Science.gov

Sample records for human chromosome 2

  1. Regional mapping of loci from human chromosome 2q to sheep chromosome 2q

    SciTech Connect

    Ansari, H.A.; Pearce, P.D.; Maher, D.W.; Malcolm, A.A.; Wood, N.J.; Phua, S.H.; Broad, T.E. )

    1994-03-01

    The human chromosome 2q loci, fibronectin 1 (FN1), the [alpha]1 chain of type III collagen (COL3A1), and the [delta] subunit of the muscle acetylcholine receptor (CHRND) have been regionally assigned to sheep chromosome 2q by in situ hybridization. COL3A1 is pericentromeric (2q12-q21), while FN1 and CHRND are in the subterminal region at 2q41-q44 and 2q42-qter, respectively. The mapping of FN1 assigns the sheep synthenic group U11, which contains FN1, villin 1 (VIL1), isocitrate dehydrogenase 1 (IDH1), and [gamma] subunit of the muscle acetylcholine receptor (CHRNG), to sheep chromosome 2q. Inhibin-[alpha] (INHA) is also assigned to sheep chromosome 2q as FN1 and INHA compose sheep linkage group 3. These seven loci are members of a conserved chromosomal segment in human, mouse, and sheep. 23 refs., 2 figs., 1 tab.

  2. Abnormal human sex chromosome constitutions

    SciTech Connect

    1993-12-31

    Chapter 22, discusses abnormal human sex chromosome constitution. Aneuploidy of X chromosomes with a female phenotype, sex chromosome aneuploidy with a male phenotype, and various abnormalities in X chromosome behavior are described. 31 refs., 2 figs.

  3. Aup1, a novel gene on mouse Chromosome 6 and human Chromosome 2p13

    SciTech Connect

    Jang, Wonhee; Weber, J.S.; Meisler, M.H.

    1996-09-01

    We have cloned a novel mouse cDNA, Aup1, encoding a predicted protein of 410 amino acid residues. The 1.5-kb Aup1 transcript is ubiquitously expressed in mouse tissues. An evolutionary relationship to the Caenorhabditis elegans predicted protein F44b9.5 is indicated by the 35% identity and 53% conservation of the amino acid sequences. Nineteen related human ESTs spanning 80% of the protein have also been identified, with a predicted amino acid sequence identity of 86% between the human and the mouse proteins. The gene has been mapped to a conserved linkage group on human chromosome 2p13 and mouse Chromosome 6. Aup1 was eliminated as a candidate gene for two closely linked disorders, human LGMD2B and mouse mnd2. 15 refs., 2 figs.

  4. The human glutamate receptor delta 2 gene (GRID2) maps to chromosome 4q22.

    PubMed

    Hu, W; Zuo, J; De Jager, P L; Heintz, N

    1998-01-01

    We isolated the human glutamate receptor delta 2 (GRID2) gene, which has 97.0% identity in amino acid sequence to the mouse glutamate receptor delta 2 (Grid2) gene. We subsequently mapped this gene to human chromosome 4q22 by radiation hybrid mapping and by hybridization to two overlapping human yeast artificial chromosomes that are located in 4q22. The Grid2 gene, which is mutated in lurcher (Lc) mice, maps to mouse chromosome 6. Thus, the mapping of the GRID2 gene to human chromosome 4q22 confirms and refines a region of synteny between mouse and human genomes.

  5. Localization of the oncogene c-erbA2 to human chromosome 3.

    PubMed

    Rider, S H; Gorman, P A; Shipley, J M; Moore, G; Vennstrom, B; Solomon, E; Sheer, D

    1987-05-01

    The human c-erbA1 gene has been previously mapped to chromosome 17. We have now mapped c-erbA2 to the short arm of chromosome 3, using a human genomic probe in Southern analysis of DNA from a panel of human/mouse somatic cell hybrids. In situ hybridization using the same probe on metaphase chromosomes has enabled fine chromosome mapping of c-erbA2 to the chromosome region 3p21-pter. PMID:3674756

  6. Sequence, genomic structure, and chromosomal assignment of human DOC-2

    SciTech Connect

    Albertsen, H.M.; Williams, B.; Smith, S.A.

    1996-04-15

    DOC-2 is a human gene originally identified as a 767-bp cDNA fragment isolated from normal ovarian epithelial cells by differential display against ovarian carcinoma cells. We have now determined the complete cDNA sequence of the 3.2-kb DOC-2 transcript and localized the gene to chromosome 5. A 12.5-kb genomic fragment at the 5{prime}-end of DOC-2 has also been sequenced, revealing the intron-exon structure of the first eight exons (788 bases) of the DOC-2 gene. Translation of the DOC-2 cDNA predicts a hydrophobic protein of 770 amino acid residues with a molecular weight of 82.5 kDa. Comparison of the DNA and amino acid sequences of DOC-2 to publicly accessible sequence data-bases revealed 83% identity to p96, a murine-responsive phosphoprotein. In addition, about 45% identity was observed between the first 140 N-terminal residues of DOC-2 and the Caenorhabditas elegans M110.5 and Drosophila melanoaster Dab genes. 14 refs., 3 figs.

  7. Human chromosome 8.

    PubMed Central

    Wood, S

    1988-01-01

    The role of human chromosome 8 in genetic disease together with the current status of the genetic linkage map for this chromosome is reviewed. Both hereditary genetic disease attributed to mutant alleles at gene loci on chromosome 8 and neoplastic disease owing to somatic mutation, particularly chromosomal translocations, are discussed. PMID:3070042

  8. Origin of human chromosome 2: An ancestral telomere-telomere fusion

    SciTech Connect

    Ijdo, J.W.; Baldini, A.; Ward, D.C.; Reeders, S.T.; Wells, R.A. )

    1991-10-15

    The authors identified two allelic genomic cosmids from human chromosome 2, c8.1 and c29B, each containing two inverted arrays of the vertebrate telomeric repeat in a head-to-head arrangement, 5{prime}(TTAGGG){sub n}-(CCCTAA){sub m}3{prime}. Sequences flanking this telomeric repeat are characteristic of present-day human pretelomeres. BAL-31 nuclease experiments with yeast artificial chromosome clones of human telomeres and fluorescence in situ hybridization reveal that sequences flanking these inverted repeats hybridize both to band 2q13 and to different, but overlapping, subsets of human chromosome ends. They conclude that the locus cloned in cosmids c8.1 and c29B is the relic of an ancient telomere-telomere fusion and marks the point at which two ancestral ape chromosomes fused to give rise to human chromosome 2.

  9. Chromosome 1 localization of the human alpha-L-fucosidase structural gene with a homologous site on chromosome 2.

    PubMed

    Fowler, M L; Nakai, H; Byers, M G; Fukushima, H; Eddy, R L; Henry, W M; Haley, L L; O'Brien, J S; Shows, T B

    1986-01-01

    Two cDNA clones coding for human alpha-L-fucosidase, one from the coding region and the other primarily from the 3' untranslated region, were used to map the location of the alpha-L-fucosidase gene. Southern filter analysis of somatic cell hybrid lines mapped the structural gene to the short arm of human chromosome 1, and in situ hybridization to chromosomes of human leukocytes further localized the homologous area to the 1p36.1----p34.1 region, with the most likely location being the distal region of 1p34. Further Southern filter analysis detected a second site of homology on chromosome 2. This alpha-L-fucosidase-like site has been designated FUCA1L.

  10. Extinction of albumin gene expression in a panel of human chromosome 2 microcell hybrids

    SciTech Connect

    Cerosaletti, K.M.; Fournier, R.E.K.

    1996-02-01

    Expression of the serum albumin gene is extinguished in rat hepatoma microcell hybrids that retain mouse chromosome 1. These data define a trans-dominant extinguisher locus, Tse-2, on mouse chromosome 1. To localize the human TSE2 locus, we prepared and characterized rat/human microcell hybrids that contained either human chromosome 1 or chromosome 2, the genetic homologues of mouse chromosome 1. Rat hepatoma microcell hybrids retaining a derivative human chromosome 1 [der 1 t(1;17)(p34.3;q11.2)] expressed their serum albumin genes at levels similar to those of parental hepatoma cells. In contrast, microcell transfer of human chromosome 2 into rat hepatoma recipients produced karyotypically heterogeneous collections of hybrid clones, some of which displayed dramatic albumin extinction phenotypes. For example, albumin mRNA levels in hapatoma x fibroblast whole-cell hybrids. Expression of several other liver genes, including {alpha}1-antitrypsin, aldolase B, alcohol dehydrogenase, and phosphoenolpyruvate carboxykinase, was also affected in some of the microcell hybrids, but expression of these genes was no concordant with expression of albumin. Hybrid segregants were prepared from the albumin-extinguished hybrids, and reexpression of albumin mRNA and protein was observed in sublines that had lost or fragmented human chromosome 2. Finally, expression of mRNAs encoding the liver-enriched transactivators HNF-1, HNF-4, HNF-3{alpha}, and HNF-3{beta} was not affected in any of the chromosome 2-containing hybrids. These data define and map a genetic locus on human chromosome 2 that extinguishes albumin gene expression in trans, and they suggest that TSE2-mediated extinction is independent of HNF-1, -4, -3{alpha}, and -3{beta} expression. 61 refs., 2 figs., 3 tabs.

  11. Regional localization of the gene for thyroid peroxidase to human chromosome 2p25 and mouse chromosome 12C

    SciTech Connect

    Endo, Yuichi; Onogi, Satoshi; Fujita, Teizo

    1995-02-10

    Thyroid peroxidase (TPO) plays a central role in thyroid gland function. The enzyme catalyzes two important reactions of thyroid hormone synthesis, i.e., the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Previously, we isolated the cDNAs encoding human and mouse TPOs and assigned the human TPO gene to the short arm of chromosome 2 by somatic cell hybrid mapping. By a similar analysis of DNA from somatic cell hybrids, the human TPO gene was mapped to 2pter-p12. The mouse TPO gene was localized to chromosome 12 using a rat TPO cDNA as a probe to hybridize with mouse-hamster somatic cell hybrids. In this study, we used fluorescence in situ hybridization (FISH) to confirm the localization of human and mouse TPO genes to human chromosome 2 and mouse chromosome 12 and to assign them regionally to 2p25 and 12C, respectively. 7 refs., 1 fig.

  12. Thermolabile phenol sulfotransferase gene (STM): Localization to human chromosome 16p11.2

    SciTech Connect

    Aksoy, I.A.; Her, C.; Weinshilboum, M.

    1994-09-01

    Thermolabile (TL) phenol sulfotransferase (PST) catalyzes the sulfate conjugation of phenolic monoamine neurotransmitters such as dopamine and serotonin. We recently cloned a cDNA for human liver TL PST and expressed it in COS-1 cells. We now report the chromosomal localization of the human TL PST gene (STM) as well as its partial sequence. DNA from NIGMS Human/Rodent Somatic Cell Hybrid Mapping Panels 1 and 2 was screened by use of the PCR, and the STM gene was mapped to chromosome 16. Regional localization to 16p11.2 was performed by PCR analysis of a high-resolution mouse/human somatic cell hybrid panel that contained defined portions of human chromosome 16. 15 refs., 2 figs.

  13. Human immunoglobulin VH and D segments on chromosomes 15q11.2 and 16p11.2.

    PubMed

    Tomlinson, I M; Cook, G P; Carter, N P; Elaswarapu, R; Smith, S; Walter, G; Buluwela, L; Rabbitts, T H; Winter, G

    1994-06-01

    In addition to the major human immunoglobulin heavy-chain locus on chromosome 14q32.3, VH and D segments are known to be present on chromosomes 15 and 16. We have now amplified and sequenced 24 such VH segments from somatic cell hybrids and have assigned them to 15q11.2 and 16p11.2 using cosmid and yeast artificial chromosome clones. In addition, we have located a cluster of D segments on 15q11.2, previously thought to be located on 14q32.3. We propose that the segments on chromosome 16 arose by an interchromosomal duplication and identify the corresponding region on chromosome 14. Taken together with the completion of a map of the human VH locus on 14q32.3, the total number of VH segments now identified is 117. We can now account for most, if not all human germ-line VH segments. PMID:7951227

  14. Human chromosome 22.

    PubMed Central

    Kaplan, J C; Aurias, A; Julier, C; Prieur, M; Szajnert, M F

    1987-01-01

    The acrocentric chromosome 22, one of the shortest human chromosomes, carries about 52 000 kb of DNA. The short arm is made up essentially of heterochromatin and, as in other acrocentric chromosomes, it contains ribosomal RNA genes. Ten identified genes have been assigned to the long arm, of which four have already been cloned and documented (the cluster of lambda immunoglobulin genes, myoglobin, the proto-oncogene c-sis, bcr). In addition, about 10 anonymous DNA segments have been cloned from chromosome 22 specific DNA libraries. About a dozen diseases, including at least four different malignancies, are related to an inherited or acquired pathology of chromosome 22. They have been characterised at the phenotypic or chromosome level or both. In chronic myelogenous leukaemia, with the Ph1 chromosome, and Burkitt's lymphoma, with the t(8;22) variant translocation, the molecular pathology is being studied at the DNA level, bridging for the first time the gap between cytogenetics and molecular genetics. PMID:3550088

  15. Linkage localization of TGFB2 and the human homeobox gene GLX1 to chromosome 1q

    SciTech Connect

    Nishimura, D.Y.; Murray, J.C. ); Purchio, A.F. )

    1993-02-01

    We have identified genetic variation within two human genes, transforming growth factor-[beta]2 (TGFB2) and the homeobox gene HB24 (HLX1). Reported here are four human RFLPs and SSCPs for TGFB2 in humans and gorillas. In addition, we describe an RFLP and a SSCP for HLX1. We propose that HLX1 is the human homologue of the mouse homeobox gene Hlx based on extensive sequence homology between the genes and the close proximity of both genes to TGFB2 in their respective species. We also report the chromosomal localization of HLX1 to the long arm of human chromosome 1. Finally, utilizing the polymorphisms described for TGFB2 and HLX1, we have been able to localize these genes within a framework map of the distal long arm of chromosome 1 and to study the linkage relationship between these two genes. Pairwise linkage analysis shows that these two genes are linked, with a recombination fraction of 3.1% and a lod score of 14.49. 27 refs., 3 figs., 6 tabs.

  16. Chromosomal localization of the human heme oxygenase genes: Heme oxygenase-1 (HMOX1) maps to chromosome 22q12 and heme oxygenase-2 (HMOX2) maps to chromosome 16p13. 3

    SciTech Connect

    Kutty, R.K.; Kutty, G.; Rodriguez, I.R.; Chader, G.J.; Wiggert, B. )

    1994-04-01

    Heme oxygenase catalyzes the oxidation of heme to biliverdin, the precursor of the bile pigment bilirubin, and carbon monoxide, a putative neurotransmitter. The authors have employed polymerase chain reaction and fluorescence in situ hybridization to determine the chromosome localization of the genes coding for the two known heme oxygenase isozymes. Heme oxygenase-1 (HMOX1), the inducible form, was localized to human chromosome 22q12, while heme oxygenase-2 (HMOX2), the constitutive form, was localized to chromosome 16p13.3. 14 refs., 3 figs.

  17. The human and mouse receptors of hyaluronan-mediated motility, RHAMM, genes (HMMR) map to human chromosome 5q33.2-qter and mouse chromosome 11

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Roller, M.L.; Camper, S.A.

    1995-11-01

    The gene for the receptor for hyaluronan-mediated motility, RHAAM (designated hyaluronan-mediated motility receptor, HMMR (human) and Hmmr (mouse), for mapping purposes), was localized to human chromosome 5q33.2-qter by somatic cell and radiation hybrid analyses. Investigation of two interspecific back-crosses localized the mouse RHAMM (Hmmr) locus 18 cM from the centromere of mouse chromosome 11 within a region of synteny homology with human chromosome 5q23-q35 genes. The map position of the human RHAMM gene places it in a region comparatively rich in disease-associated genes, including those for low-frequency hearing loss, dominant limb-girdle muscular dystrophy, diastrophic dysplasia, Treacher Collins syndrome, and myeloid disorders associated with the 5q-syndrome. The RHAMM gene location and its ability to transform cells when overexpressed implicate RHAMM as a possible candidate gene in the pathogenesis of the recently described t(5;14)(q33-q34;q11) acute lymphoblastic leukemias. 18 refs., 1 fig.

  18. Cloning, sequencing, and mapping of the human chromosome 14 heat shock protein gene (HSPA2)

    SciTech Connect

    Bonnycastle, L.L.C.; Chang-En Yu; Schellenberg, G.D.

    1994-09-01

    A genomic clone for the human heat shock protein (HSP) 70 gene located on chromosome 14 was isolated and sequenced. The gene, designated HSPA2, has a single open reading frame of 1917 bp that encodes a 639-amino acid protein with a predicted molecular weight of 70,030 Da. Analysis of the sequence indicates that HLPA2 is the human homologue of the murine Hsp 70-2 gene with 91.7% identity in the nucleotide coding sequence and 98.2% in the corresponding amino acid sequence. HSPA2 has less amino acid homology to other members of the human HSP70 gene family, 83.3% to the heat-inducible HSP70-1 gene and 86.1% with the human heat shock cognate gene HSC70. HSPA2 is constitutively expressed in most tissues, with very high levels in testis and skeletal muscle. Significant but lower levels are also expressed in ovary, small intestine, colon, brain, placenta, and kidney. A yeast artificial chromosome (YAC) clone containing HSPA2 (YAC741H4) that also contained the polymorphic marker D14S63 was identified. This 670-kb YAC was mapped to 14q24.1 by fluorescence in situ hybridization (FISH). Subsequent two-color FISH and genetic mapping placed HSPA2/D14S63 proximal to the markers D14S57 and D14S77. 50 refs., 3 figs., 1 tab.

  19. Human phenol sulfotransferase STP2 gene: Molecular cloning, structural characterization, and chromosomal localization

    SciTech Connect

    Her, C.; Raftogianis, R.; Weinshilboum, R.M.

    1996-05-01

    Sulfonation is an important pathway in the biotransformation of many drugs, xenobiotics, neurotransmitters, and steroid hormones. The thermostable (TS) form of phenol sulfotransferase (PST) preferentially catalyzes the sulfonation of {open_quotes}simple{close_quotes} planar phenols, and levels of activity of TS PST in human tissues are controlled by inheritance. Two different human liver TS PST cDNAs have been cloned that encode proteins with amino acid sequences that are 96% identical. We have determined the structure and chromosomal localization of the gene for one of these two cDNAs, STP2, as a step toward understanding molecular genetic mechanisms involved in the regulation of this enzyme activity in humans. STP2 spans approximately 5.1 kb and contains nine exons that range in length from 74 to 347 bp. The locations of most STP2 exon-intron splice junctions are identical to those of a gene for the thermolabile form of PST in humans, STM; a rat PST gene; a human estrogen ST (EST) gene, STE; and a guinea pig EST gene. The two initial STP2 exons, IA and IB, were identified by performing 5{prime}-rapid amplification of cDNA ends with human liver cDNA as template. Exons IA and IB are noncoding and represent two different human liver TS PST cDNA 5{prime}untranslated region sequences. The two apparent 5{prime}-ons IA and IB, contain no canonical TATA boxes, but do contain CCAAT elements. STP2 was localized to human chromosome 16 by performing the PCR with DNA from NIGMS human/rodent somatic cell hybrids as template. Structural characterization of STP2 will make it possible to begin to study molecular genetic mechanisms involved in the regulation of TS PST activity in human tissues. 63 refs., 7 figs., 1 tab.

  20. Regional assignment of the human homebox-containing gene EN1 to chromosome 2q13-q21

    SciTech Connect

    Koehler, A.; Muenke, M. ); Logan, C. ); Joyner, A.L. Samuel Lunenfeld Research Institute, Toronto )

    1993-01-01

    The human homeobox-containing genes EN1 and EN2 are closely related to the Drosophila pattern formation gene engrailed (en), which may be important in brain development, as shown by gene expression studies during mouse embryogenesis. Here, we have refined the localization of EN1 to human chromosome 2q13-q21 using a mapping panel of rodent/human cell hybrids containing different regions of chromosome 2 and a lymphoblastoid cell line with an interstitial deletion, del(2) (q21-q23.2). This regional assignment of EN1 increases to 22 the number of currently known genes on human chromosome 2q that have homologs on the proximal region of mouse chromosome 1. 15 refs., 2 figs.

  1. Chromosomal mapping of the human histone gene H2AZ to 4q24 by fluorescence in situ hybridization

    SciTech Connect

    Popescu, N.; Zimonjic, D.; Hatch, C.; Bonner, W. )

    1994-03-15

    The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21. Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.

  2. Identification of the human {beta}A2 crystallin gene (CRYBA2): Localization of the gene on human chromosome 2 and of the homologous gene on mouse chromosome 1

    SciTech Connect

    Hulsebos, T.J.M.; Cerosaletti, K.M.; Fournier, R.E.K.

    1995-08-10

    By using primers synthesized on the basis of the bovine {beta}A2 crystalline gene sequence, we amplified exons 5 and 6 of the human gene (CRYBA2). CRYBA2 was assigned to human chromosome 2 by concordance analysis in human x rodent somatic cell hybrids using the amplified PCR products as probe. Regional localization to 2q34-q36 was established by hybridizing the CRYBA2 probe to microcell and radiation hybrids containing defined fragments of chromosome 2 as the only human contribution. The CRYBA2 probe was also used to localize, by interspecific backcross mapping, the mouse gene (Cryba2) to the central portion of chromosome 1 in a region of known human chromosome 2 homology. Finally, we demonstrate that in both species the {beta}A2 crystallin gene is linked but separable from the {gamma}A crystallin gene. The {beta}A2 crystallin gene is a candidate gene for human and mouse hereditary cataract. 32 refs., 4 figs.

  3. Micromechanics of human mitotic chromosomes

    NASA Astrophysics Data System (ADS)

    Sun, Mingxuan; Kawamura, Ryo; Marko, John F.

    2011-02-01

    Eukaryote cells dramatically reorganize their long chromosomal DNAs to facilitate their physical segregation during mitosis. The internal organization of folded mitotic chromosomes remains a basic mystery of cell biology; its understanding would likely shed light on how chromosomes are separated from one another as well as into chromosome structure between cell divisions. We report biophysical experiments on single mitotic chromosomes from human cells, where we combine micromanipulation, nano-Newton-scale force measurement and biochemical treatments to study chromosome connectivity and topology. Results are in accord with previous experiments on amphibian chromosomes and support the 'chromatin network' model of mitotic chromosome structure. Prospects for studies of chromosome-organizing proteins using siRNA expression knockdowns, as well as for differential studies of chromosomes with and without mutations associated with genetic diseases, are also discussed.

  4. Chromosomal abnormalities in human sperm

    SciTech Connect

    Martin, R.H.

    1985-01-01

    The ability to analyze human sperm chromosome complements after penetration of zona pellucida-free hamster eggs provides the first opportunity to study the frequency and type of chromosomal abnormalities in human gametes. Two large-scale studies have provided information on normal men. We have studied 1,426 sperm complements from 45 normal men and found an abnormality rate of 8.9%. Brandriff et al. (5) found 8.1% abnormal complements in 909 sperm from 4 men. The distribution of numerical and structural abnormalities was markedly dissimilar in the 2 studies. The frequency of aneuploidy was 5% in our sample and only 1.6% in Brandriff's, perhaps reflecting individual variability among donors. The frequency of 24,YY sperm was low: 0/1,426 and 1/909. This suggests that the estimates of nondisjunction based on fluorescent Y body data (1% to 5%) are not accurate. We have also studied men at increased risk of sperm chromosomal abnormalities. The frequency of chromosomally unbalanced sperm in 6 men heterozygous for structural abnormalities varied dramatically: 77% for t11;22, 32% for t6;14, 19% for t5;18, 13% for t14;21, and 0% for inv 3 and 7. We have also studied 13 cancer patients before and after radiotherapy and demonstrated a significant dose-dependent increase of sperm chromosome abnormalities (numerical and structural) 36 months after radiation treatment.

  5. The gene encoding p120{sup cas}, a novel catenin, localizes on human chromosome 11q11 (CTNND) and mouse chromosome 2 (Catns)

    SciTech Connect

    Reynolds, A.B.; Daniel, J.M.; Shapiro, D.N.

    1996-01-01

    The p120{sub cas} gene encodes a protein tyrosine kinase substrate that associates with the cell-cell adhesion protein complex containing E-cadherin and its cytoplasmic cofactors {alpha}-catenin, {beta}-catenin, and plakoglobin. Like other components of the cadherin/catenin complex, defects in p120{sup cas} may contribute to cell malignancy. We have determined the chromosomal location of the p120{sup cas} gene in human and mouse using fluorescence in situ hybridization and interspecific backcross analysis, respectively. The human p120{sub cas} gene (CTNND) is localized immediately adjacent to the centromere on the long arm of chromosome 11 in band 11q11. The murine p120{sup cas} gene (Catns) was assigned to the middle of chromosome 2. Neither locus is currently known to be associated with disease or malignancy. 17 refs., 2 figs.

  6. ATR, BRCA1 and gammaH2AX localize to unsynapsed chromosomes at the pachytene stage in human oocytes.

    PubMed

    Garcia-Cruz, R; Roig, I; Robles, P; Scherthan, H; Garcia Caldés, M

    2009-01-01

    Asynapsis of homologous chromosomes at the pachytene stage has been associated with gametogenic failure and infertility, but the cellular mechanisms involved are currently unknown in human meiocytes. In mice, the protein encoded by the breast-cancer susceptibility gene Brca1 has been described to direct kinase ATR (ataxia telangiectasia and Rad3 related) to any unpaired DNA at the pachytene stage, where ATR triggers H2AX phosphorylation, resulting in the silencing of those chromosomes. In this study, the distribution of ATR, BRCA1 and the phosphorylated histone gammaH2AX is assessed by immunofluorescence in human oocytes and it is found that they localize at unpaired chromosomes at the pachytene stage. Evidence is shown to propose that BRCA1, ATR and gammaH2AX in the human may be part of a system such as the one previously described in mouse, which signals unsynapsed chromosomes at pachytene and may lead to their silencing. PMID:19146767

  7. The human paired domain gene PAX7 (Hup1) maps to chromosome 1p35-1p36. 2

    SciTech Connect

    Schaefer, B.W. ); Mattei, M.G. )

    1993-07-01

    The human PAX7 gene encodes a protein containing a domain homologous to the Drosophila paired box first described in three segmentation genes. In addition to the paired box, the gene contains the conserved octa-peptide and a paired-type homeobox. Two of the five known human PAX genes have been implicated in human disorders so far. Here the authors have used a somatic cell hybrid panel to localize PAX7 to human chromosome 1. In situ hybridization shows that PAX7 is confined to the short arm of chromosome 1 at 1p35-1p36.2. 15 refs., 2 figs.

  8. Organization, structure and evolution of the CYP2 gene cluster on human chromosome 19.

    PubMed

    Hoffman, S M; Nelson, D R; Keeney, D S

    2001-11-01

    The cytochrome P450 superfamily of mixed-function oxygenases has been extensively studied due to its many critical metabolic roles, and also because it is a fascinating example of gene family evolution. The cluster of genes on human chromosome 19 from the CYP2A, 2B, and 2F subfamilies has been previously described as having a complex organization and many pseudogenes. We describe the discovery of genes from three more CYP2 subfamilies inside the cluster, and assemble a complete map of the region. We comprehensively review the organization, structure, and expression of genes from all six subfamilies. A general hypothesis for the evolution of this complex gene cluster is also presented.

  9. Human ETS2 gene on chromosome 21 is not rearranged in Alzheimer disease

    SciTech Connect

    Sacchi, N.; Nalbantoglu, J.; Sergovich, F.R.; Papas, T.S. )

    1988-10-01

    The human ETS2 gene, a member of the ETS gene family, with sequence homology with the retroviral ets sequence of the avian erythroblastosis retrovirus E26 is located on chromosome 21. Molecular genetic analysis of Down syndrome (DS) patients with partial trisomy 21 allowed us to reinforce the supposition that ETS2 may be a gene of the minimal DS genetic region. It was originally proposed that a duplication of a portion of the DS region represents the genetic basis of Alzheimer disease, a condition associated also with DS. No evidence of either rearrangements or duplications of ETS2 could be detected in DNA from fibroblasts and brain tissue of Alzheimer disease patients with either the sporadic or the familiar form of the disease. Thus, an altered ETS2 gene dosage does not seem to be a genetic cause or component of Alzheimer disease.

  10. Assignment of ALDH3 to human chromosome 17p11.2 and ALDH5 to human chromosome 9p13

    SciTech Connect

    Hiraoka, L.R.; Hsu, L.; Hsieh, C.L.

    1995-01-01

    Aldehyde dehydrogenases are a group of enzymes responsible for catalyzing the conversion of numerous aldehydes to their corresponding acids. These enzymes play a major role in the detoxification of alcohol-derived acetaldehydes and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. ALDH activities are found in most tissues, with the highest activity in the liver. Five human liver ALDH isozymes, ALDH1, 2, 3, 4, and {gamma}-butyrylaldehyde dehydrogenase ({gamma}-ABDH), have been purified and characterized, and one isozyme, ALDH5, has been identified by using a 29-nucleotide probe that is conserved in ALDH1 and ALDH2 for cDNA library screening. Several other isozymes from other tissues have also been reported. Genes for ALDH3 and ALDH5 have been previously localized to chromosomes 17 and 9, respectively. Here we report the regional assignment of these two loci. 17 refs., 1 fig.

  11. Localization of human flavin-containing monooxygenase genes FMO2 and FMO5 to chromosome 1q

    SciTech Connect

    McCombie, R.R.; Shephard, E.A.; Dolphin, C.T.

    1996-06-15

    The human flavin-containing monooxygenase (FMO) gene family comprises at least five distinct members (FMO1 to FMO5) that code for enzymes responsible for the oxidation of a wide variety of soft nucleophilic substrates, including drugs and environmental pollutants. Three of these genes (FMO1, FMO3, and FMO4) have previously been localized to human chromosome 1q, raising the possibility that the entire gene family is clustered in this chromosomal region. Analysis by polymerase chain reaction of DNA isolated from a panel of human-rodent somatic cell hybrids demonstrates that the two remaining identified members of the FMO gene family, FMO2 and FMO5, also are located on chromosome 1q. 19 refs., 1 fig., 1 tab.

  12. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8

    SciTech Connect

    Burkin, D.J.; Jones, C. ); Kimbro, K.S.; Taylor, M.W. ); Barr, B.L.; Gupta, S.L. )

    1993-07-01

    Indoleamine 2,3-dioxygenase (IDO) is the first enzyme in the catabolic pathway for tryptophan. This extrahepatic enzyme differs from the hepatic enzyme, tryptophan 2,3-dioxygenase (TDO), in molecular as well as enzymatic characteristics, although both enzymes catalyze the same reaction: cleavage of tryptophan into N-formylkynurenine. The induction of IDO by IFN-[gamma] plays a role in the antigrowth effect of IFN-[gamma] in cell cultures and in the inhibition of intracellular pathogens, e.g., Toxoplasma gondii and Chlamydia psittaci. Tryptophan is also the precursor for the synthesis of serotonin, and reduced levels of tryptophan and serotonin found in AIDS patients have been correlated with the presence of IFN-[gamma] and consequent elevation of IDO activity. The IDO enzyme has been purified and characterized, and its cDNA and genomic DNA clones have been isolated and analyzed. DNA from hybrid cells containing fragments of human chromosome 8 was used to determine the regional localization of the IDO gene on chromosome 8. The hybrids R30-5B and R30-2A contain 8p11 [yields] qter and 8q13 [yields] qter, respectively. Hybrid 229-3A contains the 8pter [yields] q11. The hybrid R30-2A was negative for the IDO gene, whereas R30-5B and 229-3A were positive as analyzed by PCR and verified by Southern blotting. Only the region close to the centromere is shared by R30-5B and 229-3A hybrids. The results indicate that the IDO gene is located on chromosome 8p11 [yields] q11.

  13. Comparative analysis of the gene-dense ACHE/TFR2 region on human chromosome 7q22 with the orthologous region on mouse chromosome 5

    PubMed Central

    Wilson, Michael D.; Riemer, Cathy; Martindale, Duane W.; Schnupf, Pamela; Boright, Andrew P.; Cheung, Tony L.; Hardy, Daniel M.; Schwartz, Scott; Scherer, Stephen W.; Tsui, Lap-Chee; Miller, Webb; Koop, Ben F.

    2001-01-01

    Chromosome 7q22 has been the focus of many cytogenetic and molecular studies aimed at delineating regions commonly deleted in myeloid leukemias and myelodysplastic syndromes. We have compared a gene-dense, GC-rich sub-region of 7q22 with the orthologous region on mouse chromosome 5. A physical map of 640 kb of genomic DNA from mouse chromosome 5 was derived from a series of overlapping bacterial artificial chromosomes. A 296 kb segment from the physical map, spanning Ache to Tfr2, was compared with 267 kb of human sequence. We identified a conserved linkage of 12 genes including an open reading frame flanked by Ache and Asr2, a novel cation-chloride cotransporter interacting protein Cip1, Ephb4, Zan and Perq1. While some of these genes have been previously described, in each case we present new data derived from our comparative sequence analysis. Adjacent unfinished sequence data from the mouse contains an orthologous block of 10 additional genes including three novel cDNA sequences that we subsequently mapped to human 7q22. Methods for displaying comparative genomic information, including unfinished sequence data, are becoming increasingly important. We supplement our printed comparative analysis with a new, Web-based program called Laj (local alignments with java). Laj provides interactive access to archived pairwise sequence alignments via the WWW. It displays synchronized views of a dot-plot, a percent identity plot, a nucleotide-level local alignment and a variety of relevant annotations. Our mouse–human comparison can be viewed at http://web.uvic.ca/~bioweb/laj.html. Laj is available at http://bio.cse.psu.edu/, along with online documentation and additional examples of annotated genomic regions. PMID:11239002

  14. Induction of chromosome aberrations by Fusarium T-2 toxin in cultured human peripheral blood lymphocytes and Chinese hamster fibroblasts

    SciTech Connect

    Hsia, C.C.; Gao, Y.; Wu, J.L.; Tzian, B.

    1986-01-01

    T-2 toxin is an important representative of trichothecenes produced by various species of imperfect fungi, mainly Fusarium genus. No definite data demonstrating the carcinogenic potential of T-2 toxin had been reported up to now. The authors demonstrated that T-2 toxin reproducibly induced chromosomal structural aberrations both in cultured human peripheral blood lymphocytes as well as in V/sub 79/ Chinese hamster fibroblasts. The mean percentage of cells with aberration of human lymphocytes from normal individuals induced by T-2 toxin is 49-fold (9.8%) of the mean percentage of corresponding control cultures without T-2 toxin (0.2%). T-2 toxin induced chromosome type (76%) as well as chromatid type (24%) of aberrations; among them, acentric fragment (46%) was the most common type, and chromatid gap, deletion, and chromosome gap were the next most common. T-2 toxin can induce aberrations in cells at different phases of the cell cycle. There are definite dose-effect relationships within a certain range of dosage of T-2 toxin in experiments with both human peripheral blood lymphocytes and V/sub 79/ cells. T-2 toxin exhibited three types of effects on cells, namely, mitogenic at lowest concentration, clastogenic (chromosome aberration) at median concentration, and cytotoxic at higher concentration. The dose-effect curves of these three effects are partly overlapping. Sex or age effect was not observed. The results suggest that T-2 toxin has carcinogenic potentials. The dosage of aflatoxin that can induce chromosomal aberration of human peripheral blood lymphocytes is thousands-fold of the dosage of T-2 toxin as shown in this report.

  15. Human neuronal pentraxin II (NPTX2): Conservation, genomic structure, and chromosomal localization

    SciTech Connect

    Yung-Chih Hsu; Perin, M.S.

    1995-07-20

    We have previously identified a novel rat neuronal member of the pentraxin family (neuronal pentraxin) that may mediate the uptake of synaptic material and the presynaptic snake venom toxin, taipoxin. Here we report human cDNA and genomic sequences of a second neuronal pentraxin. This pentraxin, which we propose to name neuronal pentraxin II (NPII; gene symbol NPTX2), shows 54% amino acid identity to rat neuronal pentraxin (NPI) with 69% identity over the carboxyl-terminal half of NPI and is 88% identical to a newly identified sperm acrosomal pentraxin p50/apexin. Northern blot analysis reveals that NPII message is present in brain, testis, pancreas, liver, heart, and skeletal muscle, so, unlike NPI, NPII is not exclusively localized to neurons. Like NPI, NPII has potential N-linked glycosylation sites. The human NPII gene is 11 kb in length, contains four introns, and is localized to chromosome 7q21.3-q22.1. These data demonstrate the existence of a family of pentraxin proteins that are expressed in the brain and other tissues and that may play important roles in the uptake of extracellular material. 26 refs., 4 figs.

  16. The ubiquitous mitochondrial creatine kinase gene maps to a conserved region on human chromosome 15q15 and mouse chromosome 2 bands F1-F3

    SciTech Connect

    Steeghs, K.; Wieringa, B.; Merkx, G.

    1994-11-01

    Members of the creatine kinase isoenzyme family (CKs; EC 2.7.3.2) are found in mitochondria and specialized subregions of the cytoplasm and catalyze the reversible exchange of high-energy phosphoryl between ATP and phosphocreatine. At least four functionally active genes, which encode the distinct CK subunits CKB, CKM, CKMT1 (ubiquitous), and CKMT2 (sarcomeric), and a variable number of CKB pseudogenes have been identified. Here, we report the use of a CKMT1 containing phage to map the CKMT1 gene by in situ hybridization on both human and mouse chromosomes.

  17. The human gene for neurotrophic tyrosine kinase receptor type 2 (NTRK2) is located on chromosome 9 but is not the familial dysautonomia gene

    SciTech Connect

    Slaugenhaupt, S.A. |; Liebert, C.B.; Lucente, D.E.

    1995-02-10

    The neurotrophic tyrosine kinase receptor type 2 (NTRK2) gene is a member of the trk family of tyrosine protein kinases, which encode receptors for the nerve growth factor-related proteins known as neurotrophins. The neurotrophins and their receptors have long been considered candidate genes for familial dysautonomia (FD), a hereditary sensory neuropathy resulting from the congenital loss of both sensory and autonomic neurons. The DYS gene has recently been mapped to human chromosome 9q31-q33, and therefore we set out to determine the chromosomal localization of the candidate gene NTRK2. A mouse trkB probe was hybridized to both somatic cell hybrids containing human chromosome 9 and a human chromosome 9 flow-sorted cosmid library. The human homologue of trkB, NTRK2, was assigned to chromosome 9. To localize the NTRK2 gene further, a dinucleotide repeat polymorphism was identified within a cosmid that contains NTRK2 exon sequences. This marker was genotyped in the CEPH reference pedigrees and places the NTRK2 gene near D9S1 on the proximal long arm of human chromosome 9. The NTRK2 gene is located approximately 22 cm proximal to DYS and shows several recombinants in disease families. Therefore, the NTRK2 gene can now be excluded as a candidate gene for familial dysautonomia. 18 refs., 1 fig.

  18. Chromosome mapping of the human arrestin (SAG), {beta}-arrestin 2 (ARRB2), and {beta}-adrenergic receptor kinase 2 (ADRBK2) genes

    SciTech Connect

    Calabrese, G.; Sallese, M.; Stornaiuolo, A.

    1994-09-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor and its functional cofactor, {beta}-arrestin. Both {beta}ARK and {beta}-arrestin are members of multigene families. The family of G-protein-coupled receptor kinases includes rhodopsin kinase, {beta}ARK1, {beta}ARK2, IT11-A (GRK4), GRK5, and GRK6. The arrestin/{beta}-arrestin gene family includes arrestin (also known as S-antigen), {beta}-arrestin 1, and {beta}-arrestin 2. Here we report the chromosome mapping of the human genes for arrestin (SAG), {beta}arrestin 2 (ARRB2), and {beta}ARK2 (ADRBK2) by fluorescence in situ hybridization (FISH). FISH results confirmed the assignment of the gene coding for arrestin (SAG) to chromosome 2 and allowed us to refine its localization to band q37. The gene coding for {beta}-arrestin 2 (ARRB2) was mapped to chromosome 17p13 and that coding for {beta}ARK2 (ADRBK2) to chromosome 22q11. 17 refs., 1 fig.

  19. High-LET radiation-induced aberrations in prematurely condensed G2 chromosomes of human fibroblasts

    NASA Technical Reports Server (NTRS)

    Kawata, T.; Gotoh, E.; Durante, M.; Wu, H.; George, K.; Furusawa, Y.; Cucinotta, F. A.; Dicello, J. F. (Principal Investigator)

    2000-01-01

    PURPOSE: To determine the number of initial chromatid breaks induced by low- or high-LET irradiations, and to compare the kinetics of chromatid break rejoining for radiations of different quality. MATERIAL AND METHODS: Exponentially growing human fibroblast cells AG1522 were irradiated with gamma-rays, energetic carbon (290MeV/u), silicon (490MeV/u) and iron (200 and 600 MeV/u). Chromosomes were prematurely condensed using calyculin A. Chromatid breaks and exchanges in G2 cells were scored. PCC were collected after several post-irradiation incubation times, ranging from 5 to 600 min. RESULTS: The kinetics of chromatid break rejoining following low- or high-LET irradiation consisted of two exponential components representing a rapid and a slow time constant. Chromatid breaks decreased rapidly during the first 10min after exposure, then continued to decrease at a slower rate. The rejoining kinetics were similar for exposure to each type of radiation. Chromatid exchanges were also formed quickly. Compared to low-LET radiation, isochromatid breaks were produced more frequently and the proportion of unrejoined breaks was higher for high-LET radiation. CONCLUSIONS: Compared with gamma-rays, isochromatid breaks were observed more frequently in high-LET irradiated samples, suggesting that an increase in isochromatid breaks is a signature of high-LET radiation exposure.

  20. Numerically abnormal chromosome constitutions in humans

    SciTech Connect

    1993-12-31

    Chapter 24, discusses numerically abnormal chromosome constitutions in humans. This involves abnormalities of human chromosome number, including polyploidy (when the number of sets of chromosomes increases) and aneuploidy (when the number of individual normal chromosomes changes). Chapter sections discuss the following chromosomal abnormalities: human triploids, imprinting and uniparental disomy, human tetraploids, hydatidiform moles, anomalies caused by chromosomal imbalance, 13 trisomy (D{sub 1} trisomy, Patau syndrome), 21 trisomy (Down syndrome), 18 trisomy syndrome (Edwards syndrome), other autosomal aneuploidy syndromes, and spontaneous abortions. The chapter concludes with remarks on the nonrandom participation of chromosomes in trisomy. 69 refs., 3 figs., 4 tabs.

  1. Human chromosomes: Structure, behavior, and effects

    SciTech Connect

    Therman, E.; Susman, M.

    1993-12-31

    The book `Human Chromosomes: Structure, Behavior, and Effects` covers the most important topics regarding human chromosomes and current research in cytogenetics. Attention is given both to structure and function of autosomes and sex chromosomes, as well as definitions and causes of chromosomal aberrations. This often involves discussion about various aspects of the cell cycle (both mitosis and meiosis). Methods and techniques involved in researching and mapping human chromosomes are also discussed.

  2. Construction of human chromosome 21-specific yeast artificial chromosomes.

    PubMed

    McCormick, M K; Shero, J H; Cheung, M C; Kan, Y W; Hieter, P A; Antonarakis, S E

    1989-12-01

    Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to greater than 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtained from a mouse-human hybrid, ranging in size from 200 to greater than 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes (corresponding to the YAC ends recovered in Escherichia coli) to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from approximately equal to 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.

  3. Human GluR6 kainate receptor (GRIK2): Molecular cloning, expression, polymorphism, and chromosomal assignment

    SciTech Connect

    Paschen, W.; Blackstone, C.D.; Huganir, R.L. ); Ross, C.A. Max-Planck-Institute for Neurological Research, Koeln )

    1994-04-01

    Glutamate receptors mediate the majority of excitatory neurotransmission in the brain, and molecular cloning studies have revealed several distinct families. Because neuropathological states and possibly human disorders may involve kainate-preferring glutamate receptors, the authors have isolated a cDNA clone for the human GluR6 kainate-preferring receptor. This clone shows a very high sequence similarity with that of the rat, except for a part of the 3[prime] untranslated region in which there is a TAA triplet repeat. When the protein was overexpressed in human embryonic kidney 293 cells, it had a molecular weight, an antibody recognition, and a glutamate ligand-binding profile similar to those of the rate GluR6 receptor. Northern analysis showed expression in both human cerebral and cerebellar cortices. By PCR analysis of rodent-human monochromosomal cell lines, the human GluR6 could be assigned to chromosome 6. The length of the TAA triplet repeat was polymorphic in the normal population, with at least four alleles and an observed heterozygosity of about 45%. These studies should provide the basis for expression or linkage studies of the GluR6 kainate receptor in human disease or neuropathologic states. 53 refs., 7 figs.

  4. Detection of chromosomal abnormalities in human sperm

    SciTech Connect

    Brandriff, B.; Gordon, L.; Ashworth, A.K.; Watchmaker, G.; Carrano, A.V.

    1985-06-19

    A new technology developed by Rudak, et al. for examining the chromosomal constitution of human sperm through fusion with eggs from the Syrian hamster was used to obtain baseline data on the types and frequencies of aberrations in sperm of normal men. The frequency of structural aberrations in 2724 sperm chromosome karyotypes from the 13 healthy non-exposed donors ranged from 2 to 15.8%, demonstrating significant interindividual variability. The most frequently occurring aberrations were chromosome breaks, followed by acentric fragments, chromatid exchanges, chromatid breaks, dicentrics and translocations, chromosome deletions and duplications, inversions, and chromatid deletions. Two donors previously reported had one cell each with multiple chromatid exchanges and breaks. In addition, the oldest donor, AA, had 5 cells out of 124 examined with multiple breaks and rearrangements too extensive to completely identify. 17 refs., 2 tabs.

  5. An integrated approach of comparative genomics and heritability analysis of pig and human on obesity trait: evidence for candidate genes on human chromosome 2

    PubMed Central

    2012-01-01

    Background Traditional candidate gene approach has been widely used for the study of complex diseases including obesity. However, this approach is largely limited by its dependence on existing knowledge of presumed biology of the phenotype under investigation. Our combined strategy of comparative genomics and chromosomal heritability estimate analysis of obesity traits, subscapular skinfold thickness and back-fat thickness in Korean cohorts and pig (Sus scrofa), may overcome the limitations of candidate gene analysis and allow us to better understand genetic predisposition to human obesity. Results We found common genes including FTO, the fat mass and obesity associated gene, identified from significant SNPs by association studies of each trait. These common genes were related to blood pressure and arterial stiffness (P = 1.65E-05) and type 2 diabetes (P = 0.00578). Through the estimation of variance of genetic component (heritability) for each chromosome by SNPs, we observed a significant positive correlation (r = 0.479) between genetic contributions of human and pig to obesity traits. Furthermore, we noted that human chromosome 2 (syntenic to pig chromosomes 3 and 15) was most important in explaining the phenotypic variance for obesity. Conclusions Obesity genetics still awaits further discovery. Navigating syntenic regions suggests obesity candidate genes on chromosome 2 that are previously known to be associated with obesity-related diseases: MRPL33, PARD3B, ERBB4, STK39, and ZNF385B. PMID:23253381

  6. GAD2 on Chromosome 10p12 Is a Candidate Gene for Human Obesity

    PubMed Central

    2003-01-01

    The gene GAD2 encoding the glutamic acid decarboxylase enzyme (GAD65) is a positional candidate gene for obesity on Chromosome 10p11–12, a susceptibility locus for morbid obesity in four independent ethnic populations. GAD65 catalyzes the formation of γ-aminobutyric acid (GABA), which interacts with neuropeptide Y in the paraventricular nucleus to contribute to stimulate food intake. A case-control study (575 morbidly obese and 646 control subjects) analyzing GAD2 variants identified both a protective haplotype, including the most frequent alleles of single nucleotide polymorphisms (SNPs) +61450 C>A and +83897 T>A (OR = 0.81, 95% CI [0.681–0.972], p = 0.0049) and an at-risk SNP (−243 A>G) for morbid obesity (OR = 1.3, 95% CI [1.053–1.585], p = 0.014). Furthermore, familial-based analyses confirmed the association with the obesity of SNP +61450 C>A and +83897 T>A haplotype (χ2 = 7.637, p = 0.02). In the murine insulinoma cell line βTC3, the G at-risk allele of SNP −243 A>G increased six times GAD2 promoter activity (p < 0.0001) and induced a 6-fold higher affinity for nuclear extracts. The −243 A>G SNP was associated with higher hunger scores (p = 0.007) and disinhibition scores (p = 0.028), as assessed by the Stunkard Three-Factor Eating Questionnaire. As GAD2 is highly expressed in pancreatic β cells, we analyzed GAD65 antibody level as a marker of β-cell activity and of insulin secretion. In the control group, −243 A>G, +61450 C>A, and +83897 T>A SNPs were associated with lower GAD65 autoantibody levels (p values of 0.003, 0.047, and 0.006, respectively). SNP +83897 T>A was associated with lower fasting insulin and insulin secretion, as assessed by the HOMA-B% homeostasis model of β-cell function (p = 0.009 and 0.01, respectively). These data support the hypothesis of the orexigenic effect of GABA in humans and of a contribution of genes involved in GABA metabolism in the modulation of food intake and in the development of morbid obesity. PMID

  7. High-resolution comprehensive radiation hybrid maps of the porcine chromosomes 2p and 9p compared with the human chromosome 11.

    PubMed

    Liu, W-S; Yasue, H; Eyer, K; Hiraiwa, H; Shimogiri, T; Roelofs, B; Landrito, E; Ekstrand, J; Treat, M; Paes, N; Lemos, M; Griffith, A C; Davis, M L; Meyers, S N; Yerle, M; Milan, D; Beever, J E; Schook, L B; Beattie, C W

    2008-01-01

    We are constructing high-resolution, chromosomal 'test' maps for the entire pig genome using a 12,000-rad WG-RH panel (IMNpRH2(12,000-rad))to provide a scaffold for the rapid assembly of the porcine genome sequence. Here we present an initial, comparative map of human chromosome (HSA) 11 with pig chromosomes (SSC) 2p and 9p. Two sets of RH mapping vectors were used to construct the RH framework (FW) maps for SSC2p and SSC9p. One set of 590 markers, including 131 microsatellites (MSs), 364 genes/ESTs, and 95 BAC end sequences (BESs) was typed on the IMNpRH2(12,000-rad) panel. A second set of 271 markers (28 MSs, 138 genes/ESTs, and 105 BESs) was typed on the IMpRH(7,000-rad) panel. The two data sets were merged into a single data-set of 655 markers of which 206 markers were typed on both panels. Two large linkage groups of 72 and 194 markers were assigned to SSC2p, and two linkage groups of 84 and 168 markers to SSC9p at a two-point LOD score of 10. A total of 126 and 114 FW markers were ordered with a likelihood ratio of 1000:1 to the SSC2p and SSC9p RH(12,000-rad) FW maps, respectively, with an accumulated map distance of 4046.5 cR(12,000 )and 1355.2 cR(7,000 )for SSC2p, and 4244.1 cR(12,000) and 1802.5 cR(7,000) for SSC9p. The kb/cR ratio in the IMNpRH2(12,000-rad) FW maps was 15.8 for SSC2p, and 15.4 for SSC9p, while the ratio in the IMpRH(7,000-rad) FW maps was 47.1 and 36.3, respectively, or an approximately 3.0-fold increase in map resolution in the IMNpRH(12,000-rad) panel over the IMpRH(7,000-rad) panel. The integrated IMNpRH(12,000-rad) andIMpRH(7,000-rad) maps as well as the genetic and BAC FPC maps provide an inclusive comparative map between SSC2p, SSC9p and HSA11 to close potential gaps between contigs prior to sequencing, and to identify regions where potential problems may arise in sequence assembly. PMID:18467842

  8. Molecular cloning and chromosomal assignment of the human brain-type phosphodiesterase I/nucleotide pyrophosphatase gene (PDNP2)

    SciTech Connect

    Kawagoe, Hiroyuki; Soma, Osamu; Goji, Junko

    1995-11-20

    Phosphodiesterase I/nucleotide pyrophosphatase is a widely expressed membrane-bound enzyme that cleaves diester bonds of a variety of substrates. We have cloned brain-type cDNA for this enzyme from rat brain and designated it PD-I{alpha}. In this study we have isolated cDNA and genomic DNA encoding human PD-I{alpha}. Human PD-I{alpha} cDNA, designated PDNP2 in HGMW nomenclature, has a 2589-nucleotide open reading frame encoding a polypeptide of 863 amino acids with a calculated M{sub r} of 99,034. Northern blot analysis revealed that human PD-I{alpha} transcript was present in brain, lung, placenta, and kidney. The database analysis showed that human PD-I{alpha} was identical with human autotaxin (ATX), a novel tumor motility-stimulating factor, except that human PD-I{alpha} lacks 156 nucleotides and 52 amino acids of human ATX. Human PD-I{alpha} and human ATX are likely to be alternative splicing products from the same gene. The 5{prime} region of the human PDNP2 gene contains four putative binding sites of transcription factor Sp1 without typical TATA or CAAT boxes, and there is a potential octamer binding motif in intron 2. From the results of fluorescence in situ hybridization, the human PDNP2 gene is located at chromosome 8q24.1. 17 refs., 3 figs.

  9. Small Supernumerary Marker Chromosomes in Human Infertility.

    PubMed

    Armanet, Narjes; Tosca, Lucie; Brisset, Sophie; Liehr, Thomas; Tachdjian, Gérard

    2015-01-01

    Small supernumerary marker chromosomes (sSMC) are structurally abnormal chromosomes that cannot be unambiguously identified by banding cytogenetics. The objective of this study was to provide an overview of sSMC frequency and characterization in a context of infertility and to review the literature describing sSMC in relation with male and female infertility. Therefore, a systematic literature review on sSMC associated with infertility was conducted by means of a PubMed literature and a sSMC database (http://ssmc-tl.com/sSMC.html) search. A total of 234 patients with infertility were identified as carriers of sSMC. All chromosomes, except chromosomes 10, 19 and the X, were involved in sSMC, and in 72% the sSMC originated from acrocentric chromosomes. Euchromatic imbalances were caused by the presence of sSMC in 30% of the cases. Putative genes have been identified in only 1.2% of sSMC associated with infertility. The implication of sSMC in infertility could be due to a partial trisomy of some genes but also to mechanical effects perturbing meiosis. Further precise molecular and interphase-architecture studies on sSMC are needed in the future to characterize the relationship between this chromosomal anomaly and human infertility.

  10. [Chromosome abnormalities in human cancer].

    PubMed

    Salamanca-Gómez, F

    1995-01-01

    Recent investigation on the presence of chromosome abnormalities in neoplasias has allowed outstanding advances in the knowledge of malignant transformation mechanisms and important applications in the clinical diagnosis and prognosis of leukaemias, lymphomas and solid tumors. The purpose of the present paper is to discuss the most relevant cytogenetic aberrations, some of them described at the Unidad de Investigación Médica en Genética Humana, Instituto Mexicano del Seguro Social, and to correlate these abnormalities with recent achievements in the knowledge of oncogenes, suppressor genes or antioncogenes, their chromosome localization, and their mutations in human neoplasia; as well as their perspectives in prevention and treatment of cancer that such findings permit to anticipate.

  11. Assignment of the tyrosinase-related protein-2 gene (TYRP2) to human chromosome 13q31-q32 by fluorescence in situ hybridization: Extended synteny with mouse chromosome 14

    SciTech Connect

    Sturm, R.A. ); Baker, E.; Sutherland, G.R. )

    1994-05-01

    A recombinant human genomic liver DNA [lambda]-phage library was screened with the insert of the pHuTRP-2 cDNA clone to isolate a series of bacteriophage with inserts spanning the human TYRP2 gene. One of the [lambda]-phage clones ([lambda]HuT-YRP2-7) containing a 2-kb HindIII fragment with the 5[prime] exon sequence of the cDNA as determined by sequence analysis was used for the gene localization study. DNA prepared from the phage by Qiagen chromatography was nick-translated with biotin-14-dATP and hybridized in situ at a final concentration of 5 ng/[mu]l to metaphases from two normal males. The fluorescence in situ hybridization method was modified from that previously described in that chromosomes were stained before analysis with both propidium iodide as counterstain and DAPI for chromosome identification. Twenty metaphases from the first normal male were examined for fluorescent signal. All of these metaphases showed signal on one or both chromatids of chromosome 13 in the region 13q31-q33; 88% of this signal was at the interface of bands 13q31-q32. There was a total of four nonspecific background dots observed in these 20 metaphases. A similar result was obtained from hybridization of the probe to 20 metaphases from the second normal male (data not shown). This region has also been shown to contain the propionyl coenzyme A carboxylase [alpha]-chain gene by in situ hybridization. The localization of the TYRP2 locus to human chromosome 13q31-q32 extends the syntenic region of chromosome 13 with mouse chromosome 14. 15 refs., 1 fig.

  12. The mouse mutation sarcosinemia (sar) maps to chromosome 2 in a region homologous to human 9q33-q34

    SciTech Connect

    Brunialti, A.L.B.; Guenet, J.L.; Harding, C.O.; Wolff, J.A.

    1996-08-15

    The autosomal recessive mouse mutation sarcosinemia (sar), which was discovered segregating in the progeny of a male whose premeiotic germ cells had been treated with the mutagen ethylnitrosourea, is characterized by a deficiency in sarcosine dehydrogenase activity. Using an intersubspecific cross, we mapped the sar locus to mouse chromosome 2, approximately 15-18 cM from the centromere. The genetic localization of this locus in the mouse allows the identification of a candidate region in human (9q33-q34) where the homologous disease should map. 15 refs., 2 figs.

  13. Assignment of the human pro-melanin-concentrating hormone gene (PMCH) to chromosome 12q23-q24 and two variant genes (PMCHL1 and PMCHL2) to chromosome 5p14 and 5q12-q13

    SciTech Connect

    Pedeutour, F. ); Szpirer, C. ); Nahon, J.L. )

    1994-01-01

    Melanin-concentrating hormone (MCH) is a peptide that has been isolated from salmon pituitary and rat hypothalamus. In mammals, pro-MCH (PMCH) encodes two putative peptides, named NEI and NGE, in addition to MCH. Those peptides are expressed predominantly in hypothalamus and display a broad array of functions in rat brain. The authors have previously mapped the PMCH locus on human chromosome 12q and rat chromosome 7. Genomic cloning has revealed the existence of two distinct MCH genes in human: one authentic and one variant. In this report, they describe Southern blotting analysis with DNA from a panel of somatic cell hybrids and demonstrate that the authentic human MCH (hMCH) gene is located as expected on chromosome 12, while the variant form of hMCH gene is located on chromosome 5. Direct chromosomal assignment of the authentic and variant hMCH genes was obtained by using fluorescence in situ hybridization on metaphase chromosomes. A strong signal was observed in 12q23-q24 with the authentic HMCH genomic DNA probe. Surprisingly, two signals were conspicuously found in 5p14 and 5q12-q13 with different variant hMCH genomic DNA probes. These loci were designated PMCHL1 and PMCHL2. Evidence of physiological and pathological data in rodents together with locus linkage analyses in human suggests that hMCH authentic and variant genes may be involved in human brain disorders. 44 refs., 3 figs., 1 tab.

  14. Human {beta}2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas

    SciTech Connect

    Wewer, U.M.; Durkin, M.E.; Albrechtsen, R.

    1994-11-15

    Overlapping cDNA clones that encode the full-length human laminin {beta}2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature {beta}2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human {beta}2 chain is predicted to have all of the seven structural domains typical of the {beta} chains of laminin, including the short cysteine-rich {alpha} region. The amino acid sequence of human {beta}2 chain showed 86.1% sequence identity to the rat {beta}2 chain, 50.0% to human {beta}1 chain, and 36.3% to the human {beta}3 chain. The greatest sequence identity was in domains VI, V, and III. The sequence of a 24-amino-acid peptide fragment isolated from the {beta}2 chain of laminin purified from human amniotic basement membrane matched the sequence predicted from the cDNA, confirming that the cDNA encodes human {beta}2 laminin. The cDNA was used to assign the gene (LAMB2) to human chromosome 3p21 by in situ hybridization. It is not linked to genes for human laminin chains {alpha}1, {beta}1, and {gamma}1 or other known laminin genes. Immunostaining showed that the {beta}2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous {beta}1 chain is confined to the subendothelial basement membranes. The {beta}2 chain was found in the basement membranes of ovarian carcinomas but not colon carcinomas. These results indicate that the expression of the {beta}2 chain gene is tightly regulated in normal human tissues and in disease. 43 refs., 6 figs., 1 tab.

  15. Regional chromosomal assignments for four members of the myocyte-specific enhancer-binding factor 2 (MEF2) gene family to human chromosomes 15q, 19q, 5q, and 1q

    SciTech Connect

    Hobson, G.M.; Funanage, V.L.; Krahe, R.

    1994-09-01

    MEF2 genes belong to the MADS box family of transcription factors and encode proteins that bind as homo- and heterodimers to a consensus CTA(T/A){sub 4}TAG/A sequence present in the regulatory regions of numerous muscle-specific and growth inducible genes. Sequence analysis of human MEF2 cDNA clones suggested that they arose from alternatively spliced transcripts of four different genes, termed MEF2A-D. We have mapped the MEF2 genes to human chromosomal regions by identifying unique sequences in the 5{prime} or 3{prime} untranslated regions of each clone and using these sequences as PCR primers on the DNA of a human-rodent hybrid clone panel informative for different regions of the human genome. The localization of MEF2A to chromosome 15q, MEF2B to 19q, MEF2C to 5q, and MEF2D to 1q verifies the existence of at least four distinct loci for members of this gene family. The same PCR primers were used to identify individual YAC clones for each gene. Such isolated clones are now being used for fluorescence in situ hybridization for high resolution chromosomal regional assignment.

  16. Human collagen genes encoding basement membrane. cap alpha. 1(IV) and. cap alpha. 2(IV) chains map to the distal long arm of chromosome 13

    SciTech Connect

    Griffin, C.A.; Emanuel, B.S.; Hansen, J.R.; Cavenee, W.K.; Myers, J.C.

    1987-01-01

    At least 20 genes encode the structurally related collagen chains that comprise > 10 homo- or heterotrimeric types. Six members of this multigene family have been assigned to five chromosomes in the human genome. The two type I genes, ..cap alpha..1 and ..cap alpha..2, are located on chromosomes 17 and 7, respectively, and the ..cap alpha..1(II) gene is located on chromosome 12. Their recent mapping of the ..cap alpha..1(III) and ..cap alpha..2(V) genes to the q24.3 ..-->.. q31 region of chromosome 2 provided the only evidence that the collagen genes are not entirely dispersed. To further determine their organization, the authors and others localized the ..cap alpha..1(IV) gene to chromosome 13 and in their experiments sublocalized the gene to band q34 by in situ hybridization. Here they show the presence of the ..cap alpha..2 type IV locus also on the distal long arm of chromosome 13 by hybridizing a human ..cap alpha..2(IV) cDNA clone to rodent-human hybrids and to metaphase chromosomes. These studies represent the only demonstration of linkage between genes encoding both polypeptide chains of the same collagen type.

  17. Strategies for sequencing human chromosome 16

    SciTech Connect

    Sutherland, G.R.

    1996-06-01

    This project funded for four years (02.92 to 01.96) was a renewal of a project funded for 2.5 years (07.89 to 01.92). This report covers the period 07.89 to 07.94. The original project was entitled {open_quotes}Correlation of physical and genetic maps of Human Chromosome 16{close_quotes}. The aim over this period was to construct a cytogenetic-based physical map of chromosome 16, to enable integration of its physical and genetic maps. This was achieved by collaboration and isolation of new markers until each bin on the physical map contained a polymorphic marker on the linkage map. A further aim was to integrate all mapping data for this chromosome and to achieve contig closure over band q24.

  18. Localization of a highly conserved human potassium channel gene (NGK2-KV4-KCNC1) to chromosome 11p15

    SciTech Connect

    Ried, T.; Ward, D.C. ); Rudy, B.; Miera, V.S. de; Lau, D.; Sen, K. )

    1993-02-01

    Several genes (the Shaker or Sh gene family) encoding components of voltage-gated K[sub +] channels have been identified in various species. Based on sequence similarities Sh genes are classified into four groups or subfamilies. Mammalian genes of each one of these subfamilies also show high levels of sequence similarity to one of four related Drosophila genes: Shaker, Shab, Shaw, and Shal. Here we report the isolation of human cDNAs for a Shaw-related product (NGK2,KV2.1a) previously identified in rat and mice. A comparison of the nucleotide and deduced amino acid sequence of NGK2 in rodents and humans shows that this product is highly conserved in mammals; the human NGK2 protein shows over 99% amino acid sequence identity to its rodent homologue. The gene (NGK2-KV4; KCNC1) encoding NGK2 was mapped to human chromosome 11p15 by fluorescence in situ hybridization with the human NGK2 cDNAs. 65 refs., 2 figs., 1 tab.

  19. An updated phylogeny of the human Y-chromosome lineage O2a-M95 with novel SNPs.

    PubMed

    Zhang, Xiaoming; Kampuansai, Jatupol; Qi, Xuebin; Yan, Shi; Yang, Zhaohui; Serey, Bun; Sovannary, Tuot; Bunnath, Long; Aun, Hong Seang; Samnom, Ham; Kutanan, Wibhu; Luo, Xin; Liao, Shiyu; Kangwanpong, Daoroong; Jin, Li; Shi, Hong; Su, Bing

    2014-01-01

    Though the Y-chromosome O2a-M95 lineage is one of the major haplogroups present in eastern Asian populations, especially among Austro-Asiatic speaking populations from Southwestern China and mainland Southeast Asia, to date its phylogeny lacks structure due to only one downstream SNP marker (M88) assigned to the lineage. A recent array-capture-based Y chromosome sequencing of Asian samples has yielded a variety of novel SNPs purportedly belonging to the O2a-M95 lineage, but their phylogenetic positions have yet to be determined. In this study, we sampled 646 unrelated males from 22 Austro-Asiatic speaking populations from Cambodia, Thailand and Southwestern China, and genotyped 12 SNP makers among the sampled populations, including 10 of the newly reported markers. Among the 646 males, 343 belonged to the O2a-M95 lineage, confirming the supposed dominance of this Y chromosome lineage in Austro-Asiatic speaking populations. We further characterized the phylogeny of O2a-M95 by defining 5 sub-branches: O2a1*-M95, O2a1a-F789, O2a1b*-F1252, O2a1b1*-M88 and O2a1b1a -F761. This updated phylogeny not only improves the resolution of this lineage, but also allows for greater tracing of the prehistory of human populations in eastern Asia and the Pacific, which may yield novel insights into the patterns of language diversification and population movement in these regions.

  20. An updated phylogeny of the human Y-chromosome lineage O2a-M95 with novel SNPs.

    PubMed

    Zhang, Xiaoming; Kampuansai, Jatupol; Qi, Xuebin; Yan, Shi; Yang, Zhaohui; Serey, Bun; Sovannary, Tuot; Bunnath, Long; Aun, Hong Seang; Samnom, Ham; Kutanan, Wibhu; Luo, Xin; Liao, Shiyu; Kangwanpong, Daoroong; Jin, Li; Shi, Hong; Su, Bing

    2014-01-01

    Though the Y-chromosome O2a-M95 lineage is one of the major haplogroups present in eastern Asian populations, especially among Austro-Asiatic speaking populations from Southwestern China and mainland Southeast Asia, to date its phylogeny lacks structure due to only one downstream SNP marker (M88) assigned to the lineage. A recent array-capture-based Y chromosome sequencing of Asian samples has yielded a variety of novel SNPs purportedly belonging to the O2a-M95 lineage, but their phylogenetic positions have yet to be determined. In this study, we sampled 646 unrelated males from 22 Austro-Asiatic speaking populations from Cambodia, Thailand and Southwestern China, and genotyped 12 SNP makers among the sampled populations, including 10 of the newly reported markers. Among the 646 males, 343 belonged to the O2a-M95 lineage, confirming the supposed dominance of this Y chromosome lineage in Austro-Asiatic speaking populations. We further characterized the phylogeny of O2a-M95 by defining 5 sub-branches: O2a1*-M95, O2a1a-F789, O2a1b*-F1252, O2a1b1*-M88 and O2a1b1a -F761. This updated phylogeny not only improves the resolution of this lineage, but also allows for greater tracing of the prehistory of human populations in eastern Asia and the Pacific, which may yield novel insights into the patterns of language diversification and population movement in these regions. PMID:24972021

  1. Human tissue factor pathway inhibitor (TFPI) gene: Complete genomic structure and localization on the genetic map of chromosome 2q

    SciTech Connect

    Enjyoji, Kei-ichi; Emi, Mitsuru; Mukai, Tsunehiro; Imada, Motohiro; Kato, Hisao ); Leppert, M.L.; Lalouel, J.M. Univ. of Utah Medical School, Salt Lake City, UT )

    1993-08-01

    Tissue factor pathway inhibitor (TFPI), a protease inhibitor that circulates in association with plasma lipoproteins (VLDL, LDL and HDL), helps to regulate the extrinsic blood coagulation cascade. The authors have cloned a 125-kb genomic region containing the entire human TFPI gene on six overlapping cosmids and prepared a restriction map of this contig to clarify gene structure. More than half (45 kb) of the 85-kb gene is occupied with 5[prime] noncoding elements: coding begins at exon 3. A HindIII RFLP identified with one cosmid was genotyped in the CEPH panel of 559 reference families. Linkage analysis using markers on human chromosome 2 located the TFPI gene on 2q, 36 cM proximal to D2S43(pYNZ15) and 13 cM distal to the crystalline [gamma]-polypeptide locus CRYGP1(p5G1). 31 refs., 3 figs., 3 tabs.

  2. Comparative mapping on the mouse and human X chromosomes of a human cDNA clone encoding the vasopressin renal-type receptor (AVP2R)

    SciTech Connect

    Faust, C.J.; Gonzales, J.C.; Seibold, A.; Birnbaumer, M.; Herman, G.E. )

    1993-02-01

    Mutation in the gene for the human renal-type vasopressin receptor (V2R) have recently been identified in patients with nephrogenic diabetes insipidus (NDI). Both V2R and NDI have been independently mapped to Xq28. Using a combination of genetic and physical mapping, we have localized the murine V2r locus to within 100 kb of L1Cam on the mouse X chromosome in a region syntenic with human Xq28. Based on conserved gene order of mouse and human loci in this region, physical mapping using DNA derived form human lymphoblasts has established that the corresponding human loci V2R and L1CAM are linked within 210 kb. The efficiency and precision of genetic mapping of V2r and other loci in the mouse suggest that it might be easier to map additional human genes in the mouse first and infer the corresponding human location. More precise physical mapping in man could then be performed using pulsed-field gel electrophoresis and/or yeast artificial chromosomes. 16 refs., 1 fig. 1 tab.

  3. A region of consistent deletion in neuroblastoma maps within human chromosome 1p36.2-36.3

    SciTech Connect

    White, P.S.; Maris, J.M.; Beltinger, C.

    1995-06-06

    Deletion of the short arm of human chromosome 1 is the most common cytogenetic abnormality observed in neuroblastoma. To characterize the region of consistent deletion, we performed loss of heterozygosity (LOH) studies on 122 neuroblastoma tumor samples with 30 distal chromosome 1p polymorphisms. LOH was detected in 32 of the 122 tumors (26%). A single region of LOH, marked distally by D1Z2 and proximally by D1S228, was detected in all tumors demonstrating loss. Also, cells from a patient with a constitutional deletion of 1p36, and from a neuroblastoma cell line with a small 1p36 deletion, were analyzed by fluorescence in situ hybridization. Cells from both sources had interstitial deletions of 1p36.2-36.3 which overlapped the consensus region of LOH defined by the tumors. Interstitial deletion in the constitutional case was confirmed by allelic loss studies using the panel of polymorphic markers. Four proposed candidate genes-DAN, ID3 (heir-1), CDC2L1 (p58), and TNFR2-were shown to lie outside of the consensus region of allelic loss, as defined by the above deletions. These results more precisely define the location of a neuroblastoma suppressor gene within 1p36.2-36.3, eliminating 33 centimorgans of proximal 1p36 from consideration. Furthermore, a consensus region of loss, which excludes the four leading candidate genes, was found in all tumors with 1p36 LOH. 31 refs., 4 figs.

