophila Gukh. Because human homologs of Drosophila dlg (DLG1-DLG7) as well as human homologs of Drosophila scrib (SCRIB, ERBB2IP and Densin-180) are cancer-associated genes, human homologs of Drosophila gukh (GUKH1 and GUKH2) are predicted cancer-associated genes.

  19. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  20. Shark complement: an assessment.

    PubMed

    Smith, S L

    1998-12-01

    The classical (CCP) and alternative (ACP) pathways of complement activation have been established for the nurse shark (Ginglymostoma cirratum). The isolation of a cDNA clone encoding a mannan-binding protein-associated serine protease (MASP)-1-like protein from the Japanese dogfish (Triakis scyllia) suggests the presence of a lectin pathway. The CCP consists of six functionally distinct components: C1n, C2n, C3n, C4n, C8n and C9n, and is activated by immune complexes in the presence of Ca++ and Mg++ ions. The ACP is antibody independent, requiring Mg++ ions and a heat-labile 90 kDa factor B-like protein for activity. Proteins considered homologues of C1q, C3 and C4 (C2n) of the mammalian complement system have been isolated from nurse shark serum. Shark C1q is composed of at least two chain types each showing 50% identity to human C1q chains A and B. Partial sequence of the globular domain of one of the chains shows it to be C1q-like rather than like mannan-binding protein. N-terminal amino acid sequences of the alpha and beta chain of shark C3 and C4 molecules show significant identity with corresponding human C3 and C4 chains. A sequence representing shark C4 gamma chain, shows little similarity to human C4 gamma chain. The terminal shark components C8n and C9n are functional analogues of mammalian C8 and C9. Anaphylatoxin activity has been demonstrated in activated shark serum, and porcine C5a desArg induces shark leucocyte chemotaxis. The deduced amino acid sequence of a partial C3 cDNA clone from the nurse shark shows 50%, 30% and 24% homology with the corresponding region of mammalian C3, C4 and alpha 2-macroglobulin. Deduced amino acid sequence data from partial Bf/C2 cDNA clones, two from the nurse shark and one from the Japanese dogfish, suggest that at least one species of elasmobranch has two distinct Bf/C2 genes.

  1. Human brain factor 1, a new member of the fork head gene family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, D.B.; Wiese, S.; Burfeind, P.

    1994-06-01

    Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less

  2. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    PubMed

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  3. Illumina sequencing of green stink bug nymph and adult cdna to identify potential rnai gene targets

    USDA-ARS?s Scientific Manuscript database

    Whole-body transcriptomes for nymphs and adults of the green stink bug, Acrosternum hilare (Say), were sequenced on an Illumina® Genome Analyzer IIx sequencer. The insects were collected from sites in North Carolina and Virginia, USA. The cDNA library for each sample was sequenced on one lane of an...

  4. Virtual Northern analysis of the human genome.

    PubMed

    Hurowitz, Evan H; Drori, Iddo; Stodden, Victoria C; Donoho, David L; Brown, Patrick O

    2007-05-23

    We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes.

  5. BIOMONITORING THE TOXICOGENOMIC RESPONSE TO ENDOCRINE DISRUPTING CHEMICALS IN HUMANS, LABORATORY SPECIES AND WILDLIFE

    EPA Science Inventory

    With the advent of sequence information for entire eukaryotic genomes, it is now possible to analyze gene expression on a genomic scale. The primary tool for genomic analysis of gene expression is the gene microarray. We have used commercially available and custom cDNA microarray...

  6. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Kangaroo IGF-II is structurally and functionally similar to the human [Ser29]-IGF-II variant.

    PubMed

    Yandell, C A; Francis, G L; Wheldrake, J F; Upton, Z

    1999-06-01

    Kangaroo IGF-II has been purified from western grey kangaroo (Macropus fuliginosus) serum and characterised in a number of in vitro assays. In addition, the complete cDNA sequence of mature IGF-II has been obtained by reverse-transcription polymerase chain reaction. Comparison of the kangaroo IGF-II cDNA sequence with known IGF-II sequences from other species revealed that it is very similar to the human variant, [Ser29]-hIGF-II. Both the variant and kangaroo IGF-II contain an insert of nine nucleotides that encode the amino acids Leu-Pro-Gly at the junction of the B and C domains of the mature protein. The deduced kangaroo IGF-II protein sequence also contains three other amino acid changes that are not observed in human IGF-II. These amino acid differences share similarities with the changes described in many of the IGF-IIs reported for non-mammalian species. Characterisation of human IGF-II, kangaroo IGF-II, chicken IGF-II and [Ser29]-hIGF-II in a number of in vitro assays revealed that all four proteins are functionally very similar. No significant differences were observed in the ability of the IGF-IIs to bind to the bovine IGF-II/cation-independent mannose 6-phosphate receptor or to stimulate protein synthesis in rat L6 myoblasts. However, differences were observed in their abilities to bind to IGF-binding proteins (IGFBPs) present in human serum. Kangaroo, chicken and [Ser29]-hIGF-II had lower apparent affinities for human IGFBPs than did human IGF-II. Thus, it appears that the major circulating form of IGF-II in the kangaroo and a minor form of IGF-II found in human serum are structurally and functionally very similar. This suggests that the splice site that generates both the variant and major form of human IGF-II must have evolved after the divergence of marsupials from placental mammals.

  8. Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

    PubMed Central

    Yasuno, Rie; Wada, Hajime

    1998-01-01

    Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

  9. Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

    PubMed Central

    Matthews, R J; Cahir, E D; Thomas, M L

    1990-01-01

    Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

  10. An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

    PubMed Central

    Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

    2015-01-01

    The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

  11. Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.

    PubMed Central

    Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M

    1996-01-01

    The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645

  12. Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus.

    PubMed

    Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D

    2013-01-01

    Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.

  13. Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

    1996-01-15

    The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

  14. Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

    NASA Astrophysics Data System (ADS)

    Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

    1995-12-01

    Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

  15. NEIBank: Genomics and bioinformatics resources for vision research

    PubMed Central

    Peterson, Katherine; Gao, James; Buchoff, Patee; Jaworski, Cynthia; Bowes-Rickman, Catherine; Ebright, Jessica N.; Hauser, Michael A.; Hoover, David

    2008-01-01

    NEIBank is an integrated resource for genomics and bioinformatics in vision research. It includes expressed sequence tag (EST) data and sequence-verified cDNA clones for multiple eye tissues of several species, web-based access to human eye-specific SAGE data through EyeSAGE, and comprehensive, annotated databases of known human eye disease genes and candidate disease gene loci. All expression- and disease-related data are integrated in EyeBrowse, an eye-centric genome browser. NEIBank provides a comprehensive overview of current knowledge of the transcriptional repertoires of eye tissues and their relation to pathology. PMID:18648525

  16. Quantitative high-throughput profiling of snake venom gland transcriptomes and proteomes (Ovophis okinavensis and Protobothrops flavoviridis)

    PubMed Central

    2013-01-01

    Background Advances in DNA sequencing and proteomics have facilitated quantitative comparisons of snake venom composition. Most studies have employed one approach or the other. Here, both Illumina cDNA sequencing and LC/MS were used to compare the transcriptomes and proteomes of two pit vipers, Protobothrops flavoviridis and Ovophis okinavensis, which differ greatly in their biology. Results Sequencing of venom gland cDNA produced 104,830 transcripts. The Protobothrops transcriptome contained transcripts for 103 venom-related proteins, while the Ovophis transcriptome contained 95. In both, transcript abundances spanned six orders of magnitude. Mass spectrometry identified peptides from 100% of transcripts that occurred at higher than contaminant (e.g. human keratin) levels, including a number of proteins never before sequenced from snakes. These transcriptomes reveal fundamentally different envenomation strategies. Adult Protobothrops venom promotes hemorrhage, hypotension, incoagulable blood, and prey digestion, consistent with mammalian predation. Ovophis venom composition is less readily interpreted, owing to insufficient pharmacological data for venom serine and metalloproteases, which comprise more than 97.3% of Ovophis transcripts, but only 38.0% of Protobothrops transcripts. Ovophis venom apparently represents a hybrid strategy optimized for frogs and small mammals. Conclusions This study illustrates the power of cDNA sequencing combined with MS profiling. The former quantifies transcript composition, allowing detection of novel proteins, but cannot indicate which proteins are actually secreted, as does MS. We show, for the first time, that transcript and peptide abundances are correlated. This means that MS can be used for quantitative, non-invasive venom profiling, which will be beneficial for studies of endangered species. PMID:24224955

  17. Cloning and expression of cDNA coding for bouganin.

    PubMed

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  18. Human mitochondrial pyrophosphatase: cDNA cloning and analysis of the gene in patients with mtDNA depletion syndromes.

    PubMed

    Curbo, Sophie; Lagier-Tourenne, Clotilde; Carrozzo, Rosalba; Palenzuela, Lluis; Lucioli, Simona; Hirano, Michio; Santorelli, Filippo; Arenas, Joaquin; Karlsson, Anna; Johansson, Magnus

    2006-03-01

    Pyrophosphatases (PPases) catalyze the hydrolysis of inorganic pyrophosphate generated in several cellular enzymatic reactions. A novel human pyrophosphatase cDNA encoding a 334-amino-acid protein approximately 60% identical to the previously identified human cytosolic PPase was cloned and characterized. The novel enzyme, named PPase-2, was enzymatically active and catalyzed hydrolysis of pyrophosphate at a rate similar to that of the previously identified PPase-1. A functional mitochondrial import signal sequence was identified in the N-terminus of PPase-2, which targeted the enzyme to the mitochondrial matrix. The human pyrophosphatase 2 gene (PPase-2) was mapped to chromosome 4q25 and the 1.4-kb mRNA was ubiquitously expressed in human tissues, with highest levels in muscle, liver, and kidney. The yeast homologue of the mitochondrial PPase-2 is required for mitochondrial DNA maintenance and yeast cells lacking the enzyme exhibit mitochondrial DNA depletion. We sequenced the PPA2 gene in 13 patients with mitochondrial DNA depletion syndromes (MDS) of unknown cause to determine if mutations in the PPA2 gene of these patients were associated with this disease. No pathogenic mutations were identified in the PPA2 gene of these patients and we found no evidence that PPA2 gene mutations are a common cause of MDS in humans.

  19. Sequence conservation from human to prokaryotes of Surf1, a protein involved in cytochrome c oxidase assembly, deficient in Leigh syndrome.

    PubMed

    Poyau, A; Buchet, K; Godinot, C

    1999-12-03

    The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.

  20. Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

    PubMed Central

    Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

    2000-01-01

    Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

  1. Characterization of recombinant human HBP/CAP37/azurocidin, a pleiotropic mediator of inflammation-enhancing LPS-induced cytokine release from monocytes.

    PubMed

    Rasmussen, P B; Bjørn, S; Hastrup, S; Nielsen, P F; Norris, K; Thim, L; Wiberg, F C; Flodgaard, H

    1996-07-15

    Neutrophil-derived heparin-binding protein (HBP) is a strong chemoattractant for monocytes. We report here for the first time the expression of recombinant HBP. A baculovirus containing the human HBP cDNA mediated in insect cells the secretion of a 7-residue N-terminally extended HBP form (pro-HBP). Deletion of the pro-peptide-encoding cDNA sequence resulted in correctly processed HBP at the N-terminus. Electrospray mass spectrum analysis of recombinant HBP yielded a molecular weight of 27.237 +/- 3 amu. Consistent with this mass is a HBP form of 225 amino acids (mature part +3 amino acid C-terminal extension). The biological activity of recombinant HBP was confirmed by its chemotactic action towards monocytes. Furthermore, we have shown that recombinant HBP stimulates in a dose-dependent manner the lipopolysaccharide (LPS)-induced cytokine release from human monocytes.

  2. Purification and cDNA cloning of a protein derived from Flammulina velutipes that increases the permeability of the intestinal Caco-2 cell monolayer.

    PubMed

    Watanabe, H; Narai, A; Shimizu, M

    1999-06-01

    A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.

  3. Molecular cloning and expression of rat liver bile acid CoA ligase.

    PubMed

    Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen

    2002-12-01

    Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.

  4. Analysis of beta-carotene hydroxylase gene cDNA isolated from the American oil-palm (Elaeis oleifera) mesocarp tissue cDNA library

    PubMed Central

    Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H

    2010-01-01

    It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789

  5. Cloning and characterization of murine fanconi anemia group A gene: Fanca protein is expressed in lymphoid tissues, testis, and ovary.

    PubMed

    van de Vrugt, H J; Cheng, N C; de Vries, Y; Rooimans, M A; de Groot, J; Scheper, R J; Zhi, Y; Hoatlin, M E; Joenje, H; Arwert, F

    2000-04-01

    Fanconi anemia (FA) is an autosomal recessive disorder in humans characterized by bone marrow failure, cancer predisposition, and cellular hypersensitivity to cross-linking agents such as mitomycin C and diepoxybutane. FA genes display a caretaker function essential for maintenance of genomic integrity. We have cloned the murine homolog of FANCA, the gene mutated in the major FA complementation group (FA-A). The full-length mouse Fanca cDNA consists of 4503 bp and encodes a protein with a predicted molecular weight of 161 kDa. The deduced Fanca mouse protein shares 81% amino acid sequence similarity and 66% identity with the human protein. The nuclear localization signal and partial leucine zipper consensus motifs found in the human FANCA protein were also present in the murine homolog. In spite of the species difference, the murine Fanca cDNA was capable of correcting the cross-linker sensitive phenotype of human FA-A cells, suggesting functional conservation. Based on Northern as well as Western blots, Fanca was mainly expressed in lymphoid tissues, testis, and ovary. This expression pattern correlates with some of the clinical symptoms observed in FA patients. The availability of the murine Fanca cDNA now allows the gene to be studied in experimental mouse models.

  6. Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

    PubMed

    Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

    2004-01-01

    The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

  7. 3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

    PubMed

    Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

    2004-01-01

    The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

  8. Molecular cloning and sequencing of the cDNA and gene for a novel elastinolytic metalloproteinase from Aspergillus fumigatus and its expression in Escherichia coli.

    PubMed Central

    Sirakova, T D; Markaryan, A; Kolattukudy, P E

    1994-01-01

    An extracellular elastinolytic metalloproteinase, purified from Aspergillus fumigatus isolated from an aspergillosis and patient/and an internal peptide derived from it were subjected to N-terminal sequencing. Oligonucleotide primers based on these sequences were used to PCR amplify a segment of the metalloproteinase cDNA, which was used as a probe to isolate the cDNA and gene for this enzyme. The gene sequence matched exactly with the cDNA sequence except for the four introns that interrupted the open reading frame. According to the deduced amino acid sequence, the metalloproteinase has a signal sequence and 227 additional amino acids preceding the sequence for the mature protein of 389 amino acids with a calculated molecular mass of 42 kDa, which is close to the size of the purified mature fungal proteinase. This sequence contains segments that matched both the N terminus of the mature protein and the internal peptide. A. fumigatus metalloproteinase contains some of the conserved zinc-binding and active-site motifs characteristic of metalloproteinases but shows no overall homology with known metalloproteinases. The cDNA of the mature protein when introduced into Escherichia coli directed the expression of a protein with a size, N-terminal sequence, and immunological cross-reactivity identical to those of the native fungal enzyme. Although the enzyme in the inclusion bodies could not be renatured, expression at 30 degrees C yielded soluble enzyme that showed chromatographic behavior identical to that of the native fungal enzyme and catalyzed hydrolysis of elastin. The metalloproteinase gene described here was not found in Aspergillus flavus. Images PMID:7927676

  9. Acetylcholinesterase of the Sand Fly, Phlebotomus papatasi (Scopoli): cDNA Sequence, Baculovirus Expression, and Biochemical Properties

    DTIC Science & Technology

    2013-01-01

    identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a...tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85...improve effectiveness of pesticide application for control of the new world sand fly Lutzomyia longipalpis in chicken sheds [13]. Attempts to control

  10. Cloning of the cocaine-sensitive bovine dopamine transporter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usdin, T.B.; Chen, C.; Brownstein, M.J.

    1991-12-15

    A cDNA encoding the dopamine transporter from bovine brain substantia nigra was identified on the basis of its structural homology to other, recently cloned, neurotransmitter transporters. The sequence of the 693-amino acid protein is quite similar to those of the rat {gamma}-aminobutyric acid, human norepinephrine, and rat serotonin transporters. Dopamine transporter mRNA was detected by in situ hybridization in the substantia nigra but not in the locus coeruleus, raphe, caudate, or other brain areas. ({sup 3}H)Dopamine accumulation in tissue culture cells transfected with the cDNA was inhibited by amphetamine, cocaine, and specific inhibitors of dopamine transports, including GBR12909.

  11. Cloning and characterization of full-length mouse thymidine kinase 2: the N-terminal sequence directs import of the precursor protein into mitochondria.

    PubMed Central

    Wang, L; Eriksson, S

    2000-01-01

    The subcellular localization of mitochondrial thymidine kinase (TK2) has been questioned, since no mitochondrial targeting sequences have been found in cloned human TK2 cDNAs. Here we report the cloning of mouse TK2 cDNA from a mouse full-length enriched cDNA library. The mouse TK2 cDNA codes for a protein of 270 amino acids, with a 40-amino-acid presumed N-terminal mitochondrial targeting signal. In vitro translation and translocation experiments with purified rat mitochondria confirmed that the N-terminal sequence directed import of the precursor TK2 into the mitochondrial matrix. A single 2.4 kb mRNA transcript was detected in most tissues examined, except in liver, where an additional shorter (1.0 kb) transcript was also observed. There was no correlation between the tissue distribution of TK2 activity and the expression of TK2 mRNA. Full-length mouse TK2 protein and two N-terminally truncated forms, one of which corresponds to the mitochondrial form of TK2 and a shorter form corresponding to the previously characterized recombinant human TK2, were expressed in Escherichia coli and affinity purified. All three forms of TK2 phosphorylated thymidine, deoxycytidine and 2'-deoxyuridine, but with different kinetic efficiencies. A number of cytostatic pyrimidine nucleoside analogues were also tested and shown to be good substrates for the various forms of TK2. The active form of full-length mouse TK2 was a dimer, as judged by Superdex 200 chromatography. These results enhance our understanding of the structure and function of TK2, and may help to explain the mitochondrial disorder, mitochondrial neurogastrointestinal encephalomyopathy. PMID:11023833

  12. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-12-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

  13. Molecular cloning of a novel widely expressed human 80 kDa 17 beta-hydroxysteroid dehydrogenase IV.

    PubMed Central

    Adamski, J; Normand, T; Leenders, F; Monté, D; Begue, A; Stéhelin, D; Jungblut, P W; de Launoit, Y

    1995-01-01

    Reactions of oestrogens and androgens at position C-17 are catalysed by 17 beta-hydroxysteroid dehydrogenases (17 beta-HSDs). Cloning of the cDNA of a novel human 17 beta-HSD IV and expression of its mRNA are described. A probe derived from the recently discovered porcine 17 beta-oestradiol dehydrogenase (17 beta-EDH) was used to isolate a 2.6 kb human cDNA encoding a continuous protein of 736 amino acids of high (84%) similarity to the porcine 17 beta-EDH. The calculated molecular mass of the human enzyme is 79,595 Da. Other sequence similarities shared by the two enzymes are: an N-terminal sequence which is similar to that of members of the short-chain alcohol dehydrogenase family; amino acids 343-607 which are similar to the C-terminal domains of a trifunctional Candida tropicalis enzyme and the FOX2 gene product of Saccharomyces cerevisiae; amino acids 596-736 which are similar to human sterol carrier protein 2. The previously cloned human 17 beta-HSD I, II and III are less than 25% identical with 17 beta-HSD IV. mRNA for HSD IV is a single species of 3.0 kb, present in many tissues with highest concentrations in liver, heart, prostate and testes. When over-expressed in mammalian cells, the human 17 beta-HSD IV enzyme displays a specific unidirectional oxidative 17 beta-HSD activity. Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7487879

  14. Virtual Northern Analysis of the Human Genome

    PubMed Central

    Hurowitz, Evan H.; Drori, Iddo; Stodden, Victoria C.; Donoho, David L.; Brown, Patrick O.

    2007-01-01

    Background We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. Methodology/Principal Findings We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Conclusions/Significance Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes. PMID:17520019

  15. ILG1 : a new integrase-like gene that is a marker of bacterial contamination by the laboratory Escherichia coli strain TOP10F'.

    PubMed Central

    Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.

    2002-01-01

    BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938

  16. Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

    PubMed

    Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

    2000-05-01

    A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

  17. Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

    PubMed Central

    Eberwine, James; Bartfai, Tamas

    2011-01-01

    We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

  18. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

    PubMed Central

    Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

    2012-01-01

    RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

  19. Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

    NASA Astrophysics Data System (ADS)

    Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

    1996-06-01

    cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

  20. Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

    PubMed Central

    Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

    1998-01-01

    The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

  1. Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

    PubMed

    Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

    2003-04-02

    Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

  2. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  3. Integrating De Novo Transcriptome Assembly and Cloning to Obtain Chicken Ovocleidin-17 Full-Length cDNA

    PubMed Central

    Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480

  4. Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

    PubMed

    Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.

  5. Molecular characterization and phylogenetic analysis of a yak (Bos grunniens) κ-casein cDNA from lactating mammary gland.

    PubMed

    Bai, W L; Yin, R H; Dou, Q L; Jiang, W Q; Zhao, S J; Ma, Z J; Luo, G B; Zhao, Z H

    2011-04-01

    κ-Casein is one of the major proteins in the milk of mammals. It plays an important role in determining the size and specific function of milk micelles. We have previously identified and characterized a genetic variant of yak κ-casein by evaluating genomic DNA. Here, we isolate and characterize a yak κ-casein cDNA harboring the full-length open reading frame (ORF) from lactating mammary gland. Total RNA was extracted from mammary tissue of lactating female yak, and the κ-casein cDNA were synthesized by RT-PCR technique, then cloned and sequenced. The obtained cDNA of 660-bp contained an ORF sufficient to encode the entire amino acid sequence of κ-casein precursor protein consisting of 190 amino acids with a signal peptide of 21 amino acids. Yak κ-casein has a predicted molecular mass of 19,006.588 Da with a calculated isoelectric point of 7.245. Compared with the corresponding sequences in GenBank of cattle, buffalo, sheep, goat, Arabian camel, horse, and rabbit, yak κ-casein sequence had identity of 64.76-98.78% in cDNA, and identity of 44.79-98.42% and similarity of 53.65-98.42% in deduced amino acids, revealing a high homology with the other livestock species. Based on κ-casein cDNA sequences, the phylogenetic analysis indicated that yak κ-casein had a close relationship with that of cattle. This work might be useful in the genetic engineering researches for yak κ-casein.

