Science.gov

Sample records for human chromosome 5

  1. The complete sequence of human chromosome 5

    SciTech Connect

    Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, State; Gordon, Laurie A.; Scott, Duncan; Xie, Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan, Yee Man; Denys, Mirian; Detter, Chris; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstenin, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimbal, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou, Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar, Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang, Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, Susan M.; Myers, Richard M.; Rubin, Edward M.

    2004-04-15

    Chromosome 5 is one of the largest human chromosomes yet has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding and syntenic conservation with non-mammalian vertebrates, suggesting they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-encoding genes including the protocadherin and interleukin gene families and the first complete versions of each of the large chromosome 5 specific internal duplications. These duplications are very recent evolutionary events and play a likely mechanistic role, since deletions of these regions are the cause of debilitating disorders including spinal muscular atrophy (SMA).

  2. The third international workshop of human chromosome 5. Final report

    SciTech Connect

    1994-12-31

    The Third International Workshop on Human Chromosome 5 was held in Laguna Beach, California, March 5-8, 1994. The pace at which new mapping information has been published in the last year make almost any report outdated before publication. Much of the information in this report and the most recent data from the Human chromosome 5 Genome Center at U.C. Irvine on the physical map of chromosome 5 are accessible via a WWW server. For most loci referred to in this report that can be detected by Polymerase Chain Reaction, the sequences of the oligonucleotide primers are available and some primer sequences are provided in this report.

  3. Fourth international workshop on human chromosome 5. Final progress report

    SciTech Connect

    McPherson, J.D.

    1996-12-31

    The Fourth International Workshop on Human Chromosome 5 was held in Manchester, UK on November 9--10, 1996 and was hosted by the University of Manchester. The major goals of the workshop were: (1) to collate the various genetic, cytogenetic and physical maps of human chromosome 5; (2) to integrate these maps and identify/correct discrepancies between them wherever possible; (3) to catalogue the sequence-ready contigs of the chromosome; (4) to co-ordinate the various sequencing efforts to avoid future duplication; (5) to establish the first (to the author`s knowledge) web site for the human chromosome 5 community which contains the above information in a readily accessible form.

  4. The DNA Sequence And Comparative Analysis Of Human Chromosome5

    SciTech Connect

    Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, Steve; Gordon, Laurie A.; Scott, Duncan; Xie,Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black,Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan,Yee Man; Denys, Mirian; Detter, John C.; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner,Kristen; Kimball, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou,Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar,Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Retterer, James; Rodriguez, Alex; Rogers,Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang,Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, SusanM.; Myers, Richard M.; Rubin, Edward M.

    2004-08-01

    Chromosome 5 is one of the largest human chromosomes and contains numerous intrachromosomal duplications, yet it has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding conservation with non-mammalian vertebrates, suggesting that they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-coding genes including the protocadherin and interleukin gene families. We also completely sequenced versions of the large chromosome-5-specific internal duplications. These duplications are very recent evolutionary events and probably have a mechanistic role in human physiological variation, as deletions in these regions are the cause of debilitating disorders including spinal muscular atrophy.

  5. The gene for human glutaredoxin (GLRX) is localized to human chromosome 5q14

    SciTech Connect

    Padilla, C.A.; Holmgren, A.; Bajalica, S.; Lagercrantz, J.

    1996-03-05

    Glutaredoxin is a small protein (12 kDa) catalyzing glutathione-dependent disulfide oxidoreduction reactions in a coupled system with NADPH, GSH, and glutathione reductase. A cDNA encoding the human glutaredoxin gene (HGMW-approved symbol GLRX) has recently been isolated and cloned from a human fetal spleen cDNA library. The screening of a human fetal spleen cDNA library. The screening of a human genomic library in Charon 4A led to the identification of three genomic clones. Using fluorescence in situ hybridization to metaphase chromosomes with one genomic clone as a probe, the human glutaredoxin gene was localized to chromosomal region 5q14. This localization at chromosome 5 was in agreement with the somatic cell hybrid analysis, using DNA from a human-hamster and a human-mouse hybrid panel and using a human glutaredoxin cDNA as a probe. 13 refs., 2 figs.

  6. Chromosome 5 allele loss in human colorectal carcinomas.

    PubMed

    Solomon, E; Voss, R; Hall, V; Bodmer, W F; Jass, J R; Jeffreys, A J; Lucibello, F C; Patel, I; Rider, S H

    That the sporadic and inherited forms of a particular cancer could both result from mutations in the same gene was first proposed by Knudson. He further proposed that these mutations act recessively at the cellular level, and that both copies of the gene must be lost for the cancer to develop. In sporadic cases both events occur somatically whereas in dominant familial cases susceptibility is inherited through a germline mutation and the cancer develops after a somatic change in the homologous allele. This model has since been substantiated in the case of retinoblastoma, Wilms tumour, acoustic neuroma and several other tumours, in which loss of heterozygosity was shown in tumour material compared to normal tissue from the same patient. The dominantly inherited disorder, familial adenomatous polyposis (FAP, also called familial polyposis coli), which gives rise to multiple adenomatous polyps in the colon that have a relatively high probability of progressing to a malignant adenocarcinoma, provides a basis for studying recessive genes in the far more common colorectal carcinomas using this approach. Following a clue as to the location of the FAP gene given by a case report of an individual with an interstitial deletion of chromosome 5q, who had FAP and multiple developmental abnormalities, we have examined sporadic colorectal adenocarcinomas for loss of alleles on chromosome 5. Using a highly polymorphic 'minisatellite' probe which maps to chromosome 5q we have shown that at least 20% of this highly heterogeneous set of tumours lose one of the alleles present in matched normal tissue. This parallels the assignment of the FAP gene to chromosome 5 (see accompanying paper) and suggests that becoming recessive for this gene may be a critical step in the progression of a relatively high proportion of colorectal cancers. PMID:2886919

  7. Report of the Second International Workshop on Human Chromosome 5 Mapping

    SciTech Connect

    Westbrook, C.A.; Neuman, W.L.; McPherson, J.; Wasmuth, J.; Camper, S.; Plaetke, R.; Williamson, R.

    1993-12-31

    This report describes the accomplishments of the Second International Workshop on Human Chromosome 5 as was held May 11--13,1992 at the University of Chicago. Included in the report are abstract of individual presentations and a consensus map of the chromosome.

  8. The mouse and human excitatory amino acid transporter gene (EAAT1) maps to mouse chromosome 15 and a region of syntenic homology on human chromosome 5

    SciTech Connect

    Kirschner, M.A.; Arriza, J.L.; Amara, S.G.

    1994-08-01

    The gene for human excitatory amino acid transporter (EAAT1) was localized to the distal region of human chromosome 5p13 by in situ hybridization of metaphase chromosome spreads. Interspecific backcross analysis identified the mouse Eaat1 locus in a region of 5p13 homology on mouse chromosome 15. Markers that are linked with EAAT1 on both human and mouse chromosomes include the receptors for leukemia inhibitory factor, interleukin-7, and prolactin. The Eaat1 locus appears not be linked to the epilepsy mutant stg locus, which is also on chromosome 15. The EAAT1 locus is located in a region of 5p deletions that have been associated with mental retardation and microcephaly. 22 refs., 2 figs.

  9. The leukemia inhibitory factor receptor (LIFR) gene is located within a cluster of cytokine receptor loci on mouse chromosome 15 and human chromosome 5p12-p13

    SciTech Connect

    Gearing, D.P. ); Druck, T.; Huebner, K. ); Overhauser, J. ); Gilbert, D.J.; Copeland, N.G.; Jenkins, N.A. )

    1993-10-01

    The leukemia inhibitory factor receptor (LIFR) gene was localized to human chromosome 5p12-p13 by somatic cell hybrid analysis. Interspecific backcross analysis revealed that the murine locus was on chromosome 15 in a region of homology with human chromosome 5p. In both human and mouse genomes, the LIFR locus was linked to the genes encoding the receptors for interleukin-7, prolactin, and growth hormone. 13 refs., 1 fig.

  10. Assignment of the {beta}B1 crystallin gene (CRYBB1) to human chromosome 22 and mouse chromosome 5

    SciTech Connect

    Hulsebos, T.J.M.; Westerveld, A.; Gilbert, D.J.; Jenkins, N.A.; Copeland, N.G.

    1995-10-10

    By using primers complementary to the rat {beta}B1 crystallin gene sequence, we amplified exons 5 and 6 of the orthologous human gene (CRYBB1). The amplified human segments displayed greater than 88% sequence homology to the corresponding rat and bovine sequences. CRYBB1 was assigned to the group 5 region in 22q11.2-q12.1 by hybridizing the exon 6 PCR product to somatic cell hybrids containing defined portions of human chromosome 22. The exon 5 and exon 6 PCR products of CRYBB1 were used to localize, by interspecific backcross mapping, the mouse gene (Crybb1) to the central portion of chromosome 5. Three other {beta} crystallin genes ({beta}B2(-l), {beta}B3, and {beta}A4) have previously been mapped to the same regions in human and mouse. We demonstrate that the {beta}B1 and {beta}A4 crystallin genes are very closely linked in the two species. These assignments complete the mapping and identification of the human and mouse homologues of the major {beta} crystallins genes that are expressed in the bovine lens. 39 refs., 5 figs., 1 tab.