  4. Chromosomal DNA Replication Pattern in Human Tumour Cells in vitro

    PubMed Central

    Kucheria, Kiran

    1970-01-01

    The present paper deals with the chromosomal DNA replication pattern in human solid tumour cells in vitro. This was studied at the terminal stages of the S-period. All the cell lines of female origin showed a late replicating chromosome in group XX6-12. In cell lines of male origin one of the chromosomes of group 21-22Y was later replicating than the rest of the members of the group. The DNA replication pattern of the autosomes and the sex chromosomes was similar to that of the cultured human leucocytes. The results of the present study show that the DNA replication pattern of the chromosome in neoplastic cells is basically unchanged despite the changes in the chromosome number and morphology. Therefore the abnormal behaviour of the neoplastic cells cannot be related to the changes in the pattern of the chromosomal DNA replication. ImagesFig. 5Fig. 1Fig. 6Fig. 2Fig. 3Fig. 4 PMID:5475754

  5. Assignment of the human cytosolic acetoacetyl-coenzyme a thiolase (ACAT2) gene to chromosome 6q25.3-q26

    SciTech Connect

    Masuno, Mitsuo; Imaizumi, Kiyoshi; Kuroki, Yoshikazu

    1996-08-15

    This report describes the localization of the human cytosolic acetoacetyl-coenzyme A thiolase (ACAT2) gene to human chromosome 6q25.3-q26 using fluorescence in situ hybridization. ACAT2 is involved in steroid biosynthesis; deficiency of this coenzyme results in a phenotype which includes severe mental retardation. 11 refs., 1 fig.

  6. The mouse homologue of the tuberin gene (TSC2) maps to a conserved synteny group between mouse chromosome 17 and human 16p13.3

    SciTech Connect

    Olsson, P.G.; Sutherland, H.F.; Nowicka, U.

    1995-01-01

    The tuberous sclerosis gene (TSC2) on human chromosome 16p13.3 has recently been identified. Several markers from this region have previously been shown to be members of a conserved synteny group, in the mouse located on chromosome 17. The mouse region includes markers D17Lon1, D17Lon2, D17Lon3, and D17Lon4, which are linked to the {alpha}-globin pseudogene Hba-ps4 on chromosome 17, while the corresponding human markers, NK12, NK92, sazD, and KM17, are linked to the functional {alpha}-globin locus near the tip of chromosome 16p. Since the human TSC2 maps in close proximity to NK12, we wanted to investigate whether a mouse gene, homologous to TSC2, was present on mouse chromosome 17 and thus included in the conserved synteny group. During the characterization of transcripts from the human PKD1 region on human chromosome 16p13.3, we isolated three short clones encoding fragments of TSC2 from a human fetal brain cDNA library enriched for transcripts from the PKD1 region. These TSC2 clones were used as probes to screen a mouse teratocarcinoma (PCC4) cDNA library (Stratagene), at a final stringency of 0.3 x SSC, 0.1% SDS at 65{degrees}C. One of the positive clones isolated, mTS-1, had a 2.8-kb insert. Two hundred bases from each end of the insert were sequenced, showing 88 and 83.5% identity to the human tuberin nucleotide sequence, with the 5{prime} end of the clone starting at position 2351 and the 3{prime} end ending at position 5265. The high degree of homology to the human tuberin sequence suggests that clone mTS-1 is indeed derived from the mouse homologue of TSC2. 11 refs., 1 fig.

  7. Functional structure of the human X chromosome

    SciTech Connect

    1993-12-31

    Chapter 23, describes the functional structure of the human X chromosome. It provides a functional map of the human X chromosome, discussing in depth the inactivation center, always-active regions, and critical region. Finally, it provides a summary of X inactivation. 34 refs., 4 figs.

  8. Patterns of recombination on human chromosome 22

    SciTech Connect

    Schlumpf, K.S.; Kim, D.; Haines, J.L.

    1994-09-01

    Virtually all genetic linkage maps generated to date are gross averages across individuals, ages, and (often) sexes. In addition, although some level of positive interference has been assumed, until recently little evidence to support this in humans has been available. The major stumbling block has been the quality of the data available, since even a few genotypic errors can have drastic effects on both the map length and the number of apparent recombinants. In addition, variation in recombination by factors other than sex have pretty much been ignored. To explore recombination in more detail, we have generated a microsatellite marker map of human chromosome 22. This map includes 32 markers genotyped through 46 sibships of the Venezuelan Reference Pedigree (VRP). Extensive error checking and regenotyping was performed to remove as many genotypic errors as possible, but no genotypes were removed simply because they created unlikely events. The following 1000:1 odds map has been obtained: cen--F8VWFP1--11--S264--3-S311--4--S257--2--TOP1P2--3--S156--1--CRYB2--1--S258--2--S310--6--S193--1--S275--3--S268--1--S280--4--S304--3--S283--2--LiR1--3--IL2RB--3--S299--1--S302--1--S537--2--S270--4--PDGF--8--S274--qter. The female map (91 cM) is twice as long as the male map (46 cM) and the log-likelihood difference in the maps (22.3) is highly significant (P=0.001, df=22) and appears constant across the chromosome. Analysis of recombination with age showed no particular trends for either males or females when chromosomes were grouped into three categories (20, 20-30, 30+) by parental age at birth of child. Positive interference was found in maternally derived chromosomes ({chi}{sup 2}=30.5 (4), p<0.005), but not in paternally derived chromosomes ({chi}{sup 2}=6.24 (3), P=0.10). This contrasts to data from chromosomes 9 and 21 where positive interference was found for both sexes. More detailed analyses are in progress.

  9. Chromosomal localization of mouse and human genes encoding the splicing factors ASF/SF2 (SFRS1) and SC-35 (SFRS2)

    SciTech Connect

    Bermingham, J.R. Jr.; Arden, K.C.; Viars, C.S.

    1995-09-01

    The mammalian SR-type splicing factors ASF/SF2 and SC-35 play crucial roles in pre-mRNA splicing and have been shown to shift splice site choice in vitro. We have mapped the ASF/SF2 gene in mice and humans and the SC-35 gene in mice. Somatic cell hybrid mapping of the human ASF/SF2 gene (SFRS1 locus) reveals that it resides on chromosome 17, and fluorescence in situ hybridization refines this localization to 17q21.3-q22. Recombinant inbred mapping of the mouse ASF/ SF2 gene (Sfrs1 locus) and the mouse SC-35 gene (Sfrs2 locus) demonstrates that both genes are located in a part of mouse chromosome 11 that is homologous to human chromosome 17. Mapping of Sfrs1 using F{sub 1} hybrid backcross mice between the strains C57BL/6 and DDK places Sfrs1 very near the marker D11Mit38 and indicates that the ASF/SF2 gene is closely linked to the Ovum mutant locus. 59 refs., 5 figs., 5 tabs.

  10. [The evolution of human Y chromosome].

    PubMed

    Yang, Xianrong; Wang, Meiqin; Li, Shaohua

    2014-09-01

    The human Y chromosome is always intriguing for researchers, because of its role in gender determination and its unusual evolutionary history. The Y chromosome evolves from an autosome, and its evolution has been characterized by massive gene decay. The lack of recombination and protein-coding genes and high content of repetitive sequences have hindered the progress in our understanding of the Y chromosome biology. Recently, with the advances in comparative genomics and sequencing technology, the research on Y chromosome has become a hotspot, with an intensified debate about Y-chromosome final destination resulting from degeneration. This review focuses on the structure, inheritance characteristics, gene content, and the origin and evolution of Y chromosome. We also discuss the long-term destiny of Y chromosome.

  11. A Plain English Map of the Human Chromosomes.

    ERIC Educational Resources Information Center

    Offner, Susan

    1992-01-01

    Presents a chromosome map for 19 known chromosomes in human genetics. Describes the characteristics attributed to the genetic codes for each of the chromosomes and discusses the teaching applications of the chromosome map. (MDH)

  12. Identification of a novel zinc finger protein gene (ZNF298) in the GAP2 of human chromosome 21q

    SciTech Connect

    Shibuya, Kazunori; Kudoh, Jun; Okui, Michiyo; Shimizu, Nobuyoshi . E-mail: shimizu@dmb.med.keio.ac.jp

    2005-07-01

    We have isolated a novel zinc finger protein gene, designated ZNF298, as a candidate gene for a particular phenotype of Down syndrome or bipolar affective disorder (BPAD) which maps to human chromosome 21q22.3. ZNF298 gene consists of 25 exons spanning approximately 80 kb in a direction from the telomere to centromere. There are four kinds of transcripts that harbor three types of 3' UTR. These four transcripts (ZNF298a, ZNF298b, ZNF298c, and ZNF298d) contain putative open reading frames encoding 1178, 1198, 555, and 515 amino acids, respectively. ZNF298 gene was ubiquitously expressed in various tissues at very low level. The protein motif analysis revealed that ZNF298 proteins contain a SET [Su(var)3-9, Enhancer-of-zeste, Trithorax] domain, multiple C2H2-type zinc finger (ZnF{sub C}2H2) domains, several nuclear localization signals (NLSs), and PEST sequences. Nuclear localization of ZNF298 protein was confirmed by transfection of expression vector of GFP-tagged protein into two human cell lines. Interestingly, this gene crosses over a clone gap (GAP2) remaining in the band 21q22.3. We obtained the DNA fragments corresponding to GAP2 using ZNF298 cDNA sequence as anchor primers for PCR and determined its genomic DNA sequence.

  13. The fibulin-1 gene (FBLN1) is located on human chromosome 22 and on mouse chromosome 15

    SciTech Connect

    Mattei, M.G.; Pan, T.C.; Zhang, R.Z.

    1994-07-15

    Fibulin-1 is a calcium-binding glycoprotein present in the extracellular matrix and in the serum. The gene coding for fibulin-1 (FBLN1) was located by in situ hybridization of {sup 3}H-labeled cDNA probes to human and mouse metaphase chromosomes. The gene was assigned to the q13.2-q13.3 region of human chromosome 22 and to the E-F band of mouse chromosome 15. The finding extends the evolutionary conservation between human chromosome 22 and mouse chromosome 15. 11 refs., 2 figs.

  14. Human cardiac troponin T: Identification of fetal isoforms and assignment of the TNNT2 locus to chromosome 1q

    SciTech Connect

    Townsend, P.J.; Farza, H.; Yacoub, M.H.; Barton, P.J.R. ); MacGeoch, C.; Spurr, N.K. ); Wade, R. ); Gahlmann, R. )

    1994-05-15

    The troponin complex is located on the thin filament of striated muscle and is composed of three component polypeptides: Troponin T, troponin I, and troponin C. Three troponin T genes have been described on the basis of molecular cloning in humans and other vertebrates. These are expressed in a tissue-specific manner and encode the troponin T isoforms expressed in cardiac muscle, slow skeletal muscle, and fast skeletal muscle, respectively. Each of these genes is subject to alternative splicing, resulting in the production of multiple tissue-specific isoforms. The authors have cloned cDNAs encoding human cardiac troponin T from adult heart and have used these to demonstrate that multiple cardiac troponin T mRNAs are present in the human fetal heart, resulting from alternative splicing in the 5[prime] coding region of the gene. Hybridization of the cloned cDNAs to genomic DNA identifies a single-copy gene, and using somatic cell hybrid analysis, the authors have mapped the corresponding gene locus (designated TNNT2) to the long arm of chromosome 1 (1cen-qter). 52 refs., 2 figs., 1 tab.

  15. Identification of the locus for human polymorphic cataract on chromosome 2 near gamma-crystallin gene cluster

    SciTech Connect

    Rogaev, E.I.; Rogaeva, E.A.; Keryanov, S.

    1994-09-01

    Cataract is the leading cause of blindness in human population. While positive linkage data have been obtained for some forms of inherited cataract, no evidence for mutations in any genes have been reported for human inherited cataract existing as an isolated abnormality. Previously, we have described the autosomal dominant polymorphic congenital cataract (PCC) which is characterized by partial opacity located between the fetal nucleus of the lens and the equator. The number, color and form of opacity is varied. We described pedigrees with 73 affected individuals, and used this in a linkage analysis with a set of polymorphic DNA markers randomly placed across the genome as well as with markers selected from some of the candidate genes or from nearby chromosomal regions. We have found evidence for segregation of a cataract locus with DNA markers from 2q36. The causative genetic defect has been mapped to a 20 cM interval which includes a cluster of gamma-crystallin genes. The gamma-crystallin proteins are abundant soluble low molecular weight proteins in the lens. We have used the trinucleotide repeat polymorphic markers from intron 2 of gamma-crystallin B gene and found the segregation of this marker with the disease with no evidence for recombination in the pedigree containing 62 affected individuals. These data suggest that the non-nuclear forms of human cataract may be caused by defects in gamma-crystallin genes.

  16. Mapping genes on human chromosome 20

    SciTech Connect

    Keith, T.; Phipps, P.; Serino, K.

    1994-09-01

    While a substantial number of genes have been physically localized to human chromosome 20, few have been genetically mapped. In the process of developing a genetic linkage map of chromosome 20, we have mapped microsatellite polymorphisms associated with six genes. Three of these had highly informative polymorphisms (greater than 0.70) that were originally identified by other investigators. These include avian sarcoma oncogene homolog (SRC), ribophorin II (RPN2), and phosphoenolpyruvate carboxykinase (PCK1). Polymorphisms associated with two genes were determined following a screen of their DNA sequences in GenBank. These include dinucleotide polymorphisms in introl II of cystatin c (CST3) and in the promoter region of neuroendocrine convertase 2 (NEC2) with heterozygosities of 0.52 and 0.54, respectively. A sixth gene, prodynorphin (PDYN) was mapped following the identification of a dinucleotide repeat polymorphism (heterozygosity of 0.35) in a cosmid subclone from a YAC homologous to the original phage clone. CA-positive cosmid subclones from a YAC for an additional gene, guanine nucleotide binding protein, alpha (GNAS10), have been identified and sequencing is in progress. Similar efforts were utilized to identify a microsatellite polymorphism from a half-YAC cloned by W. Brown and localized by FISH to 20pter. This polymorphism is highly informative, with a heterozygosity of 0.83, and serves to delimit the genetic map of the short arm of this chromosome.

  17. The human serotonin N-acetyltransferase (EC 2.3.1.87) gene (AANAT): Structure, chromosomal localization, and tissue expression

    SciTech Connect

    Coon, S.L.; Bernard, M.; Roseboom, P.H.

    1996-05-15

    Serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase, AA-NAT, HGMW-approved symbol AANAT;EC 2.3.1.87) is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. We have found that the human AA-NAT gene spans {approx}2.5 kb, contains four exons, and is located at chromosome 17q25. The open reading frame encodes a 23.2-kDa protein that is {approx}80% identical to sheep and rat AA-NAT. The AA-NAT transcript ({approx}1 kb) is highly abundant in the pineal gland and is expressed at lower levels in the retina and in the Y79 retinoblastoma cell line. AA-NAT mRNA is also detectable at low levels in several brain regions and the pituitary gland, but not in several peripheral tissues examined. Brain and pituitary AA-NAT could modulate serotonin-dependent aspects of human behavior and pituitary function. 31 refs., 5 figs.

  18. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  19. Chromosome

    MedlinePlus

    Chromosomes are structures found in the center (nucleus) of cells that carry long pieces of DNA. DNA ... is the building block of the human body. Chromosomes also contain proteins that help DNA exist in ...

  20. A Comprehensive Genetic Map of Murine Chromosome 11 Reveals Extensive Linkage Conservation between Mouse and Human

    PubMed Central

    Buchberg, A. M.; Brownell, E.; Nagata, S.; Jenkins, N. A.; Copeland, N. G.

    1989-01-01

    Interspecific backcross animals from a cross between C57BL/6J and Mus spretus mice were used to generate a comprehensive linkage map of mouse chromosome 11. The relative map positions of genes previously assigned to mouse chromosome 11 by somatic cell hybrid or genetic backcross analysis were determined (Erbb, Rel, Il-3, Csfgm, Trp53-1, Evi-2, Erba, Erbb-2, Csfg, Myhs, Cola-1, Myla, Hox-2 and Pkca). We also analyzed genes that we suspected would map to chromosome 11 by virtue of their location in human chromosomes and the known linkage homologies that exist between murine chromosome 11 and human chromosomes (Mpo, Ngfr, Pdgfr and Fms). Two of the latter genes, Mpo and Ngfr, mapped to mouse chromosome 11. Both genes also mapped to human chromosome 17, extending the degree of linkage conservation observed between human chromosome 17 and mouse chromosome 11. Pdgfr and Fms, which are closely linked to Il-3 and Csfgm in humans on chromosome 5, mapped to mouse chromosome 18 rather than mouse chromosome 11, thereby defining yet another conserved linkage group between human and mouse chromosomes. The mouse chromosome 11 linkage map generated in these studies substantially extends the framework for identifying homologous genes in the mouse that are involved in human disease, for elucidating the genes responsible for several mouse mutations, and for gaining insights into chromosome evolution and genome organization. PMID:2567264

  1. Structure and linkage of the D2 dopamine receptor and neural cell adhesion molecule genes on human chromosome 11q23

    SciTech Connect

    Eubanks, J.H.; Djabali, M.; Selleri, L.; McElligott, D.L.; Evans, G.A. ); Grandy, D.K.; Civelli, O. )

    1992-12-01

    The gene encoding the D2 dopamine receptor (DRD2) is located on human chromosome 11q23 and has been circumstantially associated with a number of human disorders including Parkinson's disease, schizophrenia, and susceptibility to alcoholism. To determine the physical structure of the DRD2 gene, the authors utilized cosmid cloning, isolation of yeast artificial chromosomes (YACs), and pulsed-field gel electrophoresis to construct a long-range physical map of human chromosome 11q23 linking the genes for the DRD2 and neural cell adhesion molecule (NCAM). The D2 dopamine receptor gene extends over 270 kb and includes an intron of approximately 250 kb separating the putative first exon from the exons encoding the receptor protein. The resulting physical map spans more than 1.5 mb of chromosome band 11q23 and links the DRD2 gene with the gene encoding the NCAM located 150 kb 3[prime] of the DRD2 gene and transcribed from the same DNA strand. They additionally located the sites of at least four hypomethylated HTF islands within the physical map, which potentially indicate the sites of additional genes. High-resolution fluorescent in situ suppression hybridization using cosmid and YAC clones localized this gene cluster between the ApoAI and STMY loci at the interface of bands 11q22.3 and 11q23.1. 40 refs., 6 figs., 2 tabs.

  2. Localization of the DCTN1 gene encoding p150{sup Glued} to human chromosome 2p13 by fluorescence in situ hybridization

    SciTech Connect

    Holzbaur, E.L.F.; Tokito, M.K.

    1996-02-01

    This report discusses the genetic mapping of the DCTN1 gene to human chromosome 2p13 using fluorescence in situ hybridization. This gene encodes the largest polypeptide of the dynactin complex, which is one of two microtubule-based biological motor protein complexes. 12 refs., 1 fig.

  3. Disruption of human vigilin impairs chromosome condensation and segregation.

    PubMed

    Wei, Ling; Xie, Xiaoyan; Li, Junhong; Li, Ran; Shen, Wenyan; Duan, Shuwang; Zhao, Rongce; Yang, Wenli; Liu, Qiuying; Fu, Qiang; Qin, Yang

    2015-11-01

    Appropriate packaging and condensation are critical for eukaryotic chromatin's accommodation and separation during cell division. Human vigilin, a multi-KH-domain nucleic acid-binding protein, is associated with alpha satellites of centromeres. DDP1, a vigilin's homolog, is implicated with chromatin condensation and segregation. The expression of vigilin was previously reported to elevate in highly proliferating tissues and increased in a subset of hepatocellular carcinoma patients. Other studies showed that vigilin interacts with CTCF, contributes to regulation of imprinted genes Igf2/H19, and colocalizes with HP1α on heterochromatic satellite 2 and β-satellite repeats. These studies indicate that human vigilin might be involved in chromatin remodeling and regular cell growth. To investigate the potential role of human vigilin in cell cycle, the correlations between vigilin and chromosomal condensation and segregation were studied. Depletion of human vigilin by RNA interference in HepG2 cells resulted in chromosome undercondensation and various chromosomal defects during mitotic phase, including chromosome misalignments, lagging chromosomes, and chromosome bridges. Aberrant polyploid nucleus in telophase was also observed. Unlike the abnormal staining pattern of chromosomes, the shape of spindle was normal. Furthermore, the chromatin showed a greater sensitivity to MNase digestion. Collectively, our findings show that human vigilin apparently participates in chromatin condensation and segregation.

  4. Disruption of human vigilin impairs chromosome condensation and segregation.

    PubMed

    Wei, Ling; Xie, Xiaoyan; Li, Junhong; Li, Ran; Shen, Wenyan; Duan, Shuwang; Zhao, Rongce; Yang, Wenli; Liu, Qiuying; Fu, Qiang; Qin, Yang

    2015-11-01

    Appropriate packaging and condensation are critical for eukaryotic chromatin's accommodation and separation during cell division. Human vigilin, a multi-KH-domain nucleic acid-binding protein, is associated with alpha satellites of centromeres. DDP1, a vigilin's homolog, is implicated with chromatin condensation and segregation. The expression of vigilin was previously reported to elevate in highly proliferating tissues and increased in a subset of hepatocellular carcinoma patients. Other studies showed that vigilin interacts with CTCF, contributes to regulation of imprinted genes Igf2/H19, and colocalizes with HP1α on heterochromatic satellite 2 and β-satellite repeats. These studies indicate that human vigilin might be involved in chromatin remodeling and regular cell growth. To investigate the potential role of human vigilin in cell cycle, the correlations between vigilin and chromosomal condensation and segregation were studied. Depletion of human vigilin by RNA interference in HepG2 cells resulted in chromosome undercondensation and various chromosomal defects during mitotic phase, including chromosome misalignments, lagging chromosomes, and chromosome bridges. Aberrant polyploid nucleus in telophase was also observed. Unlike the abnormal staining pattern of chromosomes, the shape of spindle was normal. Furthermore, the chromatin showed a greater sensitivity to MNase digestion. Collectively, our findings show that human vigilin apparently participates in chromatin condensation and segregation. PMID:26032007

  5. Correlation of physical and genetic maps of human chromosome 16

    SciTech Connect

    Sutherland, G.R.

    1991-01-01

    This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentially 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.

  6. Chromosome Conformation of Human Fibroblasts Grown in 3-Dimensional Spheroids

    PubMed Central

    Chen, Haiming; Comment, Nicholas; Chen, Jie; Ronquist, Scott; Hero, Alfred; Ried, Thomas; Rajapakse, Indika

    2015-01-01

    In the study of interphase chromosome organization, genome-wide chromosome conformation capture (Hi-C) maps are often generated using 2-dimensional (2D) monolayer cultures. These 2D cells have morphological deviations from cells that exist in 3-dimensional (3D) tissues in vivo, and may not maintain the same chromosome conformation. We used Hi-C maps to test the extent of differences in chromosome conformation between human fibroblasts grown in 2D cultures and those grown in 3D spheroids. Significant differences in chromosome conformation were found between 2D cells and those grown in spheroids. Intra-chromosomal interactions were generally increased in spheroid cells, with a few exceptions, while inter-chromosomal interactions were generally decreased. Overall, chromosomes located closer to the nuclear periphery had increased intra-chromosomal contacts in spheroid cells, while those located more centrally had decreased interactions. This study highlights the necessity to conduct studies on the topography of the interphase nucleus under conditions that mimic an in vivo environment. PMID:25738643

  7. Human endopeptidase (THOP1) is localized on chromosome 19 within the linkage region for the late-onset Alzheimer disease AD2 locus

    SciTech Connect

    Meckelein, B.; Abraham, C.R.; De Silva, H.A.R.

    1996-01-15

    A cDNA encoding the rat endopeptidase 24.15 was used to determine the chromosomal localization of the respective human gene. Hybridization to DNA from human-rodent somatic cell hybrids assigned the human gene to chromosome 19. Fluorescence in situ hybridization on human metaphase chromosomes localized the human endopeptidase 24.15 to 19q13.3. 27 refs., 1 fig., 1 tab.

  8. Noninvolvement of the X chromosome in radiation-induced chromosome translocations in the human lymphoblastoid cell line TK6

    SciTech Connect

    Jordan, R.; Schwartz, J.L. )

    1994-03-01

    Fluorescence in situ hybridization procedures were used to examine the influence of chromosome locus on the frequency and type of chromosome aberrations induced by [sup 60]Co [gamma] rays in the human lymphoblastoid cell line TK6. Aberrations involving the X chromosome were compared to those involving the similarly sized autosome chromosome 7. When corrected for DNA content, acentric fragments were induced with equal frequency in the X and 7 chromosomes. Dose-dependent increases in chromosomal interchanges involving chromosome 7 were noted, and the frequencies of balanced translocations and dicentrics produced were approximately equal. Chromosome interchanges involving the X chromosome were rare and showed no apparent dose dependence. Thus, while chromosomes 7 and X are equally sensitive to the induction of chromosome breaks, the X chromosome is much less likely to interact with autosomes than chromosome 7. The noninvolvement of the X chromosome in translocations with autosomes may reflect a more peripheral and separate location for the X chromosome in the mammalian nucleus. 20 refs., 2 figs., 1 tab.

  9. Mapping of the versican proteoglycan gene (CSPG2) to the long arm of human chromosome 5 (5q12-5q14)

    SciTech Connect

    Iozzo, R.V.; Naso, M.F.; Cannizzaro, L.A. ); Wasmuth, J.J.; McPerson, J.D. )

    1992-12-01

    Versican is a major chondroitin sulfate proteoglycan of vascularized connective tissues whose eponym reflects its functional versatility in macromolecular affinity and interactions. In this report the authors have localized the versican gene (CSPG2) to the long arm of human chromosome 5 by utilizing a combination of somatic cell hybrids, Southern blotting, polymerase chain reaction, and chromosomal in situ hybridization. The proteoglycan gene segregated concordantly with hybrid cell lines containing the long arm of chromosome 5, comprising the 5q12-q14 band regions. To refine this locus further, they screened a chromosome 5-specific library and isolated several genomic clones encoding a portion of the 5[prime] end of versican. One of these genomic clones was used as a probe for in situ hybridization of human chromosome metaphases. The results corroborated the data obtained using somatic cell hybrids and further refined the assignment of the versican gene to the narrow band region of 5q12-5q14, with the primary site likely to be 5q13.2. The availability of novel genomic clones and the mapping data presented here will make possible the identification of any defect genetically linked to this proteoglycan gene. 27 refs., 4 figs.

  10. Conserved synteny between pig chromosome 8 and human chromosome 4 but rearranged and distorted linkage maps

    SciTech Connect

    Ellegren, H.; Edfors-Lilja, I.; Anderson, L. ); Wintero, A.K. )

    1993-09-01

    The porcine genes encoding interleukin 2, alcohol dehydrogenase (class I) gamma polypeptide, and osteopontin were mapped to chromosome 8 by linkage analysis. Together with previous assignments to this chromosome (the albumin, platelet-derived growth factor receptor A, and fibrinogen genes), an extensive syntenic homology with human chromosome 4 was discovered. Loci from about three-quarters of the q arm of human chromosome 4 are on pig chromosome 8. However, the linear order of the markers is not identical in the two species, and there are several examples of interspecific differences in the recombination fractions between adjacent markers. The conserved synteny between man and the pig gives strong support to a previous suggestion that a synteny group present in the ancestor of mammalian species has been retained on human chromosome 4q. Since loci from this synteny group are found on two cattle chromosomes, the bovine rearrangement must have occurred after the split of Suidae and Bovidae within Artiodactyla. 29 refs., 3 figs., 1 tab.

  11. Chromosomal localization of human genes for the LDL receptor family member glycoprotein 330 (LRP2) and its associated protein RAP (LRPAP1)

    SciTech Connect

    Korenberg, J.R.; Chen, X.N.; Argraves, K.M.

    1994-07-01

    Glycoprotein 330 (gp330) is a member of a family of receptors with structural similarities to the low-density lipoprotein receptor. Gp330 is expressed by a number of specialized epithelia, including renal proximal tubules, where it can mediate endocytosis of ligands such as complexes of urokinase and the serpin, plasminogen activator inhibitor-1. Gp330 has also been shown to bind in vitro to lipoprotein lipase and apolipoprotein E-enriched {beta}VLDL, suggesting a role for this receptor in lipoprotein metabolism. The 39-kDa protein, referred to as receptor associated protein (RAP), binds to and copurifies with gp330 and antagonizes the ligand binding activity of gp330. In this paper, the authors report the use of homology-PCR cloning to isolate cDNAs encoding human gp330. Using gp330 cDNA and previously isolated human RAP cDNA probes, they performed fluorescence in situ hybridization to map the human chromosomal location of the genes for these proteins. The gene for gp330 was mapped at a single site on the long arm of human chromosome 2 on the border of bands 2q24-q31. The gene for RAP was mapped to the short arm of human chromosome 4 at position 4q16.3, which is in the region of the chromosomal deletion causing Wolf-Hirschhorn syndrome. The assignment of chromosomal map positions for gp330 and RAP genes will aid in the evaluation of their potential roles in human diseases such as Wolf-Hirschhorn syndrome and disorders of lipoprotein metabolism, such as atherosclerosis. 38 refs., 3 figs., 1 tab.

  12. Cytochemical study of pseudoisocyanine stained human chromosomes.

    PubMed

    Vagner-Capodano, A M; Pinna-Delgrossi, M H; Stahl, A

    1976-01-28

    Human meiotic and mitotic chromosomes were studied with N-N' diethyl pseudoisocyanine stain. Following methylation and oxydation, the staining allowed microscopic observation of slides with both monochromatic light and fluorescence. In addition, stained preparations can be permanently conserved. Preceeded by diverse methods of chromosome denaturation or 5-BUDR incorporation, PIC lends itself to a large number of banding techniques. Cytochemical study of stained chromosomes demonstrated a certain PIC affinity for DNA although tests performed do not exclude the possibility of PIC reaction with certain proteins.

  13. Marked contribution of alternative end-joining to chromosome-translocation-formation by stochastically induced DNA double-strand-breaks in G2-phase human cells.

    PubMed

    Soni, Aashish; Siemann, Maria; Pantelias, Gabriel E; Iliakis, George

    2015-11-01

    Ionizing radiation (IR) induces double strand breaks (DSBs) in cellular DNA, which if not repaired correctly can cause chromosome translocations leading to cell death or cancer. Incorrect joining of DNA ends generating chromosome translocations can be catalyzed either by the dominant DNA-PKcs-dependent, classical non-homologous end-joining (c-NHEJ), or by an alternative end-joining (alt-EJ) process, functioning as backup to abrogated c-NHEJ, or homologous recombination repair. Alt-EJ operates with slower kinetics as compared to c-NHEJ and generates larger alterations at the junctions; it is also considered crucial to chromosome translocation-formation. A recent report posits that this view only holds for rodent cells and that in human cells c-NHEJ is the main mechanism of chromosome translocation formation. Since this report uses designer nucleases that induce DSBs with unique characteristics in specific genomic locations and PCR to detect translocations, we revisit the issue using stochastically distributed DSBs induced in the human genome by IR during the G2-phase of the cell cycle. For visualization and analysis of chromosome translocations, which manifest as chromatid translocations in cells irradiated in G2, we employ classical cytogenetics. In wild-type cells, we observe a significant contribution of alt-EJ to translocation formation, as demonstrated by a yield-reduction after treatment with inhibitors of Parp, or of DNA ligases 1 and 3 (Lig1, Lig3). Notably, a nearly fourfold increase in translocation formation is seen in c-NHEJ mutants with defects in DNA ligase 4 (Lig4) that remain largely sensitive to inhibitors of Parp, and of Lig1/Lig3. We conclude that similar to rodent cells, chromosome translocation formation from randomly induced DSBs in human cells largely relies on alt-EJ. We discuss DSB localization in the genome, characteristics of the DSB and the cell cycle as potential causes of the divergent results generated with IR and designer nucleases

  14. Evolutionarily conserved sequences on human chromosome 21

    SciTech Connect

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila

    2001-09-01

    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  15. Structural and functional conservation of the human homolog of the Schizosaccharomyces pombe rad2 gene, which is required for chromosome segregation and recovery from DNA damage.

    PubMed Central

    Murray, J M; Tavassoli, M; al-Harithy, R; Sheldrick, K S; Lehmann, A R; Carr, A M; Watts, F Z

    1994-01-01

    The rad2 mutant of Schizosaccharomyces pombe is sensitive to UV irradiation and deficient in the repair of UV damage. In addition, it has a very high degree of chromosome loss and/or nondisjunction. We have cloned the rad2 gene and have shown it to be a member of the Saccharomyces cerevisiae RAD2/S. pombe rad13/human XPG family. Using degenerate PCR, we have cloned the human homolog of the rad2 gene. Human cDNA has 55% amino acid sequence identity to the rad2 gene and is able to complement the UV sensitivity of the rad2 null mutant. We have thus isolated a novel human gene which is likely to be involved both in controlling the fidelity of chromosome segregation and in the repair of UV-induced DNA damage. Its involvement in two fundamental processes for maintaining chromosomal integrity suggests that it is likely to be an important component of cancer avoidance mechanisms. Images PMID:8007985

  16. Chromosome speciation: Humans, Drosophila, and mosquitoes

    PubMed Central

    Ayala, Francisco J.; Coluzzi, Mario

    2005-01-01

    Chromosome rearrangements (such as inversions, fusions, and fissions) may play significant roles in the speciation between parapatric (contiguous) or partly sympatric (geographically overlapping) populations. According to the “hybrid-dysfunction” model, speciation occurs because hybrids with heterozygous chromosome rearrangements produce dysfunctional gametes and thus have low reproductive fitness. Natural selection will, therefore, promote mutations that reduce the probability of intercrossing between populations carrying different rearrangements and thus promote their reproductive isolation. This model encounters a disabling difficulty: namely, how to account for the spread in a population of a chromosome rearrangement after it first arises as a mutation in a single individual. The “suppressed-recombination” model of speciation points out that chromosome rearrangements act as a genetic filter between populations. Mutations associated with the rearranged chromosomes cannot flow from one to another population, whereas genetic exchange will freely occur between colinear chromosomes. Mutations adaptive to local conditions will, therefore, accumulate differentially in the protected chromosome regions so that parapatric or partially sympatric populations will genetically differentiate, eventually evolving into different species. The speciation model of suppressed recombination has recently been tested by gene and DNA sequence comparisons between humans and chimpanzees, between Drosophila species, and between species related to Anopheles gambiae, the vector of malignant malaria in Africa. PMID:15851677

  17. Fourth international workshop on human chromosome 5. Final progress report

    SciTech Connect

    McPherson, J.D.

    1996-12-31

    The Fourth International Workshop on Human Chromosome 5 was held in Manchester, UK on November 9--10, 1996 and was hosted by the University of Manchester. The major goals of the workshop were: (1) to collate the various genetic, cytogenetic and physical maps of human chromosome 5; (2) to integrate these maps and identify/correct discrepancies between them wherever possible; (3) to catalogue the sequence-ready contigs of the chromosome; (4) to co-ordinate the various sequencing efforts to avoid future duplication; (5) to establish the first (to the author`s knowledge) web site for the human chromosome 5 community which contains the above information in a readily accessible form.

  18. Mapping of the mouse homolog of the human runt domain gene, AML2, to the distal region of mouse chromosome 4

    SciTech Connect

    Avraham, K.B.; Copeland, N.G.; Jenkins, N.A.

    1995-01-20

    AML2 is a runt domain belonging to a group of transcription factors that appear to play a role in Drosophila embryogenesis and mammalian oncogenic transformation. AML2 maps to human chromosome 1p36, a region involved in the t(1;3)(p36;q21) translocation found in association with myelodysplastic syndrome (MDS), myeloproliferative disease (MPD), and acute nonlymphocytic leukemia. 9 refs., 1 fig.

  19. GenomewidePDB 2.0: A Newly Upgraded Versatile Proteogenomic Database for the Chromosome-Centric Human Proteome Project.

    PubMed

    Jeong, Seul-Ki; Hancock, William S; Paik, Young-Ki

    2015-09-01

    Since the launch of the Chromosome-centric Human Proteome Project (C-HPP) in 2012, the number of "missing" proteins has fallen to 2932, down from ∼5932 since the number was first counted in 2011. We compared the characteristics of missing proteins with those of already annotated proteins with respect to transcriptional expression pattern and the time periods in which newly identified proteins were annotated. We learned that missing proteins commonly exhibit lower levels of transcriptional expression and less tissue-specific expression compared with already annotated proteins. This makes it more difficult to identify missing proteins as time goes on. One of the C-HPP goals is to identify alternative spliced product of proteins (ASPs), which are usually difficult to find by shot-gun proteomic methods due to their sequence similarities with the representative proteins. To resolve this problem, it may be necessary to use a targeted proteomics approach (e.g., selected and multiple reaction monitoring [S/MRM] assays) and an innovative bioinformatics platform that enables the selection of target peptides for rarely expressed missing proteins or ASPs. Given that the success of efforts to identify missing proteins may rely on more informative public databases, it was necessary to upgrade the available integrative databases. To this end, we attempted to improve the features and utility of GenomewidePDB by integrating transcriptomic information (e.g., alternatively spliced transcripts), annotated peptide information, and an advanced search interface that can find proteins of interest when applying a targeted proteomics strategy. This upgraded version of the database, GenomewidePDB 2.0, may not only expedite identification of the remaining missing proteins but also enhance the exchange of information among the proteome community. GenomewidePDB 2.0 is available publicly at http://genomewidepdb.proteomix.org/.

  20. Human mitochondrial 3,2-trans-enoyl-CoA isomerase (DCI): Gene structure and localization to chromosome 16p13.3

    SciTech Connect

    Janssen, U.; Stoffel, W.; Fink, T.

    1994-09-01

    A key enzyme in the mitochondrial {beta}-oxidation of unsaturated fatty acids is the 3,2-trans-enoyl-CoA isomerase (DCI; EC 5.3.3.8). It catalyzes the transformation of 3-cis and 3-trans intermediates arising during the stepwise degradation of all cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. A genomic clone encoding the human DCI was isolated and characterized by use of the previously cloned human DCI cDNA. The entire gene encompasses approximately 12.5 kb, and the coding sequence is distributed over seven exons. One major and three minor transcription start sites were determined by primer extension analysis. In common with promoters of other housekeeping genes encoding mitochondrial proteins, the GC-rich, immediate 5{prime}-flanking region of the DCI transcription initiation site lacks typical TATA and CAAT boxes; instead, two GC box consensus sequences are present. Introns 2 and 6 contain several Alu repetitive sequences. The human DCI gene locus was assigned to chromosome 16 by use of human-rodent somatic cell hybrids and to chromosome 16p13.3 by chromosomal in situ suppression hybridization studies. 26 refs., 4 figs., 1 tab.

  1. The Divergence of Neandertal and Modern Human Y Chromosomes.

    PubMed

    Mendez, Fernando L; Poznik, G David; Castellano, Sergi; Bustamante, Carlos D

    2016-04-01

    Sequencing the genomes of extinct hominids has reshaped our understanding of modern human origins. Here, we analyze ∼120 kb of exome-captured Y-chromosome DNA from a Neandertal individual from El Sidrón, Spain. We investigate its divergence from orthologous chimpanzee and modern human sequences and find strong support for a model that places the Neandertal lineage as an outgroup to modern human Y chromosomes-including A00, the highly divergent basal haplogroup. We estimate that the time to the most recent common ancestor (TMRCA) of Neandertal and modern human Y chromosomes is ∼588 thousand years ago (kya) (95% confidence interval [CI]: 447-806 kya). This is ∼2.1 (95% CI: 1.7-2.9) times longer than the TMRCA of A00 and other extant modern human Y-chromosome lineages. This estimate suggests that the Y-chromosome divergence mirrors the population divergence of Neandertals and modern human ancestors, and it refutes alternative scenarios of a relatively recent or super-archaic origin of Neandertal Y chromosomes. The fact that the Neandertal Y we describe has never been observed in modern humans suggests that the lineage is most likely extinct. We identify protein-coding differences between Neandertal and modern human Y chromosomes, including potentially damaging changes to PCDH11Y, TMSB4Y, USP9Y, and KDM5D. Three of these changes are missense mutations in genes that produce male-specific minor histocompatibility (H-Y) antigens. Antigens derived from KDM5D, for example, are thought to elicit a maternal immune response during gestation. It is possible that incompatibilities at one or more of these genes played a role in the reproductive isolation of the two groups.

  2. The Divergence of Neandertal and Modern Human Y Chromosomes.

    PubMed

    Mendez, Fernando L; Poznik, G David; Castellano, Sergi; Bustamante, Carlos D

    2016-04-01

    Sequencing the genomes of extinct hominids has reshaped our understanding of modern human origins. Here, we analyze ∼120 kb of exome-captured Y-chromosome DNA from a Neandertal individual from El Sidrón, Spain. We investigate its divergence from orthologous chimpanzee and modern human sequences and find strong support for a model that places the Neandertal lineage as an outgroup to modern human Y chromosomes-including A00, the highly divergent basal haplogroup. We estimate that the time to the most recent common ancestor (TMRCA) of Neandertal and modern human Y chromosomes is ∼588 thousand years ago (kya) (95% confidence interval [CI]: 447-806 kya). This is ∼2.1 (95% CI: 1.7-2.9) times longer than the TMRCA of A00 and other extant modern human Y-chromosome lineages. This estimate suggests that the Y-chromosome divergence mirrors the population divergence of Neandertals and modern human ancestors, and it refutes alternative scenarios of a relatively recent or super-archaic origin of Neandertal Y chromosomes. The fact that the Neandertal Y we describe has never been observed in modern humans suggests that the lineage is most likely extinct. We identify protein-coding differences between Neandertal and modern human Y chromosomes, including potentially damaging changes to PCDH11Y, TMSB4Y, USP9Y, and KDM5D. Three of these changes are missense mutations in genes that produce male-specific minor histocompatibility (H-Y) antigens. Antigens derived from KDM5D, for example, are thought to elicit a maternal immune response during gestation. It is possible that incompatibilities at one or more of these genes played a role in the reproductive isolation of the two groups. PMID:27058445

  3. Molecular characterization of the pericentric inversion that causes differences between chimpanzee chromosome 19 and human chromosome 17.

    PubMed

    Kehrer-Sawatzki, Hildegard; Schreiner, Bettina; Tänzer, Simone; Platzer, Matthias; Müller, Stefan; Hameister, Horst

    2002-08-01

    A comparison of the human genome with that of the chimpanzee is an attractive approach to attempts to understand the specificity of a certain phenotype's development. The two karyotypes differ by one chromosome fusion, nine pericentric inversions, and various additions of heterochromatin to chromosomal telomeres. Only the fusion, which gave rise to human chromosome 2, has been characterized at the sequence level. During the present study, we investigated the pericentric inversion by which chimpanzee chromosome 19 differs from human chromosome 17. Fluorescence in situ hybridization was used to identify breakpoint-spanning bacterial artificial chromosomes (BACs) and plasmid artificial chromosomes (PACs). By sequencing the junction fragments, we localized breakpoints in intergenic regions rich in repetitive elements. Our findings suggest that repeat-mediated nonhomologous recombination has facilitated inversion formation. No addition or deletion of any sequence element was detected at the breakpoints or in the surrounding sequences. Next to the break, at a distance of 10.2-39.1 kb, the following genes were found: NGFR and NXPH3 (on human chromosome 17q21.3) and GUC2D and ALOX15B (on human chromosome 17p13). The inversion affects neither the genomic structure nor the gene-activity state with regard to replication timing of these genes.

  4. YAC contigs of the Rab1 and wobbler (wr) spinal muscular atrophy gene region on proximal mouse chromosome 11 and of the homologous region on human chromosome 2p

    SciTech Connect

    Wedemeyer, N.; Lengeling, A.; Ronsiek, M.

    1996-03-05

    Despite rapid progress in the physical characterization of murine and human genomes, little molecular information is available on certain regions, e.g., proximal mouse chromosome 11 (Chr 11) and human chromosome 2p (Chr2p). We have localized the wobbler spinal atrophy gene wr to proximal mouse Chr 11, tightly linked to Rab1, a gene coding for a small GTP-binding protein, and Glns-ps1, an intronless pseudogene of the glutamine synthetase gene. We have not used these markers to construct a 1.3-Mb yeast artificial chromosome (YAC) contig of the Rab1 region on mouse Chr 11. Four YAC clones isolated from two independent YAC libraries were characterized by rare-cutting analysis, fluorescence in situ hybridization (FISH), and sequence-tagged site (STS) isolation and mapping. Rab1 and Glns-ps1 were found to be only 200 kb apart. A potential CpG island near a methylated NarI site and a trapped exon, ETG1.1, were found over 250 kb from Rab1. Two overlapping YACs were identified that contained a 150-kb region of human Chr 2p, comprising the RAB1 locus, AHY1.1, and the human homologue of ETG1.1, indicating a high degree of conservation of this region in the two species. We mapped AHY1.1 and thus human RAB1 on Chr 2p13.4-p14 using somatic cell hybrids and a radiation hybrid panel, thus extending a known region of conserved synteny between mouse Chr 11 and human Chr 2p. Recently, the gene LMGMD2B for a human recessive neuromuscular disease, limb girdle muscular dystrophy type 2B, has been mapped to 2p13-p16. The conservation between the mouse Rab1 and human RAB1 regions will be helpful in identifying candidate genes for the wobbler spinal muscular atrophy and in clarifying a possible relationship between wr and LMGMD2B. 33 refs., 7 figs., 3 tabs.

  5. AML1, AML2, and AML3, the human members of the runt domain gene-family: cDNA structure, expression, and chromosomal localization

    SciTech Connect

    Levanon, D.; Negreanu, V.; Bernstein, Y.

    1994-09-15

    cDNAs corresponding to three human runt domain-containing genes, AML1, AML2, and AML3, were isolated and characterized. In addition to homology in the highly conserved runt domain, extensive sequence similarities were also observed in other parts of the proteins. All three carried an identical, putative ATP binding sit -GRSGRGKS-, and their C-terminal halves were particularly rich in proline and serine residues. While AML1 cDNAs were cloned by others, AML2 represents a new member, not previously described, of the runt domain gene family, and AML3 was identified as the human homologue of mouse PEB-P2{alpha}A. The chromosomal location of AML1 to chromosome 21q22 was confirmed, while AML2 and AML3 were mapped to chromosome regions 1p36 and 6p21, respectively. Analysis of AML1 and AML2 expression in hematopoietic cell lines revealed a distinct pattern of expression. 42 refs., 6 figs., 1 tab.

  6. The human MCP-2 gene (SCYA8): Cloning, sequence analysis, tissue expression, and assignment to the CC chemokine gene contig on chromosome 17q11.2

    SciTech Connect

    Van Coillie, E.; Fiten, P.; Van Damme, J.; Opdenakker, G.

    1997-03-01

    Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genes a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.

  7. Gene order is conserved within the human chromosome 21 linkage group on mouse chromosome 10

    SciTech Connect

    Irving, N.G.; Cabin, D.E.; Swanson, D.A.; Reeves, R.H. )

    1994-05-01

    One hundred progeny from each of two intersubspecific mouse backcrosses were used to construct a comparative genetic map of a region of mouse chromosome 10 (MMU10) that is homologous to the distal tip of the long arm of human chromosome 21 (HSA21). The analysis included five genes and three simple sequence repeat markers, two of which flanked the HSA21-homologous cluster on either side. Analysis of 200 backcross progeny detected at least one crossover between each pair of adjacent genes and demonstrated that the proximal to distal orientation of the cluster was reversed between human and mouse. The order was determined to be Fyn-1-D10Mit20-S100b-Col6a1-Itgb2-Pfk1/D10Mit7-D10Mit11. Comparative mapping supports the order of corresponding markers on HSA21 determined using pulsed-field gel electrophoresis and radiation hybrid line data. However, sequence tagged site content mapping of human yeast artificial chromosomes (YACs) yielded conflicting data on the relative positions of human COL6A1 and S100B on HSA21. This discrepancy was resolved here by demonstrating that several key YACs used in the human contig analysis were mistyped for S100B. The murine map reported here provides a scaffold for construction of physical maps and yeast artificial chromosome contigs that will be useful in the development of mouse models for the study of Down syndrome. 28 refs., 4 figs., 2 tabs.

  8. Mapping genes to human chromosome 19

    SciTech Connect

    Connolly, Sarah

    1996-05-01

    For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. These localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.

  9. The complete sequence of human chromosome 5

    SciTech Connect

    Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, State; Gordon, Laurie A.; Scott, Duncan; Xie, Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan, Yee Man; Denys, Mirian; Detter, Chris; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstenin, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimbal, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou, Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar, Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang, Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, Susan M.; Myers, Richard M.; Rubin, Edward M.

    2004-04-15

    Chromosome 5 is one of the largest human chromosomes yet has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding and syntenic conservation with non-mammalian vertebrates, suggesting they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-encoding genes including the protocadherin and interleukin gene families and the first complete versions of each of the large chromosome 5 specific internal duplications. These duplications are very recent evolutionary events and play a likely mechanistic role, since deletions of these regions are the cause of debilitating disorders including spinal muscular atrophy (SMA).

  10. The Divergence of Neandertal and Modern Human Y Chromosomes

    PubMed Central

    Mendez, Fernando L.; Poznik, G. David; Castellano, Sergi; Bustamante, Carlos D.

    2016-01-01

    Sequencing the genomes of extinct hominids has reshaped our understanding of modern human origins. Here, we analyze ∼120 kb of exome-captured Y-chromosome DNA from a Neandertal individual from El Sidrón, Spain. We investigate its divergence from orthologous chimpanzee and modern human sequences and find strong support for a model that places the Neandertal lineage as an outgroup to modern human Y chromosomes—including A00, the highly divergent basal haplogroup. We estimate that the time to the most recent common ancestor (TMRCA) of Neandertal and modern human Y chromosomes is ∼588 thousand years ago (kya) (95% confidence interval [CI]: 447–806 kya). This is ∼2.1 (95% CI: 1.7–2.9) times longer than the TMRCA of A00 and other extant modern human Y-chromosome lineages. This estimate suggests that the Y-chromosome divergence mirrors the population divergence of Neandertals and modern human ancestors, and it refutes alternative scenarios of a relatively recent or super-archaic origin of Neandertal Y chromosomes. The fact that the Neandertal Y we describe has never been observed in modern humans suggests that the lineage is most likely extinct. We identify protein-coding differences between Neandertal and modern human Y chromosomes, including potentially damaging changes to PCDH11Y, TMSB4Y, USP9Y, and KDM5D. Three of these changes are missense mutations in genes that produce male-specific minor histocompatibility (H-Y) antigens. Antigens derived from KDM5D, for example, are thought to elicit a maternal immune response during gestation. It is possible that incompatibilities at one or more of these genes played a role in the reproductive isolation of the two groups. PMID:27058445

  11. Isolation of the human MOX2 homeobox gene and localization to chromosome 7p22.1-p21.3

    SciTech Connect

    Grigoriou, M.; Theodorakis, K.; Mankoo, B.

    1995-04-10

    We have isolated and characterized cDNA clones encoding a novel human homeobox gene, MOX2, the homologue of the murine mox-2 gene. The MOX2 protein contains all of the characteristic features of Mox-2 proteins of other vertebrate species, namely the homeobox, the polyhistidine stretch, and a number of potential serine/threonine phosphorylation sites. The homeodomain of MOX2 protein is identical to all other vertebrate species reported so far (rodents and amphibians). Outside the homeodomain, Mox-2 proteins share a high degree of identity, except for a few amino acid differences encountered between the human and the rodent polypeptides. A polyhistidine stretch of 12 amino acids in the N terminal region of the protein is also conserved among humans, rodents, and (only partly) amphibians. The chromosomal position of MOX2 was assigned to 7p22.1-p21.3. 31 refs., 3 figs.

  12. Molecular characterization of an intragenic minisatellite (VNTR) polymorphism in the human parathyroid hormone-related peptide gene in chromosome region 12p12. 1-p11. 2

    SciTech Connect

    Pausova, Z.; Morgan, K.; Fujiwara, M.; Bourdon, J.; Goltzman, D.; Hendy, G.N. )

    1993-07-01

    The human parathyroid hormone-related peptide (hPTHrP) gene in chromosome region 12p12.1-p11.2 plays an important role in mammalian development and specifically in skeletogenesis. The authors have characterized a VNTR polymorphism in the hPTHrP gene that is located in an intron 100-bp downstream of exon VI that encodes a 3[prime] untranslated region. By PCR analysis eight different alleles were identified in a group of 112 unrelated individuals. All eight alleles were sequenced and the repeat unit was identified as the general sequence [G(TA)[sub n]C][sub N], where n = 4 to 11 and N = 3 to 17. This polymorphic sequence-tagged site will be useful for mapping chromosome 12p and will aid in testing for linkage of genetic diseases to the hPTHrP gene. 3 refs., 2 figs.

  13. Mapping of the taurine transporter gene to mouse chromosome 6 and to the short arm of human chromosome 3

    SciTech Connect

    Patel, A.; Uhl, G.R.; Gregor, P.

    1995-01-01

    Transport proteins have essential functions in the uptake of neurotransmitters and neuromodulators. We have mapped the gene encoding the taurine transporter, Taut, to the central region of mouse chromosome 6. Analysis of a cross segregating the neurological mutant mnd2 excluded Taut as a candidate gene for this closely linked mutation. To map the human taurine transporter gene, TAUT, a sequence-tagged site (STS) corresponding to the 3{prime} untranslated region of the human cDNA was developed. TAUT was assigned to human chromosome 3 by typing this STS on a panel of somatic cell hybrids. Further analysis of a hybrid panel containing defined deletions of chromosome 3 suggested that TAUT maps to 3p21-p25. These data extend a conserved linkage group on mouse chromosome 6 and human chromosome 3p. Deletion of TAUT might contribute to some phenotypic features of the 3p{sup -} syndrome. 32 refs., 3 figs.

  14. Targeted gene walking by low stringency polymerase chain reaction: assignment of a putative human brain sodium channel gene (SCN3A) to chromosome 2q24-31.

    PubMed

    Malo, M S; Srivastava, K; Andresen, J M; Chen, X N; Korenberg, J R; Ingram, V M

    1994-04-12

    We have developed a low stringency polymerase chain reaction (LSPCR) to isolate the unknown neighboring region around a known DNA sequence, thus allowing efficient targeted gene walking. The method involves the polymerase chain reaction (PCR) with a single primer under conditions of low stringency for primer annealing (40 degrees C) for the first few cycles followed by more cycles at high stringency (55 degrees C). This enables the amplification of a targeted DNA fragment along with other nontargeted fragments. High stringency (55 degrees C) nested PCRs with end-labeled primers are then used to generate a ladder of radioactive bands, which accurately identifies the targeted fragment(s). We performed LSPCR on human placental DNA using a highly conserved sodium channel-specific primer for 5 cycles at 40 degrees C followed by 27 cycles at 55 degrees C for primer annealing. Subsequently, using higher stringency (55 degrees C) PCR with radiolabeled nested primers for 8 cycles, we have isolated a 0.66-kb fragment of a putative human sodium channel gene. Partial sequence (325 bp) of this fragment revealed a 270-bp region (exon) with homology to the rat brain sodium channel III alpha (RBIII) gene at the nucleotide (87%) and amino acid (92%) levels. Therefore, we putatively assign this sequence as a part of a gene coding the alpha-subunit of a human brain type III sodium channel (SCN3A). Using PCR on two human/rodent somatic cell hybrid panels with primers specific to this putative SCN3A gene, we have localized this gene to chromosome 2. Fluorescence in situ hybridization to human metaphase chromosomes was used to sublocalize the SCN3A gene to chromosome at 2q24-31. In conclusion, LSPCR is an efficient and sensitive method for targeted gene walking and is also useful for the isolation of homologous genes in related species. PMID:8159690

  15. The human CYP2F gene subfamily: Identification of a cDNA encoding a new cytochrome P450, cDNA-directed expression, and chromosome mapping

    SciTech Connect

    Nhamburo, P.T.; Kimura, Shioko; McBride, O.W.; Kozak, C.A.; Gelboin, H.V.; Gonzalez, F.J. )

    1990-06-12

    A cDNA coding for a P450, designated IIF1, was isolated from a human lung {lambda}gt11 library by screening with a human IIC9 cDNA probe. The cDNA-encoded IIF1 protein had 491 amino acids and a calculated molecular weight of 55,507. IIF1 cDNA, expressed by using a vaccinia virus vector, produced a cytochrome with a {lambda}{sub max} of 454 nm when reduced and complexed with carbon monoxide. This enzyme was able to dealkylate ethoxycoumarin, propoxycoumarin, and pentoxyresorufin but possessed no activity toward ethoxyresorufin and only trace dearylation activity toward benzyloxyresorufin. A variant cDNA, designated IIF1v, was isolated that was identical with IIF1 except for the loss of two segments of 161 and 388 bp within the cDNA coding region. Two mRNAs, consistent with the predicted size of the IIF1 and IIF1v transcripts, were found at very low abundance in lung specimens by Northern blot analysis. A 2-kb transcript, hybridizing with the human IIF1, was also detected as an abundant mRNA in rat lung. The CYP2F gene subfamily was localized to human chromosome 19 and mouse chromosome 7. On the basis of southern blotting analysis with multiple restriction enzymes, the authors conclude that the CYP2F1 gene is flanked by a second highly similar gene.

  16. A new topology of the human Y chromosome haplogroup E1b1 (E-P2) revealed through the use of newly characterized binary polymorphisms.

    PubMed

    Trombetta, Beniamino; Cruciani, Fulvio; Sellitto, Daniele; Scozzari, Rosaria

    2011-01-01

    Haplogroup E1b1, defined by the marker P2, is the most represented human Y chromosome haplogroup in Africa. A phylogenetic tree showing the internal structure of this haplogroup was published in 2008. A high degree of internal diversity characterizes this haplogroup, as well as the presence of a set of chromosomes undefined on the basis of a derived character. Here we make an effort to update the phylogeny of this highly diverse haplogroup by including seven mutations which have been newly discovered by direct resequencing. We also try to incorporate five previously-described markers which were not, however, reported in the 2008 tree. Additionally, during the process of mapping, we found that two previously reported SNPs required a new position on the tree. There are three key changes compared to the 2008 phylogeny. Firstly, haplogroup E-M2 (former E1b1a) and haplogroup E-M329 (former E1b1c) are now united by the mutations V38 and V100, reducing the number of E1b1 basal branches to two. The new topology of the tree has important implications concerning the origin of haplogroup E1b1. Secondly, within E1b1b1 (E-M35), two haplogroups (E-V68 and E-V257) show similar phylogenetic and geographic structure, pointing to a genetic bridge between southern European and northern African Y chromosomes. Thirdly, most of the E1b1b1* (E-M35*) paragroup chromosomes are now marked by defining mutations, thus increasing the discriminative power of the haplogroup for use in human evolution and forensics.

  17. Molecular genetics of the human X chromosome.

    PubMed Central

    Davies, K E

    1985-01-01

    The human X chromosome will soon be mapped at 10 cM intervals. This will permit the localisation of any X linked disorder provided that informative families are available for linkage analysis. The location of RFLPs currently in use for clinical diagnosis is summarised. The next decade should witness the elucidation of the molecular basis of some of the more common defects, such as the muscular dystrophies and X linked mental retardation. PMID:2995673

  18. OCTOBASE: ACEDB implementation of human chromosome 8

    SciTech Connect

    Wood, S.; Durbin, R.; Ritter, O.

    1994-09-01

    ACEDB, A C. elegans Database is a generalized genome database that was originally written to meet the needs of the C. elegans community. Additions and refinements to the original database are continually being made. Documentation, code and data available from anonymous FTP servers at lirmm, lirmm.fr, cele,mrc-lmb,cam.ac.uk and ncbi.nim.nih.gov. ACEDB can be used to create new databases without the need for reprogramming, and has been implemented for a number of different species as well as several human chromosomes. It displays data through a graphical interface in a manner that closely resembles the way that geneticists model their data. We have chosen to name the chromosome 8 database that relies upon the ACEDB implementation OCTOBASE. This database allows the user to view the chromosome at all levels from the cytogenetic ideogram to the DNA sequence. Besides allowing displays that span several orders of magnitude, the database will also allow simultaneously display of several types of genetic map, such as the linkage, STS content and physical map. The database also provides an excellent tool for the entry of routine laboratory data as it is collected. The gridded clone display is particularly useful for data entry. Since the database is generalized it can also be custom modified to meet the needs of individual users. Overall OCTOBASE meets the needs of the community for entry of the large amounts for data that are now being collected for chromosome 8.

  19. Three-region specific microdissection libraries for the long arm of human chromosome 2, regions q33-q35, q31-q32, and q23-q24

    SciTech Connect

    Yu, J.; Tong, S.; Whittier, A.

    1995-09-01

    Three region-specific libraries have been constructed from the long arm of human chromosome 2, including regions 2q33-35 (2Q2 library), 2q31-32 (2Q3) and 2q23-24 (2Q4). Chromosome microdissection and the MboI linker-adaptor microcloning techniques were used in constructing these libraries. The libraries comprised hundreds of thousands of microclones in each library. Approximately half of the microclones in the library contained unique or low-copy number sequence inserts. The insert sizes ranged between 50 and 800 bp, with a mean of 130-190 bp. Southern blot analysis of individual unique sequence microclones showed that 70-94% of the microclones were derived from the dissected region. 31 unique sequence microclones from the 2Q2 library, 31 from 2Q3, and 30 from 2Q4, were analyzed for insert sizes, the hybridizing genomic HindIII fragment sizes, and cross-hybridization to rodent species. These libraries and the short insert microclones derived from the libraries should be useful for high resolution physical mapping, sequence-ready reagents for large scale genomic sequencing, and positional cloning of disease-related genes assigned to these regions, e.g. the recessive familial amyotrophic lateral sclerosis assigned to 2q33-q35, and a type I diabetes susceptibility gene to 2q31-q33. 17 refs., 5 figs., 2 tabs.

  20. Comparative chromosome painting in mammals: Human and the Indian muntjac (Muntiacus muntjak vaginalis)

    SciTech Connect

    Yang, Fengtang; Mueller, S.; Ferguson-Smith, M.A.

    1997-02-01

    We have used human chromosome-specific painting probes for in situ hybridization on Indian muntjac (Muntiacus muntjak vaginalis, 2n = 6, 7) metaphase chromosomes to identify the homologous chromosome regions of the entire human chromosome set. Chromosome rearrangements that have been involved in the karyotype evolution of these two species belonging to different mammalian orders were reconstructed based on hybridization patterns. Although, compared to human chromosomes, the karyotype of the Indian muntjac seems to be highly rearranged, we could identify a limited number of highly conserved homologous chromosome regions for each of the human chromosome-specific probes. We identified 48 homologous autosomal chromosome segments, which is in the range of the numbers found in other artiodactyls and carnivores recently analyzed by chromosome painting. The results demonstrate that the reshuffling of the muntjac karyotype is mostly due to fusions of huge blocks of entire chromosomes. This is in accordance with previous chromosome painting analyses between various Muntjac species and contrasts the findings for some other mammals (e.g., gibbons, mice) that show exceptional chromosome reshuffling due to multiple reciprocal translocation events. 21 refs., 3 figs.

  1. Engineering targeted chromosomal amplifications in human breast epithelial cells.

    PubMed

    Springer, Simeon; Yi, Kyung H; Park, Jeenah; Rajpurohit, Anandita; Price, Amanda J; Lauring, Josh

    2015-07-01

    Chromosomal amplifications are among the most common genetic alterations found in human cancers. However, experimental systems to study the processes that lead to specific, recurrent amplification events in human cancers are lacking. Moreover, some common amplifications, such as that at 8p11-12 in breast cancer, harbor multiple driver oncogenes, which are poorly modeled by conventional overexpression approaches. We sought to develop an experimental system to model recurrent chromosomal amplification events in human cell lines. Our strategy is to use homologous-recombination-mediated gene targeting to deliver a dominantly selectable, amplifiable marker to a specified chromosomal location. We used adeno-associated virus vectors to target human MCF-7 breast cancer cells at the ZNF703 locus, in the recurrent 8p11-12 amplicon, using the E. coli inosine monophosphate dehydrogenase (IMPDH) enzyme as a marker. We applied selective pressure using IMPDH inhibitors. Surviving clones were found to have increased copy number of ZNF703 (average 2.5-fold increase) by droplet digital PCR and FISH. Genome-wide array comparative genomic hybridization confirmed that amplifications had occurred on the short arm of chromosome 8, without changes on 8q or other chromosomes. Patterns of amplification were variable and similar to those seen in primary human breast cancers, including "sawtooth" patterns, distal copy number loss, and large continuous regions of copy number gain. This system will allow study of the cis- and trans-acting factors that are permissive for chromosomal amplification and provide a model to analyze oncogene cooperativity in amplifications harboring multiple candidate driver genes.

  2. Human neutral amino acid transporter ASCT1: Structure of the gene (SLC1A4) and localization to chromosome 2p13-p15

    SciTech Connect

    Hofmann, K.; Dueker, M.; Stoffel, W.

    1994-11-01

    Screening for cDNAs encoding proteins similar to the sodium-coupled glutamate transporter GLAST1 led to the isolation of a cDNA clone coding for a protein that turned out to be identical to the recently described neutral amino acid transporter ASCT1. The new member of the GLAST-related transporter family does not transport glutamate or aspartate but alanine, serine, cysteine, and threonine instead. The expressed sequence tag EST02446, a short cDNA sequence found in the course of a large-scale sequencing project of human brain-derived cDNA, showed significant similarity to the eukaryotic glutamate transporter GLAST1 and was therefore used as probe in the search for further glutamate transporter cDNAs. Fragments of the cDNA were used for the isolation and characterization of human ASCT1 genomic clones. The ORF of 1572 bp encoding 524 amino acid residues is distributed over 8 exons, which span at least 40 kb of human chromosomal DNA. The ASCT1 gene locus was assigned to chromosome 2p13-p15 by chromosomal in situ suppression (CISS) studies. The gene structure is not related to any other previously characterized transporter gene. In contrast to the genes of the sodium-coupled nonglutamate neurotransmitter transporters, it shows no obvious correspondence between intron/exon structure and transmembrane organization. The transcription start site in human liver tissue was determined by primer extension analysis to be located 291 bp upstream of the initiating ATG codon. The DNA region immediately upstream of the transcription start lacks any TATA or CAAT boxes but contains several bindings sites for the transcription factors Sp1 and Egr-1. The ASCT1 gene (SLC1A4) structure reported here will facilitate the characterization of the genes of the other members of the GLAST-related transporter family and might be useful in the elucidation of amino acid transport-related defects. 36 refs., 5 figs., 1 tab.

  3. Chromosomal localization of the human fibromodulin gene

    SciTech Connect

    Roughley, P.J.; Sztrolovics, R.; Grover, J.

    1994-09-01

    The identification and mapping of genes is a fundamental step in understanding inherited diseases. This study reports the chromosomal localization of the human gene encoding fibromodulin, a collagen-binding proteoglycan which exhibits a wide distribution in connective tissue extracellular matrices. Attempts to localize the gene utilizing a probe covering the published coding region of the human fibromodulin cDNA were unsuccessful. Thus, in order to obtain an alternate probe, the 3{prime}-untranslated region of the cDNA was cloned utilizing the 3{prime}-RACE protocol. Southern blot analysis of human genomic DNA with probes covering either the coding sequence or the 3{prime}-untranslated region revealed simple patterns, indicative of a single-copy gene. Fluorescence in situ hybridization analysis with the 3{prime}-untranslated region probe resulted in hybridization at two chromosomal regions. The majority of signals were observed at 1q32, but some signals were also observed at 9q34.1. The localization of the fibromodulin gene to chromosome 1 was confirmed by the polymerase chain reaction analysis of genomic DNA from a panel of somatic cell hybrid lines. In addition to allowing the gene localization, cloning of the 3{prime}-untranslated region demonstrates that the human fibromodulin cDNA possesses an insert of approximately 160 base pairs which is not present in the published bovine sequence. The human sequence also possesses a single polyadenylation signal, yielding a 3 kb mRNA which was observed in Northern blotting experiments. These results now provide the necessary information to evaluate the potential role of fibromodulin in genetic disorders of connective tissues.

  4. Contribution of mGluR5 to pathophysiology in a mouse model of human chromosome 16p11.2 microdeletion.

    PubMed

    Tian, Di; Stoppel, Laura J; Heynen, Arnold J; Lindemann, Lothar; Jaeschke, Georg; Mills, Alea A; Bear, Mark F

    2015-02-01

    Human chromosome 16p11.2 microdeletion is the most common gene copy number variation in autism, but the synaptic pathophysiology caused by this mutation is largely unknown. Using a mouse with the same genetic deficiency, we found that metabotropic glutamate receptor 5 (mGluR5)-dependent synaptic plasticity and protein synthesis was altered in the hippocampus and that hippocampus-dependent memory was impaired. Notably, chronic treatment with a negative allosteric modulator of mGluR5 reversed the cognitive deficit.

  5. The human MCP-3 gene (SCYA7): Cloning, sequence analysis, and assignment to the C-C chemokine gene cluster on chromosome 17q11. 2-q12

    SciTech Connect

    Opdenakker, G.; Fiten, P.; Nys, G.; Froyen, G.; Van Damme, J. ); Van Roy, N.; Speleman, F.; Laureys, G. )

    1994-05-15

    Monocyte chemotactic proteins (MCPs) are chemokines involved in macrophage recruitment during inflammation and cancer. A full-size MCP-3 cDNA was used to isolate the functional human MCP-3 gene. Based on restriction analysis, subclones were selected and the MCP-3 gene sequence was completed. In addition to a dense region with direct and inverted repeats and palindromic sequences, a double microsatellite (CA)[sub n]-(GA)[sub n] was found at the 5[prime]-end of the MCP-3 gene, and an RFLP was detected. The gene was regionally mapped by fluorescence in situ hybridization to human chromosome 17, subbands q11.2-q12. This site contains the MCP-subset of C-C chemokines and can be distinguished from the syntenic MIP-1[alpha] locus. SCYA7 was assigned as the locus symbol of the MCP-3 gene. Double-labeling experiments confirmed the regional assignment of the MCP-3 gene close to the ERBB2 locus on human chromosome 17. 36 refs., 4 figs.

  6. Assignment of human potassium channel gene KCNA4 (Kv1. 4, PCN2) to chromosome 11q13. 4 [r arrow] q14. 1

    SciTech Connect

    Philipson, L.H.; Bell, G.I. ); Eddy, R.L.; Shows, T.B. )

    1993-02-01

    Both electrically excitable and nonexcitable tissues express voltage-sensitive K[sup +] channels. Since the original isolation of the Drosophila Shaker gene encoding voltage-sensitive K[sub +] channels, five additional related gene families have been described: the Shal, Shab, and Shaw families and the K-eag and Slo genes. A seventh family of slowly activating K[sup +] channels, minK of IsK, is structurally unrelated to the others. Seven human genes related to the Shaker subfamily have been described. We recently described the cloning of a fast-inactivating human voltage-gated K[sup +] channel, PCN2. Here we report the mapping of the gene encoding PNC2, designated KNCA4, to chromosome 11 by analyzing its segregation in a panel of reduced human-mouse somatic cell hybrids. In situ hybridization to prometaphase chromoxomes localized KCNA4 to the long arm of chromosome 11 in the region of bands q13.4 [r arrow] q14.1.

  7. Syntenic conservation between humans and cattle. I. Human chromosome 9.

    PubMed

    Threadgill, D W; Womack, J E

    1990-09-01

    Bovine X hamster hybrid somatic cells have been used to investigate the syntenic relationship of nine loci in the bovine that have homologous loci on human chromosome 9. Six loci, ALDH1, ALDOB, C5, GGTB2, GSN, and ITIL, were assigned to the previously identified bovine syntenic group U18 represented by ACO1, whereas the other three loci, ABL, ASS, and GRP78, mapped to a new, previously unidentified autosomal syntenic group. Additionally, a secondary locus, ABLL, which cross-hybridized with the ABL probe, was mapped to bovine syntenic group U1 with the HSA 1 loci PGD and ENO1. The results predict that ACO1 will map proximal to ALDH1; GRP78 distal to ITIL and C5; GSN proximal to AK1, ABL, and ASS on HSA 9; GRP78 to MMU 2; and ITIL and GSN to MMU 4. PMID:2081596

  8. The gene for human glutaredoxin (GLRX) is localized to human chromosome 5q14

    SciTech Connect

    Padilla, C.A.; Holmgren, A.; Bajalica, S.; Lagercrantz, J.