  6. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    PubMed

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  7. Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism

    PubMed Central

    Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang

    2013-01-01

    Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972

  8. Development of a Stable Cell Line, Overexpressing Human T-cell Immunoglobulin Mucin 1

    PubMed Central

    Ebrahimi, Mina; Kazemi, Tohid; Ganjalikhani-hakemi, Mazdak; Majidi, Jafar; khanahmad, Hossein; Rahimmanesh, Ilnaz; Homayouni, Vida; Kohpayeh, Shirin

    2015-01-01

    Background Recent researches have demonstrated that human T-cell immunoglobulin mucin 1 (TIM-1) glycoprotein plays important roles in regulation of autoimmune and allergic diseases, as well as in tumor immunity and response to viral infections. Therefore, targeting TIM-1 could be a potential therapeutic approach against such diseases. Objectives In this study, we aimed to express TIM-1 protein on Human Embryonic kidney (HEK) 293T cell line in order to have an available source of the TIM-1 antigen. Materials and Methods The cDNA was synthesized after RNA extraction from peripheral blood mononuclear cells (PBMC) and TIM-1 cDNA was amplified by PCR with specific primers. The PCR product was cloned in pcDNA™3.1/Hygro (+) and transformed in Escherichia coli TOP 10 F’. After cloning, authenticity of DNA sequence was checked and expressed in HEK 293T cells. Finally, expression of TIM-1 was analyzed by flow cytometry and real-time PCR. Results The result of DNA sequencing demonstrated correctness of TIM-1 DNA sequence. The flow cytometry results indicated that TIM-1 was expressed in about 90% of transfected HEK 293T cells. The real-time PCR analysis showed TIM-1 mRNA expression increased 195-fold in transfected cells compared with un-transfected cells. Conclusions Findings of present study demonstrated the successful cloning and expression of TIM-1 on HEK 293T cells. These cells could be used as an immunogenic source for production of specific monoclonal antibodies, nanobodies and aptamers against human TIM-1. PMID:28959306

  9. Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

    PubMed Central

    Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

    1998-01-01

    The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

  10. Characterization of a full-length infectious cDNA clone and a GFP reporter derivative of the oncolytic picornavirus SVV-001.

    PubMed

    Poirier, John T; Reddy, P Seshidhar; Idamakanti, Neeraja; Li, Shawn S; Stump, Kristine L; Burroughs, Kevin D; Hallenbeck, Paul L; Rudin, Charles M

    2012-12-01

    Seneca Valley virus (SVV-001) is an oncolytic picornavirus with selective tropism for a subset of human cancers with neuroendocrine differentiation. To characterize further the specificity of SVV-001 and its patterns and kinetics of intratumoral spread, bacterial plasmids encoding a cDNA clone of the full-length wild-type virus and a derivative virus expressing GFP were generated. The full-length cDNA of the SVV-001 RNA genome was cloned into a bacterial plasmid under the control of the T7 core promoter sequence to create an infectious cDNA clone, pNTX-09. A GFP reporter virus cDNA clone, pNTX-11, was then generated by cloning a fusion protein of GFP and the 2A protein from foot-and-mouth disease virus immediately following the native SVV-001 2A sequence. Recombinant GFP-expressing reporter virus, SVV-GFP, was rescued from cells transfected with in vitro RNA transcripts from pNTX-11 and propagated in cell culture. The proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable. The SVV-GFP reporter virus was used to determine that a subpopulation of permissive cells is present in small-cell lung cancer cell lines previously thought to lack permissivity to SVV-001. Finally, it was shown that SVV-GFP administered to tumour-bearing animals homes in to and infects tumours whilst having no detectable tropism for normal mouse tissues at 1×10(11) viral particles kg(-1), a dose equivalent to that administered in ongoing clinical trials. These infectious clones will be of substantial value in further characterizing the biology of this virus and as a backbone for the generation of additional oncolytic derivatives.

  11. The cDNA sequence of a neutral horseradish peroxidase.

    PubMed

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  12. 5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

    PubMed

    Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

    2018-01-01

    Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  13. Nectinepsin: a new extracellular matrix protein of the pexin family. Characterization of a novel cDNA encoding a protein with an RGD cell binding motif.

    PubMed

    Blancher, C; Omri, B; Bidou, L; Pessac, B; Crisanti, P

    1996-10-18

    We report the isolation and characterization of a novel cDNA from quail neuroretina encoding a putative protein named nectinepsin. The nectinepsin cDNA identifies a major 2.2-kilobase mRNA that is detected from ED 5 in neuroretina and is increasingly abundant during embryonic development. A nectinepsin mRNA is also found in quail liver, brain, and intestine and in mouse retina. The deduced nectinepsin amino acid sequence contains the RGD cell binding motif of integrin ligands. Furthermore, nectinepsin shares substantial homologies with vitronectin and structural protein similarities with most of the matricial metalloproteases. However, the presence of a specific sequence and the lack of heparin and collagen binding domains of the vitronectin indicate that nectinepsin is a new extracellular matrix protein. Furthermore, genomic Southern blot studies suggest that nectinepsin and vitronectin are encoded by different genes. Western blot analysis with an anti-human vitronectin antiserum revealed, in addition to the 65- and 70-kDa vitronectin bands, an immunoreactive protein of about 54 kDa in all tissues containing nectinepsin mRNA. It seems likely that the form of vitronectin found in chick egg yolk plasma by Nagano et al. ((1992) J. Biol. Chem. 267, 24863-24870) is the protein that corresponds to the nectinepsin cDNA. This new protein could be an important molecule involved in the early steps of the development.

  14. Identification and characterization of a novel serine-threonine kinase gene from the Xp22 region.

    PubMed

    Montini, E; Andolfi, G; Caruso, A; Buchner, G; Walpole, S M; Mariani, M; Consalez, G; Trump, D; Ballabio, A; Franco, B

    1998-08-01

    Eukaryotic protein kinases are part of a large and expanding family of proteins. Through our transcriptional mapping effort in the Xp22 region, we have isolated and sequenced the full-length transcript of STK9, a novel cDNA highly homologous to serine-threonine kinases. A number of human genetic disorders have been mapped to the region where STK9 has been localized including Nance-Horan (NH) syndrome, oral-facial-digital syndrome type 1 (OFD1), and a novel locus for nonsyndromic sensorineural deafness (DFN6). To evaluate the possible involvement of STK9 in any of the above-mentioned disorders, a 2416-bp full-length cDNA was assembled. The entire genomic structure of the gene, which is composed of 20 coding exons, was determined. Northern analysis revealed a transcript larger than 9.5 kb in several tissues including brain, lung, and kidney. The mouse homologue (Stk9) was identified and mapped in the mouse in the region syntenic to human Xp. This location is compatible with the location of the Xcat mutant, which shows congenital cataracts very similar to those observed in NH patients. Sequence homologies, expression pattern, and mapping information in both human and mouse make STK9 a candidate gene for the above-mentioned disorders. Copyright 1998 Academic Press.

  15. Purification and cDNA cloning of SAPKK3, the major activator of RK/p38 in stress- and cytokine-stimulated monocytes and epithelial cells.

    PubMed Central

    Cuenda, A; Alonso, G; Morrice, N; Jones, M; Meier, R; Cohen, P; Nebreda, A R

    1996-01-01

    Two chromatographically distinct stress-activated protein kinase kinases (SAPKKs) have been identified in several mammalian cells, termed SAPKK2 and SAPKK3, which activate the MAP kinase family member RK/p38 but not JNK/SAPK in vitro. Here we demonstrate that SAPKK2 is identical or very closely related to the MAP kinase kinase family member MKK3. However, under our assay conditions, SAPKK3 was the major activator of RK/p38 detected in extracts prepared from stress- or interleukin-1-stimulated epithelial (KB) cells, from bacterial lipopolysaccharide and tumour necrosis factor alpha-stimulated THP1 monocytes or from rabbit skeletal muscle. The activated form of SAPKK3 was purified from muscle to near homogeneity, and tryptic peptide sequences were used to clone human and murine cDNAs encoding this enzyme. Human SAPKK3 comprised 334 amino acids and was 78% identical to MKK3. The murine and human SAPKK3 were 97% identical in their amino acid sequences. We also cloned a different murine cDNA that appears to encode a SAPKK3 protein truncated at the N-terminus. SAPKK3 is identical to the recently cloned MKK6. Images PMID:8861944

  16. Transcriptome Analysis in Venom Gland of the Predatory Giant Ant Dinoponera quadriceps: Insights into the Polypeptide Toxin Arsenal of Hymenopterans

    PubMed Central

    Chong, Cheong-Meng; Leung, Siu Wai; Prieto-da-Silva, Álvaro R. B.; Havt, Alexandre; Quinet, Yves P.; Martins, Alice M. C.; Lee, Simon M. Y.; Rádis-Baptista, Gandhi

    2014-01-01

    Background Dinoponera quadriceps is a predatory giant ant that inhabits the Neotropical region and subdues its prey (insects) with stings that deliver a toxic cocktail of molecules. Human accidents occasionally occur and cause local pain and systemic symptoms. A comprehensive study of the D. quadriceps venom gland transcriptome is required to advance our knowledge about the toxin repertoire of the giant ant venom and to understand the physiopathological basis of Hymenoptera envenomation. Results We conducted a transcriptome analysis of a cDNA library from the D. quadriceps venom gland with Sanger sequencing in combination with whole-transcriptome shotgun deep sequencing. From the cDNA library, a total of 420 independent clones were analyzed. Although the proportion of dinoponeratoxin isoform precursors was high, the first giant ant venom inhibitor cysteine-knot (ICK) toxin was found. The deep next generation sequencing yielded a total of 2,514,767 raw reads that were assembled into 18,546 contigs. A BLAST search of the assembled contigs against non-redundant and Swiss-Prot databases showed that 6,463 contigs corresponded to BLASTx hits and indicated an interesting diversity of transcripts related to venom gene expression. The majority of these venom-related sequences code for a major polypeptide core, which comprises venom allergens, lethal-like proteins and esterases, and a minor peptide framework composed of inter-specific structurally conserved cysteine-rich toxins. Both the cDNA library and deep sequencing yielded large proportions of contigs that showed no similarities with known sequences. Conclusions To our knowledge, this is the first report of the venom gland transcriptome of the New World giant ant D. quadriceps. The glandular venom system was dissected, and the toxin arsenal was revealed; this process brought to light novel sequences that included an ICK-folded toxins, allergen proteins, esterases (phospholipases and carboxylesterases), and lethal-like toxins. These findings contribute to the understanding of the ecology, behavior and venomics of hymenopterans. PMID:24498135

  17. Cloning, sequence, and expression of a blood group B active recombinant alpha-D-galactosidase from pinto bean (Phaseolus vulgaris).

    PubMed

    Davis, M O; Hata, D J; Johnson, S A; Jones, D E; Harmata, M A; Evans, M L; Walker, J C; Smith, D S

    1997-07-01

    A cDNA encoding pinto bean alpha-D-galactosidase [E.C. 3.2.1.22] was obtained by amplification of cDNA using highly conserved sequences found in eucaryotic alpha-D-galactosidases. Subsequently a full length Phaseolus cDNA clone was obtained that is 1537 nt long and contains untranslated 5' and 3' sequences. The nucleotide sequence of the cDNA has a high degree of homology with other eucaryotic alpha-D-galactosidase genes. The recombinant alpha-D-galactosidase (rGal) was expressed in Escherichia coli and purified by ion exchange and affinity chromatography. Purified rGal was homogeneous by SDS-PAGE and had relative masses of 40.1 and 45.4 kDa under nonreducing and reducing conditions, respectively. The N-terminal sequence of the expressed protein contained the sequence GNGLGQTPPMG corresponding to that deduced from the cDNA sequence. The native molecular weight for rGal was determined to be 32.18 kDa by Sephacryl S-200 chromatography. The specific activity of the rGal was 349 mu moles of PNP-alpha-D-galactopyranoside hydrolyzed per mg of pure rGal per min. rGal was highly specific for alpha-D-galactosyl residues and degraded B oligosaccharide. No detectable hemagglutinin or protease activity was present in the preparations. Furthermore, rGal was active against the blood group B antigen on native human erythrocytes in cell suspension assays. The only detectable RBC phenotypic change was loss of the B and P1 epitopes. Recombinant Phaseolus vulgaris alpha-D-galactosidase may have useful biotechnical applications in the potential mass production of enzymatically converted, universally transfusable type O RBCs. alpha-D-galactosidase [E.C. 3.2.1.22] has been purified from a variety of procaryotic and eucaryotic species. Most alpha-D-galactosidases have similar low molecular weight substrate specificities, but activity against high molecular weight substrates is variable. Terminal alpha-D-galactoside residues are present in glycoproteins and glycolipids. Some alpha-D-galactosidases have activity against alpha-D-galactosyl residues on cell membrane glycoconjugates. Glycosidases with this property are useful for carbohydrate structural studies and biotechnical applications. Enzymes free of other glycosidase activities with activity near neutral pH are particularly useful for membrane modification studies on native cells. Complex sugar chains in glycolipids and glycoproteins have often been implicated in the growth and development of eucaryotes. In particular, complex sugar chains play an important role in the recognition of self in the immune system. Some alpha-D-galactosidases can modify certain carbohydrate membrane epitopes, thereby modulating the immune response. For example, the blood group B epitope expressed on erythrocytes contains a terminal alpha-D-galactosyl residue. Individuals lacking this antigen produce naturally occurring complement fixing antibodies to the B epitope. Hydrolysis of this terminal saccharide destroys the antigenic activity of the B determinant producing H antigen (blood type O) on erythrocytes. Only rare individuals produce clinically significant antibodies to the H antigen, and therefore, type O red blood cells are "universally" compatible and in great demand. Dhar purified alpha-D-galactosidase isozymes from Phaseolus vulgaris and characterized their activity. To our knowledge, our laboratory, in a brief report, is the first to describe the cloning of the gene and the use of recombinant enzyme for seroconverting blood type B to O cells. This paper describes the cloning, sequence, expression, purification, and characterization of recombinant alpha-D-galactosidase. Activity of the recombinant enzyme on the native human erythrocyte blood group B epitope is shown.

  18. The human mu opioid receptor: modulation of functional desensitization by calcium/calmodulin-dependent protein kinase and protein kinase C.

    PubMed

    Mestek, A; Hurley, J H; Bye, L S; Campbell, A D; Chen, Y; Tian, M; Liu, J; Schulman, H; Yu, L

    1995-03-01

    Opioids are some of the most efficacious analgesics used in humans. Prolonged administration of opioids, however, often causes the development of drug tolerance, thus limiting their effectiveness. To explore the molecular basis of those mechanisms that may contribute to opioid tolerance, we have isolated a cDNA for the human mu opioid receptor, the target of such opioid narcotics as morphine, codeine, methadone, and fentanyl. The receptor encoded by this cDNA is 400 amino acids long with 94% sequence similarity to the rat mu opioid receptor. Transient expression of this cDNA in COS-7 cells produced high-affinity binding sites to mu-selective agonists and antagonists. This receptor displays functional coupling to a recently cloned G-protein-activated K+ channel. When both proteins were expressed in Xenopus oocytes, functional desensitization developed upon repeated stimulation of the mu opioid receptor, as observed by a reduction in K+ current induced by the second mu receptor activation relative to that induced by the first. The extent of desensitization was potentiated by both the multifunctional calcium/calmodulin-dependent protein kinase and protein kinase C. These results demonstrate that kinase modulation is a molecular mechanism by which the desensitization of mu receptor signaling may be regulated at the cellular level, suggesting that this cellular mechanism may contribute to opioid tolerance in humans.

  19. Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

    Cancer.gov

    The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

  20. Complete sequence of HLA-B27 cDNA identified through the characterization of structural markers unique to the HLA-A, -B, and -C allelic series

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szoets, H.; Reithmueller, G.; Weiss, E.

    1986-03-01

    Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in positionmore » 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.« less

  1. Miniaturization Technologies for Efficient Single-Cell Library Preparation for Next-Generation Sequencing.

    PubMed

    Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C

    2016-08-01

    As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.

  2. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    PubMed

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  3. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    PubMed Central

    Hargreaves, Adam D.

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

  4. Light-modulated abundance of an mRNA encoding a calmodulin-regulated, chromatin-associated NTPase in pea

    NASA Technical Reports Server (NTRS)

    Hsieh, H. L.; Tong, C. G.; Thomas, C.; Roux, S. J.

    1996-01-01

    A CDNA encoding a 47 kDa nucleoside triphosphatase (NTPase) that is associated with the chromatin of pea nuclei has been cloned and sequenced. The translated sequence of the cDNA includes several domains predicted by known biochemical properties of the enzyme, including five motifs characteristic of the ATP-binding domain of many proteins, several potential casein kinase II phosphorylation sites, a helix-turn-helix region characteristic of DNA-binding proteins, and a potential calmodulin-binding domain. The deduced primary structure also includes an N-terminal sequence that is a predicted signal peptide and an internal sequence that could serve as a bipartite-type nuclear localization signal. Both in situ immunocytochemistry of pea plumules and immunoblots of purified cell fractions indicate that most of the immunodetectable NTPase is within the nucleus, a compartment proteins typically reach through nuclear pores rather than through the endoplasmic reticulum pathway. The translated sequence has some similarity to that of human lamin C, but not high enough to account for the earlier observation that IgG against human lamin C binds to the NTPase in immunoblots. Northern blot analysis shows that the NTPase MRNA is strongly expressed in etiolated plumules, but only poorly or not at all in the leaf and stem tissues of light-grown plants. Accumulation of NTPase mRNA in etiolated seedlings is stimulated by brief treatments with both red and far-red light, as is characteristic of very low-fluence phytochrome responses. Southern blotting with pea genomic DNA indicates the NTPase is likely to be encoded by a single gene.

  5. LIFEdb: a database for functional genomics experiments integrating information from external sources, and serving as a sample tracking system

    PubMed Central

    Bannasch, Detlev; Mehrle, Alexander; Glatting, Karl-Heinz; Pepperkok, Rainer; Poustka, Annemarie; Wiemann, Stefan

    2004-01-01

    We have implemented LIFEdb (http://www.dkfz.de/LIFEdb) to link information regarding novel human full-length cDNAs generated and sequenced by the German cDNA Consortium with functional information on the encoded proteins produced in functional genomics and proteomics approaches. The database also serves as a sample-tracking system to manage the process from cDNA to experimental read-out and data interpretation. A web interface enables the scientific community to explore and visualize features of the annotated cDNAs and ORFs combined with experimental results, and thus helps to unravel new features of proteins with as yet unknown functions. PMID:14681468

  6. Molecular cloning of a human Ca2+-dependent cell-cell adhesion molecule homologous to mouse placental cadherin: its low expression in human placental tissues

    PubMed Central

    1989-01-01

    P-cadherin is a subclass of Ca2+-dependent cell-cell adhesion molecules present in mouse placenta, where its localization suggests a function of connecting the embryo to the uterus (Nose, A., and M. Takeichi. 1986. J. Cell Biol. 103:2649-2658). We recently identified a human cadherin detected by an mAb capable of disrupting cell-cell adhesion of A-431 cells, and found that it was closely related immunochemically to mouse P-cadherin. Curiously, this cadherin was undetectable in human placenta by immunohistochemical examination (Shimoyama, Y., S. Hirohashi, S. Hirano, M. Noguchi, Y. Shimosato, M. Takeichi, and O. Abe. 1989. Cancer Res. 49:2128-2133). We here report the cloning and sequencing of cDNA clone encoding the human homologue of mouse P- cadherin. The deduced amino acid sequence of the human P-cadherin consists of 829 amino acid and shows striking homology with mouse P- cadherin. On Northern blot analysis, human P-cadherin was scarcely expressed in human placenta in contrast to mouse P-cadherin, which was abundantly expressed in mouse placenta throughout pregnancy, and it was shown that E-cadherin, but not P-cadherin, was the major cadherin molecule in human placenta. Moreover, NIH3T3 cells transfected with human P-cadherin cDNA expressed the functional cadherin molecule, which was identical to the cadherin we had previously identified using the mAb, showing that this molecule really does mediate cell-cell adhesion and that the cadherin we detected immunochemically is undoubtedly human P-cadherin. The results obtained in this study support the idea that P- cadherin plays little role, if any, in Ca2+-dependent cell-cell binding in human placental tissue at least after several weeks of pregnancy. PMID:2793940

  7. Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

    PubMed

    Eberwine, James; Bartfai, Tamas

    2011-03-01

    We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Constructing and detecting a cDNA library for mites.

    PubMed

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  9. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    PubMed Central

    Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

    2014-01-01

    Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

  10. Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

    PubMed

    Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

    2004-12-15

    cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

  11. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

    PubMed Central

    Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

    1987-01-01

    Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

  12. Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

    PubMed Central

    van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

    2002-01-01

    Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

  13. Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants.

    PubMed

    Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

    2002-06-15

    The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.

  14. Differential display RT PCR of total RNA from human foreskin fibroblasts for investigation of androgen-dependent gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nitsche, E.M.; Moquin, A.; Adams, P.S.

    1996-05-03

    Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less

  15. Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

    PubMed

    Ozsolak, Fatih

    2016-01-01

    With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

  16. Isolation and molecular cloning of a fast-growing strain of human hepatitis A virus from its double-stranded replicative form.