  11. Human chromosome 8.

    PubMed Central

    Wood, S

    1988-01-01

    The role of human chromosome 8 in genetic disease together with the current status of the genetic linkage map for this chromosome is reviewed. Both hereditary genetic disease attributed to mutant alleles at gene loci on chromosome 8 and neoplastic disease owing to somatic mutation, particularly chromosomal translocations, are discussed. PMID:3070042

  12. Chromosomal assignment of the genes for proprotein convertases PC4, PC5, and PACE 4 in mouse and human

    SciTech Connect

    Mbikay, M.; Seidah, N.G.; Chretien, M.

    1995-03-01

    The genes for three subtilisin/kexin-like proprotein convertases, PC4, PC5, and PACE4, were mapped in the mouse by RFLP analysis of a DNA panel from a (C57BL/6JEi x SPRET/Ei) F{sub 1} x SPRET/Ei backcross. The chromosomal locations of the human homologs were determined by Southern blot analysis of a DNA panel from human-rodent somatic cell hybrids, most of which contained a single human chromosome each. The gene for PC4 (Pcsk4 locus) mapped to mouse chromosome 10, close to the Adn (adipsin, a serine protease) locus and near the Amh (anti-Mullerian hormone) locus; in a human, the gene was localized to chromosome 19. The gene for PC5 (Pcsk5 locus) mapped to mouse chromosome 19 close to the Lpc1 (lipoacortin-1) locus and, in human, was localized to chromosome 9. The gene for PACE4 (Pcsk6 locus) mapped to mouse chromosome 7, at a distance of 13 cM from the Pcsk3 locus, which specifies furin, another member of this family of enzymes previoulsy mapped to this chromosome. This is in concordance with the known close proximity of these two loci in the homologous region on human chromosome 15q25-qter. Pcsk3 and Pcsk6 mapped to a region of mouse chromosome 7 that has been associated cytogenetically with postnatal lethality in maternal disomy, suggesting that these genes might be candidates for imprinting. 43 refs., 3 figs., 2 tabs.

  13. Genetic and physical analyses of the centromeric and pericentromeric regions of human chromosome 5: recombination across 5cen.

    PubMed

    Puechberty, J; Laurent, A M; Gimenez, S; Billault, A; Brun-Laurent, M E; Calenda, A; Marçais, B; Prades, C; Ioannou, P; Yurov, Y; Roizès, G

    1999-03-15

    Human centromeres are poorly understood at both the genetic and the physical level. In this paper, we have been able to distinguish the alphoid centromeric sequences of chromosome 5 from those of chromosome 19. This result was obtained by pulsed-field gel electrophoresis after cutting genomic DNA with restriction endonucleases NcoI (chromosome 5) and BamHI (chromosome 19). We could thus define a highly polymorphic marker, representing length variations of the D5Z1 domain located at the q arm boundary of the chromosome 5 centromere. The centromeric region of chromosome 5 was then analyzed in full detail. We established an approximately 4.6-Mb physical map of the whole region with five rare-cutting enzymes by using nonchimeric YACs, two of which were shown to contain the very ends of 5cen on both sides. The p-arm side of 5cen was shown to contain an alphoid subset (D5Z12) different from those described thus far. Two genes and several putative cDNAs could be precisely located close to the centromere. Several L1 elements were shown to be present within alpha satellites at the boundary between alphoid and nonalphoid sequences on both sides of 5cen. They were used to define STSs that could serve as physical anchor points at the junction of 5cen with the p and q arms. Some STSs were placed on a radiation hybrid map. One was polymorphic and could therefore be used as a second centromeric genetic marker at the p arm boundary of 5cen. We could thus estimate recombination rates within and around the centromeric region of chromosome 5. Recombination is highly reduced within 5cen, with zero recombinants in 58 meioses being detected between the two markers located at the two extremities of the centromere. In its immediate vicinity, 5cen indeed exerts a direct negative effect on meiotic recombination within the proximal chromosomal DNA. This effect is, however, less important than expected and is polarized, as different rates are observed on both arms if one compares the 0 c

  14. Isolation and mapping of the human eukaryotic translation initiation factor 5 to chromosome 14

    SciTech Connect

    Romano, D.M.; Wasco, W.; Murell, J.

    1994-09-01

    Eukaryotic translation initiation factor 5 (eIF-5) is essential for the initiation of protein synthesis. eIF-5 catalyzes the hydrolysis of GTP on the 40S ribosomal initiation complex. Subsequent to GTP hydrolysis and the release of eIF-2-GDP, the 60S ribosomal subunit is joined to the 40S subunit to form an 80S initiation complex which can engage in peptide transfer. In an effort to isolate the major early-onset familial Alzheimer`s disease (FAD) gene on chromosome 14, we have isolated expressed sequences from this autosome in the form of exons `trapped` from chromosome 14-specific cosmids (library provided by L. Deaven, Los Alamos, NM). One cosmid yielded multiple exons displaying strong DNA and amino acid homology (>90%) with the rat eIF-5 gene. These exons were used to isolate full-length cDNAs from a human brain library. The eIF-5 message is approximately 3.6 kB in size and is ubiquitously expressed. The predicted amino acid sequence reveals multiple phosphorylation sites which may be involved in regulation of activity of eIF-5 and regions with homology to the GTPase superfamily, consistent with eIF-5`s role in GTP hydrolysis. Further studies are underway to determine whether the eIF-5 gene resides within the FAD minimal candidate region on chromosome 14q24.3.

  15. The human and mouse receptors of hyaluronan-mediated motility, RHAMM, genes (HMMR) map to human chromosome 5q33.2-qter and mouse chromosome 11

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Roller, M.L.; Camper, S.A.

    1995-11-01

    The gene for the receptor for hyaluronan-mediated motility, RHAAM (designated hyaluronan-mediated motility receptor, HMMR (human) and Hmmr (mouse), for mapping purposes), was localized to human chromosome 5q33.2-qter by somatic cell and radiation hybrid analyses. Investigation of two interspecific back-crosses localized the mouse RHAMM (Hmmr) locus 18 cM from the centromere of mouse chromosome 11 within a region of synteny homology with human chromosome 5q23-q35 genes. The map position of the human RHAMM gene places it in a region comparatively rich in disease-associated genes, including those for low-frequency hearing loss, dominant limb-girdle muscular dystrophy, diastrophic dysplasia, Treacher Collins syndrome, and myeloid disorders associated with the 5q-syndrome. The RHAMM gene location and its ability to transform cells when overexpressed implicate RHAMM as a possible candidate gene in the pathogenesis of the recently described t(5;14)(q33-q34;q11) acute lymphoblastic leukemias. 18 refs., 1 fig.

  16. A YAC contig of approximately 3 Mb from human chromosome 5q31 [yields] q33

    SciTech Connect

    Li, Xiang; Wang Jabs, E.; Hawkins, A.L.; Griffin, C.A. ); Wise, C.A.; Lovett, M. ); Le Paslier, D. ); Pittler, S.J. )

    1994-02-01

    The human chromosome 5q31-q33 region contains an interesting cluster of growth factor and receptor genes. In addition, several genetic disease loci have been localized within this region, but have not as yet been isolated as molecular clones. These include those loci involved in autosomal dominant limb-girdle muscular dystrophy, diastrophic dysplasia, Treacher Collins syndrome, and myeloid disorders associated with the 5q-syndrome. A yeast artificial chromosome (YAC) contig of this region would assist in the further localization and isolation of these genes. The authors have used YACs isolated from the Washington University and Centre d'Etude du Polymorphisme Humain YAC libraries, including YACs from the large insert (mega) YAC library to build a contig greater than 3 Mb in size. An STS content strategy coupled with limited walking from YAC ends was used to isolate 22 overlapping YACs with as much as sixfold coverage. A total of 20 STSs, derived from genes, anonymous sequences, and vector Alu-PCR or inverse PCR products, were used to compile this contig. The order of loci, centromere-GRL-D5S207-D5S70-D5S545-D5S546-D5S547-D5S68-D5S548-D5S210-D5S549-D5S686- ADRB2-D5S559-CSF1R-D5S551-RPS14-D5S519-SPARC-telomere, was derived from the overlapping clones. This contig and clones derived from it will be useful substrates in selecting candidate cDNAs for the disease loci in this interval. 45 refs., 1 fig., 2 tabs.

  17. Abnormal human sex chromosome constitutions

    SciTech Connect

    1993-12-31

    Chapter 22, discusses abnormal human sex chromosome constitution. Aneuploidy of X chromosomes with a female phenotype, sex chromosome aneuploidy with a male phenotype, and various abnormalities in X chromosome behavior are described. 31 refs., 2 figs.

  18. Physical mapping in the Cri du Chat region on human chromosome 5

    SciTech Connect

    Church, D.M.; Bengtsson, U.; Niebuhr, E.