    1996-03-05

    Glutaredoxin is a small protein (12 kDa) catalyzing glutathione-dependent disulfide oxidoreduction reactions in a coupled system with NADPH, GSH, and glutathione reductase. A cDNA encoding the human glutaredoxin gene (HGMW-approved symbol GLRX) has recently been isolated and cloned from a human fetal spleen cDNA library. The screening of a human fetal spleen cDNA library. The screening of a human genomic library in Charon 4A led to the identification of three genomic clones. Using fluorescence in situ hybridization to metaphase chromosomes with one genomic clone as a probe, the human glutaredoxin gene was localized to chromosomal region 5q14. This localization at chromosome 5 was in agreement with the somatic cell hybrid analysis, using DNA from a human-hamster and a human-mouse hybrid panel and using a human glutaredoxin cDNA as a probe. 13 refs., 2 figs.

  9. Assignment of human myocyte-specific enhancer binding factor 2C (hMEF2C) to human chromosome 5q14 and evidence that MEF2C is evolutionarily conserved

    SciTech Connect

    Krainc, D.; Lipton, S.A.; Haas, M.; Ward, D.C.

    1995-10-10

    Human myocyte-specific enhancer binding factor 2C (hMEF2C) belongs to the MEF2 subfamily of the MADS (MCM1, AGAMOUS, DEF A, serum response factor) family of transcription factors. Members of the MADS family share a conserved domain - the MADS domain - that is necessary for DNA binding. Highly conserved versions of the MADS domain and of an adjacent domain that is known as the MEF2 domain are found in members of the MEF2 subfamily. Both of these domains are necessary for binding to the MEF2 regulatory element. This regulatory element is known to be functionally important in a variety of muscle-specific genes and possibly in the brain creatine kinase gene. The MEF2C gene product activates transcription by binding to the MEF2 element. hMEF2C is expressed at high levels in postmitotic neurons in the brain, where it is most abundant in the cerebral cortex, and is also expressed in differentiated myotubes. Several lines of evidence suggest the existence of a rat homologue of MEF2C, and a mouse homologue has been cloned. The mouse gene was mapped to mouse chromosome 13 in a region that is syntenic to human 5q13-q15. 12 refs., 1 fig.

  10. Gene structure and chromosomal localization of the human HSD11K gene encoding the kidney (type 2) isozyme of 11{beta}-hydroxysteroid dehydrogenase

    SciTech Connect

    Agarwal, A.K.; Rogerson, F.M.; Mune, T.; White, P.C.

    1995-09-01

    11{beta}-hydroxysteroid dehydrogenase (11{beta}HSD) converts glucocorticoids to inactive products and is thus thought to confer specificity for aldosterone on the type I mineralocorticoid receptor in the kidney. Recent studies indicate the presence of at least two isozymes of 11{beta}HSD. In vitro, the NAD{sup +}-dependent kidney (type 2) isozyme catalyzes 11{beta}-dehydrogenase but not reductase reactions, whereas the NADP{sup +}-dependent liver (type 1) isozyme catalyzes both reactions. We have now characterized the human gene encoding kidney 11{beta}HSD (HSD11K). A bacteriophage P1 clone was isolated after screening a human genomic library by hybridization with sheep HSD11K cDNA. The gene consists of 5 exons spread over 6 kb. The nucleotide binding domain lies in the first exon are GC-rich (80%), suggesting that the gene may be transcriptionally regulated by factors that recognize GC-rich sequences. Fluorescence in situ hybridization of metaphase chromosomes with a positive P1 clone localized the gene to chromosome 16q22. In contrast, the HSD11L (liver isozyme) gene is located on chromosome 1 and contains 6 exons; the coding sequences of these genes are only 21% identical. HSD11K is expressed at high levels in the placenta and kidney of midgestation human fetuses and at lower levels in lung and testes. Different transcriptional start sites are utilized in kidney and placenta. These data should be applicable to genetic analysis of the syndrome of apparent mineralocorticoid excess, which may represent a deficiency of 11{beta}HSD. 25 refs., 5 figs.

  11. Computational and Mass-Spectrometry-Based Workflow for the Discovery and Validation of Missing Human Proteins: Application to Chromosomes 2 and 14.

    PubMed

    Carapito, Christine; Lane, Lydie; Benama, Mohamed; Opsomer, Alisson; Mouton-Barbosa, Emmanuelle; Garrigues, Luc; Gonzalez de Peredo, Anne; Burel, Alexandre; Bruley, Christophe; Gateau, Alain; Bouyssié, David; Jaquinod, Michel; Cianferani, Sarah; Burlet-Schiltz, Odile; Van Dorsselaer, Alain; Garin, Jérôme; Vandenbrouck, Yves

    2015-09-01

    In the framework of the C-HPP, our Franco-Swiss consortium has adopted chromosomes 2 and 14, coding for a total of 382 missing proteins (proteins for which evidence is lacking at protein level). Over the last 4 years, the French proteomics infrastructure has collected high-quality data sets from 40 human samples, including a series of rarely studied cell lines, tissue types, and sample preparations. Here we described a step-by-step strategy based on the use of bioinformatics screening and subsequent mass spectrometry (MS)-based validation to identify what were up to now missing proteins in these data sets. Screening database search results (85,326 dat files) identified 58 of the missing proteins (36 on chromosome 2 and 22 on chromosome 14) by 83 unique peptides following the latest release of neXtProt (2014-09-19). PSMs corresponding to these peptides were thoroughly examined by applying two different MS-based criteria: peptide-level false discovery rate calculation and expert PSM quality assessment. Synthetic peptides were then produced and used to generate reference MS/MS spectra. A spectral similarity score was then calculated for each pair of reference-endogenous spectra and used as a third criterion for missing protein validation. Finally, LC-SRM assays were developed to target proteotypic peptides from four of the missing proteins detected in tissue/cell samples, which were still available and for which sample preparation could be reproduced. These LC-SRM assays unambiguously detected the endogenous unique peptide for three of the proteins. For two of these, identification was confirmed by additional proteotypic peptides. We concluded that of the initial set of 58 proteins detected by the bioinformatics screen, the consecutive MS-based validation criteria led to propose the identification of 13 of these proteins (8 on chromosome 2 and 5 on chromosome 14) that passed at least two of the three MS-based criteria. Thus, a rigorous step-by-step approach combining

  12. Imprinting of the gene encoding a human cyclin-dependent kinase inhibitor, p57KIP2, on chromosome 11p15.

    PubMed Central

    Matsuoka, S; Thompson, J S; Edwards, M C; Bartletta, J M; Grundy, P; Kalikin, L M; Harper, J W; Elledge, S J; Feinberg, A P

    1996-01-01

    Parental origin-specific alterations of chromosome 11p15 in human cancer suggest the involvement of one or more maternally expressed imprinted genes involved in embryonal tumor suppression and the cancer-predisposing Beckwith-Wiedemann syndrome (BWS). The gene encoding cyclin-dependent kinase inhibitor p57KIP2, whose overexpression causes G1 phase arrest, was recently cloned and mapped to this band. We find that the p57KIP2 gene is imprinted, with preferential expression of the maternal allele. However, the imprint is not absolute, as the paternal allele is also expressed at low levels in most tissues, and at levels comparable to the maternal allele in fetal brain and some embryonal tumors. The biochemical function, chromosomal location, and imprinting of the p57KIP2 gene match the properties predicted for a tumor suppressor gene at 11p15.5. However, as the p57KIP2 gene is 500 kb centromeric to the gene encoding insulin-like growth factor 2, it is likely to be part of a large domain containing other imprinted genes. Thus, loss of heterozygosity or loss of imprinting might simultaneously affect several genes at this locus that together contribute to tumor and/or growth- suppressing functions that are disrupted in BWS and embryonal tumors. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8610162

  13. Synteny mapping of five human chromosome 7 genes on bovine chromosomes 4 and 21.

    PubMed

    Antoniou, E; Womack, J E; Grosz, M D

    1999-01-01

    Five genes on human chromosome 7 (HSA 7) were assigned to bovine chromosome 21 (BTA 21) and 4 (BTA 4) using a bovine-rodent somatic hybrid cell panel. These five genes were alpha-I subunit of adenylate cyclase-inhibiting G-protein (GNAI1), alpha/beta preprotachykinin (TAC1), reelin (RELN), c-AMP dependant protein kinase type II beta regulatory chain (PRKAR2B) and apolipoprotein A1 regulatory protein 1 (TFCOUP2). Four genes mapped to BTA 4 (GNAI1, TAC1, RELN, PRKAR2B) while one gene mapped to BTA 21 (TFCOUP2). This study confirms the synteny conservation between HSA 7 and BTA 4, finely maps the breakpoints of conserved synteny on HSA 7 and defines a new synteny conservation between HSA 7 and BTA 21.

  14. Attenuation of G{sub 2} cell cycle checkpoint control in human tumor cells is associated with increased frequencies of unrejoined chromosome breaks but not increased cytotoxicity following radiation exposure

    SciTech Connect

    Schwartz, J.L.; Cowan, J.; Grdina, D.J.

    1997-08-01

    The contribution of G{sub 2} cell cycle checkpoint control to ionizing radiation responses was examined in ten human tumor cell lines. Most of the delay in cell cycle progression seen in the first cell cycle following radiation exposure was due to blocks in G{sub 2} and there were large cell line-to-cell line variations in the length of the G{sub 2} block. Longer delays were seen in cell lines that had mutations in p53. There was a highly significant inverse correlation between the length of G{sub 2} delay and the frequency of unrejoined chromosome breaks seen as chromosome terminal deletions in mitosis, and observation that supports the hypothesis that the signal for G{sub 2} delay in mammalian cells is an unrejoined chromosome break. There were also an inverse correlation between the length of G{sub 2} delay and the level of chromosome aneuploidy in each cell line, suggesting that the G{sub 2} and mitotic spindel checkpoints may be linked to each other. Attenuation in G{sub 2} checkpoint control was not associated with alterations in either the frequency of induced chromosome rearrangements or cell survival following radiation exposure suggesting that chromosome rearrangements, the major radiation-induced lethal lesion in tumor cells, form before cells enters G{sub 2}. Thus, agents that act solely to override G{sub 2} arrest should produce little radiosensitization in human tumor cells.

  15. Two member of the S-lac lectin gene family, LGALS1 and LGALS2, reside in close proximity on human chromosome 22q12-q13

    SciTech Connect

    Mehrabian, M.; Sparkes, R.S.; Lusis, A.J. ); Gitt, M.A.; Leffler, H.; Barondes, S.H. )

    1993-02-01

    S-lac lectins are a family of soluble lactose-binding proteins thought to function in the control of cell growth. We now report the chromosomal mapping of two members of the family, termed L-14-I and L-14-II, to the q12-q13 region of human chromosome 22, suggesting the possibility of a cluster of genes for lactose-binding proteins. 20 refs., 1 fig., 1 tab.

  16. Assessment of aneuploidy in human oocytes and preimplantation embryos by chromosome painting

    SciTech Connect

    Rougier, N.; Viegas-Pequignot, E.; Plachot, M.

    1994-09-01

    The poor quality of chromosome preparations often observed after fixation of oocytes and embryos did not usually allow accurate identification of chromosomes involved in non-disjunctions. We, therefore, used chromosome painting to determine the incidence of abnormalities for chromosomes 1 and 7. A total of 50 oocytes inseminated for IVF and showing no signs of fertilization as well as 37 diploid embryos donated for research were fixed according to the Dyban`s technique. Fluorescence in situ hybridization was carried out using whole chromosome painting DNA probes specific for human chromosome 1 and 7. The incidence of aneuploidy was 28%, 10% and 60% for metaphase II, polar body and sperm chromosomes, respectively. The high incidence of aneuploidy observed in sperm prematurely condensed sperm chromosomes is due to the fact that usually far less than 23 sperm chromatids are observed, maybe as a consequence of incomplete chromosome condensation. Thirty seven embryos were analyzed with the same probes. 48% of early embryos were either monosomic 1 or 7 or mosaics comprising blastomeres with 1, 2 or 3 signals. Thus, 8 among the 11 abnormal embryos had hypodiploid cells (25 to 37 chromosomes) indicating either an artefactual loss of chromosomes or a complex anomaly of nuclear division (maltinucleated blastomeres, abnormal migration of chromosomes at anaphase). We therefore calculated a {open_quotes}corrected{close_quotes} incidence of aneuploidy for chromosomes 1 or 7 in early embryos: 18%. 86% of the blastocysts showed mosaicism 2n/3 or 4n as a consequence of the formation of the syncitiotrophoblast. To conclude, chromosome painting is an efficient method to accurately identify chromosomes involved in aneuploidy. This technique should allow us to evaluate the incidence of non-disjunction for all chromosome pairs. Our results confirm the high incidence of chromosome abnormalities occurring as a consequence of meiotic or mitotic non-disjunctions in human oocytes and embryos.

  17. The human gene (CSNK2A1) coding for the casein kinase II subunit [alpha] is located on chromosome 20 and contains tandemly arranged Alu repeats

    SciTech Connect

    Wirkner, U.; Lichter, P.; Pyerin, W. ); Voss, H.; Ansorge, W. )

    1994-01-15

    The authors have isolated and characterized an 18.9-kb genomic clone representing a central portion of the human casein kinase II (CKII) subunit [alpha] gene (CSNK2A1). Using the whole clone as a probe, the gene was localized on chromosome 20p13. The clone contains eight exons whose sequences comprise bases 102 to 824 of the coding region of the human CKII[alpha]. The exon/intron splice junctions conform to the gt/ag rule. Three of the nine introns are located at positions corresponding to those in the CKII[alpha] gene of the nematode Caenorhabditis elegans. The introns contain eight complete and eight incomplete Alu repeats. Some of the Alu sequences are arranged in tandems of two or three, which seem to originate from insertions of younger Alu sequences into the poly(A) region of previously integrated Alu sequences, as indicated by flanking direct repeats. 50 refs., 5 figs., 1 tab.

  18. Human structural variation: mechanisms of chromosome rearrangements

    PubMed Central

    Weckselblatt, Brooke; Rudd, M. Katharine

    2015-01-01

    Chromosome structural variation (SV) is a normal part of variation in the human genome, but some classes of SV can cause neurodevelopmental disorders. Analysis of the DNA sequence at SV breakpoints can reveal mutational mechanisms and risk factors for chromosome rearrangement. Large-scale SV breakpoint studies have become possible recently owing to advances in next-generation sequencing (NGS) including whole-genome sequencing (WGS). These findings have shed light on complex forms of SV such as triplications, inverted duplications, insertional translocations, and chromothripsis. Sequence-level breakpoint data resolve SV structure and determine how genes are disrupted, fused, and/or misregulated by breakpoints. Recent improvements in breakpoint sequencing have also revealed non-allelic homologous recombination (NAHR) between paralogous long interspersed nuclear element (LINE) or human endogenous retrovirus (HERV) repeats as a cause of deletions, duplications, and translocations. This review covers the genomic organization of simple and complex constitutional SVs, as well as the molecular mechanisms of their formation. PMID:26209074

  19. Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

    SciTech Connect

    Warburton, P.E.; Gosden, J.; Lawson, D.

    1996-04-15

    Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

  20. Construction and availability of human chromosome-specific gene libraries

    SciTech Connect

    Fuscoe, J.C.; Van Dilla, M.A.; Deaven, L.L.

    1985-06-14

    This report briefly describes Phase I of the project, the production of complete digest fibraries. Each laboratory is currently in the process of sorting individual human chromosomes from normal human fibroblasts or human X hamster hybrids. The goal of 4 x 10/sup 6/ chromosomes for cloning purposes has been achieved. Each laboratory is also in the process of cloning the chromosomal DNA, after complete digestion with a 6-cutter, into the bacteriophage vector Charon 21A. 3 refs.

  1. Molecular characterization of the pericentric inversion of chimpanzee chromosome 11 homologous to human chromosome 9.

    PubMed

    Kehrer-Sawatzki, Hildegard; Szamalek, Justyna M; Tänzer, Simone; Platzer, Matthias; Hameister, Horst

    2005-05-01

    In addition to the fusion of human chromosome 2, nine pericentric inversions are the most conspicuous karyotype differences between humans and chimpanzees. In this study we identified the breakpoint regions of the pericentric inversion of chimpanzee chromosome 11 (PTR 11) homologous to human chromosome 9 (HSA 9). The break in homology between PTR 11p and HSA 9p12 maps to pericentromeric segmental duplications, whereas the breakpoint region orthologous to 9q21.33 is located in intergenic single-copy sequences. Close to the inversion breakpoint in PTR 11q, large blocks of alpha satellites are located, which indicate the presence of the centromere. Since G-banding analysis and the comparative BAC analyses performed in this study imply that the inversion breaks occurred in the region homologous to HSA 9q21.33 and 9p12, but not within the centromere, the structure of PTR 11 cannot be explained by a single pericentric inversion. In addition to this pericentric inversion of PTR 11, further events like centromere repositioning or a second smaller inversion must be assumed to explain the structure of PTR 11 compared with HSA 9.

  2. The DNA sequence and biological annotation of human chromosome 1.

    PubMed

    Gregory, S G; Barlow, K F; McLay, K E; Kaul, R; Swarbreck, D; Dunham, A; Scott, C E; Howe, K L; Woodfine, K; Spencer, C C A; Jones, M C; Gillson, C; Searle, S; Zhou, Y; Kokocinski, F; McDonald, L; Evans, R; Phillips, K; Atkinson, A; Cooper, R; Jones, C; Hall, R E; Andrews, T D; Lloyd, C; Ainscough, R; Almeida, J P; Ambrose, K D; Anderson, F; Andrew, R W; Ashwell, R I S; Aubin, K; Babbage, A K; Bagguley, C L; Bailey, J; Beasley, H; Bethel, G; Bird, C P; Bray-Allen, S; Brown, J Y; Brown, A J; Buckley, D; Burton, J; Bye, J; Carder, C; Chapman, J C; Clark, S Y; Clarke, G; Clee, C; Cobley, V; Collier, R E; Corby, N; Coville, G J; Davies, J; Deadman, R; Dunn, M; Earthrowl, M; Ellington, A G; Errington, H; Frankish, A; Frankland, J; French, L; Garner, P; Garnett, J; Gay, L; Ghori, M R J; Gibson, R; Gilby, L M; Gillett, W; Glithero, R J; Grafham, D V; Griffiths, C; Griffiths-Jones, S; Grocock, R; Hammond, S; Harrison, E S I; Hart, E; Haugen, E; Heath, P D; Holmes, S; Holt, K; Howden, P J; Hunt, A R; Hunt, S E; Hunter, G; Isherwood, J; James, R; Johnson, C; Johnson, D; Joy, A; Kay, M; Kershaw, J K; Kibukawa, M; Kimberley, A M; King, A; Knights, A J; Lad, H; Laird, G; Lawlor, S; Leongamornlert, D A; Lloyd, D M; Loveland, J; Lovell, J; Lush, M J; Lyne, R; Martin, S; Mashreghi-Mohammadi, M; Matthews, L; Matthews, N S W; McLaren, S; Milne, S; Mistry, S; Moore, M J F; Nickerson, T; O'Dell, C N; Oliver, K; Palmeiri, A; Palmer, S A; Parker, A; Patel, D; Pearce, A V; Peck, A I; Pelan, S; Phelps, K; Phillimore, B J; Plumb, R; Rajan, J; Raymond, C; Rouse, G; Saenphimmachak, C; Sehra, H K; Sheridan, E; Shownkeen, R; Sims, S; Skuce, C D; Smith, M; Steward, C; Subramanian, S; Sycamore, N; Tracey, A; Tromans, A; Van Helmond, Z; Wall, M; Wallis, J M; White, S; Whitehead, S L; Wilkinson, J E; Willey, D L; Williams, H; Wilming, L; Wray, P W; Wu, Z; Coulson, A; Vaudin, M; Sulston, J E; Durbin, R; Hubbard, T; Wooster, R; Dunham, I; Carter, N P; McVean, G; Ross, M T; Harrow, J; Olson, M V; Beck, S; Rogers, J; Bentley, D R; Banerjee, R; Bryant, S P; Burford, D C; Burrill, W D H; Clegg, S M; Dhami, P; Dovey, O; Faulkner, L M; Gribble, S M; Langford, C F; Pandian, R D; Porter, K M; Prigmore, E

    2006-05-18

    The reference sequence for each human chromosome provides the framework for understanding genome function, variation and evolution. Here we report the finished sequence and biological annotation of human chromosome 1. Chromosome 1 is gene-dense, with 3,141 genes and 991 pseudogenes, and many coding sequences overlap. Rearrangements and mutations of chromosome 1 are prevalent in cancer and many other diseases. Patterns of sequence variation reveal signals of recent selection in specific genes that may contribute to human fitness, and also in regions where no function is evident. Fine-scale recombination occurs in hotspots of varying intensity along the sequence, and is enriched near genes. These and other studies of human biology and disease encoded within chromosome 1 are made possible with the highly accurate annotated sequence, as part of the completed set of chromosome sequences that comprise the reference human genome.

  3. Chromosome Studies of Virus-infected Semi-continuous Human Embryonic Liver Cells

    PubMed Central

    Zuckerman, A. J.; Taylor, P. E.; Jacobs, J. P.; Jones, C. A.

    1970-01-01

    Semi-continuous human embryonic liver cells infected with San Carlos virus 3 exhibited an increased frequency of chromosomal breaks and other chromosomal abnormalities when compared with uninoculated control cultures. The chromosomes of cells inoculated with AR-17 virus retained their normal structure. The strain of liver cells used in this study is essentially diploid. It represents the first strain of diploid cells so far described from human liver. ImagesFigs. 2-3Fig. 1 PMID:4985032

  4. The gene for human erythrocyte membrane protein band 7. 2 (EPB72) maps to 9q33-q34 centromeric to the Philadelphia chromosome translocation breakpoint region

    SciTech Connect

    Gallagher, P.G.; Upender, M.; Ward, D.C.; Forget, B.G. )

    1993-10-01

    Erthrocyte band 7.2b is a 31-kDa integral phosphoprotein absent from the erythrocytes of many patients with hereditary stomatocytosis (HSt). HSt is a heterogeneous group of disorders characterized by mouth-shaped erythrocyte morphology on peripheral blood smears. The clinical severity of HSt is variable; some patients experience hemolysis and anemia while others are asymptomatic. The red cell membranes of these patients usually exhibit abnormal permeability to sodium and potassium with resultant modification of intracellular water content. The band 7.2b protein has been purified and the cDNA cloned. The approved gene name and symbol are erythrocyte membrane protein band 7.2 and EPB72, respectively, as assigned by the Human Gene Nomenclature Committee. Using a human reticulocyte cDNA library as template, a 491-bp fragment corresponding to the 3' end of the coding region of the EPB72 cDNA was amplified. Three overlapping phase DNA clones were isolated using this probe. Four genomic DNA fragments of 2.0, 2.5, 4.5, and 5.0 kb, respectively, were isolated from these clones. To localize the EPB72 gene by fluorescence in situ hybridization, these genomic DNA fragments were labeled with biotin-11-dUTP and hybridized to metaphase chromosomes as described. Probes were preannealed to C[sub 0]t1-fractionated DNA to block repetitive sequences. Experiments were analyzed and digitally imaged using a cooled CCD camera. The probes, in combination, gave specific hybridization signals only in chromosome 9q. The gene for erythrocyte membrane protein 7.2 localized to 9q33-q34.

  5. Flow cytometry measurements of human chromosome kinetochore labeling

    SciTech Connect

    Fantes, J.A.; Green, D.K.; Malloy, P.; Sumner, A.T.

    1989-03-01

    A method for the preparation and measurement of immunofluorescent human chromosome centromeres in suspension is described using CREST antibodies, which bind to the centromeric region of chromosomes. Fluorescein isothiocyanate (FITC)-conjugated antihuman antibodies provide the fluorescent label. Labeled chromosomes are examined on microscope slides and by flow cytometry. In both cases a dye which binds to DNA is added to provide identification of the chromosome groups. Sera from different CREST patients vary in their ability to bind to chromosome arms in addition to the centromeric region. Flow cytometry and microfluorimetry measurements have shown that with a given CREST serum the differences in kinetochore fluorescence between chromosomes are only minor. Flow cytometry experiments to relate the number of dicentric chromosomes, induced by in vitro radiation of peripheral blood cells to the slightly increased number of chromosomes with above-average kinetochore fluorescence did not produce decisive radiation dosimetry results.

  6. Chromosomal analysis in young vs. senescent human fibroblasts by FISH

    SciTech Connect

    Mukheriee, A.B.; Thomas, S.

    1994-09-01

    Almost all previous studies on chromosomal analysis related to in vitro aging of human fibroblasts were done using only metaphase chromosomes. However, this procedure might provide only partial information since the aneuploidy presumably hidden in interphase cells would remain undetected. We, therefore, have analyzed aneuploidy both at interphase and at metaphase. Female (IMR-90) and male (IMR-91) cells were grown from the lowest to the highest population doubling levels and aneuploidy analysis was done by FISH with {alpha}-satellite DNA probes of 15 autosomes and 2 sex chromosomes. Our data on total aneuploidy in young cells indicate that significantly higher proportions of cells with aneuploidy are detected at interphase as opposed to metaphase. This presumably indicates that during active division of young cells, a greater proportion of cells with aneuploidy than diploidy is selected against entry to mitosis. In contrast, both cell strains at senescence exhibit significantly lower proportions of nuclei with aneuploidy at interphase as compared to that of young cells. This probably indicates that during senescense, a greater proportion of cells with aneuploidy than diploidy is selected against prolonged survival in culture. Our study shows that cellular dynamics with respect to aneuploidy involving various chromosomes differs significantly at interphase and at mitosis during in vitro aging of human fibroblasts.

  7. The mouse and human excitatory amino acid transporter gene (EAAT1) maps to mouse chromosome 15 and a region of syntenic homology on human chromosome 5

    SciTech Connect

    Kirschner, M.A.; Arriza, J.L.; Amara, S.G.

    1994-08-01

    The gene for human excitatory amino acid transporter (EAAT1) was localized to the distal region of human chromosome 5p13 by in situ hybridization of metaphase chromosome spreads. Interspecific backcross analysis identified the mouse Eaat1 locus in a region of 5p13 homology on mouse chromosome 15. Markers that are linked with EAAT1 on both human and mouse chromosomes include the receptors for leukemia inhibitory factor, interleukin-7, and prolactin. The Eaat1 locus appears not be linked to the epilepsy mutant stg locus, which is also on chromosome 15. The EAAT1 locus is located in a region of 5p deletions that have been associated with mental retardation and microcephaly. 22 refs., 2 figs.

  8. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    SciTech Connect

    D'Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. ); Antonacci, R. )

    1993-11-01

    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  9. Mapping of low-frequency chimeric yeast artificial chromosome libraries from human chromosomes 16 and 21 by fluorescence in situ hybridization and quantitative image analysis

    SciTech Connect

    Marrone, B.L.; Campbell, E.W.; Anzick, S.L.; Shera, K.; Campbell, M.; Yoshida, T.M.; McCormick, M.K.; Deaven, L. )

    1994-05-01

    Yeast artificial chromosome (YAC) clones from low-frequency chimeric libraries of human chromosomes 16 and 21 were mapped onto human diploid fibroblast metaphase chromosomes using fluorescence in situ hybridization (FISH) and digital imaging microscopy. YACs mapped onto chromosome 21 were selected to provide subregional location and ordering of known and unknown markers on the long arm of chromosome 21, particularly in the Down syndrome region (q22). YACs mapped onto chromosome 16 were selected to overlap regions spanning chromosome 16 cosmid maps. YAC clones were indirectly labeled with fluorescein, and the total DNA of the chromosome was counterstained with propidium iodide. A single image containing both the FISH signal and the whole chromosome was acquired for each chromosome of interest containing the fluorescent probe signal in a metaphase spread. From the digitized image, the fluorescence intensity profile through the long axis of the chromosome gave the total chromosome length and the probe position. The map position of the probe was expressed as the fractional length (FL) of the total chromosome relative to the end of the short arm (Flpter). From each clone hybridized, 20-40 chromosome images were analyzed. Thirty-eight YACs were mapped onto chromosome 16, and their FLs were distributed along the short and long arms. On chromosome 21, 47 YACs were mapped, including 12 containing known markers. To confirm the order of a dense population of YACs within the Down syndrome region, a two-color mapping strategy was used in which an anonymous YAC was located relative to one or two known markers on the metaphase chromosome. The chromosome FL maps have a 1- to 2-Mb resolution, and the FL measurement of each probe has a typical standard error of 0.5-1 Mb. 14 refs., 3 figs., 3 tabs.

  10. Organization of the human gene for nucleobindin (NUC) and its chromosomal assignment to 19q13.2-q13.4.

    PubMed

    Miura, K; Hirai, M; Kanai, Y; Kurosawa, Y

    1996-06-01

    Nucleobindin (Nuc) was first identified as a secreted protein of 55 kDa that promotes production of DNA-specific antibodies in lupus-prone MRL/lpr mice. Analysis of cDNA that encoded Nuc revealed that the protein is composed of a signal peptide, a DNA-binding site, two calcium-binding motifs (EF-hand motifs), and a leucine zipper. In the present study, we analyzed the organization of the human gene for Nuc (NUC). It consists of 13 exons that are distributed in a region of 32 kb. The functional motifs listed above are encoded in corresponding exons. NUC was expressed in all organs examined. Comparison of nucleotide sequences in the promoter regions between human and mouse NUC genes revealed several conserved sequences. Among them, two Sp1-binding sites and a CCAAT box are of particular interest. The promoter is of the TATA-less type, and transcription starts at multiple sites in both the human and the mouse genes. These features suggest that NUC might normally play a role as a housekeeping gene. NUC was located at human chromosome 19q13.2-q13.4.

  11. Organization of the human gene for nucleobindin (NUC) and its chromosomal assignment to 19q13.2-q13.4

    SciTech Connect

    Miura, Keiji; Kurosawa, Yoshikazu; Hirai, Momoki

    1996-06-01

    Nucleobindin (Nuc) was first identified as a secreted protein of 55 kDa that promotes production of DNA-specific antibodies in lupus-prone MRL/lpr mice. Analysis of cDNA that encoded Nuc revealed that the protein is composed of a signal peptide, a DNA-binding site, two calcium-binding motifs (EF-hand motifs), and a leucine zipper. In the present study, we analysed the organization of the human gene for Nuc (NUC). It consists of 13 exons that are distributed in a region of 32 kb. The functional motifs listed above are encoded in corresponding exons. NUC was expressed in all organs examined. Comparison of nucleotide sequences in the promotre regions between human and mouse NCU genes revealed several conserved sequences. Among them, two Sp1-binding sites and a CCAAT box are of particular interest. The promoter is of the TATA-less type, and transcription starts at multiple sites in both the human and the mouse genes. These features suggest that NUC might normally play a role as a housekeeping gene. NUC was located at human chromosome 19q13.2-q13.4. 25 refs., 4 figs., 1 tab.

  12. Assignment of human elongation factor 1{alpha} genes: EEF1A maps to chromosome 6q14 and EEF1A2 to 20q13.3

    SciTech Connect

    Lund, A.; Clark, B.; Knudsen, S.M.

    1996-09-01

    The human elongation factor 1 {alpha} gene family consists of at least 2 actively transcribed genes, EEF1A and EEF1A2, and more than 18 homologous loci. EEF1A2 is expressed ubiquitously, and both of them can function in translation. An EEF1A cDNA probe has previously been shown to cross-hybridize with several human chromosomes, but the location of the functional gene has not been established. We have mapped the functional EEF1A gene to 6q14 by combined fluorescence in situ hybridization (FISH) and PCR analysis of a somatic cell hybrid panel and mapped EEF1A2 to 20q13.3 by FISH. In addition, the 11 strongest cross-hybridizing loci (EEF1AL2-EEF1AL13) were mapped by FISH to 12p12, 9q34, 7p15-p21, 19q13, 3q26-q27, 7q33-q35, 1p13-p22, 2q12-q14, 5p12-q11, 1q31-q32, and Xq21. 17 refs., 1 fig., 1 tab.

  13. Expansion of the. alpha. sub 2 -adrenergic receptor family: Cloning and characterization of a human. alpha. sub 2 -adrenergic receptor subtype, the gene for which is located on chromosome 2

    SciTech Connect

    Lomasney, J.W.; Lorenz, W.; Allen, L.F.; King, K.; Caron, M.G.; Lefkowitz, R.J. ); Regan, J.W. ); Yang-Feng, T.L. )

    1990-07-01

    Pharmacologic, biochemical, and genetic analyses have demonstrated the existence of multiple {alpha}{sub 2}-adrenergic receptor ({alpha}{sub 2}AR) subtypes. The authors have cloned a human {alpha}{sub 2}AR by using the polymerase chain reaction with oligonucleotide primers homologous to conserved regions of the previously cloned {alpha}{sub 2}ARs, the genes for which are located on human chromosomes 4 (C4) and 10 (C10). The deduced amino acid sequence encodes a protein of 450 amino acids whose putative topology is similar to that of the family of guanine nucleotide-binding protein-coupled receptors, but whose structure most closely resembles that of the {alpha}{sub 2}ARs. Competition curve analysis of the binding properties of the receptor expressed in COS-7 cells with a variety of adrenergic ligands demonstrates a unique {alpha}{sub 2}AR pharmacology. Hybridization with somatic cell hybrids shows that the gene for this receptor is located on chromosome 2. Northern blot analysis of various rat tissues shows expression in liver and kidney. The unique pharmacology and tissue localization of this receptor suggest that this is an {alpha}{sub 2}AR subtype not previously identified by classical pharmacological or ligand binding approaches.

  14. Genomics and genetics of human and primate y chromosomes.

    PubMed

    Hughes, Jennifer F; Rozen, Steve

    2012-01-01

    In mammals, the Y chromosome plays the pivotal role in male sex determination and is essential for normal sperm production. Yet only three Y chromosomes have been completely sequenced to date--those of human, chimpanzee, and rhesus macaque. While Y chromosomes are notoriously difficult to sequence owing to their highly repetitive genomic landscapes, these dedicated sequencing efforts have generated tremendous yields in medical, biological, and evolutionary insight. Knowledge of the complex structural organization of the human Y chromosome and a complete catalog of its gene content have provided a deeper understanding of the mechanisms that generate disease-causing mutations and large-scale rearrangements. Variation among human Y-chromosome sequences has been an invaluable tool for understanding relationships among human populations. Comprehensive comparisons of the human Y-chromosome sequence with those of other primates have illuminated aspects of Y-chromosome evolutionary dynamics over much longer timescales (>25 million years compared with 100,000 years). The future sequencing of additional Y chromosomes will provide a basis for a more comprehensive understanding of the evolution of Y chromosomes and their roles in reproductive biology.

  15. The human Y chromosome: function, evolution and disease.

    PubMed

    Quintana-Murci, L; Krausz, C; McElreavey, K

    2001-05-15

    The human Y chromosome is strictly paternally inherited and, in most of its length, does not recombine during male meiosis. These features make the Y a very useful genetic marker for different purposes. In the last decade, the Y has been increasingly used to investigate the evolution, migrations and range expansions of modern humans. The possibility to construct highly informative Y chromosome haplotypes has also had a significant impact in forensic studies and paternity testing. All these studies assume that the Y chromosome markers used are selectively neutral. However, recent experimental and statistical analyses suggest that both positive and negative selection are acting on the Y chromosome and, consequently, may influence Y chromosome haplotype distribution in the general population. Current data suggest that the effects of selection on patterns of Y chromosome distribution are minimal, however as interest focuses on biological functions of the Y chromosome which have a major impact on male fitness such as fertility, these assumptions may be challenged. This review briefly describes the genes and biological functions of the human Y chromosome and its use in disentangling the origin and history of human populations. An overview of the role of selection acting on the Y chromosome from the perspective of human population histories and disease is given.

  16. Cloning and characterization of Rep-8 (D8S2298E) in the human chromosome 8p11.2-p12

    SciTech Connect

    Yamabe, Yukako; Ichikawa, Koji; Sugawara, Kahori

    1997-01-15

    A novel human gene referred to as the Rep-8 gene (D8S2298E) was cloned by a combination of exon trapping, thermal asymmetric interlaced-PCR, and screening of a cDNA library. It is located in human chromosome 8p.11.2-p12. The gene consists of eight exons and spans about 20 kb between the glutathione S-reductase and the protein phosphatase 2A beta subunit genes. The full-length Rep-8 gene contains 1483 nucleotides and codes for a protein of 270 amino acids. Southern blot experiments showed that the Rep-8 gene exists as a single copy per haploid. With a zoo blot analysis, human Rep-8 DNA hybridized strongly with the monkey DNA, but only weakly with the DNAs of species other than Homo sapiens. Northern blot analysis showed that it is expressed abundantly in the testis and ovary, suggesting that the Rep-8 gene product may play a role in reproduction. 16 refs., 5 figs., 1 tab.

  17. Altered pattern of replication of human chromosomes in a human fibroblast-mouse cell hybrid.

    PubMed Central

    Farber, R A; Davidson, R L

    1978-01-01

    The pattern of terminal replication of the human chromosomes in a clone of hybrids between diploid human fibroblasts and mouse cells was analyzed by autoradiography. An average of 10 human chromosomes was present in the hybrid cells. Several of these chromosomes were found to terminate replication in a different order from the same chromosomes in the parental human fibroblasts. Chromosomes 4 and 5 completed replication later in the hybrid than in the fibroblasts (relative to the other human chromosomes). In contrast, chromosomes 7, 12, and 15 completed replication earlier in the hybrid than in the fibroblasts. These results suggest that the sequence of terminal chromosome replication in human fibroblasts is not irreversibly programmed into each chromosome. Images PMID:274734

  18. Correlations between isochores and chromosomal bands in the human genome

    SciTech Connect

    Saccone, S.; Della Valle, G. ); De Sario, A.; Bernardi, G. ); Wiegant, J.; Raap, A.K. )

    1993-11-15

    The human genome is made up of long DNA segments, the isochores, which are compositionally homogeneous and can be subdivided into a small number of families characterized by different G+C levels. Chromosome in situ suppression hybridization (in which excess unlabeled human DNA is added to suppress hybridization of repeated sequences present in the probe, enabling enhanced observation of single-copy sequences) of DNA fractions characterized by an increasing G+C level was carried out to determine the distribution of [open quotes]single-copy[close quotes] sequences corresponding to isochore families L1 + L2, H1, H2, and H3 on metaphase chromosomes. This produced a banding pattern progressing from a relatively diffuse staining to an R-banding, to a T-banding. More specifically, the results showed that (i) T-bands are formed by the G+C-richest isochores of the H3 family and by part of the G+C-rich isochores of the H1 and H2 families (with a predominance of the latter); (ii) R[prime]-bands (namely, R-bands exclusive of T-bands) are formed to almost equal extents by G+C-rich isochores of the H1 families (with a minor contribution of the H2 and H3 families) and by G+C-poor isochores of the L1 + L2 families; (iii) G-bands essentially consist of G+C-poor isochores from the L1 + L2 families, with a minor contribution of isochores from the H1 family. These results not only clarify the correlations between DNA base composition and chromosomal bands but also provide information on the distribution of genes in chromosomes, gene concentration increasing with the G+C levels of isochores.

  19. The CEPH consortium linkage map of human chromosome 16

    SciTech Connect

    Kozman, H.M.; Mulley, J.C.; Keith, T.P.

    1995-01-01

    A Centre d`Etude du Polymorphisme Humain (CEPH) consortium map of human chromosome 16 has been constructed. The map contains 158 loci defined by 191 different probe/restriction enzyme combinations or primer pairs. The marker genotypes, contributed by 9 collaborating laboratories, originated from the CEPH families DNA. A total of 60 loci, with an average heterozygosity of 68%, have been placed on the framework genetic map. The genetic map contains 7 genes. The length of the sex-averaged map is 165 cM, with a mean genetic distance between loci of 2.8 cM; the median distance between markers is 2.0 cM. The male map length is 136 cM, and the female map length is 197 cM. The map covers virtually the entire chromosome, from D16S85, within 170 to 430 kb of the 16p telomere, to D16S303 at 16qter. The markers included in the linkage map have been physically mapped on a partial human chromosome 16 somatic cell hybrid panel, thus anchoring the genetic map to the cytogenetic-based physical map. 39 refs., 2 figs., 6 tabs.

  20. Assignment of the lactotransferrin gene to human chromosome 3 and to mouse chromosome 9.

    PubMed

    Teng, C T; Pentecost, B T; Marshall, A; Solomon, A; Bowman, B H; Lalley, P A; Naylor, S L

    1987-11-01

    Lactotransferrin (LTF), a member of the transferrin family of genes, is the major iron-binding protein in milk and body secretions. The amino acid sequence of LTF consists of two homologous domains homologous to proteins in the transferrin family. Recent isolation of cDNA encoding mouse LTF has expedited the mapping of both mouse and human LTF genes. Southern blot analysis of DNA from mouse-Chinese hamster and human-mouse somatic cell hybrids maps the LTF gene to mouse chromosome 9 and to human chromosome 3, respectively. Furthermore, analysis of cell hybrids containing defined segments of human chromosome 3 demonstrates that the gene is located in the 3q21-qter region. These results suggest that LTF and associated genes of the transferrin family have existed together on the same chromosomal region for 300-500 million years. PMID:3478818

  1. Chromosome region-specific libraries for human genome analysis

    SciTech Connect

    Kao, Fa-Ten.

    1992-08-01

    During the grant period progress has been made in the successful demonstration of regional mapping of microclones derived from microdissection libraries; successful demonstration of the feasibility of converting microclones with short inserts into yeast artificial chromosome clones with very large inserts for high resolution physical mapping of the dissected region; Successful demonstration of the usefulness of region-specific microclones to isolate region-specific cDNA clones as candidate genes to facilitate search for the crucial genes underlying genetic diseases assigned to the dissected region; and the successful construction of four region-specific microdissection libraries for human chromosome 2, including 2q35-q37, 2q33-q35, 2p23-p25 and 2p2l-p23. The 2q35-q37 library has been characterized in detail. The characterization of the other three libraries is in progress. These region-specific microdissection libraries and the unique sequence microclones derived from the libraries will be valuable resources for investigators engaged in high resolution physical mapping and isolation of disease-related genes residing in these chromosomal regions.

  2. Isolation and refined regional mapping of expressed sequences from human chromosome 21

    SciTech Connect

    Kao, F.T.; Yu, J.; Patterson, D.

    1994-10-01

    To increase candidate genes from human chromosome 21 for the analysis of Down syndrome and other genetic diseases localized on this chromosome, we have isolated and studied 9 cDNA clones encoded by chromosome 21. For isolating cDNAs, single-copy microclones from a chromosome 21 microdissection library were used in direct screening of various cDNA libraries. Seven of the cDNA clones have been regionally mapped on chromosome 21 using a comprehensive hybrid mapping panel comprising 24 cell hybrids that divide the chromosome into 33 subregions. These cDNA clones with refined mapping positions should be useful for identification and cloning of genes responsible for the specific component phenotypes of Down syndrome and other diseases on chromosome 21, including progressive myoclonus epilepsy in 21q22.3. 12 refs., 2 figs., 1 tab.

  3. Roles of the Y chromosome genes in human cancers.

    PubMed

    Kido, Tatsuo; Lau, Yun-Fai Chris

    2015-01-01

    Male and female differ genetically by their respective sex chromosome composition, that is, XY as male and XX as female. Although both X and Y chromosomes evolved from the same ancestor pair of autosomes, the Y chromosome harbors male-specific genes, which play pivotal roles in male sex determination, germ cell differentiation, and masculinization of various tissues. Deletions or translocation of the sex-determining gene, SRY, from the Y chromosome causes disorders of sex development (previously termed as an intersex condition) with dysgenic gonads. Failure of gonadal development results not only in infertility, but also in increased risks of germ cell tumor (GCT), such as gonadoblastoma and various types of testicular GCT. Recent studies demonstrate that either loss of Y chromosome or ectopic expression of Y chromosome genes is closely associated with various male-biased diseases, including selected somatic cancers. These observations suggest that the Y-linked genes are involved in male health and diseases in more frequently than expected. Although only a small number of protein-coding genes are present in the male-specific region of Y chromosome, the impacts of Y chromosome genes on human diseases are still largely unknown, due to lack of in vivo models and differences between the Y chromosomes of human and rodents. In this review, we highlight the involvement of selected Y chromosome genes in cancer development in men.

  4. Cloning and characterization of CpG islands of the human chromosome 1p36 region

    SciTech Connect

    Ellmeier, W.; Barnas, C.; Kobrna, A.

    1996-02-15

    This article reports on the localization of CpG islands to human chromosome 1p36 as a means for the isolation of genes using hybridization techniques. Two cDNA clones encode the human transcription factor E2F-2 and the dominant-negative helix-loop-helix gene ID3. Further information regarding the organization of human chromosome 1 was accomplished using electrophoresis. 11 refs., 3 figs.

  5. The CEPH consortium linkage map of human chromosome 16

    SciTech Connect

    Mulley, J.C.; Kozman, H.M.; Sutherland, G.R.

    1994-09-01

    A Centre d`Etude du Polymorphisme Humain (CEPH) consortium map of human chromosome 16 has been constructed. The map contains 158 loci defined by 191 different probe/restriction enzyme combinations or primer pairs. The marker genotypes, contributed by 9 collaborating laboratories, originated from the CEPH families DNA. A total of 60 loci, with an average heterozygosity of 68%, have been placed on the framework genetic map. The genetic map contains 7 genes. The length of the sex-average map is 165 cM, with a mean genetic distance between loci of 2.8 cM; the median distance between markers is 2.0 cM. The male map length is 136 cM and the female map length is 197 cM. The map virtually covers the entire chromosome, from D16S85, within 170 to 430 Kb of the 16p telomere, to D16S303 at 16qter. The markers included in the linkage map have been physically mapped on a partial human chromosome 16 somatic cell hybrid panel, thus anchoring the genetic map to the cytogenetic-based physical map.

  6. Chromosomal localization of the human vesicular amine transporter genes

    SciTech Connect

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. )

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  7. Hierarchical radial and polar organisation of chromosomes in human sperm.

    PubMed

    Millan, N M; Lau, P; Hann, M; Ioannou, D; Hoffman, D; Barrionuevo, M; Maxson, W; Ory, S; Tempest, H G

    2012-10-01

    It is well established that chromosomes occupy distinct positions within the interphase nuclei, conferring a potential functional implication to the genome. In addition, alterations in the nuclear organisation patterns have been associated with disease phenotypes (e.g. cancer or laminopathies). The human sperm is the smallest cell in the body with specific DNA packaging and the mission of delivering the paternal genome to the oocyte during fertilisation. Studies of nuclear organisation in the sperm have postulated nonrandom chromosome position and have proposed a chromocentre model with the centromeres facing toward the interior and the telomeres toward the periphery of the nucleus. Most studies have assessed the nuclear address in the sperm longitudinally predominantly using centromeric or telomeric probes and to a lesser extent with whole chromosome paints. To date, studies investigating the radial organisation of human sperm have been limited. The purpose of this study was to utilise whole chromosome paints for six clinically important chromosomes (18, 19, 21, 22, X, and Y) to investigate nuclear address by assessing their radial and longitudinal nuclear organisation. A total of 10,800 sperm were analysed in nine normozoospermic individuals. The results have shown nonrandom chromosome position for all chromosomes using both methods of analysis. We present novel radial and polar analysis of chromosome territory localization within the human sperm nucleus. Specifically, a hierarchical organisation was observed radially with chromosomes organised from the interior to the periphery (chromosomes 22, 21, Y, X, 19, and 18 respectively) and polar organisation from the sperm head to tail (chromosomes X, 19, Y, 22, 21, and 18, respectively). We provide evidence of defined nuclear organisation in the human sperm and discuss the function of organisation and potential possible clinical ramifications of these results in regards to male infertility and early human development

  8. The finished DNA sequence of human chromosome 12.

    PubMed

    Scherer, Steven E; Muzny, Donna M; Buhay, Christian J; Chen, Rui; Cree, Andrew; Ding, Yan; Dugan-Rocha, Shannon; Gill, Rachel; Gunaratne, Preethi; Harris, R Alan; Hawes, Alicia C; Hernandez, Judith; Hodgson, Anne V; Hume, Jennifer; Jackson, Andrew; Khan, Ziad Mohid; Kovar-Smith, Christie; Lewis, Lora R; Lozado, Ryan J; Metzker, Michael L; Milosavljevic, Aleksandar; Miner, George R; Montgomery, Kate T; Morgan, Margaret B; Nazareth, Lynne V; Scott, Graham; Sodergren, Erica; Song, Xing-Zhi; Steffen, David; Lovering, Ruth C; Wheeler, David A; Worley, Kim C; Yuan, Yi; Zhang, Zhengdong; Adams, Charles Q; Ansari-Lari, M Ali; Ayele, Mulu; Brown, Mary J; Chen, Guan; Chen, Zhijian; Clerc-Blankenburg, Kerstin P; Davis, Clay; Delgado, Oliver; Dinh, Huyen H; Draper, Heather; Gonzalez-Garay, Manuel L; Havlak, Paul; Jackson, Laronda R; Jacob, Leni S; Kelly, Susan H; Li, Li; Li, Zhangwan; Liu, Jing; Liu, Wen; Lu, Jing; Maheshwari, Manjula; Nguyen, Bao-Viet; Okwuonu, Geoffrey O; Pasternak, Shiran; Perez, Lesette M; Plopper, Farah J H; Santibanez, Jireh; Shen, Hua; Tabor, Paul E; Verduzco, Daniel; Waldron, Lenee; Wang, Qiaoyan; Williams, Gabrielle A; Zhang, Jingkun; Zhou, Jianling; Allen, Carlana C; Amin, Anita G; Anyalebechi, Vivian; Bailey, Michael; Barbaria, Joseph A; Bimage, Kesha E; Bryant, Nathaniel P; Burch, Paula E; Burkett, Carrie E; Burrell, Kevin L; Calderon, Eliana; Cardenas, Veronica; Carter, Kelvin; Casias, Kristal; Cavazos, Iracema; Cavazos, Sandra R; Ceasar, Heather; Chacko, Joseph; Chan, Sheryl N; Chavez, Dean; Christopoulos, Constantine; Chu, Joseph; Cockrell, Raynard; Cox, Caroline D; Dang, Michelle; Dathorne, Stephanie R; David, Robert; Davis, Candi Mon'Et; Davy-Carroll, Latarsha; Deshazo, Denise R; Donlin, Jeremy E; D'Souza, Lisa; Eaves, Kristy A; Egan, Amy; Emery-Cohen, Alexandra J; Escotto, Michael; Flagg, Nicole; Forbes, Lisa D; Gabisi, Abdul M; Garza, Melissa; Hamilton, Cerissa; Henderson, Nicholas; Hernandez, Omar; Hines, Sandra; Hogues, Marilyn E; Huang, Mei; Idlebird, DeVincent G; Johnson, Rudy; Jolivet, Angela; Jones, Sally; Kagan, Ryan; King, Laquisha M; Leal, Belita; Lebow, Heather; Lee, Sandra; LeVan, Jaclyn M; Lewis, Lakeshia C; London, Pamela; Lorensuhewa, Lorna M; Loulseged, Hermela; Lovett, Demetria A; Lucier, Alice; Lucier, Raymond L; Ma, Jie; Madu, Renita C; Mapua, Patricia; Martindale, Ashley D; Martinez, Evangelina; Massey, Elizabeth; Mawhiney, Samantha; Meador, Michael G; Mendez, Sylvia; Mercado, Christian; Mercado, Iracema C; Merritt, Christina E; Miner, Zachary L; Minja, Emmanuel; Mitchell, Teresa; Mohabbat, Farida; Mohabbat, Khatera; Montgomery, Baize; Moore, Niki; Morris, Sidney; Munidasa, Mala; Ngo, Robin N; Nguyen, Ngoc B; Nickerson, Elizabeth; Nwaokelemeh, Ogechi O; Nwokenkwo, Stanley; Obregon, Melissa; Oguh, Maryann; Oragunye, Njideka; Oviedo, Rodolfo J; Parish, Bridgette J; Parker, David N; Parrish, Julia; Parks, Kenya L; Paul, Heidie A; Payton, Brett A; Perez, Agapito; Perrin, William; Pickens, Adam; Primus, Eltrick L; Pu, Ling-Ling; Puazo, Maria; Quiles, Miyo M; Quiroz, Juana B; Rabata, Dina; Reeves, Kacy; Ruiz, San Juana; Shao, Hongmei; Sisson, Ida; Sonaike, Titilola; Sorelle, Richard P; Sutton, Angelica E; Svatek, Amanda F; Svetz, Leah Anne; Tamerisa, Kavitha S; Taylor, Tineace R; Teague, Brian; Thomas, Nicole; Thorn, Rachel D; Trejos, Zulma Y; Trevino, Brenda K; Ukegbu, Ogechi N; Urban, Jeremy B; Vasquez, Lydia I; Vera, Virginia A; Villasana, Donna M; Wang, Ling; Ward-Moore, Stephanie; Warren, James T; Wei, Xuehong; White, Flower; Williamson, Angela L; Wleczyk, Regina; Wooden, Hailey S; Wooden, Steven H; Yen, Jennifer; Yoon, Lillienne; Yoon, Vivienne; Zorrilla, Sara E; Nelson, David; Kucherlapati, Raju; Weinstock, George; Gibbs, Richard A

    2006-03-16

    Human chromosome 12 contains more than 1,400 coding genes and 487 loci that have been directly implicated in human disease. The q arm of chromosome 12 contains one of the largest blocks of linkage disequilibrium found in the human genome. Here we present the finished sequence of human chromosome 12, which has been finished to high quality and spans approximately 132 megabases, representing approximately 4.5% of the human genome. Alignment of the human chromosome 12 sequence across vertebrates reveals the origin of individual segments in chicken, and a unique history of rearrangement through rodent and primate lineages. The rate of base substitutions in recent evolutionary history shows an overall slowing in hominids compared with primates and rodents. PMID:16541075

  9. The finished DNA sequence of human chromosome 12.

    PubMed

    Scherer, Steven E; Muzny, Donna M; Buhay, Christian J; Chen, Rui; Cree, Andrew; Ding, Yan; Dugan-Rocha, Shannon; Gill, Rachel; Gunaratne, Preethi; Harris, R Alan; Hawes, Alicia C; Hernandez, Judith; Hodgson, Anne V; Hume, Jennifer; Jackson, Andrew; Khan, Ziad Mohid; Kovar-Smith, Christie; Lewis, Lora R; Lozado, Ryan J; Metzker, Michael L; Milosavljevic, Aleksandar; Miner, George R; Montgomery, Kate T; Morgan, Margaret B; Nazareth, Lynne V; Scott, Graham; Sodergren, Erica; Song, Xing-Zhi; Steffen, David; Lovering, Ruth C; Wheeler, David A; Worley, Kim C; Yuan, Yi; Zhang, Zhengdong; Adams, Charles Q; Ansari-Lari, M Ali; Ayele, Mulu; Brown, Mary J; Chen, Guan; Chen, Zhijian; Clerc-Blankenburg, Kerstin P; Davis, Clay; Delgado, Oliver; Dinh, Huyen H; Draper, Heather; Gonzalez-Garay, Manuel L; Havlak, Paul; Jackson, Laronda R; Jacob, Leni S; Kelly, Susan H; Li, Li; Li, Zhangwan; Liu, Jing; Liu, Wen; Lu, Jing; Maheshwari, Manjula; Nguyen, Bao-Viet; Okwuonu, Geoffrey O; Pasternak, Shiran; Perez, Lesette M; Plopper, Farah J H; Santibanez, Jireh; Shen, Hua; Tabor, Paul E; Verduzco, Daniel; Waldron, Lenee; Wang, Qiaoyan; Williams, Gabrielle A; Zhang, Jingkun; Zhou, Jianling; Allen, Carlana C; Amin, Anita G; Anyalebechi, Vivian; Bailey, Michael; Barbaria, Joseph A; Bimage, Kesha E; Bryant, Nathaniel P; Burch, Paula E; Burkett, Carrie E; Burrell, Kevin L; Calderon, Eliana; Cardenas, Veronica; Carter, Kelvin; Casias, Kristal; Cavazos, Iracema; Cavazos, Sandra R; Ceasar, Heather; Chacko, Joseph; Chan, Sheryl N; Chavez, Dean; Christopoulos, Constantine; Chu, Joseph; Cockrell, Raynard; Cox, Caroline D; Dang, Michelle; Dathorne, Stephanie R; David, Robert; Davis, Candi Mon'Et; Davy-Carroll, Latarsha; Deshazo, Denise R; Donlin, Jeremy E; D'Souza, Lisa; Eaves, Kristy A; Egan, Amy; Emery-Cohen, Alexandra J; Escotto, Michael; Flagg, Nicole; Forbes, Lisa D; Gabisi, Abdul M; Garza, Melissa; Hamilton, Cerissa; Henderson, Nicholas; Hernandez, Omar; Hines, Sandra; Hogues, Marilyn E; Huang, Mei; Idlebird, DeVincent G; Johnson, Rudy; Jolivet, Angela; Jones, Sally; Kagan, Ryan; King, Laquisha M; Leal, Belita; Lebow, Heather; Lee, Sandra; LeVan, Jaclyn M; Lewis, Lakeshia C; London, Pamela; Lorensuhewa, Lorna M; Loulseged, Hermela; Lovett, Demetria A; Lucier, Alice; Lucier, Raymond L; Ma, Jie; Madu, Renita C; Mapua, Patricia; Martindale, Ashley D; Martinez, Evangelina; Massey, Elizabeth; Mawhiney, Samantha; Meador, Michael G; Mendez, Sylvia; Mercado, Christian; Mercado, Iracema C; Merritt, Christina E; Miner, Zachary L; Minja, Emmanuel; Mitchell, Teresa; Mohabbat, Farida; Mohabbat, Khatera; Montgomery, Baize; Moore, Niki; Morris, Sidney; Munidasa, Mala; Ngo, Robin N; Nguyen, Ngoc B; Nickerson, Elizabeth; Nwaokelemeh, Ogechi O; Nwokenkwo, Stanley; Obregon, Melissa; Oguh, Maryann; Oragunye, Njideka; Oviedo, Rodolfo J; Parish, Bridgette J; Parker, David N; Parrish, Julia; Parks, Kenya L; Paul, Heidie A; Payton, Brett A; Perez, Agapito; Perrin, William; Pickens, Adam; Primus, Eltrick L; Pu, Ling-Ling; Puazo, Maria; Quiles, Miyo M; Quiroz, Juana B; Rabata, Dina; Reeves, Kacy; Ruiz, San Juana; Shao, Hongmei; Sisson, Ida; Sonaike, Titilola; Sorelle, Richard P; Sutton, Angelica E; Svatek, Amanda F; Svetz, Leah Anne; Tamerisa, Kavitha S; Taylor, Tineace R; Teague, Brian; Thomas, Nicole; Thorn, Rachel D; Trejos, Zulma Y; Trevino, Brenda K; Ukegbu, Ogechi N; Urban, Jeremy B; Vasquez, Lydia I; Vera, Virginia A; Villasana, Donna M; Wang, Ling; Ward-Moore, Stephanie; Warren, James T; Wei, Xuehong; White, Flower; Williamson, Angela L; Wleczyk, Regina; Wooden, Hailey S; Wooden, Steven H; Yen, Jennifer; Yoon, Lillienne; Yoon, Vivienne; Zorrilla, Sara E; Nelson, David; Kucherlapati, Raju; Weinstock, George; Gibbs, Richard A

    2006-03-16

    Human chromosome 12 contains more than 1,400 coding genes and 487 loci that have been directly implicated in human disease. The q arm of chromosome 12 contains one of the largest blocks of linkage disequilibrium found in the human genome. Here we present the finished sequence of human chromosome 12, which has been finished to high quality and spans approximately 132 megabases, representing approximately 4.5% of the human genome. Alignment of the human chromosome 12 sequence across vertebrates reveals the origin of individual segments in chicken, and a unique history of rearrangement through rodent and primate lineages. The rate of base substitutions in recent evolutionary history shows an overall slowing in hominids compared with primates and rodents.

  10. Chromosome aberrations in human blood lymphocytes exposed to energetic protons

    NASA Astrophysics Data System (ADS)

    Hada, Megumi; George, Ms Kerry; Cucinotta, Francis A.

    During space flight, astronauts are exposed to space radiation consisting of high-energy protons, high charge and energy (HZE) nuclei, as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary particles have a higher LET value than primary protons and are therefore expected to have a higher relative biological effectiveness (RBE). To investigate this theory, we exposed human peripheral blood lymphocytes to protons with energies of 250 MeV, 800MeV, 2 GeV, or 2.5 GeV. LET values for these protons ranged from 0.4 to 0.2 keV/µm. and doses ranged from 0.2 to 3 Gy. Over this energy range the probability of nuclear reaction leading to secondary radiation, and the multiplicity of reaction products such as neutrons and mesons increases substantially. The effect of aluminum and polyethylene shielding was also assessed using the 2 GeV and 2.5GeV proton beams. After exposure lymphocytes were stimulated to divide and chromosomes were collected from cells in the first G2 and metaphase cell cycle after exposure using a chemical induced premature chromosome condensation (PCC) technique. Dose response data for chromosome damage was analyzed using the fluorescence in situ hybridization (FISH) chromosome painting technique. Selected samples were also analyzed with multicolor FISH (mFISH) and multicolor banding FISH (mBAND) techniques. Data indicates that the dose response for simple-type exchanges is similar for proton and gamma exposure, whereas protons induce higher yields of complex exchanges that are energy dependent. RBE values will be presented for each proton energy, and the effects of shielding and possible cytogenetic signatures of proton exposure will be discussed.

  11. Chromosome Aberration in Human Blood Lymphocytes Exposed to Energetic Protons

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, Kerry A.; Cucinotta, F. A.

    2008-01-01

    During space flight, astronauts are exposed to a space radiation consisting of high-energy protons, high charge and energy (HZE) nuclei, as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary particles have a higher LET value than primary protons and therefore expected to have a higher relative biological effectiveness (RBE). To investigate this theory, we exposed human peripheral blood lymphocytes to protons with energies of 250 MeV, 800MeV, 2 GeV, or 2.5 GeV. LET values for these protons ranged from 0.4 to 0.2 keV/micrometer. and doses ranged from 0.2 to 3 Gy. Over this energy the probability of nuclear reaction leading to secondary radiation, and the multiplicity of reaction produces such as neutrons and mesons increases substantially. The effect of aluminum and polyethylene shielding was also assessed using the 2 GeV and 2.5GeV proton beams. After exposure lymphocytes were stimulated to divide and chromosomes were collected from cells in the first G2 and metaphase cell cycle after exposure using a chemical induced premature chromosome condensation (PCC) technique. Dose response data for chromosome damage was analyzed using the fluorescence in situ hybridization (FISH) chromosome painting technique. Selected samples were also analyzed with multicolor FISH (mFISH) and multicolor banding FISH (mBAND) techniques. Data indicates that the dose response for simple-type exchanges is similar for proton and gamma exposure, whereas protons induce higher yields of complex exchanges that are LET dependent. RBE values will be presented for each proton energy, and the effects of shielding and possible cytogenetic signatures of proton exposure will be discussed.

  12. Structure and chromosomal localization of the human gene of the phosphotyrosyl phosphatase activator (PTPA) of protein phosphatase 2A

    SciTech Connect

    Van Hoof, C.; Cayla, X.; Merlevede, W.; Goris, J.

    1995-07-20

    The PTPA gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. PTPA, cloned from human genomic libraries, is encoded by one single-copy gene, composed of 10 exons and 9 introns with a total length of about 60 kb. The transcription start site was determined, and the 5{prime} flanking sequence was analyzed for its potential as a promotor. This region lacks a TATA sequence in the appropriate position relative to the transcription start, is very GC-rich, and contains upstream of the transcription start four Sp1 sites, a feature common to many TATA-less promotors. Based on the homology with DNA binding consensus sequences of transcription factors, we identified in this promotor region several putative DNA binding sites for transcription factors, such as NF-{kappa}B, Myb, Ets-1, Myc, and ATF. Transfection experiments with a construct containing the PTPA promotor region inserted 5{prime} of a luciferase reporter gene revealed that the 5{prime} flanking sequence of the PTPA gene indeed displayed promotor activity that seems to be cell-line dependent. By fluorescence in situ hybridization and G-banding, the PTPA gene was localized to the 9q34 region. The PTPA gene is positioned centromeric of c-abl in a region embracing several genes implicated in oncogenesis. 28 refs., 8 figs., 1 tab.

  13. Deficit of mitonuclear genes on the human X chromosome predates sex chromosome formation.

    PubMed

    Dean, Rebecca; Zimmer, Fabian; Mank, Judith E

    2015-02-01

    Two taxa studied to date, the therian mammals and Caenorhabditis elegans, display underrepresentations of mitonuclear genes (mt-N genes, nuclear genes whose products are imported to and act within the mitochondria) on their X chromosomes. This pattern has been interpreted as the result of sexual conflict driving mt-N genes off of the X chromosome. However, studies in several other species have failed to detect a convergent biased distribution of sex-linked mt-N genes, leading to questions over the generality of the role of sexual conflict in shaping the distribution of mt-N genes. Here we tested whether mt-N genes moved off of the therian X chromosome following sex chromosome formation, consistent with the role of sexual conflict, or whether the paucity of mt-N genes on the therian X is a chance result of an underrepresentation on the ancestral regions that formed the X chromosome. We used a synteny-based approach to identify the ancestral regions in the platypus and chicken genomes that later formed the therian X chromosome. We then quantified the movement of mt-N genes on and off of the X chromosome and the distribution of mt-N genes on the human X and ancestral X regions. We failed to find an excess of mt-N gene movement off of the X. The bias of mt-N genes on ancestral therian X chromosomes was also not significantly different from the biases on the human X. Together our results suggest that, rather than conflict driving mt-N genes off of the mammalian X, random biases on chromosomes that formed the X chromosome could explain the paucity of mt-N genes in the therian lineage.

  14. Deficit of mitonuclear genes on the human X chromosome predates sex chromosome formation.

    PubMed

    Dean, Rebecca; Zimmer, Fabian; Mank, Judith E

    2015-02-01

    Two taxa studied to date, the therian mammals and Caenorhabditis elegans, display underrepresentations of mitonuclear genes (mt-N genes, nuclear genes whose products are imported to and act within the mitochondria) on their X chromosomes. This pattern has been interpreted as the result of sexual conflict driving mt-N genes off of the X chromosome. However, studies in several other species have failed to detect a convergent biased distribution of sex-linked mt-N genes, leading to questions over the generality of the role of sexual conflict in shaping the distribution of mt-N genes. Here we tested whether mt-N genes moved off of the therian X chromosome following sex chromosome formation, consistent with the role of sexual conflict, or whether the paucity of mt-N genes on the therian X is a chance result of an underrepresentation on the ancestral regions that formed the X chromosome. We used a synteny-based approach to identify the ancestral regions in the platypus and chicken genomes that later formed the therian X chromosome. We then quantified the movement of mt-N genes on and off of the X chromosome and the distribution of mt-N genes on the human X and ancestral X regions. We failed to find an excess of mt-N gene movement off of the X. The bias of mt-N genes on ancestral therian X chromosomes was also not significantly different from the biases on the human X. Together our results suggest that, rather than conflict driving mt-N genes off of the mammalian X, random biases on chromosomes that formed the X chromosome could explain the paucity of mt-N genes in the therian lineage. PMID:25637223

  15. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human.

    PubMed

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  16. A new region of conservation is defined between human and mouse X chromosomes

    SciTech Connect

    Dinulos, M.B.; Disteche, C.M.; Bassi, M.T.

    1996-07-01

    Comparative mapping of the X chromosome in eutherian mammals have revealed distinct regions of conservation as well as evolutionary rearrangements between human and mouse. Recently, we and others mapped the murine homologue of CLCN4 (Chloride channel 4) to band F4 of the X chromosome in Mus spretus but to chromosome 7 in laboratory strains. We now report the mapping of the murine homologues of APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), two genes that are located on the human X chromosome at band p22.3 and in close proximity to CLCN4. Interestingly, Oa1 and Apxl map to bands F2-F3 in both M. spretus and the laboratory strain C57BL/6J, defining a new rearrangement between human and mouse X chromosomes. 17 refs., 2 figs., 1 tab.

  17. Linkage mapping of the gene for Type III collagen (COL3A1) to human chromosome 2q using a VNTR polymorphism

    SciTech Connect

    Tiller, G.E.; Polumbo, P.A.; Summar, M.L. )

    1994-03-15

    The gene for the [alpha]1(III) chain of type III collagen, COL3A1, has been previously mapped to human chromosome 2q24.3-q31 by in situ hybridization. Physical mapping by pulsed-field gel electrophoresis has demonstrated that COL3A1 lies within 35 kb of COL5A2. The authors genotyped the CEPH families at the COL3A2 locus using a pentanucleotide repeat polymorphism within intron 25. They demonstrated significant linkage to 18 anonymous markers as well as the gene for carbamyl phosphate synthetase (CPSI), which had been previously mapped to this region. No recombination was seen between COL3A1 and COL5A2 (Z = 9.93 at [theta] = 0) or D2S24 (Z = 10.55 at [theta] = 0). The locus order is (D2S32-D2S138-D2S148)-(D2S24-COL5A2-COL3A1)-(D2S118-D2S161), with odds of 1:2300 for the next most likely order. These relationships are consistent with the physical mapping of COL3A1 to the distal portion of 2q and place it proximal to CPSI by means of multipoint analysis. These linkage relationships should prove useful in further studies of Ehlers-Danlos syndrome type IV and carbamyl phosphate synthetase I deficiency and provide an additional framework for localizing other genes in this region. 13 refs., 2 figs., 1 tab.

  18. Spectral karyotyping analysis of human and mouse chromosomes

    PubMed Central

    Padilla-Nash, Hesed M; Barenboim-Stapleton, Linda; Difilippantonio, Michael J; Ried, Thomas

    2016-01-01

    Classical banding methods provide basic information about the identities and structures of chromosomes on the basis of their unique banding patterns. Spectral karyotyping (SKY), and the related multiplex fluorescence in situ hybridization (M-FISH), are chromosome-specific multicolor FISH techniques that augment cytogenetic evaluations of malignant disease by providing additional information and improved characterization of aberrant chromosomes that contain DNA sequences not identifiable using conventional banding methods. SKY is based on cohybridization of combinatorially labeled chromosome-painting probes with unique fluorochrome signatures onto human or mouse metaphase chromosome preparations. Image acquisition and analysis use a specialized imaging system, combining Sagnac interferometer and CCD camera images to reconstruct spectral information at each pixel. Here we present a protocol for SKY analysis using commercially available SkyPaint probes, including procedures for metaphase chromosome preparation, slide pretreatment and probe hybridization and detection. SKY analysis requires approximately 6 d. PMID:17406576

  19. Human chromosomes 6 and 21 are required for sensitivity to human interferon. gamma

    SciTech Connect

    Jung, V.; Rashidbaigi, A.; Jones, C.; Tischfield, J.A.; Shows, T.B.; Pestka, S.

    1987-06-01

    The human interferon ..gamma.. receptor has previously been assigned to chromosome 6. Chromosome 6 also encodes HLA, the human class I major histocompatibility antigens. However, the presence of chromosome 6 in hamster-human hybrids is by itself insufficient to confer sensitivity to human immune interferon as measured by the induction of human HLA. Human chromosome 21 was found to be the second chromosome essential for HLA inducibility. Similar results were found with mouse-human somatic cell hybrids. Thus, at least two steps are involved in the action of human interferon ..gamma..: the binding of interferon ..gamma.. to its receptor coded by chromosome 6 and the linkage of this binding event through a factor coded by chromosome 21 to trigger biological action. Both of these steps are species-specific.

  20. The IG-DMR and the MEG3-DMR at human chromosome 14q32.2: hierarchical interaction and distinct functional properties as imprinting control centers.

    PubMed

    Kagami, Masayo; O'Sullivan, Maureen J; Green, Andrew J; Watabe, Yoshiyuki; Arisaka, Osamu; Masawa, Nobuhide; Matsuoka, Kentarou; Fukami, Maki; Matsubara, Keiko; Kato, Fumiko; Ferguson-Smith, Anne C; Ogata, Tsutomu

    2010-06-17

    Human chromosome 14q32.2 harbors the germline-derived primary DLK1-MEG3 intergenic differentially methylated region (IG-DMR) and the postfertilization-derived secondary MEG3-DMR, together with multiple imprinted genes. Although previous studies in cases with microdeletions and epimutations affecting both DMRs and paternal/maternal uniparental disomy 14-like phenotypes argue for a critical regulatory function of the two DMRs for the 14q32.2 imprinted region, the precise role of the individual DMR remains to be clarified. We studied an infant with upd(14)pat body and placental phenotypes and a heterozygous microdeletion involving the IG-DMR alone (patient 1) and a neonate with upd(14)pat body, but no placental phenotype and a heterozygous microdeletion involving the MEG3-DMR alone (patient 2). The results generated from the analysis of these two patients imply that the IG-DMR and the MEG3-DMR function as imprinting control centers in the placenta and the body, respectively, with a hierarchical interaction for the methylation pattern in the body governed by the IG-DMR. To our knowledge, this is the first study demonstrating an essential long-range imprinting regulatory function for the secondary DMR.