    PubMed Central

    Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M

    1985-01-01

    A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478

  17. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed Central

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-01-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

  18. Characterization of the in vitro expressed autoimmune rippling muscle disease immunogenic domain of human titin encoded by TTN exons 248-249

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zelinka, L.; McCann, S.; Budde, J.

    2011-08-05

    Highlights: {yields} Affinity purification of the autoimmune rippling muscle disease immunogenic domain of titin. {yields} Partial sequence analysis confirms that the peptides is in the I band region of titin. {yields} This region of the human titin shows high degree of homology to mouse titin N2-A. -- Abstract: Autoimmune rippling muscle disease (ARMD) is an autoimmune neuromuscular disease associated with myasthenia gravis (MG). Past studies in our laboratory recognized a very high molecular weight skeletal muscle protein antigen identified by ARMD patient antisera as the titin isoform. These past studies used antisera from ARMD and MG patients as probes tomore » screen a human skeletal muscle cDNA library and several pBluescript clones revealed supporting expression of immunoreactive peptides. This study characterizes the products of subcloning the titin immunoreactive domain into pGEX-3X and the subsequent fusion protein. Sequence analysis of the fusion gene indicates the cloned titin domain (GenBank ID: (EU428784)) is in frame and is derived from a sequence of N2-A spanning the exons 248-250 an area that encodes the fibronectin III domain. PCR and EcoR1 restriction mapping studies have demonstrated that the inserted cDNA is of a size that is predicted by bioinformatics analysis of the subclone. Expression of the fusion protein result in the isolation of a polypeptide of 52 kDa consistent with the predicted inferred amino acid sequence. Immunoblot experiments of the fusion protein, using rippling muscle/myasthenia gravis antisera, demonstrate that only the titin domain is immunoreactive.« less

  19. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    NASA Astrophysics Data System (ADS)

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective animal model of human disease.

  20. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.

    1989-08-01

    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two,more » and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.« less

  1. Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

    USDA-ARS?s Scientific Manuscript database

    Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

  2. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    USDA-ARS?s Scientific Manuscript database

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  3. Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

    PubMed

    Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

    2011-12-10

    Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Analysis and Functional Annotation of an Expressed Sequence Tag Collection for Tropical Crop Sugarcane

    PubMed Central

    Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo

    2003-01-01

    To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979

  5. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  6. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  7. Automated sample-preparation technologies in genome sequencing projects.

    PubMed

    Hilbert, H; Lauber, J; Lubenow, H; Düsterhöft, A

    2000-01-01

    A robotic workstation system (BioRobot 96OO, QIAGEN) and a 96-well UV spectrophotometer (Spectramax 250, Molecular Devices) were integrated in to the process of high-throughput automated sequencing of double-stranded plasmid DNA templates. An automated 96-well miniprep kit protocol (QIAprep Turbo, QIAGEN) provided high-quality plasmid DNA from shotgun clones. The DNA prepared by this procedure was used to generate more than two mega bases of final sequence data for two genomic projects (Arabidopsis thaliana and Schizosaccharomyces pombe), three thousand expressed sequence tags (ESTs) plus half a mega base of human full-length cDNA clones, and approximately 53,000 single reads for a whole genome shotgun project (Pseudomonas putida).

  8. Human cDNA mapping using fluorescence in situ hybridization. Final progress report, April 1, 1994--July 31, 1997

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Korenberg, J.R.

    The ultimate goal of this research is to generate and apply novel technologies to speed completion and integration of the human genome map and sequence with biomedical problems. To do this, techniques were developed and genome-wide resources generated. This includes a genome-wide Mapped and Integrated BAC/PAC Resource that has been used for gene finding, map completion and anchoring, breakpoint definition and sequencing. In the last period of the grant, the Human Mapped BAC/PAC Resource was also applied to determine regions of human variation and to develop a novel paradigm of primate evolution through to humans. Further, in order to moremore » rapidly evaluate animal models of human disease, a BAC Map of the mouse was generated in collaboration with the MTI Genome Center, Dr. Bruce Birren.« less

  9. The active gene that encodes human High Mobility Group 1 protein (HMG1) contains introns and maps to chromosome 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferrari, S.; Finelli, P.; Rocchi, M.

    The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mousemore » Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.« less

  10. Genomic resources for songbird research and their use in characterizing gene expression during brain development

    PubMed Central

    Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

    2007-01-01

    Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

  11. Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

    PubMed

    Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

    2013-05-01

    One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Molecular characterization and expression analysis of osteopontin cDNA from lactating mammary gland in yak (Bos grunniens).

    PubMed

    Bai, W L; Yang, R J; Yin, R H; Jiang, W Q; Luo, G B; Yin, R L; Zhao, S J; Li, C; Zhao, Z H

    2012-04-01

    Osteopontin (OPN) is a secreted phosphorylated glycoprotein. It has an important role in mammary gland development and lactation, as well as, is thought to be a potential candidate gene for lactation traits. In the present work, we isolated and characterized a full-length open reading frame (ORF) of yak OPN cDNA from lactating mammary tissue, and examined its expression pattern in mammary gland during different stages of lactation, as well as, the recombinant OPN protein of yak was expressed successfully in E. coli. The sequencing results indicated that the isolated cDNA was 1132-bp in length containing a complete ORF of 837-bp. It encoded a precursor protein of yak OPN consisting of 278 amino acid with a signal peptide of 16 amino acids. Yak OPN has a predicted molecular mass of 29285.975 Da and an isoelectric point of 4.245. It had an identity of 65.50-99.16% in cDNA, identity of 52.06-98.56% and similarity of 65.40-98.56% in deduced amino acids with the corresponding sequences of cattle, buffalo, sheep, goat, pig, human, and rabbit. The phylogenetic analysis indicated that yak OPN had the closest evolutionary relationship with that of cattle, and next buffalo. In mammary gland, yak OPN was generally transcribed in a declining pattern from colostrum period to dry period with an apparent increase of OPN expression being present in the late period of lactation compared with peak period of lactation. Western blot analysis indicated that His-tagged yak OPN protein expressed in E. coli could be recognized not only by an anti-His-tag antibody but also by an anti-human OPN antibody. These results from the present work provided a foundation for further insight into the role of OPN gene in yak lactation.

  13. Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones

    PubMed Central

    Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio

    2004-01-01

    The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In addition, among 72,027 uniquely mapped SNPs and insertions/deletions localized within human genes, 13,215 nonsynonymous SNPs, 315 nonsense SNPs, and 452 indels occurred in coding regions. Together with 25 polymorphic microsatellite repeats present in coding regions, they may alter protein structure, causing phenotypic effects or resulting in disease. The H-InvDB platform represents a substantial contribution to resources needed for the exploration of human biology and pathology. PMID:15103394

  14. Reduced TCOF1 mRNA level in a rhesus macaque with Treacher Collins-like syndrome: further evidence for haploinsufficiency of treacle as the cause of disease.

    PubMed

    Shows, Kathryn H; Ward, Christy; Summers, Laura; Li, Lin; Ziegler, Gregory R; Hendrickx, Andrew G; Shiang, Rita

    2006-02-01

    Mutations in the human gene TCOF1 cause a mandibulofacial dysostosis known as Treacher Collins syndrome (TCS). An infant rhesus macaque (Macaca mulatta) that displayed the TCS phenotype was identified at the California National Primate Research Center. The TCOF1 coding region was cloned from a normal rhesus macaque and sequenced. The rhesus macaque homolog of TCOF1 is 91.6% identical in cDNA sequence and 93.8% identical in translated protein sequence compared to human TCOF1. Sequencing of TCOF1 in the TCS-affected rhesus macaque showed no mutations within the coding region or splice sites; however, real-time quantitative PCR showed an 87% reduction of spleen TCOF1 mRNA level in the TCS affected macaque when compared with normal macaque spleen.

  15. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    PubMed Central

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  16. Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

    PubMed Central

    Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

    2012-01-01

    Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

  17. RPG: the Ribosomal Protein Gene database.

    PubMed

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes.

  18. RPG: the Ribosomal Protein Gene database

    PubMed Central

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes. PMID:14681386

  19. Description and physical localization of the bovine survival of motor neuron gene (SMN).

    PubMed

    Pietrowski, D; Goldammer, T; Meinert, S; Schwerin, M; Förster, M

    1998-01-01

    Proximal spinal muscular atrophy (SMA) is an autosomal recessive disease in humans and other mammals, characterized by degeneration of anterior horn cells of the spinal cord. In humans, the survival of motor neuron gene (SMN) has been recognized as the SMA-determining gene and has been mapped to 5q13. In cattle, SMA is a recurrent, inherited disease that plays an important economic role in breeding programs of Brown Swiss stock. Now we have identified the full- length cDNA sequence of the bovine SMN gene. Molecular analysis and characterization of the sequence documents 85% identity to its human counterpart and three evolutionarily conserved domains in different species. Physical mapping data reveals that bovine SMN is localized to chromosome region 20q12-->q13, supporting the conserved synteny of this chromosomal region between humans and cattle.

  20. Characterization of the venom from the Australian scorpion Urodacus yaschenkoi: Molecular mass analysis of components, cDNA sequences and peptides with antimicrobial activity.

    PubMed

    Luna-Ramírez, Karen; Quintero-Hernández, Veronica; Vargas-Jaimes, Leonel; Batista, Cesar V F; Winkel, Kenneth D; Possani, Lourival D

    2013-03-01

    The Urodacidae scorpions are the most widely distributed of the four families in Australia and represent half of the species in the continent, yet their venoms remain largely unstudied. This communication reports the first results of a proteome analysis of the venom of the scorpion Urodacus yaschenkoi performed by mass fingerprinting, after high performance liquid chromatography (HPLC) separation. A total of 74 fractions were obtained by HPLC separation allowing the identification of approximately 274 different molecular masses with molecular weights varying from 287 to 43,437 Da. The most abundant peptides were those from 1 K Da and 4-5 K Da representing antimicrobial peptides and putative potassium channel toxins, respectively. Three such peptides were chemically synthesized and tested against Gram-positive and Gram-negative bacteria showing minimum inhibitory concentration in the low micromolar range, but with moderate hemolytic activity. It also reports a transcriptome analysis of the venom glands of the same scorpion species, undertaken by constructing a cDNA library and conducting random sequencing screening of the transcripts. From the resultant cDNA library 172 expressed sequence tags (ESTs) were analyzed. These transcripts were further clustered into 120 unique sequences (23 contigs and 97 singlets). The identified putative proteins can be assorted in several groups, such as those implicated in common cellular processes, putative neurotoxins and antimicrobial peptides. The scorpion U. yaschenkoi is not known to be dangerous to humans and its venom contains peptides similar to those of Opisthacanthus cayaporum (antibacterial), Scorpio maurus palmatus (maurocalcin), Opistophthalmus carinatus (opistoporines) and Hadrurus gerstchi (scorpine-like molecules), amongst others. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.

    PubMed

    Kröger, M; Tschesche, H

    1997-09-01

    The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.

  2. RICD: a rice indica cDNA database resource for rice functional genomics.

    PubMed

    Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

    2008-11-26

    The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  3. The human serotonin 5-HT{sub 2C} receptor: Complete cDNA, genomic structure, and alternatively spliced variant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun

    1996-08-01

    The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less

  4. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types.

    PubMed

    Kilian, A; Bowtell, D D; Abud, H E; Hime, G R; Venter, D J; Keese, P K; Duncan, E L; Reddel, R R; Jefferson, R A

    1997-11-01

    Telomerase is a multicomponent reverse transcriptase enzyme that adds DNA repeats to the ends of chromosomes using its RNA component as a template for synthesis. Telomerase activity is detected in the germline as well as the majority of tumors and immortal cell lines, and at low levels in several types of normal cells. We have cloned a human gene homologous to a protein from Saccharomyces cerevisiae and Euplotes aediculatus that has reverse transcriptase motifs and is thought to be the catalytic subunit of telomerase in those species. This gene is present in the human genome as a single copy sequence with a dominant transcript of approximately 4 kb in a human colon cancer cell line, LIM1215. The cDNA sequence was determined using clones from a LIM1215 cDNA library and by RT-PCR, cRACE and 3'RACE on mRNA from the same source. We show that the gene is expressed in several normal tissues, telomerase-positive post-crisis (immortal) cell lines and various tumors but is not expressed in the majority of normal tissues analyzed, pre-crisis (non-immortal) cells and telomerase-negative immortal (ALT) cell lines. Multiple products were identified by RT-PCR using primers within the reverse transcriptase domain. Sequencing of these products suggests that they arise by alternative splicing. Strikingly, various tumors, cell lines and even normal tissues (colonic crypt and testis) showed considerable differences in the splicing patterns. Alternative splicing of the telomerase catalytic subunit transcript may be important for the regulation of telomerase activity and may give rise to proteins with different biochemical functions.

  5. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    PubMed

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  6. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

  7. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  8. Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herzog, R.; Lutz, S.; Blin, N.

    1991-02-05

    Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

  9. Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.

    PubMed

    Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N

    2017-09-01

    DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.

  10. BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA from disk abalone Haliotis discus discus.

    PubMed

    Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee

    2010-11-01

    A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.

  11. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    PubMed Central

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  12. Nucleotide sequence and regulatory studies of VGF, a nervous system-specific mRNA that is rapidly and relatively selectively induced by nerve growth factor.

    PubMed

    Salton, S R

    1991-09-01

    A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.

  13. Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

    PubMed

    Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

    2015-06-01

    The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

  14. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  15. The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

    PubMed

    Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

    2003-11-01

    Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

  16. [Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

    PubMed

    Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

    2006-09-01

    To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leong, JoAnn Ching

    The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

  18. Molecular cloning of a murine homologue of membrane cofactor protein (CD46): preferential expression in testicular germ cells.

    PubMed Central

    Tsujimura, A; Shida, K; Kitamura, M; Nomura, M; Takeda, J; Tanaka, H; Matsumoto, M; Matsumiya, K; Okuyama, A; Nishimune, Y; Okabe, M; Seya, T

    1998-01-01

    Human membrane cofactor protein (MCP, CD46) has been suggested, although no convincing evidence has been proposed, to be a fertilization-associated protein, in addition to its primary functions as a complement regulator and a measles virus receptor. We have cloned a cDNA encoding the murine homologue of MCP. This cDNA showed 45% identity in deduced protein sequence and 62% identity in nucleotide sequence with human MCP. Its ectodomains were four short consensus repeats and a serine/threonine-rich domain, and it appeared to be a type 1 membrane protein with a 23-amino acid transmembrane domain and a short cytoplasmic tail. The protein expressed on Chinese hamster ovary cell transfectants was 47 kDa on SDS/PAGE immunoblotting, approximately 6 kDa larger than the murine testis MCP. It served as a cofactor for factor I-mediated inactivation of the complement protein C3b in a homologous system and, to a lesser extent, in a human system. Strikingly, the major message of murine MCP was 1.5 kb and was expressed predominantly in the testis. It was not detected in mice defective in spermatogenesis or with immature germ cells (until 23 days old). Thus, murine MCP may be a sperm-dominant protein the message of which is expressed selectively in spermatids during germ-cell differentiation. PMID:9461505

  19. The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

    PubMed Central

    Craig, R K; Hall, L; Parker, D; Campbell, P N

    1981-01-01

    A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

  20. Sequence, molecular properties, and chromosomal mapping of mouse lumican

    NASA Technical Reports Server (NTRS)

    Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

    1995-01-01

    PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

  1. From biomedicine to natural history research: EST resources for ambystomatid salamanders

    PubMed Central

    Putta, Srikrishna; Smith, Jeramiah J; Walker, John A; Rondet, Mathieu; Weisrock, David W; Monaghan, James; Samuels, Amy K; Kump, Kevin; King, David C; Maness, Nicholas J; Habermann, Bianca; Tanaka, Elly; Bryant, Susan V; Gardiner, David M; Parichy, David M; Voss, S Randal

    2004-01-01

    Background Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (Ambystoma mexicanum) and Eastern tiger salamander (A. tigrinum tigrinum), species with deep and diverse research histories. Results Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences for A. mexicanum were processed to yield 35,413 and 20,599 high quality ESTs for A. mexicanum and A. t. tigrinum, respectively. Because the A. t. tigrinum ESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human – Ambystoma synteny group with marker loci, and extended PCR primer sets designed for A. mexicanum / A. t. tigrinum orthologues to a related tiger salamander species. Conclusions Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research. PMID:15310388

  2. Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

    PubMed

    Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

    2004-05-01

    Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

  3. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome

    PubMed Central

    Camargo, Anamaria A.; Samaia, Helena P. B.; Dias-Neto, Emmanuel; Simão, Daniel F.; Migotto, Italo A.; Briones, Marcelo R. S.; Costa, Fernando F.; Aparecida Nagai, Maria; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; Sonati, Maria de Fátima; Tajara, Eloiza H.; Valentini, Sandro R.; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Arnaldi, Liliane A. T.; de Assis, Angela M.; Bengtson, Mário Henrique; Bergamo, Nadia Aparecida; Bombonato, Vanessa; de Camargo, Maria E. R.; Canevari, Renata A.; Carraro, Dirce M.; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Corrêa, Rosana F. R.; Costa, Maria Cristina R.; Curcio, Cyntia; Hokama, Paula O. M.; Ferreira, Ari J. S.; Furuzawa, Gilberto K.; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Krieger, José E.; Leite, Luciana C. C.; Majumder, Paromita; Marins, Mozart; Marques, Everaldo R.; Melo, Analy S. A.; Melo, Monica; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana G.; Prevedel, Aline C.; Rahal, Paula; Rainho, Claudia A.; Reis, Eduardo M. R.; Ribeiro, Marcelo L.; da Rós, Nancy; de Sá, Renata G.; Sales, Magaly M.; Sant'anna, Simone Cristina; dos Santos, Mariana L.; da Silva, Aline M.; da Silva, Neusa P.; Silva, Wilson A.; da Silveira, Rosana A.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Soares, Fernando; Moreira, Eloisa S.; Nunes, Diana N.; Correa, Ricardo G.; Zalcberg, Heloisa; Carvalho, Alex F.; Reis, Luis F. L.; Brentani, Ricardo R.; Simpson, Andrew J. G.; de Souza, Sandro J.

    2001-01-01

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription–PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning. PMID:11593022

  4. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome.

    PubMed

    Camargo, A A; Samaia, H P; Dias-Neto, E; Simão, D F; Migotto, I A; Briones, M R; Costa, F F; Nagai, M A; Verjovski-Almeida, S; Zago, M A; Andrade, L E; Carrer, H; El-Dorry, H F; Espreafico, E M; Habr-Gama, A; Giannella-Neto, D; Goldman, G H; Gruber, A; Hackel, C; Kimura, E T; Maciel, R M; Marie, S K; Martins, E A; Nobrega, M P; Paco-Larson, M L; Pardini, M I; Pereira, G G; Pesquero, J B; Rodrigues, V; Rogatto, S R; da Silva, I D; Sogayar, M C; Sonati, M F; Tajara, E H; Valentini, S R; Alberto, F L; Amaral, M E; Aneas, I; Arnaldi, L A; de Assis, A M; Bengtson, M H; Bergamo, N A; Bombonato, V; de Camargo, M E; Canevari, R A; Carraro, D M; Cerutti, J M; Correa, M L; Correa, R F; Costa, M C; Curcio, C; Hokama, P O; Ferreira, A J; Furuzawa, G K; Gushiken, T; Ho, P L; Kimura, E; Krieger, J E; Leite, L C; Majumder, P; Marins, M; Marques, E R; Melo, A S; Melo, M B; Mestriner, C A; Miracca, E C; Miranda, D C; Nascimento, A L; Nobrega, F G; Ojopi, E P; Pandolfi, J R; Pessoa, L G; Prevedel, A C; Rahal, P; Rainho, C A; Reis, E M; Ribeiro, M L; da Ros, N; de Sa, R G; Sales, M M; Sant'anna, S C; dos Santos, M L; da Silva, A M; da Silva, N P; Silva, W A; da Silveira, R A; Sousa, J F; Stecconi, D; Tsukumo, F; Valente, V; Soares, F; Moreira, E S; Nunes, D N; Correa, R G; Zalcberg, H; Carvalho, A F; Reis, L F; Brentani, R R; Simpson, A J; de Souza, S J; Melo, M

    2001-10-09

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription-PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning.

  5. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis

    PubMed Central

    2004-01-01

    Abstract The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer. PMID:15581228

  6. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis.

    PubMed

    Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A

    2004-10-01

    The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.

  7. [Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

    PubMed

    Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

    2009-04-01

    This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

  8. Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

    PubMed Central

    2011-01-01

    Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

  9. Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

    PubMed

    Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

    2000-10-06

    Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

  10. MCT1, MCT4 and CD147 gene polymorphisms in healthy horses and horses with myopathy.

    PubMed

    Mykkänen, A K; Koho, N M; Reeben, M; McGowan, C M; Pösö, A R

    2011-12-01

    Polymorphisms in human lactate transporter proteins (monocarboxylate transporters; MCTs), especially the MCT1 isoform, can affect lactate transport activity and cause signs of exercise-induced myopathy. Muscles express MCT1, MCT4 and CD147, an ancillary protein, indispensable for the activity of MCT1 and MCT4. We sequenced the coding sequence (cDNA) of horse MCT4 for the first time and examined polymorphisms in the cDNA of MCT1, MCT4 and CD147 of 16 healthy horses. To study whether signs of myopathy are linked to the polymorphisms, biopsy samples were taken from 26 horses with exercise-induced recurrent myopathy. Two polymorphisms that cause a change in amino acid sequence were found in MCT1 (Val(432)Ile and Lys(457)Gln) and one in CD147 (Met(125)Val). All polymorphisms in MCT4 were silent. Mutations in MCT1 or CD147 in equine muscle were not associated with myopathy. In the future, a functional study design is needed to evaluate the physiological role of the polymorphisms found. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. Isolation and functional expression of human COQ2, a gene encoding a polyprenyl transferase involved in the synthesis of CoQ.