    1994-09-01

    The Cri du Chat syndrome is a segmental aneusomy associated with deletions in the short arm of human chromosome 5. More specifically, the cytogenetic band 5p15.2 must be deleted in order to manifest the typical phenotypic signs. We have studied several cell lines from individuals who have chromosomal abnormalities within this cytogenetic band but who do not have typical Cri du Chat syndrome. In fact, several individual studied have no discernible features of this syndrome. Using fluorescent in situ hybridization (FISH) analysis and PCR analysis on somatic cell hybrids we have mapped the breakpoints relative to each other within this band. There is a great degree of phenotypic heterogeneity between several of the patients, even those which share common breakpoints. This heterogeneity makes it very difficult to narrow the region of interest to a very small (<1 Mb) region. In order to more thoroughly analyze this region, we have assembled a yeast artificial chromosome (YAC) contig of part of this region. This contig has been analyzed for STS content and covers approximately a 1.5-2.0 Mb region within 5p15.2. In addition, we have constructed a radiation hybrid map of the region. The YACs contained within the minimal contig have been used as hybridization probes to isolate corresponding cosmid clones within the region of interest. These cosmids, in turn, are being utilized to obtain potential exons using exon amplification. Several cosmids within this region have been isolated by STS content and potential exons have been isolated from them. These exons have been used as probes to isolate cDNA clones from the region. It is our hope that isolation of genes throughout the region of interest will allow a better understanding of the etiology of Cri du Chat.

  19. Mapping of the versican proteoglycan gene (CSPG2) to the long arm of human chromosome 5 (5q12-5q14)

    SciTech Connect

    Iozzo, R.V.; Naso, M.F.; Cannizzaro, L.A. ); Wasmuth, J.J.; McPerson, J.D. )

    1992-12-01

    Versican is a major chondroitin sulfate proteoglycan of vascularized connective tissues whose eponym reflects its functional versatility in macromolecular affinity and interactions. In this report the authors have localized the versican gene (CSPG2) to the long arm of human chromosome 5 by utilizing a combination of somatic cell hybrids, Southern blotting, polymerase chain reaction, and chromosomal in situ hybridization. The proteoglycan gene segregated concordantly with hybrid cell lines containing the long arm of chromosome 5, comprising the 5q12-q14 band regions. To refine this locus further, they screened a chromosome 5-specific library and isolated several genomic clones encoding a portion of the 5[prime] end of versican. One of these genomic clones was used as a probe for in situ hybridization of human chromosome metaphases. The results corroborated the data obtained using somatic cell hybrids and further refined the assignment of the versican gene to the narrow band region of 5q12-5q14, with the primary site likely to be 5q13.2. The availability of novel genomic clones and the mapping data presented here will make possible the identification of any defect genetically linked to this proteoglycan gene. 27 refs., 4 figs.

  20. Assignment of the human dihydrofolate reductase gene to the q11. -->. q22 region of chromosome 5

    SciTech Connect

    Funanage, V.L.; Myoda, T.T.; Moses, P.A.; Cowell, H.R.

    1984-10-01

    Cells from a dihydrofolate reductase-deficit Chinese hamster ovary cell line were hybridized to human fetal skin fibroblast cells. Nineteen dihydrofolate reductase-positive hybrid clones were isolated and characterized. Cytogenetic and biochemical analyses of these clones have shown that the human dihydrofolate reductase (DHFR) gene is located on chromosome 5. Three of these hybrid cell lines contained different terminal deletions of chromosome 5. An analysis of the breakpoints of these deletions has demonstrated that the DHFR gene resides in the q11..-->..q22 region.

  1. Assignment of ALDH3 to human chromosome 17p11.2 and ALDH5 to human chromosome 9p13

    SciTech Connect

    Hiraoka, L.R.; Hsu, L.; Hsieh, C.L.

    1995-01-01

    Aldehyde dehydrogenases are a group of enzymes responsible for catalyzing the conversion of numerous aldehydes to their corresponding acids. These enzymes play a major role in the detoxification of alcohol-derived acetaldehydes and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. ALDH activities are found in most tissues, with the highest activity in the liver. Five human liver ALDH isozymes, ALDH1, 2, 3, 4, and {gamma}-butyrylaldehyde dehydrogenase ({gamma}-ABDH), have been purified and characterized, and one isozyme, ALDH5, has been identified by using a 29-nucleotide probe that is conserved in ALDH1 and ALDH2 for cDNA library screening. Several other isozymes from other tissues have also been reported. Genes for ALDH3 and ALDH5 have been previously localized to chromosomes 17 and 9, respectively. Here we report the regional assignment of these two loci. 17 refs., 1 fig.

  2. Localization of human flavin-containing monooxygenase genes FMO2 and FMO5 to chromosome 1q

    SciTech Connect

    McCombie, R.R.; Shephard, E.A.; Dolphin, C.T.

    1996-06-15

    The human flavin-containing monooxygenase (FMO) gene family comprises at least five distinct members (FMO1 to FMO5) that code for enzymes responsible for the oxidation of a wide variety of soft nucleophilic substrates, including drugs and environmental pollutants. Three of these genes (FMO1, FMO3, and FMO4) have previously been localized to human chromosome 1q, raising the possibility that the entire gene family is clustered in this chromosomal region. Analysis by polymerase chain reaction of DNA isolated from a panel of human-rodent somatic cell hybrids demonstrates that the two remaining identified members of the FMO gene family, FMO2 and FMO5, also are located on chromosome 1q. 19 refs., 1 fig., 1 tab.

  3. Human chromosome 22.

    PubMed Central

    Kaplan, J C; Aurias, A; Julier, C; Prieur, M; Szajnert, M F

    1987-01-01

    The acrocentric chromosome 22, one of the shortest human chromosomes, carries about 52 000 kb of DNA. The short arm is made up essentially of heterochromatin and, as in other acrocentric chromosomes, it contains ribosomal RNA genes. Ten identified genes have been assigned to the long arm, of which four have already been cloned and documented (the cluster of lambda immunoglobulin genes, myoglobin, the proto-oncogene c-sis, bcr). In addition, about 10 anonymous DNA segments have been cloned from chromosome 22 specific DNA libraries. About a dozen diseases, including at least four different malignancies, are related to an inherited or acquired pathology of chromosome 22. They have been characterised at the phenotypic or chromosome level or both. In chronic myelogenous leukaemia, with the Ph1 chromosome, and Burkitt's lymphoma, with the t(8;22) variant translocation, the molecular pathology is being studied at the DNA level, bridging for the first time the gap between cytogenetics and molecular genetics. PMID:3550088

  4. The interleukin 3 gene is located on human chromosome 5 and is deleted in myeloid leukemias with a deletion of 5q.

    PubMed Central

    Le Beau, M M; Epstein, N D; O'Brien, S J; Nienhuis, A W; Yang, Y C; Clark, S C; Rowley, J D

    1987-01-01

    The gene IL-3 encodes interleukin 3, a hematopoietic colony-stimulating factor (CSF) that is capable of supporting the proliferation of a broad range of hematopoietic cell types. By using somatic cell hybrids and in situ chromosomal hybridization, we localized this gene to human chromosome 5 at bands q23-31, a chromosomal region that is frequently deleted [del(5q)] in patients with myeloid disorders. By in situ hybridization, IL-3 was found to be deleted in the 5q-chromosome of one patient with refractory anemia who had a del(5)(q15q33.3), of three patients with refractory anemia (two patients) or acute nonlymphocytic leukemia (ANLL) de novo who had a similar distal breakpoint [del(5)(q13q33.3)], and of a fifth patient, with therapy-related ANLL, who had a similar distal breakpoint in band q33 [del(5)(q14q33.3)]. Southern blot analysis of somatic cell hybrids retaining the normal or the deleted chromosome 5 from two patients with the refractory anemia 5q- syndrome indicated that IL-3 sequences were absent form the hybrids retaining the deleted chromosome 5 but not from hybrids that had a cytologically normal chromosome 5. Thus, a small segment of chromosome 5 contains IL-3, GM-CSF (the gene encoding granulocyte-macrophage-CSF), CSF-1 (the gene encoding macrophage-CSF), and FMS (the human c-fms protooncogene, which encodes the CSF-1 receptor). Our findings and earlier results indicating that GM-CSF, CSF-1, and FMS were deleted in the 5q-chromosome, suggest that loss of IL-3 or of other CSF genes may play an important role in the pathogenesis of hematologic disorders associated with a del(5q). Images PMID:3497400

  5. A novel human phosphoglucomutase (PGM5) maps to the centromeric region of chromosome 9

    SciTech Connect

    Edwards, Y.H.; Putt, W.; Fox, M.; Ives, J.H.

    1995-11-20

    The phophoglucomutases (PGM1-3) in humans are surrounded by three genes, PGM1, PGM2, and PGM3. These enzymes are central to carbohydrate metabolism. All three isozymes show genetic variation, and PGM1 has achieved prominence as a key marker in genetic linkage mapping and in forensic science. The human PGM genes are assumed to have arisen by gene duplication since their products are broadly similar in structure and function; however, direct proof of their evolutionary relationship is not available because only PGM1 has been cloned. During a search for other members of the PGM family, a novel sequence with homology to PGM1 was identified. Mapping using fluorescence in situ hybridization and somatic cell hybrids locates this gene to the centromeric region of chromosome 9. RT-PCR and Northern analysis indicate that this is an expressed PGM gene with widespread distribution in adult and fetal tissues. We propose that this gene be designated PGM5 and that it represents a novel member of the PGM family. 19 refs., 2 figs.