  1. Number and size of human X chromosome fragments transferred to mouse cells by chromosome-mediated gene transfer

    SciTech Connect

    Olsen, A.S.; McBride, O.W.; Moore, D.E.

    1981-05-01

    Labeled probes of unique-sequence human X chromosomal deoxyribonucleic acid, prepared by two different procedures, were used to measure the amount of human X chromosomal deoxyribonucleic acid in 12 mouse cell lines expressing human hypoxanthine phosphoribosyltransferase after chromosome-mediated gene transfer. The amount of X chromosomal deoxyribonucleic acid detected by this procedure ranged from undetectable levels in the three stable transformants and some unstable transformants examined to about 20% of the human X chromosome in two unstable transformants. Reassociation kinetics of the X chromosomal probe with deoxyribonucleic acid from the two unstable transformants containing 15 to 20% of the human X chromosome indicate that a single copy of these sequences is present. In one of these lines, the X chromosomal sequences exist as multiple fragments which were not concordantly segregated when the cells were selected for loss of hprt.

  2. Sex chromosome evolution: platypus gene mapping suggests that part of the human X chromosome was originally autosomal.

    PubMed Central

    Watson, J M; Spencer, J A; Riggs, A D; Graves, J A

    1991-01-01

    To investigate the evolution of the mammalian sex chromosomes, we have compared the gene content of the X chromosomes in the mammalian groups most distantly related to man (marsupials and monotremes). Previous work established that genes on the long arm of the human X chromosome are conserved on the X chromosomes in all mammals, revealing that this region was part of an ancient mammalian X chromosome. However, we now report that several genes located on the short arm of the human X chromosome are absent from the platypus X chromosome, as well as from the marsupial X chromosome. Because monotremes and marsupials diverged independently from eutherian mammals, this finding implies that the whole human X short arm region is a relatively recent addition to the X chromosome in eutherian mammals. Images PMID:1763040

  3. The transfer of human artificial chromosomes via cryopreserved microcells.

    PubMed

    Uno, Narumi; Uno, Katsuhiro; Zatti, Susi; Ueda, Kana; Hiratsuka, Masaharu; Katoh, Motonobu; Oshimura, Mitsuo

    2013-10-01

    Microcell-mediated chromosome transfer (MMCT) technology enables a single and intact mammalian chromosome or megabase-sized chromosome fragments to be transferred from donor to recipient cells. The conventional MMCT method is performed immediately after the purification of microcells. The timing of the isolation of microcells and the preparation of recipient cells is very important. Thus, ready-made microcells can improve and simplify the process of MMCT. Here, we established a cryopreservation method to store microcells at -80 °C, and compared these cells with conventionally- (immediately-) prepared cells with respect to the efficiency of MMCT and the stability of a human artificial chromosome (HAC) transferred to human HT1080 cells. The HAC transfer in microcell hybrids was confirmed by FISH analysis. There was no significant difference between the two methods regarding chromosome transfer efficiency and the retention rate of HAC. Thus, cryopreservation of ready-to-use microcells provides an improved and simplified protocol for MMCT.

  4. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved

    PubMed Central

    Meng, Hao; Agbagwa, Ikechukwu O.; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

    2016-01-01

    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history. PMID:26760298

  5. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved.

    PubMed

    Zhang, Minjie; Wang, Chuan-Chao; Yang, Caiyun; Meng, Hao; Agbagwa, Ikechukwu O; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

    2016-01-01

    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history. PMID:26760298

  6. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved.

    PubMed

    Zhang, Minjie; Wang, Chuan-Chao; Yang, Caiyun; Meng, Hao; Agbagwa, Ikechukwu O; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

    2016-01-01

    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history.

  7. Mapping of guanylin to murine chromosome 4 and human chromosome 1p34-p35

    SciTech Connect

    Sciaky, D.; Cohen, M.B.; Jenkins, N.A.

    1995-03-20

    Guanylin is a 15-amino-acid peptide similar in structure and in function to ST{sub a}, the heat stable enterotoxin of enterotoxigenic Escherichia coli (4). Both guanylin and ST{sub a} bind guanylyl cyclase-C (GC-C), resulting in increased levels of intracellular cGMP and induction of Cl- secretion (4) via the cystic fibrosis transmembrane regulator (CFM) (2). Guanylin is a highly regulated intestinal gene that is differentially expressed along the duodenal-to-colonic and villus-to-crypt axes. Guanylin mRNA abundance is maximal in the distal small intestine and proximal colon, where the mRNA is detected mainly in differentiated villus epithelial cells and superficial colonic epithelial cells, respectively. The murine guanylin gene (Guca2) has been isolated and sequenced; the gene is 1.7 kb and consists of 3 exons. We report here the mapping of Guca2 to mouse chromosome 4 by linkage analysis and to human chromosome region 1p34-p35 using fluorescence in situ hybridization (FISH). 20 refs., 2 figs.

  8. Cloning and chromosomal localization of the three human syntrophin genes

    SciTech Connect

    Feener, C.A.; Anderson, M.D.S.; Selig, S.

    1994-09-01

    Dystrophin, the protein product the Duchenne muscular dystrophy locus, is normally found to be associated with a complex of proteins. Among these dystrophin-associated proteins are the syntrophins, a group of 59 kDa membrane-associated proteins. When the syntrophins are purified based upon their association with dystrophin, they have been shown previously to form two distinct groups, the acidic ({alpha}) and basic ({beta}) forms. Based on peptide and rodent cDNA sequences, three separate syntrophin genes have been cloned and characterized from human tissues. The predicted amino acid sequences from these cDNA reveal that these proteins are related but are distinct with respect to charge, as predicted from their biochemistry. The family consists of one acidic ({alpha}-syntrophin, analogous to mouse syntrophin-1) and two basic ({beta}{sub 1}-syntrophin; and {beta}{sub 2}-syntrophin, analogous to mouse syntrophin-2) genes. Each of the three genes are widely expressed in a variety of human tissues, but the relative abundance of the three are unique with respect to each other. {alpha}-syntrophin is expressed primarily in skeletal muscle and heart as a single transcript. {beta}{sub 1}-syntrophin is expressed widely in up to five distinct transcript sizes, and is most abundant in brain. The human chromosomal locations of the three syntrophins are currently being mapped. {beta}{sub 1}-syntrophin maps to chromosome 8q23-24 and {beta}{sub 2}-syntrophin to chromosome 16. The {alpha}-syntrophin gene will be mapped accordingly. Although all three genes are candidates for neuromuscular diseases, the predominant expression of {alpha}-syntrophin in skeletal muscle and heart makes it a strong candidate to be involved in a neuromuscular disease.

  9. Induction of chromosome aberrations in cultured human lymphocytes treated with ethoxyquin.

    PubMed

    Blaszczyk, A; Osiecka, R; Skolimowski, J

    2003-12-01

    The chromosomal aberration test was employed to investigate the effect in vitro of a known antioxidant and food preservative, ethoxyquin (EQ, 1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline) on human chromosomes. The studies were undertaken because there are no published in vitro data on genotoxicity of EQ in mammalian cells and there are many reports pointing out that it may be harmful to animals and human beings. Lymphocytes obtained from three healthy donors were incubated with EQ (0.01-0.5mM) both with and without metabolic activation. Stability studies performed by HPLC analysis showed that EQ was stable under the conditions of the lymphocyte cultures. The results of the chromosome aberration assay showed that EQ induces chromosome aberrations: gaps and breaks as well as dicentrics and atypical translocation chromosomes.

  10. Chromosomal duplications in bacteria, fruit flies, and humans

    SciTech Connect

    Lupski, J.R.; Weinstock, G.M.; Roth, J.R.

    1996-01-01

    Tandem duplication of chromosomal segments has been recognized as a frequent mutational mechanism in several genetic model systems. In bacteria, fruit flies, and humans, duplications form by similar molecular mechanisms and appear to be important in genome evolution. 80 refs.

  11. The third international workshop of human chromosome 5. Final report

    SciTech Connect

    1994-12-31

    The Third International Workshop on Human Chromosome 5 was held in Laguna Beach, California, March 5-8, 1994. The pace at which new mapping information has been published in the last year make almost any report outdated before publication. Much of the information in this report and the most recent data from the Human chromosome 5 Genome Center at U.C. Irvine on the physical map of chromosome 5 are accessible via a WWW server. For most loci referred to in this report that can be detected by Polymerase Chain Reaction, the sequences of the oligonucleotide primers are available and some primer sequences are provided in this report.

  12. Effects of cellular differentiation, chromosomal integration and 5-aza-2'-deoxycytidine treatment on human papillomavirus-16 DNA methylation in cultured cell lines.

    PubMed

    Kalantari, Mina; Lee, Denis; Calleja-Macias, Itzel E; Lambert, Paul F; Bernard, Hans-Ulrich

    2008-05-10

    Human papillomavirus-16 (HPV-16) genomes in cell culture and in situ are affected by polymorphic methylation patterns, which can repress the viral transcription. In order to understand some of the underlying mechanisms, we investigated changes of the methylation of HPV-16 DNA in cell cultures in response to cellular differentiation, to recombination with cellular DNA, and to an inhibitor of methylation. Undifferentiated W12E cells, derived from a precancerous lesion, contained extrachromosomal HPV-16 DNA with a sporadically methylated enhancer-promoter segment. Upon W12E cell differentiation, the viral DNA was demethylated, suggesting a link between differentiation and the epigenetic state of HPV-16 DNA. The viral genomes present in two W12I clones, in which individual copies of the HPV-16 genome have integrated into cellular DNA (type 1 integrants), were unmethylated, akin to that seen in the cervical carcinoma cell line SiHa (also a type 1 integrant). This finding is consistent with hypomethylation being necessary for continued viral gene expression. In contrast, two of three type 2 integrant W12I clones, containing concatemers of HPV-16 genomes integrated into the cellular DNA contained hypermethylated viral DNA, as observed in the cervical carcinoma cell line CaSki (also a type 2 integrant). A third, type 2, W12I clone, interestingly with fewer copies of the viral genome, contained unmethylated HPV-16 genomes. Epithelial differentiation of W12I clones did not lead to demethylation of chromosomally integrated viral genomes as was seen for extrachromosomal HPV-16 DNA in W12E clones. Hypomethylation of CaSki cells in the presence of the DNA methylation inhibitor 5-aza-2'-deoxycytidine reduced the cellular viability, possibly as a consequence of toxic effects of an excess of HPV-16 gene products. Our data support a model wherein (i) the DNA methylation state of extrachromosomal HPV16 replicons and epithelial differentiation are inversely coupled during the viral

  13. CD28/CTLA-4 ligands: the gene encoding CD86 (B70/B7.2) maps to the same region as CD80 (B7/B7.1) gene in human chromosome 3q13-q23.

    PubMed

    Fernández-Ruiz, E; Somoza, C; Sánchez-Madrid, F; Lanier, L L

    1995-05-01

    CD86 (B70/B7.2) is an antigen of the immunoglobulin superfamily expressed on monocytes, dendritic cells and activated B, T, and natural killer cells. CD86 was recently identified as a second ligand for the T cell antigens CD28 and CTLA-4, and plays an important role in the co-stimulation of T cells in a primary immune response. We report here the assignment of the CD86 gene to human chromosome 3 using Southern blot analysis on a panel of hamster x human somatic cell hybrid genomic DNA. Fluorescence hybridization in situ on metaphase chromosomes coupled with GTG banding (G-bands by trypsin using Giemsa staining) confirmed this assignment and localized the CD86 gene to 3q13-q23 region. The CD86 gene is, therefore, located in the proximity of the CD80 (B7/B7.1) gene, the first identified ligand for CD28 and CTLA-4, previously mapped to chromosome 3q13.3-q21. Deletions, inversions and insertions of chromosome 3q21-q26, as well as translocations of 3q21 with other chromosomes have been described in many cases of acute myeloid leukemia (AML), acute non-lymphocytic leukemia (ANLL), chronic myeloid leukemia (CML) and myelodisplastic syndromes (MDS), suggesting that this region contains several genes involved in the leukemic process.

  14. The human alpha 2(IV) collagen gene, COL4A2, is syntenic with the alpha 1(IV) gene, COL4A1, on chromosome 13.

    PubMed

    Solomon, E; Hall, V; Kurkinen, M

    1987-05-01

    We have previously assigned the gene for the alpha 1 chain of type IV collagen to chromosome 13. In this report we show that the gene coding for the second chain of this heterotrimer is on the same chromosome. This is the first example of the genes for both chains of one collagen molecule being syntenic. PMID:3674752

  15. Chromosomal translocation engineering to recapitulate primary events of human cancer.

    PubMed

    Forster, A; Pannell, R; Drynan, L; Cano, F; Chan, N; Codrington, R; Daser, A; Lobato, N; Metzler, M; Nam, C-H; Rodriguez, S; Tanaka, T; Rabbitts, T

    2005-01-01

    Mouse models of human cancers are important for understanding determinants of overt disease and for "preclinical" development of rational therapeutic strategies; for instance, based on macrodrugs. Chromosomal translocations underlie many human leukemias, sarcomas, and epithelial tumors. We have developed three technologies based on homologous recombination in mouse ES cells to mimic human chromosome translocations. The first, called the knockin method, allows creation of fusion genes like those typical of translocations of human leukemias and sarcomas. Two new conditional chromosomal translocation mimics have been developed. The first is a method for generating reciprocal chromosomal translocations de novo using Cre-loxP recombination (translocator mice). In some cases, there is incompatible gene orientation and the translocator model cannot be applied. We have developed a different model (invertor mice) for these situations. This method consists of introducing an inverted cDNA cassette into the intron of a target gene and bringing the cassette into the correct transcriptional orientation by Cre-loxP recombination. We describe experiments using the translocator model to generate MLL-mediated neoplasias and the invertor method to generate EWS-ERG-mediated cancer. These methods mimic the situation found in human chromosome translocations and provide the framework for design and study of human chromosomal translocations in mice.

  16. Cytokinesis-block micronucleus assay in WIL2-NS cells: a sensitive system to detect chromosomal damage induced by reactive oxygen species and activated human neutrophils.

    PubMed

    Umegaki, K; Fenech, M

    2000-05-01

    experiments. These results suggest that the CBMN assay using WIL2-NS cells is a sensitive assay system to examine ROS-induced chromosomal damage and necrosis by activated human neutrophils.

  17. Chromosomal localization of murine and human oligodendrocyte-specific protein genes

    SciTech Connect

    Bronstein, J.M.; Wu, S.; Korenberg, J.R.

    1996-06-01

    Oligodendrocyte-specific protein (OSP) is a recently described protein present only in myelin of the central nervous system. Several inherited disorders of myelin are caused by mutations in myelin genes but the etiology of many remain unknown. We mapped the location of the mouse OSP gene to the proximal region of chromosome 3 using two sets of multilocus crosses and to human chromosome 3 using somatic cell hybrids. Fine mapping with fluorescence in situ hybridization placed the OSP gene at human chromosome 3q26.2-q26.3. To date, there are no known inherited neurological disorders that localize to these regions. 24 refs., 2 figs.

  18. Molecular cloning, expression pattern, and chromosomal localization of human CDKN2D/INK4d, an inhibitor of cyclin D-dependent kinases

    SciTech Connect

    Okuda, Tsukasa; Shurtleff, S.A.; Downing, J.R.

    1995-10-10

    Progression through the G1 phase of the cell cycle is dependent on the activity of holoenzymes formed between D-type cyclins and their catalytic partners, the cyclin-dependent kinases cdk4 and cdk6. p16{sup INK4a} p15{sup INK4b}, and p18{sup INK4c}, a group of structurally related proteins, function as specific inhibitors of the cyclin D-dependent kinases and are likely to play physiologic roles as specific regulators of these kinases in vivo. A new member of the INK4 gene family, murine INK4d, has recently been identified. Here we report the isolation of human INK4d (gene symbol CDKN2D), which is 86 identical at the amino acid level to the murine clone and {approximately}44% identical to each of the other human INK4 family members. The INK4d gene is ubiquitously expressed as a single 1.4-kb mRNA with the highest levels detected in thymus, spleen, peripheral blood leukocytes, fetal liver, brain, and testes. The abundance of INK4d mRNA oscillates in a cell-cycle-dependent manner with expression lowest at mid G1 and maximal during S phase. Using a P1-phage genomic clone of INK4d for fluorescence in situ hybridization analysis, the location of this gene was mapped to chromosome 19p13. No rearrangements or deletions of the INK4d gene were observed in Southern blot analysis of selected cases of pediatric acute lymphoblastic leukemia (ALL) containing a variant (1;19)(q23;p13) translocation that lacks rearrangement of either E2A or PBX1, or in ALL cases containing homozygous or hemizygous deletions of the related genes, INK4a and INK4b. 39 refs., 3 figs.

  19. Physical mapping of the human glutamine:fructose-6-phosphate amidotransferase gene (GFPT) to chromosome 2p13

    SciTech Connect

    Whitmore, T.E.; Mudri, S.L.; McKnight, G.L.

    1995-03-20

    Diabetic hyperglycemia influences insulin resistance through a process termed glucose toxicity. Implicated as a source of the mediators of this toxicity is an increased intracellular glucose metabolism through the hexosamine pathway. The hexosamine pathway itself is controlled by the rate-limiting enzyme glutamine:fructose-6-phosphate amidotransferase (GFAT), which is the first enzyme of the pathway. It has been shown that there is a close correlation between the glucose-mediated reduction of GFAT activity and the onset of insulin desensitization of the glucose transport system, a condition associated with insulin-resistant states of non-insulin-dependent diabetes mellitus and obesity. To gain a better understanding of the molecular regulation of GFAT and its role in the induction of insulin resistance, we previously isolated and cloned the cDNA for the human form of this enzyme and expressed the functional protein in Escherichia coli. 9 refs., 1 fig.

  20. Chromosome region-specific libraries for human genome analysis

    SciTech Connect

    Kao, Fa-Ten.

    1991-01-01

    We have made important progress since the beginning of the current grant year. We have further developed the microdissection and PCR- assisted microcloning techniques using the linker-adaptor method. We have critically evaluated the microdissection libraries constructed by this microtechnology and proved that they are of high quality. We further demonstrated that these microdissection clones are useful in identifying corresponding YAC clones for a thousand-fold expansion of the genomic coverage and for contig construction. We are also improving the technique of cloning the dissected fragments in test tube by the TDT method. We are applying both of these PCR cloning technique to human chromosomes 2 and 5 to construct region-specific libraries for physical mapping purposes of LLNL and LANL. Finally, we are exploring efficient procedures to use unique sequence microclones to isolate cDNA clones from defined chromosomal regions as valuable resources for identifying expressed gene sequences in the human genome. We believe that we are making important progress under the auspices of this DOE human genome program grant and we will continue to make significant contributions in the coming year. 4 refs., 4 figs.

  1. Assignment of the Gene for Adenine Phosphoribosyltransferase to Human Chromosome 16 by Mouse-Human Somatic Cell Hybridization

    PubMed Central

    Tischfield, Jay A.; Ruddle, Frank H.

    1974-01-01

    A series of mouse-human hybrids was prepared from mouse cells deficient in adenine phosphoribosyltransferase (EC 2.4.2.7) and normal human cells. The hybrids were made in medium containing adenine and alanosine, an antimetabolite known to inhibit de novo adenylic acid biosynthesis. The mouse cells, unable to utilize exogenous adenine, were killed in this medium, but the hybrids proliferated as a consequence of their retaining the human aprt gene. The hybrids were then exposed to the adenine analogs 2,6-diaminopurine and 2-fluoroadenine to select for cells that had lost this gene. Before exposure to the adenine analogs, the expression of human adenine phosphoribosyltransferase by the hybrids was strongly associated only with the presence of human chromosome 16, and afterwards this was the only human chromosome consistently lost. This observation suggests that the human aprt gene can be assigned to chromosome 16. Images PMID:4129802

  2. Abnormal chromosome behavior in human oocytes which remained unfertilized during human in vitro fertilization.

    PubMed

    Spielmann, H; Krüger, C; Stauber, M; Vogel, R

    1985-09-01

    Chromosomal abnormalities and abnormal embryonic development have previously been observed after human in vitro fertilization (IVF). Chromosomal abnormalities may arise not only after fertilization but even earlier during meiotic maturation of human oocytes in culture. Since chromosomal analysis is simple in oocytes during meiotic maturation, the chromosomal status was analyzed in oocytes which remained unfertilized in a human in vitro fertilization program. In 50 fertilization attempts the chromosomes of 62 unfertilized oocytes could be analyzed; 45 of them were in the process of meiotic maturation. In three oocytes two small polar bodies were observed 16-18 hr after insemination in the absence of fertilization. In one oocyte abnormal chromosome behavior was found during the first meiotic division, and in four oocytes during metaphase of the second meiotic division. These data suggest that chromosomal analysis of unfertilized oocytes in human IVF may improve the understanding human oocyte maturation and fertilization.

  3. Human Chromosome 21: Mapping of the chromosomes and cloning of cDNAs

    SciTech Connect

    Antonarakis, S.E.

    1991-09-01

    The objective of the research funded by DOE grant DE-FG02-89ER60857 from 6/15/89 to 8/31/91 was to contribute to the physical mapping of human chromosome 21 (HC21) by cloning large fragments of DNA into Yeast Artificial Chromosomes (YACs) and identify YACs that map on HC21. A total of 54 sequence tagged sites (STS) have been developed and mapped in our laboratory to HC21 and can be used as initial reference points for YAC identification and construction of overlapping clones. A small YAC library was constructed which is HC21 specific. DNA from somatic cell hybrid WAV17 or from flow-sorted HC21 was partially digested with EcoRI, ligated into vectors PJS97, PJS98, and YACs have been obtained with average size insert of more than 300 kb. This library has been deposited in D. Patterson's lab for the Joint YAC screening effort. Additional YAC libraries from ICI Pharmaceuticals or from Los Alamos National Laboratories have been screened with several STS and positive YACs have been identified. Work in progress includes screening of YAC libraries in order to construct overlapping clones, characterization of the cloning ends of YACs, characterization of additional STS and cloning of HC21 specific cDNAs. 15 refs., 2 figs., 5 tabs.

  4. The DNA sequence of the human X chromosome

    PubMed Central

    Ross, Mark T.; Grafham, Darren V.; Coffey, Alison J.; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R.; Burrows, Christine; Bird, Christine P.; Frankish, Adam; Lovell, Frances L.; Howe, Kevin L.; Ashurst, Jennifer L.; Fulton, Robert S.; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C.; Hurles, Matthew E.; Andrews, T. Daniel; Scott, Carol E.; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P.; Hunt, Sarah E.; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L.; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Ainscough, Rachael; Ambrose, Kerrie D.; Ansari-Lari, M. Ali; Aradhya, Swaroop; Ashwell, Robert I. S.; Babbage, Anne K.; Bagguley, Claire L.; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E.; Barlow, Karen F.; Barrett, Ian P.; Bates, Karen N.; Beare, David M.; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M.; Brown, Andrew J.; Brown, Mary J.; Bonnin, David; Bruford, Elspeth A.; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M.; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C.; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y.; Clarke, Graham; Clee, Chris M.; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G.; Conquer, Jen S.; Corby, Nicole; Connor, Richard E.; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; DeShazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K. James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L.; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E.; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G.; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A.; Hawes, Alicia; Heath, Paul D.; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J.; Huckle, Elizabeth J.; Hume, Jennifer; Hunt, Paul J.; Hunt, Adrienne R.; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J.; Joseph, Shirin S.; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K.; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J.; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K.; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M.; Loulseged, Hermela; Loveland, Jane E.; Lovell, Jamieson D.; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H.; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L.; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C.; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O’Dell, Christopher N.; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V.; Pearson, Danita M.; Pelan, Sarah E.; Perez, Lesette; Porter, Keith M.; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A.; Schlessinger, David; Schueler, Mary G.; Sehra, Harminder K.; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M.; Shownkeen, Ratna; Skuce, Carl D.; Smith, Michelle L.; Sotheran, Elizabeth C.; Steingruber, Helen E.; Steward, Charles A.; Storey, Roy; Swann, R. Mark; Swarbreck, David; Tabor, Paul E.; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C.; d’Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L.; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L.; Whiteley, Mathew N.; Wilkinson, Jane E.; Willey, David L.; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L.; Wray, Paul W.; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J.

    2009-01-01

    The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence. PMID:15772651

  5. The DNA sequence of the human X chromosome.

    PubMed

    Ross, Mark T; Grafham, Darren V; Coffey, Alison J; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R; Burrows, Christine; Bird, Christine P; Frankish, Adam; Lovell, Frances L; Howe, Kevin L; Ashurst, Jennifer L; Fulton, Robert S; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C; Hurles, Matthew E; Andrews, T Daniel; Scott, Carol E; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P; Hunt, Sarah E; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A; Worley, Kim C; Ainscough, Rachael; Ambrose, Kerrie D; Ansari-Lari, M Ali; Aradhya, Swaroop; Ashwell, Robert I S; Babbage, Anne K; Bagguley, Claire L; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E; Barlow, Karen F; Barrett, Ian P; Bates, Karen N; Beare, David M; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M; Brown, Andrew J; Brown, Mary J; Bonnin, David; Bruford, Elspeth A; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y; Clarke, Graham; Clee, Chris M; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G; Conquer, Jen S; Corby, Nicole; Connor, Richard E; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; Deshazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A; Hawes, Alicia; Heath, Paul D; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J; Huckle, Elizabeth J; Hume, Jennifer; Hunt, Paul J; Hunt, Adrienne R; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J; Joseph, Shirin S; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M; Loulseged, Hermela; Loveland, Jane E; Lovell, Jamieson D; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O'Dell, Christopher N; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V; Pearson, Danita M; Pelan, Sarah E; Perez, Lesette; Porter, Keith M; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A; Schlessinger, David; Schueler, Mary G; Sehra, Harminder K; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M; Shownkeen, Ratna; Skuce, Carl D; Smith, Michelle L; Sotheran, Elizabeth C; Steingruber, Helen E; Steward, Charles A; Storey, Roy; Swann, R Mark; Swarbreck, David; Tabor, Paul E; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C; d'Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L; Whiteley, Mathew N; Wilkinson, Jane E; Willey, David L; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L; Wray, Paul W; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J; Hillier, Ladeana W; Willard, Huntington F; Wilson, Richard K; Waterston, Robert H; Rice, Catherine M; Vaudin, Mark; Coulson, Alan; Nelson, David L; Weinstock, George; Sulston, John E; Durbin, Richard; Hubbard, Tim; Gibbs, Richard A; Beck, Stephan; Rogers, Jane; Bentley, David R

    2005-03-17

    The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence.

  6. Genetic Diversity on the Human X Chromosome Does Not Support a Strict Pseudoautosomal Boundary

    PubMed Central

    Cotter, Daniel J.; Brotman, Sarah M.

    2016-01-01

    Unlike the autosomes, recombination between the X chromosome and the Y chromosome is often thought to be constrained to two small pseudoautosomal regions (PARs) at the tips of each sex chromosome. PAR1 spans the first 2.7 Mb of the proximal arm of the human sex chromosomes, whereas the much smaller PAR2 encompasses the distal 320 kb of the long arm of each sex chromosome. In addition to PAR1 and PAR2, there is a human-specific X-transposed region that was duplicated from the X to the Y chromosome. The X-transposed region is often not excluded from X-specific analyses, unlike the PARs, because it is not thought to routinely recombine. Genetic diversity is expected to be higher in recombining regions than in nonrecombining regions because recombination reduces the effect of linked selection. In this study, we investigated patterns of genetic diversity in noncoding regions across the entire X chromosome of a global sample of 26 unrelated genetic females. We found that genetic diversity in PAR1 is significantly greater than in the nonrecombining regions (nonPARs). However, rather than an abrupt drop in diversity at the pseudoautosomal boundary, there is a gradual reduction in diversity from the recombining through the nonrecombining regions, suggesting that recombination between the human sex chromosomes spans across the currently defined pseudoautosomal boundary. A consequence of recombination spanning this boundary potentially includes increasing the rate of sex-linked disorders (e.g., de la Chapelle) and sex chromosome aneuploidies. In contrast, diversity in PAR2 is not significantly elevated compared to the nonPARs, suggesting that recombination is not obligatory in PAR2. Finally, diversity in the X-transposed region is higher than in the surrounding nonPARs, providing evidence that recombination may occur with some frequency between the X and Y chromosomes in the X-transposed region. PMID:27010023

  7. Genetic Diversity on the Human X Chromosome Does Not Support a Strict Pseudoautosomal Boundary.

    PubMed

    Cotter, Daniel J; Brotman, Sarah M; Wilson Sayres, Melissa A

    2016-05-01

    Unlike the autosomes, recombination between the X chromosome and the Y chromosome is often thought to be constrained to two small pseudoautosomal regions (PARs) at the tips of each sex chromosome. PAR1 spans the first 2.7 Mb of the proximal arm of the human sex chromosomes, whereas the much smaller PAR2 encompasses the distal 320 kb of the long arm of each sex chromosome. In addition to PAR1 and PAR2, there is a human-specific X-transposed region that was duplicated from the X to the Y chromosome. The X-transposed region is often not excluded from X-specific analyses, unlike the PARs, because it is not thought to routinely recombine. Genetic diversity is expected to be higher in recombining regions than in nonrecombining regions because recombination reduces the effect of linked selection. In this study, we investigated patterns of genetic diversity in noncoding regions across the entire X chromosome of a global sample of 26 unrelated genetic females. We found that genetic diversity in PAR1 is significantly greater than in the nonrecombining regions (nonPARs). However, rather than an abrupt drop in diversity at the pseudoautosomal boundary, there is a gradual reduction in diversity from the recombining through the nonrecombining regions, suggesting that recombination between the human sex chromosomes spans across the currently defined pseudoautosomal boundary. A consequence of recombination spanning this boundary potentially includes increasing the rate of sex-linked disorders (e.g., de la Chapelle) and sex chromosome aneuploidies. In contrast, diversity in PAR2 is not significantly elevated compared to the nonPARs, suggesting that recombination is not obligatory in PAR2. Finally, diversity in the X-transposed region is higher than in the surrounding nonPARs, providing evidence that recombination may occur with some frequency between the X and Y chromosomes in the X-transposed region.

  8. Rapid human chromosome aberration analysis using fluorescence in situ hybridization.

    PubMed

    Lucas, J N; Tenjin, T; Straume, T; Pinkel, D; Moore, D; Litt, M; Gray, J W

    1989-07-01

    We have used in situ hybridization of repeat-sequence DNA probes, specific to the paracentromric locus 1q12 and the telomeric locus 1p36, to fluorescently stain regions that flank human chromosome 1p. This procedure was used for fast detection of structural aberrations involving human chromosome 1p in two separate experiments. In one, human lymphocytes were irradiated with 0, 0.8, 1.6, 2.4 and 3.2 Gy of 137Cs gamma-rays. In the other, human lymphocytes were irradiated with 0, 0.09, 0.18, 2.0, 3.1 and 4.1 Gy of 60Co gamma-rays. The frequencies (per cell) of translocations and dicentrics with one breakpoint in 1p and one elsewhere in the genome were determined for cells irradiated at each dose point. These frequencies both increased with dose, D, in a linear-quadratic manner. The delta, alpha, and beta coefficients resulting from a fit of the equation f(D)=delta + alphaD + betaD2 to the translocation frequency dose-response data were 0.0025, 0.0027 and 0.0037 for 137Cs gamma-rays, and 0.0010, 0.0041, and 0.0057 for 60Co gamma-rays. The delta, alpha, and beta coefficients resulting from a fit to the dicentric frequency dose-response data were 0.0005, 0.0010 and 0.0028 for 137Cs gamma-rays and 0.0001, 0.0002 and 0.0035, for 60Co gamma-rays. Approximately 32,000 metaphase spreads were scored in this study. The average analysis rate was over two metaphase spreads per minute. However, an experienced analyst was able to find and score one metaphase spread every 10s. The importance of this new cytogenetic analysis technique for biological dosimetry and in vivo risk assessment is discussed.

  9. The human chromosome. Electron microscopic observations on chromatin fiber organization.

    PubMed

    Abuelo, J G; Moore, D E

    1969-04-01

    Human lymphocytes were grown in short-term tissue culture and were arrested in metaphase with Colcemid. Their chromosomes were prepared by the Langmuir trough-critical point drying technique and were examined under the electron microscope. In addition, some chromosomes were digested with trypsin, Pronase, or DNase. The chromosomes consist entirely of tightly packed, 240 +/- 50-A chromatin fibers. Trypsin and Pronase treatments induce relaxation of fiber packing and reveal certain underlying fiber arrangements. Furthermore, trypsin treatment demonstrates that the chromatin fiber has a 25-50 A trypsin-resistant core surrounded by a trypsin-sensitive sheath. DNase digestion suggests that this core contains DNA.

  10. Developmental potential of clinically discarded human embryos and associated chromosomal analysis

    PubMed Central

    Yao, Guidong; Xu, Jiawei; Xin, Zhimin; Niu, Wenbin; Shi, Senlin; Jin, Haixia; Song, Wenyan; Wang, Enyin; Yang, Qingling; Chen, Lei; Sun, Yingpu

    2016-01-01

    Clinically discarded human embryos, which are generated from both normal and abnormal fertilizations, have the potential of developing into blastocysts. A total of 1,649 discarded human embryos, including zygotes containing normal (2PN) and abnormal (0PN, 1PN, 3PN and ≥4PN) pronuclei and prematurely cleaved embryos (2Cell), were collected for in vitro culture to investigate their developmental potential and chromosomal constitution using an SNP array-based chromosomal analysis. We found that blastocyst formation rates were 63.8% (for 2Cell embryos), 22.6% (2PN), 16.7% (0PN), 11.2% (3PN) and 3.6% (1PN). SNP array-based chromosomal analysis of the resultant blastocysts revealed that the percentages of normal chromosomes were 55.2% (2Cell), 60.7% (2PN), 44.4% (0PN) and 47.4% (0PN). Compared with clinical preimplantation genetic diagnosis (PGD) data generated with clinically acceptable embryos, results of the SNP array-based chromosome analysis on blastocysts from clinically discarded embryos showed similar values for the frequency of abnormal chromosome occurrence, aberrant signal classification and chromosomal distribution. The present study is perhaps the first systematic analysis of the developmental potential of clinically discarded embryos and provides a basis for future studies. PMID:27045374

  11. Assignment of the gene (EPLG2) encoding a high-affinity binding protein for the receptor tyrosine kinase elk to a 200-kilobasepair region in human chromosome Xq12

    SciTech Connect

    Fletcher, F.A.; Beckmann, M.P.; Lyman, S.D.

    1995-01-01

    Elk is a member of the eph family of receptor tyrosine kinases. Elk is expressed only in the brain and testes of the developing and adult rat, and the interaction of elk with its ligand(s) has been suggested to play a role in the development or maintenance of the nervous system. The mouse gene Eplg2 encodes a potential elk ligand that is highly conserved among rat, mouse, and human. Eplg2 has been mapped to the central portion of the mouse X chromosome, tightly linked to the androgen receptor (Ar) locus. Linkage conservation between the mouse and the human X chromosomes suggested that the human homologue (EPLG2) would map near human AR, in the interval Xq11-q12. In the present study, we have confirmed this prediction and have localized EPLG2 to a 200-kb interval in Xq12 by somatic cell hybrid analysis, two-color fluorescence in situ hybridization (FISH), and yeast artificial chromosome (YAC) hybridization. 12 refs., 1 fig.

  12. Comparative analysis of a conserved zinc finger gene cluster on human chromosome 19q and mouse chromosome 7

    SciTech Connect

    Shannon, M.; Mucenski, M.L.; Stubbs, L.

    1996-04-01

    Several lines of evidence now suggest that many of the zinc-finger-containing (ZNF) genes in the human genome are arranged in clusters. However, little is known about the structure or function of the clusters or about their conservation throughout evolution. Here, we report the analysis of a conserved ZNF gene cluster located in human chromosome 19q13.2 and mouse chromosome 7. Our results indicate that the human cluster consists of at least 10 related Kruppel-associated box (KRAB)-containing ZNF genes organized in tandem over a distance of 350-450 kb. Two cDNA clones representing genes in the murine cluster have been studied in detail. The KRAB A domains of these genes are nearly identical and are highly similar to human 19q13.2-derived KRAB sequences, but DNA-binding ZNF domains and other portions of the genes differ considerably. The two murine genes display distinct expression patterns, but are coexpressed in some adult tissues. These studies pave the way for a systematic analysis of the evolution of structure and function of genes within the numerous clustered ZNF families located on human chromosome 19 and elsewhere in the human and mouse genomes. 32 refs., 7 figs.

  13. The pronatriodilatin gene is located on the distal short arm of human chromosome 1 and on mouse chromosome 4.

    PubMed

    Yang-Feng, T L; Floyd-Smith, G; Nemer, M; Drouin, J; Francke, U

    1985-11-01

    Atrial natriuretic factors (ANF) are polypeptides having natriuretic, diuretic, and smooth muscle-relaxing activities that are synthesized from a single larger precursor: pronatriodilatin. Chromosomal assignment of the gene coding for human pronatriodilatin was accomplished by in situ hybridization of a [3H]-labeled pronatriodilatin probe to human chromosome preparations and by Southern blot analysis of somatic cell hybrid DNAs with normal and rearranged chromosomes 1. The human pronatriodilatin gene was mapped to the distal short arm of chromosome 1, in band 1p36. Southern blot analysis of mouse X Chinese hamster somatic cell hybrids was used to assign the mouse pronatriodilatin gene to chromosome 4. This assignment adds another locus to the conserved syntenic group of homologous genes located on the distal half of the short arm of human chromosome 1 and on mouse chromosome 4.

  14. Localization of a novel natural killer triggering receptor locus to human chromosome 3p23-p21 and mouse chromosome 9

    SciTech Connect

    Young, H.A.; Jenkins, N.A.; Copeland, N.G.; Simek, S.; Lerman, M.I.; Zbar, B.; Glenn, G.; Ortaldo, J.R.; Anderson, S.K.

    1993-05-01

    A novel gene (NKTR) that is involved in the recognition of tumor cells by large granular lymphocytes (LGLs) has been assigned to the short arm of human chromosome 3 in the region 3p23-p21 by somatic cell hybrid analysis. Interspecific backcross analysis revealed that the murine homologue maps to the distal end of mouse chromosome 9 and is closely linked to the locus coding for cholecystokinin (Cck). This region of mouse 9 shares a region of homology with human 3p. Thus, the placement of NKTR in these regions confirms and extends the relationship between these human and mouse chromosomes. 11 refs., 2 figs.

  15. Investigating chromosome damage and gammaH2AX response in human lymphocytes and lymphocyte subsets as potential biomarkers of radiation sensitivity

    NASA Astrophysics Data System (ADS)

    Beaton, Lindsay A.

    This thesis examines in vitro irradiated blood samples from prostate cancer patients exhibiting late normal tissue damage after receiving radiotherapy, for lymphocyte response. Chromosomal aberrations, translocations and proliferation rate are measured, as well as gammaH2AX response in lymphocytes and lymphocyte subsets. The goal of this thesis is to determine whether the lymphocyte response to in vitro radiation could be used as a marker for radiosensitivity. Patients were selected from a randomized clinical trial evaluating the optimal timing of Dose Escalated Radiation and short course Androgen Deprivation Therapy. Of 438 patients, 3% developed Grade 3 late radiation proctitis and were considered to be radiosensitive. Blood was drawn from 10 of these patients along with 20 matched samples from patients with grade 0 proctitis. The samples were irradiated and were analyzed for dicentric chromosomes, excess fragments and proliferation rates (at 6 Gy), translocations, stable and unstable damage (at 4 Gy), and dose response (up to 10 Gy), along with time response after 2 Gy (0 -- 24 h). Chromosome aberrations, excess fragments per cell, translocations per cell and proliferation rates were analyzed by brightfield and fluorescent microscopy, while the gammaH2AX response in lymphocytes and lymphocyte subsets was analyzed by flow cytometry. Both groups were statistically similar for all endpoints at 0 Gy. At 6 Gy, there were statistically significant differences between the radiosensitive and control cohorts for three endpoints; the mean number of dicentric chromosomes per cell, the mean number of excess fragments per cell and the proportion of cells in second metaphase. At 4 Gy, there were statistically significant differences between the two cohorts for three endpoints; the mean number of translocations per cell, the mean number of dicentric chromosomes per cell and the mean number of deletions per cell. There were no significant differences between the gammaH2AX

  16. Ribosomal protein gene mapping and human chromosomal disorders

    SciTech Connect

    Kenmochi, N.; Goodman, N.; Page, D.C.

    1994-09-01

    In Drosophila, the Minute phenotype (reduced body size, diminished viability and fertility, and short, thin bristles) results from heterozygous deficiencies (deletions) at any one of 50 loci scattered about the genome. A handful of these Minute loci have been molecularly characterized, and all have been found to encode ribosomal proteins. Thus, the Minute phenotype appears to result from reduced protein synthetic capacity in flies with one rather than two copies of a given ribosomal protein (rp) gene. We are pursuing the possibility that similar reductions in protein synthetic capacity--again resulting from rp gene deficiencies--might underlie phenotypes associated with certain chromosomal disorders in humans. We and our colleagues have reported findings consistent with a role for RPS4 deficiency in the etiology of certain features of Turner syndrome, a complex human disorder classically associated with an XO karyotype. We are intrigued by the possibility that deficiencies of other human rp genes might cause phenotypic abnormalities similar to those seen in Turner syndrome--just as deficiencies of any of a number of Drosophila rp genes cause the Minute phenotype. We must first learn the chromosomal map position of each of the estimated 83 human rp genes. The task of mapping the functional (intron-containing) rp genes is complicated by the existence of processed pseudogenes elsewhere in the genome. To date, we have assigned (or confirmed the previous assignment of) 38 rp genes to individual human chromosomes by PCR analysis of human-rodent somatic cell hybrids containing subsets of human chromosomes, with all but four chromosomes carrying at least one rp gene. We have also identified more than 100 large-insert human YAC (yeast artificial chromosome) clones that contain individual rp genes. Such screening of YAC libraries will result in precise positioning of the rp genes on the emerging physical map of the human genome.

  17. Human decorin gene: Intron-exon junctions and chromosomal localization

    SciTech Connect

    Vetter, U.; Young, M.F.; Fisher, L.W. ); Vogel, W.; Just, W. )

    1993-01-01

    All of the protein-encoding exons and the 3[prime]flanking region of the human decorin gene have been cloned an partially sequenced. The locations of the intron-exon junctions within the coding portion of the gene were identical to those found for the homologous human gene, biglycan. The sizes of the introns in the decorin gene, however, were substantially larger than those of the same introns of the biglycan gene. Portions of introns 1, 2, and 3 as well as exon 1 were not found during our extensive screening process. The 5[prime] end of intron 2 was found to have an AG-rich region followed immediately by a CT-rich region. Furthermore, the 5[prime] end of intron 3 was very rich in thymidine, whereas the 3[prime] end of intron 7 was rich in adenosine. Several cDNA clones constructed from cultured human bone cell mRNA were found to contain a different sequence at the 5[prime] end compared to that previously published for mRNA from a human embryonic fibroblast cell line. We were also unable to find the alternate 3[prime] flanking region of the previously published cDNA sequence. We have mapped the human decorin gene by in situ methods to chromosome 12q2l.3. 30 refs., 3 figs., 1 tab.

  18. Assignment of the human fast skeletal troponin T gene (TNNT3) to chromosome 11p15.5: Evidence for the presence of 11pter in a monochromosome 9 somatic cell hybrid in NIGMS mapping panel 2

    SciTech Connect

    Mao, Chengjian; Jha, P.K.; Sarkar, S.

    1996-02-01

    Human fast skeletal troponin T (TnT{sub f}), the tropomyosin binding component of the multisubunit troponin complex, plays an important role in the Ca{sup 2+} regulation of striated muscle contraction. Specific primers designed from the 3{prime} end of human TnT{sub f} cDNA were used to amplify an intronic region by polymerase chain reaction (PCR). This TnT{sub f}-specific PCR product was detected from two somatic cell hybrids containing human chromosomes 9 and 11, respectively, in NIGMS mapping panel 2. However, further studies with other somatic hybrid cell lines (Bios Laboratory) localized the TnT{sub f} genomic probe generated by extended PCR, showing the sublocalization of the gene to band p15.5 on chromosome 11. This locus is of specific interest, as Beckwith-Wiedemann syndrome and various childhood and adult tumor-related abnormalities have been mapped to this region. The study also indicates the presence of an 11pter region in the NIGMS cell hybrid GM10611, which has previously been reported to contain only human chromosome 9. 11 refs., 2 figs.

  19. UV-A breakage sensitivity of human chromosomes as measured by COMET-FISH depends on gene density and not on the chromosome size.

    PubMed

    Rapp, A; Bock, C; Dittmar, H; Greulich, K O

    2000-07-01

    COMET-FISH, a single cell-based combination of COMET-assay (also known as single cell gel electrophoresis (SCGE)) with fluorescence in situ hybridization (FISH) allows region specific studies on DNA stability and damage. COMET-FISH can be used to investigate UV-A-induced DNA damage of selected whole chromosomes. In the present work, a modified COMET-FISH protocol with whole chromosome painting probes was used to study whether UV-A-induced DNA damage is distributed randomly over the whole genome or occurs at preferred sites. The study was performed with 12 different chromosome painting probes (for chromosomes 1, 2, 3, 8, 9, 11, 14, 18, 19, 21, X and Y). The results on human lymphocytes irradiated with 500 kJ/m2 at a wavelength of 365 nm indicate that the induced number of chromatin strand breaks does not correlate with the chromosome size. They therefore are distributed in a non-random manner. For example, fragments of the gene-rich chromosome chromosome 1 were found in the comet tail in only 3% of the examined cells, and thus chromosome 1 is rather stable, whereas fragmentation of the gene-poor chromosome 8 was observed in 25% of all comets. On the basis of all 12 chromosomes analyzed, an inverse correlation between the density of active genes and the sensitivity toward UV-A radiation is found. PMID:11079471

  20. Physical mapping of human chromosome 16. Annual progress report

    SciTech Connect

    Sutherland, G.R.

    1993-08-01

    We aim to isolate cDNAs mapping to human chromosome 16 and localise such cDNAs on the high resolution physical map. In collaboration with LANL, PCR primers will be synthesised from cDNA sequences mapped to chromosome 16 and used as ESTs in the generation of mega-YAC contigs for this chromosome. Probing of high density cosmid grids will enable integration of the ESTs into cosmid contigs and location of the cosmid contigs on the YAC contig. A hn-cDNA library has been constructed from the hybrid CY18 which contains chromosome 16 as the only human chromosome. A modified screening protocol has been successfully developed and 15 hn-cDNA clones have been sequenced and localised on the hybrid map. Sequence analysis of four of these revealed that they were known cDNAs, which are now mapped to chromosome 16. Development of techniques to allow the isolation of longer cDNAs from the identified exons is in progress. This will depend on PCR amplification of cDNAs from a total human CDNA library.

  1. The sequence and analysis of duplication rich human chromosome 16

    SciTech Connect

    Martin, J; Han, C; Gordon, L A; Terry, A; Prabhakar, S; She, X; Xie, G; Hellsten, U; Chan, Y M; Altherr, M; Couronne, O; Aerts, A; Bajorek, E; Black, S; Blumer, H; Branscomb, E; Brown, N; Bruno, W J; Buckingham, J; Callen, D F; Campbell, C S; Campbell, M L; Campbell, E W; Caoile, C; Challacombe, J F; Chasteen, L A; Chertkov, O; Chi, H C; Christensen, M; Clark, L M; Cohn, J D; Denys, M; Detter, J C; Dickson, M; Dimitrijevic-Bussod, M; Escobar, J; Fawcett, J J; Flowers, D; Fotopulos, D; Glavina, T; Gomez, M; Gonzales, E; Goodstein, D; Goodwin, L A; Grady, D L; Grigoriev, I; Groza, M; Hammon, N; Hawkins, T; Haydu, L; Hildebrand, C E; Huang, W; Israni, S; Jett, J; Jewett, P B; Kadner, K; Kimball, H; Kobayashi, A; Krawczyk, M; Leyba, T; Longmire, J L; Lopez, F; Lou, Y; Lowry, S; Ludeman, T; Manohar, C F; Mark, G A; McMurray, K L; Meincke, L J; Morgan, J; Moyzis, R K; Mundt, M O; Munk, A C; Nandkeshwar, R D; Pitluck, S; Pollard, M; Predki, P; Parson-Quintana, B; Ramirez, L; Rash, S; Retterer, J; Ricke, D O; Robinson, D; Rodriguez, A; Salamov, A; Saunders, E H; Scott, D; Shough, T; Stallings, R L; Stalvey, M; Sutherland, R D; Tapia, R; Tesmer, J G; Thayer, N; Thompson, L S; Tice, H; Torney, D C; Tran-Gyamfi, M; Tsai, M; Ulanovsky, L E; Ustaszewska, A; Vo, N; White, P S; Williams, A L; Wills, P L; Wu, J; Wu, K; Yang, J; DeJong, P; Bruce, D; Doggett, N A; Deaven, L; Schmutz, J; Grimwood, J; Richardson, P; Rokhsar, D S; Eichler, E E; Gilna, P; Lucas, S M; Myers, R M; Rubin, E M; Pennacchio, L A

    2005-04-06

    Human chromosome 16 features one of the highest levels of segmentally duplicated sequence among the human autosomes. We report here the 78,884,754 base pairs of finished chromosome 16 sequence, representing over 99.9% of its euchromatin. Manual annotation revealed 880 protein-coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes, and 3 RNA pseudogenes. These genes include metallothionein, cadherin, and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobase pairs were identified and result in gene content differences among humans. While the segmental duplications of chromosome 16 are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events likely to have had an impact on the evolution of primates and human disease susceptibility.

  2. The morbid anatomy of the human genome: chromosomal location of mutations causing disease.

    PubMed Central

    McKusick, V A; Amberger, J S

    1993-01-01

    Information is given in tabular form derived from a synopsis of the human gene map which has been updated continuously since 1973 as part of Mendelian Inheritance in Man (Johns Hopkins University Press, 10th ed, 1992) and of OMIM (Online Mendelian Inheritance in Man, available generally since 1987). The part of the synopsis reproduced here consists of chromosome by chromosome gene lists of loci for which there are associated disorders (table 1), a pictorial representation of this information (fig 1a-d), and an index of disorders for which the causative mutations have been mapped (table 2). In table 1, information on genes that have been located to specific chromosomal positions and are also the site of disease producing mutations is arranged by chromosome, starting with chromosome 1 and with the end of the short arm of the chromosome in each case. In table 2 an alphabetized list of these disorders and the chromosomal location of the mutation in each case are provided. Both in the 'Disorder' field of table 1 and in table 2, the numbers 1, 2, or 3 in parentheses after the name of the disorder indicate that its chromosomal location was determined by mapping of the wildtype gene (1), by mapping of the clinical phenotype (2), or by both strategies (3). PMID:8423603

  3. Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

    SciTech Connect

    Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F. )

    1988-08-01

    Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

  4. Assignment of the locus for Waardenburg syndrome type I to human chromosome 2q37 and possible homology to the Splotch mouse.

    PubMed Central

    Foy, C; Newton, V; Wellesley, D; Harris, R; Read, A P

    1990-01-01

    We have demonstrated close linkage between the locus for the autosomal dominant Waardenburg syndrome type I and the placental alkaline phosphatase locus on chromosome 2q37. In five families the peak lod score was 4.76 at a recombination fraction of .023. In the mouse the Splotch locus maps to near the homologous position. Splotch mice have white spotting and hearing defects, suggesting that Splotch may be the murine homologue of Waardenburg syndrome type I. PMID:2339698

  5. Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

    PubMed

    Waye, J S; Willard, H F

    1986-09-01

    The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.

  6. Chromosomal localization and structure of the human type II IMP dehydrogenase gene

    SciTech Connect

    Glesne, D.; Huberman, E. |; Collart, F.; Varkony, T.; Drabkin, H.

    1994-05-01

    We determined the chromosomal localization and structure of the gene encoding human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC 1.1.1.205), an enzyme associated with cellular proliferation, malignant transformation, and differentiation. Using polymerase chain reaction (PCR) primers specific for type II IMPDH, we screened a panel of human-Chinese hamster cell somatic hybrids and a separate deletion panel of chromosome 3 hybrids and localized the gene to 3p21.1{yields}p24.2. Two overlapping yeast artificial chromosome clones containing the full gene for type II IMPDH were isolated and a physical map of 117 kb of human genomic DNA in this region of chromosome 3 was constructed. The gene for type II IMPDH was localized and oriented on this map and found to span no more than 12.5 kb.

  7. Chromosomal assignment of the genes for proprotein convertases PC4, PC5, and PACE 4 in mouse and human

    SciTech Connect

    Mbikay, M.; Seidah, N.G.; Chretien, M.

    1995-03-01

    The genes for three subtilisin/kexin-like proprotein convertases, PC4, PC5, and PACE4, were mapped in the mouse by RFLP analysis of a DNA panel from a (C57BL/6JEi x SPRET/Ei) F{sub 1} x SPRET/Ei backcross. The chromosomal locations of the human homologs were determined by Southern blot analysis of a DNA panel from human-rodent somatic cell hybrids, most of which contained a single human chromosome each. The gene for PC4 (Pcsk4 locus) mapped to mouse chromosome 10, close to the Adn (adipsin, a serine protease) locus and near the Amh (anti-Mullerian hormone) locus; in a human, the gene was localized to chromosome 19. The gene for PC5 (Pcsk5 locus) mapped to mouse chromosome 19 close to the Lpc1 (lipoacortin-1) locus and, in human, was localized to chromosome 9. The gene for PACE4 (Pcsk6 locus) mapped to mouse chromosome 7, at a distance of 13 cM from the Pcsk3 locus, which specifies furin, another member of this family of enzymes previoulsy mapped to this chromosome. This is in concordance with the known close proximity of these two loci in the homologous region on human chromosome 15q25-qter. Pcsk3 and Pcsk6 mapped to a region of mouse chromosome 7 that has been associated cytogenetically with postnatal lethality in maternal disomy, suggesting that these genes might be candidates for imprinting. 43 refs., 3 figs., 2 tabs.

  8. The DNA sequence and analysis of human chromosome 14.

    PubMed

    Heilig, Roland; Eckenberg, Ralph; Petit, Jean-Louis; Fonknechten, Núria; Da Silva, Corinne; Cattolico, Laurence; Levy, Michaël; Barbe, Valérie; de Berardinis, Véronique; Ureta-Vidal, Abel; Pelletier, Eric; Vico, Virginie; Anthouard, Véronique; Rowen, Lee; Madan, Anup; Qin, Shizhen; Sun, Hui; Du, Hui; Pepin, Kymberlie; Artiguenave, François; Robert, Catherine; Cruaud, Corinne; Brüls, Thomas; Jaillon, Olivier; Friedlander, Lucie; Samson, Gaelle; Brottier, Philippe; Cure, Susan; Ségurens, Béatrice; Anière, Franck; Samain, Sylvie; Crespeau, Hervé; Abbasi, Nissa; Aiach, Nathalie; Boscus, Didier; Dickhoff, Rachel; Dors, Monica; Dubois, Ivan; Friedman, Cynthia; Gouyvenoux, Michel; James, Rose; Madan, Anuradha; Mairey-Estrada, Barbara; Mangenot, Sophie; Martins, Nathalie; Ménard, Manuela; Oztas, Sophie; Ratcliffe, Amber; Shaffer, Tristan; Trask, Barbara; Vacherie, Benoit; Bellemere, Chadia; Belser, Caroline; Besnard-Gonnet, Marielle; Bartol-Mavel, Delphine; Boutard, Magali; Briez-Silla, Stéphanie; Combette, Stephane; Dufossé-Laurent, Virginie; Ferron, Carolyne; Lechaplais, Christophe; Louesse, Claudine; Muselet, Delphine; Magdelenat, Ghislaine; Pateau, Emilie; Petit, Emmanuelle; Sirvain-Trukniewicz, Peggy; Trybou, Arnaud; Vega-Czarny, Nathalie; Bataille, Elodie; Bluet, Elodie; Bordelais, Isabelle; Dubois, Maria; Dumont, Corinne; Guérin, Thomas; Haffray, Sébastien; Hammadi, Rachid; Muanga, Jacqueline; Pellouin, Virginie; Robert, Dominique; Wunderle, Edith; Gauguet, Gilbert; Roy, Alice; Sainte-Marthe, Laurent; Verdier, Jean; Verdier-Discala, Claude; Hillier, LaDeana; Fulton, Lucinda; McPherson, John; Matsuda, Fumihiko; Wilson, Richard; Scarpelli, Claude; Gyapay, Gábor; Wincker, Patrick; Saurin, William; Quétier, Francis; Waterston, Robert; Hood, Leroy; Weissenbach, Jean

    2003-02-01

    Chromosome 14 is one of five acrocentric chromosomes in the human genome. These chromosomes are characterized by a heterochromatic short arm that contains essentially ribosomal RNA genes, and a euchromatic long arm in which most, if not all, of the protein-coding genes are located. The finished sequence of human chromosome 14 comprises 87,410,661 base pairs, representing 100% of its euchromatic portion, in a single continuous segment covering the entire long arm with no gaps. Two loci of crucial importance for the immune system, as well as more than 60 disease genes, have been localized so far on chromosome 14. We identified 1,050 genes and gene fragments, and 393 pseudogenes. On the basis of comparisons with other vertebrate genomes, we estimate that more than 96% of the chromosome 14 genes have been annotated. From an analysis of the CpG island occurrences, we estimate that 70% of these annotated genes are complete at their 5' end. PMID:12508121

  9. CAPER: a chromosome-assembled human proteome browsER.

    PubMed

    Guo, Feifei; Wang, Dan; Liu, Zhongyang; Lu, Liang; Zhang, Wei; Sun, Haiyan; Zhang, Hongxing; Ma, Jie; Wu, Songfeng; Li, Ning; Jiang, Ying; Zhu, Weimin; Qin, Jun; Xu, Ping; Li, Dong; He, Fuchu

    2013-01-01

    High-throughput mass spectrometry and antibody-based experiments have begun to produce a large amount of proteomic data sets. Chromosome-based visualization of these data sets and their annotations can help effectively integrate, organize, and analyze them. Therefore, we developed a web-based, user-friendly Chromosome-Assembled human Proteome browsER (CAPER). To display proteomic data sets and related annotations comprehensively, CAPER employs two distinct visualization strategies: track-view for the sequence/site information and the correspondence between proteome, transcriptome, genome, and chromosome and heatmap-view for the qualitative and quantitative functional annotations. CAPER supports data browsing at multiple scales through Google Map-like smooth navigation, zooming, and positioning with chromosomes as the reference coordinate. Both track-view and heatmap-view can mutually switch, providing a high-quality user interface. Taken together, CAPER will greatly facilitate the complete annotation and functional interpretation of the human genome by proteomic approaches, thereby making a significant contribution to the Chromosome-Centric Human Proteome Project and even the human physiology/pathology research. CAPER can be accessed at http://www.bprc.ac.cn/CAPE .

  10. Structure of human chromosomes studied by atomic force microscopy.

    PubMed

    Tamayo, Javier

    2003-03-01

    In this work human chromosomes have been treated with RNase and pepsin to remove the layer of cellular material that covers the standard preparations on glass slides. This allows characterization of the topography of chromosomes at nanometer scale in air and in physiological solution by atomic force microscopy. Imaging of the dehydrated structure in air indicates radial arrangement of chromatin loops as the last level of DNA packing. However, imaging in liquid reveals a last level of organization consisting of a hierarchy of bands and coils. Additionally force curves between the tip and the chromosome in liquid are consistent with radial chromatin loops. These results and previous electron microscopy studies are analyzed, and a model is proposed for the chromosome structure in which radial loops and helical coils coexist.

  11. Large-scale polymorphism near the ends of several human chromosomes analyzed by using fluorescence in situ hybridization (FISH)

    SciTech Connect

    Trask, B.J.; Friedman, C.; Giorgi, D.

    1994-09-01

    We have discovered a large DNA segment that is polymorphically present at the ends of several human chromosomes. The segment, f7501, was originally derived form a human chromosome 19-specific cosmid library. FISH was used to determine the cosmid`s chromosomal distribution on 44 unrelated humans and several closely related primates. The human subjects represent a diversity of reproductively isolated ethnic populations. FISH analysis revealed that sequences highly homologous to the cosmid`s insert are present on both homologs at 3q, 15q,. and 19p in almost all individuals (88, 85, and 87 of 88 homologs, respectively). Other chromosomes sites were labeled much more rarely in the sampled individuals. For example, 56 of the 88 analyzed chromosomes 11 were labeled (18+/+, 6-/-, and 20+/- individuals). In contrast, 2q was labeled on only 1/88 sampled chromosomes. The termini of 2q, 5q, 6p, 6q, 7p, 8p, 9p, 9q, 11p, 12q, 16p, 19q, and 20q and an interstitial site at 2q13-14 were labeled in at least one individual of the set. EcoR1-fragments derived from the cosmid showed the same hybridization pattern as the entire cosmid, indicating that at least 40 kbp is shared by these chromosome ends. Ethnic differences in the allele frequency of these polymorphic variants was observed. For example, signals were observed on 8/10 and 7/10 of the chromosomes 7p and 16q, respectively, derived form Biakan Pygmies, but these sites were infrequently labeled in non-Pygmy human populations (2/68, respectively). This region has undergone significant changes in chromosome location during human evolution. Strong signal was seen on chimpanzee and gorilla chromosome 3, which is homologous to human chromosome 4, a chromosome unlabeled in any of the humans we have analyzed.

  12. Evaluating the relationship between spermatogenic silencing of the X chromosome and evolution of the Y chromosome in chimpanzee and human.

    PubMed

    Mulugeta Achame, Eskeatnaf; Baarends, Willy M; Gribnau, Joost; Grootegoed, J Anton

    2010-12-14

    Chimpanzees and humans are genetically very similar, with the striking exception of their Y chromosomes, which have diverged tremendously. The male-specific region (MSY), representing the greater part of the Y chromosome, is inherited from father to son in a clonal fashion, with natural selection acting on the MSY as a unit. Positive selection might involve the performance of the MSY in spermatogenesis. Chimpanzees have a highly polygamous mating behavior, so that sperm competition is thought to provide a strong selective force acting on the Y chromosome in the chimpanzee lineage. In consequence of evolution of the heterologous sex chromosomes in mammals, meiotic sex chromosome inactivation (MSCI) results in a transcriptionally silenced XY body in male meiotic prophase, and subsequently also in postmeiotic repression of the sex chromosomes in haploid spermatids. This has evolved to a situation where MSCI has become a prerequisite for spermatogenesis. Here, by analysis of microarray testicular expression data representing a small number of male chimpanzees and men, we obtained information indicating that meiotic and postmeiotic X chromosome silencing might be more effective in chimpanzee than in human spermatogenesis. From this, we suggest that the remarkable reorganization of the chimpanzee Y chromosome, compared to the human Y chromosome, might have an impact on its meiotic interactions with the X chromosome and thereby on X chromosome silencing in spermatogenesis. Further studies will be required to address comparative functional aspects of MSCI in chimpanzee, human, and other placental mammals.

  13. Analysis of human spermatozoa for Y chromosomal nondisjunction

    SciTech Connect

    Kapp, R.W. Jr.; Jacobson, C.B.

    1980-01-01

    The YFF sperm assay, which is a quantification of the incidence of sperm with two fluorescent bodies (YFF . two fluorescent bodies), was performed to measure Y chromosomal nondisjunction. Three categories of human subjects were analyzed: 1) nonexposed, 2) exposed to antineoplastic agents - ie, chemo- and radiation therapy, and 3) dibromochloropropane (DBCP)-exposed. The individuals exposed to antineoplastic agents showed a three- to four-fold increase in the incidence of YFF sperm three to six weeks after the initiation of exposure to Adriamycin and X-irradiation. The maximum percentages of YFF per 1,000 sperm for each individual in this exposed group was analyzed by Wilcoxon's distribution free rank sum test using a one-sided alternative. The exposed individuals' maximum YFF percentages were statistically significantly increased when compared to the maximum YFF values of the nonexposed controls. The individuals exposed to the nematocide DBCP also exhibited a statistically significant increase in the number of sperm containing two Y chromosomes as determined by chi-square analysis with one degree of freedom (P less than 0.01). Data presented herein show statistically significant increases in the incidence of double Y chromosomes as measured by the presence of YFF sperm following exposure to Adriamycin, X-irradiation, and DBCP. It is suggested that men who have a history of antineoplastic therapy could be evaluated for evidence of Y-Y nondisjunction with this method. In the event of an increased YFF sperm level, genetic counseling and amniocentesis should be made available to the spouse where pregnancy has occurred. Further, because this procedure measures gametic mutation, is relatively simple, and is noninvasive, it should be considered for inclusion as part of a battery of medical tests for monitoring industrial populations.

  14. Localization of the tight junction protein gene TJP1 to human chromosome 15q13, distal to the Prader-Willi/Angelman region, and to mouse chromosome 7

    SciTech Connect

    Mohandas, T.K.; Chen, X.N.; Korenberg, J.R.

    1995-12-10

    The gene encoding the tight junction (zonula occludens) protein, TJP1, was mapped to human chromosome 15q13 by fluorescence in situ hybridization (FISH) using a cDNA probe. The Jackson Laboratory backcross DNA panel derived from the cross (C57BL/6JEi X SPRET/Ei) F1 females X SPRET/Ei males was used to map the mouse Tjp1 to chromosome 7 near position 30 on the Chromosome Committee Map, a region with conserved homology to human chromosome 15q13. FISH studies on metaphases from patients with the Prader-Willi (PWS) or the Angelman syndrome (AS) showed that TJP1 maps close but distal to the PWS/AS chromosome region. 13 refs., 2 figs.

  15. Analysis of Heavy Ion-Induced Chromosome Aberrations in Human Fibroblast Cells Using In Situ Hybridization

    NASA Technical Reports Server (NTRS)

    Wu, Honglu; Durante, Marco; Furusawa, Yoshiya; George, Kerry; Kawata, Tetsuya; Cucinotta, Francis A.

    2003-01-01

    Confluent human fibroblast cells (AG1522) were irradiated with gamma rays, 490 MeV/nucleon Si, or with Fe ions at either 200 or 500 MeV/nucleon. The cells were allowed to repair at 37 0 C for 24 hours after exposure, and a chemically induced premature chromosome condensation (PCC) technique was used to condense chromosomes in the G2 phase of the cell cycle. Unrejoined chromosomal breaks and complex exchanges were analyzed in the irradiated samples. In order to verify that chromosomal breaks were truly unrejoined, chromosome aberrations were analyzed using a combination of whole chromosome specific probes and probes specific for the telomere region of the chromosome. Results showed that the frequency of unrejoined chromosome breaks was higher after high-LET radiation, and consequently, the ratio of incomplete to complete exchanges increased steadily with LET up to 440 keV/micron, the highest LET value in the present study. For samples exposed to 200 MeV/nucleon Fe ions, chromosome aberrations were analyzed using the multicolor FISH (mFISH) technique that allows identification of both complex and truly incomplete exchanges. Results of the mFISH study showed that 0.7 and 3 Gy dose of the Fe ions produced similar ratios of complex to simple exchanges and incomplete to complete exchanges, values for which were higher than those obtained after a 6 Gy gamma exposure. After 0.7 Gy of Fe ions, most complex aberrations were found to involve three or four chromosomes, indicating the maximum number of chromosome domains traversed by a single Fe ion track. 2

  16. Induction of chromosome aberrations in human cells by charged particles

    NASA Technical Reports Server (NTRS)

    Wu, H.; Durante, M.; George, K.; Yang, T. C.

    1997-01-01

    Chromosome aberrations induced by high-energy charged particles in normal human lymphocytes and human fibroblasts have been investigated. The charged particles included 250 MeV/nucleon protons, 290 MeV/nucleon carbon ions and 1 GeV/nucleon iron ions. The energies of the charged particles were higher than in most of the studies reported in the literature. Lymphocytes were stimulated to grow immediately after irradiation, while fibroblasts were incubated at 37 degrees C for 24 h for repair. Chromosomes were collected at the first mitosis after irradiation and chromosome aberrations were scored using the fluorescence in situ hybridization (FISH) technique with a whole-chromosome 4 probe. Chromosome aberrations were classified as reciprocal exchanges, incomplete exchanges, deletions and complex exchanges. The relative biological effectiveness (RBE) for each type of aberration was calculated by dividing a dose of 4 Gy by the dose of the charged particles producing the same effect as 4 Gy of gamma rays. Results of this study showed that complex aberrations have the highest RBE for radiation of high linear energy transfer (LET) for human lymphocytes, but for fibroblasts, the greatest effect was for incomplete exchanges. For both lymphocytes and fibroblasts, iron ions induced a similar fraction of aberrant cells.

  17. Chromosome Conformation Capture in Primary Human Cells.

    PubMed

    Cortesi, Alice; Bodega, Beatrice

    2016-01-01

    3D organization of the genome, its structural and regulatory function of cell identity, is acquiring prominent features in epigenetics studies; more efforts have been done to develop techniques that allow studying nuclear structure. Chromosome conformation capture (3C) has been set up in 2002 from Dekker and from that moment great investments were made to develop genomics variants of 3C technology (4C, 5C, Hi-C) providing new tools to investigate the shape of the genome in a more systematic and unbiased manner. 3C method allows scientists to fix dynamic and variable 3D interactions in nuclear space, and consequently to study which sequences interact, how a gene is regulated by different and distant enhancer, or how a set of enhancer could regulate transcriptional units; to follow the conformation that mediates regulation change in development; and to evaluate if this fine epigenetic mechanism is impaired in disease condition. PMID:27659988

  18. Construction of a chromosome specific library of human MARs and mapping of matrix attachment regions on human chromosome 19.

    PubMed

    Nikolaev, L G; Tsevegiyn, T; Akopov, S B; Ashworth, L K; Sverdlov, E D

    1996-04-01

    Using a novel procedure a representative human chromosome 19-specific library was constructed of short sequences, which bind preferentially to the nuclear matrix (matrix attachment regions, or MARs). Judging by 20 clones sequenced so far, the library contains > 50% of human inserts, about 90% of which are matrix-binding by the in vitro test. Computer analysis of sequences of eight human MARs did not reveal any significant homologies with the EMBL Nucleotide Data Base entries as well as between MARs themselves. Eight MARs were assigned to individual positions on the chromosome 19 physical map. The library constructed can serve as a good source of MAR sequences for comparative analysis and classification and for further chromosome mapping of MARs as well.

  19. Construction of a chromosome specific library of human MARs and mapping of matrix attachment regions on human chromosome 19.

    PubMed Central

    Nikolaev, L G; Tsevegiyn, T; Akopov, S B; Ashworth, L K; Sverdlov, E D

    1996-01-01

    Using a novel procedure a representative human chromosome 19-specific library was constructed of short sequences, which bind preferentially to the nuclear matrix (matrix attachment regions, or MARs). Judging by 20 clones sequenced so far, the library contains > 50% of human inserts, about 90% of which are matrix-binding by the in vitro test. Computer analysis of sequences of eight human MARs did not reveal any significant homologies with the EMBL Nucleotide Data Base entries as well as between MARs themselves. Eight MARs were assigned to individual positions on the chromosome 19 physical map. The library constructed can serve as a good source of MAR sequences for comparative analysis and classification and for further chromosome mapping of MARs as well. PMID:8614638

  20. Chromosomal localization of human RNA polymerase II subunit genes

    SciTech Connect

    Acker, J.; Wintzerith, M.; Vigneron, M.; Kedinger, C. ); Mattei, M.G.; Roeckel, N.; Depetris, D. )

    1994-04-01

    The eukaryotic DNA-dependent RNA polymerase II (or B) is composed of 10 to 14 polypeptides ranging from 220 to 10 kDa. To gain further insight into the molecular structure and function of these subunits, the authors have undertaken the molecular cloning of nucleotide sequences corresponding to the human enzyme. The cDNAs of five subunits (hRPB220, hRPB140, hRPB33, hRPB25, and hRPB14.5) have been isolated. Using in situ hybridization, they show that the genes of these subunits have distinct chromosomal locations (17p13, 4q12, 16q13-q21, 19p13.3, and 19q12, respectively). Thus, if assembly of active polymerase molecules requires coordinated expression from these independent genes, mechanisms that ensure tight coregulation of the corresponding promoters must exist. 20 refs., 2 figs., 1 tab.