    PubMed

    Forsgren, Margareta; Attersand, Anneli; Lake, Staffan; Grünler, Jacob; Swiezewska, Ewa; Dallner, Gustav; Climent, Isabel

    2004-09-01

    The COQ2 gene in Saccharomyces cerevisiae encodes a Coq2 (p-hydroxybenzoate:polyprenyl transferase), which is required in the biosynthetic pathway of CoQ (ubiquinone). This enzyme catalyses the prenylation of p-hydroxybenzoate with an all-trans polyprenyl group. We have isolated cDNA which we believe encodes the human homologue of COQ2 from a human muscle and liver cDNA library. The clone contained an open reading frame of length 1263 bp, which encodes a polypeptide that has sequence homology with the Coq2 homologues in yeast, bacteria and mammals. The human COQ2 gene, when expressed in yeast Coq2 null mutant cells, rescued the growth of this yeast strain in the absence of a non-fermentable carbon source and restored CoQ biosynthesis. However, the rate of CoQ biosynthesis in the rescued cells was lower when compared with that in cells rescued with the yeast COQ2 gene. CoQ formed when cells were incubated with labelled decaprenyl pyrophosphate and nonaprenyl pyrophosphate, showing that the human enzyme is active and that it participates in the biosynthesis of CoQ.

  12. Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri).

    PubMed

    Zheng, Yu; Yun, Chenxia; Wang, Qihui; Smith, Wanli W; Leng, Jing

    2015-02-01

    The tree shrew (Tupaia belangeri) diverges from the primate order (Primates) and is classified as a separate taxonomic group of mammals - Scandentia. It has been suggested that the tree shrew can be used as an animal model for studying human diseases; however, the genomic sequence of the tree shrew is largely unidentified. In the present study, we reported the full-length cDNA sequence of the housekeeping gene, β-actin, in the tree shrew. The amino acid sequence of β-actin in the tree shrew was compared to that of humans and other species; a simple phylogenetic relationship was discovered. Quantitative polymerase chain reaction (qPCR) and western blot analysis further demonstrated that the expression profiles of β-actin, as a general conservative housekeeping gene, in the tree shrew were similar to those in humans, although the expression levels varied among different types of tissue in the tree shrew. Our data provide evidence that the tree shrew has a close phylogenetic association with humans. These findings further enhance the potential that the tree shrew, as a species, may be used as an animal model for studying human disorders.

  13. Highly multiplexed subcellular RNA sequencing in situ

    PubMed Central

    Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Yang, Joyce L.; Terry, Richard; Jeanty, Sauveur S. F.; Li, Chao; Amamoto, Ryoji; Peters, Derek T.; Turczyk, Brian M.; Marblestone, Adam H.; Inverso, Samuel A.; Bernard, Amy; Mali, Prashant; Rios, Xavier; Aach, John; Church, George M.

    2014-01-01

    Understanding the spatial organization of gene expression with single nucleotide resolution requires localizing the sequences of expressed RNA transcripts within a cell in situ. Here we describe fluorescent in situ RNA sequencing (FISSEQ), in which stably cross-linked cDNA amplicons are sequenced within a biological sample. Using 30-base reads from 8,742 genes in situ, we examined RNA expression and localization in human primary fibroblasts using a simulated wound healing assay. FISSEQ is compatible with tissue sections and whole mount embryos, and reduces the limitations of optical resolution and noisy signals on single molecule detection. Our platform enables massively parallel detection of genetic elements, including gene transcripts and molecular barcodes, and can be used to investigate cellular phenotype, gene regulation, and environment in situ. PMID:24578530

  14. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    PubMed Central

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

  15. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    DTIC Science & Technology

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  16. Cloning, characterization and comparative analysis of pig plasma apolipoprotein A-IV.

    PubMed

    Navarro, María A; Acín, Sergio; Iturralde, María; Calleja, Lucía; Carnicer, Ricardo; Guzmán-García, Mario A; González-Ramón, Nieves; Mata, Pedro; Isabel, Beatriz; López-Bote, Clemente J; Lampreave, Fermín; Piñeiro, Andrés; Osada, Jesús

    2004-01-21

    Pig apolipoprotein (apo) A-IV cDNA was cloned, characterized and compared to the human ortholog. Mature porcine apo A-IV consists of 362 amino acids and displays a 75.6% sequence identity with human protein. Pig apo A-IV is the smallest reported mammalian apo A-IV because it lacks the repeated motifs of glutamine and glutamic acid at the carboxyl terminus. A phylogenic tree of apo A-IV mammalian proteins reveals that porcine apo A-IV is more closely related to humans and primates than to rodents. This protein is highly hydrophobic and is mainly associated with lipoproteins.

  17. Molecular cloning and 3D model of first cytochrome P450 from CYP3A subfamily in saltwater crocodile (Crocodylus porosus).

    PubMed

    Tabassum, Rabia

    2017-10-18

    Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Molecular cloning and sequence analysis of stearoyl-CoA desaturase in milkfish, Chanos chanos.

    PubMed

    Hsieh, S L; Liao, W L; Kuo, C M

    2001-12-01

    Stearoyl-CoA desaturase (EC 1.14.99.5) is a key enzyme in the biosynthesis of polyunsaturated fatty acids and the maintenance of the homeoviscous fluidity of biological membranes. The stearoyl-CoA desaturase cDNA in milkfish (Chanos chanos) was cloned by RT-PCR and RACE, and it was compared with the stearoyl-CoA desaturase in cold-tolerant teleosts, common carp and grass carp. Nucleotide sequence analysis revealed that the cDNA clone has a 972-bp open reading frame encoding 323 amino acid residues. Alignments of the deduced amino acid sequence showed that the milkfish stearoyl-CoA desaturase shares 79% and 75% identity with common carp and grass carp, and 63%-64% with other vertebrates such as sheep, hamsters, rats, mice, and humans. Like common carp and grass carp, the deduced amino acid sequence in milkfish well conserves three histidine cluster motifs (one HXXXXH and two HXXHH) that are essential for catalysis of stearoyl-CoA desaturase activity. However, RT-PCR analysis showed that stearoyl-CoA desaturase expression in milkfish is detected in the tissues of liver, muscle, kidney, brain, and gill, and more expression sites were found in milkfish than in common carp and grass carp. Phylogenic relationships among the deduced stearoyl-CoA desaturase amino acid sequence in milkfish and those in other vertebrates showed that the milkfish stearoyl-CoA desaturase amino acid sequence is phylogenetically closer to those of common carp and grass carp than to other higher vertebrates.

  19. Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

    PubMed Central

    Oduru, Sreedhar; Campbell, Janee L; Karri, SriTulasi; Hendry, William J; Khan, Shafiq A; Williams, Simon C

    2003-01-01

    Background Complete genome annotation will likely be achieved through a combination of computer-based analysis of available genome sequences combined with direct experimental characterization of expressed regions of individual genomes. We have utilized a comparative genomics approach involving the sequencing of randomly selected hamster testis cDNAs to begin to identify genes not previously annotated on the human, mouse, rat and Fugu (pufferfish) genomes. Results 735 distinct sequences were analyzed for their relatedness to known sequences in public databases. Eight of these sequences were derived from previously unidentified genes and expression of these genes in testis was confirmed by Northern blotting. The genomic locations of each sequence were mapped in human, mouse, rat and pufferfish, where applicable, and the structure of their cognate genes was derived using computer-based predictions, genomic comparisons and analysis of uncharacterized cDNA sequences from human and macaque. Conclusion The use of a comparative genomics approach resulted in the identification of eight cDNAs that correspond to previously uncharacterized genes in the human genome. The proteins encoded by these genes included a new member of the kinesin superfamily, a SET/MYND-domain protein, and six proteins for which no specific function could be predicted. Each gene was expressed primarily in testis, suggesting that they may play roles in the development and/or function of testicular cells. PMID:12783626

  20. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

    PubMed

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

  1. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

    PubMed Central

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

  2. A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

    PubMed

    Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

    2015-04-09

    Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

  3. Chromosomal localization and cDNA cloning of the human DBP and TEF genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khatib, Z.A.; Inaba, T.; Valentine, M.

    1994-09-15

    The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less

  4. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    PubMed

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  5. Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

    PubMed Central

    Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

    2004-01-01

    We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

  6. Splicing Variants of SERPINA1 Gene in Ovine Milk: Characterization of cDNA and Identification of Polymorphisms

    PubMed Central

    Marchitelli, Cinzia; Crisà, Alessandra; Mostarda, Elisa; Napolitano, Francesco; Moioli, Bianca

    2013-01-01

    The serine protease inhibitor, clade A, member 1 (SERPINA1) is the gene for a protein called alpha-1-antitrypsin (AAT), which is a member of the serine protease inhibitor (serpin) superfamily of proteins. By conformational change, serpins control several chemical reactions inhibiting the activity of proteases. AAT is the most abundant endogenous serpin in blood circulation and it is present in relatively high concentration in human milk as well as in bovine and porcine colostrum. Here we report for the first time the molecular characterization and sequence variability of the ovine SERPINA1 cDNA and gene. cDNAs from mammary gland and from milk were PCR amplified, and three different transcripts (1437, 1166 and 521bp) of the SERPINA1 gene were identified. We amplified and sequenced different regions of the gene (5’ UTR, from exon 2 to exon 5 and 3’ UTR), and we found that the exon-intron structure of the gene is similar to that of human and bovine. We detected a total of 97 SNPs in cDNAs and gene sequences from 10 sheep of three different breeds. In adult sheep tissues a SERPINA1 gene expression analysis indicated a differential expression of the three different transcripts. The finding reported in this paper will aid further studies on possible involvement of the SERPINA1 gene in different physiological states and its possible association with production traits. PMID:24009725

  7. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  8. Organization of the murine Cd22 locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.

    1993-07-01

    Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less

  9. Identification of a GTP-binding protein. cap alpha. subunit that lacks an apparent ADP-ribosylation site for pertussis toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fong, H.K.W.; Yoshimoto, K.K.; Eversole-Cire, P.

    1988-05-01

    Recent molecular cloning of cDNA for the ..cap alpha.. subunit of bovine transducin (a guanine nucleotide-binding regulatory protein, or G protein) has revealed the presence of two retinal-specific transducins, called T/sub r/ and T/sub c/, which are expressed in rod or cone photoreceptor cells. In a further study of G-protein diversity and signal transduction in the retina, the authors have identified a G-protein ..cap alpha.. subunit, which they refer to as G/sub z/..cap alpha.., by isolating a human retinal cDNA clone that cross-hybridizes at reduced stringency with bovine T/sub r/ ..cap alpha..-subunit cDNA. The deduced amino acid sequence of G/submore » z/..cap alpha.. is 41-67% identical with those of other known G-protein ..cap alpha.. subunits. However, the 355-residue G/sub z/..cap alpha.. lacks a consensus site for ADP-ribosylation by pertussis toxin, and its amino acid sequence varies within a number of regions that are strongly conserved among all of the other G-protein ..cap alpha.. subunits. They suggest that G/sub z/..cap alpha.., which appears to be highly expressed in neural tissues, represents a member of a subfamily of G proteins that mediate signal transduction in pertussis toxin-insensitive systems.« less

  10. TsAg5, a Taenia solium cysticercus protein with a marginal trypsin-like activity in the diagnosis of human neurocysticercosis.

    PubMed

    Rueda, Analiz; Sifuentes, Cecilia; Gilman, Robert H; Gutiérrez, Andrés H; Piña, Ruby; Chile, Nancy; Carrasco, Sebastián; Larson, Sandra; Mayta, Holger; Verástegui, Manuela; Rodriguez, Silvia; Gutiérrez-Correa, Marcel; García, Héctor H; Sheen, Patricia; Zimic, Mirko

    2011-12-01

    Neurocysticercosis is an endemic parasitic disease caused by Taenia solium larva. Although the mechanism of infection is not completely understood, it is likely driven by proteolytic activity that degrades the intestinal wall to facilitate oncosphere penetration and further infection. We analyzed the publicly available T. solium EST/DNA library and identified two contigs comprising a full-length cDNA fragment very similar to Echinococcus granulosus Ag5 protein. The T. solium cDNA sequence included a proteolytic trypsin-like-domain in the C-terminal region, and a thrombospondin type-1 adherence-domain in the N-terminal region. Both the trypsin-like and adherence domains were expressed independently as recombinant proteins in bacterial systems. TsAg5 showed marginal trypsin-like activity and high sequence similarity to Ag5. The purified antigens were tested in a Western immunoblot assay to diagnose human neurocysticercosis. The sensitivity of the trypsin-like-domain was 96.36% in patients infected with extraparenchymal cysts, 75.44% in patients infected with multiple cysts, and 39.62% in patients with a single cyst. Specificity was 76.70%. The thrombospondin type-1 adherence-domain was not specific for neurocysticercosis. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    PubMed

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  12. Purification and characterization of an antifungal protein, C-FKBP, from Chinese cabbage.

    PubMed

    Park, Seong-Cheol; Lee, Jung Ro; Shin, Sun-Oh; Jung, Ji Hyun; Lee, Young Mee; Son, Hyosuk; Park, Yoonkyung; Lee, Sang Yeol; Hahm, Kyung-Soo

    2007-06-27

    An antifungal protein was isolated from Chinese cabbage (Brassica campestris L. ssp. pekinensis) by buffer-soluble extraction and two chromatographic procedures. The results of matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry revealed that the isolated Chinese cabbage protein was identical to human FK506-binding protein (FKBP). A cDNA encoding FKBP was isolated from a Chinese cabbage leaf cDNA library and named C-FKBP. The open reading frame of the gene encoded a 154-amino acid polypeptide. The amino acid sequence of C-FKBP exhibits striking degrees of identity with the corresponding mouse (61%), human (60%), and yeast (56%) proteins. Genomic Southern blot analyses using the full-length C-FKBP cDNA probe revealed a multigene family in the Chinese cabbage genome. The C-FKBP mRNA was highly expressed in vegetative tissues. We also analyzed the antifungal and peptidyl-prolyl cis-trans isomerase activity of recombinant C-FKBP protein expressed in Escherichia coli. This protein inhibited pathogenic fungal strains, including Candida albicans, Botrytis cinerea, Rhizoctonia solani, and Trichoderma viride, whereas it exhibited no activity against E. coli and Staphylococcus aureus. These results suggest that recombinant C-FKBP is an excellent candidate as a lead compound for the development of antifungal agents.

  13. Metatranscriptomics of Soil Eukaryotic Communities.

    PubMed

    Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2016-01-01

    Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

  14. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  15. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

    PubMed

    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

    2013-11-01

    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  16. Ranalexin. A novel antimicrobial peptide from bullfrog (Rana catesbeiana) skin, structurally related to the bacterial antibiotic, polymyxin.

    PubMed

    Clark, D P; Durell, S; Maloy, W L; Zasloff, M

    1994-04-08

    Antimicrobial peptides comprise a diverse class of molecules used in host defense by plants, insects, and animals. In this study we have isolated a novel antimicrobial peptide from the skin of the bullfrog, Rana catesbeiana. This 20 amino acid peptide, which we have termed Ranalexin, has the amino acid sequence: NH2-Phe-Leu-Gly-Gly-Leu-Ile-Lys-Ile-Val-Pro-Ala-Met-Ile-Cys-Ala-Val-Thr- Lys-Lys - Cys-COOH, and it contains a single intramolecular disulfide bond which forms a heptapeptide ring within the molecule. Structurally, Ranalexin resembles the bacterial antibiotic, polymyxin, which contains a similar heptapeptide ring. We have also cloned the cDNA for Ranalexin from a metamorphic R. catesbeiana tadpole cDNA library. Based on the cDNA sequence, it appears that Ranalexin is initially synthesized as a propeptide with a putative signal sequence and an acidic amino acid-rich region at its amino-terminal end. Interestingly, the putative signal sequence of the Ranalexin cDNA is strikingly similar to the signal sequence of opioid peptide precursors isolated from the skin of the South American frogs Phyllomedusa sauvagei and Phyllomedusa bicolor. Northern blot analysis and in situ hybridization experiments demonstrated that Ranalexin mRNA is first expressed in R. catesbeiana skin at metamorphosis and continues to be expressed into adulthood.

  17. Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

    PubMed

    Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

    1998-08-01

    An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

  18. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  19. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  20. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    PubMed

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  1. Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

    PubMed

    Livingston, B T; Shaw, R; Bailey, A; Wilt, F

    1991-12-01

    In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

  2. Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

    PubMed Central

    Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

    1996-01-01

    Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

  3. NcoI and TaqI RFLPs for human M creatine kinase (CKM)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perryman, M.B.; Hejtmancik, J.F.; Ashizawa, Tetsuo

    1988-09-12

    Probe pHMCKUT contains a 135 bp cDNA fragment inserted into pGEM 3. The probe corresponds to nucleotides 1,201 to 1,336 located in the 3{prime} untranslated region of human M creatine kinase. The probe is specific for human M creatine kinase and does not hybridize to human B cretine kinase sequences. NcoI identifies a two allele polymorphism of a band at either 2.5 kb or 3.6 kb. TaqI identifies a two allele polymorphism at either 3.8 kb or 4.5 kb. Human M creatine has been localized to chromosome 19q. Autosomal co-dominant inheritance was shown in six informative Caucasian families.

  4. Complete cDNA sequence of SAP-like pentraxin from Limulus polyphemus: implications for pentraxin evolution.

    PubMed

    Tharia, Hazel A; Shrive, Annette K; Mills, John D; Arme, Chris; Williams, Gwyn T; Greenhough, Trevor J

    2002-02-22

    The serum amyloid P component (SAP)-like pentraxin Limulus polyphemus SAP is a recently discovered, distinct pentraxin species, of known structure, which does not bind phosphocholine and whose N-terminal sequence has been shown to differ markedly from the highly conserved N terminus of all other known horseshoe crab pentraxins. The complete cDNA sequence of Limulus SAP, and the derived amino acid sequence, the first invertebrate SAP-like pentraxin sequence, have been determined. Two sequences were identified that differed only in the length of the 3' untranslated region. Limulus SAP is synthesised as a precursor protein of 234 amino acid residues, the first 17 residues encoding a signal peptide that is absent from the mature protein. Phylogenetic analysis clusters Limulus SAP pentraxin with the horseshoe crab C-reactive proteins (CRPs) rather than the mammalian SAPs, which are clustered with mammalian CRPs. The deduced amino acid sequence shares 22% identity with both human SAP and CRP, which are 51% identical, and 31-35% with horseshoe crab CRPs. These analyses indicate that gene duplication of CRP (or SAP), followed by sequence divergence and the evolution of CRP and/or SAP function, occurred independently along the chordate and arthropod evolutionary lines rather than in a common ancestor. They further indicate that the CRP/SAP gene duplication event in Limulus occurred before both the emergence of the Limulus CRP variants and the mammalian CRP/SAP gene duplication. Limulus SAP, which does not exhibit the CRP characteristic of calcium-dependent binding to phosphocholine, is established as a pentraxin species distinct from all other known horseshoe crab pentraxins that exist in many variant forms sharing a high level of sequence homology. Copyright 2002 Elsevier Science Ltd.

  5. Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

    PubMed Central

    Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

    1995-01-01

    Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

  6. Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

    PubMed Central

    Newsome, A L; McLean, J W; Lively, M O

    1992-01-01

    Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

  7. 1,4-Benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akileswaran, L.; Brock, B.J.; Cereghino, J.L.

    1999-02-01

    A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less

  8. Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

    PubMed Central

    Ridley, R G; Patel, H V; Gerber, G E; Morton, R C; Freeman, K B

    1986-01-01

    A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a targeting region must reside within the amino acid sequence of the mature protein. Images PMID:3012461

  9. Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

    PubMed

    Stevens, Mark; Viganó, Felicita

    2007-04-01

    The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

  10. Human endomembrane H+ pump strongly resembles the ATP-synthetase of Archaebacteria.

    PubMed Central

    Südhof, T C; Fried, V A; Stone, D K; Johnston, P A; Xie, X S

    1989-01-01

    Preparations of mammalian H+ pumps that acidify intracellular vesicles contain eight or nine polypeptides, ranging in size from 116 to 17 kDa. Biochemical analysis indicates that the 70- and 58-kDa polypeptides are subunits critical for ATP hydrolysis. The amino acid sequences of the major catalytic subunits (58 and 70 kDa) of the endomembrane H+ pump are unknown from animal cells. We report here the complete sequence of the 58-kDa subunit derived from a human kidney cDNA clone and partial sequences of the 70- and 58-kDa subunits purified from clathrin-coated vesicles of bovine brain. The amino acid sequences of both proteins strongly resemble the sequences of the corresponding subunits of the vacuolar H+ pumps of Archaebacteria, plants, and fungi. The archaebacterial enzyme is believed to use a H+ gradient to synthesize ATP. Thus, a common ancestral protein has given rise to a H+ pump that synthesizes ATP in one organism and hydrolyzes it in another and is highly conserved from prokaryotes to humans. The same pump appears to mediate the acidification of intracellular organelles, including coated vesicles, lysosomes, and secretory granules, as well as extracellular fluids such as urine. PMID:2527371

  11. Automated Antibody De Novo Sequencing and Its Utility in Biopharmaceutical Discovery

    NASA Astrophysics Data System (ADS)

    Sen, K. Ilker; Tang, Wilfred H.; Nayak, Shruti; Kil, Yong J.; Bern, Marshall; Ozoglu, Berk; Ueberheide, Beatrix; Davis, Darryl; Becker, Christopher

    2017-05-01

    Applications of antibody de novo sequencing in the biopharmaceutical industry range from the discovery of new antibody drug candidates to identifying reagents for research and determining the primary structure of innovator products for biosimilar development. When murine, phage display, or patient-derived monoclonal antibodies against a target of interest are available, but the cDNA or the original cell line is not, de novo protein sequencing is required to humanize and recombinantly express these antibodies, followed by in vitro and in vivo testing for functional validation. Availability of fully automated software tools for monoclonal antibody de novo sequencing enables efficient and routine analysis. Here, we present a novel method to automatically de novo sequence antibodies using mass spectrometry and the Supernovo software. The robustness of the algorithm is demonstrated through a series of stress tests.