  6. Interleukin 3 gene is located on human chromosome 5 and is deleted in myeloid leukemias with a deletion of 5q

    SciTech Connect

    Le Beau, M.M.; Epstein, N.D.; O'Brien, S.J.; Nienhuis, A.W.; Yang, Y.C.; Clark, S.C.; Rowley, J.D.

    1987-08-01

    The gene IL-3 encodes interleukin 3, a hematopoietic colony-stimulating factor (CSF) that is capable of supporting the proliferation of a broad range of hematopoietic cell types. By using somatic cell hybrids and in situ chromosomal hybridization, the authors localized this gene to human chromosome 5 at bands q23-31, a chromosomal region that is frequently deleted (del(5q)) in patients with myeloid disorders. By in situ hybridization, IL-3 was found to be deleted in the 5q-chromosome of one patient with refractory anemia who had a del(5)(q15q33.3), of three patients with refractory anemia (two patients) or acute nonlymphocytic leukemia (ANLL) de novo who had a similar distal breakpoint (del(5)(q13q33.3)), and of a fifth patient, with therapy-related ANLL, who had a similar distal breakpoint in band q33(del(5)(q14q33.3)). Southern blot analysis of somatic cell hybrids retaining the normal or the deleted chromosome 5 from two patients with the refractory anemia 5q- syndrome indicated that IL-3 sequences were absent from the hybrids retaining the deleted chromosome 5 but not from hybrids that had a cytologically normal chromosome 5. Thus, a small segment of chromosome 5 contains IL-3, GM-CSF, CSF-1, and FMS. The findings and earlier results indicating that GM-CSF, CSF-1, and FMS were deleted in the 5q- chromosome, suggest that loss of IL-3 or of other CSF genes may play an important role in the pathogenesis of hematologic disorders associated with a del(5q).

  7. Assignment of the human pro-melanin-concentrating hormone gene (PMCH) to chromosome 12q23-q24 and two variant genes (PMCHL1 and PMCHL2) to chromosome 5p14 and 5q12-q13

    SciTech Connect

    Pedeutour, F. ); Szpirer, C. ); Nahon, J.L. )

    1994-01-01

    Melanin-concentrating hormone (MCH) is a peptide that has been isolated from salmon pituitary and rat hypothalamus. In mammals, pro-MCH (PMCH) encodes two putative peptides, named NEI and NGE, in addition to MCH. Those peptides are expressed predominantly in hypothalamus and display a broad array of functions in rat brain. The authors have previously mapped the PMCH locus on human chromosome 12q and rat chromosome 7. Genomic cloning has revealed the existence of two distinct MCH genes in human: one authentic and one variant. In this report, they describe Southern blotting analysis with DNA from a panel of somatic cell hybrids and demonstrate that the authentic human MCH (hMCH) gene is located as expected on chromosome 12, while the variant form of hMCH gene is located on chromosome 5. Direct chromosomal assignment of the authentic and variant hMCH genes was obtained by using fluorescence in situ hybridization on metaphase chromosomes. A strong signal was observed in 12q23-q24 with the authentic HMCH genomic DNA probe. Surprisingly, two signals were conspicuously found in 5p14 and 5q12-q13 with different variant hMCH genomic DNA probes. These loci were designated PMCHL1 and PMCHL2. Evidence of physiological and pathological data in rodents together with locus linkage analyses in human suggests that hMCH authentic and variant genes may be involved in human brain disorders. 44 refs., 3 figs., 1 tab.

  8. Chromosomal abnormalities in human sperm

    SciTech Connect

    Martin, R.H.

    1985-01-01

    The ability to analyze human sperm chromosome complements after penetration of zona pellucida-free hamster eggs provides the first opportunity to study the frequency and type of chromosomal abnormalities in human gametes. Two large-scale studies have provided information on normal men. We have studied 1,426 sperm complements from 45 normal men and found an abnormality rate of 8.9%. Brandriff et al. (5) found 8.1% abnormal complements in 909 sperm from 4 men. The distribution of numerical and structural abnormalities was markedly dissimilar in the 2 studies. The frequency of aneuploidy was 5% in our sample and only 1.6% in Brandriff's, perhaps reflecting individual variability among donors. The frequency of 24,YY sperm was low: 0/1,426 and 1/909. This suggests that the estimates of nondisjunction based on fluorescent Y body data (1% to 5%) are not accurate. We have also studied men at increased risk of sperm chromosomal abnormalities. The frequency of chromosomally unbalanced sperm in 6 men heterozygous for structural abnormalities varied dramatically: 77% for t11;22, 32% for t6;14, 19% for t5;18, 13% for t14;21, and 0% for inv 3 and 7. We have also studied 13 cancer patients before and after radiotherapy and demonstrated a significant dose-dependent increase of sperm chromosome abnormalities (numerical and structural) 36 months after radiation treatment.

  9. Comparative analysis of the gene-dense ACHE/TFR2 region on human chromosome 7q22 with the orthologous region on mouse chromosome 5

    PubMed Central

    Wilson, Michael D.; Riemer, Cathy; Martindale, Duane W.; Schnupf, Pamela; Boright, Andrew P.; Cheung, Tony L.; Hardy, Daniel M.; Schwartz, Scott; Scherer, Stephen W.; Tsui, Lap-Chee; Miller, Webb; Koop, Ben F.

    2001-01-01

    Chromosome 7q22 has been the focus of many cytogenetic and molecular studies aimed at delineating regions commonly deleted in myeloid leukemias and myelodysplastic syndromes. We have compared a gene-dense, GC-rich sub-region of 7q22 with the orthologous region on mouse chromosome 5. A physical map of 640 kb of genomic DNA from mouse chromosome 5 was derived from a series of overlapping bacterial artificial chromosomes. A 296 kb segment from the physical map, spanning Ache to Tfr2, was compared with 267 kb of human sequence. We identified a conserved linkage of 12 genes including an open reading frame flanked by Ache and Asr2, a novel cation-chloride cotransporter interacting protein Cip1, Ephb4, Zan and Perq1. While some of these genes have been previously described, in each case we present new data derived from our comparative sequence analysis. Adjacent unfinished sequence data from the mouse contains an orthologous block of 10 additional genes including three novel cDNA sequences that we subsequently mapped to human 7q22. Methods for displaying comparative genomic information, including unfinished sequence data, are becoming increasingly important. We supplement our printed comparative analysis with a new, Web-based program called Laj (local alignments with java). Laj provides interactive access to archived pairwise sequence alignments via the WWW. It displays synchronized views of a dot-plot, a percent identity plot, a nucleotide-level local alignment and a variety of relevant annotations. Our mouse–human comparison can be viewed at http://web.uvic.ca/~bioweb/laj.html. Laj is available at http://bio.cse.psu.edu/, along with online documentation and additional examples of annotated genomic regions. PMID:11239002

  10. A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India

    PubMed Central

    Sharma, Swarkar; Rai, Ekta; Bhat, Audesh K; Bhanwer, Amarjit S; Bamezai, Rameshwar NK

    2007-01-01

    Background Y-chromosomal haplogroup (Y-HG) Q is suggested to originate in Asia and represent recent founder paternal Native American radiation into the Americas. This group is delineated into Q1, Q2 and Q3 subgroups defined by biallelic markers M120, M25/M143 and M3, respectively. Recently, a novel subgroup Q4 has been identified which is defined by bi-allelic marker M346, representing HG Q (0.41%, 3/728) in Indian population. With scanty details of HG Q in Asia, especially India, it was pertinent to explore the status of the Y-HG Q in Indian population to gather an insight to determine the extent of diversity within this region. Results We observed 15/630 (2.38%) Y-HG Q individuals in India with an ancestral state at M120, M25, M3 and M346 markers, indicating an absence of already known Q1, Q2, Q3 and Q4 sub-haplogroups. Interestingly, we further observed a novel 4 bp deletion/insertion polymorphism (ss4 bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, defining a novel sub-lineage Q5 (in 5/15 individuals, i.e., 33.3 % of the observed Y-HG Q) with distributions independent of the social, cultural, linguistic and geographical affiliations in India. Conclusion The study adds another sublineage Q5 in the already existing arrangement of Y-HG Q in literature. It was quite interesting to observe an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in Indian subcontinent, though in low frequency. A novel subgroup Q4 was identified recently which is also restricted to Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. However, other explanations of, either the presence of both the sub haplogroups (Q4 and Q5) in ancestral migrants or recent migrations from central Asia, cannot be ruled out till the distribution and diversity of

  11. Identification of Class-mu glutathione transferase genes GSTMI-GSTM5 on human chromosome lpl3

    SciTech Connect

    Pearson, W.R.; Vorachek, W.R.; Xu, Shi-jie ); Berger, R.; Hart, I.; Vannais, D.; Patterson, D. )

    1993-07-01

    The GSTM1, GSTM2, GSTM3, GSTM4, and GSTM5 glutathione transferase genes have been mapped to human chromosome 1 by using locus-specific PCR primer pairs spanning exon 6, intron 6, and exon 7, as probes on DNA from human/hamster somatic cell hybrids. For GSTM1, the assignment was confirmed by Southern blot hybridization to a pair of 12.5/2.4-kb HindlIl fragments. The GSTM1-specific primer pairs can be used to identify individuals carrying non-null GSTM1 alleles. The organization of these five genes was confirmed by the isolation of a yeast artificial chromosome clone (GSTM-YAC2) that contains all five genes. With this clone, the location of the GSTM1-GSTM5 gene cluster on chromosome 1 was confirmed by fluorescence in situ hybridization. Both regional assignment using the fractional length method and examination of probe signal with reference to R-banded chromosomes induced by BrdU places the gene cluster in or near the 1p13.3 region. The close physical proximity of the GSTM1 and GSTM2 loci, which share 99% nucleotide sequence identity over 460 nucleotides of 3'-untranslated mRNA, suggests that the GSTM1-null allele may result from unequal crossing-over. 49 refs., 8 figs., 1 tab.