  1. Technologies for large-scale physical mapping of human chromosomes

    SciTech Connect

    Beugelsdijk, T.J.

    1994-12-01

    Since its inception 6 years ago, the Human Genome Project has made rapid progress towards its ultimate goal of developing the complete sequence of all human chromosomes. This progress has been made possible through the development of automated devices by laboratories throughout the world that aid the molecular biologist in various phases of the project. The initial phase involves the generation of physical and genetic maps of each chromosome. This task is nearing completion at a low resolution level with several instances of very high detailed maps being developed for isolated chromosomes. In support of the initial mapping thrust of this program, the robotics and automation effort at Los Alamos National Laboratory has developed DNA gridding technologies along with associated database and user interface systems. This paper will discuss these systems in detail and focus on the formalism developed for subsystems which allow for facile system integration.

  2. The DNA Sequence And Comparative Analysis Of Human Chromosome5

    SciTech Connect

    Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, Steve; Gordon, Laurie A.; Scott, Duncan; Xie,Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black,Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan,Yee Man; Denys, Mirian; Detter, John C.; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner,Kristen; Kimball, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou,Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar,Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Retterer, James; Rodriguez, Alex; Rogers,Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang,Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, SusanM.; Myers, Richard M.; Rubin, Edward M.

    2004-08-01

    Chromosome 5 is one of the largest human chromosomes and contains numerous intrachromosomal duplications, yet it has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding conservation with non-mammalian vertebrates, suggesting that they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-coding genes including the protocadherin and interleukin gene families. We also completely sequenced versions of the large chromosome-5-specific internal duplications. These duplications are very recent evolutionary events and probably have a mechanistic role in human physiological variation, as deletions in these regions are the cause of debilitating disorders including spinal muscular atrophy.

  3. Frequent, unconventional structural changes of the human Y chromosome

    SciTech Connect

    Chen, T.R.

    1994-09-01

    Six human cell lines in which the Y/autosome translocations were suspected by the conventional chromosome banding study exhibited unconventional, complex structural rearrangements of the Y chromosome. These translocations included Yqter{r_arrow}Yq12::Ycen{r_arrow}Yp11 (or Yq11{r_arrow}Ycen)::9pter{r_arrow}9qter; insertion of Ycen interstitially to an autosome; interstitial insertion of two Yq12 segments separated by an euchromatic non-Y segment; and multiple Y/autosomal translocations containing unequal Yq12 segments. These markers required three or more breaks/reunions. Loci of breaks and retaining segments of the Y chromosome were identified by the combination of conventional chromosome bandings, fluorescence in situ hybridization, and Southern blot DNA analyses. Extensive structural rearrangements involving the Y chromosome were evident. The heterochromatic Y segments retained in cell lines of male donor origins at a distinctively higher rate than the euchromatic Y arms. The Y/A markers were present in all cells and paired Y/As were found in some cell lines. These facts strongly suggested that at least some of these markers were present in the tissue explant, but not entirely derived newly in vitro. These naturally occurring structural changes of the Y chromosomes are very complex, and often rather unique. Therefore, a single Y/A marker chromosome may be used solely to identify a cell line; cell lines with the unique aberration(s) can be collated to construct a Y segment sequential panel for mapping genes; and the unique Y/A translocations can be used to discriminate a DNA segment at multiple sites on the Y chromosome arm simultaneously.

  4. Reciprocal chromosome painting among human, aardvark, and elephant (superorder Afrotheria) reveals the likely eutherian ancestral karyotype

    PubMed Central

    Yang, F.; Alkalaeva, E. Z.; Perelman, P. L.; Pardini, A. T.; Harrison, W. R.; O'Brien, P. C. M.; Fu, B.; Graphodatsky, A. S.; Ferguson-Smith, M. A.; Robinson, T. J.

    2003-01-01

    The Afrotheria, a supraordinal grouping of mammals whose radiation is rooted in Africa, is strongly supported by DNA sequence data but not by their disparate anatomical features. We have used flow-sorted human, aardvark, and African elephant chromosome painting probes and applied reciprocal painting schemes to representatives of two of the Afrotherian orders, the Tubulidentata (aardvark) and Proboscidea (elephants), in an attempt to shed additional light on the evolutionary affinities of this enigmatic group of mammals. Although we have not yet found any unique cytogenetic signatures that support the monophyly of the Afrotheria, embedded within the aardvark genome we find the strongest evidence yet of a mammalian ancestral karyotype comprising 2n = 44. This karyotype includes nine chromosomes that show complete conserved synteny to those of man, six that show conservation as single chromosome arms or blocks in the human karyotype but that occur on two different chromosomes in the ancestor, and seven neighbor-joining combinations (i.e., the synteny is maintained in the majority of species of the orders studied so far, but which corresponds to two chromosomes in humans). The comparative chromosome maps presented between human and these Afrotherian species provide further insight into mammalian genome organization and comparative genomic data for the Afrotheria, one of the four major evolutionary clades postulated for the Eutheria. PMID:12552116

  5. Radiation-induced chromosomal instability in human mammary epithelial cells

    NASA Astrophysics Data System (ADS)

    Durante, M.; Grossi, G. F.; Yang, T. C.

    Karyotypes of human cells surviving X- and alpha-irradiation have been studied. Human mammary epithelial cells of the immortal, non-tumorigenic cell line H184B5 F5-1 M/10 were irradiated and surviving clones isolated and expanded in culture. Cytogenetic analysis was performed using dedicated software with an image analyzer. We have found that both high- and low-LET radiation induced chromosomal instability in long-term cultures, but with different characteristics. Complex chromosomal rearrangements were observed after X-rays, while chromosome loss predominated after alpha-particles. Deletions were observed in both cases. In clones derived from cells exposed to alpha-particles, some cells showed extensive chromosome breaking and double minutes. Genomic instability was correlated to delayed reproductive death and neoplastic transformation. These results indicate that chromosomal instability is a radiation-quality-dependent effect which could determine late genetic effects, and should therefore be carefully considered in the evaluation of risk for space missions.

  6. Radiation-induced chromosomal instability in human mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Durante, M.; Grossi, G. F.; Yang, T. C.

    1996-01-01

    Karyotypes of human cells surviving X- and alpha-irradiation have been studied. Human mammary epithelial cells of the immortal, non-tumorigenic cell line H184B5 F5-1 M/10 were irradiated and surviving clones isolated and expanded in culture. Cytogenetic analysis was performed using dedicated software with an image analyzer. We have found that both high- and low-LET radiation induced chromosomal instability in long-term cultures, but with different characteristics. Complex chromosomal rearrangements were observed after X-rays, while chromosome loss predominated after alpha-particles. Deletions were observed in both cases. In clones derived from cells exposed to alpha-particles, some cells showed extensive chromosome breaking and double minutes. Genomic instability was correlated to delayed reproductive death and neoplastic transformation. These results indicate that chromosomal instability is a radiation-quality-dependent effect which could determine late genetic effects, and should therefore be carefully considered in the evaluation of risk for space missions.

  7. Human chromokinesins promote chromosome congression and spindle microtubule dynamics during mitosis

    PubMed Central

    Wandke, Cornelia; Barisic, Marin; Sigl, Reinhard; Rauch, Veronika; Wolf, Frank; Amaro, Ana C.; Tan, Chia H.; Pereira, Antonio J.; Kutay, Ulrike; Maiato, Helder; Meraldi, Patrick

    2012-01-01

    Chromokinesins are microtubule plus end–directed motor proteins that bind to chromosome arms. In Xenopus egg cell-free extracts, Xkid and Xklp1 are essential for bipolar spindle formation but the functions of the human homologues, hKID (KIF22) and KIF4A, are poorly understood. By using RNAi-mediated protein knockdown in human cells, we find that only co-depletion delayed progression through mitosis in a Mad2-dependent manner. Depletion of hKID caused abnormal chromosome arm orientation, delayed chromosome congression, and sensitized cells to nocodazole. Knockdown of KIF4A increased the number and length of microtubules, altered kinetochore oscillations, and decreased kinetochore microtubule flux. These changes were associated with failures in establishing a tight metaphase plate and an increase in anaphase lagging chromosomes. Co-depletion of both chromokinesins aggravated chromosome attachment failures, which led to mitotic arrest. Thus, hKID and KIF4A contribute independently to the rapid and correct attachment of chromosomes by controlling the positioning of chromosome arms and the dynamics of microtubules, respectively. PMID:22945934

  8. Human chromokinesins promote chromosome congression and spindle microtubule dynamics during mitosis.

    PubMed

    Wandke, Cornelia; Barisic, Marin; Sigl, Reinhard; Rauch, Veronika; Wolf, Frank; Amaro, Ana C; Tan, Chia H; Pereira, Antonio J; Kutay, Ulrike; Maiato, Helder; Meraldi, Patrick; Geley, Stephan

    2012-09-01

    Chromokinesins are microtubule plus end-directed motor proteins that bind to chromosome arms. In Xenopus egg cell-free extracts, Xkid and Xklp1 are essential for bipolar spindle formation but the functions of the human homologues, hKID (KIF22) and KIF4A, are poorly understood. By using RNAi-mediated protein knockdown in human cells, we find that only co-depletion delayed progression through mitosis in a Mad2-dependent manner. Depletion of hKID caused abnormal chromosome arm orientation, delayed chromosome congression, and sensitized cells to nocodazole. Knockdown of KIF4A increased the number and length of microtubules, altered kinetochore oscillations, and decreased kinetochore microtubule flux. These changes were associated with failures in establishing a tight metaphase plate and an increase in anaphase lagging chromosomes. Co-depletion of both chromokinesins aggravated chromosome attachment failures, which led to mitotic arrest. Thus, hKID and KIF4A contribute independently to the rapid and correct attachment of chromosomes by controlling the positioning of chromosome arms and the dynamics of microtubules, respectively. PMID:22945934

  9. The human and mouse homologs of the yeat RAD52 gene: cDNA cloning, sequence analysis, assignment to human chromosome 12p12.2-p13, and mRNA expression in mouse tissues

    SciTech Connect

    Shen, Z.; Chen, D.J.; Denison, K.

    1995-01-01

    The yeast Saccharomyces cerevisiae RAD52 gene is involved in DNA double-strand break repair and mitotic/meiotic recombination. The N-terminal amino acid sequence of yeast S. cerevisiae, Schizosaccharomyces pombe, and Kluyveromyces lactis and chicken is highly conserved. Using the technology of mixed oligonucleotide primed amplification of cDNA (MOPAC), two mouse RAD52 homologous cDNA fragments were amplified and sequenced. Subsequently, we have cloned the cDNA of the human and mouse homologs of yeast RAD52 gene by screening cDNA libraries using the identified mouse cDNA fragments. Sequence analysis of cDNA derived amino acid revealed a highly conserved N-terminus among human, mouse, chicken, and yeast RAD52 genes. The human RAD52 gene was assigned to chromosome 12p12.2-p13 by fluorescence in situ hybridization, R-banding, and DNA analysis of somatic cell hybrids. Unlike chicken RAD52 and mouse RAD51, no significant difference in mouse RAD52 mRNA level was found among mouse heart, brain, spleen, lung, liver, skeletal muscle, kidney, and testis. In addition to an {approximately}1.9-kb RAD52 mRNA band that is present in all of the tested tissues, an extra mRNA species of {approximately}0.85 kb was detectable in mouse testis. 40 refs., 7 figs., 1 tab.

  10. [Developing a physical map of human chromosome 22]. Progress report

    SciTech Connect

    Simon, M.I.

    1991-12-31

    We have developed bacterial F-factor based systems for cloning large fragments of human DNA in E. coli. In addition to large size, these systems are capable of maintaining human DNA with a high degree of stability. The cosmid size clones are called Fosmids and the clones containing larger inserts (100--200 kb) are called bacterial artificial chromosomes (BACs). The ultimate test of the effectiveness of cloning and mapping technology is the degree to which it can be efficiently applied to solve complex mapping problems. We, therefore, plan to use the large fragment cloning procedure as well as a variety of other approaches to generate a complete map of overlapping clones corresponding to human chromosome 22. We have thus far prepared two human chromosome 22 specific Fosmid libraries and we are in the process of constructing a chromosome 22 specific BAC library composed of fragments larger than 100 kb. We will further optimize the technology so that libraries of fragments larger than 200 kb can be readily prepared.

  11. (Developing a physical map of human chromosome 22)

    SciTech Connect

    Simon, M.I.

    1991-01-01

    We have developed bacterial F-factor based systems for cloning large fragments of human DNA in E. coli. In addition to large size, these systems are capable of maintaining human DNA with a high degree of stability. The cosmid size clones are called Fosmids and the clones containing larger inserts (100--200 kb) are called bacterial artificial chromosomes (BACs). The ultimate test of the effectiveness of cloning and mapping technology is the degree to which it can be efficiently applied to solve complex mapping problems. We, therefore, plan to use the large fragment cloning procedure as well as a variety of other approaches to generate a complete map of overlapping clones corresponding to human chromosome 22. We have thus far prepared two human chromosome 22 specific Fosmid libraries and we are in the process of constructing a chromosome 22 specific BAC library composed of fragments larger than 100 kb. We will further optimize the technology so that libraries of fragments larger than 200 kb can be readily prepared.

  12. Repeat Sequences and Base Correlations in Human Y Chromosome Palindromes

    NASA Astrophysics Data System (ADS)

    Jin, Neng-zhi; Liu, Zi-xian; Qi, Yan-jiao; Qiu, Wen-yuan

    2009-06-01

    On the basis of information theory and statistical methods, we use mutual information, n-tuple entropy and conditional entropy, combined with biological characteristics, to analyze the long range correlation and short range correlation in human Y chromosome palindromes. The magnitude distribution of the long range correlation which can be reflected by the mutual information is P5>P5a>P5b (P5a and P5b are the sequences that replace solely Alu repeats and all interspersed repeats with random uncorrelated sequences in human Y chromosome palindrome 5, respectively); and the magnitude distribution of the short range correlation which can be reflected by the n-tuple entropy and the conditional entropy is P5>P5a>P5b>random uncorrelated sequence. In other words, when the Alu repeats and all interspersed repeats replace with random uncorrelated sequence, the long range and short range correlation decrease gradually. However, the random uncorrelated sequence has no correlation. This research indicates that more repeat sequences result in stronger correlation between bases in human Y chromosome. The analyses may be helpful to understand the special structures of human Y chromosome palindromes profoundly.

  13. Characterization of human PGD blastocysts with unbalanced chromosomal translocations and human embryonic stem cell line derivation?

    PubMed

    Frydman, N; Féraud, O; Bas, C; Amit, M; Frydman, R; Bennaceur-Griscelli, A; Tachdjian, G

    2009-01-01

    Novel embryonic stem cell lines derived from embryos carrying structural chromosomal abnormalities obtained after preimplantation genetic diagnosis (PGD) are of interest to study in terms of the influence of abnormalities on further development. A total of 22 unbalanced blastocysts obtained after PGD were analysed for structural chromosomal defects. Morphological description and chromosomal status of these blastocysts was established and they were used to derive human embryonic stem cell (ESC) lines. An outgrowth of cells was observed for six blastocysts (6/22; 27%). For two blastocysts, the exact morphology was unknown since they were at early stage, and for four blastocysts, the inner cell mass was clearly visible. Fifteen blastocysts carried an unbalanced chromosomal defect linked to a reciprocal translocation, resulting in a positive outgrowth of cells for five blastocysts. One human ESC line was obtained from a blastocyst carrying a partial chromosome-21 monosomy and a partial chromosome-1 trisomy. Six blastocysts carried an unbalanced chromosomal defect linked to a Robertsonian translocation, and one showed a positive outgrowth of cells. One blastocyst carried an unbalanced chromosomal defect linked to an insertion and no outgrowth was observed. The efficiency of deriving human ESC lines with constitutional chromosomal disorders was low and probably depends on the initial morphological aspect of the blastocysts and/or the type of the chromosomal disorders.

  14. The sequence and analysis of duplication rich human chromosome 16

    SciTech Connect

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  15. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    DOE R&D Accomplishments Database

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  16. Report on the Second International Workshop on Human Chromosome 9

    SciTech Connect

    Kwiatkowski, D.J.; Armour, J.; Bale, A.E.

    1993-12-31

    The Second International Workshop on Human Chromosome 9 was held in Chatham, Massachusetts on April 18--20, 1993. Fifty-three abstracts were received and the data presented on posters. The purpose of the meeting was to bring together all interested investigators working on the map of chromosome 9, many of whom had disease-specific interests. After a brief presentation of interests and highlighted results, the meeting broke up into the following subgroups for production of consensus maps: 9p; 9cen-q32; 9q32 ter. A global mapping group also met. Reports of each of these working groups is presented in the summary.

  17. Molecular cloning, genomic organization, and chromosomal localization of the human pancreatitis-associated protein (PAP) gene

    SciTech Connect

    Dusetti, N.J.; Frigerio, J.M.; Dagorn, J.C.; Iovanna, J.L. ); Fox, M.F.; Swallow, D.M. )

    1994-01-01

    Pancreatitis-associated protein (PAP) is a secretory pancreatic protein present in small amounts in normal pancreas and overexpressed during the acute phase of pancreatitis. In this paper, the authors describe the cloning, characterization, and chromosomal mapping of the human PAP gene. The gene spans 2748 bp and contains six exons interrupted by five introns. The gene has a typical promoter containing the sequences TATAAA and CCAAT 28 and 52 bp upstream of the cap site, respectively. They found striking similarities in genomic organization as well as in the promoter sequences between the human and rat PAP genes. The human PAP gene was mapped to chromosome 2p12 using rodent-human hybrid cells and in situ chromosomal hybridization. This localization coincides with that of the reg/lithostathine gene, which encodes a pancreatic secretory protein structurally related to PAP, suggesting that both genes derived from the same ancestral gene by duplication. 35 refs., 4 figs., 1 tab.

  18. Chromosome mapping of five human cardiac and skeletal muscle sarcoplasmic reticulum protein genes

    SciTech Connect

    Otsu, K.; Fujii, J.; MacLennan, D.H. ); Periasamy, M. ); Difilippantonio, M.; Uppender, M.; Ward, D.C. )

    1993-08-01

    Fluorescence in situ hybridization (FISH) experiments were performed using genomic and complementary DNA probes in order to determine the location on human chromosomes for five genes expressed in cardiac and skeletal muscle sarcoplasmic reticulum. The chromosome location of each gene was determined in terms of both cytogenetic bands and fractional chromosome length. The ATP2A2 gene, expressing the SERCA2 isoform of the Ca[sup 2+] pump, maps to bands 12q23-q24.1, the phospholamban gene (PLN) to 6q22.1, the human skeletal muscle calsequestrin gene (CASQ1) to band 1q21, the cardiac calsequestrin gene (CASQ2) to bands 1p11-p13.3, and the cardiac calcium release channel gene (RYR2) to the interval between band 1q42.1 (distal) and band 1q43 (proximal). 13 refs., 1 fig.

  19. GANP protein encoded on human chromosome 21/mouse chromosome 10 is associated with resistance to mammary tumor development.

    PubMed

    Kuwahara, Kazuhiko; Yamamoto-Ibusuki, Mutsuko; Zhang, Zhenhuan; Phimsen, Suchada; Gondo, Naomi; Yamashita, Hiroko; Takeo, Toru; Nakagata, Naomi; Yamashita, Daisuke; Fukushima, Yoshimi; Yamamoto, Yutaka; Iwata, Hiroji; Saya, Hideyuki; Kondo, Eisaku; Matsuo, Keitaro; Takeya, Motohiro; Iwase, Hirotaka; Sakaguchi, Nobuo

    2016-04-01

    Human chromosome 21 is known to be associated with the high risk of hematological malignancy but with resistance to breast cancer in the study of Down syndrome. In human cancers, we previously observed the significant alterations of the protein expression encoded by the ganp/MCM3AP gene on human chromosome 21q22.3. Here, we investigated GANP protein alterations in human breast cancer samples (416 cases) at various stages by immunohistochemical analysis. This cohort study clearly showed that expression of GANP is significantly decreased in human breast cancer cases with poor prognosis as an independent risk factor (relapse-free survival, hazard ratio = 2.37, 95% confidence interval, 1.27-4.42, P = 0.007 [univariate analysis]; hazard ratio = 2.70, 95% confidence interval, 1.42-5.13, P = 0.002 [multivariate analysis]). To investigate whether the altered GANP expression is associated with mammary tumorigenesis, we created mutant mice that were conditionally deficient in the ganp/MCM3AP gene using wap-cre recombinase transgenic mice. Mammary gland tumors occurred at a very high incidence in female mammary gland-specific GANP-deficient mice after severe impairment of mammary gland development during pregnancy. Moreover, tumor development also occurred in female post parous GANP-heterodeficient mice. GANP has a significant role in the suppression of DNA damage caused by estrogen in human breast cancer cell lines. These results indicated that the GANP protein is associated with breast cancer resistance. PMID:26749495

  20. Chromosomes of older humans are more prone to aminopterine-induced breakage

    SciTech Connect

    Esposito, D. North Shore Univ. Hospital, Long Island, NY ); Fassina, G. Istituto Scientifico Tumori, Genova ); Szabo, P.; Weksler, M. ); De Angelis, P.; Siniscalco, M. ); Rodgers, L. )

    1989-02-01

    The authors have adopted a simplified version of the cell hybrid cotransfer method to test the hypothesis that human lymphocytes derived from elderly individuals have a higher chromosome instability. Peripheral blood lymphocytes from old male individuals and young controls were fused with a Chinese hamster cell line (CHO-YH21), yielding 10 HAT-resistant rodent-human clones from the old propositi and 22 from the young controls. Both series of hybrid clones were analyzed with respect to the retention of the enzyme glucose-6-phosphate dehydrogenase and the surface antigen MIC2 identified by monoclonal antibody 12E7, two human X chromosome-linked markers located at opposite ends of the X chromosome. Cell hybrid clones with an X chromosome from a young control retained both markers in about 70% of the cells. In contrast, cell hybrid clones with an X chromosome from an old donor retained the MIC2 marker in only 30% of their cells. Slot-blot hybridization studies have established that the observed loss of the MIC2 marker is due to loss of the coding gene, not to suppression of its expression. T lymphocytes from old donors were also found to have an LD{sub 50} for aminopterine significantly lower than the concentration of this drug in the HAT medium used to grow the hybrids. They speculate that the higher rate of chromosomal breakage and of marker loss observed along the old-age X chromosomes could be the result of molecular scars accumulated with aging at sites of constitutive chromosomal fragility.

  1. Hexavalent chromium induces chromosome instability in human urothelial cells.

    PubMed

    Wise, Sandra S; Holmes, Amie L; Liou, Louis; Adam, Rosalyn M; Wise, John Pierce

    2016-04-01

    Numerous metals are well-known human bladder carcinogens. Despite the significant occupational and public health concern of metals and bladder cancer, the carcinogenic mechanisms remain largely unknown. Chromium, in particular, is a metal of concern as incidences of bladder cancer have been found elevated in chromate workers, and there is an increasing concern for patients with metal hip implants. However, the impact of hexavalent chromium (Cr(VI)) on bladder cells has not been studied. We compared chromate toxicity in two bladder cell lines; primary human urothelial cells and hTERT-immortalized human urothelial cells. Cr(VI) induced a concentration- and time-dependent increase in chromosome damage in both cell lines, with the hTERT-immortalized cells exhibiting more chromosome damage than the primary cells. Chronic exposure to Cr(VI) also induced a concentration-dependent increase in aneuploid metaphases in both cell lines which was not observed after a 24h exposure. Aneuploidy induction was higher in the hTERT-immortalized cells. When we correct for uptake, Cr(VI) induces a similar amount of chromosome damage and aneuploidy suggesting that the differences in Cr(VI) sensitivity between the two cells lines were due to differences in uptake. The increase in chromosome instability after chronic chromate treatment suggests this may be a mechanism for chromate-induced bladder cancer, specifically, and may be a mechanism for metal-induced bladder cancer, in general. PMID:26908176

  2. Hexavalent chromium induces chromosome instability in human urothelial cells.

    PubMed

    Wise, Sandra S; Holmes, Amie L; Liou, Louis; Adam, Rosalyn M; Wise, John Pierce

    2016-04-01

    Numerous metals are well-known human bladder carcinogens. Despite the significant occupational and public health concern of metals and bladder cancer, the carcinogenic mechanisms remain largely unknown. Chromium, in particular, is a metal of concern as incidences of bladder cancer have been found elevated in chromate workers, and there is an increasing concern for patients with metal hip implants. However, the impact of hexavalent chromium (Cr(VI)) on bladder cells has not been studied. We compared chromate toxicity in two bladder cell lines; primary human urothelial cells and hTERT-immortalized human urothelial cells. Cr(VI) induced a concentration- and time-dependent increase in chromosome damage in both cell lines, with the hTERT-immortalized cells exhibiting more chromosome damage than the primary cells. Chronic exposure to Cr(VI) also induced a concentration-dependent increase in aneuploid metaphases in both cell lines which was not observed after a 24h exposure. Aneuploidy induction was higher in the hTERT-immortalized cells. When we correct for uptake, Cr(VI) induces a similar amount of chromosome damage and aneuploidy suggesting that the differences in Cr(VI) sensitivity between the two cells lines were due to differences in uptake. The increase in chromosome instability after chronic chromate treatment suggests this may be a mechanism for chromate-induced bladder cancer, specifically, and may be a mechanism for metal-induced bladder cancer, in general.

  3. Human chromosome-specific DNA libraries: construction and availability

    SciTech Connect

    Van Dilla, M.A.; Deaven, L.L.; Albright, K.L.; Allen, N.A.; Aubuchon, M.R.; Bartholdi, M.F.; Brown, N.C.; Campbell, E.W.; Carrano, A.V.; Clark, L.M.; Cram, L.S.

    1986-06-01

    The goal of the National Laboratory Gene Library Project at the Los Alamos and Lawrence Livermore National Laboratories is the production of chromosome-specific human gene libraries and their distribution to the scientific community for studies of the molecular biology of genes and chromosomes, and for the study and diagnosis of genetic disease. The specific aim of Phase I of the project is the production of complete digest (4 kb average insert size) libraries from each of the 24 human chromosomal types purified by flow sorting. The bacteriophage vector is Charon 21A, which has both Eco R1 and Hind III insertion sites accommodating human DNA fragments up to 9.1 kb in size. Each laboratory has undertaken production of a complete set of chromosome-specific libraries, Los Alamos with Eco R1 and Livermore with Hind III; most of this task has now been accomplished. Close to 1200 library aliquots have been sent to about 300 laboratories world-wide through February 1986, at which time repository and distribution functions were transferred to the American Type Culture Collection, Rockville, MD. Following Phase I, libraries will be constructed with large inserts in a more advanced, recently developed bacteriophage vector (about 20 kb inserts) or in a cosmid vector (about 40 kb inserts), and with characteristics better suited to basic studies of gene structure and function.

  4. Inferring human history in East Asia from Y chromosomes

    PubMed Central

    2013-01-01

    East Asia harbors substantial genetic, physical, cultural and linguistic diversity, but the detailed structures and interrelationships of those aspects remain enigmatic. This question has begun to be addressed by a rapid accumulation of molecular anthropological studies of the populations in and around East Asia, especially by Y chromosome studies. The current Y chromosome evidence suggests multiple early migrations of modern humans from Africa via Southeast Asia to East Asia. After the initial settlements, the northward migrations during the Paleolithic Age shaped the genetic structure in East Asia. Subsequently, recent admixtures between Central Asian immigrants and northern East Asians enlarged the genetic divergence between southern and northern East Asia populations. Cultural practices, such as languages, agriculture, military affairs and social prestige, also have impacts on the genetic patterns in East Asia. Furthermore, application of Y chromosome analyses in the family genealogy studies offers successful showcases of the utility of genetics in studying the ancient history. PMID:23731529

  5. The TP53 dependence of radiation-induced chromosome instability in human lymphoblastoid cells

    NASA Technical Reports Server (NTRS)

    Schwartz, Jeffrey L.; Jordan, Robert; Evans, Helen H.; Lenarczyk, Marek; Liber, Howard

    2003-01-01

    The dose and TP53 dependence for the induction of chromosome instability were examined in cells of three human lymphoblastoid cell lines derived from WIL2 cells: TK6, a TP53-normal cell line, NH32, a TP53-knockout created from TK6, and WTK1, a WIL2-derived cell line that spontaneously developed a TP53 mutation. Cells of each cell line were exposed to (137)Cs gamma rays, and then surviving clones were isolated and expanded in culture for approximately 35 generations before the frequency and characteristics of the instability were analyzed. The presence of dicentric chromosomes, formed by end-to-end fusions, served as a marker of chromosomal instability. Unexposed TK6 cells had low levels of chromosomal instability (0.002 +/- 0.001 dicentrics/cell). Exposure of TK6 cells to doses as low as 5 cGy gamma rays increased chromosome instability levels nearly 10-fold to 0.019 +/- 0.008 dicentrics/cell. There was no further increase in instability levels beyond 5 cGy. In contrast to TK6 cells, unexposed cultures of WTK1 and NH32 cells had much higher levels of chromosome instability of 0.034 +/- 0.007 and 0.041 +/- 0.009, respectively, but showed little if any effect of radiation on levels of chromosome instability. The results suggest that radiation exposure alters the normal TP53-dependent cell cycle checkpoint controls that recognize alterations in telomere structure and activate apoptosis.

  6. Paternal uniparental isodisomy for human chromosome 20 and absence of external ears

    SciTech Connect

    Spinner, N.B.; Rand, E.; McDonald-McGinn, D.M.

    1994-09-01

    Uniparental disomy can cause disease if the involved chromosomal region contains imprinted genes. Uniparental disomy for portions of human chromosomes 6, 7, 9, 11, 14 and 15 have been associated with abnormal phenotypes. We studied a patient with multiple abnormalities including an absent left ear with a small right ear remnant, microcephaly, congenital heart disease and Hirschprung`s disease. Cytogenetics revealed a 45,XY,-20,-20,+ter rea(20;20)(p13;p13) in 10/10 cells from bone marrow and 20/20 cells from peripheral blood. Analysis of a skin culture revealed a second cell line with trisomy 20 resulting from an apparently normal chromosome 20 in addition to the terminally rearranged chromosome, in 8/100 cells studied. The unusual phenotype of our patient was not consistent with previously reported cases of deletions of 20p or mosaic trisomy 20. We hypothesized that the patient`s phenotype could either result from deletion of both copies of a gene near the p arm terminus of chromosome 20 or from uniparental disomy of chromosome 20. There were no alterations or rearrangements of PTP-alpha (which maps to distal 20p) by Southern or Northern blot analysis. A chromosome 20 sub-telomeric probe was found to be present on the rearranged 20 by FISH suggesting that subtelomeric sequences have not been lost as a consequece of this rearrangement. To determine the parental origin of the 2 chromosome 20`s in the terminal rearrangement, we studied the genotypes of the proband and his parents in lymphoblastoid cell lines at 8 polymorphic loci. Genotypes at D20S115, D20S186, and D20S119 indicated that there was paternal isodisomy. Other loci were uninformative. This is the first example of uniparental disomy for chromosome 20. Further studies are warranted to correlate phenotype with uniparental inheritance of this chromosome.

  7. The gene for human U2 snRNP auxiliary factor small 35-kDa subunit (U2AF1) maps to the progressive myoclonus epilepsy (EPM1) critical region on chromosome 21q22.3

    SciTech Connect

    Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.

    1996-04-15

    We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of different factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.

  8. Chromosomal Instability in the progeny of human irradiated cells

    NASA Astrophysics Data System (ADS)

    Testard, I.; Boissière, A.; Martins, L. M.; Sabatier, L.

    Manned space missions recently increased in number and duration, thus it became important to estimate the biological risks encountered by astronauts. They are exposed to cosmic and galactic rays, a complex mixture of different radiations. In addition to the measurements realized by physical dosimeters, it becomes essential to estimate real biologically effective doses and compare them to physical doses. Biological dosimetry of radiation exposures has been widely performed using cytogenetic analysis of chromosomes. This approach has been used for many years in order to estimate absorbed doses in accidental or chronic overexposures of humans. Recent studies show that some alterations can appear many cell generations after the initial radiation exposure as a delayed genomic instability. This delayed instability is characterized by the accumulation of cell alterations leading to cell transformation, delayed cell death and mutations. Chromosome instability was shown in vitro in different model systems (Sabatier et al., 1992; Marder and Morgan, 1993; Kadhim et al., 1994 and Holmberg et al., 1993, 1995). All types of radiation used induce chromosome instability; however, heavy ions cause the most damage. The period of chromosome instability followed by the formation of clones with unbalanced karyotypes seems to be shared by cancer cells. The shortening of telomere sequences leading to the formation of telomere fusions is an important factor in the appearance of this chromosome instability.

  9. The DNA sequence and biology of human chromosome 19

    SciTech Connect

    Grimwood, J; Gordon, L A; Olsen, A; Terry, A; Schmutz, J; Lamerdin, J; Hellsten, U; Goodstein, D; Couronne, O; Tran-Gyamfi, M

    2004-04-06

    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high GC content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9% of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in Mendelian disorders, including familial hypercholesterolemia and insulin-resistant diabetes. Nearly one quarter of these genes belong to tandemly arranged families, encompassing more than 25% of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, and segments of coding and non-coding conservation with the distant fish species Takifugu.

  10. The DNA sequence and biology of human chromosome 19

    SciTech Connect

    Grimwood, Jane; Gordon, Laurie A.; Olsen, Anne; Terry, Astrid; Schmutz, Jeremy; Lamerdin, Jane; Hellsten, Uffe; Goodstein, David; Couronne, Olivier; Tran-Gyamfi, Mary; Aerts, Andrea; Altherr, Michael; Ashworth, Linda; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caenepeel, Sean; Carrano, Anthony; Caoile, Chenier; Chan, Yee Man; Christensen, Mari; Cleland, Catherine A.; Copeland, Alex; Dalin, Eileen; Dehal, Paramvir; Denys, Mirian; Detter, John C.; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Garcia, Carmen; Georgescu, Anca M.; Glavina, Tijana; Gomez, Maria; Gonzales, Eldelyn; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Ho, Issac; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Larionov, Vladimer; Leem, Sun-Hee; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Malfatti, Stephanie; Martinez, Diego; McCready, Paula; Medina, Catherine; Morgan, Jenna; Nelson, Kathryn; Nolan, Matt; Ovcharenko, Ivan; Pitluck, Sam; Pollard, Martin; Popkie, Anthony P.; Predki, Paul; Quan, Glenda; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanine; Salamov, Asaf; Salazar, Angelica; She, Xinwei; Smith, Doug; Slezak, Tom; Solovyev, Victor; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wagner, Mark; Wheeler, Jeremy; Wu, Kevin; Xie, Gary; Yang, Joan; Dubchak, Inna; Furey, Terrence S.; DeJong, Pieter; Dickson, Mark; Gordon, David; Eichler, Evan E.; Pennacchio, Len A.; Richardson, Paul; Stubbs, Lisa; Rokhsar, Daniel S.; Myers, Richard M.; Rubin, Edward M.; Lucas, Susan M.

    2003-09-15

    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high G1C content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9 percent of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in mendelian disorders, including familial hypercholesterolaemia and insulin-resistant diabetes. Nearly one-quarter of these genes belong to tandemly arranged families, encompassing more than 25 percent of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, a nd segments of coding and non-coding conservation with the distant fish species Takifugu.

  11. The mapping of novel genes to human chromosome 19

    SciTech Connect

    Buenaventura, J.M.

    1994-12-01

    The principle goal of our laboratory is the discovery of new genes on human chromosome 19. One of the strategies to achieve this goal is through the use of cDNA clones known as {open_quotes}expressed sequence tags{close_quotes} (ESTs). ESTs, short segments of sequence from a cDNA clone that correspond to the mRNA, occur as unique regions in the genome and, therefore, can be used as markers for specific positions. In collaboration with researchers from Genethon in France, fifteen cDNA clones from a normalized human infant brain cDNA library were tested and determined to map to chromosome 19. A verification procedure is then followed to confirm assignment to chromosome 19. First, primers for each cDNA clone are developed and then amplified by polymerase chain reaction from genomic DNA. Next, a {sup 32}P-radiolabeled probe is made by polymerase chain reaction for each clone and then hybridized against filters containing an LLNL chromosome 19-specific cosmid library to find putative locations on the chromosome. The location is then verified by running a polymerase chain reactions from the positive cosmids. With the Browser database at LLNL, additional information about the positive cosmids can be found. Through use of the BLAST database at the National Library of Medicine, homologous sequences to the clones can be found. Among the fifteen cDNA clones received from Genethon, all have been amplified by polymerase chain reaction. Three have turned out as repetitive elements in the genome. Ten have been mapped to specific locations on chromosome 19. Putative locations have been found for the remaining two clones and thus verification testing will proceed.

  12. Assignment of the {beta}B1 crystallin gene (CRYBB1) to human chromosome 22 and mouse chromosome 5

    SciTech Connect

    Hulsebos, T.J.M.; Westerveld, A.; Gilbert, D.J.; Jenkins, N.A.; Copeland, N.G.

    1995-10-10

    By using primers complementary to the rat {beta}B1 crystallin gene sequence, we amplified exons 5 and 6 of the orthologous human gene (CRYBB1). The amplified human segments displayed greater than 88% sequence homology to the corresponding rat and bovine sequences. CRYBB1 was assigned to the group 5 region in 22q11.2-q12.1 by hybridizing the exon 6 PCR product to somatic cell hybrids containing defined portions of human chromosome 22. The exon 5 and exon 6 PCR products of CRYBB1 were used to localize, by interspecific backcross mapping, the mouse gene (Crybb1) to the central portion of chromosome 5. Three other {beta} crystallin genes ({beta}B2(-l), {beta}B3, and {beta}A4) have previously been mapped to the same regions in human and mouse. We demonstrate that the {beta}B1 and {beta}A4 crystallin genes are very closely linked in the two species. These assignments complete the mapping and identification of the human and mouse homologues of the major {beta} crystallins genes that are expressed in the bovine lens. 39 refs., 5 figs., 1 tab.

  13. M-BAND Study of Radiation-Induced Chromosome Aberrations in Human Epithelial Cells: Radiation Quality and Dose Rate Effects

    NASA Technical Reports Server (NTRS)

    Hada, Megumi; Cucinotta, Francis; Wu, Honglu

    2009-01-01

    The advantage of the multicolor banding in situ hybridization (mBAND) technique is its ability to identify both inter- (translocation to unpainted chromosomes) and intra- (inversions and deletions within a single painted chromosome) chromosome aberrations simultaneously. To study the detailed rearrangement of low- and high-LET radiation induced chromosome aberrations in human epithelial cells (CH184B5F5/M10) in vitro, we performed a series of experiments with Cs-137 gamma rays of both low and high dose rates, neutrons of low dose rate and 600 MeV/u Fe ions of high dose rate, with chromosome 3 painted with multi-binding colors. We also compared the chromosome aberrations in both 2- and 3-dimensional cell cultures. Results of these experiments revealed the highest chromosome aberration frequencies after low dose rate neutron exposures. However, detailed analysis of the radiation induced inversions revealed that all three radiation types induced a low incidence of simple inversions. Most of the inversions in gamma-ray irradiated samples were accompanied by other types of intra-chromosomal aberrations but few inversions were accompanied by inter-chromosomal aberrations. In contrast, neutrons and Fe ions induced a significant fraction of inversions that involved complex rearrangements of both inter- and intrachromosomal exchanges. The location of the breaks involved in chromosome exchanges was analyzed along the painted chromosome. The breakpoint distribution was found to be randomly localized on chromosome 3 after neutron or Fe ion exposure, whereas non-random distribution with clustering breakpoints was observed after -ray exposure. Our comparison of chromosome aberration yields between 2- and 3-dimensional cell cultures indicated a significant difference for gamma exposures, but not for Fe ion exposures. These experimental results indicated that the track structure of the radiation and the cellular/chromosome structure can both affect radiation-induced chromosome

  14. Induction of chromosome aberrations and mitotic arrest by cytomegalovirus in human cells

    SciTech Connect

    AbuBakar, S.; Au, W.W.; Legator, M.S.; Albrecht, T.

    1988-01-01

    Human cytomegalovirus (CMV) is potentially an effective but often overlooked genotoxic agent in humans. We report here evidence that indicates that infection by CMV can induce chromosome alterations and mitotic inhibition. The frequency of chromosome aberrations induced was dependent on the input multiplicity of infection (m.o.i.) for human lung fibroblasts (LU), but not for human peripheral blood lymphocytes (PBLs) when both cell types were infected at the GO phase of the cell cycle. The aberrations induced by CMV were mostly chromatid breaks and chromosome pulverizations that resembled prematurely condensed S-phase chromatin. Pulverized chromosomes were not observed in LU cells infected with virus stocks that had been rendered nonlytic by UV-irradiation at 24,000 ergs/mm2 or from infection of human lymphocytes. In LU cells infected with UV-irradiated CMV, the frequency of aberrations induced was inversely dependent on the extent of the exposure of the CMV stock to the UV-light. In permissive CMV infection of proliferating LU cells at 24 hr after subculture, a high percentage (greater than 40%) of the metaphase cells were arrested at their first metaphase and displayed severely condensed chromosomes when harvested 48 hr later. A significant increase (p less than 0.05) in the chromosome aberration frequency was also observed. Our study shows that CMV infection is genotoxic to host cells. The types and extent of damage are dependent on the viral genome expression and on the cell cycle stage of the cells at the time of infection. The possible mechanisms for induction of chromosome damage by CMV are discussed.

  15. Influence of GSTM1, GSTT1, GSTP1, NAT1, NAT2, EPHX1, MTR and MTHFR polymorphism on chromosomal aberration frequencies in human lymphocytes.

    PubMed

    Skjelbred, Camilla Furu; Svendsen, Marit; Haugan, Vera; Eek, Anette Kildal; Clausen, Kjell Oskar; Kure, Elin H; Tuimala, Jarno T; Svendsen, Martin Veel; Norppa, Hannu; Hansteen, Inger-Lise

    2011-03-01

    We have studied the influence of genetic polymorphisms in the xenobiotic-metabolizing genes GSTM1, GSTP1, GSTT1, EPHX1, NAT1 and NAT2 and the folate-metabolizing genes MTR and MTHFR on the frequencies of cells with chromosomal aberrations (CAs) in peripheral lymphocytes of Norwegian men. Log-linear Poisson regression models were applied on 357 subjects of whom data on all the polymorphisms examined were available. Total CAs and chromosome-type aberrations (CSAs) were significantly increased by higher age alone, whereas chromatid-type aberrations (CTAs) were elevated by the GSTT1-null genotype and MTHFR codon 222 variant allele and chromatid gaps (CTGs) by EPHX1 high activity genotype and occupational exposure. Stratification by smoking and age (<40 and ≥40 years) showed that the effect of the GSTT1 null and EPHX1 high activity genotypes only concerned (older) smokers, in agreement with the roles of the respective enzymes in detoxification and metabolic activation. The MTHFR codon 222 variant allele was associated with high CTGs in smokers, the MTR codon 919 variant allele with high CTAs in older smokers and the NAT2 fast acetylator genotype with high CTGs in older subjects. Among younger nonsmokers, however, carriers of the MTHFR codon 222 and MTR codon 919 variant alleles showed a decrease in the level of CTGs and total CAs, respectively. In conclusion, polymorphisms of GSTT1, EPHX1, MTHFR, MTR and NAT2 differentially affect the frequency of CTAs, CSAs and CTGs, showing interaction with smoking and age. It appears that CA subtypes rather than total CAs should be considered in this type of studies.

  16. Human chromosome 3 mediates growth arrest and suppression of apoptosis in microcell hybrids.

    PubMed Central

    Speevak, M D; Chevrette, M

    1996-01-01

    Chemotherapeutic treatment of tumor cells leads either to tumor cell death (usually by apoptosis) or to the formation of drug-resistant subpopulations. Known mechanisms of cancer cell drug resistance include gene amplification and increased expression of drug transporters. On the other hand, normal cells survive many forms of chemotherapy with minimal damage probably because of their capacity for growth arrest and stringent control of apoptosis. Microcell hybrids between B78 (murine melanoma) and HSF5 (normal human fibroblasts) were analyzed to identify a new human chromosomal region involved in the promotion of drug-induced growth arrest and suppression of apoptosis. In these hybrids, the presence of human chromosome 3 was strongly associated with suppression of apoptosis via G1 and G2 growth arrest during exposure to the antimetabolite N-phosphonoacetyl-L-aspartate (PALA), suggesting that a gene(s) on chromosome 3 serves an antiproliferative role in a drug-responsive growth arrest pathway. PMID:8628288

  17. Paternal-age effects on sperm aneuploidy investigated in mice and humans by three-chromosome fluorescence in situ hybridization

    SciTech Connect

    Wyrobek, A.J.; Lowe, X.; Holland, N.T.

    1994-09-01

    We conducted a cross-species comparison of the effects of paternal age on sperm aneuploidy in mice and humans. A new murine assay was developed to detect sperm hyperhaploidy and polyploidy for chromosomes X, Y, and 8 using fluorescence in situ hybridization with chromosome-specific DNA probes, to serve as a direct corollate to the three-chromosome method developed early for human sperm. Sperm aneuploidy was evaluated in eight male B6C3F1 male mice (aged 22.5-30.5 mo) and compared to young controls (2.4 mo). The aged group showed significant ({approximately}2.0-fold) increases in hyperhaploidies involving chromosomes X, Y and 8, with the greatest effects seen in the oldest animals. Sperm aneuploidy was also evaluated in two groups of healthy men who differed in mean age [46.8{plus_minus}3.1 (n=4) vs. 28.5{plus_minus}5.0 (n=10) yrs], using the three-chromosome method. The older group showed a statistically significant increase in hyperhaploid sperm for both sex chromosomes. Additional controlled human studies are planned. Taken together, the murine and human data are consistent with a positive effect of paternal age on sperm aneuploidy. In both species, the strongest age effect was observed for hyperhaploidies of chromosome Y. Future studies are needed to investigate the shape of the age-effect curve and to evaluate chromosomal differences, especially for humans in their late reproductive years.

  18. Molecular Dissection of the Basal Clades in the Human Y Chromosome Phylogenetic Tree

    PubMed Central

    Scozzari, Rosaria; Massaia, Andrea; D’Atanasio, Eugenia; Myres, Natalie M.; Perego, Ugo A.; Trombetta, Beniamino; Cruciani, Fulvio

    2012-01-01

    One hundred and forty-six previously detected mutations were more precisely positioned in the human Y chromosome phylogeny by the analysis of 51 representative Y chromosome haplogroups and the use of 59 mutations from literature. Twenty-two new mutations were also described and incorporated in the revised phylogeny. This analysis made it possible to identify new haplogroups and to resolve a deep trifurcation within haplogroup B2. Our data provide a highly resolved branching in the African-specific portion of the Y tree and support the hypothesis of an origin in the north-western quadrant of the African continent for the human MSY diversity. PMID:23145109

  19. Molecular dissection of the basal clades in the human Y chromosome phylogenetic tree.

    PubMed

    Scozzari, Rosaria; Massaia, Andrea; D'Atanasio, Eugenia; Myres, Natalie M; Perego, Ugo A; Trombetta, Beniamino; Cruciani, Fulvio

    2012-01-01

    One hundred and forty-six previously detected mutations were more precisely positioned in the human Y chromosome phylogeny by the analysis of 51 representative Y chromosome haplogroups and the use of 59 mutations from literature. Twenty-two new mutations were also described and incorporated in the revised phylogeny. This analysis made it possible to identify new haplogroups and to resolve a deep trifurcation within haplogroup B2. Our data provide a highly resolved branching in the African-specific portion of the Y tree and support the hypothesis of an origin in the north-western quadrant of the African continent for the human MSY diversity.

  20. Variations in the association of papillomavirus E2 proteins with mitotic chromosomes

    PubMed Central

    Oliveira, Jaquelline G.; Colf, Leremy A.; McBride, Alison A.

    2006-01-01

    The E2 protein segregates episomal bovine papillomavirus (BPV) genomes to daughter cells by tethering them to mitotic chromosomes, thus ensuring equal distribution and retention of viral DNA. To date, only the BPV1 E2 protein has been shown to bind to mitotic chromosomes. We assessed the localization of 13 different animal and human E2 proteins from seven papillomavirus genera, and we show that most of them are stably bound to chromosomes throughout mitosis. Furthermore, in contrast to the random association of BPV1 E2 with mitotic chromosomes, several of these proteins appear to bind to more specific regions of mitotic chromosomes. Using human papillomavirus (HPV) type 8 E2, we show that this region is adjacent to centromeres/kinetochores. Therefore, E2 proteins from both HPV and animal papillomavirus bind to mitotic chromosomes, and there are variations in the specificity of this binding. Only the α-papillomavirus E2 proteins do not stably associate with mitotic chromatin throughout mitosis. These proteins closely associate with prophase chromosomes and bind to chromosomes in telophase but not in metaphase. However, extraction of mitotic cells before fixation results in α-E2 proteins binding to the pericentromeric region of metaphase chromosomes, as observed for HPV8 E2. We postulate that this is the authentic target of these E2 proteins but that additional factors or a specialized cellular environment is required to stabilize this association. Thus, E2-mediated tethering of viral genomes to mitotic chromosomes is a common strategy of papillomaviruses, but different viruses have evolved different variations of this theme. PMID:16415162

  1. The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) (CHC1) is localized to human chromosome 1p36.1

    SciTech Connect

    Nishimoto, T.; Seino, H.; Seki, N. |; Hori, T.A.

    1994-10-01

    The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) encodes a chromosomal protein of 45 kDa that has seven internal homologous repeats and functions as a guanine nucleotide releasing factor on the nuclear Ras-like small G protein. We report here the precise localization of the RCC1 gene to human chromosome 1p36.1. There is a conserved region of homology between the 1p36 region of human and a distal region of mouse chromosome 4. Thus, the assignment of the human gene encoding RCC1 adds another marker to the conserved region of homology between human chromosome 1p and mouse chromosome 4. 17 refs., 1 fig.

  2. Chromosome Connections: Compelling Clues to Common Ancestry

    ERIC Educational Resources Information Center

    Flammer, Larry

    2013-01-01

    Students compare banding patterns on hominid chromosomes and see striking evidence of their common ancestry. To test this, human chromosome no. 2 is matched with two shorter chimpanzee chromosomes, leading to the hypothesis that human chromosome 2 resulted from the fusion of the two shorter chromosomes. Students test that hypothesis by looking for…

  3. Chromosome painting between human and lorisiform prosimians: evidence for the HSA 7/16 synteny in the primate ancestral karyotype.

    PubMed

    Nie, Wenhui; O'Brien, Patricia C M; Fu, Beiyuan; Wang, Jinhuan; Su, Weiting; Ferguson-Smith, Malcolm A; Robinson, Terence J; Yang, Fengtang

    2006-02-01

    Multidirectional chromosome painting with probes derived from flow-sorted chromosomes of humans (Homo sapiens, HSA, 2n = 46) and galagos (Galago moholi, GMO, 2n = 38) allowed us to map evolutionarily conserved chromosomal segments among humans, galagos, and slow lorises (Nycticebus coucang, NCO, 2n = 50). In total, the 22 human autosomal painting probes detected 40 homologous chromosomal segments in the slow loris genome. The genome of the slow loris contains 16 sytenic associations of human homologues. The ancient syntenic associations of human chromosomes such as HSA 3/21, 7/16, 12/22 (twice), and 14/15, reported in most mammalian species, were also present in the slow loris genome. Six associations (HSA 1a/19a, 2a/12a, 6a/14b, 7a/12c, 9/15b, and 10a/19b) were shared by the slow loris and galago. Five associations (HSA 1b/6b, 4a/5a, 11b/15a, 12b/19b, and 15b/16b) were unique to the slow loris. In contrast, 30 homologous chromosome segments were identified in the slow loris genome when using galago chromosome painting probes. The data showed that the karyotypic differences between these two species were mainly due to Robertsonian translocations. Reverse painting, using galago painting probes onto human chromosomes, confirmed most of the chromosome homologies between humans and galagos established previously, and documented the HSA 7/16 association in galagos, which was not reported previously. The presence of the HSA 7/16 association in the slow loris and galago suggests that the 7/16 association is an ancestral synteny for primates. Based on our results and the published homology maps between humans and other primate species, we propose an ancestral karyotype (2n = 60) for lorisiform primates.

  4. A Comprehensive Survey of Human Y-Chromosomal Microsatellites

    PubMed Central

    Kayser, Manfred ; Kittler, Ralf ; Erler, Axel ; Hedman, Minttu ; Lee, Andrew C. ; Mohyuddin, Aisha ; Mehdi, S. Qasim ; Rosser, Zoë ; Stoneking, Mark ; Jobling, Mark A. ; Sajantila, Antti ; Tyler-Smith, Chris 

    2004-01-01

    We have screened the nearly complete DNA sequence of the human Y chromosome for microsatellites (short tandem repeats) that meet the criteria of having a repeat-unit size of ⩾3 and a repeat count of ⩾8 and thus are likely to be easy to genotype accurately and to be polymorphic. Candidate loci were tested in silico for novelty and for probable Y specificity, and then they were tested experimentally to identify Y-specific loci and to assess their polymorphism. This yielded 166 useful new Y-chromosomal microsatellites, 139 of which were polymorphic, in a sample of eight diverse Y chromosomes representing eight Y-SNP haplogroups. This large sample of microsatellites, together with 28 previously known markers analyzed here—all sharing a common evolutionary history—allowed us to investigate the factors influencing their variation. For simple microsatellites, the average repeat count accounted for the highest proportion of repeat variance (∼34%). For complex microsatellites, the largest proportion of the variance (again, ∼34%) was explained by the average repeat count of the longest homogeneous array, which normally is variable. In these complex microsatellites, the additional repeats outside the longest homogeneous array significantly increased the variance, but this was lower than the variance of a simple microsatellite with the same total repeat count. As a result of this work, a large number of new, highly polymorphic Y-chromosomal microsatellites are now available for population-genetic, evolutionary, genealogical, and forensic investigations. PMID:15195656

  5. A verified minimal YAC contig for human chromosome 21

    SciTech Connect

    Graw, S.L.; Patterson, D.; Drabkin, H.

    1994-09-01

    The goal of this project is the construction of a verified YAC contig of the complete long arm of human chromosome 21 utilizing YACs from the CEPH and St. Louis libraries. The YACs in this contig have been analyzed for size by PFGE, tested for chimerism by FISH or end-cloning, and verified for STS content by PCR. This last analysis has revealed a number of cases of conflict with the published STS order. To establish correct order, we have utilized STS content analysis of somatic cell hybrids containing portions of chromosome 21. Additional problems being addressed include completeness of coverage and possible deletions or gaps. Questions of completeness of the CEPH 810 YAC set arose after screening with 57 independently derived probes failed to identify clones for 11 (19%). Ten of the 11, however, do detect chromosome 21 cosmids when used to screen Lawrence Livermore library LL21NC02`G,` a cosmid library constructed from flow-sorted chromosomes 21. Remaining gaps in the contig are being closed by several methods. These include YAC fingerprinting and conversion of YACs to cosmids. In addition, we are establishing the overlap between the physical NotI map and the YAC contig by testing YACs for NotI sites and screening the YACs in the contig for the presence of NotI-linking clones.

  6. Isolation, characterization, and regional mapping of microclones from a human chromosome 21 microdissection library

    SciTech Connect

    Yu, J.; Hartz, J.; Yisheng Xu; Gemmill, R.M.; Patterson, D.; Kao, Faten ); Gemmill, R.M.; Patterson, D.; Kao, Fa-Ten ); Korenberg, J.R. )

    1992-08-01

    Thirty-four unique-sequence microclones were isolated from a previously described microdissection library of human chromosome 21 and were regionally mapped using a cell hybrid mapping panel which consists of six cell hybrids and divides chromosome 21 into eight regions. The mapping results showed that the microclones were unevenly distributed along chromosome 21, with the majority of microclones located in the distal half portion of the long arm, between 21q21.3 and 21qter. The number of unique-sequence clones began to decrease significantly from 21q21.2 to centromere and extending to the short arm. This finding is consistent with those reported in other chromosome 21 libraries. Thus, it may be inferred that the proximal portion of the long arm of chromosome 21 contains higher proportions of repetitive sequences, rather than unique sequences of genes. The microclones were also characterized for insert size and were used to identify the corresponding genomic fragments generated by HindIII. In addition, the authors demonstrated that the microclones with short inserts can be efficiently used to identify YAC (yeast artificial chromosome) clones with large inserts, for increased genomic coverage for high-resolution physical mapping. They also used 200 unique-sequence microclones to screen a human liver cDNA library and identified two cDNA clones which were regionally assigned to the 21q21.3-q22.1 region. Thus, generation of unique-sequence microclones from chromosome 21 appears to be useful to isolate and regionally map many cDNA clones, among which will be candidate genes for important diseases on chromosome 21, including Down syndrome, Alzheimer disease, amyotrophic lateral sclerosis, and one form of epilepsy.

  7. Structure and chromosomal localization of a human water channel (AQP3) gene

    SciTech Connect

    Ishibashi, Kenichi; Sasaki, Sei; Saito, Fumiko

    1995-05-20

    A cDNA encoding rat AQP3, a water channel and a member of the MIP family, that is expressed predominantly in kidney medulla and colon was cloned recently. To determine the structure, tissue distribution, and chromosomal localization of the human AQP3 gene, the authors screened a human kidney cDNA library with rat AQP3 probe and isolated a cDNA coding for human AQP3 protein. The deduced amino acid sequence of human AQP3 was 91% identical to rat AQP3. Human AQP3 mRNA was expressed in colon, kidney, liver, pancreas, lung, peripheral leukocytes, spleen, and prostate. The human AQP3 gene was mapped to 7q36.2-q36.3 by chromosome fluorescence in situ hybridization. 10 refs., 3 figs.

  8. Preparation and characterization of ordered libraries of transcribable sequences from human chromosome 19 from hybrid human-hamster cells

    SciTech Connect

    Obradovick, D.; Borodin, A.M.; Kopantsev, E.P.

    1994-08-20

    Improvements in the preparation of chromosome-specific libraries of transcribable sequences from the human genome using somatic hybrid cells are described. One of the main advantages of the new method is the enrichment of the starting material with human-specific heterogeneous nuclear RNA (hnRNA) sequences at each of the three steps in library construction. The method was used to prepare a chromosome-specific library from a hybrid cell line. The resulting ranged library was characterized. The primary structures of 80 randomly selected clones were determined, and these were analyzed. Some 95% of the clones were found to be human-specific and to have arisen from hnRNA, and the chromosomal localizations of a number of clones were identified. The advantages and disadvantages of the method are discussed. 34 refs., 3 figs., 2 tabs.

  9. Correlation of physical and genetic maps of human chromosome 16

    SciTech Connect

    Sutherland, G.R.

    1990-01-01

    This project is now progressing strongly. Thirteen somatic cell hybrids containing rearranged {number sign}16 chromosomes have been constructed, bringing the total number of hybrids constructed by the group to 27 which divides chromosome 16 into 29 regions. 170 probes have been mapped into these regions. Although this is the second progress report for this contract it essentially contains all the work carried out since the first progress report covered a period of less than three months during which little had been done other than setting up. The project has been progressing very well and has led to numerous collaborations with other groups involved in mapping this chromosome or studying genes on it. 7 refs., 1 fig., 2 tabs.

  10. Cloning and chromosomal localization of the human and murine genes for the T-cell transcription factors NFATc and NFATp.

    PubMed

    Li, X; Ho, S N; Luna, J; Giacalone, J; Thomas, D J; Timmerman, L A; Crabtree, G R; Francke, U

    1995-01-01

    The nuclear factor of activated T cells (NFAT) is a transcription factor complex involved in the activation of cytokines and cell surface molecules associated with coordinating the actions of different cells required for an immune response. Two different genes have recently been cloned that encode proteins capable of functioning as the pre-existing (p) and cytosolic (c) component of the NFAT transcription complex, NFATc of human and NFATp of murine origin (Northrop et al., 1994; McCaffrey et al., 1993b). We report here the partial cDNA cloning of the murine homolog of NFATc and the human homolog of NFATp, and the chromosomal localization of both genes in both species to conserved syntenic regions. Through the use of mapping panels of human x Chinese hamster and mouse x rodent cells hybrids, the NFATc genes were mapped to human and mouse chromosomes 18. By analyzing a chromosome 18 radiation hybrid panel, the human NFATc gene was localized to the q terminus, closely linked to STS marker D18S497. The murine Nfatc gene was sublocalized to chromosome band 18E4 by FISH. The NFATp genes were mapped by somatic cell hybrid analysis to human chromosome 20 and mouse chromosome 2. Human NFATp was assigned to chromosome region 20q13.2-->q13.3 by FISH. Based on the conserved syntenic region on human chromosome 20 and mouse chromosome 2, murine Nfatp is predicted to reside in the vicinity of a mutant locus wasted. Homozygous wst/wst mice display a phenotype reminiscent of severe combined immune deficiency or ataxia telangiectasia, disorders that could therefore be considered candidates for NFATp mutations.

  11. Chromosome landmarks and autosome-sex chromosome translocations in Rumex hastatulus, a plant with XX/XY1Y2 sex chromosome system.

    PubMed

    Grabowska-Joachimiak, Aleksandra; Kula, Adam; Książczyk, Tomasz; Chojnicka, Joanna; Sliwinska, Elwira; Joachimiak, Andrzej J

    2015-06-01

    Rumex hastatulus is the North American endemic dioecious plant with heteromorphic sex chromosomes. It is differentiated into two chromosomal races: Texas (T) race characterised by a simple XX/XY sex chromosome system and North Carolina (NC) race with a polymorphic XX/XY1Y2 sex chromosome system. The gross karyotype morphology in NC race resembles the derived type, but chromosomal changes that occurred during its evolution are poorly understood. Our C-banding/DAPI and fluorescence in situ hybridization (FISH) experiments demonstrated that Y chromosomes of both races are enriched in DAPI-positive sequences and that the emergence of polymorphic sex chromosome system was accompanied by the break of ancestral Y chromosome and switch in the localization of 5S rDNA, from autosomes to sex chromosomes (X and Y2). Two contrasting domains were detected within North Carolina Y chromosomes: the older, highly heterochromatinised, inherited from the original Y chromosome and the younger, euchromatic, representing translocated autosomal material. The flow-cytometric DNA estimation showed ∼3.5 % genome downsizing in the North Carolina race. Our results are in contradiction to earlier reports on the lack of heterochromatin within Y chromosomes of this species and enable unambiguous identification of autosomes involved in the autosome-heterosome translocation, providing useful chromosome landmarks for further studies on the karyotype and sex chromosome differentiation in this species.

  12. A FISH approach for mapping the human genome using Bacterial Artificial Chromosomes (BACs)

    SciTech Connect

    Hubert, R.S.; Chen, X.N.; Mitchell, S.

    1994-09-01

    As the Human Genome Project progresses, large insert cloning vectors such as BACs, P1, and P1 Artificial Chromosomes (PACs) will be required to complement the YAC mapping efforts. The value of the BAC vector for physical mapping lies in the stability of the inserts, the lack of chimerism, the length of inserts (up to 300 kb), the ability to obtain large amounts of pure clone DNA and the ease of BAC manipulation. These features helped us design two approaches for generating physical mapping reagents for human genetic studies. The first approach is a whole genome strategy in which randomly selected BACs are mapped, using FISH, to specific chromosomal bands. To date, 700 BACs have been mapped to single chromosome bands at a resolution of 2-5 Mb in addition to BACs mapped to 14 different centromeres. These BACs represent more than 90 Mb of the genome and include >70% of all human chromosome bands at the 350-band level. These data revealed that >97% of the BACs were non-chimeric and have a genomic distribution covering most gaps in the existing YAC map with excellent coverage of gene-rich regions. In the second approach, we used YACs to identify BACs on chromosome 21. A 1.5 Mb contig between D21S339 and D21S220 nears completion within the Down syndrome congenital heart disease (DS-CHD) region. Seventeen BACs ranging in size from 80 kb to 240 kb were ordered using 14 STSs with FISH confirmation. We have also used 40 YACs spanning 21q to identify, on average, >1 BAC/Mb to provide molecular cytogenetic reagents and anchor points for further mapping. The contig generated on chromosome 21 will be helpful in isolating the genes for DS-CHD. The physical mapping reagents generated using the whole genome approach will provide cytogenetic markers and mapped genomic fragments that will facilitate positional cloning efforts and the identification of genes within most chromosomal bands.

  13. Chromosome surveys of human populations: between epidemiology and anthropology.

    PubMed

    de Chadarevian, Soraya

    2014-09-01

    It is commonly held that after 1945 human genetics turned medical and focussed on the individual rather than on the study of human populations that had become discredited. However, a closer look at the research practices at the time quickly reveals that human population studies, using old and new tools, prospered in this period. The essay focuses on the rise of chromosome analysis as a new tool for the study of human populations. It reviews a broad array of population studies ranging from newborn screening programmes to studies of isolated or 'primitive' people. Throughout, it highlights the continuing role of concerns and opportunities raised by the propagation of atomic energy for civilian and military uses, the collection of large data bases and computers, and the role of international organisations like the World Health Organisation and the International Biological Programme in shaping research agendas and carving out a space for human heredity in the postwar era.

  14. Mechanisms of chromosomal rearrangement in the human genome

    PubMed Central

    2010-01-01

    Many human cancers are associated with characteristic chromosomal rearrangements, especially hematopoietic cancers such as leukemias and lymphomas. The first and most critical step in the rearrangement process is the induction of two DNA double-strand breaks (DSB). In all cases, at least one of the two DSBs is generated by a pathologic process, such as (1) randomly-positioned breaks due to ionizing radiation, free radical oxidative damage, or spontaneous hydrolysis; (2) breaks associated with topoisomerase inhibitor treatment; or (3) breaks at direct or inverted repeat sequences, mediated by unidentified strand breakage mechanisms. In lymphoid cells, one of the two requisite DSBs is often physiologic, the result of V(D)J recombination or class switch recombination (CSR) at the lymphoid antigen receptor loci. The RAG complex, which causes the DSBs in V(D)J recombination, can cause (4) sequence-specific, pathologic DSBs at sites that fit the consensus of their normal V(D)J recombination signal targets; or (5) structure-specific, pathologic DSBs at regions of single- to double-strand transition. CSR occurs specifically in the B-cell lineage, and requires (6) activation-induced cytidine deaminase (AID) action at sites of single-stranded DNA, which may occur pathologically outside of the normal target loci of class switch recombination regions and somatic hypermutation (SHM) zones. Recent work proposes a seventh mechanism: the sequential action of AID and the RAG complex at CpG sites provides a coherent model for the pathologic DSBs at some of the most common sites of translocation in human lymphoma – the bcl-2 gene in follicular lymphoma and diffuse large B-cell lymphoma, and the bcl-1 gene in mantle cell lymphoma. PMID:20158866

  15. YAC contig and cell hybrid mapping of six expressed sequences encoded by human chromosome 21

    SciTech Connect

    Yu, J.; Cox, M.; Patterson, D.

    1994-09-01

    The candidate gene approach for positional cloning requires a sufficient number of expressed gene sequences from the chromosomal region of interest. Trisomy for human chromosome 21 results in Down syndrome (DS). However, only a limited number of genes on chromosome 21 have been identified and cloned. We used 1,000 single-copy microclones from a microdissection library of chromosome 21 to screen various cDNA libraries and isolated 9 cDNA clones, of which 6 contain unique sequences: 21E-C1, C3, C4, C5, C7, C10. Using a refined regional mapping panel of chromosome 21 which comprised 24 cell hybrids and divided the chromosome into 33 subregions, we assigned 21E-C1 and C7 to subregion No. 22 (distal q22.1), 21E-C3 to No. 25 (proximal q22.2), 21E-C4 to No. 23 (very distal q22.1), 21E-C5 to No. 31 (proximal q22.3), and 21E-C10 to No. 28 (middle q22.2). In addition, we identified YAC clones corresponding to these cDNA clones using the complete YAC contig spanning the entire chromosome 21q. On the average, 10 positive YAC clones were identified for each cDNA. The mapping positions for the 6 cDNAs determined by the STSs in the YAC contig agree well with the cytogenetic map constructed by the hybrid panel. These cDNA clones with refined mapping positions on chromosome 21 should be useful as candidate genes for the specific component phenotypes of DS assigned to the region.

  16. Non-meiotic chromosome instability in human immature oocytes

    PubMed Central

    Daina, Gemma; Ramos, Laia; Rius, Mariona; Obradors, Albert; del Rey, Javier; Giralt, Magda; Campillo, Mercedes; Velilla, Esther; Pujol, Aïda; Martinez-Pasarell, Olga; Benet, Jordi; Navarro, Joaquima

    2014-01-01

    Aneuploidy has been a major issue in human gametes and is closely related to fertility problems, as it is known to be present in cleavage stage embryos and gestational losses. Pre-meiotic chromosome abnormalities in women have been previously described. The aim of this study is to assess the whole-chromosome complement in immature oocytes to find those abnormalities caused by mitotic instability. For this purpose, a total of 157 oocytes at the germinal vesicle or metaphase I stage, and discarded from IVF cycles, were analysed by CGH. Fifty-six women, between 18 and 45 years old (mean 32.5 years), including 32 IVF patients (25–45 years of age) and 24 IVF oocyte donors (18–33 years of age), were included in the study. A total of 25/157 (15.9%) of the oocytes analysed, obtained from three IVF clinics, contained chromosome abnormalities, including both aneuploidy (24/157) and structural aberrations (9/157). Independently of the maternal age, the incidence of abnormal oocytes which originated before meiosis is 15.9%, and these imbalances were found in 33.9% of the females studied. This work sheds light on the relevance of mitotic instability responsible for the generation of the abnormalities present in human oocytes. PMID:23695274

  17. 3D Chromosome Regulatory Landscape of Human Pluripotent Cells.

    PubMed

    Ji, Xiong; Dadon, Daniel B; Powell, Benjamin E; Fan, Zi Peng; Borges-Rivera, Diego; Shachar, Sigal; Weintraub, Abraham S; Hnisz, Denes; Pegoraro, Gianluca; Lee, Tong Ihn; Misteli, Tom; Jaenisch, Rudolf; Young, Richard A

    2016-02-01

    In this study, we describe the 3D chromosome regulatory landscape of human naive and primed embryonic stem cells. To devise this map, we identified transcriptional enhancers and insulators in these cells and placed them within the context of cohesin-associated CTCF-CTCF loops using cohesin ChIA-PET data. The CTCF-CTCF loops we identified form a chromosomal framework of insulated neighborhoods, which in turn form topologically associating domains (TADs) that are largely preserved during the transition between the naive and primed states. Regulatory changes in enhancer-promoter interactions occur within insulated neighborhoods during cell state transition. The CTCF anchor regions we identified are conserved across species, influence gene expression, and are a frequent site of mutations in cancer cells, underscoring their functional importance in cellular regulation. These 3D regulatory maps of human pluripotent cells therefore provide a foundation for future interrogation of the relationships between chromosome structure and gene control in development and disease. PMID:26686465

  18. Modeling cell response to low doses of photon irradiation: Part 2--application to radiation-induced chromosomal aberrations in human carcinoma cells.

    PubMed

    Cunha, Micaela; Testa, Etienne; Komova, Olga V; Nasonova, Elena A; Mel'nikova, Larisa A; Shmakova, Nina L; Beuve, Michaël

    2016-03-01

    The biological phenomena observed at low doses of ionizing radiation (adaptive response, bystander effects, genomic instability, etc.) are still not well understood. While at high irradiation doses, cellular death may be directly linked to DNA damage, at low doses, other cellular structures may be involved in what are known as non-(DNA)-targeted effects. Mitochondria, in particular, may play a crucial role through their participation in a signaling network involving oxygen/nitrogen radical species. According to the size of the implicated organelles, the fluctuations in the energy deposited into these target structures may impact considerably the response of cells to low doses of ionizing irradiation. Based on a recent simulation of these fluctuations, a theoretical framework was established to have further insight into cell responses to low doses of photon irradiation, namely the triggering of radioresistance mechanisms by energy deposition into specific targets. Three versions of a model are considered depending on the target size and on the number of targets that need to be activated by energy deposition to trigger radioresistance mechanisms. These model versions are applied to the fraction of radiation-induced chromosomal aberrations measured at low doses in human carcinoma cells (CAL51). For this cell line, it was found in the present study that the mechanisms of radioresistance could not be triggered by the activation of a single small target (nanometric size, 100 nm), but could instead be triggered by the activation of a large target (micrometric, 10 μm) or by the activation of a great number of small targets. The mitochondria network, viewed either as a large target or as a set of small units, might be concerned by these low-dose effects. PMID:26708100

  19. The tyrosinase-positive oculocutaneous albinism locus maps to chromosome 15q11. 2-q12

    SciTech Connect

    Ramsay, M.; Colman, M.A.; Stevens, G.; Zwane, E.; Kromberg, J.; Jenkins, T. ); Garral, M.