  12. Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

    PubMed

    Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

    2009-01-01

    Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

  13. Sequence characterization of cDNA sequence of encoding of an antimicrobial Peptide with no disulfide bridge from the Iranian mesobuthus eupeus venomous glands.

    PubMed

    Farajzadeh-Sheikh, Ahmad; Jolodar, Abbas; Ghaemmaghami, Shamsedin

    2013-01-01

    Scorpion venom glands produce some antimicrobial peptides (AMP) that can rapidly kill a broad range of microbes and have additional activities that impact on the quality and effectiveness of innate responses and inflammation. In this study, we reported the identification of a cDNA sequence encoding cysteine-free antimicrobial peptides isolated from venomous glands of this species. Total RNA was extracted from the Iranian mesobuthus eupeus venom glands, and cDNA was synthesized by using the modified oligo (dT). The cDNA was used as the template for applying Semi-nested RT- PCR technique. PCR Products were used for direct nucleotide sequencing and the results were compared with Gen Bank database. A 213 BP cDNA fragment encoding the entire coding region of an antimicrobial toxin from the Iranian scorpion M. Eupeus venom glands were isolated. The full-length sequence of the coding region was 210 BP contained an open reading frame of 70 amino with a predicted molecular mass of 7970.48 Da and theoretical Pi of 9.10. The open reading frame consists of 210 BP encoding a precursor of 70 amino acid residues, including a signal peptide of 23 residues a propertied of 7 residues, and a mature peptide of 34 residues with no disulfide bridge. The peptide has detectable sequence identity to the Lesser Asian mesobuthus eupeus MeVAMP-2 (98%), MeVAMP-9 (60%) and several previously described AMPs from other scorpion venoms including mesobuthus martensii (94%) and buthus occitanus Israelis (82%). The secondary structure of the peptide mainly consisted of α-helical structure which was generally conserved by previously reported scorpion counterparts. The phylogenetic analysis showed that the Iranian MeAMP-like toxin was similar but not identical with that of venom antimicrobial peptides from lesser Asian scorpion mesobuthus eupeus.

  14. Genomic structure of the human D-site binding protein (DBP) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shutler, G.; Glassco, T.; Kang, Xiaolin

    1996-06-15

    The human gene for the D-Site Binding Protein (DBP) has been sequenced and characterized. This gene is a member of the b/ZIP family of transcription factors and is one of three genes forming the PAR sub-family. DBP has been implicated in the diurnal regulation of a variety of liver-specific genes. Examination of the genomic structure of DBP reveals that the gene is divided into four exons and is contained within a relatively compact region of approximately 6 kb. These exons appear to correspond to functional divisions the DBP protein. Exon 1 contains a long 5{prime} UTR, and conservation between themore » rat and the human genes of the presence of small open reading frames within this region suggests that is may play a role in translational control. Exon 2 contains a limited region of similarity to the other PAR domain genes, which may be part of a potential activation domain. Exon 3 contains the PAR domain and differs by only 1 of 71 amino acids between rat and human. Exon 4, containing both the basic and the leucine zipper domains, is likewise highly conserved. The overall degree of homology between the rat and the human cDNA sequences is 82% for the nucleic acid sequence and 92% for the protein sequence. comparison of the rat and human proximal promoters reveals extensive sequence conservation, with two previously characterized DNA binding sites being conserved at the functional and sequence levels. 31 refs., 4 figs.« less

  15. Cloning and expression of the rat homologue of the Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmitt, I.; Epplen, J.T.; Riess, O.

    1994-09-01

    Huntington`s disease (HD) is an autosomal dominant neurodegenerative disorder which is manifested usually in adult life. The age of onset is variable and leads to progressive symptoms including involuntary choreatic movements and various cognitive and psychiatric disturbances. Recently, a gene (IT15) was cloned containing a (CAG){sub n} repeat which is elongated and unstable in HD patients. IT15 is widely expressed in human tissues but unrelated to any known deduced protein sequence. To further investigate the HD gene, 15 rat cDNA libraries were screened. 24 clones have been identified covering the Huntingtin gene. Comparison of the Huntingtin gene between human andmore » rat revealed homologies between 80% and 87% at the DNA level and about 90% at the protein level. These analyses will help to define biologically important sequence regions, e.g., via evolutionary conservation. One clone contains the (CAG){sub n} repeat which consists of eight triplets compared to seven triplets in the mouse and a median of 17 in human. As in humans there are two transcripts arising from differential 3{prime}-polyadenylation. In the 3{prime}UTR a stretch of about 280 bp is exchanged for a 250 bp fragment with no homology in rodents and man. The cDNA clones are currently used to study Huntingtin gene expression during development in rodent tissues. RNA in situ hybridization of embryonic sections shows predominant signals in all neuronal tissues. In contrast to previously published data Huntingtin mRNA expression in testis is increased in spermatocytes vs. spermatogonia.« less

  16. FragIdent--automatic identification and characterisation of cDNA-fragments.

    PubMed

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  17. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  18. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1998-11-03

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

  19. The Role of eIF4E Activity in Breast Cancer

    DTIC Science & Technology

    2010-08-01

    ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem

  20. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  1. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    PubMed

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Cloning of cDNA encoding the nuclear form of chicken sterol response element binding protein-2 (SREBP-2), chromosomal localization, and tissue expression of chicken SREBP-1 and -2 genes.

    PubMed

    Assaf, S; Hazard, D; Pitel, F; Morisson, M; Alizadeh, M; Gondret, F; Diot, C; Vignal, A; Douaire, M; Lagarrigue, S

    2003-01-01

    Sterol regulatory element binding protein-1 and -2 (SREBP-1 and -2) are key transcription factors involved in the biosynthesis of cholesterol and fatty adds. The SREBP have mainly been studied in rodents in which lipogenesis is regulated in both liver and adipose tissue. There is, however, a paucity of information on birds, in which lipogenesis occurs essentially in the liver as in humans. As a prelude to the investigation of the role of SREBP in lipid metabolism regulation in chicken, we sequenced the cDNA, encoding the mature nuclear form of chicken SREBP-2 protein, mapped SREBP-1 and -2 genes and studied their tissue expressions. The predicted chicken SREBP-2 amino acid sequence shows a 77 to 79% identity with human, mouse, and hamster homologues, with a nearly perfect conservation in all the important functional motifs, basic, helix-loop-helix, and leucine zipper (bHLH-Zip) region as well as cleavage sites. As in the human genome, SREBP-1 and SREBP-2 chicken genes are located on two separate chromosomes, respectively microchromosome 14 and macrochromosome 1. Tissue expression data show that SREBP-1 and SREBP-2 are expressed in a wide variety of tissues in chicken. However, unlike SREBP-2, SREBP-1 is expressed preferentially in the liver and uropygial gland, suggesting an important role of SREBP-1 in the regulation of lipogenesis in avian species.

  3. Expression and permeation properties of the K(+) channel Kir7.1 in the retinal pigment epithelium.

    PubMed

    Shimura, M; Yuan, Y; Chang, J T; Zhang, S; Campochiaro, P A; Zack, D J; Hughes, B A

    2001-03-01

    Bovine Kir7.1 clones were obtained from a retinal pigment epithelium (RPE)-subtracted cDNA library. Human RPE cDNA library screening resulted in clones encoding full-length human Kir7.1. Northern blot analysis indicated that bovine Kir7.1 is highly expressed in the RPE. Human Kir7.1 channels were expressed in Xenopus oocytes and studied using the two-electrode voltage-clamp technique. The macroscopic Kir7.1 conductance exhibited mild inward rectification and an inverse dependence on extracellular K+ concentration ([K+]o). The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.013) > Na+ (0.003) approximately Li+ (0.001) and the sequence based on conductance ratios was Rb+ (9.5) > K+ (1.0) > Na+ (0.458) > Cs+ (0.331) > Li+ (0.139). Non-stationary noise analysis of Rb+ currents in cell-attached patches yielded a unitary conductance for Kir7.1 of approximately 2 pS. In whole-cell recordings from freshly isolated bovine RPE cells, the predominant current was a mild inwardly rectifying K+ current that exhibited an inverse dependence of conductance on [K+]o. The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.021) > Na+ (0.003) approximately Li+ (0.002) and the sequence based on conductance ratios was Rb+ (8.9) > K+ (1.0) > Na+ (0.59) > Cs+ (0.23) > Li+ (0.08). In cell-attached recordings with Rb+ in the pipette, inwardly rectifying currents were observed in nine of 12 patches of RPE apical membrane but in only one of 13 basolateral membrane patches. Non-stationary noise analysis of Rb+ currents in cell-attached apical membrane patches yielded a unitary conductance for RPE Kir of approximately 2 pS. On the basis of this molecular and electrophysiological evidence, we conclude that Kir7.1 channel subunits comprise the K+ conductance of the RPE apical membrane.

  4. Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

    PubMed

    Yi, S Y; Hwang, B K

    1998-10-31

    Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

  5. Characterization of embryo-specific genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sung, Z.R.

    1988-01-01

    The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less

  6. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika

    2010-01-27

    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rorsman, F.; Bywater, M.; Knott, T.J.

    The human platelet-derived growth factor (PDGF) A-chain locus was characterized by restriction endonuclease analysis, and the nucleotide sequence of its exons was determined. Seven exons were identified, spanning approximately 22 kilobase pairs of genomic DNA. Alternative exon usage, identified by cDNA cloning, occurs in a human glioblastoma cell line and may give rise to two types of A-chain precursors with different C termini. The exon-intron arrangement was similar to that of the PDGF B-chain/sis locus and seemed to divide the precursor proteins into functional domains. Southern blot analysis of genomic DNA showed that a single PDGF A-chain gene was presentmore » in the human genome.« less

  8. Characterization of transformation related genes in oral cancer cells.

    PubMed

    Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

    1998-04-16

    A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

  9. Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

    PubMed

    Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

    2013-02-01

    In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. The TGA codons are present in the open reading frame of selenoprotein P cDNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hill, K.E.; Lloyd, R.S.; Read, R.

    1991-03-11

    The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less

  11. cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

    PubMed

    Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

    1999-02-01

    A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

  12. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    PubMed

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  13. Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

    PubMed

    Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

    1996-10-31

    Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

  14. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1996-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  15. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1996-01-09

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  16. Localization of the human tripeptidyl peptidase II gene (TPP2) to 13q32-q33 by nonradioactive in situ hybridization and somatic cell hybrids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinsson, T.; Vujic, M.; Tomkinson, B.

    1993-08-01

    The authors have assigned the human tripeptidyl peptidase II (TPP2) gene to chromosome region 13q32-q33 using two different methods. First, a full-length TPP2 cDNA was used as a probe on Southern blots of DNA from a panel of human/rodent somatic cell hybrids. The TPP2 sequences were found to segregate with the human chromosome 13. Second, fluorescence in situ hybridization analysis was performed with the same probe. This analysis supported the chromosome 13 localization and further refined it to region 13q32-q33. 20 refs., 2 figs.

  17. R1, a novel repressor of the human monoamine oxidase A.

    PubMed

    Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

    2005-03-25

    Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

  18. Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

    PubMed Central

    Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

    1999-01-01

    Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

  19. Characterisation and In Silico Analysis of Interleukin-4 cDNA of Nilgai (Boselaphus tragocamelus) and Indian Buffalo (Bubalus bubalis)

    PubMed Central

    Saini, M.; Palai, T. K.; Das, D. K.; Hatle, K. M.; Gupta, P. K.

    2013-01-01

    Interleukin-4 (IL-4) produced from Th2 cells modulates both innate and adaptive immune responses. It is a common belief that wild animals possess better immunity against diseases than domestic and laboratory animals; however, the immune system of wild animals is not fully explored yet. Therefore, a comparative study was designed to explore the wildlife immunity through characterisation of IL-4 cDNA of nilgai, a wild ruminant, and Indian buffalo, a domestic ruminant. Total RNA was extracted from peripheral blood mononuclear cells of nilgai and Indian buffalo and reverse transcribed into cDNA. Respective cDNA was further cloned and sequenced. Sequences were analysed in silico and compared with their homologues available at GenBank. The deduced 135 amino acid protein of nilgai IL-4 is 95.6% similar to that of Indian buffalo. N-linked glycosylation sequence, leader sequence, Cysteine residues in the signal peptide region, and 3′ UTR of IL-4 were found to be conserved across species. Six nonsynonymous nucleotide substitutions were found in Indian buffalo compared to nilgai amino acid sequence. Tertiary structure of this protein in both species was modeled, and it was found that this protein falls under 4-helical cytokines superfamily and short chain cytokine family. Phylogenetic analysis revealed a single cluster of ruminants including both nilgai and Indian buffalo that was placed distinct from other nonruminant mammals. PMID:24348167

  20. Four subunits that are shared by the three classes of RNA polymerase are functionally interchangeable between Homo sapiens and Saccharomyces cerevisiae.

    PubMed Central

    Shpakovski, G V; Acker, J; Wintzerith, M; Lacroix, J F; Thuriaux, P; Vigneron, M

    1995-01-01

    Four cDNAs encoding human polypeptides hRPB7.0, hRPB7.6, hRPB17, and hRPB14.4 (referred to as Hs10 alpha, Hs10 beta, Hs8, and Hs6, respectively), homologous to the ABC10 alpha, ABC10 beta, ABC14.5, and ABC23 RNA polymerase subunits (referred to as Sc10 alpha, Sc10 beta, Sc8, and Sc6, respectively) of Saccharomyces cerevisiae, were cloned and characterized for their ability to complement defective yeast mutants. Hs10 alpha and the corresponding Sp10 alpha of Schizosaccharomyces pombe can complement an S. cerevisiae mutant (rpc10-delta::HIS3) defective in Sc10 alpha. The peptide sequences are highly conserved in their carboxy-terminal halves, with an invariant motif CX2CX12RCX2CGXR corresponding to a canonical zinc-binding domain. Hs10 beta, Sc10 beta, and the N subunit of archaeal RNA polymerase are homologous. An invariant CX2CGXnCCR motif presumably forms an atypical zinc-binding domain. Hs10 beta, but not the archaeal subunit, complemented an S. cerevisiae mutant (rpb10-delta 1::HIS3) lacking Sc10 beta. Hs8 complemented a yeast mutant (rpb8-delta 1::LYS2) defective in the corresponding Sc8 subunit, although with a strong thermosensitive phenotype. Interspecific complementation also occurred with Hs6 and with the corresponding Dm6 cDNA of Drosophila melanogaster. Hs6 cDNA and the Sp6 cDNA of S. pombe are dosage-dependent suppressors of rpo21-4, a mutation generating a slowly growing yeast defective in the largest subunit of RNA polymerase II. Finally, a doubly chimeric S. cerevisiae strain bearing the Sp6 cDNA and the human Hs10 beta cDNA was also viable. No interspecific complementation was observed for the human hRPB25 (Hs5) homolog of the yeast ABC27 (Sc5) subunit. PMID:7651387

  1. STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.

    PubMed Central

    Small, D; Levenstein, M; Kim, E; Carow, C; Amin, S; Rockwell, P; Witte, L; Burrow, C; Ratajczak, M Z; Gewirtz, A M

    1994-01-01

    We cloned the cDNA for stem cell tyrosine kinase 1 (STK-1), the human homolog of murine Flk-2/Flt-3, from a CD34+ hematopoietic stem cell-enriched library and investigated its expression in subsets of normal human bone marrow. The cDNA encodes a protein of 993 aa with 85% identity and 92% similarity to Flk-2/Flt-3. STK-1 is a member of the type III receptor tyrosine kinase family that includes KIT (steel factor receptor), FMS (colony-stimulating factor 1R), and platelet-derived growth factor receptor. STK-1 expression in human blood and marrow is restricted to CD34+ cells, a population greatly enriched for stem/progenitor cells. Anti-STK-1 antiserum recognizes polypeptides of 160 and 130 kDa in several STK-1-expressing cell lines and in 3T3 cells transfected with a STK-1 expression vector. Antisense oligonucleotides directed against STK-1 sequences inhibited hematopoietic colony formation, most strongly in long-term bone marrow cultures. These data suggest that STK-1 may function as a growth factor receptor on hematopoietic stem and/or progenitor cells. Images Fig. 2 Fig. 3 Fig. 4 PMID:7507245

  2. Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis.

    PubMed

    Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela

    2013-10-30

    Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.

  3. Chimeras of human complement C9 reveal the site recognized by complement regulatory protein CD59.

    PubMed

    Hüsler, T; Lockert, D H; Kaufman, K M; Sodetz, J M; Sims, P J

    1995-02-24

    CD59 antigen is a membrane glycoprotein that inhibits the activity of the C9 component of the C5b-9 membrane attack complex, thereby protecting human cells from lysis by human complement. The complement-inhibitory activity of CD59 is species-selective and is most effective toward C9 derived from human or other primate plasma. By contrast, rabbit C9, which can substitute for human C9 in the membrane attack complex, mediates unrestricted lysis of human cells. To identify the peptide segment of human C9 that is recognized by CD59, rabbit C9 cDNA clones were isolated, characterized, and used to construct hybrid cDNAs for expression of full-length human/rabbit C9 chimeras in COS-7 cells. All resulting chimeras were hemolytically active, when tested against chicken erythrocytes bearing C5b-8 complexes. Assays performed in the presence or absence of CD59 revealed that this inhibitor reduced the hemolytic activity of those chimeras containing human C9 sequence between residues 334-415, irrespective of whether the remainder of the protein contained human or rabbit sequence. By contrast, when this segment of C9 contained rabbit sequence, lytic activity was unaffected by CD59. These data establish that human C9 residues 334-415 contain the site recognized by CD59, and they suggest that sequence variability within this segment of C9 is responsible for the observed species-selective inhibitory activity of CD59.

  4. Production, gene structure and characterization of two orthologs of leptin and a leptin receptor in tilapia.

    PubMed

    Shpilman, Michal; Hollander-Cohen, Lian; Ventura, Tomer; Gertler, Arieh; Levavi-Sivan, Berta

    2014-10-01

    Full-length cDNA encoding two leptin sequences (tLepA and tLepB) and one leptin receptor sequence (tLepR) were identified in tilapia (Oreochromis niloticus). The full-length cDNA of tLepR was 3423bp, encoding a protein of 1140 amino acid (aa) which contained all functionally important domains conserved among vertebrate leptin receptors. The cDNAs of tLepA and tLepB were 486bp and 459bp in length, encoding proteins of 161 aa and 152 aa, respectively. Modeling the three-dimensional structures of tLepA and tLepB predicted strong conservation of tertiary structure with that of human leptin, comprised of four helixes. Using synteny, the tLeps were found near common genes, such as IMPDH1 and LLRC4. The cDNA for tLepA and tLepB was cloned and synthetic cDNA optimized for expression in Escherichia coli was prepared according to the cloned sequence. The tLepA- and tLepB-expressing plasmids were transformed into E. coli and expressed as recombinant proteins upon induction with nalidixic acid, found almost entirely in insoluble inclusion bodies (IBs). The proteins were solubilized, refolded and purified to homogeneity by anion-exchange chromatography. In the case of tLepA, the fraction eluted contained a mixture of monomers and dimers. The purified tLepA and tLepB monomers and tLepA dimer showed a single band of ∼15kDa on an SDS-polyacrylamide gel in the presence of reducing agent, whereas the tLepA dimer showed one band of ∼30kDa in the absence of reducing agent, indicating its formation by S-S bonds. The three tLeps were biologically active in promoting proliferation of BAF/3 cells stably transfected with the long form of human leptin receptor (hLepR), but their activity was four orders of magnitude lower than that of mammalian leptin. Furthermore, the three tLeps were biologically active in promoting STAT-LUC activation in COS7 cells transfected with the identified tLepR but not in cells transfected with hLepR. tLepA was more active than tLepB. Low or no activity likely resulted from low identity (9-22%) to mammalian leptins. In an in vivo experiment in which tilapia were fed ad libitum or fasted, there was no significant difference in the expressions of tLepA, tLepB or tLepR in the brain between the two groups examined both by real-time PCR and RNA next generation sequencing. In conclusion, in the present report we show novel, previously unknown sequences of tilapia leptin receptor and two leptins and prepare two biologically active recombinant leptin proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

    PubMed Central

    Kilimann, M W; DeGennaro, L J

    1985-01-01

    To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

  6. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  7. Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

    PubMed

    Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

    1999-12-01

    An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

  8. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    PubMed

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  9. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. cDNA encoding a polypeptide including a hev ein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  11. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  12. CDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  13. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  14. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    PubMed

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  15. Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

    PubMed

    Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

    1991-08-01

    1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

  16. Sperm flagella protein components: Human meichroacidin constructed by the membrane occupation and recognition nexus motif

    PubMed Central

    MATSUOKA, YASUHIRO; NISHIMURA, HIROMI; NUMAZAWA, KAHORI; TSUCHIDA, JUNJI; MIYAGAWA, YASUSHI; TSUJIMURA, AKIRA; MATSUMIYA, KIYOMI; OKUYAMA, AKIHIKO; NISHIMUNE, YOSHITAKE

    2005-01-01

    Background and Aims:   In a previous study, the authors of the present study cloned mouse meichroacidin (MCA), which is expressed in stages of spermatogenesis from pachytene spermatocytes through round spermatid germ cells. MCA protein contains the membrane occupation and recognition nexus (MORN) motif and localizes to a male meiotic metaphase chromosome. Recently, a MCA homolog of carp (Cyprinus carpio), MORN motif‐containing sperm‐specific axonemal protein (MSAP), was reportedly identified and localized in sperm flagella. Present knowledge of human spermiogenesis requires the identification of proteins in human sperm. The present study identified the human orthologue of MCA. Methods:   Colony hybridization using a human testis plasmid cDNA library was carried out to clone human MCA (h‐MCA) cDNA. Northern blot, Western blot, and immunohistochemical analyses were carried out. Results:   h‐MCA was found to be specifically expressed in the testes. The h‐MCA amino acid sequence shared 79.8% identity with mouse MCA and contained MORN motifs. h‐MCA localized in the sperm flagellum and basal body, as does MSAP in carp. Conclusion:   Expression and localization analyses showed that h‐MCA is a component of the sperm flagellum and basal body and might play an important role in the development of the sperm flagellum in humans. (Reprod Med Biol 2005; 4: 213–219) PMID:29699225

  17. Isolation, expression, and chromosomal localization of the human mitochondrial capsule selenoprotein gene (MCSP)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aho, Hanne; Schwemmer, M.; Tessmann, D.