  12. Localization of the gene encoding peptidylglycine [alpha]-amidating monooxygenase (PAM) to human chromosome 5q14-5q21

    SciTech Connect

    Ouafik, L.H.; Giraud, P.; Oliver, C. ); Mattei, M.G. ); Eipper, B.A.; Mains, R.E. )

    1993-11-01

    Peptidylglycine [alpha]-amidating monooxygenase (PAM; EC 1.14.17.3) is a multifunctional protein containing two enzymes that act sequentially to catalyze the [alpha]-amidation of neuroendocrine peptides. Southern blot analysis of human placental DNA demonstrated that PAM is encoded by a single gene. The chromosomal localization of the PAM gene was established using in situ hybridization. A 2.2-kb human PAM cDNA hybridized to human metaphase chromosomes revealed a significant clustering of silver grains over chromosome 5 bands q14-q21. The gene encoding another enzyme important in the post-translational processing of neuroendocrine precursors, prohormone convertase 1 (PC1), is localized in the same region (5q15-q21). 14 refs., 2 figs.

  13. Micromechanics of human mitotic chromosomes

    NASA Astrophysics Data System (ADS)

    Sun, Mingxuan; Kawamura, Ryo; Marko, John F.

    2011-02-01

    Eukaryote cells dramatically reorganize their long chromosomal DNAs to facilitate their physical segregation during mitosis. The internal organization of folded mitotic chromosomes remains a basic mystery of cell biology; its understanding would likely shed light on how chromosomes are separated from one another as well as into chromosome structure between cell divisions. We report biophysical experiments on single mitotic chromosomes from human cells, where we combine micromanipulation, nano-Newton-scale force measurement and biochemical treatments to study chromosome connectivity and topology. Results are in accord with previous experiments on amphibian chromosomes and support the 'chromatin network' model of mitotic chromosome structure. Prospects for studies of chromosome-organizing proteins using siRNA expression knockdowns, as well as for differential studies of chromosomes with and without mutations associated with genetic diseases, are also discussed.

  14. Human dopamine transporter gene (DAT1) maps to chromosome 5p15. 3 and displays a VNTR

    SciTech Connect

    Vandenbergh, D.J.; Perisco, A.M.; Uhl, G.R.; Hawkins, A.L.; Griffin, C.A.; Li, Xiang; Jabs, E.W. )

    1992-12-01

    The human dopamine transporter (DAT1) gene is localized to chromosome 5p15.3 by in situ hybridization and PCR amplification of rodent somatic cell hybrid DNA. Analysis of a 40-bp repeat in the 3[prime] untranslated region of the message revealed variable numbers of the repeat ranging from 3 to 11 copies. These results will aid in the investigation of a role for this gene in genetic disorders of the dopaminergic system in humans. 15 refs., 1 fig., 1 tab.

  15. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  16. A human serotonin 1D receptor variant (5HT1D beta) encoded by an intronless gene on chromosome 6.

    PubMed Central

    Demchyshyn, L; Sunahara, R K; Miller, K; Teitler, M; Hoffman, B J; Kennedy, J L; Seeman, P; Van Tol, H H; Niznik, H B

    1992-01-01

    An intronless gene encoding a serotonin receptor (5HT1D beta) has been cloned and functionally expressed in mammalian fibroblast cultures. Based on the deduced amino acid sequence, the gene encodes a 390-amino acid protein displaying considerable homology, within putative transmembrane domains (approximately 75% identity) to the canine and human 5HT1D receptors. Membranes prepared from CHO cells stably expressing the receptor bound [3H]serotonin with high affinity (Kd 4 nM) and displayed a pharmacological profile consistent, but not identical, with that of the characterized serotonin 5HT1D receptor. Most notably, metergoline and serotonergic piperazine derivatives, as a group, display 3- to 8-fold lower affinity for the 5HT1D beta receptor than for the 5HT1D receptor, whereas both receptors display similar affinities for tryptamine derivatives, including the antimigraine drug sumatriptan. Northern blot analysis revealed an mRNA of approximately 5.5 kilobases expressed in human and monkey frontal cortex, medulla, striatum, hippocampus and amygdala but not in cerebellum, olfactory tubercle, and pituitary. The 5HT1D beta gene maps to human chromosome 6. The existence of multiple neuronal 5HT1D-like receptors may help account for some of the complexities associated with [3H]serotonin binding patterns in native membranes. Images PMID:1351684

  17. Cytochemical study of pseudoisocyanine stained human chromosomes.

    PubMed

    Vagner-Capodano, A M; Pinna-Delgrossi, M H; Stahl, A

    1976-01-28

    Human meiotic and mitotic chromosomes were studied with N-N' diethyl pseudoisocyanine stain. Following methylation and oxydation, the staining allowed microscopic observation of slides with both monochromatic light and fluorescence. In addition, stained preparations can be permanently conserved. Preceeded by diverse methods of chromosome denaturation or 5-BUDR incorporation, PIC lends itself to a large number of banding techniques. Cytochemical study of stained chromosomes demonstrated a certain PIC affinity for DNA although tests performed do not exclude the possibility of PIC reaction with certain proteins.

  18. Evolutionarily conserved sequences on human chromosome 21

    SciTech Connect

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila

    2001-09-01

    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  19. Numerically abnormal chromosome constitutions in humans

    SciTech Connect

    1993-12-31

    Chapter 24, discusses numerically abnormal chromosome constitutions in humans. This involves abnormalities of human chromosome number, including polyploidy (when the number of sets of chromosomes increases) and aneuploidy (when the number of individual normal chromosomes changes). Chapter sections discuss the following chromosomal abnormalities: human triploids, imprinting and uniparental disomy, human tetraploids, hydatidiform moles, anomalies caused by chromosomal imbalance, 13 trisomy (D{sub 1} trisomy, Patau syndrome), 21 trisomy (Down syndrome), 18 trisomy syndrome (Edwards syndrome), other autosomal aneuploidy syndromes, and spontaneous abortions. The chapter concludes with remarks on the nonrandom participation of chromosomes in trisomy. 69 refs., 3 figs., 4 tabs.

  20. Human chromosomes: Structure, behavior, and effects

    SciTech Connect

    Therman, E.; Susman, M.

    1993-12-31

    The book `Human Chromosomes: Structure, Behavior, and Effects` covers the most important topics regarding human chromosomes and current research in cytogenetics. Attention is given both to structure and function of autosomes and sex chromosomes, as well as definitions and causes of chromosomal aberrations. This often involves discussion about various aspects of the cell cycle (both mitosis and meiosis). Methods and techniques involved in researching and mapping human chromosomes are also discussed.

  1. Identification and mapping of ten new potential insulators in the FXYD5-COX7A1 region of human chromosome 19q13.12.

    PubMed

    Didych, D A; Akopov, S B; Snezhkov, E V; Skaptsova, N V; Nikolaev, L G; Sverdlov, E D

    2009-07-01

    A positive-negative selection system revealed 10 potential insulators able to block enhancer interaction with promoter in the 10(6) bp human chromosome 19 region between genes FXYD5 and COX7A1. Relative positions of insulators and genes are in accord with the hypothesis that insulators subdivide genomic DNA into independently regulated loop domains. PMID:19747092

  2. Construction of human chromosome 21-specific yeast artificial chromosomes.

    PubMed

    McCormick, M K; Shero, J H; Cheung, M C; Kan, Y W; Hieter, P A; Antonarakis, S E

    1989-12-01

    Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to greater than 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtained from a mouse-human hybrid, ranging in size from 200 to greater than 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes (corresponding to the YAC ends recovered in Escherichia coli) to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from approximately equal to 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.

  3. Detection of chromosomal abnormalities in human sperm

    SciTech Connect

    Brandriff, B.; Gordon, L.; Ashworth, A.K.; Watchmaker, G.; Carrano, A.V.

    1985-06-19

    A new technology developed by Rudak, et al. for examining the chromosomal constitution of human sperm through fusion with eggs from the Syrian hamster was used to obtain baseline data on the types and frequencies of aberrations in sperm of normal men. The frequency of structural aberrations in 2724 sperm chromosome karyotypes from the 13 healthy non-exposed donors ranged from 2 to 15.8%, demonstrating significant interindividual variability. The most frequently occurring aberrations were chromosome breaks, followed by acentric fragments, chromatid exchanges, chromatid breaks, dicentrics and translocations, chromosome deletions and duplications, inversions, and chromatid deletions. Two donors previously reported had one cell each with multiple chromatid exchanges and breaks. In addition, the oldest donor, AA, had 5 cells out of 124 examined with multiple breaks and rearrangements too extensive to completely identify. 17 refs., 2 tabs.