    1992-10-01

    Tyrosinase-positive oculocutaneous albinism (ty-pos OCA), an autosomal recessive disorder of the melanin biosynthetic pathway, is the most common type of albinism occurring worldwide. In southern African Bantu-speaking negroids it has an overall prevalence of about 1/3,900. Since the basic biochemical defect is unknown, a linkage study with candidate loci, candidate chromosomal regions, and random loci was undertaken. The ty-pos OCA locus was found to be linked to two arbitrary loci, D15S10 and D15S13, in the Prader-Willi/Angelman chromosomal region on chromosome 15q11.2-q12. The pink-eyed dilute locus, p, on mouse chromosome 7, maps close to a region of homology on human chromosome 15q, and we postulate that the ty-pos OCA and p loci are homologous. 43 refs., 2 figs., 1 tab.

  20. Correlation of physical and genetic maps of human chromosome 16. Annual progress report, October 1, 1990--July 31, 1991

    SciTech Connect

    Sutherland, G.R.

    1991-12-31

    This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentially 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.

  1. [Intraspecific chromosomal variability in human pathogenic fungi, especially in Histoplasma capsulatum].

    PubMed

    Romero-Martínez, Rafael; Canteros, Cristina; Taylor, Maria Lucia

    2004-12-01

    The ploidy, karyotype, and chromosome length polymorphism (CLP) of human pathogenic fungi were revised with emphasis on Histoplasma capsulatum, the causative agent of the systemic mycosis, histoplasmosis. Currently, different systems of gel electrophoresis are being used to determine fungal electrokaryotypes (EK). By renaturation kinetic and genomic reconstruction in H. capsulatum strains (G-186AS and Downs), estimated genome sizes of 23 and 32 Mb were determined for both strains, respectively. The haploid state was proposed for both strains, although aneuploidy was suggested for the Downs strain. Contour-clamped homogeneous electric field (CHEF), field inversion gel electrophoresis (FIGE), and Southern blot using different probes showed the presence of six to seven chromosomes in the Downs strain (low virulence), whereas four chromosomes were identified in the G-186B strain (high virulence). The use of these methods in the three major H. capsulatum reference strains (G-217B and Downs from the United States of America, G-186B from Panama) revealed distinct chromosome sizes, from 0.5 to 5.7 Mb, with CLP associated with chromosomes size and mobility. Recently, by CHEF, using 19 H. capsulatum isolates from Latin-America and the G-186B strain, five to seven chromosomes with 1.1 to 11.2 Mb molecular sizes were revealed, which again suggested CLP in H. capsulatum. However, to elucidate the EKs polymorphism in H. capsulatum and its relationship with the isolates phenotype more studies are needed to understand the mechanisms controlling ploidy variability.

  2. Assessment of aneuploidy for chromosomes 8, 9, 13, 16, and 21 in human sperm by using primed in situ labeling technique

    SciTech Connect

    Pellestor, F.; Girardet, A.; Coignet, L.; Andreo, B.; Charlieu, J.P.

    1996-04-01

    The incidence of aneuploidy was estimated for chromosomes 8, 9, 13, 16, and 21 in mature human spermatozoa by primed in situ (PRINS) labeling technique. This method allows us to perform a chromosome-specific detection by in situ annealing of a centromeric specific primer. A dual color PRINS protocol was adapted to human sperm. The decondensation and the denaturation of sperm nuclei were simultaneously performed by 3-M NaOH treatment. Double labeling of spermatozoa was obtained in < 2 h. A total of 96,292 sperm nuclei were analyzed by two independent observers. The estimates of disomy were 0.31 % for chromosome 8, 0.28% for chromosome 9, 0.28% for chromosome 13, 0.26% for chromosome 16, and 0.32% for chromosome 21. These homogeneous findings suggest an equal distribution of aneuploidies among all autosomal chromosomes in males. 26 refs., 1 fig., 2 tabs.

  3. HACking the centromere chromatin code: insights from human artificial chromosomes.

    PubMed

    Bergmann, Jan H; Martins, Nuno M C; Larionov, Vladimir; Masumoto, Hiroshi; Earnshaw, William C

    2012-07-01

    The centromere is a specialized chromosomal region that serves as the assembly site of the kinetochore. At the centromere, CENP-A nucleosomes form part of a chromatin landscape termed centrochromatin. This chromatin environment conveys epigenetic marks regulating kinetochore formation. Recent work sheds light on the intricate relationship between centrochromatin state, the CENP-A assembly pathway and the maintenance of centromere function. Here, we review the emerging picture of how chromatin affects mammalian kinetochore formation. We place particular emphasis on data obtained from Human Artificial Chromosome (HAC) biology and the targeted engineering of centrochromatin using synthetic HACs. We discuss implications of these findings, which indicate that a delicate balance of histone modifications and chromatin state dictates both de novo centromere formation and the maintenance of centromere identity in dividing cell populations. PMID:22825423

  4. HACking the centromere chromatin code: insights from human artificial chromosomes.

    PubMed

    Bergmann, Jan H; Martins, Nuno M C; Larionov, Vladimir; Masumoto, Hiroshi; Earnshaw, William C

    2012-07-01

    The centromere is a specialized chromosomal region that serves as the assembly site of the kinetochore. At the centromere, CENP-A nucleosomes form part of a chromatin landscape termed centrochromatin. This chromatin environment conveys epigenetic marks regulating kinetochore formation. Recent work sheds light on the intricate relationship between centrochromatin state, the CENP-A assembly pathway and the maintenance of centromere function. Here, we review the emerging picture of how chromatin affects mammalian kinetochore formation. We place particular emphasis on data obtained from Human Artificial Chromosome (HAC) biology and the targeted engineering of centrochromatin using synthetic HACs. We discuss implications of these findings, which indicate that a delicate balance of histone modifications and chromatin state dictates both de novo centromere formation and the maintenance of centromere identity in dividing cell populations.

  5. DNA Secondary Structure at Chromosomal Fragile Sites in Human Disease

    PubMed Central

    Thys, Ryan G; Lehman, Christine E; Pierce, Levi C. T; Wang, Yuh-Hwa

    2015-01-01

    DNA has the ability to form a variety of secondary structures that can interfere with normal cellular processes, and many of these structures have been associated with neurological diseases and cancer. Secondary structure-forming sequences are often found at chromosomal fragile sites, which are hotspots for sister chromatid exchange, chromosomal translocations, and deletions. Structures formed at fragile sites can lead to instability by disrupting normal cellular processes such as DNA replication and transcription. The instability caused by disruption of replication and transcription can lead to DNA breakage, resulting in gene rearrangements and deletions that cause disease. In this review, we discuss the role of DNA secondary structure at fragile sites in human disease. PMID:25937814

  6. Sequence divergence and chromosomal rearrangements during the evolution of human pseudoautosomal genes and their mouse homologs

    SciTech Connect

    Ellison, J.; Li, X.; Francke, U.

    1994-09-01

    The pseudoautosomal region (PAR) is an area of sequence identity between the X and Y chromosomes and is important for mediating X-Y pairing during male meiosis. Of the seven genes assigned to the human PAR, none of the mouse homologs have been isolated by a cross-hybridization strategy. Two of these homologs, Csfgmra and II3ra, have been isolated using a functional assay for the gene products. These genes are quite different in sequence from their human homologs, showing only 60-70% sequence similarity. The Csfgmra gene has been found to further differ from its human homolog in being isolated not on the sex chromosomes, but on a mouse autosome (chromosome 19). Using a mouse-hamster somatic cell hybrid mapping panel, we have mapped the II3ra gene to yet another mouse autosome, chromosome 14. Attempts to clone the mouse homolog of the ANT3 locus resulted in the isolation of two related genes, Ant1 and Ant2, but failed to yield the Ant3 gene. Southern blot analysis of the ANT/Ant genes showed the Ant1 and Ant2 sequences to be well-conserved among all of a dozen mammals tested. In contrast, the ANT3 gene only showed hybridization to non-rodent mammals, suggesting it is either greatly divergent or has been deleted in the rodent lineage. Similar experiments with other human pseudoautosomal probes likewise showed a lack of hybridization to rodent sequences. The results show a definite trend of extensive divergence of pseudoautosomal sequences in addition to chromosomal rearrangements involving X;autosome translocations and perhaps gene deletions. Such observations have interesting implications regarding the evolution of this important region of the sex chromosomes.

  7. Effects of alpha-particles on survival and chromosomal aberrations in human mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Durante, M.; Grossi, G. F.; Gialanella, G.; Pugliese, M.; Nappo, M.; Yang, T. C.

    1995-01-01

    We have studied the radiation responses of a human mammary epithelial cell line, H184B5 F5-1 M/10. This cell line was derived from primary mammary cells after treatment with chemicals and heavy ions. The F5-1 M/10 cells are immortal, density-inhibited in growth, and non-tumorigenic in athymic nude mice and represent an in vitro model of the human epithelium for radiation studies. Because epithelial cells are the target of alpha-particles emitted from radon daughters, we concentrated our studies on the efficiency of alpha-particles. Confluent cultures of M/10 cells were exposed to accelerated alpha-particles [beam energy incident at the cell monolayer = 3.85 MeV, incident linear energy transfer (LET) in cell = 109 keV/microns] and, for comparison, to 80 kVp x-rays. The following endpoints were studied: (1) survival, (2) chromosome aberrations at the first postirradiation mitosis, and (3) chromosome alterations at later passages following irradiation. The survival curve was exponential for alpha-particles (D0 = 0.73 +/- 0.04 Gy), while a shoulder was observed for x-rays (alpha/beta = 2.9 Gy; D0 = 2.5 Gy, extrapolation number 1.6). The relative biological effectiveness (RBE) of high-LET alpha-particles for human epithelial cell killing was 3.3 at 37% survival. Dose-response curves for the induction of chromosome aberrations were linear for alpha-particles and linearquadratic for x-rays. The RBE for the induction of chromosome aberrations varied with the type of aberration scored and was high (about 5) for chromosome breaks and low (about 2) for chromosome exchanges.(ABSTRACT TRUNCATED AT 250 WORDS).

  8. Benefit to neoadjuvant anti-human epidermal growth factor receptor 2 (HER2)-targeted therapies in HER2-positive primary breast cancer is independent of phosphatase and tensin homolog deleted from chromosome 10 (PTEN) status

    PubMed Central

    Nuciforo, P. G.; Aura, C.; Holmes, E.; Prudkin, L.; Jimenez, J.; Martinez, P.; Ameels, H.; de la Peña, L.; Ellis, C.; Eidtmann, H.; Piccart-Gebhart, M. J.; Scaltriti, M.; Baselga, J.

    2015-01-01

    Background Assessment of phosphatase and tensin homolog deleted from chromosome 10 (PTEN) might be an important tool in identifying human epidermal growth factor receptor 2 (HER2)-positive breast cancer patients unlikely to derive benefit from anti-HER2 therapies. However, studies to date have failed to demonstrate its predictive role in any treatment setting. Patients and methods Prospectively collected baseline core biopsies from 429 early-stage HER2-positive breast cancer patients treated with trastuzumab, lapatinib, or their combination in the Neo-ALTTO study were stained using two anti-PTEN monoclonal antibodies (CST and DAKO). The association of PTEN status and PI3K pathway activation (defined as either PTEN loss and/or PIK3CA mutation) with total pathological complete response (tpCR) at surgery, event-free survival (EFS), and overall survival (OS) was evaluated. Results PTEN loss was observed in 27% and 29% of patients (all arms, n = 361 and n = 363) for CST and DAKO, respectively. PTEN loss was more frequently observed in hormone receptor (HR)-negative (33% and 36% with CST and DAKO, respectively) compared with HR-positive tumours (20% and 22% with CST and DAKO, respectively). No significant differences in tpCR rates were observed according to PTEN status. PI3K pathway activation was found in 47% and 48% of patients (all arms, n = 302 and n = 301) for CST and DAKO, respectively. Similarly, tpCR rates were not significantly different for those with or without PI3K pathway activation. Neither PTEN status nor PI3K pathway activation were predictive of tpCR, EFS, or OS, independently of treatment arm or HR status. High inter-antibody and inter-observer agreements were found (>90%). Modification of scoring variables significantly affected the correlation between PTEN and HR status but not with tpCR. Conclusion These data show that PTEN status determination is not a useful biomarker to predict resistance to trastuzumab and lapatinib-based therapies. The lack of

  9. Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans.

    PubMed

    Dickinson, Peter J; York, Dan; Higgins, Robert J; LeCouteur, Richard A; Joshi, Nikhil; Bannasch, Danika

    2016-07-01

    Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy.

  10. Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans.

    PubMed

    Dickinson, Peter J; York, Dan; Higgins, Robert J; LeCouteur, Richard A; Joshi, Nikhil; Bannasch, Danika

    2016-07-01

    Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041

  11. Pericentric characterization of human chromosome 7 in a melanoma cell line

    SciTech Connect

    Fetni, R.; Lemieux, N.; Richer, C.L.

    1994-09-01

    Cytogenetic analyses of an established melanoma cell line show structural abnormalities involving mainly chromosome 7. Molecular cytogenetic examination of the different abnormalities (i(7q), i(7p), t(7;12)) was used to pinpoint the site of the break and to analyse the possible mechanisms by which isochromosomes 7 could be formed. Human chromosome 7 has been shown to contain two distinct alpha satellite arrays: D7Z1 and D7Z2 which are separated by 1Mb. We confirm the order to be short-arm- D7Z2 - D7Z1 - long arm. Both probes were then used to characterize two different types of isochromosomes 7 (one of the long arms and one of the short arms) and a translocation (7;12). Isochromosome 7q showed a single D7Z1 signal and loss of D7Z2. The unique centromeric structure of i(7q), with only the D7Z1 signal, suggests that a breakpoint occurred within D7Z1. Isochromosome 7p showed two distinct D7Z1 and D7Z2 hybridization signals. The distance observed between the two signals suggests that the breakpoint is in the proximal part of the long arms. This chromosome might be considered as a dicentric isochromosome 7p. Translocation (7;12) showed the two arrays of chromosome 7 {alpha} satellite DNA. The three derived chromosomes appeared to result from independent rearrangements. This observation shows that a variety of breaks may occur in the juxtacentromeric region of a given chromosome. It also shows that the functional centromere of chromosome 7 does not need the presence of D7Z2, since only D7Z1 was conserved in all cases, suggesting the importance of this sequence for the centromeric function.

  12. Histone H2AFX Links Meiotic Chromosome Asynapsis to Prophase I Oocyte Loss in Mammals

    PubMed Central

    Cloutier, Jeffrey M.; Mahadevaiah, Shantha K.; ElInati, Elias; Nussenzweig, André; Tóth, Attila; Turner, James M. A.

    2015-01-01

    Chromosome abnormalities are common in the human population, causing germ cell loss at meiotic prophase I and infertility. The mechanisms driving this loss are unknown, but persistent meiotic DNA damage and asynapsis may be triggers. Here we investigate the contribution of these lesions to oocyte elimination in mice with chromosome abnormalities, e.g. Turner syndrome (XO) and translocations. We show that asynapsed chromosomes trigger oocyte elimination at diplonema, which is linked to the presence of phosphorylated H2AFX (γH2AFX). We find that DNA double-strand break (DSB) foci disappear on asynapsed chromosomes during pachynema, excluding persistent DNA damage as a likely cause, and demonstrating the existence in mammalian oocytes of a repair pathway for asynapsis-associated DNA DSBs. Importantly, deletion or point mutation of H2afx restores oocyte numbers in XO females to wild type (XX) levels. Unexpectedly, we find that asynapsed supernumerary chromosomes do not elicit prophase I loss, despite being enriched for γH2AFX and other checkpoint proteins. These results suggest that oocyte loss cannot be explained simply by asynapsis checkpoint models, but is related to the gene content of asynapsed chromosomes. A similar mechanistic basis for oocyte loss may operate in humans with chromosome abnormalities. PMID:26509888

  13. The HOX-5 and surfeit gene clusters are linked in the proximal portion of mouse chromosome 2.

    PubMed

    Stubbs, L; Huxley, C; Hogan, B; Evans, T; Fried, M; Duboule, D; Lehrach, H

    1990-04-01

    Using an interspecies backcross, we have mapped the HOX-5 and surfeit (surf) gene clusters within the proximal portion of mouse chromosome 2. While the HOX-5 cluster of homeobox-containing genes has been localized to chromosome 2, bands C3-E1, by in situ hybridization, its more precise position relative to the genes and cloned markers of chromosome 2 was not known. Surfeit, a tight cluster of at least six highly conserved "housekeeping" genes, has not been previously mapped in mouse, but has been localized to human chromosome 9q, a region of the human genome with strong homology to proximal mouse chromosome 2. The data presented here place HOX-5 in the vicinity of the closely linked set of developmental mutations rachiterata, lethargic, and fidget and place surf close to the proto-oncogene Abl, near the centromere of chromosome 2.

  14. Reporting of the third international workshop on human chromosome 22 mapping

    SciTech Connect

    Emanuel, B.S.; Buetow, K.; Nussbaum, R.; Scambler, P; Lipinski, M.; Overton, C.

    1992-12-31

    The third international workshop on the mapping of human chromosome 22 was held at the Sugarloaf Conference Center in Philadelphia Pennsylvania USA from September 17--20, 1992. It was organized by Beverly S. Emanuel of Children`s Hospital of Philadelphia and the Human Genome Center for Chromosome 22. The highlights of the conference included the discussion of the chromosome 22 gene at the Ewings Sarcoma breakpoint, the identification of a polymorphic TG/CA repeat containing locus tightly linked to the NF2 gene, the isolation of a candidate tumor suppressor locus for meningioma, the isolation of numerous as yet uncharacterized new cDNAs for chromosome 22 and the progress which has been made on generating physical and genetic maps of the chromosome. There is a new genetic map comprised of 16 short tandem repeat polymorphism (STRP) markers of which 12 have greater than 70% heterozygosity (Fig. 1). It was decided that the next meeting should be held in 18 months and it will be organized by Peter Scambler in the United Kingdom.

  15. Comparative Genomic Hybridization of Human Malignant Gliomas Reveals Multiple Amplification Sites and Nonrandom Chromosomal Gains and Losses

    PubMed Central

    Schròck, Evelin; Thiel, Gundula; Lozanova, Tanka; du Manoir, Stanislas; Meffert, Marie-Christine; Jauch, Anna; Speicher, Michael R.; Nürnberg, Peter; Vogel, Siegfried; Janisch, Werner; Donis-Keller, Helen; Ried, Thomas; Witkowski, Regine; Cremer, Thomas

    1994-01-01

    Nine human malignant gliomas (2 astrocytomas grade III and 7 glioblastomas) were analyzed using comparative genomic hybridization (CGH). In addition to the amplification of the EGFR gene at 7p12 in 4 of 9 cases, six new amplification sites were mapped to 1q32, 4q12, 7q21.1, 7q21.2-3, 12p, and 22q12. Nonrandom chromosomal gains and losses were identified with overrepresentation of chromosome 7 and underrepresentation of chromosome 10 as the most frequent events (1 of 2 astrocytomas, 7 of 7 glioblastomas). Gain of a part or the whole chromosome 19 and losses of chromosome bands 9pter-23 and 22q13 were detected each in five cases. Loss of chromosome band 17p13 and gain of chromosome 20 were revealed each in three cases. The validity of the CGH data was confirmed using interphase cytogenetics with YAC clones, chromosome painting in tumor metaphase spreads, and DNA fingerprinting. A comparison of CGH data with the results of chromosome banding analyses indicates that metaphase spreads accessible in primary tumor cell cultures may not represent the clones predominant in the tumor tissue ImagesFigure 1Figure 4Figure 6 PMID:8203461

  16. Localization of genes encoding three distinct flavin-containing monooxygenases to human chromosome 1q

    SciTech Connect

    Shephard, E.A.; Fox, M.F.; Povey, S. ); Dolphin, C.T.; Phillips, I.R.; Smith, R. )

    1993-04-01

    The authors have used the polymerase chain reaction to map the gene encoding human flavin-containing monooxygenase (FMO) form II (N. Lomri, Q. Gu, and J. R. Cashman, 1992, Proc. Natl. Acad. Sci. USA 89: 1685--1689) to chromosome 1. They propose the designation FMO3 for this gene as it is the third FMO gene to be mapped. The two other human FMO genes identified to date, FMO1 and FMO2, are also located on chromosome 1 (C. Dolphin, E. A. Shephard, S. Povey, C. N. A. Palmer, D. M. Ziegler, R. Ayesh, R. L. Smith, and 1. R. Phillips, 1991, J. Biol. Chem. 266: 12379--12385; C. Dolphin, E. A. Shephard, S. F. Povey, R. L. Smith, and I. R. Phillips, 1992, Biochem. J. 286: 261--267). The localization of FMO1, FMO2, and FMO3 has been refined to the long arm of chromosome 1. Analysis of human metaphase chromosomes by in situ hybridization confirmed the mapping of FMO1 and localized this gene more precisely to 1 q23-q25. 28 refs., 3 figs., 2 tabs.

  17. Radiation-induced chromosome damage in human lymphocytes

    PubMed Central

    Lloyd, D. C.; Dolphin, G. W.

    1977-01-01

    ABSTRACT Analysis for chromosome aberrations in human peripheral blood lymphocytes has been developed as an indicator of dose from ionising radiation. This paper outlines the mechanism of production of aberrations, the technique for their analysis and the dose-effect relationships for various types of radiation. During the past ten years the National Radiological Protection Board has developed a service for the UK in which estimates of dose from chromosome aberration analysis are made on people known or suspected of being accidentally over-exposed. This service can provide estimates where no physical dosemeter was worn and is frequently able to resolve anomalous or disputed data from routine film badges. Several problems in the interpretation of chromosome aberration yields are reviewed. These include the effects of partial body irradiation and the response to variations in dose rate and the intermittent nature of some exposures. The dosimetry service is supported by a research programme which includes surveys of groups of patients irradiated for medical purposes. Two surveys are described. In the first, lymphocyte aberrations were examined in rheumatiod arthritis patients receiving intra-articular injections of colloidal radiogold or radioyttrium. A proportion of the nuclide leaked from the joint into the regional lymphatic system. In the second survey a comparison was made between the cytogenetic and physical estimates of whole body dose in patients receiving iodine 131 for thyroid carcinoma. Images PMID:338021

  18. Dataset of target mass spectromic proteome profiling for human chromosome 18.

    PubMed

    Ilgisonis, Ekaterina V; Kopylov, Arthur T; Zgoda, Victor G

    2016-09-01

    Proteome profiling is a type of quantitative analysis that reveals level of protein expression in the sample. Proteome profiling by using selected reaction monitoring is an approach for the Chromosome-centric Human Proteome Project (C-HPP). Here we describe dataset generated in the course of the pilot phase of Russian part of C-HPP, which was focused on human Chr 18 proteins. Proteome profiling was performed using stable isotope-labeled standards (SRM/SIS) for plasma, liver tissue and HepG2 cells. Dataset includes both positive and negative results of protein detection. These data were partly discussed in recent publications, "Chromosome 18 Transcriptome Profiling and Targeted Proteome Mapping in Depleted Plasma, Liver Tissue and HepG2 Cells" [1] and "Chromosome 18 transcriptoproteome of liver tissue and HepG2 Cells and targeted proteome mapping in depleted plasma: Update 2013" [2], supporting the accompanying publication "State of the Chromosome 18-centric HPP in 2016: Transcriptome and Proteome Profiling of Liver Tissue and HepG2 Cells" [3], and are deposited at the ProteomeXchange via the PASSEL repository with the dataset identifier PASSEL: PASS00697 for liver and HepG2 cell line.

  19. Dataset of target mass spectromic proteome profiling for human chromosome 18.

    PubMed

    Ilgisonis, Ekaterina V; Kopylov, Arthur T; Zgoda, Victor G

    2016-09-01

    Proteome profiling is a type of quantitative analysis that reveals level of protein expression in the sample. Proteome profiling by using selected reaction monitoring is an approach for the Chromosome-centric Human Proteome Project (C-HPP). Here we describe dataset generated in the course of the pilot phase of Russian part of C-HPP, which was focused on human Chr 18 proteins. Proteome profiling was performed using stable isotope-labeled standards (SRM/SIS) for plasma, liver tissue and HepG2 cells. Dataset includes both positive and negative results of protein detection. These data were partly discussed in recent publications, "Chromosome 18 Transcriptome Profiling and Targeted Proteome Mapping in Depleted Plasma, Liver Tissue and HepG2 Cells" [1] and "Chromosome 18 transcriptoproteome of liver tissue and HepG2 Cells and targeted proteome mapping in depleted plasma: Update 2013" [2], supporting the accompanying publication "State of the Chromosome 18-centric HPP in 2016: Transcriptome and Proteome Profiling of Liver Tissue and HepG2 Cells" [3], and are deposited at the ProteomeXchange via the PASSEL repository with the dataset identifier PASSEL: PASS00697 for liver and HepG2 cell line. PMID:27595127

  20. Construction of a panel of transgenic mice containing a contiguous 2-mb set of YAC/P1 clones from human chromosome 21q22

    SciTech Connect

    Smith, D.J.; Zhu, Y.; Zhang, J.

    1995-06-10

    Libraries of the entire human genome, or regions of the genome, have been made in bacteria, yeast, and somatic cells. We have expanded this strategy using overlapping YACs and P1s from human 21q22.2 (the Down syndrome region) to create a panel of transgenic mice containing DNA that encompasses this region of the human genome. Together the members of the in vivo library, each with a unique transgene (four YACs and four P1s), contain approximately 2 Mb of contiguous DNA. The integrity, stable inheritance, and expression of a coding sequence for each member of the YAC panel are demonstrated, and the uses of the panel are described. 54 refs., 3 figs., 6 tabs.

  1. Distinct responses to reduplicated chromosomes require distinct Mad2 responses

    PubMed Central

    Stormo, Benjamin M; Fox, Donald T

    2016-01-01

    Duplicating chromosomes once each cell cycle produces sister chromatid pairs, which separate accurately at anaphase. In contrast, reduplicating chromosomes without separation frequently produces polytene chromosomes, a barrier to accurate mitosis. Chromosome reduplication occurs in many contexts, including: polytene tissue development, polytene tumors, and following treatment with mitosis-blocking chemotherapeutics. However, mechanisms responding to or resolving polyteny during mitosis are poorly understood. Here, using Drosophila, we uncover two distinct reduplicated chromosome responses. First, when reduplicated polytene chromosomes persist into metaphase, an anaphase delay prevents tissue malformation and apoptosis. Second, reduplicated polytene chromosomes can also separate prior to metaphase through a spindle-independent mechanism termed Separation-Into-Recent-Sisters (SIRS). Both reduplication responses require the spindle assembly checkpoint protein Mad2. While Mad2 delays anaphase separation of metaphase polytene chromosomes, Mad2’s control of overall mitotic timing ensures efficient SIRS. Our results pinpoint mechanisms enabling continued proliferation after genome reduplication, a finding with implications for cancer progression and prevention. DOI: http://dx.doi.org/10.7554/eLife.15204.001 PMID:27159240

  2. Transillumination spatially modulated illumination microscopy for human chromosome imaging

    NASA Astrophysics Data System (ADS)

    Pitris, Costas; Heracleous, Peter; Patsalis, Philippos

    2005-03-01

    Human chromosome analysis is an essential task in cytogenetics, especially in prenatal screening, genetic syndrome diagnosis, cancer pathology research and mutagen dosimetry. Chromosomal analysis begins with the creation of a karyotype, which is a layout of chromosome images organized by decreasing size in pairs. Both manual and automatic classification of chromosomes are limited by the resolution of the microscope and imaging system used. One way to improve the results of classification and even detect subtleties now remaining undetected, is to enhance the resolution of the images. It is possible to achieve lateral resolution beyond the classical limit, by using spatially modulated illumination (SMI) in a wide-field, non-confocal microscope. In this case, the sample is illuminated with spatially modulated light, which makes normally inaccessible high-resolution information visible in the observed image by shifting higher frequencies within the OTF limits of the microscope. Although, SMI microscopes have been reported in the past, this manuscript reports the development of a transillumination microscope for opaque, non-fluorescent samples. The illumination path consisted of a light source illuminating a ruled grating which was subsequently imaged on the sample. The grating was mounted on a rotating and translating stage so that the magnification and rotation of the pattern could be adjusted. The imaging lens was a 1.25 NA oil immersion objective. Test samples showed resolution improvement, as judged from a comparison of the experimentally obtained FWHM. Further studies using smaller fringe distance or laser interference pattern illumination will be evaluated to further optimize the SMI results.

  3. Functional gene groups are concentrated within chromosomes, among chromosomes and in the nuclear space of the human genome.

    PubMed

    Thévenin, Annelyse; Ein-Dor, Liat; Ozery-Flato, Michal; Shamir, Ron

    2014-09-01

    Genomes undergo changes in organization as a result of gene duplications, chromosomal rearrangements and local mutations, among other mechanisms. In contrast to prokaryotes, in which genes of a common function are often organized in operons and reside contiguously along the genome, most eukaryotes show much weaker clustering of genes by function, except for few concrete functional groups. We set out to check systematically if there is a relation between gene function and gene organization in the human genome. We test this question for three types of functional groups: pairs of interacting proteins, complexes and pathways. We find a significant concentration of functional groups both in terms of their distance within the same chromosome and in terms of their dispersal over several chromosomes. Moreover, using Hi-C contact map of the tendency of chromosomal segments to appear close in the 3D space of the nucleus, we show that members of the same functional group that reside on distinct chromosomes tend to co-localize in space. The result holds for all three types of functional groups that we tested. Hence, the human genome shows substantial concentration of functional groups within chromosomes and across chromosomes in space.

  4. Structure and chromosomal localization of the human homeobox gene Prox 1

    SciTech Connect

    Zinovieva, R.D.; Duncan, M.K.; Johnson, T.R.

    1996-08-01

    The genomic organization and nucleotide sequence of the human homeobox gene Prox 1 as well as its chromosomal localization have been determined. This gene spans more than 40 kb, consists of at least 5 exons, and encodes an 83-kDa protein. It shows 89% identity with the chicken sequence at the nucleotide level in the coding region, while the human and chicken proteins are 94% identical. Among the embryonic tissues analyzed (lens, brain, lung, liver, and kidney), the human Prox 1 gene is most actively expressed i the developing lens, similar to the expression pattern of the chicken Prox 1 gene. The Prox 1 gene was mapped to human chromosome 1q32.2-q32.3. 26 refs., 6 figs.

  5. Chromosomal mapping of the human and murine orphan receptors ERRalpha (ESRRA) and ERRbeta (ESRRB) and identification of a novel human ERRalpha-related pseudogene.

    PubMed

    Sladek, R; Beatty, B; Squire, J; Copeland, N G; Gilbert, D J; Jenkins, N A; Giguère, V

    1997-10-15

    The estrogen-related receptors ERRalpha and ERRbeta (formerly ERR1 and ERR2) form a subgroup of the steroid/thyroid/retinoid receptor family. ERRalpha and ERRbeta are homologous to the estrogen receptor and bind similar DNA targets; however, they are unable to activate gene transcription in response to estrogens. We have used interspecific backcross analysis to map the murine Estrra locus to chromosome 19 and Estrrb to mouse chromosome 12. Using fluorescence in situ hybridization, we have mapped the human ESRRA gene to chromosome 11q12-q13 and the human ESRRB gene to chromosome 14q24.3. In addition, we report the isolation of a processed human ERRalpha pseudogene mapping to chromosome 13q12.1. To our knowledge, this represents the first report of a pseudogene associated with a member of the nuclear receptor superfamily.

  6. Mapping of the NEP receptor tyrosine kinase gene to human chromosome 6p21.3 and mouse chromosome 17C

    SciTech Connect

    Edelhoff, S.; Disteche, C.M.; Sweetser, D.A.

    1995-01-01

    The mouse receptor tyrosine kinase (RTK) NEP, also called Ptk-3, is widely expressed, with high levels in proliferating neuroepithelia of mouse embryos. The recently described human discoidin domain receptor (DDR) has a predicted amino acid sequence 93% identical to that of murine NEP and may be its human homologue. We have mapped the gene encoding NEP in human and mouse by fluorescence in situ hybridization using a mouse cDNA probe. The NEP/Nep gene maps to human chromosome 6p21.3 and mouse chromosome 17C, respectively. This places the NEP/Nep gene at, or near, the major histocompatibility (MHC) locus-HLA in human and H2 in mouse, respectively. Based on its pattern of expression during development, NEP and Nep represent candidate genes for several MHC-linked developmental abnormalities in human and mouse. 19 refs., 1 fig.

  7. A continuous high-resolution physical map spanning 17 megabases of the q12, q13.1, and q13.2 cytogenetic bands of human chromosome 19

    SciTech Connect

    Garcia, E.; Elliott, J.; Gorvad, A.

    1995-05-01

    The authors report the construction of a high-resolution physical map of a 17-Mb region that encompasses the entire q12, q13.1, and q13.2 bands of human chromosome 19. The continuous map extends from a region approximately 400 kb centromeric of the D1j9S7 marker to the excision repair cross-complementing rodent repair deficiency complementation group 1 (ERCC1) locus. The ordered clone map has been obtained starting from a foundation of cosmid contigs assembled by automated fingerprinting and localized to the cytogenetic map by fluorescence in situ hybridization (FISH). Clonal continuity of the map has been achieved by binning and linking the premapped cosmid contigs by means of yeast artificial chromosomes (YACs). The map consists of a single contig composed of 169 YAC members (minimal spanning path of 18 YACs) linking 165 cosmid contigs. Eighty percent, or about 13.2 Mb of the entire regions spanned by the map, has been resolved to the EcoRI restriction map level. Twenty-nine sequence-tagged sites associated with genetic markers or derived from FISH-mapped cosmids have been placed on the map. In addition to the ERCC1 gene area, the map includes the location of the creatine kinase muscle locus (CKM), imidazoledipeptidase (PEPD), glucophosphate isomerase (GPI), myelin-associated glycoprotein (MAG), the apolipoprotein E and C (APOE and APOC) genes, and the ryanodine receptor (RYR1) gene. This type of map provides a source of continuously overlapping DNA segments at a level of resolution two orders of magnitude higher than that obtained using YACs alone. In addition, it provides ready-to-use reagents for detailed analyses at the gene level, FISH studies of chromosomal aberrations, and DNA sequencing. 53 refs., 5 tabs., 5 figs.

  8. CREB Binds to Multiple Loci on Human Chromosome 22

    PubMed Central

    Euskirchen, Ghia; Royce, Thomas E.; Bertone, Paul; Martone, Rebecca; Rinn, John L.; Nelson, F. Kenneth; Sayward, Fred; Luscombe, Nicholas M.; Miller, Perry; Gerstein, Mark; Weissman, Sherman; Snyder, Michael

    2004-01-01

    The cyclic AMP-responsive element-binding protein (CREB) is an important transcription factor that can be activated by hormonal stimulation and regulates neuronal function and development. An unbiased, global analysis of where CREB binds has not been performed. We have mapped for the first time the binding distribution of CREB along an entire human chromosome. Chromatin immunoprecipitation of CREB-associated DNA and subsequent hybridization of the associated DNA to a genomic DNA microarray containing all of the nonrepetitive DNA of human chromosome 22 revealed 215 binding sites corresponding to 192 different loci and 100 annotated potential gene targets. We found binding near or within many genes involved in signal transduction and neuronal function. We also found that only a small fraction of CREB binding sites lay near well-defined 5′ ends of genes; the majority of sites were found elsewhere, including introns and unannotated regions. Several of the latter lay near novel unannotated transcriptionally active regions. Few CREB targets were found near full-length cyclic AMP response element sites; the majority contained shorter versions or close matches to this sequence. Several of the CREB targets were altered in their expression by treatment with forskolin; interestingly, both induced and repressed genes were found. Our results provide novel molecular insights into how CREB mediates its functions in humans. PMID:15082775

  9. Chromosomal assignment of human DNA fingerprint sequences by simultaneous hybridization to arbitrarily primed PCR products from human/rodent monochromosome cell hybrids

    SciTech Connect

    Yasuda, Jun; Sekiya, Takao; Navarro, J.M.

    1996-05-15

    We have developed a technique for the simultaneous chromosomal assignment of multiple human DNA sequences from DNA fingerprints obtained by the arbitrarily primed polymerase chain reaction (AP-PCR). Radioactively labeled human AP-PCR products are hybridized to DNA fingerprints generated with the same arbitrary primer from human/rodent monochromosome cell hybrids after electroblotting to a nylong membrane. Human-specific hybridization bands in the human/rodent fingerprints unambiguously determine their chromosome of origin. We named this method simultaneous hybridization of arbitrarily primed PCR DNA fingerprinting products (SHARP). Using this approach, we determined the chromosomal origins of most major bands of human AP-PCR fingerprints obtained with two arbitrary primers. Altogether, the chromosomal localization of near 50 DNA fragments, comprehensive of all human chromosomes except chromosomes 21 and Y, was achieved in this simple manner. Chromosome assignment of fingerprint bands is essential for molecular karyotyping of cancer by AP-PCR DNA fingerprinting. The SHARP method provides a convenient and powerful tool for this purpose. 23 refs., 3 figs., 2 tabs.

  10. Chromosomal structure of the human TYRP1 and TYRP2 loci and comparison of the tyrosinase-related protein gene family

    SciTech Connect

    Sturm, R.A.; Smith, A.G.; Smit, S.E.

    1995-09-01

    The structures of the human tyrosinase-related protein genes TYRP1 and TYRP2 have been determined and compared with that of the tyrosinase gene (TYR). The TYRP1 protein is encoded in 7 exons spread over 24 kb of genomic DNA. Characterization of a 55-kb contig encompassing the human TYRP2 locus reveals that the protein coding region is divided into 8 exons. All three members of the TYRP gene family share a common C-terminal membrane spanning exon. Examination of the position of other intron junctions suggests that TYRP1 was derived from a TYR duplication and then was itself duplicated to give rise to the TYRP2 gene. The evidence also suggests that at least some of the introns within the TYR, TYRP1, and TYRP2 coding regions were gained after duplication and that intron slippage is unlikely to have occurred. 51 refs., 7 figs., 3 tabs.

  11. The gene for PAX7, a member of the paired-box-containing genes, is localized on human chromosome arm 1p36

    SciTech Connect

    Shapiro, D.N.; Morris, S.W. Univ. of Tennessee College of Medicine, Memphis, TN ); Sublett, J.E.; Li, Baitao; Valentine, M.B. ); Noll, M. )

    1993-09-01

    The murine Pax-7 gene and the cognate human gene, formerly designated HuP1, are members of the multigene paired-box-containing class of developmental regulatory genes first identified in Drosophila. By analysis of somatic cell hybrids segregating human chromosomes, the gene encoding PAX7 was localized to human chromosome 1. Fluorescence in situ hybridization confirmed this assignment and allowed mapping of the gene to the terminal region of the short arm (1p36) of the extensive homology between human chromosome 1p and the distal segment of mouse chromosome 4, extending from bands C5 through E2. 19 refs., 1 fig.

  12. Suggestive evidence for association of human chromosome 18q12-q21 and its orthologue on rat and mouse chromosome 18 with several autoimmune diseases.

    PubMed

    Merriman, T R; Cordell, H J; Eaves, I A; Danoy, P A; Coraddu, F; Barber, R; Cucca, F; Broadley, S; Sawcer, S; Compston, A; Wordsworth, P; Shatford, J; Laval, S; Jirholt, J; Holmdahl, R; Theofilopoulos, A N; Kono, D H; Tuomilehto, J; Tuomilehto-Wolf, E; Buzzetti, R; Marrosu, M G; Undlien, D E; Rønningen, K S; Ionesco-Tirgoviste, C; Shield, J P; Pociot, F; Nerup, J; Jacob, C O; Polychronakos, C; Bain, S C; Todd, J A

    2001-01-01

    Some immune system disorders, such as type 1 diabetes, multiple sclerosis (MS), and rheumatoid arthritis (RA), share common features: the presence of autoantibodies and self-reactive T-cells, and a genetic association with the major histocompatibility complex. We have previously published evidence, from 1,708 families, for linkage and association of a haplotype of three markers in the D18S487 region of chromosome 18q21 with type 1 diabetes. Here, the three markers were typed in an independent set of 627 families and, although there was evidence for linkage (maximum logarithm of odds score [MLS] = 1.2; P = 0.02), no association was detected. Further linkage analysis revealed suggestive evidence for linkage of chromosome 18q21 to type 1 diabetes in 882 multiplex families (MLS = 2.2; lambdas = 1.2; P = 0.001), and by meta-analysis the orthologous region (also on chromosome 18) is linked to diabetes in rodents (P = 9 x 10(-4)). By meta-analysis, both human chromosome 18q12-q21 and the rodent orthologous region show positive evidence for linkage to an autoimmune phenotype (P = 0.004 and 2 x 10(-8), respectively, empirical P = 0.01 and 2 x 10(-4), respectively). In the diabetes-linked region of chromosome 18q12-q21, a candidate gene, deleted in colorectal carcinoma (DCC), was tested for association with human autoimmunity in 3,380 families with type 1 diabetes, MS, and RA. A haplotype ("2-10") of two newly characterized microsatellite markers within DCC showed evidence for association with autoimmunity (P = 5 x 10(-6)). Collectively, these data suggest that a locus (or loci) exists on human chromosome 18q12-q21 that influences multiple autoimmune diseases and that this association might be conserved between species. PMID:11147786

  13. Molecular structure and chromosomal mapping of the human homolog of the agouti gene

    SciTech Connect

    Kwon, H.Y.; Woychik, R.P.; Bultman, S.J. |; Loeffler, C.; Hansmann, I.; Chen, W.J.; Furdon, P.J.; Wilkison, W.; Powell, J.G.; Usala, A.L.

    1994-10-11

    The agouti (a) locus in mouse chromosome 2 normally regulates coat color pigmentation. The mouse agouti gene was recently cloned and shown to encode a distinctive 131-amino acid protein with a consensus signal peptide. Here the authors describe the cloning of the human homolog of the mouse agouti gene using an interspecies DNA-hybridization approach. Sequence analysis revealed that the coding region of the human agouti gene is 85% identical to the mouse gene and has the potential to encode a protein of 132 amino acids with a consensus signal peptide. Chromosomal assignment using somatic-cell-hybrid mapping panels and fluorescence in situ hybridization demonstrated that the human agouti gene maps to chromosome band 20q11.2. This result revealed that the human agouti gene is closely linked to several traits, including a locus called MODY (for maturity onset diabetes of the young) and another region that is associated with the development of myeloid leukemia. Initial expression studies with RNA from several adult human tissues showed that the human agouti gene is expressed in adipose tissue and testis.

  14. Human Spermatozoa as a Model for Detecting Missing Proteins in the Context of the Chromosome-Centric Human Proteome Project.

    PubMed

    Jumeau, Fanny; Com, Emmanuelle; Lane, Lydie; Duek, Paula; Lagarrigue, Mélanie; Lavigne, Régis; Guillot, Laëtitia; Rondel, Karine; Gateau, Alain; Melaine, Nathalie; Guével, Blandine; Sergeant, Nicolas; Mitchell, Valérie; Pineau, Charles

    2015-09-01

    The Chromosome-Centric Human Proteome Project (C-HPP) aims at cataloguing the proteins as gene products encoded by the human genome in a chromosome-centric manner. The existence of products of about 82% of the genes has been confirmed at the protein level. However, the number of so-called "missing proteins" remains significant. It was recently suggested that the expression of proteins that have been systematically missed might be restricted to particular organs or cell types, for example, the testis. Testicular function, and spermatogenesis in particular, is conditioned by the successive activation or repression of thousands of genes and proteins including numerous germ cell- and testis-specific products. Both the testis and postmeiotic germ cells are thus promising sites at which to search for missing proteins, and ejaculated spermatozoa are a potential source of proteins whose expression is restricted to the germ cell lineage. A trans-chromosome-based data analysis was performed to catalog missing proteins in total protein extracts from isolated human spermatozoa. We have identified and manually validated peptide matches to 89 missing proteins in human spermatozoa. In addition, we carefully validated three proteins that were scored as uncertain in the latest neXtProt release (09.19.2014). A focus was then given to the 12 missing proteins encoded on chromosomes 2 and 14, some of which may putatively play roles in ciliation and flagellum mechanistics. The expression pattern of C2orf57 and TEX37 was confirmed in the adult testis by immunohistochemistry. On the basis of transcript expression during human spermatogenesis, we further consider the potential for discovering additional missing proteins in the testicular postmeiotic germ cell lineage and in ejaculated spermatozoa. This project was conducted as part of the C-HPP initiatives on chromosomes 14 (France) and 2 (Switzerland). The mass spectrometry proteomics data have been deposited with the Proteome

  15. Chromosomal loci of 50 human keratinocyte cDNAs assigned by fluorescence in situ hybridization

    SciTech Connect

    Morishima, Yohich; Ariyama, Takeshi; Yamanishi, Kiyofumi

    1995-07-20

    The chromosomal loci of expressed genes provide useful information for a candidate gene approach to the genes responsible for genetic diseases. A large set of randomly isolated cDNAs catalogued by partial sequencing can serve as a resource for accessing and isolating these disease genes. Using fluorescence in situ hybridization, we examined the chromosomal loci of 217 human keratinocyte-derived cDNAs, with independent novel sequence tags at the 3{prime} end region. Among them, we determined the loci of 50 cDNAs. Single-pass sequencing of these from the 5{prime} ends indicated that 39 cDNAs still can be produced for new genes. These cDNAs with identified chromosomal loci are powerful tools that can be used to help elucidate the genes responsible for hereditary skin disorders. 42 refs., 3 figs., 2 tabs.

  16. Structural organisation and chromosomal mapping of the human Id-3 gene.

    PubMed

    Deed, R W; Hirose, T; Mitchell, E L; Santibanez-Koref, M F; Norton, J D

    1994-12-30

    The helix-loop-helix (HLH) family of transcription factors plays a central role in the regulation of cell growth, differentiation and tumourigenesis. Members of the Id (inhibitor of DNA binding) class of these nuclear proteins are able to heterodimerise with and thereby antagonise the functions of other transcription factors of this family. We report here on the genomic organisation of the human Id3 (HLH 1R21/heir1) gene. Comparison with the two other mammalian Id genes, Id1 and Id2, reveals a highly conserved protein coding gene organisation consistent with evolution from a common, ancestral Id-like gene. In addition, by using a yeast artificial chromosome (YAC) clone of Id3, we have fine-scale mapped the gene to chromosome band 1p36.1 by fluorescence in situ hybridisation (FISH) and, using the same FISH technique, we have detected heterogeneity in tumour-associated 1p36 chromosome translocations.

  17. International study of factors affecting human chromosome translocations

    PubMed Central

    Sigurdson, Alice J.; Ha, Mina; Hauptmann, Michael; Bhatti, Parveen; Sram, Radim J.; Beskid, Olena; Tawn, E. Janet; Whitehouse, Caroline A.; Lindholm, Carita; Nakano, Mimako; Kodama, Yoshiaki; Nakamura, Nori; Vorobtsova, Irena; Oestreicher, Ursula; Stephan, Günther; Yong, Lee C.; Bauchinger, Manfred; Schmid, Ernst; Chung, Hai Won; Darroudi, Firouz; Roy, Laurence; Voisin, Phillipe; Barquinero, Joan F.; Livingston, Gordon; Blakey, David; Hayata, Isamu; Zhang, Wei; Wang, Chunyan; Bennett, L. Michelle; Littlefield, L. Gayle; Edwards, Alan A.; Kleinerman, Ruth A.; Tucker, James D.

    2009-01-01

    Chromosome translocations in peripheral blood lymphocytes of normal, healthy humans increase with age, but the effects of gender, race, and cigarette smoking on background translocation yields have not been examined systematically. Further, the shape of the relationship between age and translocation frequency (TF) has not been definitively determined. We collected existing data from sixteen laboratories in North America, Europe, and Asia on TFs measured in peripheral blood lymphocytes by fluorescence in situ hybridization whole chromosome painting among 1933 individuals. In Poisson regression models, age, ranging from newborns (cord blood) to 85 years, was strongly associated with TF and this relationship showed significant upward curvature at older ages vs. a linear relationship (p <0.001). Ever smokers had significantly higher TFs than non-smokers (rate ratio (RR) = 1.19, 95% confidence interval (CI), 1.09–1.30) and smoking modified the effect of age on TFs with a steeper age-related increase among ever smokers compared to non-smokers (p<0.001). TFs did not differ by gender. Interpreting an independent effect of race was difficult owing to laboratory variation. Our study is three times larger than any pooled effort to date, confirming a suspected curvilinear relationship of TF with age. The significant effect of cigarette smoking has not been observed with previous pooled studies of TF in humans. Our data provide stable estimates of background TF by age, gender, race, and smoking status and suggest an acceleration of chromosome damage above age 60 and among those with a history of smoking cigarettes. PMID:18337160

  18. Independent Histories of Human Y Chromosomes from Melanesia and Australia

    PubMed Central

    Kayser, Manfred; Brauer, Silke; Weiss, Gunter; Schiefenhövel, Wulf; Underhill, Peter A.; Stoneking, Mark

    2001-01-01

    To investigate the origins and relationships of Australian and Melanesian populations, 611 males from 18 populations from Australia, Melanesia, and eastern/southeastern Asia were typed for eight single-nucleotide polymorphism (SNP) loci and seven short tandem-repeat loci on the Y chromosome. A unique haplotype, DYS390.1del/RPS4Y711T, was found at a frequency of 53%–69% in Australian populations, whereas the major haplotypes found in Melanesian populations (M4G/M5T/M9G and DYS390.3del/RPS4Y711T) are absent from the Australian populations. The Y-chromosome data thus indicate independent histories for Australians and Melanesians, a finding that is in agreement with evidence from mtDNA but that contradicts some analyses of autosomal loci, which show a close relationship between Australian and Melanesian (specifically, highland Papua New Guinean) populations. Since the Australian and New Guinean landmasses were connected when first colonized by humans ⩾50,000 years ago but separated some 8,000 years ago, a possible way to reconcile all the genetic data is to infer that the Y-chromosome and mtDNA results reflect the past 8,000 years of independent history for Australia and New Guinea, whereas the autosomal loci reflect the long preceding period of common origin and shared history. Two Y-chromosome haplotypes (M119C/M9G and M122C/M9G) that originated in eastern/southeastern Asia are present in coastal and island Melanesia but are rare or absent in both Australia and highland Papua New Guinea. This distribution, along with demographic analyses indicating that population expansions for both haplotypes began ∼4,000–6,000 years ago, suggests that these haplotypes were brought to Melanesia by the Austronesian expansion. Most of the populations in this study were previously typed for mtDNA SNPs; population differentiation is greater for the Y chromosome than for mtDNA and is significantly correlated with geographic distance, a finding in agreement with results of

  19. Convergent evolution of chicken Z and human X chromosomes by expansion and gene acquisition.

    PubMed

    Bellott, Daniel W; Skaletsky, Helen; Pyntikova, Tatyana; Mardis, Elaine R; Graves, Tina; Kremitzki, Colin; Brown, Laura G; Rozen, Steve; Warren, Wesley C; Wilson, Richard K; Page, David C

    2010-07-29

    In birds, as in mammals, one pair of chromosomes differs between the sexes. In birds, males are ZZ and females ZW. In mammals, males are XY and females XX. Like the mammalian XY pair, the avian ZW pair is believed to have evolved from autosomes, with most change occurring in the chromosomes found in only one sex--the W and Y chromosomes. By contrast, the sex chromosomes found in both sexes--the Z and X chromosomes--are assumed to have diverged little from their autosomal progenitors. Here we report findings that challenge this assumption for both the chicken Z chromosome and the human X chromosome. The chicken Z chromosome, which we sequenced essentially to completion, is less gene-dense than chicken autosomes but contains a massive tandem array containing hundreds of duplicated genes expressed in testes. A comprehensive comparison of the chicken Z chromosome with the finished sequence of the human X chromosome demonstrates that each evolved independently from different portions of the ancestral genome. Despite this independence, the chicken Z and human X chromosomes share features that distinguish them from autosomes: the acquisition and amplification of testis-expressed genes, and a low gene density resulting from an expansion of intergenic regions. These features were not present on the autosomes from which the Z and X chromosomes originated but were instead acquired during the evolution of Z and X as sex chromosomes. We conclude that the avian Z and mammalian X chromosomes followed convergent evolutionary trajectories, despite their evolving with opposite (female versus male) systems of heterogamety. More broadly, in birds and mammals, sex chromosome evolution involved not only gene loss in sex-specific chromosomes, but also marked expansion and gene acquisition in sex chromosomes common to males and females.

  20. The Biological Effectiveness of Four Energies of Neon Ions for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    George, Kerry; Hada, Megumi; Cucinotta, F. A.

    2011-01-01

    Chromosomal aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to neon ions at energies of 64, 89, 142, or 267. The corresponding LET values for these energies of neon ranged from 38-103 keV/micrometers and doses delivered were in the 10 to 80 cGy range. Chromosome exchanges were assessed in metaphase and G2 phase cells at first division after exposure using fluorescence in situ hybridization (FISH) with whole chromosome probes and dose response curves were generated for different types of chromosomal exchanges. The yields of total chromosome exchanges were similar for the 64, 89, and 142 MeV exposures, whereas the 267 MeV/u neon with LET of 38 keV/micrometers produced about half as many exchanges per unit dose. The induction of complex type chromosome exchanges (exchanges involving three or more breaks and two or more chromosomes) showed a clear LET dependence for all energies. The ratio of simple to complex type exchanges increased with LET from 18 to 51%. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose response curve for chromosome damage with respect to gamma-rays. The RBE(sub max) values for total chromosome exchanges for the 64 MeV/u was around 30.

  1. Chromosomal instability, tolerance of mitotic errors and multidrug resistance are promoted by tetraploidization in human cells

    PubMed Central

    Kuznetsova, Anastasia Y; Seget, Katarzyna; Moeller, Giuliana K; de Pagter, Mirjam S.; de Roos, Jeroen A D M; Dürrbaum, Milena; Kuffer, Christian; Müller, Stefan; Zaman, Guido J R; Kloosterman, Wigard P; Storchová, Zuzana

    2015-01-01

    Up to 80% of human cancers, in particular solid tumors, contain cells with abnormal chromosomal numbers, or aneuploidy, which is often linked with marked chromosomal instability. Whereas in some tumors the aneuploidy occurs by missegregation of one or a few chromosomes, aneuploidy can also arise during proliferation of inherently unstable tetraploid cells generated by whole genome doubling from diploid cells. Recent findings from cancer genome sequencing projects suggest that nearly 40% of tumors underwent whole genome doubling at some point of tumorigenesis, yet its contribution to cancer phenotypes and benefits for malignant growth remain unclear. Here, we investigated the consequences of a whole genome doubling in both cancerous and non-transformed p53 positive human cells. SNP array analysis and multicolor karyotyping revealed that induced whole-genome doubling led to variable aneuploidy. We found that chromosomal instability (CIN) is a frequent, but not a default outcome of whole genome doubling. The CIN phenotypes were accompanied by increased tolerance to mitotic errors that was mediated by suppression of the p53 signaling. Additionally, the expression of pro-apoptotic factors, such as iASPP and cIAP2, was downregulated. Furthermore, we found that whole genome doubling promotes resistance to a broad spectrum of chemotherapeutic drugs and stimulates anchorage-independent growth even in non-transformed p53-positive human cells. Taken together, whole genome doubling provides multifaceted benefits for malignant growth. Our findings provide new insight why genome-doubling promotes tumorigenesis and correlates with poor survival in cancer. PMID:26151317

  2. A PCR-based genetic linkage map of human chromosome 16

    SciTech Connect

    Shen, Y.; Kozman, H.M.; Thompson, A.

    1994-07-01

    A high-resolution cytogenetic-based physical map and a genetic linkage map of human chromosome 16 have been developed based on 79 PCR-typable genetic markers and 2 Southern-based RFLP markers. The PCR-based markers were previously-characterized polymorphic (AC){sub n} repeats. Two approaches have led to the characterization of 47 highly informative genetic markers spread along chromosome 16, some of which are closely linked to disease loci. In addition, 22 markers (D16S401-423) previously genetically mapped were also physically mapped. Ten markers characterized by other laboratories were physically mapped and genotyped on the CEPH families. These 32 markers were incorporated into the PCR-based map. Seventy-two markers have heterozygosities >0.50 and 51 of these markers >0.70. By multipoint linkage analysis a framework genetic map and a comprehensive genetic map were constructed. The length of the sex-averaged framework genetic map if 152.1 cM. The average distance and the median distance between markers on this map are 3.2 and 2.7 cM, respectively, and the largest gap is 15.9 cM. These maps were anchored to the high-resolution cytogenetic map (on average 1.5 Mb per interval). Together these integrated genetic and physical maps of human chromosome 16 provide the basis for the localization and ultimately the isolation of disease genes that map to this chromosome. 1 fig., 3 tabs.

  3. Distribution of chromosome 18 and X centric heterochromatin in the interphase nucleus of cultured human cells

    SciTech Connect

    Popp, S.; Scholl, H.P.; Loos, P.; Jauch, A.; Cremer, C.; Cremer, T. ); Stelzer, E. )

    1990-07-01

    In situ hybridization of human chromosome 18 and X-specific alphoid DNA-probes was performed in combination with three dimensional (3D) and two dimensional (2D) image analysis to study the interphase distribution of the centric heterochromatin (18c and Xc) of these chromosomes in cultured human cells. 3D analyses of 18c targets using confocal laser scanning microscopy indicated a nonrandom disposition in 73 amniotic fluid cell nuclei. In agreement with the 3D observations 18c targets were found significantly closer to the center of the 2D nuclear image (CNI) and to each other in all these cultures compared to a random distribution derived from corresponding ellipsoid or cylinder model nuclei. For comparison, a chromosome X-specific alphoid DNA probe was used to investigate the 2D distribution of chromosome X centric heterochromatin in the same cell types. Two dimensional Xc-Xc and Xc-CNI distances fit a random distribution in diploid normal and Bloom's syndrome nuclei, as well as in nuclei with trisomy X. The different distributions of 18c and Xc targets were confirmed by the simultaneous staining of these targets in different colors within individual nuclei using a double in situ hybridization approach.

  4. Characterization of putative human homologues of the yeast chromosome transmission fidelity gene, CHL1.

    PubMed

    Amann, J; Kidd, V J; Lahti, J M

    1997-02-01

    Helicases are components of numerous protein complexes, including those regulating transcription, translation, DNA replication and repair, splicing, and mitotic chromosome transmission. Helicases unwind double-stranded DNA and RNA homo- and hetero-duplexes. The yeast CHL1 helicase has been linked to maintenance of the high fidelity of chromosome transmission during mitosis. Mutations in this gene result in a 200-fold increase in the rate of aberrant chromosome segregation with a concomitant delay in the cell cycle at G2-M, suggesting that CHL1 is required for the maintenance of proper chromosome transmission. Two highly related human cDNA clones encoding proteins which are homologous to the yeast CHL1 gene product have been isolated. Here we show that these two distinct human CHL1-related mRNAs and proteins (hCHLR1 and hCHLR2) are expressed only in proliferating human cell lines. Quiescent normal human fibroblasts stimulated to re-enter the cell cycle by addition of serum begin to express the CHL1-related proteins as the cells enter S phase, concomitant with the expression of proliferating cell nuclear antigen. Furthermore, expression of the CHL1-related mRNAs is lost when human K562 cells cease to proliferate and terminally differentiate in response to phorbol ester treatments. Human hCHLR expression is not extinguished during hemin-induced differentiation of the same cell line, which produces erythrocyte-like cells that continue to proliferate. These experiments are consistent with the requirement of this putative helicase during either S or G2-M phase but not G1. In vitro transcribed and translated hCHLR1 protein binds to both single- and double-stranded DNA, supporting the possibility that these proteins are DNA helicases. Finally, affinity-purified hCHLR1 antisera was used to demonstrate the localization of the hCHLR proteins to the nucleolus by indirect immunofluorescence as well as by cell fractionation.

  5. Cloning of the human SIX1 gene and its assignment to chromosome 14

    SciTech Connect

    Boucher, C.A.; Carey, N.; Edwards, Y.H.

    1996-04-01

    The recently described murine homeobox genes, Six1 and Six2, which are expressed during development in limb tendons, have also been shown to be expressed in skeletal and smooth muscle, respectively. We have cloned and sequenced a human SIX1 cDNA and shown by Northern blotting that it is expressed in adult skeletal muscle. The cDNA sequence and predicted protein sequence of SIX1 and Six1 are highly homologous, with 98% similarity over the entire predicted amino acid sequence. SIX1 was mapped to human chromosome 14 using a rodent/human somatic cell hybrid panel. 7 refs., 2 figs.

  6. A Revised Root for the Human Y Chromosomal Phylogenetic Tree: The Origin of Patrilineal Diversity in Africa

    PubMed Central

    Cruciani, Fulvio; Trombetta, Beniamino; Massaia, Andrea; Destro-Bisol, Giovanni; Sellitto, Daniele; Scozzari, Rosaria

    2011-01-01

    To shed light on the structure of the basal backbone of the human Y chromosome phylogeny, we sequenced about 200 kb of the male-specific region of the human Y chromosome (MSY) from each of seven Y chromosomes belonging to clades A1, A2, A3, and BT. We detected 146 biallelic variant sites through this analysis. We used these variants to construct a patrilineal tree, without taking into account any previously reported information regarding the phylogenetic relationships among the seven Y chromosomes here analyzed. There are several key changes at the basal nodes as compared with the most recent reference Y chromosome tree. A different position of the root was determined, with important implications for the origin of human Y chromosome diversity. An estimate of 142 KY was obtained for the coalescence time of the revised MSY tree, which is earlier than that obtained in previous studies and easier to reconcile with plausible scenarios of modern human origin. The number of deep branchings leading to African-specific clades has doubled, further strengthening the MSY-based evidence for a modern human origin in the African continent. An analysis of 2204 African DNA samples showed that the deepest clades of the revised MSY phylogeny are currently found in central and northwest Africa, opening new perspectives on early human presence in the continent. PMID:21601174

  7. Wolfram syndrome maps to distal human chromosome 4p

    SciTech Connect

    Polymeropoulos, M.H.; Swift, R.; Swift, M.

    1994-09-01

    Wolfram syndrome (MIM 222300) is an autosomal recessive disorder defined by the occurrence of diabetes mellitus and progressive bilateral optic atrophy. Wolfram syndrome homozygotes develop widespread nervous system abnormalities; in particular, they exhibit severe behavioral difficulties that often lead to suicide attempts or psychiatric hospitalizations. The Wolfram syndrome gene also predisposes heterozygous carriers to psychiatric disorders. Since these heterozygotes are common in the general population, the Wolfram syndrome gene may contribute significantly to the overall burden of psychiatric illness. Based on a linkage analysis of 11 families segregating for this syndrome, using microsatellite repeat polymorphisms throughout the human genome, we found the Wolfram syndrome gene to be linked to markers on the short arm of human chromosome 4, with Zmax=6.46 at {theta}=0.02 for marker D4S431.

  8. Chromosome abnormalities in human arrested preimplantation embryos: A multiple-probe FISH study

    SciTech Connect

    Munne, S.; Grifo, J.; Cohen, J. ); Weier, H.U.G. )

    1994-07-01

    Numerical chromosome abnormalities were studied in single blastomeres from arrested or otherwise morphologically abnormal human preimplantation embryos. A 6-h FISH procedure with fluorochrome-labeled DNA probes was developed to determine numerical abnormalities of chromosomes X, Y, and 18. The three chromosomes were stained and detected simultaneously in 571 blastomeres from 131 embryos. Successful analysis including biopsy, fixation, and FISH analysis was achieved in 86.5% of all blastomeres. The procedure described here offers a reliable alternative to sexing of embryos by PCR and allows simultaneous ploidy assessment. For the three chromosomes tested, numerical aberrations were found in 56.5% of the embroys. Most abnormal embryos were polyploid or mosaics, and 6.1% were aneuploid for gonosomes or chromosome 18. Extrapolation of these results to all human chromosomes suggests that the majority of abnormally developing and arrested human embryos carry numerical chromosome abnormalities. 44 refs., 1 fig., 4 tabs.

  9. Mapping the Stability of Human Brain Asymmetry across Five Sex-Chromosome Aneuploidies

    PubMed Central

    Lin, Amy; Clasen, Liv; Lee, Nancy Raitano; Wallace, Gregory L.; Lalonde, Francois; Blumenthal, Jonathan; Giedd, Jay N.

    2015-01-01

    The human brain displays stereotyped and early emerging patterns of cortical asymmetry in health. It is unclear if these asymmetries are highly sensitive to genetic and environmental variation or fundamental features of the brain that can survive severe developmental perturbations. To address this question, we mapped cortical thickness (CT) asymmetry in a group of genetically defined disorders known to impact CT development. Participants included 137 youth with one of five sex-chromosome aneuploidies [SCAs; XXX (n = 28), XXY (n = 58), XYY (n = 26), XXYY (n = 20), and XXXXY (n = 5)], and 169 age-matched typically developing controls (80 female). In controls, we replicated previously reported rightward inferior frontal and leftward lateral parietal CT asymmetry. These opposing frontoparietal CT asymmetries were broadly preserved in all five SCA groups. However, we also detected foci of shifting CT asymmetry with aneuploidy, which fell almost exclusively within regions of significant CT asymmetry in controls. Specifically, X-chromosome aneuploidy accentuated normative rightward inferior frontal asymmetries, while Y-chromosome aneuploidy reversed normative rightward medial prefrontal and lateral temporal asymmetries. These findings indicate that (1) the stereotyped normative pattern of opposing frontoparietal CT asymmetry arises from developmental mechanisms that can withstand gross chromosomal aneuploidy and (2) X and Y chromosomes can exert focal, nonoverlapping and directionally opposed influences on CT asymmetry within cortical regions of significant asymmetry in health. Our study attests to the resilience of developmental mechanisms that support the global patterning of CT asymmetry in humans, and motivates future research into the molecular bases and functional consequences of sex chromosome dosage effects on CT asymmetry. PMID:25568109

  10. Mapping the stability of human brain asymmetry across five sex-chromosome aneuploidies.

    PubMed

    Lin, Amy; Clasen, Liv; Lee, Nancy Raitano; Wallace, Gregory L; Lalonde, Francois; Blumenthal, Jonathan; Giedd, Jay N; Raznahan, Armin

    2015-01-01

    The human brain displays stereotyped and early emerging patterns of cortical asymmetry in health. It is unclear if these asymmetries are highly sensitive to genetic and environmental variation or fundamental features of the brain that can survive severe developmental perturbations. To address this question, we mapped cortical thickness (CT) asymmetry in a group of genetically defined disorders known to impact CT development. Participants included 137 youth with one of five sex-chromosome aneuploidies [SCAs; XXX (n = 28), XXY (n = 58), XYY (n = 26), XXYY (n = 20), and XXXXY (n = 5)], and 169 age-matched typically developing controls (80 female). In controls, we replicated previously reported rightward inferior frontal and leftward lateral parietal CT asymmetry. These opposing frontoparietal CT asymmetries were broadly preserved in all five SCA groups. However, we also detected foci of shifting CT asymmetry with aneuploidy, which fell almost exclusively within regions of significant CT asymmetry in controls. Specifically, X-chromosome aneuploidy accentuated normative rightward inferior frontal asymmetries, while Y-chromosome aneuploidy reversed normative rightward medial prefrontal and lateral temporal asymmetries. These findings indicate that (1) the stereotyped normative pattern of opposing frontoparietal CT asymmetry arises from developmental mechanisms that can withstand gross chromosomal aneuploidy and (2) X and Y chromosomes can exert focal, nonoverlapping and directionally opposed influences on CT asymmetry within cortical regions of significant asymmetry in health. Our study attests to the resilience of developmental mechanisms that support the global patterning of CT asymmetry in humans, and motivates future research into the molecular bases and functional consequences of sex chromosome dosage effects on CT asymmetry.

  11. An Allometric Analysis of Sex and Sex Chromosome Dosage Effects on Subcortical Anatomy in Humans.

    PubMed

    Reardon, Paul Kirkpatrick; Clasen, Liv; Giedd, Jay N; Blumenthal, Jonathan; Lerch, Jason P; Chakravarty, M Mallar; Raznahan, Armin

    2016-02-24

    Structural neuroimaging of humans with typical and atypical sex-chromosome complements has established the marked influence of both Yand X-/Y-chromosome dosage on total brain volume (TBV) and identified potential cortical substrates for the psychiatric phenotypes associated with sex-chromosome aneuploidy (SCA). Here, in a cohort of 354 humans with varying karyotypes (XX, XY, XXX, XXY, XYY, XXYY, XXXXY), we investigate sex and SCA effects on subcortical size and shape; focusing on the striatum, pallidum and thalamus. We find large effect-size differences in the volume and shape of all three structures as a function of sex and SCA. We correct for TBV effects with a novel allometric method harnessing normative scaling rules for subcortical size and shape in humans, which we derive here for the first time. We show that all three subcortical volumes scale sublinearly with TBV among healthy humans, mirroring known relationships between subcortical volume and TBV among species. Traditional TBV correction methods assume linear scaling and can therefore invert or exaggerate sex and SCA effects on subcortical anatomy. Allometric analysis restricts sex-differences to: (1) greater pallidal volume (PV) in males, and (2) relative caudate head expansion and ventral striatum contraction in females. Allometric analysis of SCA reveals that supernumerary X- and Y-chromosomes both cause disproportionate reductions in PV, and coordinated deformations of striatopallidal shape. Our study provides a novel understanding of sex and sex-chromosome dosage effects on subcortical organization, using an allometric approach that can be generalized to other basic and clinical structural neuroimaging settings.

  12. An Allometric Analysis of Sex and Sex Chromosome Dosage Effects on Subcortical Anatomy in Humans.

    PubMed

    Reardon, Paul Kirkpatrick; Clasen, Liv; Giedd, Jay N; Blumenthal, Jonathan; Lerch, Jason P; Chakravarty, M Mallar; Raznahan, Armin

    2016-02-24

    Structural neuroimaging of humans with typical and atypical sex-chromosome complements has established the marked influence of both Yand X-/Y-chromosome dosage on total brain volume (TBV) and identified potential cortical substrates for the psychiatric phenotypes associated with sex-chromosome aneuploidy (SCA). Here, in a cohort of 354 humans with varying karyotypes (XX, XY, XXX, XXY, XYY, XXYY, XXXXY), we investigate sex and SCA effects on subcortical size and shape; focusing on the striatum, pallidum and thalamus. We find large effect-size differences in the volume and shape of all three structures as a function of sex and SCA. We correct for TBV effects with a novel allometric method harnessing normative scaling rules for subcortical size and shape in humans, which we derive here for the first time. We show that all three subcortical volumes scale sublinearly with TBV among healthy humans, mirroring known relationships between subcortical volume and TBV among species. Traditional TBV correction methods assume linear scaling and can therefore invert or exaggerate sex and SCA effects on subcortical anatomy. Allometric analysis restricts sex-differences to: (1) greater pallidal volume (PV) in males, and (2) relative caudate head expansion and ventral striatum contraction in females. Allometric analysis of SCA reveals that supernumerary X- and Y-chromosomes both cause disproportionate reductions in PV, and coordinated deformations of striatopallidal shape. Our study provides a novel understanding of sex and sex-chromosome dosage effects on subcortical organization, using an allometric approach that can be generalized to other basic and clinical structural neuroimaging settings. PMID:26911691

  13. Localization of two metabotropic glutamate receptor genes, GRM3 and GRM8, to human chromosome 7q

    SciTech Connect

    Scherer, S.W.; Heng, H.H.Q.; Lap-Chee Tsui

    1996-01-15

    Metabotropic glutamate receptors (GRMs) are neutrotransmitter receptors that respond to glutamate stimulations by activating GTP-binding proteins and modulating second-messenger cascades. Eight related GRMs have been identified to date. In this study, we have mapped GRM3 and GRM8 to human chromosome 7q21.1-q21.2 and 7q31.3-q32.1, respectively, using somatic cell hybrid and fluorescence in situ hybridization analysis. A yeast artificial chromosome contig was constructed surrounding the genes, allowing their location to be integrated into the genetic and physical map of chromosome 7. 20 refs., 2 figs.

  14. Independent intrachromosomal recombination events underlie the pericentric inversions of chimpanzee and gorilla chromosomes homologous to human chromosome 16.