    1996-03-01

    The mitochondrial capsule selenoprotein (MCS) (HGMW-approved symbol MCSP) is one of three proteins that are important for the maintenance and stabilization of the crescent structure of the sperm mitochondria. We describe here the isolation of a cDNA, the exon-intron organization, the expression, and the chromosomal localization of the human MCS gene. Nucleotide sequence analysis of the human and mouse MCS cDNAs reveals that the 5{prime}- and 3{prime}-untranslated sequences are more conserved (71%) than the coding sequences (59%). The open reading frame encodes a 116-amino-acid protein and lacks the UGA codons, which have been reported to encode the selenocysteines in themore » N-terminal of the deduced mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein (39%). The most striking homology lies in the dicysteine motifs. Northern and Southern zooblot analyses reveal that the MCS gene in human, baboon, and bovine is more conserved than its counterparts in mouse and rat. The single intron in the human MCS gene is approximately 6 kb and interrupts the 5{prime}-untranslated region at a position equivalent to that in the mouse and rat genes. Northern blot and in situ hybridization experiments demonstrate that the expression of the human MCS gene is restricted to haploid spermatids. The human gene was assigned to q21 of chromosome 1. 30 refs., 9 figs.« less

  18. The Role of elF4E Activity in Breast Cancer

    DTIC Science & Technology

    2011-08-01

    protein; ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...Reactions were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less...that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem-loop structure6. This

  19. A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells.

    PubMed

    Mitsui, Shinichi; Okui, Akira; Kominami, Katsuya; Konishi, Eiichi; Uemura, Hidetoshi; Yamaguchi, Nozomi

    2005-10-01

    We have isolated a cDNA that encodes a novel serine protease, prosemin, from human brain. The cDNA of human prosemin is 1306 bp, encoding 317 amino acids. It showed significant homology with the sequence of a chromosome 16 cosmid clone (accession no. NT_037887.4). The prosemin gene contains six exons and five introns. The amino acid sequence of prosemin shows significant homology to prostasin, gamma-tryptase, and testisin (43%, 41%, and 38% identity, respectively), the genes of which are also located on chromosome 16. Northern hybridization showed that prosemin is expressed predominantly in the pancreas and weakly in the prostate and cerebellum. However, western blot and RT-PCR analyses showed that prosemin is expressed and secreted from various kinds of cancer cells, such as glioma, pancreas, prostate, and ovarian cell lines. Prosemin is secreted in the cystic fluid of clinical ovarian cancers. Furthermore, immunohistochemistry showed prosemin protein localized in the apical parts of ovarian carcinomas. Recombinant prosemin was expressed in COS cells and was purified by immunoaffinity chromatography. Recombinant prosemin preferentially cleaved benzyloxycarbonyl (Z)-His-Glu-Lys-methylcoumaryl amidide (MCA) and t-butyloxycarbonyl (Boc)-Gln-Ala-Arg-MCA. Our results suggest that prosemin is a novel serine protease of the chromosome 16 cluster that is highly expressed in the pancreas. The usefulness of this serine protease as a candidate tumor marker should be further examined.

  20. HOXBES2: a novel epididymal HOXB2 homeoprotein and its domain-specific association with spermatozoa.

    PubMed

    Prabagaran, E; Bandivdekar, A H; Dighe, V; Raghavan, V P

    2007-02-01

    The sperm from the testis acquires complete fertilizing ability and forward progressive motility following its transit through the epididymis. Acquisition of these characteristics results from the modification of the sperm proteome following interactions with epididymal secretions. In our attempts to identify epididymis-specific sperm plasma membrane proteins, a partial 2.83-kb clone was identified by immunoscreening a monkey epididymal cDNA library with an agglutinating monoclonal antibody raised against washed human spermatozoa. The sequence of the 2.83-kb clone exhibited homology to the region between 1 and 1097 bp of the homeobox gene, Hoxb2. This sequence was found to be species conserved, as revealed by RT-PCR analysis. To obtain a full-length clone of the sequence, 5' RACE-PCR (rapid amplification of cDNA ends PCR) was carried out using rat epididymal RNA as the template. It resulted in a full-length 1.657-kb cDNA encoding a 32.9-kDa putative protein. The protein designated HOXBES2 exhibited homology to the conserved 61-amino acid homeodomain region of the HOXB2 homeoprotein. However, characteristic differences were noted in its amino and carboxyl termini compared with HOXB2. A putative 30-kDa protein was detected in the tissue extracts from adult rat epididymis and caudal spermatozoa, and a 37-kDa protein was detected in the rat embryo when probed with a polyclonal antibody against HOXB2 protein. Multiple tissue Western blot and immunohistochemical analysis further indicated its expression in the cytoplasm of the principal and basal epithelial cells, with maximal expression in the distal epididymal segments. Northern blot analysis detected a single approximately 2.5-kb transcript from the adult epididymis. Indirect immunofluorescence localized the protein to the acrosome, midpiece, and equatorial segments of rat caudal and ejaculated human and monkey spermatozoa, respectively. In conclusion, we have identified and characterized a novel epididymal homeoprotein different from HOXB2 protein and hereafter referred to as HOXBES2, (HOXB2 homeodomain containing epididymis-specific sperm protein) with a probable role in fertilization.

  1. Identification of an NADH-Cytochrome b5 Reductase Gene from an Arachidonic Acid-Producing Fungus, Mortierella alpina 1S-4, by Sequencing of the Encoding cDNA and Heterologous Expression in a Fungus, Aspergillus oryzae

    PubMed Central

    Sakuradani, Eiji; Kobayashi, Michihiko; Shimizu, Sakayu

    1999-01-01

    Based on the sequence information for bovine and yeast NADH-cytochrome b5 reductases (CbRs), a DNA fragment was cloned from Mortierella alpina 1S-4 after PCR amplification. This fragment was used as a probe to isolate a cDNA clone with an open reading frame encoding 298 amino acid residues which show marked sequence similarity to CbRs from other sources, such as yeast (Saccharomyces cerevisiae), bovine, human, and rat CbRs. These results suggested that this cDNA is a CbR gene. The results of a structural comparison of the flavin-binding β-barrel domains of CbRs from various species and that of the M. alpina enzyme suggested that the overall barrel-folding patterns are similar to each other and that a specific arrangement of three highly conserved amino acid residues (i.e., arginine, tyrosine, and serine) plays a role in binding with the flavin (another prosthetic group) through hydrogen bonds. The corresponding genomic gene, which was also cloned from M. alpina 1S-4 by means of a hybridization method with the above probe, had four introns of different sizes. These introns had GT at the 5′ end and AG at the 3′ end, according to a general GT-AG rule. The expression of the full-length cDNA in a filamentous fungus, Aspergillus oryzae, resulted in an increase (4.7 times) in ferricyanide reduction activity involving the use of NADH as an electron donor in the microsomes. The M. alpina CbR was purified by solubilization of microsomes with cholic acid sodium salt, followed by DEAE-Sephacel, Mono-Q HR 5/5, and AMP-Sepharose 4B affinity column chromatographies; there was a 645-fold increase in the NADH-ferricyanide reductase specific activity. The purified CbR preferred NADH over NADPH as an electron donor. This is the first report of an analysis of this enzyme in filamentous fungi. PMID:10473389

  2. Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

    PubMed Central

    Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

    2010-01-01

    PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040

  3. Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

    PubMed

    Sugimoto, H; Hayashi, H; Yamashita, S

    1996-03-29

    A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

  4. Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

    PubMed

    Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

    2003-01-01

    A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

  5. Isolation and expression of the human gametocyte-specific factor 1 gene (GTSF1) in fetal ovary, oocytes, and preimplantation embryos.

    PubMed

    Huntriss, John; Lu, Jianping; Hemmings, Karen; Bayne, Rosemary; Anderson, Richard; Rutherford, Anthony; Balen, Adam; Elder, Kay; Picton, Helen M

    2017-01-01

    Gametocyte-specific factor 1 has been shown in other species to be required for the silencing of retrotransposons via the Piwi-interacting RNA (piRNA) pathway. In this study, we aimed to isolate and assess expression of transcripts of the gametocyte-specific factor 1 (GTSF1) gene in the human female germline and in preimplantation embryos. Complementary DNA (cDNA) libraries from human fetal ovaries and testes, human oocytes and preimplantation embryos and ovarian follicles isolated from an adult ovarian cortex biopsy were used to as templates for PCR, cloning and sequencing, and real time PCR experiments of GTSF1 expression. GTSF1 cDNA clones that covered the entire coding region were isolated from human oocytes and preimplantation embryos. GTSF1 mRNA expression was detected in archived cDNAs from staged human ovarian follicles, germinal vesicle (GV) stage oocytes, metaphase II oocytes, and morula and blastocyst stage preimplantation embryos. Within the adult female germline, expression was highest in GV oocytes. GTSF1 mRNA expression was also assessed in human fetal ovary and was observed to increase during gestation, from 8 to 21 weeks, during which time oogonia enter meiosis and primordial follicle formation first occurs. In human fetal testis, GTSF1 expression also increased from 8 to 19 weeks. To our knowledge, this report is the first to describe the expression of the human GTSF1 gene in human gametes and preimplantation embryos.

  6. Molecular cloning and expression of a chloride channel-associated protein pICln in human young red blood cells: association with actin.

    PubMed

    Schwartz, R S; Rybicki, A C; Nagel, R L

    1997-10-15

    We report the cloning and sequencing from human reticulocytes of cDNA coding for the Cl- channel-associated protein, pICln. Human reticulocyte pICln (HRpICln) cDNA encodes a protein (predicted molecular mass 26293Da) identical with human non-pigmented ciliary epithelial cell pICln. By using full-length HRpICln cDNA (approx. 1.2 kb) to probe human lymphocyte metaphase-chromosome spreads, the location of the human ICln gene was mapped to 11q13 by fluorescence in situ hybridization analysis. Polyclonal antibodies to recombinant HRpICln detected bands at approx. 43 kDa and approx. 37 kDa in both normal (AA) and sickle (SS) red blood cell (RBC) ghost membranes. In SS ghosts, and in ghosts from a patient with autoimmune haemolytic anaemia with 9.8% reticulocytes, the amount of HRpICln was increased compared with AA ghosts, suggesting that the expression or membrane assembly of HRpICln is cell age-dependent. Laser scanning confocal fluorescent microscopy immunolocalized HRpICln largely to the RBC membrane. The increased staining intensity of HRpICln in a reticulocyte-enriched AA RBC density-separated fraction is consistent with a dependence of HRpICln membrane content on cell age. HRpICln and beta-actin form stable complexes in vivo, demonstrated with the yeast two-hybrid system. Low-ionic-strength extraction of ghost membranes, which results in the extraction of the spectrin-actin cytoskeleton, also results in the extraction of HRpICln, consistent with the possibility for the association of these proteins in RBCs in vivo. The results presented here establish the presence of the Cl- channel-associated protein, pICln, in human RBCs, and raises the possibility that this protein has a role in RBC Cl- transport and volume regulation in young RBCs. Moreover the association of RBC pICln with actin offers a model in which to test interactions between RBC ion channels and the cytoskeleton.

  7. Light regulation of the abundance of mRNA encoding a nucleolin-like protein localized in the nucleoli of pea nuclei.

    PubMed Central

    Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J

    1997-01-01

    A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096

  8. Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

    PubMed

    Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

    2007-06-01

    As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

  9. Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

    PubMed Central

    Kurtz, David T.; Feigelson, Philip

    1977-01-01

    A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, J.; Liu, C.; Koopman, W.J.

    Ligation of the Fas cell-surface molecule induces apoptosis. Defective Fas-mediated apoptosis has been associated with spontaneous autoimmunity in mice. Using human Fas/Apo-1 cDNA as a probe, the authors have molecularly cloned and characterized the human Fas chromosomal gene. The gene consists of nine exons and spans more than 26 kilobases of DNA. The lengths of introns vary from > 14 kilobases at the 5` end of the gene to 152 base pairs upstream of the exon encoding the transmembrane domain. The domain structure of the human Fas is encoded by an exon or a set of exons. Primer extension analysismore » revealed three major transcription initiation sites. The promoter region lacked canonical {open_quotes}TATA{close_quotes} and {open_quotes}CAAT{close_quotes} boxes but was a {open_quotes}GC-rich{close_quotes} sequence, and contained consensus sequences for AP-1, GF-1, NY-Y, CP-2, EBP20, and c-myb. These data provide the first characterization of the human Fas gene and insight into its regulatory region. 54 refs., 3 figs., 1 tab.« less

  11. Identifying active foraminifera in the Sea of Japan using metatranscriptomic approach

    NASA Astrophysics Data System (ADS)

    Lejzerowicz, Franck; Voltsky, Ivan; Pawlowski, Jan

    2013-02-01

    Metagenetics represents an efficient and rapid tool to describe environmental diversity patterns of microbial eukaryotes based on ribosomal DNA sequences. However, the results of metagenetic studies are often biased by the presence of extracellular DNA molecules that are persistent in the environment, especially in deep-sea sediment. As an alternative, short-lived RNA molecules constitute a good proxy for the detection of active species. Here, we used a metatranscriptomic approach based on RNA-derived (cDNA) sequences to study the diversity of the deep-sea benthic foraminifera and compared it to the metagenetic approach. We analyzed 257 ribosomal DNA and cDNA sequences obtained from seven sediments samples collected in the Sea of Japan at depths ranging from 486 to 3665 m. The DNA and RNA-based approaches gave a similar view of the taxonomic composition of foraminiferal assemblage, but differed in some important points. First, the cDNA dataset was dominated by sequences of rotaliids and robertiniids, suggesting that these calcareous species, some of which have been observed in Rose Bengal stained samples, are the most active component of foraminiferal community. Second, the richness of monothalamous (single-chambered) foraminifera was particularly high in DNA extracts from the deepest samples, confirming that this group of foraminifera is abundant but not necessarily very active in the deep-sea sediments. Finally, the high divergence of undetermined sequences in cDNA dataset indicate the limits of our database and lack of knowledge about some active but possibly rare species. Our study demonstrates the capability of the metatranscriptomic approach to detect active foraminiferal species and prompt its use in future high-throughput sequencing-based environmental surveys.

  12. Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.

    PubMed

    Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L

    1986-09-01

    The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.

  13. The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi

    1993-01-01

    Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less

  14. Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin

    PubMed Central

    Loit, Evelin; Melnyk, Charles W; MacFarlane, Amanda J; Scott, Fraser W; Altosaar, Illimar

    2009-01-01

    Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D). Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s) encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health. PMID:19615078

  15. Gambling on a shortcut to genome sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roberts, L.

    1991-06-21

    Almost from the start of the Human Genome Project, a debate has been raging over whether to sequence the entire human genome, all 3 billion bases, or just the genes - a mere 2% or 3% of the genome, and by far the most interesting part. In England, Sydney Brenner convinced the Medical Research Council (MRC) to start with the expressed genes, or complementary DNAs. But the US stance has been that the entire sequence is essential if we are to understand the blueprint of man. Craig Venter of the National Institute of Neurological Disorders and Stroke says that focusingmore » on the expressed genes may be even more useful than expected. His strategy involves randomly selecting clones from cDNA libraries which theoretically contain all the genes that are switched on at a particular time in a particular tissue. Then the researchers sequence just a short stretch of each clone, about 400 to 500 bases, to create can expressed sequence tag or EST. The sequences of these ESTs are then stored in a database. Using that information, other researchers can then recreate that EST by using polymerase chain reaction techniques.« less

  16. Alteration of gene expression in human hepatocellular carcinoma with integrated hepatitis B virus DNA.

    PubMed

    Tamori, Akihiro; Yamanishi, Yoshihiro; Kawashima, Shuichi; Kanehisa, Minoru; Enomoto, Masaru; Tanaka, Hiromu; Kubo, Shoji; Shiomi, Susumu; Nishiguchi, Shuhei

    2005-08-15

    Integration of hepatitis B virus (HBV) DNA into the human genome is one of the most important steps in HBV-related carcinogenesis. This study attempted to find the link between HBV DNA, the adjoining cellular sequence, and altered gene expression in hepatocellular carcinoma (HCC) with integrated HBV DNA. We examined 15 cases of HCC infected with HBV by cassette ligation-mediated PCR. The human DNA adjacent to the integrated HBV DNA was sequenced. Protein coding sequences were searched for in the human sequence. In five cases with HBV DNA integration, from which good quality RNA was extracted, gene expression was examined by cDNA microarray analysis. The human DNA sequence successive to integrated HBV DNA was determined in the 15 HCCs. Eight protein-coding regions were involved: ras-responsive element binding protein 1, calmodulin 1, mixed lineage leukemia 2 (MLL2), FLJ333655, LOC220272, LOC255345, LOC220220, and LOC168991. The MLL2 gene was expressed in three cases with HBV DNA integrated into exon 3 of MLL2 and in one case with HBV DNA integrated into intron 3 of MLL2. Gene expression analysis suggested that two HCCs with HBV integrated into MLL2 had similar patterns of gene expression compared with three HCCs with HBV integrated into other loci of human chromosomes. HBV DNA was integrated at random sites of human DNA, and the MLL2 gene was one of the targets for integration. Our results suggest that HBV DNA might modulate human genes near integration sites, followed by integration site-specific expression of such genes during hepatocarcinogenesis.

  17. Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Claffey, K.P.; Herrera, V.L.; Brecher, P.

    1987-12-01

    A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

  18. Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

    NASA Astrophysics Data System (ADS)

    Sun, S. M.; Slightom, J. L.; Hall, T. C.

    1981-01-01

    A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

  19. Isolation and characterization of full-length putative alcohol dehydrogenase genes from polygonum minus

    NASA Astrophysics Data System (ADS)

    Hamid, Nur Athirah Abd; Ismail, Ismanizan

    2013-11-01

    Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.

  20. Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

    PubMed

    Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

    1994-12-01

    Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

  1. Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilkins, T.A.

    1993-06-01

    This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

  2. cDNA cloning and immunological characterization of a newly identified enolase allergen from Penicillium citrinum and Aspergillus fumigatus.

    PubMed

    Lai, Hsiu-Yu; Tam, Ming F; Tang, Ren-Bin; Chou, Hong; Chang, Ching-Yun; Tsai, Jaw-Ji; Shen, Horng-Der

    2002-03-01

    Penicillium citrinum and Aspergillus fumigatus are prevalent indoor airborne fungal species that have been implicated in human respiratory allergic disorders. It is important to understand the allergenic profile of these fungal species. The purpose of the present study is to characterize a newly identified enolase allergen from P. citrinum and A. fumigatus. Fungal proteins were separated by two-dimensional (2D) gel electrophoresis and blotted onto polyvinylidene difluoride membranes. Protein spots that reacted with IgE antibodies in serum samples from asthmatic patients were identified and the N-terminal amino acid sequences were determined by Edman degradation. The peptide sequences obtained were utilized in cloning the cDNA of the allergen genes by reverse transcriptase-polymerase chain reaction and the 5'- and 3'-rapid amplification cDNA end reactions. Our results from 2D immunoblotting identified a 47-kD IgE-reactive component in the extracts of P. citrinum and A. fumigatus. The N-terminal amino acid sequences of the 47-kD proteins are homologous to those of fungal enolases. The corresponding enolase cDNA from P. citrinum contains 1,552 bp and encodes a protein of 438 residues. In A. fumigatus, the isolated enolase cDNA has 1,649 bp and contains a 438-amino acid open reading frame. The deduced amino acid sequences of these two enolases have 94% identity. These enolases from P. citrinum and A. fumigatus were expressed in Escherichia coli as a His-tagged protein and designated as rPen c 22 and rAsp f 22, respectively. Sera from 7 (30%) of the 23 Penicillium-sensitized asthmatic patients showed IgE binding to the 47-kD P. citrinum component (Pen c 22) and rPen c 22. In addition, six of seven Pen c 22-positive serum samples have IgE immunoblot reactivity to the 47-kD A. fumigatus component (Asp f 22) and rAsp f 22. A polyclonal rabbit antiserum generated against the N-terminal peptide of Pen c 22 can react with Pen c 22, rPen c 22, Asp f 22 and rAsp f 22. In addition, the presence of IgE cross-reactivity between rPen c 22 and rAsp f 22 and between enolases from A. fumigatus and Alternaria alternata was also detected by immunoblot inhibition. These results demonstrated that a novel enolase allergen from P. citrinum (Pen c 22) and A. fumigatus (Asp f 22) was identified. In addition, IgE cross-reactivity between enolase allergens from A. fumigatus and P. citrinum and between enolases from A. fumigatus and A. alternata was also detected. Results obtained provide more information on fungal enolase allergens. Copyright 2002 S. Karger AG, Basel

  3. Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

    PubMed Central

    Matroudi, S.; Zamani, M.R.; Motallebi, M.

    2008-01-01

    In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

  4. Identification of a testis-expressed creatine transporter gene at 16p11.2 and confirmation of the X-linked locus to Xq28

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iyer, G.S.; Funanage, V.L.; Proujansky, R.