  4. Assignment of the gene encoding the 5-HT{sub 1E} serotonin receptor (S31) (locus HTR1E) to human chromosome 6q14-q15

    SciTech Connect

    Levy, F.O.; Tasken, K.; Solberg, R.

    1994-08-01

    The human gene for the 5-HT{sub 1E} serotonin receptor was recently cloned, but no chromosomal assignment has yet been given to this gene (locus HTR1E). In this work, we demonstrate by two independent polymerase chain reactions on a panel of human-hamster somatic cell hybrid genomic DNA that the 5-HT{sub 1E} serotonin receptor gene is localized on human chromosome 6. Furthermore, by means of in situ hybridization to human metaphase chromosomes, using the cloned 5-HT{sub 1E} receptor gene (phage clone {lambda}-S31) as a probe, we demonstrate that this gene is localized to the q14-q15 region on chromosome 6. Screening of genomic DNA from 15 unrelated Caucasian individuals, using as a probe the open reading frame of the cloned 5-HT{sub 1E} receptor gene, did not reveal any restriction fragment length polymorphisms with the enzymes BamHI, BanII, BglII, EcoRI, HincII, HindIII, HinfI, MspI, PstI, and PvuII. Since the 5-HT{sub 1E} receptor is found mainly in the cerebral cortex and abnormal function of the serotonergic system has been implicated in a variety of neurologic and psychiatric diseases, the precise chromosomal assignment of the 5-HT{sub 1E} receptor gene is the crucial first step toward the evaluation of this locus as a candidate for mutations in such syndromes. 28 refs., 2 figs., 2 tabs.

  5. Construction of 110 cosmid markers and a 4.5-Mb YAC contig on human chromosome 8p12-q11

    SciTech Connect

    Kurimasa, Akihiro; Suzuki, Noriyuki; Kumano, Satoshi; Oshimura, Mitsuo

    1995-07-20

    Microcell hybrids containing various regions of human chromosome 8 were formed by microcell-mediated transfer of neo-tagged chromosome 8 into the cells derived from severe combined immunodeficiency (SCID) mouse. Thus, 110 cosmid markers were isolated from SV40-transformed SCID fibroblast cell line (SCVA) containing a p12-q11.1 region of human chromosome 8 and were assigned to eight regions in 8p12-q11.1, using a microcell-hybrid panel. For positional cloning of a human gene that restores the DNA-repair defect in a mouse with SCID on 8p11.1-q11.1 (SCID region), we constructed a yeast artificial chromosome (YAC) contig of about 4.5 Mb. Overlapping YACs were further aligned by restriction mapping, using rare-cutting restriction endonucleases. The cosmids and YAC contig should facilitate isolation of the SCID gene and other genes, such as the Werner syndrome-responsible gene in or near this region. 29 refs., 5 figs.

  6. Regional chromosomal assignments for four members of the myocyte-specific enhancer-binding factor 2 (MEF2) gene family to human chromosomes 15q, 19q, 5q, and 1q

    SciTech Connect

    Hobson, G.M.; Funanage, V.L.; Krahe, R.

    1994-09-01

    MEF2 genes belong to the MADS box family of transcription factors and encode proteins that bind as homo- and heterodimers to a consensus CTA(T/A){sub 4}TAG/A sequence present in the regulatory regions of numerous muscle-specific and growth inducible genes. Sequence analysis of human MEF2 cDNA clones suggested that they arose from alternatively spliced transcripts of four different genes, termed MEF2A-D. We have mapped the MEF2 genes to human chromosomal regions by identifying unique sequences in the 5{prime} or 3{prime} untranslated regions of each clone and using these sequences as PCR primers on the DNA of a human-rodent hybrid clone panel informative for different regions of the human genome. The localization of MEF2A to chromosome 15q, MEF2B to 19q, MEF2C to 5q, and MEF2D to 1q verifies the existence of at least four distinct loci for members of this gene family. The same PCR primers were used to identify individual YAC clones for each gene. Such isolated clones are now being used for fluorescence in situ hybridization for high resolution chromosomal regional assignment.

  7. [Chromosome abnormalities in human cancer].

    PubMed

    Salamanca-Gómez, F

    1995-01-01

    Recent investigation on the presence of chromosome abnormalities in neoplasias has allowed outstanding advances in the knowledge of malignant transformation mechanisms and important applications in the clinical diagnosis and prognosis of leukaemias, lymphomas and solid tumors. The purpose of the present paper is to discuss the most relevant cytogenetic aberrations, some of them described at the Unidad de Investigación Médica en Genética Humana, Instituto Mexicano del Seguro Social, and to correlate these abnormalities with recent achievements in the knowledge of oncogenes, suppressor genes or antioncogenes, their chromosome localization, and their mutations in human neoplasia; as well as their perspectives in prevention and treatment of cancer that such findings permit to anticipate.

  8. Altered pattern of replication of human chromosomes in a human fibroblast-mouse cell hybrid.

    PubMed Central

    Farber, R A; Davidson, R L

    1978-01-01

    The pattern of terminal replication of the human chromosomes in a clone of hybrids between diploid human fibroblasts and mouse cells was analyzed by autoradiography. An average of 10 human chromosomes was present in the hybrid cells. Several of these chromosomes were found to terminate replication in a different order from the same chromosomes in the parental human fibroblasts. Chromosomes 4 and 5 completed replication later in the hybrid than in the fibroblasts (relative to the other human chromosomes). In contrast, chromosomes 7, 12, and 15 completed replication earlier in the hybrid than in the fibroblasts. These results suggest that the sequence of terminal chromosome replication in human fibroblasts is not irreversibly programmed into each chromosome. Images PMID:274734

  9. Strategies for sequencing human chromosome 16

    SciTech Connect

    Sutherland, G.R.

    1996-06-01

    This project funded for four years (02.92 to 01.96) was a renewal of a project funded for 2.5 years (07.89 to 01.92). This report covers the period 07.89 to 07.94. The original project was entitled {open_quotes}Correlation of physical and genetic maps of Human Chromosome 16{close_quotes}. The aim over this period was to construct a cytogenetic-based physical map of chromosome 16, to enable integration of its physical and genetic maps. This was achieved by collaboration and isolation of new markers until each bin on the physical map contained a polymorphic marker on the linkage map. A further aim was to integrate all mapping data for this chromosome and to achieve contig closure over band q24.

  10. A physical map of 15 loci on human chromosome 5q23-q33 by two-color fluorescence in situ hybridization

    SciTech Connect

    Saltman, D.L.; Dolganov, G.M. ); Warrington, J.A.; Wasmuth, J.J. ); Lovett, M. )

    1993-06-01

    The q23-q33 region of human chromosome 5 encodes a large number of growth factors, growth factor receptors, and hormone/neurotransmitter receptors. This is also the general region into which several disease genes have been mapped, including diastrophic dysplasia, Treacher Collins syndrome, hereditary startle disease, the myeloid disorders that are associated with the 5q-syndrome, autosomal-dominant forms of hereditary deafness, and limb girdle muscular dystrophy. The authors have developed a framework physical map of this region using cosmid clones isolated from the Los Alamos arrayed chromosome 5-specific library. Entry points into this library included 14 probes to genes within this interval and one anonymous polymorphic marker locus. A physical map has been constructed using fluorescence in situ hybridization of these cosmids on metaphase and interphase chromosomes, and this is in good agreement with the radiation hybrid map of the region. The derived order of loci across the region is cen-IL4-IL5-IRF1-IL3-IL9-EGR1-CD14-FGFA-GRL-D5S207-ADRB2-SPARC-RPS14-CSF1R-ADRA1, and the total distance spanned by these loci is approximately 15 Mb. The framework map, genomic clones, and contig expansion within 5q23-q33 should provide valuable resources for the eventual isolation of the clinically relevant loci that reside in this region. 31 refs., 3 figs., 2 tabs.

  11. Contribution of mGluR5 to pathophysiology in a mouse model of human chromosome 16p11.2 microdeletion.

    PubMed

    Tian, Di; Stoppel, Laura J; Heynen, Arnold J; Lindemann, Lothar; Jaeschke, Georg; Mills, Alea A; Bear, Mark F

    2015-02-01

    Human chromosome 16p11.2 microdeletion is the most common gene copy number variation in autism, but the synaptic pathophysiology caused by this mutation is largely unknown. Using a mouse with the same genetic deficiency, we found that metabotropic glutamate receptor 5 (mGluR5)-dependent synaptic plasticity and protein synthesis was altered in the hippocampus and that hippocampus-dependent memory was impaired. Notably, chronic treatment with a negative allosteric modulator of mGluR5 reversed the cognitive deficit.