    PubMed

    Goidts, Violaine; Szamalek, Justyna M; de Jong, Pieter J; Cooper, David N; Chuzhanova, Nadia; Hameister, Horst; Kehrer-Sawatzki, Hildegard

    2005-09-01

    Analyses of chromosomal rearrangements that have occurred during the evolution of the hominoids can reveal much about the mutational mechanisms underlying primate chromosome evolution. We characterized the breakpoints of the pericentric inversion of chimpanzee chromosome 18 (PTR XVI), which is homologous to human chromosome 16 (HSA 16). A conserved 23-kb inverted repeat composed of satellites, LINE and Alu elements was identified near the breakpoints and could have mediated the inversion by bringing the chromosomal arms into close proximity with each other, thereby facilitating intrachromosomal recombination. The exact positions of the breakpoints may then have been determined by local DNA sequence homologies between the inversion breakpoints, including a 22-base pair direct repeat. The similarly located pericentric inversion of gorilla (GGO) chromosome XVI, was studied by FISH and PCR analysis. The p- and q-arm breakpoints of the inversions in PTR XVI and GGO XVI were found to occur at slightly different locations, consistent with their independent origin. Further, FISH studies of the homologous chromosomal regions in macaque and orangutan revealed that the region represented by HSA BAC RP11-696P19, which spans the inversion breakpoint on HSA 16q11-12, was derived from the ancestral primate chromosome homologous to HSA 1. After the divergence of orangutan from the other great apes approximately 12 million years ago (Mya), a duplication of the corresponding region occurred followed by its interchromosomal transposition to the ancestral chromosome 16q. Thus, the most parsimonious interpretation is that the gorilla and chimpanzee homologs exhibit similar but nonidentical derived pericentric inversions, whereas HSA 16 represents the ancestral form among hominoids.

  15. An Allometric Analysis of Sex and Sex Chromosome Dosage Effects on Subcortical Anatomy in Humans

    PubMed Central

    Clasen, Liv; Giedd, Jay N.; Blumenthal, Jonathan; Lerch, Jason P.; Chakravarty, M. Mallar; Raznahan, Armin

    2016-01-01

    Structural neuroimaging of humans with typical and atypical sex-chromosome complements has established the marked influence of both Yand X-/Y-chromosome dosage on total brain volume (TBV) and identified potential cortical substrates for the psychiatric phenotypes associated with sex-chromosome aneuploidy (SCA). Here, in a cohort of 354 humans with varying karyotypes (XX, XY, XXX, XXY, XYY, XXYY, XXXXY), we investigate sex and SCA effects on subcortical size and shape; focusing on the striatum, pallidum and thalamus. We find large effect-size differences in the volume and shape of all three structures as a function of sex and SCA. We correct for TBV effects with a novel allometric method harnessing normative scaling rules for subcortical size and shape in humans, which we derive here for the first time. We show that all three subcortical volumes scale sublinearly with TBV among healthy humans, mirroring known relationships between subcortical volume and TBV among species. Traditional TBV correction methods assume linear scaling and can therefore invert or exaggerate sex and SCA effects on subcortical anatomy. Allometric analysis restricts sex-differences to: (1) greater pallidal volume (PV) in males, and (2) relative caudate head expansion and ventral striatum contraction in females. Allometric analysis of SCA reveals that supernumerary X- and Y-chromosomes both cause disproportionate reductions in PV, and coordinated deformations of striatopallidal shape. Our study provides a novel understanding of sex and sex-chromosome dosage effects on subcortical organization, using an allometric approach that can be generalized to other basic and clinical structural neuroimaging settings. SIGNIFICANCE STATEMENT Sex and sex-chromosome dosage (SCD) are known to modulate human brain size and cortical anatomy, but very little is known regarding their impact on subcortical structures that work with the cortex to subserve a range of behaviors in health and disease. Moreover

  16. “Genome-wide recombination and chromosome segregation in human oocytes and embryos reveal selection for maternal recombination rates”

    PubMed Central

    Natesan, Senthilkumar A.; Joshi, Hrishikesh A.; Cimadomo, Danilo; Griffin, Darren K.; Sage, Karen; Summers, Michael C.; Thornhill, Alan R.; Housworth, Elizabeth; Herbert, Alex D.; Rienzi, Laura; Ubaldi, Filippo M.; Handyside, Alan H.; Hoffmann, Eva R.

    2015-01-01

    Crossover recombination reshuffles genes and prevents errors in segregation that lead to extra or missing chromosomes (aneuploidy) in human eggs, a major cause of pregnancy failure and congenital disorders. Here, we generate genome-wide maps of crossovers and chromosome segregation patterns by recovering all three products of single female meioses. Genotyping > 4 million informative single-nucleotide polymorphisms (SNPs) from 23 complete meioses allowed us to map 2,032 maternal and 1,342 paternal crossovers and to infer the segregation patterns of 529 chromosome pairs. We uncover a novel reverse chromosome segregation pattern in which both homologs separate their sister chromatids at meiosis I; detect selection for higher recombination rates in the female germline by the elimination of aneuploid embryos; and report chromosomal drive against non-recombinant chromatids at meiosis II. Collectively, our findings reveal that recombination not only affects homolog segregation at meiosis I but also the fate of sister chromatids at meiosis II. PMID:25985139

  17. Genetic heterogeneity of gingival fibromatosis on chromosome 2p

    PubMed Central

    Shashi, V.; Pallos, D.; Pettenati, M.; Cortelli, J.; Fryns, J.; von Kap-Herr, C.; Hart, T.

    1999-01-01

    Gingival fibromatosis (GF) occurs in several genetic forms as a simple Mendelian trait, in malformation syndromes, and in some chromosomal disorders. Specific genes responsible for GF have not been identified. An autosomal dominant form of hereditary gingival fibromatosis (HGF, MIM 135300) was recently mapped to chromosome 2p21 in a large Brazilian family and there was an earlier report of GF in a boy with a cytogenetic duplication involving 2p13→p21. We thus hypothesised that a common gene locus may be responsible for GF in both the Brazilian family and the boy with the chromosome 2p duplication. We performed additional genetic linkage studies on the Brazilian family and molecular cytogenetic studies on the patient with the cytogenetic duplication to correlate more precisely the genetic interval of the HGF phenotype with the duplicated 2p interval. Additional linkage analysis of new family members resulted in refinement of the candidate region for HGF to an 8 Mb region. Molecular cytogenetic analysis of the 2p13→p21 duplication associated with GF showed that the duplicated region was proximal to the candidate interval for HGF. Thus, our results support the presence of two different gene loci on chromosome 2p that are involved in GF.


Keywords: gingival fibromatosis; chromosome duplication; chromosome 2 PMID:10507724

  18. Cloning of the cDNA for the human ATP synthase OSCP subunit (ATP5O) by exon trapping and mapping to chromosome 21q22.1-q22.2

    SciTech Connect

    Chen, Haiming; Morris, M.A.; Rossier, C.

    1995-08-10

    Exon trapping was used to clone portions of potential genes from human chromosome 21. One trapped sequence showed striking homology with the bovine and rat ATP synthase OSCP (oligomycin sensitivity conferring protein) subunit. We subsequently cloned the full-length human ATP synthase OSCP cDNA (GDB/HGMW approved name ATP50) from infant brain and muscle libraries and determined its nucleotide and deduced amino acid sequence (EMBL/GenBank Accession No. X83218). The encoded polypeptide contains 213 amino acids, with more than 80% identity to bovine and murine ATPase OSCP subunits and over 35% identity to Saccharomyces cerevisiae and sweet potato sequences. The human ATP5O gene is located at 21q22.1-q22.2, just proximal to D21S17, in YACs 860G11 and 838C7 of the Chumakov et al. YAC contig. The gene is expressed in all human tissues examined, most strongly in muscle and heart. This ATP5O subunit is a key structural component of the stalk of the mitochondrial respiratory chain F{sub 1}F{sub 0}-ATP synthase and as such may contribute in a gene dosage-dependent manner to the phenotype of Down syndrome (trisomy 21). 39 refs., 5 figs.

  19. Genome-wide significant schizophrenia risk variation on chromosome 10q24 is associated with altered cis-regulation of BORCS7, AS3MT, and NT5C2 in the human brain.

    PubMed

    Duarte, Rodrigo R R; Troakes, Claire; Nolan, Matthew; Srivastava, Deepak P; Murray, Robin M; Bray, Nicholas J

    2016-09-01

    Chromosome 10q24.32-q24.33 is one of the most robustly supported risk loci to emerge from genome-wide association studies (GWAS) of schizophrenia. However, extensive linkage disequilibrium makes it difficult to distinguish the actual susceptibility gene(s) at the locus, limiting its value for improving biological understanding of the condition. In the absence of coding changes that can account for the association, risk is likely conferred by altered regulation of one or more genes in the region. We, therefore, used highly sensitive measures of allele-specific expression to assess cis-regulatory effects associated with the two best-supported schizophrenia risk variants (SNP rs11191419 and indel ch10_104957618_I/rs202213518) on the primary positional candidates BORCS7, AS3MT, CNNM2, and NT5C2 in the human brain. Heterozygosity at rs11191419 was associated with increased allelic expression of BORCS7 and AS3MT in the fetal and adult brain, and with reduced allelic expression of NT5C2 in the adult brain. Heterozygosity at ch10_104957618_I was associated with reduced allelic expression of NT5C2 in both the fetal and adult brain. Comparisons between cDNA ratios in heterozygotes and homozygotes for the risk alleles indicated that cis-effects on NT5C2 expression in the adult dorsolateral prefrontal cortex could be largely accounted for by genotype at these two risk variants. While not excluding effects on other genes in the region, this study implicates altered neural expression of BORCS7, AS3MT, and NT5C2 in susceptibility to schizophrenia arising from genetic variation at the chromosome 10q24 locus. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc.

  20. Genome‐wide significant schizophrenia risk variation on chromosome 10q24 is associated with altered cis‐regulation of BORCS7, AS3MT, and NT5C2 in the human brain

    PubMed Central

    Duarte, Rodrigo R. R.; Troakes, Claire; Nolan, Matthew; Srivastava, Deepak P.; Murray, Robin M.

    2016-01-01

    Chromosome 10q24.32‐q24.33 is one of the most robustly supported risk loci to emerge from genome‐wide association studies (GWAS) of schizophrenia. However, extensive linkage disequilibrium makes it difficult to distinguish the actual susceptibility gene(s) at the locus, limiting its value for improving biological understanding of the condition. In the absence of coding changes that can account for the association, risk is likely conferred by altered regulation of one or more genes in the region. We, therefore, used highly sensitive measures of allele‐specific expression to assess cis‐regulatory effects associated with the two best‐supported schizophrenia risk variants (SNP rs11191419 and indel ch10_104957618_I/rs202213518) on the primary positional candidates BORCS7, AS3MT, CNNM2, and NT5C2 in the human brain. Heterozygosity at rs11191419 was associated with increased allelic expression of BORCS7 and AS3MT in the fetal and adult brain, and with reduced allelic expression of NT5C2 in the adult brain. Heterozygosity at ch10_104957618_I was associated with reduced allelic expression of NT5C2 in both the fetal and adult brain. Comparisons between cDNA ratios in heterozygotes and homozygotes for the risk alleles indicated that cis‐effects on NT5C2 expression in the adult dorsolateral prefrontal cortex could be largely accounted for by genotype at these two risk variants. While not excluding effects on other genes in the region, this study implicates altered neural expression of BORCS7, AS3MT, and NT5C2 in susceptibility to schizophrenia arising from genetic variation at the chromosome 10q24 locus. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc. PMID:27004590

  1. Three-dimensional reconstruction of painted human interphase chromosomes: active and inactive X chromosome territories have similar volumes but differ in shape and surface structure

    PubMed Central

    1996-01-01

    This study provides a three-dimensional (3D) analysis of differences between the 3D morphology of active and inactive human X interphase chromosomes (Xa and Xi territories). Chromosome territories were painted in formaldehyde-fixed, three-dimensionally intact human diploid female amniotic fluid cell nuclei (46, XX) with X-specific whole chromosome compositive probes. The colocalization of a 4,6-diamidino-2- phenylindole dihydrochloride-stained Barr body with one of the two painted X territories allowed the unequivocal discrimination of the inactive X from its active counterpart. Light optical serial sections were obtained with a confocal laser scanning microscope. 3D- reconstructed Xa territories revealed a flatter shape and exhibited a larger and more irregular surface when compared to the apparently smoother surface and rounder shape of Xi territories. The relationship between territory surface and volume was quantified by the determination of a dimensionless roundness factor (RF). RF and surface area measurements showed a highly significant difference between Xa and Xi territories (P < 0.001) in contrast to volume differences (P > 0.1). For comparison with an autosome of similar DNA content, chromosome 7 territories were additionally painted. The 3D morphology of the chromosome 7 territories was similar to the Xa territory but differed strongly from the Xi territory with respect to RF and surface area (P < 0.001). PMID:8978813

  2. Fine mapping of the human pentraxin gene region on chromosome 1q23

    SciTech Connect

    Walsh, M.T.; Whitehead, A.S.; Divane, A.

    1996-12-31

    The 1q21 to 25 region of human chromosome 1 contains genes which encode proteins with immune- and inflammation-associated functions. These include the pentraxin genes, for C-reactive protein (CRP), serum amyloid P(SAP) protein (APCS), and a CRP pseudogene (CRPP1). The region of chromosome 1 containing this cluster is syntenic with distal mouse chromosome 1. We constructed an approximately 1.4 megabase yeast artificial chromosome (YAC) contig with the pentraxin genes at its core. This four-YAC contig includes other genes with immune functions including the FCER1A gene, which encodes the {alpha}-subunit of the IgE high-affinity Fc receptor and the 1F1-16 gene, an interferon-{gamma}-induced gene. In addition, it contains the histone H3F2 and H4F2 genes and the gene for erythroid {alpha}-spectrin (SPTA1). The gene order is cen.-SPTA1-H4F2-H3F2-1F1-16-CRP-CRPP1-APCS-FCERIA-tel. The contig thus consists of a cluster of genes whose products either have immunological importance, bind DNA, or both. 68 refs., 3 figs., 2 tabs.

  3. Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation

    SciTech Connect

    Yang, Tracy Chui-hsu; Craise, L.M; Prioleau, J.C.; Stampfer, M.R.; Rhim, J.S.

    1990-11-01

    For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude nice. Neoplastic transformation was achieved by irradiation cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level. 15 refs., 9 figs., 2 tabs.

  4. Effect of borax on immune cell proliferation and sister chromatid exchange in human chromosomes

    PubMed Central

    Pongsavee, Malinee

    2009-01-01

    Background Borax is used as a food additive. It becomes toxic when accumulated in the body. It causes vomiting, fatigue and renal failure. Methods The heparinized blood samples from 40 healthy men were studied for the impact of borax toxicity on immune cell proliferation (lymphocyte proliferation) and sister chromatid exchange in human chromosomes. The MTT assay and Sister Chromatid Exchange (SCE) technic were used in this experiment with the borax concentrations of 0.1, 0.15, 0.2, 0.3 and 0.6 mg/ml. Results It showed that the immune cell proliferation (lymphocyte proliferation) was decreased when the concentrations of borax increased. The borax concentration of 0.6 mg/ml had the most effectiveness to the lymphocyte proliferation and had the highest cytotoxicity index (CI). The borax concentrations of 0.15, 0.2, 0.3 and 0.6 mg/ml significantly induced sister chromatid exchange in human chromosomes (P < 0.05). Conclusion Borax had effects on immune cell proliferation (lymphocyte proliferation) and induced sister chromatid exchange in human chromosomes. Toxicity of borax may lead to cellular toxicity and genetic defect in human. PMID:19878537

  5. Mapping and ordered cloning of the human X chromosome

    SciTech Connect

    Caskey, C.T.; Nelson, D.L.

    1992-12-01

    Progress is reported on gathering X chromosome specific libraries and integrating those with the library produced in this project. Further studies on understanding Fragile X Syndrome and other hereditary diseases related to the X chromosome are described. (DT)

  6. Structural variability of human chromosome 9 in relation to its evolution.

    PubMed

    Hansmann, I

    1976-03-12

    Human chromosome 9 shows a high susceptibility for structural rearrangements, particularly pericentric inversions, which often are transmitted. Three types of pericentric inversions can be observed on No. 9: 1) Type I, showing the total constitutive heterochromatin in the short arm. 2) Type II with part of the C heterochromatin on the short arm, the rest located on the long arm proximal to the centromere. 3) Type III: a subtelocentric chromosome with part of the C heterochromatin in the very short arm and the rest located interstitially on the long arm. With these inversions as well as with other structural rearrangements, e.g. translocations, the break-points are located preferentially within the C heterochromatin or close to the heterochromatic-euchromatic junctions. These findings are in contrast to the findings in lymphocytes from 5 patients with fancomi's and after irradiation in vitro, reported in the literature. In lymphocytes break-points seem to be distributed more or less by chance. These observations together led us to speculate that human chromosome 9 primarily was an acrocentric chrosome; in morphology and at least in some functions similar to D- and G-group chromosomes. During evolution this acrocentric chromsome changed to a submetacentric one due to a pericentric inversion.

  7. The Human Proteome Organization Chromosome 6 Consortium: Integrating chromosome-centric and biology/disease driven strategies

    PubMed Central

    Borchers, C.H.; Kast, J.; Foster, L.J.; Siu, K.W.M.; Overall, C.M.; Binkowski, T.A.; Hildebrand, W.H.; Scherer, A.; Mansoor, M.; Keown, P.A.

    2014-01-01

    The Human Proteome Project (HPP) is designed to generate a comprehensive map of the protein-based molecular architecture of the human body, to provide a resource to help elucidate biological and molecular function, and to advance diagnosis and treatment of diseases. Within this framework, the chromosome-based HPP (C-HPP) has allocated responsibility for mapping individual chromosomes by country or region, while the biology/disease HPP (B/D-HPP) coordinates these teams in cross-functional disease-based groups. Chromosome 6 (Ch6) provides an excellent model for integration of these two tasks. This metacentric chromosome has a complement of 1002–1034 genes that code for known, novel or putative proteins. Ch6 is functionally associated with more than 120 major human diseases, many with high population prevalence, devastating clinical impact and profound societal consequences. The unique combination of genomic, proteomic, metabolomic, phenomic and health services data being drawn together within the Ch6 program has enormous potential to advance personalized medicine by promoting robust biomarkers, subunit vaccines and new drug targets. The strong liaison between the clinical and laboratory teams, and the structured framework for technology transfer and health policy decisions within Canada will increase the speed and efficacy of this transition, and the value of this translational research. Biological significance Canada has been selected to play a leading role in the international Human Proteome Project, the global counterpart of the Human Genome Project designed to understand the structure and function of the human proteome in health and disease. Canada will lead an international team focusing on chromosome 6, which is functionally associated with more than 120 major human diseases, including immune and inflammatory disorders affecting the brain, skeletal system, heart and blood vessels, lungs, kidney, liver, gastrointestinal tract and endocrine system. Many of

  8. Cell-autonomous correction of ring chromosomes in human induced pluripotent stem cells

    NASA Astrophysics Data System (ADS)

    Bershteyn, Marina; Hayashi, Yohei; Desachy, Guillaume; Hsiao, Edward C.; Sami, Salma; Tsang, Kathryn M.; Weiss, Lauren A.; Kriegstein, Arnold R.; Yamanaka, Shinya; Wynshaw-Boris, Anthony

    2014-03-01

    Ring chromosomes are structural aberrations commonly associated with birth defects, mental disabilities and growth retardation. Rings form after fusion of the long and short arms of a chromosome, and are sometimes associated with large terminal deletions. Owing to the severity of these large aberrations that can affect multiple contiguous genes, no possible therapeutic strategies for ring chromosome disorders have been proposed. During cell division, ring chromosomes can exhibit unstable behaviour leading to continuous production of aneuploid progeny with low viability and high cellular death rate. The overall consequences of this chromosomal instability have been largely unexplored in experimental model systems. Here we generated human induced pluripotent stem cells (iPSCs) from patient fibroblasts containing ring chromosomes with large deletions and found that reprogrammed cells lost the abnormal chromosome and duplicated the wild-type homologue through the compensatory uniparental disomy (UPD) mechanism. The karyotypically normal iPSCs with isodisomy for the corrected chromosome outgrew co-existing aneuploid populations, enabling rapid and efficient isolation of patient-derived iPSCs devoid of the original chromosomal aberration. Our results suggest a fundamentally different function for cellular reprogramming as a means of `chromosome therapy' to reverse combined loss-of-function across many genes in cells with large-scale aberrations involving ring structures. In addition, our work provides an experimentally tractable human cellular system for studying mechanisms of chromosomal number control, which is of critical relevance to human development and disease.

  9. Physical mapping of the human t-cell receptor beta gene complex, using yeast artificial chromosomes

    SciTech Connect

    Hashim, Y.; So, A.K.; Kearney, L.

    1995-04-01

    Yeast artificial chromosomes (YACs) were used to construct a physical map of the germline human T-cell {beta} chain gene complex (TCRB). Variable region genes (BV) for the 25 known subfamilies were used as probes to screen the ICRF AM4x YAC library. Of the five positive YACs identified, one YAC designated B3, 820 kilobase pairs (kbp) in size, scored positive for all 25 TCRBV subfamilies plus the constant region genes (BC) when analyzed by pulse field gel electrophoresis. Restriction enzyme mapping of B3 located TCRBV and TCRBC gene regions to 4 Sfi I fragments of 280, 110, 90, and 125 kbp and was in accordance with published data. In addition, comparison of hybridization results of Sfi I-restricted B3 and genomic DNA from the parental cell line GM1416B revealed identical banding patterns. The data thus showed YAC B3 encoded a complete and unrearranged TCRB gene locus of some 600-620 kbp. The map was further resolved by locating restriction sites for Sal I and Bss HII on B3, giving more precise localization of the individual TCRBV gene families. Fluorescent in situ hybridization of B3 to spreads of human metaphase chromosomes localized B3 to 7q35. However, two additional signals were obtained; one attributable to the TCRBV orphon cluster on 9p21, the second to the long arm of chromosome 2. Polymerase chain reaction amplification of a chromosome 2 somatic cell hybrid, using primers for all 25 TCRBV gene families, revealed that the signal was not attributable to a second orphon cluster. It is suggested that B3 is a chimeric YAC with an intact TCRB locus flanked by chromosome 2 sequences. 32 refs., 5 figs., 1 tab.

  10. Localization of a second NM23 gene, NME2, to chromosome 17q21-q22

    SciTech Connect

    Kelsell, D.P.; Spurr, N.K. ); Black, D.M.; Solomon, E. )

    1993-08-01

    NM23 is a candidate tumor suppressor protein and has recently been identified as an NDP kinase. The expression of NM23 is inversely related to the metastatic potential of tumor cells. Two NM23 genes, NME1 and NME2, that code for the A and B chains of the kinase, respectively, have been cloned. To determine the human chromosomal location of the NME2 gene, the authors have analyzed DNA from rodent-human cell lines and hybrid cell lines containing portions of chromosome 17 by a combination of PC amplification and Southern hybridization. The NME2 gene was mapped to the chromosome region 17q21-q22, the same region in which the the NME1 gene has been localized. This region is linked to the early onset breast/ovarian locus (BRCA1) and allelic deletions of NME1 have been associated with metastatic potential of colorectal carcinomas. 15 refs., 2 figs.

  11. Human cytomegalovirus: bacterial artificial chromosome (BAC) cloning and genetic manipulation.

    PubMed

    Paredes, Anne M; Yu, Dong

    2012-02-01

    The understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  12. Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation

    PubMed Central

    Paredes, Anne M.; Yu, Dong

    2011-01-01

    Our understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  13. A mouse embryonic stem cell bank for inducible overexpression of human chromosome 21 genes

    PubMed Central

    2010-01-01

    Background Dosage imbalance is responsible for several genetic diseases, among which Down syndrome is caused by the trisomy of human chromosome 21. Results To elucidate the extent to which the dosage imbalance of specific human chromosome 21 genes perturb distinct molecular pathways, we developed the first mouse embryonic stem (ES) cell bank of human chromosome 21 genes. The human chromosome 21-mouse ES cell bank includes, in triplicate clones, 32 human chromosome 21 genes, which can be overexpressed in an inducible manner. Each clone was transcriptionally profiled in inducing versus non-inducing conditions. Analysis of the transcriptional response yielded results that were consistent with the perturbed gene's known function. Comparison between mouse ES cells containing the whole human chromosome 21 (trisomic mouse ES cells) and mouse ES cells overexpressing single human chromosome 21 genes allowed us to evaluate the contribution of single genes to the trisomic mouse ES cell transcriptome. In addition, for the clones overexpressing the Runx1 gene, we compared the transcriptome changes with the corresponding protein changes by mass spectroscopy analysis. Conclusions We determined that only a subset of genes produces a strong transcriptional response when overexpressed in mouse ES cells and that this effect can be predicted taking into account the basal gene expression level and the protein secondary structure. We showed that the human chromosome 21-mouse ES cell bank is an important resource, which may be instrumental towards a better understanding of Down syndrome and other human aneuploidy disorders. PMID:20569505

  14. Isolation and mapping of human chromosome 21 cDNA: Progress in constructing a chromosome 21 expression map

    SciTech Connect

    Jan-Fang Cheng; Boyartchuk, V.; Zhu Y.

    1994-09-01

    We have isolated 175 cDNA clones from a fetal brain library by direct cDNA selection using genomic DNA isolated from pools of human chromosome 21 (HC21) cosmids. DNA sequences have revealed that 16 of these cDNA clones contain overlapping sequences. Of the other 159 cDNA sequences, 10 match previously identified HC21 genes, and 9 match previously determined cDNA sequences, including the Wilms tumor related transcript (QM), the human testican cDNA, the mammalian calponin cDNA, and 6 anonymous expressed sequence tags. All isolated cDNAs were hybridized to their corresponding cosmids, which suggests that they originated from HC21. We have localized 92 cDNA clones to previously reported HC21q YACs. The remaining unmapped cDNAs contain either sequences not included in the isolated HC21q YACs or sequences that hybridize to yeast DNA. The cDNAs not included in the YACs should be useful in isolating new YACs to bridge the gaps. PCR primers were derived from 4 novel cDNA sequences that had been mapped to the YACs in the suspected Down syndrome region and used in RT-PCR analysis. All 4 primer sequences amplified RNA fragments with the expected sizes, suggesting that these sequences could be used for expression analysis. The construction of a chromosome 21 cDNA map not only is important in the refinement of physical maps, but also will identify a set of genes in the disease regions for detailed characterization. 30 refs., 2 figs., 2 tabs.

  15. Analysis of unrejoined chromosomal breakage in human fibroblast cells exposed to low- and high-LET radiation

    NASA Technical Reports Server (NTRS)

    Wu, Honglu; Furusawa, Yoshiya; George, Kerry; Kawata, Tetsuya; Cucinotta, Francis A.

    2002-01-01

    Reported studies of DNA breakage induced by radiation of various qualities have generally shown a higher fraction of unrejoined residual breaks after high-LET exposure. This observation is supported by the argument that high-LET radiation induced DNA breaks that are more complex in nature and, thus, less likely to be repaired. In most cases the doses used in these studies were very high. We have studied unrejoined chromosome breaks by analyzing chromosome aberrations using a fluorescence in situ hybridization (FISH) technique with a combination of whole chromosome specific probes and probes specific for the telomere region of the chromosomes. Confluent human fibroblast cells (AG1522) were irradiated with gamma rays, 490 MeV/nucleon Si, or with Fe ions at either 200 and 500 MeV/nucleon, and were allowed to repair at 37 degrees C for 24 hours after exposure. A chemically induced premature chromosome condensation (PCC) technique was used to condense chromosomes in the G2 phase of the cell cycle. Results showed that the frequency of unrejoined chromosome breaks was higher after high-LET radiation, and the ratio of unrejoined to misrejoined chromosome breaks increased steadily with LET up a peak value at 440 keV/microm.

  16. On the association between chromosomal rearrangements and genic evolution in humans and chimpanzees

    PubMed Central

    Marques-Bonet, Tomàs; Sànchez-Ruiz, Jesús; Armengol, Lluís; Khaja, Razi; Bertranpetit, Jaume; Lopez-Bigas, Núria; Rocchi, Mariano; Gazave, Elodie; Navarro, Arcadi

    2007-01-01

    Background The role that chromosomal rearrangements might have played in the speciation processes that have separated the lineages of humans and chimpanzees has recently come into the spotlight. To date, however, results are contradictory. Here we revisit this issue by making use of the available human and chimpanzee genome sequence to study the relationship between chromosomal rearrangements and rates of DNA sequence evolution. Results Contrary to previous findings for this pair of species, we show that genes located in the rearranged chromosomes that differentiate the genomes of humans and chimpanzees, especially genes within rearrangements themselves, present lower divergence than genes elsewhere in the genome. Still, there are considerable differences between individual chromosomes. Chromosome 4, in particular, presents higher divergence in genes located within its rearrangement. Conclusion A first conclusion of our analysis is that divergence is lower for genes located in rearranged chromosomes than for those in colinear chromosomes. We also report that non-coding regions within rearranged regions tend to have lower divergence than non-coding regions outside them. These results suggest an association between chromosomal rearrangements and lower non-coding divergence that has not been reported before, even if some chromosomes do not follow this trend and could be potentially associated with a speciation episode. In summary, without excluding it, our results suggest that chromosomal speciation has not been common along the human and chimpanzee lineage. PMID:17971225

  17. High- and low-LET Radiation-induced Chromosome Aberrations in Human Epithelial Cells Cultured in 3-dimensional Matrices

    NASA Technical Reports Server (NTRS)

    Hada, M.; George K.; Cucinotta, F. A.; Wu, H.

    2008-01-01

    Energetic heavy ions pose a great health risk to astronauts who participate in extended ISS missions and will be an even greater concern for future manned lunar and Mars missions. High-LET heavy ions are particularly effective in causing various biological effects, including cell inactivation, genetic mutations, cataracts and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied low- and high-LET radiation-induced chromosome aberrations in human epithelial cells cultured in 2-dimension (2D) using the multicolor banding fluorescence in situ hybridization (mBAND) technique. However, it has been realized that the biological response to radiation insult in a 2D in vitro cellular environment can differ significantly from the response in 3-dimension (3D) or at the actual tissue level. In this study, we cultured human epithelial cells in 3D to provide a more suitable model for human tissue. Human mammary epithelial cells (CH184B5F5/M10) were grown in Matrigel to form 3D structures, and exposed to Fe-ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory or 137Cs-gamma radiation source at the University of Texas MD Anderson Cancer Center. After exposure, cells were allowed to repair for 16hr before dissociation and subcultured at low density in 2D. G2 and metaphase chromosomes in the first cell cycle were collected in the first cell cycle after irradiation using a chemical-induced premature chromosome condensation (PCC) technique, and chromosome aberrations were analyzed using mBAND technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). Our data indicate a significant difference in the

  18. Repair of chromosome damage induced by X-irradiation during G2 phase in a line of normal human fibroblasts and its malignant derivative

    SciTech Connect

    Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.

    1982-08-01

    A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G2 phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. The gaps may represent single-strand breaks. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or beta-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G2 phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G2 phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives.

  19. Group-specific human granulocyte antigens on a chronic myelogenous leukemia cell line with a Philadelphia chromosome marker.

    PubMed

    Drew, S I; Terasaki, P I; Billing, R J; Bergh, O J; Minowada, J; Klein, E

    1977-05-01

    Group-specific human granulocyte antigens are serologically detectable with granulocytotoxic-positive human alloantisera on a cell line, K562, of chronic myelogenous leukemia origin which bears a Philadelphia chromosomal marker. The same cell line lacks serologically detectable HLA, B2 microglobulin, and B-lymphocyte antigens. Granulocyte antigens are important cell markers for cell lines of suspected myeloid lineage.

  20. The α isoform of topoisomerase II is required for hypercompaction of mitotic chromosomes in human cells.

    PubMed

    Farr, Christine J; Antoniou-Kourounioti, Melissa; Mimmack, Michael L; Volkov, Arsen; Porter, Andrew C G

    2014-04-01

    As proliferating cells transit from interphase into M-phase, chromatin undergoes extensive reorganization, and topoisomerase (topo) IIα, the major isoform of this enzyme present in cycling vertebrate cells, plays a key role in this process. In this study, a human cell line conditional null mutant for topo IIα and a derivative expressing an auxin-inducible degron (AID)-tagged version of the protein have been used to distinguish real mitotic chromosome functions of topo IIα from its more general role in DNA metabolism and to investigate whether topo IIβ makes any contribution to mitotic chromosome formation. We show that topo IIβ does contribute, with endogenous levels being sufficient for the initial stages of axial shortening. However, a significant effect of topo IIα depletion, seen with or without the co-depletion of topo IIβ, is the failure of chromosomes to hypercompact when delayed in M-phase. This requires much higher levels of topo II protein and is impaired by drugs or mutations that affect enzyme activity. A prolonged delay at the G2/M border results in hyperefficient axial shortening, a process that is topo IIα-dependent. Rapid depletion of topo IIα has allowed us to show that its function during late G2 and M-phase is truly required for shaping mitotic chromosomes.

  1. Repair of chromosome damage induced by X-irradiation during G/sub 2/ phase in a line of normal human fibroblasts and its malignant derivative

    SciTech Connect

    Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.

    1982-08-01

    A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G/sub 2/ phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or ..beta..-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G/sub 2/ phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, which destroys H/sub 2/O/sub 2/, or mannitol, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G/sub 2/ phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives.

  2. New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes for radiation molecular cytogenetics

    PubMed Central

    Repin, Mikhail V; Golubev, Pavel I; Repina, Ludmila A

    2009-01-01

    Background The objective of this work is to obtain the correct relative DNA contents of chromosomes in the normal male and female human diploid genomes for the use at FISH analysis of radiation-induced chromosome aberrations. Results The relative DNA contents of chromosomes in the male and female human diploid genomes have been calculated from the publicly available international Human Genome Project data. New sequence-based data on the relative DNA contents of human chromosomes were compared with the data recommended by the International Atomic Energy Agency in 2001. The differences in the values of the relative DNA contents of chromosomes obtained by using different approaches for 15 human chromosomes, mainly for large chromosomes, were below 2%. For the chromosomes 13, 17, 20 and 22 the differences were above 5%. Conclusion New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes were obtained. This approach, based on the genome sequence, can be recommended for the use in radiation molecular cytogenetics. PMID:19500331

  3. The leukemia inhibitory factor receptor (LIFR) gene is located within a cluster of cytokine receptor loci on mouse chromosome 15 and human chromosome 5p12-p13

    SciTech Connect

    Gearing, D.P. ); Druck, T.; Huebner, K. ); Overhauser, J. ); Gilbert, D.J.; Copeland, N.G.; Jenkins, N.A. )

    1993-10-01

    The leukemia inhibitory factor receptor (LIFR) gene was localized to human chromosome 5p12-p13 by somatic cell hybrid analysis. Interspecific backcross analysis revealed that the murine locus was on chromosome 15 in a region of homology with human chromosome 5p. In both human and mouse genomes, the LIFR locus was linked to the genes encoding the receptors for interleukin-7, prolactin, and growth hormone. 13 refs., 1 fig.

  4. Complete sequence of human vinculin and assignment of the gene to chromosome 10

    SciTech Connect

    Weller, P.A.; Corben, E.B.; Patel, B.; Price, G.J.; Critchley, D.R. ); Ogryzko, E.P.; Zhidkova, N.I.; Koteliansky, V.E. ); Spurr, N.K. )

    1990-08-01

    The authors have determined the complete sequence of human vinculin, a cytoskeletal protein associated with cell-cell and cell-matrix junctions. Comparison of human and chicken embryo vinculin sequences shows that both proteins contain 1,066 amino acids and exhibit a high level of sequence identity (>95%). The region of greatest divergence falls within three 112-amino acid repeats spanning residues 259-589. Interestingly, nematode vinculin lacks one of these central repeats. The regions of human vinculin that are N- and C-terminal to the repeats show 54% and 61% sequence identity, respectively, to nematode vinculin. Southern blots of human genomic DNA hybridized with short vinculin cDNA fragments indicate that there is a single vinculin gene. By using a panel of human-rodent somatic cell hybrids, the human vinculin gene was mapped to chromosome 10q11.2-qter.

  5. X Chromosome of female cells shows dynamic changes in status during human somatic cell reprogramming.

    PubMed

    Kim, Kun-Yong; Hysolli, Eriona; Tanaka, Yoshiaki; Wang, Brandon; Jung, Yong-Wook; Pan, Xinghua; Weissman, Sherman Morton; Park, In-Hyun

    2014-06-01

    Induced pluripotent stem cells (iPSCs) acquire embryonic stem cell (ESC)-like epigenetic states, including the X chromosome. Previous studies reported that human iPSCs retain the inactive X chromosome of parental cells, or acquire two active X chromosomes through reprogramming. Most studies investigated the X chromosome states in established human iPSC clones after completion of reprogramming. Thus, it is still not fully understood when and how the X chromosome reactivation occurs during reprogramming. Here, we report a dynamic change in the X chromosome state throughout reprogramming, with an initial robust reactivation of the inactive X chromosome followed by an inactivation upon generation of nascent iPSC clones. iPSCs with two active X chromosomes or an eroded X chromosome arise in passaging iPSCs. These data provide important insights into the plasticity of the X chromosome of human female iPSCs and will be crucial for the future application of such cells in cell therapy and X-linked disease modeling. PMID:24936474

  6. X Chromosome of Female Cells Shows Dynamic Changes in Status during Human Somatic Cell Reprogramming

    PubMed Central

    Kim, Kun-Yong; Hysolli, Eriona; Tanaka, Yoshiaki; Wang, Brandon; Jung, Yong-Wook; Pan, Xinghua; Weissman, Sherman Morton; Park, In-Hyun

    2014-01-01

    Summary Induced pluripotent stem cells (iPSCs) acquire embryonic stem cell (ESC)-like epigenetic states, including the X chromosome. Previous studies reported that human iPSCs retain the inactive X chromosome of parental cells, or acquire two active X chromosomes through reprogramming. Most studies investigated the X chromosome states in established human iPSC clones after completion of reprogramming. Thus, it is still not fully understood when and how the X chromosome reactivation occurs during reprogramming. Here, we report a dynamic change in the X chromosome state throughout reprogramming, with an initial robust reactivation of the inactive X chromosome followed by an inactivation upon generation of nascent iPSC clones. iPSCs with two active X chromosomes or an eroded X chromosome arise in passaging iPSCs. These data provide important insights into the plasticity of the X chromosome of human female iPSCs and will be crucial for the future application of such cells in cell therapy and X-linked disease modeling. PMID:24936474

  7. Identification of microsatellite markers linked to the human leptin receptor gene on chromosome 1

    SciTech Connect

    Winick, J.D.; Friedman, J.M.; Stoffel, M.

    1996-08-15

    This report describes the localization of the human leptin receptor gene to human chromosome 1 using polymerase chain reaction of somatic cell hybrids. Leptin is a secreted protein important in the regulation of body weight. 16 refs., 1 fig.

  8. Sequence-tagged site (STS) content mapping of human chromosomes: theoretical considerations and early experiences.

    PubMed

    Green, E D; Green, P

    1991-11-01

    The magnitude of the effort required to complete the human genome project will require constant refinements of the tools available for the large-scale study of DNA. Such improvements must include both the development of more powerful technologies and the reformulation of the theoretical strategies that account for the changing experimental capabilities. The two technological advances described here, PCR and YAC cloning, have rapidly become incorporated into the standard armamentarium of genome analysis and represent key examples of how technological developments continue to drive experimental strategies in molecular biology. Because of its high sensitivity, specificity, and potential for automation, PCR is transforming many aspects of DNA mapping. Similarly, by providing the means to isolate and study larger pieces of DNA, YAC cloning has made practical the achievement of megabase-level continuity in physical maps. Taken together, these two technologies can be envisioned as providing a powerful strategy for constructing physical maps of whole chromosomes. Undoubtedly, future technological developments will promote even more effective mapping strategies. Nonetheless, the theoretical projections and practical experience described here suggest that constructing YAC-based STS-content maps of whole human chromosomes is now possible. Random STSs can be efficiently generated and used to screen collections of YAC clones, and contiguous YAC coverage of regions exceeding 2 Mb can be readily obtained. While the predicted laboratory effort required for mapping whole human chromosomes remains daunting, it is clearly feasible.

  9. The human liver glycogen synthase isozyme gene is located on the short arm of chromosome 12

    SciTech Connect

    Nuttall, F.Q.; Gannon, M.C. ); Kubic, V.L.; Hoyt, K.J. )

    1994-01-15

    Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis. Its activity is regulated by a complex phosphorylation-dephosphorylation mechanism and by allosteric stimulators and inhibitors. Two isozymes of synthase, a skeletal muscle type and liver type, have been identified in rabbit and rat tissues using specific polyclonal antibodies. The skeletal muscle type isozyme is present in several organs in addition to skeletal muscle; the liver isozyme has been identified only in liver. Recently, we have purified and characterized the human liver synthase isozyme. We also have cloned and sequenced the gene from a human liver cDNA library. Using the entire cDNA coding sequence as a probe, we report here the localization of the liver synthase isozyme gene to the short arm of chromosome 12. These studies revealed a centromeric signal on chromosome 12 together with signal to glycogen synthase on the short arm of this chromosome in the p11.2-p12.2 region. Measurements of the relative distance from the midpoint of the centromere to the signal corresponding to glycogen synthase suggests that the locus is in the p12.2 band rather than in the more centromeric location.

  10. Chromosomal localization and cDNA cloning of the genes (DDB1 and DDB2) for the p127 and p48 subunits of a human damage-specific DNA binding protein

    SciTech Connect

    Dualan, R.; Brody, T.; Keeney, S.

    1995-09-01

    DDB is a damage-specific DNA binding protein whose binding activity is absent from a minority of cell strains from individuals with xeroderma pigmentosum Group E, a human hereditary disease characterized by defective nucleotide excision DNA repair and an increased incidence of skin cancer. The binding activity from HeLa cells is associated with polypeptides of M{sub r} 124,000 and 41,000 as determined by SDS-polyacrylamide gels. This report describes the isolation of full-length human cDNAs encoding each polypeptide of DDB. The predicted peptide molecular masses based on open reading frames are 127,000 and 48,000. When expressed in an in vitro rabbit reticulocyte system, the p48 subunit migrates with an M{sub r} of 41 kDa on SDS-polyacrylamide gels, similarly to the peptide purified from HeLa cells. There is no significant homology between the derived p48 peptide sequence and any proteins in current databases, and the derived peptide sequence of p127 has homology only with the monkey DDB p127 (98% nucleotide identity and only one conserved amino acid substitution). Using a fluorescence in situ hybridization technique, the DDB p127 locus (DDB1) was assigned to the chromosomal location 11q12-q13, and the DDB p48 locus (DDB2) to 11p11-p12. 34 refs., 3 figs., 1 tab.

  11. Topology, structures, and energy landscapes of human chromosomes

    PubMed Central

    Zhang, Bin; Wolynes, Peter G.

    2015-01-01

    Chromosome conformation capture experiments provide a rich set of data concerning the spatial organization of the genome. We use these data along with a maximum entropy approach to derive a least-biased effective energy landscape for the chromosome. Simulations of the ensemble of chromosome conformations based on the resulting information theoretic landscape not only accurately reproduce experimental contact probabilities, but also provide a picture of chromosome dynamics and topology. The topology of the simulated chromosomes is probed by computing the distribution of their knot invariants. The simulated chromosome structures are largely free of knots. Topologically associating domains are shown to be crucial for establishing these knotless structures. The simulated chromosome conformations exhibit a tendency to form fibril-like structures like those observed via light microscopy. The topologically associating domains of the interphase chromosome exhibit multistability with varying liquid crystalline ordering that may allow discrete unfolding events and the landscape is locally funneled toward “ideal” chromosome structures that represent hierarchical fibrils of fibrils. PMID:25918364

  12. Topology, structures, and energy landscapes of human chromosomes.

    PubMed

    Zhang, Bin; Wolynes, Peter G

    2015-05-12

    Chromosome conformation capture experiments provide a rich set of data concerning the spatial organization of the genome. We use these data along with a maximum entropy approach to derive a least-biased effective energy landscape for the chromosome. Simulations of the ensemble of chromosome conformations based on the resulting information theoretic landscape not only accurately reproduce experimental contact probabilities, but also provide a picture of chromosome dynamics and topology. The topology of the simulated chromosomes is probed by computing the distribution of their knot invariants. The simulated chromosome structures are largely free of knots. Topologically associating domains are shown to be crucial for establishing these knotless structures. The simulated chromosome conformations exhibit a tendency to form fibril-like structures like those observed via light microscopy. The topologically associating domains of the interphase chromosome exhibit multistability with varying liquid crystalline ordering that may allow discrete unfolding events and the landscape is locally funneled toward "ideal" chromosome structures that represent hierarchical fibrils of fibrils.

  13. Truly incomplete and complex exchanges in prematurely condensed chromosomes of human fibroblasts exposed in vitro to energetic heavy ions

    NASA Technical Reports Server (NTRS)

    Wu, Honglu; Durante, Marco; Furusawa, Yoshiya; George, Kerry; Kawata, Tetsuya; Cucinotta, Francis A.

    2003-01-01

    Confluent human fibroblast cells (AG1522) were irradiated with gamma rays, 490 MeV/nucleon silicon ions, or iron ions at either 200 or 500 MeV/nucleon. The cells were allowed to repair at 37 degrees C for 24 h after exposure, and a chemically induced premature chromosome condensation (PCC) technique was used to condense chromosomes in the G2 phase of the cell cycle. Incomplete and complex exchanges were analyzed in the irradiated samples. To verify that chromosomal breaks were truly unrejoined, chromosome aberrations were analyzed using a combination of whole-chromosome specific probes and probes specific for the telomere region of the chromosome. Results showed that the frequency of unrejoined chromosome breaks was higher after irradiation with the heavy ions of high LET, and consequently the ratio of incomplete to complete exchanges increased steadily with LET up to 440 keV/microm, the highest LET included in the present study. For samples exposed to 200 MeV/nucleon iron ions, chromosome aberrations were analyzed using the multicolor FISH (mFISH) technique, which allows identification of both complex and truly incomplete exchanges. Results of the mFISH study showed that 0.7 and 3 Gy iron ions produced similar ratios of complex to simple exchanges and incomplete to complete exchanges; these ratios were higher than those obtained after exposure to 6 Gy gamma rays. After 0.7 Gy of iron ions, most complex aberrations were found to involve three or four chromosomes, which is a likely indication of the maximum number of chromosome domains traversed by a single iron-ion track.

  14. Truly Incomplete and Complex Chromosomal Exchanges in Human Fibroblast Cells Exposed In Situ to Energetic Heavy Ions

    NASA Technical Reports Server (NTRS)

    Wu, Honglu; Durante, marco; Furusawa, Yoshiya; George, Kerry; Kawata, Tetsuya; Cucinotta, Francis A.

    2003-01-01

    Confluent human fibroblast cells (AG 1522) were irradiated with gamma rays, 490 MeV/nucleon Si, or with Fe ions at either 200 or 500 MeV/nucleon. The cells were allowed to repair at 37 C for 24 hours after exposure, and a chemically induced premature chromosome condensation (PCC) technique was used to condense chromosomes in the G2 phase of the cell cycle. Incomplete and complex exchanges were analyzed in the irradiated samples. In order to verify that chromosomal breaks were truly unrejoined, chromosome aberrations were analyzed using a combination of whole chromosome specific probes and probes specific for the telomere region of the chromosome. Results showed that the frequency of unrejoined chromosome breaks was higher after high-LET radiation, and consequently, the ratio of incomplete to complete exchanges increased steadily with LET up to 440 keV/micron, the highest LET value in the present study. For samples exposed to 200 MeV/nucleon Fe ions, chromosome aberrations were analyzed using the multicolor FISH (mFISH) technique that allow identification of both complex and truly incomplete exchanges. Results of the mFISH study showed that 0.7 and 3 Gy dose of the Fe ions produced similar ratios of complex to simple exchanges and incomplete to complete exchanges, values for which were higher than those obtained after a 6 Gy gamma exposure. After 0.7 Gy of Fe ions, most complex aberrations were found to involve three or four chromosomes, which is a likely indication of the maximum number of chromosome domains traversed by a single Fe ion track.

  15. Chromosome region-specific libraries for human genome analysis. Final progress report, 1 March 1991--28 February 1994

    SciTech Connect

    Kao, F.T.

    1994-04-01

    The objectives of this grant proposal include (1) development of a chromosome microdissection and PCR-mediated microcloning technology, (2) application of this microtechnology to the construction of region-specific libraries for human genome analysis. During this grant period, the authors have successfully developed this microtechnology and have applied it to the construction of microdissection libraries for the following chromosome regions: a whole chromosome 21 (21E), 2 region-specific libraries for the long arm of chromosome 2, 2q35-q37 (2Q1) and 2q33-q35 (2Q2), and 4 region-specific libraries for the entire short arm of chromosome 2, 2p23-p25 (2P1), 2p21-p23 (2P2), 2p14-p16 (wP3) and 2p11-p13 (2P4). In addition, 20--40 unique sequence microclones have been isolated and characterized for genomic studies. These region-specific libraries and the single-copy microclones from the library have been used as valuable resources for (1) isolating microsatellite probes in linkage analysis to further refine the disease locus; (2) isolating corresponding clones with large inserts, e.g. YAC, BAC, P1, cosmid and phage, to facilitate construction of contigs for high resolution physical mapping; and (3) isolating region-specific cDNA clones for use as candidate genes. These libraries are being deposited in the American Type Culture Collection (ATCC) for general distribution.

  16. Broader utilization of origins of DNA replication in cancer cell lines along a 78 kb region of human chromosome 2q34.

    PubMed

    Valenzuela, Manuel S; Hu, Lan; Lueders, John; Walker, Robert; Meltzer, Paul S

    2012-01-01

    Human DNA replication depends on the activation of thousands of origins distributed within the genome. The actual distribution of origins is not known, nor whether this distribution is unique to a cell type, or if it changes with the proliferative state of the cell. In this study, we have employed a real-time PCR-based nascent strand DNA abundance assay, to determine the location of origins along a 78 kb region on Chr2q34. Preliminary studies using nascent DNA strands isolated from either HeLa and normal skin fibroblast cells showed that in both cell lines peaks of high origin activity mapped in similar locations. However, the overall origin profile in HeLa cells corresponded to broad origin activation zones, whereas in fibroblasts a more punctuated profile of origin activation was observed. To investigate the relevance of this differential origin profile, we compared the origin distribution profiles in breast cancer cell lines MDA-MB-231, BT-474, and MCF-7, to their normal counterpart MCF-10A. In addition, the CRL7250 cell line was also used as a normal control. Our results validated our earlier observation and showed that the origin profile in normal cell lines exhibited a punctuated pattern, in contrast to broader zone profiles observed in the cancer cell lines. A quantitative analysis of origin peaks revealed that the number of activated origins in cancer cells is statistically larger than that obtained in normal cells, suggesting that the flexibility of origin usage is significantly increased in cancer cells compared to their normal counterparts.

  17. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, K.; Cucinotta, F. A.

    2010-01-01

    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to 28Si- ions with energies ranging from 90 to 600 MeV/u, or to 56Fe-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Fe beams in this study ranged from 145 to 440 keV/micron and the LET of the Si ions ranged from 48 to 158 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to -rays. The estimates of RBE(sub max) values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBE(sub max) value for Fe ions was obtained with the 600-Mev/u beam, and the highest RBE(sub max) value for Si ions was obtained with the 170 MeV/u beam. For both ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/ m for Si, and decreasing with further increase in LET. Additional studies for low doses 28Si-ions down to 0.02 Gy will be discussed.

  18. Genetic linkage analysis of familial amyotrophic lateral sclerosis using human chromosome 21 microsatellite DNA markers

    SciTech Connect

    Rosen, D.R.; Sapp, P.; O`Regan, J.; McKenna-Yasek, D.; Schlumpf, K.S.; Haines, J.L.; Gusella, J.F.; Horvitz, H.R.; Brown, R.H. Jr.

    1994-05-15

    Amyotrophic lateral sclerosis (ALS; Lou Gehrig`s Disease) is a lethal neurodegenerative disease of upper and lower motorneurons in the brain and spinal cord. We previously reported linkage of a gene for familial ALS (FALS) to human chromosome 21 using 4 restriction fragment length polymorphism DNA markers and identified disease-associated mutations in the superoxide dismutase (SOD)-1 gene in some ALS families. We report here the genetic linkage data that led us to examine the SOD-1 gene for mutations. We also report a new microsatellite DNA marker for D21S63, derived from the cosmid PW517. Ten microsatellite DNA markers, including the new marker D21S63, were used to reinvestigate linkage of FALS to chromosome 21. Genetic linkage analysis performed with 13 ALS familes for these 10 DNA markers confirmed the presence of a FALS gene on chromosome 21. The highest total 2-point LOD score for all families was 4.33, obtained at a distance of 10 cM from the marker D21S223. For 5 ALS families linked to chromosome 21, a peak 2-point LOD score of 5.94 was obtained at the DNA marker D21S223. A multipoint score of 6.50 was obtained with the markers D21S213, D21S223, D21S167, and FALS for 5 chromosome 21-linked ALS families. The haplotypes of these families for the 10 DNA markers reveal recombination events that further refined the location of the FALS gene to a segment of approximately 5 megabases (Mb) between D21S213 and D21S219. The only characterized gene within this segment was SOD-1, the structural gene for Cu, Zn SOD. 30 refs., 4 figs., 4 tabs.

  19. G2-chromosome aberrations induced by high-LET radiations

    NASA Astrophysics Data System (ADS)

    Kawata, T.; Durante, M.; Furusawa, Y.; George, K.; Ito, H.; Wu, H.; Cucinotta, F. A.

    We report measurements of initial G2-chromatid breaks in normal human fibroblasts exposed to various types of high-LET particles. Exponentially growing AG 1522 cells were exposed to γ-rays or heavy ions. Chromosomes were prematurely condensed by calyculin A. Chromatid-type breaks and isochromatid-type breaks were scored separately. The dose response curves for the induction of total chromatid breaks (chromatid-type + isochromatid-type) and chromatid-type breaks were linear for each type of radiation. However, dose response curves for the induction of isochromatid-type breaks were linear for high-LET radiations and linear-quadratic for γ-rays. Relative biological effectiveness (RBE), calculated from total breaks, showed a LET dependent tendency with a peak at 55 keV/μm silicon (2.7) or 80 keV/μm carbon (2.7) and then decreased with LET (1.5 at 440 keV/μm). RBE for chromatid-type break peaked at 55 keV/μm (2.4) then decreased rapidly with LET. The RBE of 440 keV/μm iron particles was 0.7. The RBE calculated from induction of isochromatid-type breaks was much higher for high-LET radiations. It is concluded that the increased production of isochromatid-type breaks, induced by the densely ionizing track structure, is a signature of high-LET radiation exposure.

  20. Field-flow fractionation of chromosomes

    SciTech Connect

    Giddings, J.C.

    1990-09-01

    Research continued on field flow fractionation of chromosomes. Progress in the past year can be organized into three main categories: (1) chromosome sample preparation; (2) preliminary chromosome fractionation; (3) fractionation of a polystyrene aggregate model which approximates the chromosome shape. We have been successful in isolating metaphase chromosomes from the Chinese hamster. We also received a human chromosome sample from Dr. Carolyn Bell-Prince of Los Alamos National Laboratory. Results are discussed. 2 figs.

  1. Geminin overexpression prevents the completion of topoisomerase IIα chromosome decatenation, leading to aneuploidy in human mammary epithelial cells

    PubMed Central

    2011-01-01

    Introduction The nuclear enzyme topoisomerase IIα (TopoIIα) is able to cleave DNA in a reversible manner, making it a valuable target for agents such as etoposide that trap the enzyme in a covalent bond with the 5′ DNA end to which it cleaves. This prevents DNA religation and triggers cell death in cancer cells. However, development of resistance to these agents limits their therapeutic use. In this study, we examined the therapeutic targeting of geminin for improving the therapeutic potential of TopoIIα agents. Methods Human mammary epithelial (HME) cells and several breast cancer cell lines were used in this study. Geminin, TopoIIα and cell division cycle 7 (Cdc7) silencing were done using specific small interfering RNA. Transit or stable inducible overexpression of these proteins and casein kinase Iε (CKIε) were also used, as well as several pharmacological inhibitors that target TopoIIα, Cdc7 or CKIε. We manipulated HME cells that expressed H2B-GFP, or did not, to detect chromosome bridges. Immunoprecipitation and direct Western blot analysis were used to detect interactions between these proteins and their total expression, respectively, whereas interactions on chromosomal arms were detected using a trapped in agarose DNA immunostaining assay. TopoIIα phosphorylation by Cdc7 or CKIε was done using an in vitro kinase assay. The TopoGen decatenation kit was used to measure TopoIIα decatenation activity. Finally, a comet assay and metaphase chromosome spread were used to detect chromosome breakage and changes in chromosome condensation or numbers, respectively. Results We found that geminin and TopoIIα interact primarily in G2/M/early G1 cells on chromosomes, that geminin recruits TopoIIα to chromosomal decatenation sites or vice versa and that geminin silencing in HME cells triggers the formation of chromosome bridges by suppressing TopoIIα access to chromosomal arms. CKIε kinase phosphorylates and positively regulates TopoIIα chromosome

  2. Search for a schizophrenia susceptibility locus of human chromosome 22

    SciTech Connect

    Coon, H.; Hoff, M.; Holik, J.

    1994-06-15

    We used 10 highly informative DNA polymorphic markers and genetic linkage analysis to examine whether a gene locus predisposing to schizophrenia is located on chromosome 22, in 105 families with schizophrenia and schizoaffective disorder. The LOD score method, including analysis for heterogeneity, provided no conclusive evidence of linkage under a dominant, recessive, or penetrance free model of inheritance. Affected sib-pair analysis was inconclusive. Affected Pedigree Member (APM) analysis gave only suggestive evidence for linkage. Multipoint APM analysis, using 4 adjacent loci including D22S281 and IL2RB, a region of interest from the APM analysis, gave non-significant results for the three different weighting functions. 18 refs., 1 fig., 7 tabs.

  3. A review of thresholding strategies applied to human chromosome segmentation.

    PubMed

    Poletti, Enea; Zappelli, Francesca; Ruggeri, Alfredo; Grisan, Enrico

    2012-11-01

    Karyotype analysis is a widespread procedure in cytogenetics to assess the presence of genetic defects by the visualization of the structure of chromosomes. The procedure is lengthy and repetitive and an effective automatic analysis would greatly help the cytogeneticist routine work. Still, automatic segmentation and the full disentangling of chromosomes are open issues. The first step in every automatic procedure is the thresholding step, which detect blobs that represent either single chromosomes or clusters of chromosomes. The better the thresholding step, the easier is the subsequent disentanglement of chromosome clusters into single entities. We implemented eleven thresholding methods, i.e. the ones that appear in the literature as the best performers, and compared their performance in segmenting chromosomes and chromosome clusters in cytogenetic Q-band images. The images are affected by the presence of hyper- or hypo-fluorescent regions and by a contrast variability between the stained chromosomes and the background. A thorough analysis of the results highlights that, although every single algorithm shows peculiar strong/weak points, Adaptive Threshold and Region Based Level Set have the overall best performance. In order to provide the scientific community with a public dataset, the data and manual segmentation used in this paper are available for public download at http://bioimlab.dei.unipd.it.

  4. Syntenic assignment of human chromosome 1 homologous loci in the bovine.

    PubMed

    Threadgill, D S; Threadgill, D W; Moll, Y D; Weiss, J A; Zhang, N; Davey, H W; Wildeman, A G; Womack, J E

    1994-08-01

    Three mouse chromosomes (MMU 1, 3, and 4) carry homologs of human chromosome 1 (HSA 1) genes. A similar situation is found in the bovine, where five bovine chromosomes (BTA 2, 3, 5, 16, and unassigned syntenic group U25) contain homologs of HSA 1 loci. To evaluate further the syntenic relationship of HSA 1 homologs in cattle, 10 loci have been physically mapped through segregation analysis in bovine-rodent hybrid somatic cells. These loci, chosen for their location on HSA 1, are antithrombin 3 (AT3), renin (REN), complement component receptor 2 (CR2), phosphofructokinase muscle type (PFKM), Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog (FGR), alpha fucosidase (FUCA1), G-protein beta 1 subunit (GNB1), alpha 1A amylase, (AMY1), the neuroblastoma RAS viral (v-ras) oncogene homolog (NRAS), and alpha skeletal actin (ACTA1). AT3, REN, CR2, and GNB1 mapped to BTA 16, PFKM to BTA 5, AMY1A and NRAS to BTA 3, FGR and FUCA1 to BTA 2, and ACTA1 to BTA 28. PMID:8001974

  5. The nature of chromosomal aberrations detected in humans exposed to benzene.

    PubMed

    Zhang, Luoping; Eastmond, David A; Smith, Martyn T

    2002-01-01

    Benzene is an established cause of human leukemia that is thought to act by producing chromosomal aberrations and altered in cell differentiation. In several recent studies increased levels of chromosomal aberrations in peripheral blood lymphocytes were correlated with a heightened risk of cancer, especially hematological malignancies. Thus, chromosomal aberrations may be a predictor of future leukemia risk. Previous studies exploring whether benzene exposure induces chromosomal aberrations have yielded mostly positive results. However, it remains unclear whether the chromosomal aberrations induced by benzene occur in a distinct pattern. Here, we thoroughly review the major chromosome studies published to date in benzene-exposed workers, benzene-poisoned and preleukemia patients, and leukemia cases associated with benzene expose. Although three cytogenetic markers (chromosomal aberrations, sister chromatid exchanges, and micronuclei) are commonly examined, our primary focus is on studies of chromosomal aberrations, because only this marker has so far been correlated with increased cancer risk. This review surveys the published literature, analyzes the study results, and discusses the characteristics of effects reported. In most studies of currently exposed workers, increases in chromosomal aberrations were observed. However, due to the relatively small number of affected individuals and variability in the reported aberrations, firm conclusions cannot be made about the involvement of specific chromosomes or chromosome regions. Further, in leukemia cases associated with benzene exposure, there is no evidence of a unique pattern of benzene-induced chromosomal aberrations in humans. Leukemia cases associated with benzene exposure are, however, more likely to contain clonal chromosome aberrations then those arising de novo in the general population.

  6. Identification, characterization, and chromosomal localization of the human homolog (hES) of ES/130

    SciTech Connect

    Basson, C.T.; Morton, C.C.; MacRae, C.A.

    1996-08-01

    The chicken extracellular matrix glycoprotein ES/130 is necessary for epithelial-mesenchymal transformation in the developing hear and is also expressed in noncardiac chicken tissues such as limb and notochord. We have identified hES, the human homology of chicken ES/130. Fluorescence in situ hybridization analysis (FISH) localizes hES to human chromosome 20p11.2-p12. FISH analyses of individuals with 20p12 deletions and affected by Alagille syndrome exclude hES as a candidate gene for this disorder. Reverse transcriptase-polymerase chain reaction studies reveal that hES is expressed in both fetal and adult human tissues and that hES expression in the left ventricle is increased in the failing adult heart. Further studies will evaluate how hES mutations may relate to congenital human cardiac and skeletal anomalies as well as cardiac remodeling in the adult. 16 refs., 2 figs.

  7. Comparative study of artificial chromosome centromeres in human and murine cells

    PubMed Central

    Moralli, Daniela; Jefferson, Andrew; Valeria Volpi, Emanuela; Larin Monaco, Zoia

    2013-01-01

    Human artificial chromosomes (HAC) are a valuable tool in the analysis of complex chromatin structures such as the human centromere because of their small size and relative simplicity compared with normal human chromosomes. This report includes a comprehensive study of the centromere and chromatin composition of HAC, expressing human genes, generated in human cells and transferred to murine cells. The analysis involved chromatin immuno-precipitation and immuno-FISH on metaphase chromosomes and chromatin fibres. In both the cell types, the HAC consisted of alphoid and non-alphoid DNA and were mainly euchromatic in composition, although a pericentromeric heterochromatic region was present on all the HAC. Fibre-FISH and chromatin immuno-precipitation data indicated that the position of the centromere differed between HAC in human cells and in murine cells. Our work highlights the importance and utilisation of HAC for understanding the epigenetic aspects of chromosome biology. PMID:23403904

  8. Physical mapping of the congenital chloride diarrhea gene region in human chromosome 7

    SciTech Connect

    Kere, J.; Hoeglund, P.; Haila, S.

    1994-09-01

    The gene for congenital chloride diarrhea (CLD; MIM 214700) has been mapped to human chromosome 7 by a linkage study in Finnish families. The markers closest to the gene are D7S496 and D7S501, both with zero recombination fraction. In order to physically map the region and facilitate positional cloning, altogether 25 YAC clones have been isolated from the Washington University chromosome 7 collection of YACs. The clones form 2 contigs, 700 to 900 kb in size, around D7S496 and D7SS01. One YAC from the CEPH collection that bridges these contigs has been identified, but the link remains unconfirmed. Rare-cutter restriction mapping has identified as least 3 CpG islands within 50 to 200 kb of D7S496, supposed to map closest to CLD on the basis of linkage disequilibrium studies. Isolation of candidate cDNAs is in progress.

  9. The genes for the {alpha}-type HC3 (PMSA2) and {beta}-type HC5 (PMSB1) subunits of human proteasomes map to chromosomes 6q27 and 7p12-p13 by fluorescence in situ hybridization

    SciTech Connect

    Okumura, Katsuzumi; Nogami, Masahiro; Taguchi, Hiroshi

    1995-05-20

    The authors have determined the locations of the genes for the two subunits, HC3 and HC5, by fluorescence in situ hybridization (FISH). Chromosome spreads were obtained from phytohemagglutinin-stimulated blood lymphocytes of a healthy donor after thymidine synchronization and bromodeoxyuridine incorporation by the method of Takahashi et al. Genomic DNA fragments of HC3 (4.3 kb, including exons 3, 4, and 5) and HC5 (7.5 kb including exons 1 and 2) (11) were labeled with biotin-16-dUTP by nick-translation. In situ hybridization was performed according to Lichter et al. in the presence of COT-1 DNA as a competitor. Hybridized probe was detected with FITC-conjugated avidin without further signal amplification. Comparison of the fluorescence signals and the banding patterns of the chromosomes indicated that the HC3 and HC5 genes were located on chromosome band 6q27 and 7p12-p13, respectively.

  10. Human Xq24-Xq28: approaches to mapping with yeast artificial chromosomes.

    PubMed Central

    Wada, M; Little, R D; Abidi, F; Porta, G; Labella, T; Cooper, T; Della Valle, G; D'Urso, M; Schlessinger, D

    1990-01-01

    One hundred twenty-seven yeast strains with artificial chromosomes containing Xq24-Xqter human DNA were obtained starting from a human/hamster somatic cell hybrid. The clones were characterized with respect to their insert size, stability, and representation of a set of Xq24-Xqter DNA probes. The inserts of the clones add up to 19.3 megabase (Mb) content, or about 0.4 genomic equivalents of that portion of the X chromosome, with a range of 40-650 kb in individual YACs. Eleven clones contained more than one YAC, the additional ones usually having hamster DNA inserts; the individual YACs could be separated by extracting the total DNA from such strains and using it to retransform yeast cells. One of the YACs, containing the probe for the DXS49 locus, was grossly unstable, throwing off smaller versions of an initial 300-kb YAC during subculture; the other YACs appeared to breed true on subculture. Of 52 probes tested, 12 found cognate YACs; the YACs included one with the glucose-6-phosphate dehydrogense gene and another containing four anonymous probe sequences (DX13, St14, cpx67, and cpx6). Xq location of YACs is being verified by in situ hybridization to metaphase chromosomes, and fingerprinting and hybridization methods are being used to detect YACs that overlap. Images Figure 3 Figure 1 Figure 2 Figure 4 Figure 5 Figure 6 PMID:2294758

  11. Human sperm chromosome analysis after subzonal sperm insemination of hamster oocytes

    SciTech Connect

    Cozzi, J.

    1994-09-01

    Sperm microinjection techniques, subzonal sperm insemination (SUZI) and intracytoplasmic sperm injection (ICSI), have achieved a wide spread clinical application for the treatment of male infertility. To date, only one study has focused on sperm karyotypes after microinjection. Martin et al. reported a very high incidence of abnormal human sperm complements after ICSI into hamster oocytes. In the present study, are reported the first human sperm karyotypes after SUZI of hamster oocytes. Spermatozoa from two control donors were treated by calcium ionophore A23187 and injected under the zona of hamster eggs. The microinjected eggs were then cultured for cytogenetic analysis of the pronuclei. Out of 47 analyzed sperm chromosome metaphases, 5 (10.6%) were abnormal, 4 (8.5%) were hypohaploid and 1 (2.1%) had a structural abnormality. The sex ratio was not significantly different from the expected 1:1 ratio. Rates of chromosomal abnormalities in microinjected spermatozoa were similar to those observed in spermatozoa inseminated with zona free eggs, suggesting that SUZI procedure per se does not increase sperm chromosomal abnormalities.

  12. Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

    SciTech Connect

    Calabrese, G.; Morizio, E.; Palka, G.

    1994-11-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here the authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.

  13. Exchange of terminal portions of X- and Y-chromosomal short arms in human XY females

    SciTech Connect

    Levilliers, J.; Quack, B.; Weissenbach, J.; Petit, C. )

    1989-04-01

    Human Y(+) XX maleness has been shown to result from an abnormal terminal Xp-Yp interchange that can occur during paternal meiosis. To test whether human XY females are produced by the same mechanism, the authors followed the inheritance of paternal pseudoautosomal loci and Xp22.3-specific loci in two XY female patients. Y-specific sequences and the whole pseudoautosomal region of the Y chromosome of their fathers were absent in these patients. However, the entire pseudoautosomal region and the X-specific part of Xp22.3 distal to the STS locus had been inherited from the X chromosome of the respective father. This Xp transfer to Yp was established by in situ hybridization experiments showing an Xp22.3-specific locus on Yp in both cases. Such results demonstrate that an abnormal and terminal X-Y interchange generated the rearranged Y chromosome of these two XY females; they appear to be the true counter type of Y(+) XX males. In these patients, who also display some Turner stigmata, the Y gene(s) involved in this phenotype is (are) localized to interval 1 or 2. If the loss of such gene(s) affects fetal viability, their proximity to TDF would account for the under representation of interchange 46,XY females compared with Y(+) XX males.

  14. Detection of sex chromosomal aneuploidies X-X, Y-Y, and X-Y in human sperm using two-chromosome fluorescence in situ hybridization

    SciTech Connect

    Wyrobek, A.J.; Robbins, W.A. |; Pinkel, D.; Weier, H.U.; Mehraein, Y. |

    1994-10-15

    Sex chromosome aneuploidy is the most common numerical chromosomal abnormality in humans at birth and a substantial portion of these abnormalities involve paternal chromosomes. An efficient method is presented for using air-dried smears of human semen to detect the number of X and Y chromosomes in sperm chromatin using two-chromosome fluorescence in situ hybridization. Air-dried semen smears were pre-treated with dithiothreitol and 3,4-diiodosalicylate salt to decondense the sperm chromatin and then were hybridized with repetitive sequence DNA probes that had been generated by PCR and differentially labeled. Hybridizations with X and Y specific probes showed the expected ratio of 50%X:50%Y bearing sperm. Sperm carrying extra fluorescence domains representing disomy for the X or Y chromosomes occurred at frequencies of {approximately} 4 per 10,000 sperm each. Cells carrying both X and Y fluorescence domains occurred at a frequency of {approximately} 6/10,000. Thus, the overall frequency of sperm that carried an extra sex chromosome was 1.4/1,000. The frequencies of sperm carrying sex chromosome aneuploidies determined by hybridization did not differ statistically from those reported from the same laboratory using the human-sperm/hamster-egg cytogenetic technique. Multi-chromosome fluorescence in situ hybridization to sperm is a promising method for assessing sex-ratio alterations in human semen and for determining the fraction of sperm carrying sex or other chromosome aneuploidies which may be transmissible to offspring. 44 refs., 1 fig., 3 tabs.