    1996-05-15

    Creatine and creatine phosphate act as a buffer system for the regeneration of ATP in tissues with fluctuating energy demands. Following reports of the cloning of a creatine transporter in rat, rabbit, and human, we cloned and sequenced a creatine transporter from a human intestinal cDNA library. PCR amplification of genomic DNAs from somatic cell hybrid panels localized two creatine transporter (CT) genes: CT1 to Xq26-q28 and CT2 to 16p11.2. Refinement of CT1 to Xq28 was confirmed by FISH. Identification of CT2 sequences in YACs and cosmid contigs that had been ordered on human chromosome 16 enabled its assignment tomore » the proximal end of 16p11.2. Sequencing of the CT2 gene identified sequence differences between CT1 and CT2 transcripts that were utilized to determine that CT2 is expressed in testis only. CT2 is the most proximally identified gene on chromosome 16p to date. The existence of an autosomal, testis-specific form of the human creatine transporter gene suggests that creatine transporter activity is critical for normal function of spermatazoa following meiosis. 17 refs., 2 figs., 2 tabs.« less

  5. Poly A- transcripts expressed in HeLa cells.

    PubMed

    Wu, Qingfa; Kim, Yeong C; Lu, Jian; Xuan, Zhenyu; Chen, Jun; Zheng, Yonglan; Zhou, Tom; Zhang, Michael Q; Wu, Chung-I; Wang, San Ming

    2008-07-30

    Transcripts expressed in eukaryotes are classified as poly A+ transcripts or poly A- transcripts based on the presence or absence of the 3' poly A tail. Most transcripts identified so far are poly A+ transcripts, whereas the poly A- transcripts remain largely unknown. We developed the TRD (Total RNA Detection) system for transcript identification. The system detects the transcripts through the following steps: 1) depleting the abundant ribosomal and small-size transcripts; 2) synthesizing cDNA without regard to the status of the 3' poly A tail; 3) applying the 454 sequencing technology for massive 3' EST collection from the cDNA; and 4) determining the genome origins of the detected transcripts by mapping the sequences to the human genome reference sequences. Using this system, we characterized the cytoplasmic transcripts from HeLa cells. Of the 13,467 distinct 3' ESTs analyzed, 24% are poly A-, 36% are poly A+, and 40% are bimorphic with poly A+ features but without the 3' poly A tail. Most of the poly A- 3' ESTs do not match known transcript sequences; they have a similar distribution pattern in the genome as the poly A+ and bimorphic 3' ESTs, and their mapped intergenic regions are evolutionarily conserved. Experiments confirmed the authenticity of the detected poly A- transcripts. Our study provides the first large-scale sequence evidence for the presence of poly A- transcripts in eukaryotes. The abundance of the poly A- transcripts highlights the need for comprehensive identification of these transcripts for decoding the transcriptome, annotating the genome and studying biological relevance of the poly A- transcripts.

  6. A novel recombinantly produced banana lectin isoform is a valuable tool for glycoproteomics and a potent modulator of the proliferation response in CD3+, CD4+, and CD8+ populations of human PBMCs.

    PubMed

    Gavrovic-Jankulovic, Marija; Poulsen, Knud; Brckalo, Tamara; Bobic, Sonja; Lindner, Buko; Petersen, Arnd

    2008-01-01

    Lectins as carbohydrate-binding proteins have been employed in various biological assays for the detection and characterization of glycan structures on glycoproteins, including clinical biomarkers in disease states. A mannose-specific banana lectin (BanLec) is unique in its specificity for internal alpha1,3 linkages as well as beta1,3 linkages at the reducing termini. The immunomodulatory potential of natural BanLec was recognized by a strong immunoglobulin G4 antibody response and T cell mitogen activity in humans. To explore its applicability in glycoproteomics and its modulatory potential, the gene of banana lectin was cloned, sequenced and a recombinant protein was produced in Escherichia coli. The obtained cDNA revealed a novel banana lectin isoform, with an open reading frame of 426 nucleotides, encoding a cytoplasmatic protein of 141 amino acids. The molecular mass of rBanLec determined by ESI FT-MS and N-terminal sequencing confirmed the cDNA at the protein level. The specificity of rBanLec for detection glycan structures was the same as for natural BanLec as examined with five protein extracts rich in glycoprotein content, as well as with horseradish peroxidase glycoprotein. Besides, the immunomodulatory potential of rBanLec and nBanLec were comparable as assessed by an inhibition assay and a human T cell proliferation assay where they induced a strong proliferation response in CD3+, CD4+, and CD8+ populations of human PBMCs. This recombinant BanLec is a useful reagent for glycoproteomics and lectin microarrays, with a potential for modulation of the immune response.

  7. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  8. Genetic Regulation in the Aiptasia pallida Symbiosis - Performance Report, Year 1.

    DTIC Science & Technology

    1997-02-01

    and symbiotic zooxanthellae is one developed for serial analysis of gene expression (SAGE). We initially tested the SAGE protocol with cDNA generated...technically difficult. We are now focusing on constructing representative cDNA libraries from cultured and symbiotic zooxanthellae and will sequence

  9. cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

    PubMed

    Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

    2003-12-19

    SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

  10. The structure of the human interferon alpha/beta receptor gene.

    PubMed

    Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

    1992-02-05

    Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

  11. Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

    PubMed

    Su, S; Bird, R C

    1995-09-15

    A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed by a single amino acid from the sequence of hG1.16 and the published rat L37 sequence. Southern-blot analysis revealed that hG1.16 exists in multiple copies in human, rat and mouse genomes. These G1.16 clones encode unique human, rat and bovine members of the ribosomal protein L37 gene family, which are constitutively expressed even during transitions from quiescence to active cell proliferation or terminal differentiation, in all tissues and all vertebrates investigated.

  12. Stachyose synthesis in seeds of adzuki bean (Vigna angularis): molecular cloning and functional expression of stachyose synthase.

    PubMed

    Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A

    1999-12-01

    Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.

  13. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    PubMed

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  14. Characterization of the cDNA coding for rat brain cysteine sulfinate decarboxylase: brain and liver enzymes are identical proteins encoded by two distinct mRNAs.

    PubMed

    Tappaz, M; Bitoun, M; Reymond, I; Sergeant, A

    1999-09-01

    Cysteine sulfinate decarboxylase (CSD) is considered as the rate-limiting enzyme in the biosynthesis of taurine, a possible osmoregulator in brain. Through cloning and sequencing of RT-PCR and RACE-PCR products of rat brain mRNAs, a 2,396-bp cDNA sequence was obtained encoding a protein of 493 amino acids (calculated molecular mass, 55.2 kDa). The corresponding fusion protein showed a substrate specificity similar to that of the endogenous enzyme. The sequence of the encoded protein is identical to that encoded by liver CSD cDNA. Among other characterized amino acid decarboxylases, CSD shows the highest homology (54%) with either isoform of glutamic acid decarboxylase (GAD65 and GAD67). A single mRNA band, approximately 2.5 kb, was detected by northern blot in RNA extracts of brain, liver, and kidney. However, brain and liver CSD cDNA sequences differed in the 5' untranslated region. This indicates two forms of CSD mRNA. Analysis of PCR-amplified products of genomic DNA suggests that the brain form results from the use of a 3' alternative internal splicing site within an exon specifically found in liver CSD mRNA. Through selective RT-PCR the brain form was detected in brain only, whereas the liver form was found in liver and kidney. These results indicate a tissue-specific regulation of CSD genomic expression.

  15. Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

    PubMed

    Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

    2014-06-01

    Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Rat PPAR delta contains a CGG triplet repeat and is prominently expressed in the thalamic nuclei.

    PubMed

    Xing, G; Zhang, L; Zhang, L; Heynen, T; Yoshikawa, T; Smith, M; Weiss, S; Detera-Wadleigh, S

    1995-12-26

    We have isolated a new rat sequence containing motifs of a nuclear hormone receptor from a brain cDNA library. The deduced amino acid sequence encoded by the cDNA clone showed a strong homology to the human NUCI and the mouse peroxisome proliferator activated receptor delta (PPAR delta). We therefore refer to this new clone as rat PPAR delta (rPPAR delta). The new feature of rPPAR delta is a 14 CGG triplet repeat on the 5' untranslated region, not previously reported in either NUCI or mPPAR delta. We found that rPPAR delta was expressed as a 3.5-kb transcript which showed a wide distribution in adult rat tissues. Abundant expression was detected in brain, heart, skeletal muscle, kidney and lung. Weaker expression was noted in the liver, spleen and testis. To determine the specific brain localization of rPPAR delta we performed in situ hybridization analysis. Prominent expression was observed in the thalamus, particularly in the posterior part of the ventral medial nucleus, a site responsive to pain and cold stress. These results raise the possibility that PPAR delta might play a role in modulating response to thermal and pain sensations.

  17. Molecular cloning, expression, functional characterization, chromosomal localization, and gene structure of junctate, a novel integral calcium binding protein of sarco(endo)plasmic reticulum membrane.

    PubMed

    Treves, S; Feriotto, G; Moccagatta, L; Gambari, R; Zorzato, F

    2000-12-15

    Screening a cDNA library from human skeletal muscle and cardiac muscle with a cDNA probe derived from junctin led to the isolation of two groups of cDNA clones. The first group displayed a deduced amino acid sequence that is 84% identical to that of dog heart junctin, whereas the second group had a single open reading frame that encoded a polypeptide with a predicted mass of 33 kDa, whose first 78 NH(2)-terminal residues are identical to junctin whereas its COOH terminus domain is identical to aspartyl beta-hydroxylase, a member of the alpha-ketoglutarate-dependent dioxygenase family. We named the latter amino acid sequence junctate. Northern blot analysis indicates that junctate is expressed in a variety of human tissues including heart, pancreas, brain, lung, liver, kidney, and skeletal muscle. Fluorescence in situ hybridization analysis revealed that the genetic loci of junctin and junctate map to the same cytogenetic band on human chromosome 8. Analysis of intron/exon boundaries of the genomic BAC clones demonstrate that junctin, junctate, and aspartyl beta-hydroxylase result from alternative splicing of the same gene. The predicted lumenal portion of junctate is enriched in negatively charged residues and is able to bind calcium. Scatchard analysis of equilibrium (45)Ca(2+) binding in the presence of a physiological concentration of KCl demonstrate that junctate binds 21.0 mol of Ca(2+)/mol protein with a k(D) of 217 +/- 20 microm (n = 5). Tagging recombinant junctate with green fluorescent protein and expressing the chimeric polypeptide in COS-7-transfected cells indicates that junctate is located in endoplasmic reticulum membranes and that its presence increases the peak amplitude and transient calcium released by activation of surface membrane receptors coupled to InsP(3) receptor activation. Our study shows that alternative splicing of the same gene generates the following functionally distinct proteins: an enzyme (aspartyl beta-hydroxylase), a structural protein of SR (junctin), and a membrane-bound calcium binding protein (junctate).

  18. Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2008-01-01

    Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

  19. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  20. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    PubMed

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  1. Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

    PubMed

    Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

    2004-03-01

    The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

  2. Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

    PubMed

    Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

    2008-05-01

    SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

  3. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    PubMed Central

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

  4. Quantitative Characterization of the T Cell Receptor Repertoire of Naïve and Memory Subsets Using an Integrated Experimental and Computational Pipeline Which Is Robust, Economical, and Versatile

    PubMed Central

    Oakes, Theres; Heather, James M.; Best, Katharine; Byng-Maddick, Rachel; Husovsky, Connor; Ismail, Mazlina; Joshi, Kroopa; Maxwell, Gavin; Noursadeghi, Mahdad; Riddell, Natalie; Ruehl, Tabea; Turner, Carolin T.; Uddin, Imran; Chain, Benny

    2017-01-01

    The T cell receptor (TCR) repertoire can provide a personalized biomarker for infectious and non-infectious diseases. We describe a protocol for amplifying, sequencing, and analyzing TCRs which is robust, sensitive, and versatile. The key experimental step is ligation of a single-stranded oligonucleotide to the 3′ end of the TCR cDNA. This allows amplification of all possible rearrangements using a single set of primers per locus. It also introduces a unique molecular identifier to label each starting cDNA molecule. This molecular identifier is used to correct for sequence errors and for effects of differential PCR amplification efficiency, thus producing more accurate measures of the true TCR frequency within the sample. This integrated experimental and computational pipeline is applied to the analysis of human memory and naive subpopulations, and results in consistent measures of diversity and inequality. After error correction, the distribution of TCR sequence abundance in all subpopulations followed a power law over a wide range of values. The power law exponent differed between naïve and memory populations, but was consistent between individuals. The integrated experimental and analysis pipeline we describe is appropriate to studies of T cell responses in a broad range of physiological and pathological contexts. PMID:29075258

  5. Clinical characteristics of severe congenital neutropenia caused by novel ELANE gene mutations.

    PubMed

    Shu, Zhou; Li, Xiao-Hui; Bai, Xiao-Ming; Zhang, Zhi-Yong; Jiang, Li-ping; Tang, Xue-Mei; Zhao, Xiao-dong

    2015-02-01

    Mutations within the ELANE gene, which encodes human neutrophil elastase, are the most common genetic causes of severe congenital neutropenia (SCN). No cases of SCN have been previously described from a Chinese population. Herein, we describe the clinical, hematologic and molecular characteristics of 7 Chinese SCN cases with novel ELANE mutations. Seven Chinese pediatric patients (4 males and 3 females) with suspected SCN were enrolled in this study. Clinical data, peripheral blood, bone marrow and immune function were evaluated for SCN. ELANE genomic DNA and cDNA sequences from patients and potential carriers were analyzed using polymerase chain reaction (PCR) and direct sequencing. All the7 patients experienced recurrent infection (soft tissue, lung, oral cavity) during a period of 120 days. Noninfectious conditions such as anemia and osteopenia were found in most patients, and absolute peripheral neutrophil counts varied. DNA and cDNA sequencing demonstrated that the patients harbored a range of heterozygous ELANE gene mutations, including substitution, deletion, insertion and frame shift alterations. All the mutations had not been reported previously; however, no mutation carriers were identified among the parents or siblings, even in a family with 2 affected offspring. SCN cases were identified for the first time in China, and all patients carried novel ELANE mutations. Granulocyte-colony stimulating factor (G-CSF) was an effective treatment for most of the SCN patients and prevented life-threatening bacterial infections.

  6. Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

    PubMed Central

    Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

    1983-01-01

    The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

  7. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  8. Genes expressed during the development and ripening of watermelon fruit.

    PubMed

    Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S

    2006-11-01

    A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.

  9. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  10. Characterization of mouse and human GTP cyclohydrolase I genes. Mutations in patients with GTP cyclohydrolase I deficiency.

    PubMed

    Ichinose, H; Ohye, T; Matsuda, Y; Hori, T; Blau, N; Burlina, A; Rouse, B; Matalon, R; Fujita, K; Nagatsu, T

    1995-04-28

    GTP cyclohydrolase I is the first and rate-limiting enzyme for the biosynthesis of tetrahydrobiopterin in mammals. Previously, we reported three species of human GTP cyclohydrolase I cDNA in a human liver cDNA library (Togari, A., Ichinose, H., Matsumoto, S., Fujita, K., and Nagatsu, T. (1992) Biochem. Biophys. Res. Commun. 187, 359-365). Furthermore, very recently, we found that the GTP cyclohydrolase I gene is causative for hereditary progressive dystonia with marked diurnal fluctuation, also known as DOPA-responsive dystonia (Ichinose, H., Ohye, T., Takahashi, E., Seki, N., Hori, T., Segawa, M., Nomura, Y., Endo, K., Tanaka, H., Tsuji, S., Fujita, K., and Nagatsu, T. (1994) Nature Genetics 8, 236-242). To clarify the mechanisms that regulate transcription of the GTP cyclohydrolase I gene and to generate multiple species of mRNA, we isolated genomic DNA clones for the human and mouse GTP cyclohydrolase I genes. Structural analysis of the isolated clones revealed that the GTP cyclohydrolase I gene is encoded by a single copy gene and is composed of six exons spanning approximately 30 kilobases. We sequenced all exon/intron boundaries of the human and mouse genes. Structural analysis also demonstrated that the heterogeneity of GTP cyclohydrolase I mRNA is caused by an alternative usage of the splicing acceptor site at the sixth exon. The transcription start site of the mouse GTP cyclohydrolase I gene and the 5'-flanking sequences of the mouse and human genes were determined. We performed regional mapping of the mouse gene by fluorescence in situ hybridization, and the mouse GTP cyclohydrolase I gene was assigned to region C2-3 of mouse chromosome 14. We identified missense mutations in patients with GTP cyclohydrolase I deficiency and expressed mutated enzymes in Escherichia coli to confirm alterations in the enzyme activity.

  11. Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).

    PubMed

    Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y

    1996-02-01

    Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.

  12. Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.

    PubMed

    Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei

    2018-01-01

    Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.

  13. Molecular cloning of the mouse gene coding for {alpha}{sub 2}-macroglobulin and targeting of the gene in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Umans, L.; Serneels, L.; Hilliker, C.

    1994-08-01

    The authors have cloned the mouse gene coding for {alpha}{sub 2}-macroglobulin in overlapping {lambda} clones and have analyzed its structure. The gene contains 36 exons, coding for the 4.8-kb cDNA that we cloned previously. Including putative control elements in the 5{prime} flanking region, the gene covers about 45 kb. A region of 3.8 kb, stretching from 835 bases upstream of the cDNA start site to exon 4, including all intervening sequences, was sequenced completely. The analysis demonstrated that the putative promoter region of the mouse A2M gene differed considerably from the known promoter sequences of the human A2M gene andmore » of the rat acute-phas A2M gene. Comparison of the exon-intron structure of all known genes of the A2M family confirmed that the rat acute phase A2M gene is more closely related to the human gene than to the mouse A2M gene. To generate mice with the A2M gene inactivated, an insertion type of construct containing 7.5 kb of genomic DNA of the mouse strain 129/J, encompassing exons 16 to 19, was synthesized. A hygromycin marker gene was embedded in intron 17. After electroporation, 198 hygromycin-resistant ES cell lines were isolated and analyzed by Southern blotting. Five ES cell lines were obtained with one allele of the mouse A2M gene targeted by this insertion construct, demonstrating that the position and the characteristics of the vector served the intended goal.« less

  14. Sequence and structural implications of a bovine corneal keratan sulfate proteoglycan core protein. Protein 37B represents bovine lumican and proteins 37A and 25 are unique

    NASA Technical Reports Server (NTRS)

    Funderburgh, J. L.; Funderburgh, M. L.; Brown, S. J.; Vergnes, J. P.; Hassell, J. R.; Mann, M. M.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Amino acid sequence from tryptic peptides of three different bovine corneal keratan sulfate proteoglycan (KSPG) core proteins (designated 37A, 37B, and 25) showed similarities to the sequence of a chicken KSPG core protein lumican. Bovine lumican cDNA was isolated from a bovine corneal expression library by screening with chicken lumican cDNA. The bovine cDNA codes for a 342-amino acid protein, M(r) 38,712, containing amino acid sequences identified in the 37B KSPG core protein. The bovine lumican is 68% identical to chicken lumican, with an 83% identity excluding the N-terminal 40 amino acids. Location of 6 cysteine and 4 consensus N-glycosylation sites in the bovine sequence were identical to those in chicken lumican. Bovine lumican had about 50% identity to bovine fibromodulin and 20% identity to bovine decorin and biglycan. About two-thirds of the lumican protein consists of a series of 10 amino acid leucine-rich repeats that occur in regions of calculated high beta-hydrophobic moment, suggesting that the leucine-rich repeats contribute to beta-sheet formation in these proteins. Sequences obtained from 37A and 25 core proteins were absent in bovine lumican, thus predicting a unique primary structure and separate mRNA for each of the three bovine KSPG core proteins.

  15. Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq

    PubMed Central

    Stork, Cheryl; Zheng, Sika

    2017-01-01

    UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263

  16. Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

    PubMed

    Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

    2015-10-26

    Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

  17. Overexpression of Nrp/b (nuclear restrict protein in brain) suppresses the malignant phenotype in the C6/ST1 glioma cell line.

    PubMed

    Degaki, Theri Leica; Demasi, Marcos Angelo Almeida; Sogayar, Mari Cleide

    2009-11-01

    Upon searching for glucocorticoid-regulated cDNA sequences associated with the transformed to normal phenotypic reversion of C6/ST1 rat glioma cells, we identified Nrp/b (nuclear restrict protein in brain) as a novel rat gene. Here we report on the identification and functional characterization of the complete sequence encoding the rat NRP/B protein. The cloned cDNA presented a 1767 nucleotides open-reading frame encoding a 589 amino acids residues sequence containing a BTB/POZ (broad complex Tramtrack bric-a-brac/Pox virus and zinc finger) domain in its N-terminal region and kelch motifs in its C-terminal region. Sequence analysis indicates that the rat Nrp/b displays a high level of identity with the equivalent gene orthologs from other organisms. Among rat tissues, Nrp/b expression is more pronounced in brain tissue. We show that overexpression of the Nrp/b cDNA in C6/ST1 cells suppresses anchorage independence in vitro and tumorigenicity in vivo, altering their malignant nature towards a more benign phenotype. Therefore, Nrp/b may be postulated as a novel tumor suppressor gene, with possible relevance for glioblastoma therapy.

  18. Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

    PubMed

    Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

    2016-08-30

    The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

  19. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    PubMed

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  20. Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

    PubMed

    Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

    2014-09-01

    Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Cloning of apg-2 encoding a novel member of heat shock protein 110 family.

    PubMed

    Kaneko, Y; Kimura, T; Kishishita, M; Noda, Y; Fujita, J

    1997-04-11

    Chinese hamster heat shock protein 110-encoding gene (hsp110), mouse apg-1 and human hsp70RY are structurally related genes, with the first two encoding about 110-kDa HSPs [Yoon et al. (1995) J. Biol. Chem. 270, 15725-15733; Kaneko et al. (1997) J. Biol. Chem., in press; Fathallah et al. (1993) J. Immunol. 151, 810-813]. Using apg-1 cDNA as a probe, we isolated a novel cDNA, apg-2 from a mouse testis cDNA library, which was highly homologous to human hsp70RY. However, the predicted amino acid (aa) sequence of APG-2 was longer (841 aa) than that of HSP70RY (701 aa) and comparable to those of HSP110 and APG-1. Northern blot analysis revealed that the expression of apg-2 transcripts was ubiquitous in various mouse tissues, and most abundant in the testis and ovary. While induction of hsp70 transcripts was observed in mouse TAMA26 Sertoli cells and NIH/3T3 fibroblasts on temperature shift from 37 degrees C to 42 degrees C (traditional heat shock) or from 32 degrees C to 39 degrees C, apg-2 transcripts were not induced under either condition. These results suggest that apg-2 is an isoform of mouse homolog of hsp70RY, but that it belongs to the hsp110 family instead of hsp70 family, and that it plays a role under non-stress conditions.