  12. Chromosomal DNA Replication Pattern in Human Tumour Cells in vitro

    PubMed Central

    Kucheria, Kiran

    1970-01-01

    The present paper deals with the chromosomal DNA replication pattern in human solid tumour cells in vitro. This was studied at the terminal stages of the S-period. All the cell lines of female origin showed a late replicating chromosome in group XX6-12. In cell lines of male origin one of the chromosomes of group 21-22Y was later replicating than the rest of the members of the group. The DNA replication pattern of the autosomes and the sex chromosomes was similar to that of the cultured human leucocytes. The results of the present study show that the DNA replication pattern of the chromosome in neoplastic cells is basically unchanged despite the changes in the chromosome number and morphology. Therefore the abnormal behaviour of the neoplastic cells cannot be related to the changes in the pattern of the chromosomal DNA replication. ImagesFig. 5Fig. 1Fig. 6Fig. 2Fig. 3Fig. 4 PMID:5475754

  13. Genomic organization of the human gene (CA5) and pseudogene for mitochondrial carbonic anhydrase V and their localization to chromosomes 16q and 16p

    SciTech Connect

    Nagao, Yoshiro; Sly, W.S.; Batanian, J.R.

    1995-08-10

    Carbonic anhydrase V (CA V) is expressed in mitochondrial matrix in liver and several other tissues. It is of interest for its putative roles in providing bicarbonate to carbamoyl phosphate synthetase for ureagenesis and to pyruvate carboxylase for gluconeogenesis and its possible importance in explaining certain inherited metabolic disorders with hyperammonemia and hypoglycemia. Following the recent characterization of the cDNA for human CA V, we report the isolation of the human gene from two {lambda} genomic libraries and its characterization. The CA V gene (CA5) is approximately 50 kb long and contains 7 exons and 6 introns. The exon-intron boundaries are found in positions identical to those determined for the previously described CA II, CA III, and CA VII genes. Like the CA VII gene, CA5 does not contain typical TATA and CAAT promoter elements in the 5{prime} flanking region but does contain a TTTAA sequence 147 nucleotides upstream of the initiation codon. CA5 also contains a 12-bp GT-rich segment beginning 13 bp downstream of the polyadenylation signal in the 3{prime} untranslated region of exon 7. FISH analysis allowed CA5 to be assigned to chromosome 16q24.3. An unprocessed pseudogene containing sequence homologous to exons 3-7 and introns 3-6 was also isolated and was assigned by FISH analysis to chromosome 16p11.2-p12. 22 refs., 4 figs., 1 tab.

  14. Functional structure of the human X chromosome

    SciTech Connect

    1993-12-31

    Chapter 23, describes the functional structure of the human X chromosome. It provides a functional map of the human X chromosome, discussing in depth the inactivation center, always-active regions, and critical region. Finally, it provides a summary of X inactivation. 34 refs., 4 figs.

  15. [The evolution of human Y chromosome].

    PubMed

    Yang, Xianrong; Wang, Meiqin; Li, Shaohua

    2014-09-01

    The human Y chromosome is always intriguing for researchers, because of its role in gender determination and its unusual evolutionary history. The Y chromosome evolves from an autosome, and its evolution has been characterized by massive gene decay. The lack of recombination and protein-coding genes and high content of repetitive sequences have hindered the progress in our understanding of the Y chromosome biology. Recently, with the advances in comparative genomics and sequencing technology, the research on Y chromosome has become a hotspot, with an intensified debate about Y-chromosome final destination resulting from degeneration. This review focuses on the structure, inheritance characteristics, gene content, and the origin and evolution of Y chromosome. We also discuss the long-term destiny of Y chromosome.

  16. A Plain English Map of the Human Chromosomes.

    ERIC Educational Resources Information Center

    Offner, Susan

    1992-01-01

    Presents a chromosome map for 19 known chromosomes in human genetics. Describes the characteristics attributed to the genetic codes for each of the chromosomes and discusses the teaching applications of the chromosome map. (MDH)

  17. The finished DNA sequence of human chromosome 12.

    PubMed

    Scherer, Steven E; Muzny, Donna M; Buhay, Christian J; Chen, Rui; Cree, Andrew; Ding, Yan; Dugan-Rocha, Shannon; Gill, Rachel; Gunaratne, Preethi; Harris, R Alan; Hawes, Alicia C; Hernandez, Judith; Hodgson, Anne V; Hume, Jennifer; Jackson, Andrew; Khan, Ziad Mohid; Kovar-Smith, Christie; Lewis, Lora R; Lozado, Ryan J; Metzker, Michael L; Milosavljevic, Aleksandar; Miner, George R; Montgomery, Kate T; Morgan, Margaret B; Nazareth, Lynne V; Scott, Graham; Sodergren, Erica; Song, Xing-Zhi; Steffen, David; Lovering, Ruth C; Wheeler, David A; Worley, Kim C; Yuan, Yi; Zhang, Zhengdong; Adams, Charles Q; Ansari-Lari, M Ali; Ayele, Mulu; Brown, Mary J; Chen, Guan; Chen, Zhijian; Clerc-Blankenburg, Kerstin P; Davis, Clay; Delgado, Oliver; Dinh, Huyen H; Draper, Heather; Gonzalez-Garay, Manuel L; Havlak, Paul; Jackson, Laronda R; Jacob, Leni S; Kelly, Susan H; Li, Li; Li, Zhangwan; Liu, Jing; Liu, Wen; Lu, Jing; Maheshwari, Manjula; Nguyen, Bao-Viet; Okwuonu, Geoffrey O; Pasternak, Shiran; Perez, Lesette M; Plopper, Farah J H; Santibanez, Jireh; Shen, Hua; Tabor, Paul E; Verduzco, Daniel; Waldron, Lenee; Wang, Qiaoyan; Williams, Gabrielle A; Zhang, Jingkun; Zhou, Jianling; Allen, Carlana C; Amin, Anita G; Anyalebechi, Vivian; Bailey, Michael; Barbaria, Joseph A; Bimage, Kesha E; Bryant, Nathaniel P; Burch, Paula E; Burkett, Carrie E; Burrell, Kevin L; Calderon, Eliana; Cardenas, Veronica; Carter, Kelvin; Casias, Kristal; Cavazos, Iracema; Cavazos, Sandra R; Ceasar, Heather; Chacko, Joseph; Chan, Sheryl N; Chavez, Dean; Christopoulos, Constantine; Chu, Joseph; Cockrell, Raynard; Cox, Caroline D; Dang, Michelle; Dathorne, Stephanie R; David, Robert; Davis, Candi Mon'Et; Davy-Carroll, Latarsha; Deshazo, Denise R; Donlin, Jeremy E; D'Souza, Lisa; Eaves, Kristy A; Egan, Amy; Emery-Cohen, Alexandra J; Escotto, Michael; Flagg, Nicole; Forbes, Lisa D; Gabisi, Abdul M; Garza, Melissa; Hamilton, Cerissa; Henderson, Nicholas; Hernandez, Omar; Hines, Sandra; Hogues, Marilyn E; Huang, Mei; Idlebird, DeVincent G; Johnson, Rudy; Jolivet, Angela; Jones, Sally; Kagan, Ryan; King, Laquisha M; Leal, Belita; Lebow, Heather; Lee, Sandra; LeVan, Jaclyn M; Lewis, Lakeshia C; London, Pamela; Lorensuhewa, Lorna M; Loulseged, Hermela; Lovett, Demetria A; Lucier, Alice; Lucier, Raymond L; Ma, Jie; Madu, Renita C; Mapua, Patricia; Martindale, Ashley D; Martinez, Evangelina; Massey, Elizabeth; Mawhiney, Samantha; Meador, Michael G; Mendez, Sylvia; Mercado, Christian; Mercado, Iracema C; Merritt, Christina E; Miner, Zachary L; Minja, Emmanuel; Mitchell, Teresa; Mohabbat, Farida; Mohabbat, Khatera; Montgomery, Baize; Moore, Niki; Morris, Sidney; Munidasa, Mala; Ngo, Robin N; Nguyen, Ngoc B; Nickerson, Elizabeth; Nwaokelemeh, Ogechi O; Nwokenkwo, Stanley; Obregon, Melissa; Oguh, Maryann; Oragunye, Njideka; Oviedo, Rodolfo J; Parish, Bridgette J; Parker, David N; Parrish, Julia; Parks, Kenya L; Paul, Heidie A; Payton, Brett A; Perez, Agapito; Perrin, William; Pickens, Adam; Primus, Eltrick L; Pu, Ling-Ling; Puazo, Maria; Quiles, Miyo M; Quiroz, Juana B; Rabata, Dina; Reeves, Kacy; Ruiz, San Juana; Shao, Hongmei; Sisson, Ida; Sonaike, Titilola; Sorelle, Richard P; Sutton, Angelica E; Svatek, Amanda F; Svetz, Leah Anne; Tamerisa, Kavitha S; Taylor, Tineace R; Teague, Brian; Thomas, Nicole; Thorn, Rachel D; Trejos, Zulma Y; Trevino, Brenda K; Ukegbu, Ogechi N; Urban, Jeremy B; Vasquez, Lydia I; Vera, Virginia A; Villasana, Donna M; Wang, Ling; Ward-Moore, Stephanie; Warren, James T; Wei, Xuehong; White, Flower; Williamson, Angela L; Wleczyk, Regina; Wooden, Hailey S; Wooden, Steven H; Yen, Jennifer; Yoon, Lillienne; Yoon, Vivienne; Zorrilla, Sara E; Nelson, David; Kucherlapati, Raju; Weinstock, George; Gibbs, Richard A