  15. Hereditary spherocytosis associated with deletion of human erythrocyte ankyrin gene on chromosome 8.

    PubMed

    Lux, S E; Tse, W T; Menninger, J C; John, K M; Harris, P; Shalev, O; Chilcote, R R; Marchesi, S L; Watkins, P C; Bennett, V

    1990-06-21

    Hereditary spherocytosis (HS) is one of the most common hereditary haemolytic anaemias. HS red cells from both autosound dominant and recessive variants are spectrin-deficient, which correlates with the severity of the disease. Some patients with recessive HS have a mutation in the spectrin alpha-2 domain (S.L.M. et al., unpublished observations), and a few dominant HS patients have an unstable beta-spectrin that is easily oxidized, which damages the protein 4.1 binding site and weakens spectrin-actin interactions. In most patients, however, the cause of spectrin deficiency is unknown. The alpha- and beta-spectrin loci are on chromosomes 1 and 14 respectively. The only other genetic locus for HS is SPH2, on the short arm of chromosome 8 (8p11). This does not correspond to any of the known loci of genes for red cell membrane proteins including protein 4.1 (1p36.2-p34), the anion exchange protein (AE1, band 3; 17q21-qter), glycophorin C (2q14-q21), and beta-actin (7pter-q22). Human erythrocyte ankyrin, which links beta-spectrin to the anion exchange protein, has recently been cloned. We now show that the ankyrin gene maps to chromosome 8p11.2, and that one copy is missing from DNA of two unrelated children with severe HS and heterozygous deletions of chromosome 8 (del(8)(p11-p21.1)). Affected red cells are also ankyrin-deficient. The data suggest that defects or deficiency or ankyrin are responsible for HS at the SPH2 locus.

  16. Internet-based support for bioscience research: a collaborative genome center for human chromosome 12.

    PubMed Central

    Miller, P L; Nadkarni, P M; Kidd, K K; Cheung, K; Ward, D C; Banks, A; Bray-Ward, P; Cupelli, L; Herdman, V; Marondel, I

    1995-01-01

    This paper describes an approach that provides Internet-based support for a genome center to map human chromosome 12, as a collaboration between laboratories at the Albert Einstein College of Medicine in Bronx, New York, and the Yale University School of Medicine in New Haven, Connecticut. Informatics is well established as an important enabling technology within the genome mapping community. The goal of this paper is to use the chromosome 12 project as a case study to introduce a medical informatics audience to certain issues involved in genome informatics and in the Internet-based support of collaborative bioscience research. Central to the approach described is a shared database (DB/12) with Macintosh clients in the participating laboratories running the 4th Dimension database program as a user-friendly front end, and a Sun SPARCstation-2 server running Sybase. The central component of the database stores information about yeast artificial chromosomes (YACs), each containing a segment of human DNA from chromosome 12 to which genome markers have been mapped, such that an overlapping set of YACs (called a "contig") can be identified, along with an ordering of the markers. The approach also includes 1) a map assembly tool developed to help biologists interpret their data, proposing a ranked set of candidate maps, 2) the integration of DB/12 with external databases and tools, and 3) the dissemination of the results. This paper discusses several of the lessons learned that apply to many other areas of bioscience, and the potential role for the field of medical informatics in helping to provide such support. PMID:8581551

  17. Continuous chromosomal instability in human pluripotent stem cells - the role of DNA replication.

    PubMed

    Lamm, Noa; Kerem, Batsheva

    2016-07-01

    Human pluripotent stem cells (hPSCs) frequently acquire chromosomal aberrations, including aneuploidy, during culture. Recently, we identified a replication stress-based mechanism leading to ongoing chromosomal instability in aneuploid hPSCs that may also operate during the initiation of instability in diploid cells. PMID:27652327

  18. X Chromosome Abnormalities and Cognitive Development: Implications for Understanding Normal Human Development.

    ERIC Educational Resources Information Center

    Walzer, Stanley

    1985-01-01

    Argues that knowledge from studies of individuals with sex chromosome abnormalities can further understanding of aspects of normal human development. Studies of XO girls, XXY boys, XXX girls, and males with a fragile X chromosome are summarized to demonstrate how results contribute to knowledge about normal cognitive development and about…

  19. Report of the Second International Workshop on Human Chromosome 5 Mapping

    SciTech Connect

    Westbrook, C.A.; Neuman, W.L.; McPherson, J.; Wasmuth, J.; Camper, S.; Plaetke, R.; Williamson, R.

    1993-12-31

    This report describes the accomplishments of the Second International Workshop on Human Chromosome 5 as was held May 11--13,1992 at the University of Chicago. Included in the report are abstract of individual presentations and a consensus map of the chromosome.

  20. Painting Analysis of Chromosome Aberrations Induced by Energetic Heavy Ions in Human Cells

    NASA Technical Reports Server (NTRS)

    Wu, Honglu

    2006-01-01

    FISH, mFISH, mBAND, telomere and centromere probes have been used to study chromosome aberrations induced in human cells exposed to low-and high-LET radiation in vitro. High-LET induced damages are mostly a single track effect. Unrejoined chromosome breaks (incomplete exchanges) and complex type aberrations were higher for high-LET. Biosignatures may depend on the method the samples are collected. Recent mBAND analysis has revealed more information about the nature of intra-chromosome exchanges. Whether space flight/microgravity affects radiation-induced chromosome aberration frequencies is still an open question.

  1. The human immediate early gene BRF1 maps to chromosome 14q22-q24

    SciTech Connect

    Maclean, K.N.; Bustin, S.A.; McKay, I.A.; See, C.G.

    1995-11-01

    BRF1 (Butyrate response factor 1) is a member of an immediate early gene family specifying putative nuclear transcription factors. A repeat motif incorporating two Cys and two His is highly conserved between family members identified from yeast, Drosophila, mouse, rat, and human. The chromosome localization of none of the human genes has been determined thus far. Using the polymerase chain reaction on a human-rodent hybrid panel, we have localized BRF1 to chromosome 14. This was confirmed by direct sequencing of the PCR fragment. Using fluorescence in situ hybridization, the chromosome localization of BRF1 was further determined as 14q22-q24. 15 refs., 1 fig.

  2. Functional annotation of the human chromosome 7 "missing" proteins: a bioinformatics approach.

    PubMed

    Ranganathan, Shoba; Khan, Javed M; Garg, Gagan; Baker, Mark S

    2013-06-01

    The chromosome-centric human proteome project aims to systematically map all human proteins, chromosome by chromosome, in a gene-centric manner through dedicated efforts from national and international teams. This mapping will lead to a knowledge-based resource defining the full set of proteins encoded in each chromosome and laying the foundation for the development of a standardized approach to analyze the massive proteomic data sets currently being generated. The neXtProt database lists 946 proteins as the human proteome of chromosome 7. However, 170 (18%) proteins of human chromosome 7 have no evidence at the proteomic, antibody, or structural levels and are considered "missing" in this study as they lack experimental support. We have developed a protocol for the functional annotation of these "missing" proteins by integrating several bioinformatics analysis and annotation tools, sequential BLAST homology searches, protein domain/motif and gene ontology (GO) mapping, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Using the BLAST search strategy, homologues for reviewed non-human mammalian proteins with protein evidence were identified for 90 "missing" proteins while another 38 had reviewed non-human mammalian homologues. Putative functional annotations were assigned to 27 of the remaining 43 novel proteins. Proteotypic peptides have been computationally generated to facilitate rapid identification of these proteins. Four of the "missing" chromosome 7 proteins have been substantiated by the ENCODE proteogenomic peptide data.

  3. The IPP gene is assigned to human chromosome 1p32-1p22

    SciTech Connect

    Chang-Yeh, A.; Huang, R.C.C. ); Jabs, E.W.; Li, Xiang ); Dracopoli, N.C. )

    1993-01-01

    We previously reported the isolation and characterization of a novel mouse gene that is promoted by an intracisternal A-particle (IAP) LTR and is expressed in placental tissue (mouse IAP-promoted placenta gene, Ipp). Based on restriction fragment length polymorphism (RFLP) studies using inbred strains and recombinant inbred (RI) mice, we have established the linkage between the Ipp gene and several loci on distal mouse chromosome 4. In this publication, we report the partial sequence of a human cDNA clone isolated from a human placental library that has 83% identity to the 3[prime]region of the Ipp cDNA. For human chromosome mapping, two 20-base oligonucleotides within the homologous region were used as primers for polymerase chain reactions (PCR) to chromosome-specific DNAs from two somatic cell hybrid panels and several hybrid cell lines carrying breakpoints on human chromosome 1p. We have assigned this human homolog of the Ipp (IPP) gene to chromosome 1 at 1p32-1p22, based on analysis of PCR products. With this assignment, the homology between mouse chromosome 4 and human chromosome 1 is maintained (5). 7 refs., 1 fig.

  4. Paroxysmal dystonic choreoathetosis: Tight linkage to chromosome 2q

    SciTech Connect

    Fink, J.K.; Rainier, S.; Wilkowski, J.; Jones, S.M.

    1996-07-01

    Paroxysmal dystonic choreoathetosis (PDC) is characterized by attacks of involuntary movements that last up to several hours and occur at rest both spontaneously and following caffeine or alcohol consumption. We analyzed a Polish-American kindred with autosomal dominant PDC and identified tight linkage between the disorder and microsatellite markers on chromosome 2q (maximum two-point LOD score 4.77; recombination fraction 0). Our results clearly establish the existence of a locus for autosomal dominant PDC on distal chromosome 2q. The fact that three other paroxysmal neurological disorders (periodic ataxia with myokymia and hypo- and hyperkalemic periodic paralysis) are due to mutation in ion-channel genes raises the possibility that PDC is also due to an ion-channel gene mutation. It is noteworthy that a cluster of sodium-channel genes is located on distal chromosome 2q, near the PDC locus. Identifying the PDC locus on chromosome 2q will facilitate discovery whether PDC is genetically homogeneous and whether other paroxysmal movement disorders are also genetically linked to the PDC locus. 28 refs., 2 figs., 1 tab.

  5. Characteristics of chromosome instability in the human lymphoblast cell line WTK1

    NASA Technical Reports Server (NTRS)

    Schwartz, J. L.; Jordan, R.; Evans, H. H.

    2001-01-01

    The characteristics of spontaneous and radiation-induced chromosome instability were determined in each of 50 individual clones isolated from control populations of human lymphoblasts (WTK1), as well as from populations of these cells previously exposed to two different types of ionizing radiation, Fe-56 and Cs-137. The types of chromosome instability did not appear to change in clones surviving radiation exposure. Aneuploidy, polyploidy, chromosome dicentrics and translocations, and chromatid breaks and gaps were found in both control and irradiated clones. The primary effect of radiation exposure was to increase the number of cells within any one clone that had chromosome alterations. Chromosome instability was associated with telomere shortening and elevated levels of apoptosis. The results suggest that the proximal cause of chromosome instability is telomere shortening.

  6. Karyotyping human and mouse cells using probes from single-sorted chromosomes and open source software.

    PubMed

    Potapova, Tamara A; Unruh, Jay R; Box, Andrew C; Bradford, William D; Seidel, Christopher W; Slaughter, Brian D; Sivagnanam, Shamilene; Wu, Yuping; Li, Rong

    2015-12-01

    Multispectral karyotyping analyzes all chromosomes in a single cell by labeling them with chromosome-specific probes conjugated to unique combinations of fluorophores. Currently available multispectral karyotyping systems require the purchase of specialized equipment and reagents. However, conventional laser scanning confocal microscopes that are capable of separating multiple overlapping emission spectra through spectral imaging and linear unmixing can be utilized for classifying chromosomes painted with multicolor probes. Here, we generated multicolor chromosome paints from single-sorted human and mouse chromosomes and developed the Karyotype Identification via Spectral Separation (KISS) analysis package, a set of freely available open source ImageJ tools for spectral unmixing and karyotyping. Chromosome spreads painted with our multispectral probe sets can be imaged on widely available spectral laser scanning confocal microscopes and analyzed using our ImageJ tools. Together, our probes and software enable academic labs with access to a laser-scanning spectral microscope to perform multicolor karyotyping in a cost-effective manner.

  7. Flow analysis of human chromosome sets by means of mixing-stirring device

    NASA Astrophysics Data System (ADS)

    Zenin, Valeri V.; Aksenov, Nicolay D.; Shatrova, Alla N.; Klopov, Nicolay V.; Cram, L. Scott; Poletaev, Andrey I.

    1997-05-01

    A new mixing and stirring device (MSD) was used to perform flow karyotype analysis of single human mitotic chromosomes analyzed so as to maintain the identity of chromosomes derived from the same cell. An improved method for cell preparation and intracellular staining of chromosomes was developed. The method includes enzyme treatment, incubation with saponin and separation of prestained cells from debris on a sucrose gradient. Mitotic cells are injected one by one in the MSD which is located inside the flow chamber where cells are ruptured, thereby releasing chromosomes. The set of chromosomes proceeds to flow in single file fashion to the point of analysis. The device works in a stepwise manner. The concentration of cells in the sample must be kept low to ensure that only one cell at a time enters the breaking chamber. Time-gated accumulation of data in listmode files makes it possible to separate chromosome sets comprising of single cells. The software that was developed classifies chromosome sets according to different criteria: total number of chromosomes, overall DNA content in the set, and the number of chromosomes of certain types. This approach combines the high performance of flow cytometry with the advantages of image analysis. Examples obtained with different human cell lines are presented.

  8. Genetic dosage and position effect of small supernumerary marker chromosome (sSMC) in human sperm nuclei in infertile male patient.

    PubMed

    Olszewska, Marta; Wanowska, Elzbieta; Kishore, Archana; Huleyuk, Nataliya; Georgiadis, Andrew P; Yatsenko, Alexander N; Mikula, Mariya; Zastavna, Danuta; Wiland, Ewa; Kurpisz, Maciej

    2015-11-30

    Chromosomes occupy specific distinct areas in the nucleus of the sperm cell that may be altered in males with disrupted spermatogenesis. Here, we present alterations in the positioning of the human chromosomes 15, 18, X and Y between spermatozoa with the small supernumerary marker chromosome (sSMC; sSMC(+)) and spermatozoa with normal chromosome complement (sSMC(-)), for the first time described in the same ejaculate of an infertile, phenotypically normal male patient. Using classical and confocal fluorescent microscopy, the nuclear colocalization of chromosomes 15 and sSMC was analyzed. The molecular cytogenetic characteristics of sSMC delineated the karyotype as 47,XY,+der(15)(pter->p11.2::q11.1->q11.2::p11.2->pter)mat. Analysis of meiotic segregation showed a 1:1 ratio of sSMC(+) to sSMC(-) spermatozoa, while evaluation of sperm aneuploidy status indicated an increased level of chromosome 13, 18, 21 and 22 disomy, up to 7 × (2.7 - 15.1). Sperm chromatin integrity assessment did not reveal any increase in deprotamination in the patient's sperm chromatin. Importantly, we found significant repositioning of chromosomes X and Y towards the nuclear periphery, where both chromosomes were localized in close proximity to the sSMC. This suggests the possible influence of sSMC/XY colocalization on meiotic chromosome division, resulting in abnormal chromosome segregation, and leading to male infertility in the patient.

  9. The human tissue transglutaminase gene maps on chromosome 20q12 by in situ fluorescence hybridization

    SciTech Connect

    Gentile, V.; Davies, P.J.A. ); Baldini, A. )

    1994-03-15

    A cDNA encoding for the human tissue transglutaminase gene has been used to identify the chromosomal localization of the corresponding structural gene. The precise chromosomal and subregional localizations have been established by using in situ fluorescence mapping with a recombinant [lambda]-Zap phage containing the full cDNA coding sequence. The study showed that the human tissue transglutaminase gene is localized on chromosome 20 and, more precisely, within the band 20q12. To date, this is the third member of the transglutaminase gene family to be mapped. Human factor XIIIa (plasma transglutaminase), human keratinocyte transglutaminase (type I), and human tissue transglutaminase (type II) genes, although codifying for homologous enzymes, are localized on three different chromosomes. 16 refs., 1 fig.

  10. Localization of the human stress responsive MAP kinase-like CSAIDs binding protein (CSBP) gene to chromosome 6p21.3/21.2

    SciTech Connect

    McDonnell, P.C.; Young, P.R.; DiLella, A.G.

    1995-09-01

    The proinflammatory cytokines interleukin 1 (IL-1) and tumor necrosis factor (TNF) play a pivotal role in the initiation of inflammatory responses. Soluble protein antagonists of IL-1 and TNF, such as IL-1ra, sTNFR-Fc fusion, and monoclonal antibodies to TNF have proven to be effective at blocking acute and chronic responses in a number of animal models of inflammatory diseases such as rheumatoid arthritis, septic shock, and inflammatory bowel disease. Consequently, there has been considerable interest in discovering compounds that could inhibit the production of these cytokines and might therefore become treatments. Recently, a structurally related series of pyridinyl imidazoles was found to block IL-1 and TNF production from LPS-stimulated human monocytes and to ameliorate inflammatory diseases significantly in vivo, leading to their being named CSAIDs (cytokine suppressive anti-inflammatory drugs). The protein target of these compounds, termed CSBP (CSAID binding protein), was discovered to be a new member of the MAP kinase family of serine-threonine protein kinases whose kinase activity is activated by LPS in human monocytes. Independently, the same kinase, or its rodent homologues, was found to respond also to chemical, thermal, and osmotic stress and IL-1 treatment. Inhibition of this kinase correlated with reduction in inflammatory cytokine production from LPS-activated monocytes. 15 refs., 1 fig.

  11. A gene involved in control of human cellular senescence on human chromosome 1q

    SciTech Connect

    Hensler, P.J.; Pereira-Smith, O.M. ); Annab, L.A.; Barrett, J.C. )

    1994-04-01

    Normal cells in culture exhibit limited division potential and have been used as a model for cellular senescence. In contrast, tumor-derived or carcinogen- or virus-transformed cells are capable of indefinite division. Fusion of normal human diploid fibroblasts with immortal human cells yielded hybrids having limited life spans, indicating that cellular senescence was dominant. Fusions of various immortal human cell lines with each other led to the identification of four complementation groups for indefinite division. The purpose of this study was to determine whether human chromosome 1 could complement the recessive immortal defect of human cell lines assigned to one of the four complementation groups. Using microcell fusion, the authors introduced a single normal human chromosome 1 into immortal human cell lines representing the complementation groups and determined that it caused loss of proliferative potential of an osteosarcoma-derived cell line (TE85), a cytomegalovirus-transformed lung fibroblast cell line (CMV-Mj-HEL-1), and a Ki-ras[sup +]-transformed derivative of TE85 (143B TK[sup [minus

  12. Isolation of amplified DNA sequences from IMR-32 human neuroblastoma cells: facilitation by fluorescence-activated flow sorting of metaphase chromosomes.

    PubMed Central

    Kanda, N; Schreck, R; Alt, F; Bruns, G; Baltimore, D; Latt, S

    1983-01-01

    Human neuroblastoma IMR-32 cells have large homogeneously staining regions (HSRs), primarily in the short arms of chromosome 1. We have constructed a recombinant phage library that is enriched for DNA present in the HSR of this chromosome by using fluorescence-activated flow sorting for initial chromosome purification. Eleven distinct cloned DNA segments were identified that showed significantly greater hybridization to IMR-32 genomic DNA, detected by Southern blotting, than to normal human genomic DNA. These sequences have also been localized to the HSR of chromosome 1 by in situ hybridization. Based on an approximate 50-fold sequence amplification for each cloned segment and a total HSR size of 150,000 kilobases, the amplified unit in the HSR is estimated to be 3,000 kilobases. Sequences homologous to all cloned HSR DNA segments were mapped to human chromosome 2 by using human-mouse hybrid cells. Further work using in situ hybridization demonstrated that cloned HSR segments were localized in the short arm of chromosome 2 in both normal and IMR-32 cells. Thus, the amplification of these sequences in IMR-32 cells may have involved transposition from chromosome 2 to chromosome I. Images PMID:6575396

  13. SCNN1, an epithelial cell sodium channel gene in the conserved linkage group on mouse chromosome 6 and human chromosome 12

    SciTech Connect

    Meisler, M.H.; Barrow, L.L.; Canessa, C.M.

    1994-11-01

    SCNN1, a gene encoding a nonvoltage-gated sodium channel, was detected using a rat colon cDNA probe with homology to Caenorhabditis elegans degenerin genes. Human SCNN1 was assigned to chromosome 12 using the NIGMS hybrid mapping panel 2. Mouse SCNN1 was mapped to a conserved linkage group on distal chromosome 6. The observed order of mouse genes was centromere-Raf1-(2.1 {plus_minus} 2.1)Scnn1, Vwf-(1.9 {plus_minus} 1.9)-Ntf3, with 0/101 recombinants between Scnn1 and Vwf. No rearrangements of genomic DNA were detected in the linked mouse mutations deaf waddler (dfw) and opisthotonus (opt). 10 refs., 1 fig.

  14. Localization of the structural gene for human apolipoprotein A-I on the long arm of human chromosome 11.

    PubMed Central

    Cheung, P; Kao, F T; Law, M L; Jones, C; Puck, T T; Chan, L

    1984-01-01

    Apolipoprotein A-I (apo A-I), the major apolipoprotein in human high density lipoproteins, is involved in the disease atherosclerosis. Cloned apo A-I cDNA (pA1-3) was used as a probe in chromosome mapping studies to detect the human apo A-I structural gene sequence in human-Chinese hamster cell hybrids. Southern blot analysis of 13 hybrids localized the gene to human chromosome 11. Confirmation of the chromosomal assignment was obtained by analysis of a hybrid (J1) containing a single human chromosome, no. 11. Regional mapping was achieved by using deletion subclones of J1 that localized the human apo A-I structural gene to the region 11q13 leads to qter. Since the human apolipoprotein C-III (apo C-III) structural gene is closely linked to apo A-I, it can be assigned to the same region on the long arm of chromosome 11. By extension of methods previously described, it now appears possible to carry out fine-structure analysis of this and related gene regions on chromosome 11 and to study the biochemical concomitants of these genes and of genes on other chromosomes for analysis of their role in atherosclerosis. Images PMID:6420790

  15. Architecture and anatomy of the chromosomal locus in human chromosome 21 encoding the Cu/Zn superoxide dismutase.

    PubMed Central

    Levanon, D; Lieman-Hurwitz, J; Dafni, N; Wigderson, M; Sherman, L; Bernstein, Y; Laver-Rudich, Z; Danciger, E; Stein, O; Groner, Y

    1985-01-01

    The SOD-1 gene on chromosome 21 and approximately 100 kb of chromosomal DNA from the 21q22 region have been isolated and characterized. The gene which is present as a single copy per haploid genome spans 11 kb of chromosomal DNA. Heteroduplex analysis and DNA sequencing reveals five rather small exons and four introns that interrupt the coding region. The donor sequence at the first intron contains an unusual variant dinucleotide 5'-G-C, rather than the highly conserved 5'-GT. The unusual splice junction is functional in vivo since it was detected in both alleles of the SOD-1 gene, which were defined by differences in the length of restriction endonuclease fragments (RFLPs) that hybridize to the cDNA probe. Genomic blots of human DNA isolated from cells trisomic for chromosome 21 (Down's syndrome patients) show the normal pattern of bands. At the 5' end of gene there are the 'TATA' and 'CAT' promoter sequences as well as four copies of the -GGCGGG- hexanucleotide. Two of these -GC- elements are contained within a 13 nucleotide inverted repeat that could form a stem-loop structure with stability of -33 kcal. The 3'-non coding region of the gene contains five short open reading-frames starting with ATG and terminating with stop codons. Images Fig. 1. Fig. 3. Fig. 7. PMID:3160582

  16. Haplotyping the human leukocyte antigen system from single chromosomes

    PubMed Central

    Murphy, Nicholas M.; Burton, Matthew; Powell, David R.; Rossello, Fernando J.; Cooper, Don; Chopra, Abha; Hsieh, Ming Je; Sayer, David C.; Gordon, Lavinia; Pertile, Mark D; Tait, Brian D.; Irving, Helen R.; Pouton, Colin W.

    2016-01-01

    We describe a method for determining the parental HLA haplotypes of a single individual without recourse to conventional segregation genetics. Blood samples were cultured to identify and sort chromosome 6 by bivariate flow cytometry. Single chromosome 6 amplification products were confirmed with a single nucleotide polymorphism (SNP) array and verified by deep sequencing to enable assignment of both alleles at the HLA loci, defining the two haplotypes. This study exemplifies a rapid and efficient method of haplotyping that can be applied to any chromosome pair, or indeed all chromosome pairs, using a single sorting operation. The method represents a cost-effective approach to complete phasing of SNPs, which will facilitate a deeper understanding of the links between SNPs, gene regulation and protein function. PMID:27461731

  17. Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content.

    PubMed

    Hughes, Jennifer F; Skaletsky, Helen; Pyntikova, Tatyana; Graves, Tina A; van Daalen, Saskia K M; Minx, Patrick J; Fulton, Robert S; McGrath, Sean D; Locke, Devin P; Friedman, Cynthia; Trask, Barbara J; Mardis, Elaine R; Warren, Wesley C; Repping, Sjoerd; Rozen, Steve; Wilson, Richard K; Page, David C

    2010-01-28

    The human Y chromosome began to evolve from an autosome hundreds of millions of years ago, acquiring a sex-determining function and undergoing a series of inversions that suppressed crossing over with the X chromosome. Little is known about the recent evolution of the Y chromosome because only the human Y chromosome has been fully sequenced. Prevailing theories hold that Y chromosomes evolve by gene loss, the pace of which slows over time, eventually leading to a paucity of genes, and stasis. These theories have been buttressed by partial sequence data from newly emergent plant and animal Y chromosomes, but they have not been tested in older, highly evolved Y chromosomes such as that of humans. Here we finished sequencing of the male-specific region of the Y chromosome (MSY) in our closest living relative, the chimpanzee, achieving levels of accuracy and completion previously reached for the human MSY. By comparing the MSYs of the two species we show that they differ radically in sequence structure and gene content, indicating rapid evolution during the past 6 million years. The chimpanzee MSY contains twice as many massive palindromes as the human MSY, yet it has lost large fractions of the MSY protein-coding genes and gene families present in the last common ancestor. We suggest that the extraordinary divergence of the chimpanzee and human MSYs was driven by four synergistic factors: the prominent role of the MSY in sperm production, 'genetic hitchhiking' effects in the absence of meiotic crossing over, frequent ectopic recombination within the MSY, and species differences in mating behaviour. Although genetic decay may be the principal dynamic in the evolution of newly emergent Y chromosomes, wholesale renovation is the paramount theme in the continuing evolution of chimpanzee, human and perhaps other older MSYs.

  18. Duplication of the DR3 gene on human chromosome 1p36 and its deletion in human neuroblastoma.

    PubMed

    Grenet, J; Valentine, V; Kitson, J; Li, H; Farrow, S N; Kidd, V J

    1998-05-01

    The human DR3 gene, whose product is also known as Wsl-1/APO-3/TRAMP/LARD, encodes a tumor necrosis factor-related receptor that is expressed primarily on the surface of thymocytes and lymphocytes. DR3 is capable of inducing both NF-kappa B activation and apoptosis when overexpressed in mammalian cells, although its ligand has not yet been identified. We report here that the DR3 gene locus is tandemly duplicated on human chromosome band 1p36.2-p36.3 and that these genes are hemizygously deleted and/or translocated to another chromosome in neuroblastoma (NB) cell lines with amplified MYCN. Duplication of at least a portion of the DR3 gene, including the extracellular and transmembrane regions but not the cytoplasmic domain, was demonstrated by both fluorescence in situ hybridization and genomic Southern blotting. In most NB cell lines, both the DR3 and the DR3L sequences are simultaneously deleted and/or translocated to another chromosome. Finally, DR3/ Wsl-1 protein expression is quite variable among these NB cell lines, with very low or undetectable levels in 7 of 17 NB cell lines.

  19. A complex chromosomal rearrangement involving chromosomes 2, 5, and X in autism spectrum disorder.

    PubMed

    Griesi-Oliveira, Karina; Moreira, Danielle de Paula; Davis-Wright, Nicole; Sanders, Stephan; Mason, Christopher; Orabona, Guilherme Müller; Vadasz, Estevão; Bertola, Débora Romeo; State, Matthew W; Passos-Bueno, Maria Rita

    2012-07-01

    Here, we describe a female patient with autism spectrum disorder and dysmorphic features that harbors a complex genetic alteration, involving a de novo balanced translocation t(2;X)(q11;q24), a 5q11 segmental trisomy and a maternally inherited isodisomy on chromosome 5. All the possibly damaging genetic effects of such alterations are discussed. In light of recent findings on ASD genetic causes, the hypothesis that all these alterations might be acting in orchestration and contributing to the phenotype is also considered.

  20. Paternal Age and Numerical Chromosome Abnormalities in Human Spermatozoa.

    PubMed

    Donate, Anna; Estop, Anna M; Giraldo, Jesús; Templado, Cristina

    2016-01-01

    This study explores the relationship between numerical chromosome abnormalities in sperm and age in healthy men. We performed FISH in the spermatozoa of 10 donors from the general population: 5 men younger than 40 years of age and 5 fertile men older than 60 years of age. For each chromosome, 1,000 sperm nuclei were analyzed, with a total of 15,000 sperm nuclei for each donor. We used a single sperm sample per donor, thus minimizing intra-donor variability and optimizing consistent analysis. FISH with a TelVysion assay, which provides data on aneuploidy of 19 chromosomes, was used in order to gain a more genome-wide perspective of the level of aneuploidy. Aneuploidy and diploidy rates observed in the younger and older groups were compared. There were no significant differences in the incidence of autosomal disomy, sex chromosome disomy, total chromosome disomy, diploidy, nor total numerical abnormalities between younger and older men. This work confirms that aneuploidy of the sex chromosomes is more common than that of autosomes and that this does not change with age. Our results suggest that some probe combinations have a tendency to indicate higher levels of diploidy, thus potentially affecting FISH results and highlighting the limitations of FISH. PMID:27322585

  1. New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree

    PubMed Central

    Karafet, Tatiana M.; Mendez, Fernando L.; Meilerman, Monica B.; Underhill, Peter A.; Zegura, Stephen L.; Hammer, Michael F.

    2008-01-01

    Markers on the non-recombining portion of the human Y chromosome continue to have applications in many fields including evolutionary biology, forensics, medical genetics, and genealogical reconstruction. In 2002, the Y Chromosome Consortium published a single parsimony tree showing the relationships among 153 haplogroups based on 243 binary markers and devised a standardized nomenclature system to name lineages nested within this tree. Here we present an extensively revised Y chromosome tree containing 311 distinct haplogroups, including two new major haplogroups (S and T), and incorporating approximately 600 binary markers. We describe major changes in the topology of the parsimony tree and provide names for new and rearranged lineages within the tree following the rules presented by the Y Chromosome Consortium in 2002. Several changes in the tree topology have important implications for studies of human ancestry. We also present demography-independent age estimates for 11 of the major clades in the new Y chromosome tree. PMID:18385274

  2. New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree.

    PubMed

    Karafet, Tatiana M; Mendez, Fernando L; Meilerman, Monica B; Underhill, Peter A; Zegura, Stephen L; Hammer, Michael F

    2008-05-01

    Markers on the non-recombining portion of the human Y chromosome continue to have applications in many fields including evolutionary biology, forensics, medical genetics, and genealogical reconstruction. In 2002, the Y Chromosome Consortium published a single parsimony tree showing the relationships among 153 haplogroups based on 243 binary markers and devised a standardized nomenclature system to name lineages nested within this tree. Here we present an extensively revised Y chromosome tree containing 311 distinct haplogroups, including two new major haplogroups (S and T), and incorporating approximately 600 binary markers. We describe major changes in the topology of the parsimony tree and provide names for new and rearranged lineages within the tree following the rules presented by the Y Chromosome Consortium in 2002. Several changes in the tree topology have important implications for studies of human ancestry. We also present demography-independent age estimates for 11 of the major clades in the new Y chromosome tree.

  3. cDNA cloning, molecular characterization, and chromosomal localization of NET(EPHT2), a human EPH-related receptor protein-tyrosine kinase gene preferentially expressed in brain

    SciTech Connect

    Tang, X.X.; Yoshioka, A.; Pleasure, D.E.

    1995-09-20

    By screening a human fetal brain cDNA expression library using a monoclonal anti-phosphotyrosine antibody , we have isolated a cDNA clone encoding a receptor type protein-tyrosine kinase belonging to the EPH family, NET (neuronally expressed EPH-related tyrosine kinase). NET shows 87% homology in nucleotide sequence and 99% homology in the deduced amino acid sequence to rat elk, suggesting that NET is the human homologue of elk. The NET gene is mapped to human chromosome 3q21-q23 by PCR screening of a human rodent somatic cell hybrid panel and by fluorescence in situ hybridization. Examination of NET mRNA expression in several human tissues has shown that the NET gene is expressed preferentially in brain as a 5-kb transcript. Steady-state levels of NET mRNA in human brain are greater in the midterm fetus than in the adult. Lower levels of NET mRNA are found in fetal kidney and adult skeletal muscle. The expression pattern of NET mRNA thus differs from that of elk, suggesting that these two gene products may preform distinct roles in human and rat. NET transcripts are detected in human acid-induced neuronal differentiation. Several human tumor cell lines derived from neuroectoderm including primitive neuroblastoma also express NET transcripts. Since the NET mRNA expression in human brain is developmentally regulated and is induced during neuronal differentiation, NET potentially plays important roles in human neurogenesis. 89 refs., 7 figs.

  4. Comparative mapping of DNA probes derived from the V{sub k} immunoglobulin gene regions on human and great ape chromosomes by fluorescence in situ hybridization

    SciTech Connect

    Arnold, N.; Wienberg, J.; Ermert, K.

    1995-03-01

    Fluorescence in situ hybridization (FISH) of cosmid clones of human V{sub K} gene regions to human and primate chromosomes contributed to the dating of chromosome reorganizations in evolution. A clone from the K locus at 2p11-p12 (cos 106) hybridized to the assumed homologous chromosome bands in the chimpanzees Pan troglodytes (PTR) and P. paniscus (PPA), the Gorilla gorilla (GGO), and the orangutan Pongo Pygmaeus (PPY). Human and both chimpanzees differed from gorilla and orangutan by the mapping of cos 170, a clone derived from chromosome 2cen-q11.2; the transposition of this orphon to the other side of the centromere can, therefore, be dated after the human/chimpanzee and gorilla divergence. Hybridization to homologous bands was also found with a cosmid clone containing a V{sub K}I orphon located on chromosome 1 (cos 115, main signal at 1q31-q32), although the probe is not fully unique. Also, a clone derived from the orphon V{sub K} region on chromosome 22q11 (cos 121) hybridized to the homologous bands in the great apes. This indicates that the orphons on human chromosomes 1 and 22 had been translocated early in primate evolution. 18 refs., 2 figs.

  5. Structure and expression of Strabismus 1 gene on human chromosome 1q21-q23.

    PubMed

    Katoh, Masaru

    2002-06-01

    Xenopus Strabismus (Stbm) is a negative regulator of the WNT - beta-catenin signaling pathway. Strabismus 1 (STB1/VangL2) and Strabismus 2 (STB2/Vangl1) are human homologues of Xenopus Stbm and Drosophila Stbm/ Van Gogh (Vang) STB1 and STB2 are four-transmembrane-type proteins with Dishevelled-binding motif. STB2 and CASQ2 genes are located on human chromosome 1p13.3-p11 with an interval less than 5 kb. Here, STB1 gene and CASQ1 gene were found to be located on human chromosome 1q21-q23 with an interval of about 210 kb including Nicastrin, COPA, PXF, H326 and PEA15 genes. Exon-intron structure was well conserved between STB1 and STB2 genes. STB1-CASQ1 gene cluster and STB2-CASQ2 gene cluster might be generated due to duplication of ancestral gene cluster, and several genes might be inserted into the STB1-CASQ1 intergenic region during or after gene-cluster duplication. STB1 mRNA was relatively highly expressed in prostate, trachea, thymus, lymph node, placenta, fetal kidney, fetal brain, and fetal lung. In adult brain, STB1 mRNA was more highly expressed in cerebellum, corpus callosum, amygdala, and medulla oblongata. STB1 mRNA was moderately expressed in K-562 (chronic myelogenous leukemia), G-361 (melanoma), and MKN7 (gastric cancer). On the other hand, STB1 mRNA was almost undetectable in several human cancer cell lines, and was down-regulated in 4 out of 14 cases of primary kidney tumors, and in 2 out of 3 cases of primary lung cancer. Loss-of-function mutation of STB1 gene might lead to carcinogenesis through activation of the WNT - beta-catenin signaling pathway.

  6. Expanded conserved linkage group between human 16p13 and the Scid region of the mouse chromosome 16

    SciTech Connect

    Deng, Z.M.; Siciliano, M.J.; Davisson, M.T.

    1994-09-01

    Knowledge of homologies between human and mouse chromosomes is essential for understanding chromosomal evolution and the development of experimental models for human disease. We have reported the identification of a conserved linkage group between human 16p13 and the centromeric portion of the mouse 16. Defining the extent of this linkage conservation has significant biomedical implications since that region of mouse genome contains the Scid mutation and the human 16p13 contains genes that are involved in DNA repair and certain types of human leukemia as well as other diseases such as Rubinstein-Taybi Syndrome. Here, this conserved linkage group has been defined and expanded. It now contains 5 genetic loci and spans more than 3 Mb in human and 23 cM in mouse. The 5 loci are PRM1,2 (protamine 1 and 2), NOP3 (a subclone of D16S237), GSPT1 (a gene involved in the regulation of G1 to S phase transition), MYH11 (a human smooth muscle myosin heavy chain gene) and MRP (multi-drug resistant-associated protein gene). Using a panel of human-rodent hybrids that are informative for different portions of human 16, we have established the following order on human 16p: telomere-NOP3-PRM1,2-GSPT1-(MYH11,MRP)-centromere. The genes were assigned to the mouse chromosome 16 by a mouse-Chinese hamster somatic cell hybrid panel informative for mouse chromosomes. Linkage analysis using backcross mice informative for the Scid mutation indicated the following order and genetic distance (in cM) in mouse: centromere-Nop3-11.7-Prm1-1.4-Gspt1-8.2-(Myh11,Mrp)-1.4-Scid-telomere.

  7. Localization of the gene for the ciliary neutrotrophic factor receptor (CNTFR) to human chromosome 9

    SciTech Connect

    Donaldson, D.H.; Jones, C.; Patterson, D. Univ. of Colorado Health Science Center, Denver, CO ); Britt, D.E.; Jackson, C.L. )

    1993-09-01

    Ciliary neurotrophic factor (CNTF) has recently been found to be important for the survival of motor neurons and has shown activity in animal models of amyotrophic lateral sclerosis (ALS). CNTF therefore holds promise as a treatment for ALS, and it and its receptor (CNTFR) are candidates for a gene involved in familial ALS. The CNTFR gene was mapped to chromosome 9 by PCR on a panel of human/CHO somatic cell hybrids and localized to 9p13 by PCR on a panel of radiation hybrids. 18 ref., 1 fig., 2 tabs.

  8. Construction of DNA libraries from flow sorted human chromosomes

    SciTech Connect

    Deaven, L.L.; McCormick, M.K.; Grady, D.L.

    1994-09-01

    We have constructed a series of DNA libraries from flow-sorted chromosomes. Small insert, complete digest libraries cloned into the EcoRI insertion site of Charon 21A are available from the American Type Culture Collection, Rockville, MD. Partial digest libraries cloned into cosmid (sCos1) or phage (Charon 40) vectors have been constructed for chromosomes 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, X and Y. Purity estimates by in situ analysis of sorted chromosomes, flow karyotype analysis, and plaque or colony hybridization indicate that most of these libraries are 90-95% pure. Additional cosmid library constructions, 5-10X arrays of libraries into microtiter plates, and high density membrane arrays of libraries are in progress. Recently, we have completed YAC libraries for chromosomes 5, 9, 16, and 21. These libraries are made from complete DNA digests using the rare cutters Clal, SacII, EagI, or NotI/NheI. The average insert size is {similar_to}200 kb, and chimera frequencies are low (1-10%). Libraries have also been constructed using M13 or bluescript vectors (chromosomes 5, 7, 17) to generate STS markers for the selection of chromosome-specific inserts from total genomic AC libraries. Because of the advantages of insert size and stability associated with BAC and PAC cloning systems, we are currently attempting to adapt pBAC108L and pCYPAC1 vectors for use with flow-sorted chromosomal DNA.

  9. Cloning and primary structure of a human islet isoform of glutamic acid decarboxylase from chromosome 10

    SciTech Connect

    Karlsen, A.E.; Hagopian, W.A.; Grubin, C.E.; Dube, S.; Disteche, C.M.; Adler, D.A.; Baermeier, H.; Lernmark, A. ); Mathewes, S.; Grant, F.J.; Foster, D. )

    1991-10-01

    Glutamic acid decarboxylase which catalyzes formation of {gamma}-aminobutyric acid from L-glutamic acid, is detectable in different isoforms with distinct electrophoretic and kinetic characteristics. GAD has also been implicated as an autoantigen in the vastly differing autoimmune disease stiff-man syndrome and insulin-dependent diabetes mellitus. Despite the differing GAD isoforms, only one type of GAD cDNA (GAD-1), localized to a syntenic region of chromosome 2, has been isolated from rat, mouse, and cat. Using sequence information from GAD-1 to screen a human pancreatic islet cDNA library, the authors describe the isolation of an additional GAD cDNA (GAD-2), which was mapped to the short arm of human chromosome 10. Genomic Southern blotting with GAD-2 demonstrated a hybridization pattern different form that detected by GAD-1. GAD-2 recognizes a 5.6-kilobase transcript in both islets and brain, in contrast to GAD-1, which detects a 3.7-kilobase transcript in brain only. The deduced 585-amino acid sequence coded for by GAD-2 shows < 65% identify to previously published, highly conserved GAD-1 brain sequences, which show > 96% deduced amino acid sequence homology among the three species.

  10. Cloning and linkage mapping of three polymorphic tetranucleotide (TAAA)[sub n] repeats on human chromosome 21

    SciTech Connect

    Kalaitsidaki, M.; Antonarakis, S.E. ); Cox, T.; Chakravarti, A. )

    1992-12-01

    The authors report the cloning, sequencing, and mapping of three short sequence repeat polymorphisms due to tetranucleotide (TAAA) repeats from human chromosome 21. These DNA markers (D21S221, D21S225, D21S226) have been cloned from the chromosome 21-specific plasmid library of J. C. Fuscoe, C. C. Collins, D. Pinkel, and J. W. Gray and were shown to be polymorphic by polymerase chain reaction amplification and polyacrylamide gel electrophoresis. Genotypes were determined in informative CEPH pedigrees and used in linkage analysis relative to other mapped markers on human chromosome 21. One of these markers, D21S221, is closely linked to the amyloid precursor protein gene (APP), which has been implicated in the etiology of familial Alzheimer disease in some families. 18 refs., 3 figs., 2 tabs.

  11. The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23

    SciTech Connect

    Li, S.S.L.; Sharief, F.S. )

    1993-09-01

    Human prostatic acid phosphatase (ACPP) has been used as a diagnostic marker for prostate cancer. It is synthesized under androgen regulation and secreted by the epithelial cells of the prostate gland. The authors have confirmed the previous assignment of the ACPP gene to chromosome 3 by probing a panel of 25 human-Chinese hamster somatic cell hybrids, and they have further localized the ACPP gene to chromosome 3q21-q23 by fluorescence in situ hybridization. 10 refs., 1 fig.

  12. Isolation and mapping of the human eukaryotic translation initiation factor 5 to chromosome 14

    SciTech Connect

    Romano, D.M.; Wasco, W.; Murell, J.

    1994-09-01

    Eukaryotic translation initiation factor 5 (eIF-5) is essential for the initiation of protein synthesis. eIF-5 catalyzes the hydrolysis of GTP on the 40S ribosomal initiation complex. Subsequent to GTP hydrolysis and the release of eIF-2-GDP, the 60S ribosomal subunit is joined to the 40S subunit to form an 80S initiation complex which can engage in peptide transfer. In an effort to isolate the major early-onset familial Alzheimer`s disease (FAD) gene on chromosome 14, we have isolated expressed sequences from this autosome in the form of exons `trapped` from chromosome 14-specific cosmids (library provided by L. Deaven, Los Alamos, NM). One cosmid yielded multiple exons displaying strong DNA and amino acid homology (>90%) with the rat eIF-5 gene. These exons were used to isolate full-length cDNAs from a human brain library. The eIF-5 message is approximately 3.6 kB in size and is ubiquitously expressed. The predicted amino acid sequence reveals multiple phosphorylation sites which may be involved in regulation of activity of eIF-5 and regions with homology to the GTPase superfamily, consistent with eIF-5`s role in GTP hydrolysis. Further studies are underway to determine whether the eIF-5 gene resides within the FAD minimal candidate region on chromosome 14q24.3.

  13. Synteny of human chromosomes 14 and 15 in the platyrrhines (Primates, Platyrrhini)

    PubMed Central

    2009-01-01

    In order to study the intra- and interspecific variability of the 14/15 association in Platyrrhini, we analyzed 15 species from 13 genera, including species that had not been described yet. The DNA libraries of human chromosomes 14 and 15 were hybridized to metaphases of Alouatta guariba clamitans, A. caraya, A. sara, Ateles paniscus chamek, Lagothrix lagothricha, Brachyteles arachnoides, Saguinus midas midas, Leontopithecus chrysomelas, Callimico goeldii, Callithrix sp., Cebus apella, Aotus nigriceps, Cacajao melanocephalus,Chiropotes satanas and Callicebus caligatus. The 14/15 hybridization pattern was present in 13 species, but not in Alouatta sara that showed a 14/15/14 pattern and Aotus nigriceps that showed a 15/14/15/14 pattern. In the majority of the species, the HSA 14 homologue retained synteny for the entire chromosome, whereas the HSA 15 homologue displayed fragmented segments. Within primates, the New World monkeys represent the taxon with the highest variability in chromosome number (2n = 16 to 62). The presence of the HSA 14/15 association in all species and subspecies studied herein confirms that this association is the ancestral condition for platyrrhines and that this association has been retained in most platyrrhines, despite the occurrence of extensive inter- and intrachromosomal rearrangements in this infraorder of Primates. PMID:21637455

  14. Synteny of human chromosomes 14 and 15 in the platyrrhines (Primates, Platyrrhini).

    PubMed

    Gifalli-Iughetti, Cristiani; Koiffmann, Célia P

    2009-10-01

    In order to study the intra- and interspecific variability of the 14/15 association in Platyrrhini, we analyzed 15 species from 13 genera, including species that had not been described yet. The DNA libraries of human chromosomes 14 and 15 were hybridized to metaphases of Alouatta guariba clamitans, A. caraya, A. sara, Ateles paniscus chamek, Lagothrix lagothricha, Brachyteles arachnoides, Saguinus midas midas, Leontopithecus chrysomelas, Callimico goeldii, Callithrix sp., Cebus apella, Aotus nigriceps, Cacajao melanocephalus,Chiropotes satanas and Callicebus caligatus. The 14/15 hybridization pattern was present in 13 species, but not in Alouatta sara that showed a 14/15/14 pattern and Aotus nigriceps that showed a 15/14/15/14 pattern. In the majority of the species, the HSA 14 homologue retained synteny for the entire chromosome, whereas the HSA 15 homologue displayed fragmented segments. Within primates, the New World monkeys represent the taxon with the highest variability in chromosome number (2n = 16 to 62). The presence of the HSA 14/15 association in all species and subspecies studied herein confirms that this association is the ancestral condition for platyrrhines and that this association has been retained in most platyrrhines, despite the occurrence of extensive inter- and intrachromosomal rearrangements in this infraorder of Primates.

  15. The use of DAPI fluorescence lifetime imaging for investigating chromatin condensation in human chromosomes

    PubMed Central

    Estandarte, Ana Katrina; Botchway, Stanley; Lynch, Christophe; Yusuf, Mohammed; Robinson, Ian

    2016-01-01

    Chromatin undergoes dramatic condensation and decondensation as cells transition between the different phases of the cell cycle. The organization of chromatin in chromosomes is still one of the key challenges in structural biology. Fluorescence lifetime imaging (FLIM), a technique which utilizes a fluorophore’s fluorescence lifetime to probe changes in its environment, was used to investigate variations in chromatin compaction in fixed human chromosomes. Fixed human metaphase and interphase chromosomes were labeled with the DNA minor groove binder, DAPI, followed by measurement and imaging of the fluorescence lifetime using multiphoton excitation. DAPI lifetime variations in metaphase chromosome spreads allowed mapping of the differentially compacted regions of chromatin along the length of the chromosomes. The heteromorphic regions of chromosomes 1, 9, 15, 16, and Y, which consist of highly condensed constitutive heterochromatin, showed statistically significant shorter DAPI lifetime values than the rest of the chromosomes. Differences in the DAPI lifetimes for the heteromorphic regions suggest differences in the structures of these regions. DAPI lifetime variations across interphase nuclei showed variation in chromatin compaction in interphase and the formation of chromosome territories. The successful probing of differences in chromatin compaction suggests that FLIM has enormous potential for application in structural and diagnostic studies. PMID:27526631

  16. Human germ cell formation in xenotransplants of induced pluripotent stem cells carrying X chromosome aneuploidies.

    PubMed

    Dominguez, Antonia A; Chiang, H Rosaria; Sukhwani, Meena; Orwig, Kyle E; Reijo Pera, Renee A

    2014-09-22

    Turner syndrome is caused by complete or partial loss of the second sex chromosome and is characterized by spontaneous fetal loss in >90% of conceptions. Survivors possess an array of somatic and germline clinical characteristics. Induced pluripotent stem cells (iPSCs) offer an opportunity for insight into genetic requirements of the X chromosome linked to Turner syndrome. We derived iPSCs from Turner syndrome and control individuals and examined germ cell development as a function of X chromosome composition. We demonstrate that two X chromosomes are not necessary for reprogramming or maintenance of pluripotency and that there are minimal differences in gene expression, at the single cell level, linked to X chromosome aneuploidies. Formation of germ cells, as assessed in vivo through a murine xenotransplantation model, indicated that undifferentiated iPSCs, independent of X chromosome composition, are capable of forming germ-cell-like cells (GCLCs) in vivo. In combination with clinical data regarding infertility in women with X chromosome aneuploidies, results suggest that two intact X chromosomes are not required for human germ cell formation, qualitatively or quantitatively, but rather are likely to be required for maintenance of human germ cells to adulthood.

  17. The use of DAPI fluorescence lifetime imaging for investigating chromatin condensation in human chromosomes.

    PubMed

    Estandarte, Ana Katrina; Botchway, Stanley; Lynch, Christophe; Yusuf, Mohammed; Robinson, Ian

    2016-01-01

    Chromatin undergoes dramatic condensation and decondensation as cells transition between the different phases of the cell cycle. The organization of chromatin in chromosomes is still one of the key challenges in structural biology. Fluorescence lifetime imaging (FLIM), a technique which utilizes a fluorophore's fluorescence lifetime to probe changes in its environment, was used to investigate variations in chromatin compaction in fixed human chromosomes. Fixed human metaphase and interphase chromosomes were labeled with the DNA minor groove binder, DAPI, followed by measurement and imaging of the fluorescence lifetime using multiphoton excitation. DAPI lifetime variations in metaphase chromosome spreads allowed mapping of the differentially compacted regions of chromatin along the length of the chromosomes. The heteromorphic regions of chromosomes 1, 9, 15, 16, and Y, which consist of highly condensed constitutive heterochromatin, showed statistically significant shorter DAPI lifetime values than the rest of the chromosomes. Differences in the DAPI lifetimes for the heteromorphic regions suggest differences in the structures of these regions. DAPI lifetime variations across interphase nuclei showed variation in chromatin compaction in interphase and the formation of chromosome territories. The successful probing of differences in chromatin compaction suggests that FLIM has enormous potential for application in structural and diagnostic studies. PMID:27526631

  18. pain2: A neuropathic pain QTL identified on rat chromosome 2.

    PubMed

    Nissenbaum, Jonathan; Shpigler, Hagai; Pisanté, Anne; DelCanho, Sonia; Minert, Anne; Seltzer, Ze'ev; Devor, Marshall; Darvasi, Ariel

    2008-03-01

    We aimed to locate a chronic pain-associated QTL in the rat (Rattus norvegicus) based on previous findings of a QTL (pain1) on chromosome 15 of the mouse (Mus musculus). The work was based on rat selection lines HA (high autotomy) and LA (low autotomy) which show a contrasting pain phenotype in response to nerve injury in the neuroma model of neuropathic pain. An F(2) segregating population was generated from HA and LA animals. Phenotyped F(2) rats were genotyped on chromosome 7 and chromosome 2, regions that share a partial homology with mouse chromosome 15. Our interval mapping analysis revealed a LOD score value of 3.63 (corresponding to p=0.005 after correcting for multiple testing using permutations) on rat chromosome 2, which is suggestive of the presence of a QTL affecting the predisposition to neuropathic pain. This QTL was mapped to the 14-26cM interval of chromosome 2. Interestingly, this region is syntenic to mouse chromosome 13, rather than to the region of mouse chromosome 15 that contains pain1. This chromosomal position indicates that it is possibly a new QTL, and hence we name it pain2. Further work is needed to replicate and to uncover the underlying gene(s) in both species.

  19. Genetic Polymorphism of Human Y Chromosome and Risk Factors for Cardiovascular Diseases: A Study in WOBASZ Cohort

    PubMed Central

    Kostrzewa, Grażyna; Broda, Grażyna; Konarzewska, Magdalena; Krajewki, Paweł; Płoski, Rafał

    2013-01-01

    Genetic variants of Y chromosome predispose to hypertension in rodents, whereas in humans the evidence is conflicting. Our purpose was to study the distribution of a panel of Y chromosome markers in a cohort from a cross-sectional population-based study on the prevalence of cardiovascular risk factors in Poland (WOBASZ study). The HindIII, YAP Y chromosome variants, previously shown to influence blood pressure, lipid traits or height, as well as SNPs defining main Y chromosome haplogroups, were typed in 3026, 2783 and 2652 samples, respectively. In addition, 4 subgroups (N∼100 each) representing extremes of LDL concentration or blood pressure (BP) were typed for a panel of 17 STRs. The HindIII and YAP polymorphism were not associated with any of the studied traits. Analysis of the haplogroup distribution showed an association between higher HDL level and hg I-M170 (P = 0.02), higher LDL level and hg F*(xI-M170, J2-M172, K-M9) (P = 0.03) and lower BMI and hg N3-Tat (P = 0.04). Analysis of STRs did not show statistically significant differences. Since all these associations lost statistical significance after Bonferroni correction, we conclude that a major role of Y chromosome genetic variation (defined by HindIII, YAP or main Y chromosome haplogroups) in determining cardiovascular risk in Poles is unlikely. PMID:23935855

  20. Bioinformatics Annotation of Human Y Chromosome-Encoded Protein Pathways and Interactions.

    PubMed

    Rengaraj, Deivendran; Kwon, Woo-Sung; Pang, Myung-Geol

    2015-09-01

    We performed a comprehensive analysis of human Y chromosome-encoded proteins, their pathways, and their interactions using bioinformatics tools. From the NCBI annotation release 107 of human genome, we retrieved a total of 66 proteins encoded on Y chromosome. Most of the retrieved proteins were also matched with the proteins listed in the core databases of the Human Proteome Project including neXtProt, PeptideAtlas, and the Human Protein Atlas. When we examined the pathways of human Y-encoded proteins through KEGG database and Pathway Studio software, many of proteins fall into the categories related to cell signaling pathways. Using the STRING program, we found a total of 49 human Y-encoded proteins showing strong/medium interaction with each other. While using the Pathway studio software, we found that a total of 16 proteins interact with other chromosome-encoded proteins. In particular, the SRY protein interacted with 17 proteins encoded on other chromosomes. Additionally, we aligned the sequences of human Y-encoded proteins with the sequences of chimpanzee and mouse Y-encoded proteins using the NCBI BLAST program. This analysis resulted in a significant number of orthologous proteins between human, chimpanzee, and mouse. Collectively, our findings provide the scientific community with additional information on the human Y chromosome-encoded proteins.

  1. cDNA cloning, tissue distribution, and chromosomal localization of myelodysplasia/Myeloid Leukemia Factor 2 (MLF2)

    SciTech Connect

    Kuefer, M.U.; Valentine, V.; Behm, F.G.

    1996-07-15

    A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, and MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal region frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements. 19 refs., 2 figs.

  2. Structure and chromosomal localization of the human antidiuretic hormone receptor gene

    SciTech Connect

    Seibold, A.; Brabet, P.; Rosenthal, W.; Birnbaumer, M. )

    1992-11-01

    Applying a genomic DNA-expression approach, the authors cloned the gene and cDNA coding for the human antidiuretic hormone receptor, also called vasopressin V2 receptor' (V2R). The nucleotide sequence of both cloned DNAs provided the information to elucidate the structure of the isolated transcriptional unit. The structure of this gene is unusual in that it is the first G protein-coupled receptor gene that contains two very small intervening sequences, the second of which separates the region encoding the seventh transmembrane region from the rest of the open reading frame. The sequence information was used to synthesize appropriate oligonucleotides to be used as primers in the PCR. The V2R gene was localized by PCR using DNA from hybrid cells as template. The gene was found to reside in the q28-qter portion of the human X chromosome, a region identified as the locus for congential nephrogenic diabetes insipidus. 27 refs., 4 figs.

  3. Localization of the homolog of a mouse craniofacial mutant to human chromosome 18q11 and evaluation of linkage to human CLP and CPO

    SciTech Connect

    Griffith, A.J.; Burgess, D.L.; Kohrman, D.C.; Yu, J.

    1996-06-15

    The transgene-induced mutation 9257 and the spontaneous mutation twirler cause craniofacial and inner ear malformations and are located on mouse chromosome 18 near the ataxia locus ax. To map the human homolog of 9257, a probe from the transgene insertion site was used to screen a human genomic library. Analysis of a cross-hybridizing human clone identified a 3-kb conserved sequence block that does not appear to contain protein coding sequence. Analysis of somatic cell hybrid panels assigned the human locus to 18q11. The polymorphic microsatellite markers D18S1001 and D18S1002 were isolated from the human locus and mapped by linkage analysis using the CEPH pedigrees. The 9257 locus maps close to the centromeres of human chromosome 18q and mouse chromosome 18 at the proximal end of a conserved linkage group. To evaluate the role of this locus in human craniofacial disorders, linkage to D18S1002 was tested in 11 families with autosomal dominant nonsyndromic cleft lip and palate and 3 families with autosomal dominant cleft palate only. Obligatory recombinants were observed in 8 of the families, and negative lod scores from the other families indicated that these disorders are not linked to the chromosome 18 loci. 23 refs., 4 figs., 2 tabs.

  4. Human sperm chromosomes. Long-term effect of cancer treatment

    SciTech Connect

    Genesca, A.; Caballin, M.R.; Miro, R.; Benet, J.; Bonfill, X.; Egozcue, J. )

    1990-06-01

    The long-term cytogenetic effect of radio- or chemotherapy or both on male germ cells was evaluated by study of the chromosomal abnormalities in spermatozoa of four men treated for cancer 5-18 years earlier. The cytogenetic analysis of 422 sperm metaphases showed no differences in the aneuploidy rate. The incidence of structural chromosome aberrations was 14.0%, however, which is much higher than in controls. Thus, the high incidence of structurally aberrant spermatozoa observed in our long-term study indicates that antitumoral treatments affect stem-cell spermatogonia and that aberrant cells can survive germinal selection and produce abnormal spermatozoa.

  5. Identification and chromosome assignment of a human gene encoding a novel phosphatidylinositol-3 kinase.

    PubMed

    Seki, N; Nimura, Y; Ohira, M; Saito, T; Ichimiya, S; Nomura, N; Nakagawara, A

    1997-10-31

    We identified a novel phosphatidylinositol (PI) 3-kinase by screening human brain cDNA libraries with probes designed from the conserved kinase-domain sequence. Analysis of cDNAs indicated that two different forms of transcripts are present: one is the full-length form composed of 1,044 amino acid residues and the other is the short form that the N-terminal 216 amino acid residues including a putative p85 binding domain has been truncated (828 amino acid residues). Database search revealed the sequence of the full-length form to be identical to that recently registered by D. Chantry et al. (Accession No. U86453 in GenBank release, August 1997). Northern blot analysis showed this mRNA to be ubiquitously expressed in various tissues, with relatively higher expression was observed in spleen, thymus and leukocytes. Based on fluorescence in situ hybridization and PCR-based analyses with both human/rodent mono-chromosomal hybrid cell panels and radiation hybrid mapping panels, this gene was localized to chromosome region 1p36.2. This region is frequently lost in a variety of human malignancies, including neuroblastoma. The novel PI3K could be a candidate target of the 1p36 alteration that occurs in neuroendocrine tumors.

  6. Convergence and divergence of tumor-suppressor and proto-oncogenes in chimpanzee from human chromosome 17

    SciTech Connect

    Verma, R.S.; Ramesh, K.H.

    1994-09-01

    Due to the emergence of molecular technology, the phylogenetic evolution of the human genome via apes has become a saltatory even. In the present investigation, cosmid probes for P53, Charcot-Marie-Tooth [CMTIA], HER-2/NEU and myeloperoxidase [MPO] were used. Probes mapping to these genetic loci are well-defined on human chromosome 17 [HSA 17]. We localized these genes on chimpanzee [Pan troglodyte] chromosomes by FISH technique employing two different cell lines. Our results indicate that chimpanzee chromosome 19 [PTR 19] differs from HSA 17 by a pericentric inversion. The P53 gene assigned to HSA 17p13.1 is localized on PTR 19p15 and the MPO sequence of HSA 17q21.3-23 hybridized to PTR 19q23. Perplexing enough, HER-2/NEU assigned to HSA 17q11.2 localized to PTR 19p12. Obviously, there is convergence of P53 and MPO regions and distinctive divergence of HER-2/NEU and CMT1A regions of human and chimpanzee. This investigation has demonstrated the pronounced genetic shuffling which occurred during the origin of HSA 17. Molecular markers should serve as evolutionary punctuations in defining the precise sequence of genetic events that led to the evolution of other chromosomes whose genomic synteny, although similar, have surprisingly evolved through different mechanisms.

  7. Chromosomal localization of TIL, a gene encoding a protein related to the Drosophila transmembrane receptor Toll, to human chromosome 4p14

    SciTech Connect

    Taguchi, Takahiro; Testa, J.R.; Mitcham, J.L.; Dower, S.K.; Sims, J.E.

    1996-03-05

    This report describes the localization of the the TIL gene to human chromosome 4p14 using fluorescence in situ hybridization. This gene encodes a protein which is related to the Drosophila transmembrane receptor Toll and the mammalian interleukin-1 receptor, which share similarities in structure and function. The Drosophila gene is also important during embryonic development, which makes TIL a candidate locus for human congenital malformations that are genetically linked to human chromosome 4. 17 refs., 1 fig.

  8. X-Chromosome Inactivation in Rett Syndrome Human Induced Pluripotent Stem Cells

    PubMed Central

    Cheung, Aaron Y. L.; Horvath, Lindsay M.; Carrel, Laura; Ellis, James

    2012-01-01

    Rett syndrome (RTT) is a neurodevelopmental disorder that affects girls due primarily to heterozygous mutations in the X-linked gene encoding methyl-CpG binding protein 2 (MECP2). Random X-chromosome inactivation (XCI) results in cellular mosaicism in which some cells express wild-type (WT) MECP2 while other cells express mutant MECP2. The generation of patient-specific human induced pluripotent stem cells (hiPSCs) facilitates the production of RTT-hiPSC-derived neurons in vitro to investigate disease mechanisms and identify novel drug treatments. The generation of RTT-hiPSCs has been reported by many laboratories, however, the XCI status of RTT-hiPSCs has been inconsistent. Some report RTT-hiPSCs retain the inactive X-chromosome (post-XCI) of the founder somatic cell allowing isogenic RTT-hiPSCs that express only the WT or mutant MECP2 allele to be isolated from the same patient. Post-XCI RTT-hiPSCs-derived neurons retain this allele-specific expression pattern of WT or mutant MECP2. Conversely, others report RTT-hiPSCs in which the inactive X-chromosome of the founder somatic cell reactivates (pre-XCI) upon reprogramming into RTT-hiPSCs. Pre-XCI RTT-hiPSC-derived neurons exhibit random XCI resulting in cellular mosaicism with respect to WT and mutant MECP2 expression. Here we review and attempt to interpret the inconsistencies in XCI status of RTT-hiPSCs generated to date by comparison to other pluripotent systems in vitro and in vivo and the methods used to analyze XCI. Finally, we discuss the relative strengths and weaknesses of post- and pre-XCI hiPSCs in the context of RTT, and other X-linked and autosomal disorders for translational medicine. PMID:22470355

  9. Genomic Instability in Human Pluripotent Stem Cells Arises from Replicative Stress and Chromosome Condensation Defects.

    PubMed

    Lamm, Noa; Ben-David, Uri; Golan-Lev, Tamar; Storchová, Zuzana; Benvenisty, Nissim; Kerem, Batsheva

    2016-02-01

    Human pluripotent stem cells (hPSCs) frequently acquire chromosomal aberrations such as aneuploidy in culture. These aberrations progressively increase over time and may compromise the properties and clinical utility of the cells. The underlying mechanisms that drive initial genomic instability and its continued progression are largely unknown. Here, we show that aneuploid hPSCs undergo DNA replication stress, resulting in defective chromosome condensation and segregation. Aneuploid hPSCs show altered levels of actin cytoskeletal genes controlled by the transcription factor SRF, and overexpression of SRF rescues impaired chromosome condensation and segregation defects in aneuploid hPSCs. Furthermore, SRF downregulation in diploid hPSCs induces replication stress and perturbed condensation similar to that seen in aneuploid cells. Together, these results suggest that decreased SRF expression induces replicative stress and chromosomal condensation defects that underlie the ongoing chromosomal instability seen in aneuploid hPSCs. A similar mechanism may also operate during initiation of instability in diploid cells.

  10. Structural organization and chromosomal assignment of the human prostacyclin receptor gene

    SciTech Connect

    Ogawa, Yoshihiro; Tanaka, Issei; Inoue, Miho

    1995-05-01

    Prostacyclin receptor is a member of the prostanoid receptor family in the G protein-coupled receptor superfamily with seven transmembrane domains. The authors report here the isolation and structural organization of the human prostacyclin receptor gene. Southern blot analysis demonstrated a single copy of the human prostacyclin receptor gene in the human genome. The human prostacyclin receptor gene spanned approximately 7.0 kb and was composed of three exons separated by two introns. The first intron occurred in the 5`-untranslated region, 13 bp upstream to the ATG start codon. The second intron was located at the end of the sixth transmembrane domain, thereby separating it from the downstream coding region and the 3`-untranslated region. By primer extension analysis, the transcription initiation sites were mapped 870-872 bp upstream to the ATG start codon. The 1.2-kb human prostacyclin receptor 5`-flanking region lacked conventional TATA and CCAAT boxes, but it contained several cis-acting regulatory elements including an inverted CCAAT box (Y box) and two copies of SP-1 binding sites. Using human-rodent somatic hybrid cell DNA, the human prostacyclin receptor gene was assigned to human chromosome 19. The present study helps establish the genetic basis for prostacyclin receptor research and provides further insight into the molecular mechanisms underlying the prostanoid receptor family. 38 refs., 6 figs.

  11. Human fructose-1,6-bisphosphatase gene (FBP1): Exon-intron organization, localization to chromosome bands 9q22.2-q22.3, and mutation screening in subjects with fructose-1,6-bisphosphatase deficiency

    SciTech Connect

    El-Maghrabi, M.R.; Jiang, W.

    1995-06-10

    Fructose-1,6-bisphosphatase (EC 3.1.3.11) is a key regulatory enzyme of gluconeogenesis that catalyzes the hydrolysis of fructose-1,6-bisphosphate to generate fructose-6-phosphate and inorganic phosphate. Deficiency of fructose-1,6-bisphosphatase is associated with fasting hypoglycemia and metabolic acidosis because of impaired gluconeogenesis. We have cloned and characterized the human liver fructose-1,6-bisphosphatase gene (FBP1). FBP1, localized to chromosome bands 9q22.2-q22.3 by fluorescence in situ hybridization, consists of seven exons that span > 31 kb, and the six introns are in the same position as in the rat gene. FBP1 was screened for mutations in two subjects with fructose-1,6-bisphosphatase deficiency. Four nucleotide substitutions were identified, two of which were silent mutations in the codons for Ala-216 (GCT {yields} GCC) and Gly-319 (GGG {yields} GGA). The other substitutions were in intron 3, a C {yields} T substitution 7 nucleotides downstream from the splice donor site, and in the promoter region, an A {yields} T substitution 188 nucleotides upstream from the start of transcription. These nucleotide substitutions were also found in normal unaffected subjects and thus are not the cause of fructose-1,6-bisphosphatase deficiency in the two subjects studied. The molecular basis of hepatic fructose-1,6-bisphosphatase deficiency in these subjects remains undetermined but could result from unidentified mutations in the promoter that decrease expression or from mutations in another gene that indirectly lead to decreased fructose-1,6-bisphosphatase activity. 18 refs., 3 figs., 3 tabs.

  12. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, Kerry; Cucinotta, F. A.

    2011-01-01

    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to Si-28-ions with energies ranging from 90 to 600 MeV/u, Ti-48-ions with energies ranging from 240 to 1000 MeV/u, or to Fe-56-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Si beams in this study ranged from 48 to 158 keV/ m, the LET of the Ti ions ranged from 107 to 240 keV/micron, and the LET of the Fe-ions ranged from 145 to 440 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to gamma-rays. The estimates of RBEmax values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, 21.4+/-1.7 to 28.3+/-2.4 for Ti ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBEmax value for Fe ions was obtained with the 600 MeV/u beam, the highest RBEmax value for Ti ions was obtained 1000 MeV/u beam, and the highest RBEmax value for Si ions was obtained with the 170 MeV/u beam. For Si and Fe ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/micron for Si, and decreasing with further increase in LET. Additional studies for low doses Si-28-ions down to 0.02 Gy will be discussed.

  13. Chromosome Aberrations in Human Epithelial Cells Exposed Los Alamos High-Energy Secondary Neutrons: M-BAND Analysis

    NASA Technical Reports Server (NTRS)

    Hada, M.; Saganti, P. B.; Gersey, B.; Wilkins, R.; Cucinotta, F. A.; Wu, H.

    2007-01-01

    High-energy secondary neutrons, produced by the interaction of galactic cosmic rays (GCR) with the atmosphere, spacecraft structure and planetary surfaces, contribute a significant fraction to the dose equivalent radiation measurement in crew members and passengers of commercial aviation travel as well as astronauts in space missions. The Los Alamos Nuclear Science Center (LANSCE) neutron facility's 30L beam line (4FP30L-A/ICE House) is known to generate neutrons that simulate the secondary neutron spectrum of the Earth's atmosphere at high altitude. The neutron spectrum is also similar to that measured onboard spacecrafts like the MIR and the International Space Station (ISS). To evaluate the biological damage, we exposed human epithelial cells in vitro to the LANSCE neutron beams with an entrance dose rate of 2.5 cGy/hr, and studied the induction of chromosome aberrations that were identified with multicolor-banding in situ hybridization (mBAND) technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of inter-chromosomal aberrations (translocation to unpainted chromosomes) and intra-chromosomal aberrations (inversions and deletions within a single painted chromosome). Compared to our previous results with gamma-rays and 600 MeV/nucleon Fe ions of high dose rate at NSRL (NASA Space Radiation Laboratory at Brookhaven National Laboratory), the neutron data from the LANSCE experiments showed significantly higher frequency of chromosome aberrations. However, detailed analysis of the inversion type revealed that all of the three radiation types in the study induced a low incidence of simple inversions. Most of the inversions in gamma-ray irradiated samples were accompanied by other types of intrachromosomal aberrations but few inversions were accompanied by interchromosomal aberrations. In contrast, neutrons and Fe ions induced a significant fraction of inversions that involved complex rearrangements of both

  14. ASPP1/2-PP1 complexes are required for chromosome segregation and kinetochore-microtubule attachments

    PubMed Central

    Gao, Kun; Wang, Yuqi; Jin, Xiaofeng; Wei, Youheng; Saiyin, Heige; Wang, Dejie; Peng, Jintao; Ma, Jian; Tang, Yan; Wumaier, Reziya; Yu, Hongxiu; Dong, Yimin; Huang, Haojie; Yu, Long; Wang, Chenji

    2015-01-01

    Regulated interactions between kinetochores and spindle microtubules are critical for maintaining genomic stability during chromosome segregation. Defects in chromosome segregation are widespread phenomenon in human cancers that are thought to serve as the fuel for tumorigenic progression. Tumor suppressor proteins ASPP1 and ASPP2, two members of the apoptosis stimulating proteins of p53 (ASPP) family, are frequently down-regulated in human cancers. Here we report that ASPP1/2 are required for proper mitotic progression. In ASPP1/2 co-depleted cells, the persistence of unaligned chromosomes and the reduction of tension across s