  2. Construction and Evaluation of Normalized cDNA Libraries Enriched with Full-Length Sequences for Rapid Discovery of New Genes from Sisal (Agave sisalana Perr.) Different Developmental Stages

    PubMed Central

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-01-01

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944

  3. Single-Cell RNA Sequencing of Glioblastoma Cells.

    PubMed

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

    2018-01-01

    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  4. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  5. Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

    PubMed Central

    Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

    1998-01-01

    Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

  6. Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

    PubMed

    Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

    2003-09-01

    The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

  7. Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

    PubMed

    Kanai, T H; Ueda, S; Nakamura, T

    2000-01-31

    Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

  8. CYP3A4 allelic variants with amino acid substitutions in exons 7 and 12: evidence for an allelic variant with altered catalytic activity.

    PubMed

    Sata, F; Sapone, A; Elizondo, G; Stocker, P; Miller, V P; Zheng, W; Raunio, H; Crespi, C L; Gonzalez, F J

    2000-01-01

    To determine the existence of mutant and variant CgammaP3A4 alleles in three racial groups and to assess functions of the variant alleles by complementary deoxyribonucleic acid (cDNA) expression. A bacterial artificial chromosome that contains the complete CgammaP3A4 gene was isolated and the exons and surrounding introns were directly sequenced to develop primers to polymerase chain reaction (PCR) amplify and sequence the gene from lymphocyte DNA. DNA samples from Chinese, black, and white subjects were screened. Mutating the affected amino acid in the wild-type cDNA and expressing the variant enzyme with use of the baculovirus system was used to functionally evaluate the variant allele having a missense mutation. To investigate the existence of mutant and variant CgammaP3A4 alleles in humans, all 13 exons and the 5'-flanking region of the human CgammaP3A4 gene in three racial groups were sequenced and four alleles were identified. An A-->G point mutation in the 5'-flanking region of the human CgammaP3A4 gene, designated CgammaP3A4*1B, was found in the three different racial groups. The frequency of this allele in a white population was 4.2%, whereas it was 66.7% in black subjects. The CgammaP3A4*1B allele was not found in Chinese subjects. A second variant allele, designated CgammaP3A4*2, having a Ser222Pro change, was found at a frequency of 2.7% in the white population and was absent in the black subjects and Chinese subjects analyzed. Baculovirus-directed cDNA expression revealed that the CYP3A4*2 P450 had a lower intrinsic clearance for the CYP3A4 substrate nifedipine compared with the wild-type enzyme but was not significantly different from the wild-type enzyme for testosterone 6beta-hydroxylation. Another rare allele, designated CgammaP3A4*3, was found in a single Chinese subject who had a Met445Thr change in the conserved heme-binding region of the P450. These are the first examples of potential function polymorphisms resulting from missense mutations in the CgammaP3A4 gene. The CgammaP3A4*2 allele was found to encode a P450 with substrate-dependent altered kinetics compared with the wild-type P450.

  9. Bmcystatin, a cysteine proteinase inhibitor characterized from the tick Boophilus microplus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lima, Cassia A.; Sasaki, Sergio D.; Tanaka, Aparecida S.

    2006-08-18

    The bovine tick Rhipicephalus (Boophilus) microplus is a blood-sucking animal, which is responsible for Babesia spp and Anaplasma marginale transmission for cattle. From a B. microplus fat body cDNA library, 465 selected clones were sequenced randomly and resulted in 60 Contigs. An open reading frame (ORF) contains 98 amino acids named Bmcystatin, due to 70% amino acid identity to a classical type 1 cystatin from Ixodes scapularis tick (GenBank Accession No. DQ066227). The Bmcystatin amino acid sequence analysis showed two cysteine residues, theoretical pI of 5.92 and M{sub r} of 11kDa. Bmcystatin gene was cloned in pET 26b vector andmore » the protein expressed using bacteria Escherichia coli BL21 SI. Recombinant Bmcystatin (rBmcystatin) purified by affinity chromatography on Ni-NTA-agarose column and ionic exchange chromatography on HiTrap Q column presented molecular mass of 11kDa, by SDS-PAGE and the N-terminal amino acid sequenced revealed unprocessed N-terminal containing part of pelB signal sequence. Purified rBmcystatin showed to be a C1 cysteine peptidase inhibitor with K{sub i} value of 0.1 and 0.6nM for human cathepsin L and VTDCE (vitellin degrading cysteine endopeptidase), respectively. The rBmcystatin expression analyzed by semi-quantitative RT-PCR confirmed the amplification of a specific DNA sequence (294bp) in the fat body and ovary cDNA preparation. On the other hand, a protein band was detected in the fat body, ovary, and the salivary gland extracts using anti-Bmcystatin antibody by Western blot. The present results suggest a possible role of Bmcystatin in the ovary, even though the gene was cloned from the fat body, which could be another site of this protein synthesis.« less

  10. Bmcystatin, a cysteine proteinase inhibitor characterized from the tick Boophilus microplus.

    PubMed

    Lima, Cassia A; Sasaki, Sergio D; Tanaka, Aparecida S

    2006-08-18

    The bovine tick Rhipicephalus (Boophilus) microplus is a blood-sucking animal, which is responsible for Babesia spp and Anaplasma marginale transmission for cattle. From a B. microplus fat body cDNA library, 465 selected clones were sequenced randomly and resulted in 60 Contigs. An open reading frame (ORF) contains 98 amino acids named Bmcystatin, due to 70% amino acid identity to a classical type 1 cystatin from Ixodes scapularis tick (GenBank Accession No. ). The Bmcystatin amino acid sequence analysis showed two cysteine residues, theoretical pI of 5.92 and M(r) of 11 kDa. Bmcystatin gene was cloned in pET 26b vector and the protein expressed using bacteria Escherichia coli BL21 SI. Recombinant Bmcystatin (rBmcystatin) purified by affinity chromatography on Ni-NTA-agarose column and ionic exchange chromatography on HiTrap Q column presented molecular mass of 11 kDa, by SDS-PAGE and the N-terminal amino acid sequenced revealed unprocessed N-terminal containing part of pelB signal sequence. Purified rBmcystatin showed to be a C1 cysteine peptidase inhibitor with K(i) value of 0.1 and 0.6 nM for human cathepsin L and VTDCE (vitellin degrading cysteine endopeptidase), respectively. The rBmcystatin expression analyzed by semi-quantitative RT-PCR confirmed the amplification of a specific DNA sequence (294 bp) in the fat body and ovary cDNA preparation. On the other hand, a protein band was detected in the fat body, ovary, and the salivary gland extracts using anti-Bmcystatin antibody by Western blot. The present results suggest a possible role of Bmcystatin in the ovary, even though the gene was cloned from the fat body, which could be another site of this protein synthesis.

  11. Poly A- Transcripts Expressed in HeLa Cells

    PubMed Central

    Lu, Jian; Xuan, Zhenyu; Chen, Jun; Zheng, Yonglan; Zhou, Tom; Zhang, Michael Q.; Wu, Chung-I; Wang, San Ming

    2008-01-01

    Background Transcripts expressed in eukaryotes are classified as poly A+ transcripts or poly A- transcripts based on the presence or absence of the 3′ poly A tail. Most transcripts identified so far are poly A+ transcripts, whereas the poly A- transcripts remain largely unknown. Methodology/Principal Findings We developed the TRD (Total RNA Detection) system for transcript identification. The system detects the transcripts through the following steps: 1) depleting the abundant ribosomal and small-size transcripts; 2) synthesizing cDNA without regard to the status of the 3′ poly A tail; 3) applying the 454 sequencing technology for massive 3′ EST collection from the cDNA; and 4) determining the genome origins of the detected transcripts by mapping the sequences to the human genome reference sequences. Using this system, we characterized the cytoplasmic transcripts from HeLa cells. Of the 13,467 distinct 3′ ESTs analyzed, 24% are poly A-, 36% are poly A+, and 40% are bimorphic with poly A+ features but without the 3′ poly A tail. Most of the poly A- 3′ ESTs do not match known transcript sequences; they have a similar distribution pattern in the genome as the poly A+ and bimorphic 3′ ESTs, and their mapped intergenic regions are evolutionarily conserved. Experiments confirmed the authenticity of the detected poly A- transcripts. Conclusion/Significance Our study provides the first large-scale sequence evidence for the presence of poly A- transcripts in eukaryotes. The abundance of the poly A- transcripts highlights the need for comprehensive identification of these transcripts for decoding the transcriptome, annotating the genome and studying biological relevance of the poly A- transcripts. PMID:18665230

  12. Computational Identification and Functional Predictions of Long Noncoding RNA in Zea mays

    PubMed Central

    Boerner, Susan; McGinnis, Karen M.

    2012-01-01

    Background Computational analysis of cDNA sequences from multiple organisms suggests that a large portion of transcribed DNA does not code for a functional protein. In mammals, noncoding transcription is abundant, and often results in functional RNA molecules that do not appear to encode proteins. Many long noncoding RNAs (lncRNAs) appear to have epigenetic regulatory function in humans, including HOTAIR and XIST. While epigenetic gene regulation is clearly an essential mechanism in plants, relatively little is known about the presence or function of lncRNAs in plants. Methodology/Principal Findings To explore the connection between lncRNA and epigenetic regulation of gene expression in plants, a computational pipeline using the programming language Python has been developed and applied to maize full length cDNA sequences to identify, classify, and localize potential lncRNAs. The pipeline was used in parallel with an SVM tool for identifying ncRNAs to identify the maximal number of ncRNAs in the dataset. Although the available library of sequences was small and potentially biased toward protein coding transcripts, 15% of the sequences were predicted to be noncoding. Approximately 60% of these sequences appear to act as precursors for small RNA molecules and may function to regulate gene expression via a small RNA dependent mechanism. ncRNAs were predicted to originate from both genic and intergenic loci. Of the lncRNAs that originated from genic loci, ∼20% were antisense to the host gene loci. Conclusions/Significance Consistent with similar studies in other organisms, noncoding transcription appears to be widespread in the maize genome. Computational predictions indicate that maize lncRNAs may function to regulate expression of other genes through multiple RNA mediated mechanisms. PMID:22916204

  13. Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

    PubMed Central

    Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo

    2012-01-01

    Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit peptide sequence) of the full length cDNA from M. alba. PMID:23284650

  14. Display of a maize cDNA library on baculovirus infected insect cells.

    PubMed

    Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A

    2008-08-12

    Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  15. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

    PubMed Central

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-01-01

    Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

  16. Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

    NASA Astrophysics Data System (ADS)

    Qi, Fei; Guo, Huarong; Wang, Jian

    2008-02-01

    Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

  17. A pituitary gene encodes a protein that produces differentiation of breast and prostate cancer cells.

    PubMed

    Platica, Micsunica; Ivan, Elena; Holland, James F; Ionescu, Alin; Chen, Sheryl; Mandeli, John; Unger, Pamela D; Platica, Ovidiu

    2004-02-10

    A cDNA clone of 1.1 kb encoding a 108-aa polypeptide was isolated from a human pituitary cDNA library by expression cloning. This protein was named tumor differentiation factor (TDF). The recombinant TDF protein and a 20-aa peptide, P1, selected from the ORF of the gene, induced morphological and biochemical changes consistent with differentiation of human breast and prostate cancer cells. Fibroblast, kidney, hepatoma, and leukemic lymphocytic cell lines were unaffected. Breast and prostate cancer cells aggregated in spheroid-like structures within 24 h of exposure to TDF. This effect was abrogated by a specific affinity-purified rabbit polyclonal anti-P1 Ab. E-cadherin expression was increased in a dose-dependent manner by TDF. Treatment of MCF7 cells with TDF led to production of a lactalbumin-related protein. Peptide P1 significantly decreased the growth of androgen-independent DU145 prostate cancer in severe combined immunodeficient mice. The presence of TDF protein in human sera was detected by the anti-P1 Ab, suggesting a role of TDF in endocrine metabolism. The fact that all activities of TDF can be mimicked by a peptide derived from the encoding TDF sequence opens the possibility of therapeutic applications.

  18. Cloning and characterization of mouse extracellular-signal-regulated protein kinase 3 as a unique gene product of 100 kDa.

    PubMed

    Turgeon, B; Saba-El-Leil, M K; Meloche, S

    2000-02-15

    MAP (mitogen-activated protein) kinases are a family of serine/threonine kinases that have a pivotal role in signal transduction. Here we report the cloning and characterization of a mouse homologue of extracellular-signal-regulated protein kinase (ERK)3. The mouse Erk3 cDNA encodes a predicted protein of 720 residues, which displays 94% identity with human ERK3. Transcription and translation of this cDNA in vitro generates a 100 kDa protein similar to the human gene product ERK3. Immunoblot analysis with an antibody raised against a unique sequence of ERK3 also recognizes a 100 kDa protein in mouse tissues. A single transcript of Erk3 was detected in every adult mouse tissue examined, with the highest expression being found in the brain. Interestingly, expression of Erk3 mRNA is acutely regulated during mouse development, with a peak of expression observed at embryonic day 11. The mouse Erk3 gene was mapped to a single locus on central mouse chromosome 9, adjacent to the dilute mutation locus and in a region syntenic to human chromosome 15q21. Finally, we provide several lines of evidence to support the existence of a unique Erk3 gene product of 100 kDa in mammalian cells.

  19. Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

    PubMed

    Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

    1993-03-31

    Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

  20. Identification and characterization of a DnaJ gene from red alga Pyropia yezoensis (Bangiales, Rhodophyta)

    NASA Astrophysics Data System (ADS)

    Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin

    2016-03-01

    Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.

  1. Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

    PubMed Central

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

    2007-01-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  2. Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Z.; Olsen, J.C.; Silverman, L.M.

    Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less

  3. Construction and characterization of a normalized cDNA library of Nannochloropsis oculata (Eustigmatophyceae)

    NASA Astrophysics Data System (ADS)

    Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong

    2010-07-01

    We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.

  4. Characterization and expression of the calpastatin gene in Cyprinus carpio.

    PubMed

    Chen, W X; Ma, Y

    2015-07-03

    Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).

  5. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    PubMed Central

    2011-01-01

    Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934

  6. High-level expression of human stem cell factor fused with erythropoietin mimetic peptide in Escherichia coli.

    PubMed

    Su, Lin; Chen, Song-Sen; Yang, Ke-Gong; Liu, Chang-Zheng; Zhang, Yan-Li; Liang, Zhi-Quan

    2006-06-01

    Stem cell factor (SCF) and erythropoietin are essential for normal erythropoiesis and induce proliferation and differentiation synergistically for erythroid progenitor cells. Here, we report our work on construction of SCF/erythropoietin mimetic peptide (EMP) fusion protein gene, in which human SCF cDNA (1-165aa) and EMP sequence (20aa) were connected using a short (GGGGS) or long (GGGGSGGGGGS) linker sequence. The SCF/EMP gene was cloned into the pBV220 vector and expressed in the Escherichia coli DH5alpha strain. The expression level of the fusion protein was about 30% of total cell protein. The resulting inclusion bodies were solubilized with 8 M urea, followed by dilution refolding. The renatured protein was subsequently purified by Q-Sepharose FF column. The final product was >95% pure by SDS-PAGE and the yield of fusion protein was about 40 mg/L of culture. UT-7 cell proliferation and human cord blood cell colony-forming assays showed that the fusion proteins exhibited more potent activity than recombinant human SCF, suggesting a new strategy to enhance biological activities of growth factors.

  7. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    PubMed

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  8. Characterization and distribution of a maize cDNA encoding a peptide similar to the catalytic region of second messenger dependent protein kinases

    NASA Technical Reports Server (NTRS)

    Biermann, B.; Johnson, E. M.; Feldman, L. J.

    1990-01-01

    Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.

  9. Primary and secondary structural analyses of glutathione S-transferase pi from human placenta.

    PubMed

    Ahmad, H; Wilson, D E; Fritz, R R; Singh, S V; Medh, R D; Nagle, G T; Awasthi, Y C; Kurosky, A

    1990-05-01

    The primary structure of glutathione S-transferase (GST) pi from a single human placenta was determined. The structure was established by chemical characterization of tryptic and cyanogen bromide peptides as well as automated sequence analysis of the intact enzyme. The structural analysis indicated that the protein is comprised of 209 amino acid residues and gave no evidence of post-translational modifications. The amino acid sequence differed from that of the deduced amino acid sequence determined by nucleotide sequence analysis of a cDNA clone (Kano, T., Sakai, M., and Muramatsu, M., 1987, Cancer Res. 47, 5626-5630) at position 104 which contained both valine and isoleucine whereas the deduced sequence from nucleotide sequence analysis identified only isoleucine at this position. These results demonstrated that in the one individual placenta studied at least two GST pi genes are coexpressed, probably as a result of allelomorphism. Computer assisted consensus sequence evaluation identified a hydrophobic region in GST pi (residues 155-181) that was predicted to be either a buried transmembrane helical region or a signal sequence region. The significance of this hydrophobic region was interpreted in relation to the mode of action of the enzyme especially in regard to the potential involvement of a histidine in the active site mechanism. A comparison of the chemical similarity of five known human GST complete enzyme structures, one of pi, one of mu, two of alpha, and one microsomal, gave evidence that all five enzymes have evolved by a divergent evolutionary process after gene duplication, with the microsomal enzyme representing the most divergent form.

  10. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    PubMed

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  11. cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds.

    PubMed

    Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin

    2005-01-01

    SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.

  12. Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.

    PubMed

    Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil

    2003-06-30

    Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.

  13. Casein expression in cytotoxic T lymphocytes.

    PubMed Central

    Grusby, M J; Mitchell, S C; Nabavi, N; Glimcher, L H

    1990-01-01

    A cDNA that expresses a mRNA restricted to cytotoxic T lymphocytes (CTL) and mammary tissue has been isolated and characterized. The deduced amino acid sequence from this cDNA shows extensive homology with the previously reported amino acid sequence for rat alpha-casein. Indeed, the presence of a six-residue-repeated motif that is specific for rodent alpha-caseins strongly supports the identification of this cDNA as mouse alpha-casein. Northern (RNA) blot analysis of many hematopoietic cell types revealed that this gene is restricted to CTL, being expressed in four of six CTL lines examined. Furthermore, CTL that express this gene were also found to express other members of the casein gene family, such as beta- and kappa-casein. These results suggest that caseins may be important in CTL function, and their potential role in CTL-mediated lysis is discussed. Images PMID:2395885

  14. Expression, purification, and evaluation for anticancer activity of ribosomal protein L31 gene (RPL31) from the giant panda (Ailuropoda melanoleuca).

    PubMed

    Su, Xiu-Lan; Hou, Yi-Ling; Yan, Xiang-Hui; Ding, Xiang; Hou, Wan-Ru; Sun, Bing; Zhang, Si-Nan

    2012-09-01

    Ribosomal protein L31 gene is a component of the 60S large ribosomal subunit encoded by RPL31 gene, while ribosomal protein L31 (RPL31) is an important constituent of peptidyltransferase center. In our research, the cDNA and the genomic sequence of RPL31 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology respectively, following sequencing and analyzing preliminarily. We constructed a recombinant expression vector contained RPL31 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product was purified to obtain recombinant protein of RPL31 from the giant panda. Recombinant protein of RPL31 obtained from the experiment acted on human laryngeal carcinoma Hep-2 and human hepatoma HepG-2 cells for study of its anti-cancer activity by MTT [3-(4, 5-dimehyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] method. Then observe these cells growth depressive effect. The result indicated that the cDNA fragment of the RPL31 cloned from the giant panda is 419 bp in size, containing an open reading frame of 378 bp, and deduced protein was composed of 125 amino acids with an estimated molecular weight of 14.46-kDa and PI of 11.21. The length of the genomic sequence is 8,091 bp, which was found to possess four exons and three introns. The RPL31 gene can be readily expressed in E.coli, expecting 18-kDa polypeptide that formed inclusion bodies. Recombinant protein RPL31 from the giant panda consists of 157 amino acids with an estimated molecular weight of 17.86 kDa and PI of 10.77. The outcomes showed that the cell growth inhibition rate in a time- and dose-dependent on recombinant protein RPL31. And also indicated that the effect at low concentrations was better than high concentrations on Hep-2 cells, and the concentration of 0.33 μg/mL had the best rate of growth inhibition, 44 %. Consequently, our study aimed at revealing the recombinant protein RPL31 anti-cancer function from the giant panda, providing scientific basis and resources for the research and development of cancer protein drugs anti-cancer mechanism research. Further studies of the mechanism and the signal transduction pathways are in progress.

  15. Cloning and characterization of a novel human STAR domain containing cDNA KHDRBS2.

    PubMed

    Wang, Liu; Xu, Jian; Zeng, Li; Ye, Xin; Wu, Qihan; Dai, Jianfeng; Ji, Chaoneng; Gu, Shaohua; Zhao, Chunhua; Xie, Yi; Mao, Yumin

    2002-12-01

    KHDRBS2, KH domain containing, RNA binding, signal transduction associated 2, is an RNA-binding protein that is tyrosine phosphorylated by Src during mitosis. It contains a KH domain,which is embedded in a larger conserved domain called the STAR domain. This protein has a 99% sequence identity with rat SLM-1 (the Sam68-like mammalian protein 1) and 98% sequence identity with mouse SLM-1 in its STAR domain. KHDRBS2 has the characteristic Sam68 SH2 and SH3 domain binding sites. RT-PCR analysis showed its transcript is ubiquitously expressed. The characterization of KHDRBS2 indicates it may link tyrosine kinase signaling cascades with some aspect of RNA metabolism.

  16. Syntenic conservation of HSP70 genes in cattle and humans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grosz, M.D.; Womack, J.E.; Skow, L.C.

    1992-12-01

    A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digestedmore » DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.« less

  17. cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

    MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

  18. Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

    PubMed Central

    Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

    1990-01-01

    Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

  19. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    PubMed Central

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  20. Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stewart, G.J.; Savioz, A.; Davies, R.W.

    1997-01-15

    The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less

Top