    2006-03-16

    Human chromosome 12 contains more than 1,400 coding genes and 487 loci that have been directly implicated in human disease. The q arm of chromosome 12 contains one of the largest blocks of linkage disequilibrium found in the human genome. Here we present the finished sequence of human chromosome 12, which has been finished to high quality and spans approximately 132 megabases, representing approximately 4.5% of the human genome. Alignment of the human chromosome 12 sequence across vertebrates reveals the origin of individual segments in chicken, and a unique history of rearrangement through rodent and primate lineages. The rate of base substitutions in recent evolutionary history shows an overall slowing in hominids compared with primates and rodents. PMID:16541075

  18. The finished DNA sequence of human chromosome 12.

    PubMed

    Scherer, Steven E; Muzny, Donna M; Buhay, Christian J; Chen, Rui; Cree, Andrew; Ding, Yan; Dugan-Rocha, Shannon; Gill, Rachel; Gunaratne, Preethi; Harris, R Alan; Hawes, Alicia C; Hernandez, Judith; Hodgson, Anne V; Hume, Jennifer; Jackson, Andrew; Khan, Ziad Mohid; Kovar-Smith, Christie; Lewis, Lora R; Lozado, Ryan J; Metzker, Michael L; Milosavljevic, Aleksandar; Miner, George R; Montgomery, Kate T; Morgan, Margaret B; Nazareth, Lynne V; Scott, Graham; Sodergren, Erica; Song, Xing-Zhi; Steffen, David; Lovering, Ruth C; Wheeler, David A; Worley, Kim C; Yuan, Yi; Zhang, Zhengdong; Adams, Charles Q; Ansari-Lari, M Ali; Ayele, Mulu; Brown, Mary J; Chen, Guan; Chen, Zhijian; Clerc-Blankenburg, Kerstin P; Davis, Clay; Delgado, Oliver; Dinh, Huyen H; Draper, Heather; Gonzalez-Garay, Manuel L; Havlak, Paul; Jackson, Laronda R; Jacob, Leni S; Kelly, Susan H; Li, Li; Li, Zhangwan; Liu, Jing; Liu, Wen; Lu, Jing; Maheshwari, Manjula; Nguyen, Bao-Viet; Okwuonu, Geoffrey O; Pasternak, Shiran; Perez, Lesette M; Plopper, Farah J H; Santibanez, Jireh; Shen, Hua; Tabor, Paul E; Verduzco, Daniel; Waldron, Lenee; Wang, Qiaoyan; Williams, Gabrielle A; Zhang, Jingkun; Zhou, Jianling; Allen, Carlana C; Amin, Anita G; Anyalebechi, Vivian; Bailey, Michael; Barbaria, Joseph A; Bimage, Kesha E; Bryant, Nathaniel P; Burch, Paula E; Burkett, Carrie E; Burrell, Kevin L; Calderon, Eliana; Cardenas, Veronica; Carter, Kelvin; Casias, Kristal; Cavazos, Iracema; Cavazos, Sandra R; Ceasar, Heather; Chacko, Joseph; Chan, Sheryl N; Chavez, Dean; Christopoulos, Constantine; Chu, Joseph; Cockrell, Raynard; Cox, Caroline D; Dang, Michelle; Dathorne, Stephanie R; David, Robert; Davis, Candi Mon'Et; Davy-Carroll, Latarsha; Deshazo, Denise R; Donlin, Jeremy E; D'Souza, Lisa; Eaves, Kristy A; Egan, Amy; Emery-Cohen, Alexandra J; Escotto, Michael; Flagg, Nicole; Forbes, Lisa D; Gabisi, Abdul M; Garza, Melissa; Hamilton, Cerissa; Henderson, Nicholas; Hernandez, Omar; Hines, Sandra; Hogues, Marilyn E; Huang, Mei; Idlebird, DeVincent G; Johnson, Rudy; Jolivet, Angela; Jones, Sally; Kagan, Ryan; King, Laquisha M; Leal, Belita; Lebow, Heather; Lee, Sandra; LeVan, Jaclyn M; Lewis, Lakeshia C; London, Pamela; Lorensuhewa, Lorna M; Loulseged, Hermela; Lovett, Demetria A; Lucier, Alice; Lucier, Raymond L; Ma, Jie; Madu, Renita C; Mapua, Patricia; Martindale, Ashley D; Martinez, Evangelina; Massey, Elizabeth; Mawhiney, Samantha; Meador, Michael G; Mendez, Sylvia; Mercado, Christian; Mercado, Iracema C; Merritt, Christina E; Miner, Zachary L; Minja, Emmanuel; Mitchell, Teresa; Mohabbat, Farida; Mohabbat, Khatera; Montgomery, Baize; Moore, Niki; Morris, Sidney; Munidasa, Mala; Ngo, Robin N; Nguyen, Ngoc B; Nickerson, Elizabeth; Nwaokelemeh, Ogechi O; Nwokenkwo, Stanley; Obregon, Melissa; Oguh, Maryann; Oragunye, Njideka; Oviedo, Rodolfo J; Parish, Bridgette J; Parker, David N; Parrish, Julia; Parks, Kenya L; Paul, Heidie A; Payton, Brett A; Perez, Agapito; Perrin, William; Pickens, Adam; Primus, Eltrick L; Pu, Ling-Ling; Puazo, Maria; Quiles, Miyo M; Quiroz, Juana B; Rabata, Dina; Reeves, Kacy; Ruiz, San Juana; Shao, Hongmei; Sisson, Ida; Sonaike, Titilola; Sorelle, Richard P; Sutton, Angelica E; Svatek, Amanda F; Svetz, Leah Anne; Tamerisa, Kavitha S; Taylor, Tineace R; Teague, Brian; Thomas, Nicole; Thorn, Rachel D; Trejos, Zulma Y; Trevino, Brenda K; Ukegbu, Ogechi N; Urban, Jeremy B; Vasquez, Lydia I; Vera, Virginia A; Villasana, Donna M; Wang, Ling; Ward-Moore, Stephanie; Warren, James T; Wei, Xuehong; White, Flower; Williamson, Angela L; Wleczyk, Regina; Wooden, Hailey S; Wooden, Steven H; Yen, Jennifer; Yoon, Lillienne; Yoon, Vivienne; Zorrilla, Sara E; Nelson, David; Kucherlapati, Raju; Weinstock, George; Gibbs, Richard A

    2006-03-16

    Human chromosome 12 contains more than 1,400 coding genes and 487 loci that have been directly implicated in human disease. The q arm of chromosome 12 contains one of the largest blocks of linkage disequilibrium found in the human genome. Here we present the finished sequence of human chromosome 12, which has been finished to high quality and spans approximately 132 megabases, representing approximately 4.5% of the human genome. Alignment of the human chromosome 12 sequence across vertebrates reveals the origin of individual segments in chicken, and a unique history of rearrangement through rodent and primate lineages. The rate of base substitutions in recent evolutionary history shows an overall slowing in hominids compared with primates and rodents.

  19. Patterns of recombination on human chromosome 22

    SciTech Connect

    Schlumpf, K.S.; Kim, D.; Haines, J.L.

    1994-09-01

    Virtually all genetic linkage maps generated to date are gross averages across individuals, ages, and (often) sexes. In addition, although some level of positive interference has been assumed, until recently little evidence to support this in humans has been available. The major stumbling block has been the quality of the data available, since even a few genotypic errors can have drastic effects on both the map length and the number of apparent recombinants. In addition, variation in recombination by factors other than sex have pretty much been ignored. To explore recombination in more detail, we have generated a microsatellite marker map of human chromosome 22. This map includes 32 markers genotyped through 46 sibships of the Venezuelan Reference Pedigree (VRP). Extensive error checking and regenotyping was performed to remove as many genotypic errors as possible, but no genotypes were removed simply because they created unlikely events. The following 1000:1 odds map has been obtained: cen--F8VWFP1--11--S264--3-S311--4--S257--2--TOP1P2--3--S156--1--CRYB2--1--S258--2--S310--6--S193--1--S275--3--S268--1--S280--4--S304--3--S283--2--LiR1--3--IL2RB--3--S299--1--S302--1--S537--2--S270--4--PDGF--8--S274--qter. The female map (91 cM) is twice as long as the male map (46 cM) and the log-likelihood difference in the maps (22.3) is highly significant (P=0.001, df=22) and appears constant across the chromosome. Analysis of recombination with age showed no particular trends for either males or females when chromosomes were grouped into three categories (20, 20-30, 30+) by parental age at birth of child. Positive interference was found in maternally derived chromosomes ({chi}{sup 2}=30.5 (4), p<0.005), but not in paternally derived chromosomes ({chi}{sup 2}=6.24 (3), P=0.10). This contrasts to data from chromosomes 9 and 21 where positive interference was found for both sexes. More detailed analyses are in progress.

  20. Human inositol 1,4,5-trisphosphate type-1 receptor, InsP3R1: structure, function, regulation of expression and chromosomal localization.

    PubMed Central

    Yamada, N; Makino, Y; Clark, R A; Pearson, D W; Mattei, M G; Guénet, J L; Ohama, E; Fujino, I; Miyawaki, A; Furuichi, T

    1994-01-01

    We have isolated cDNA clones encoding an inositol 1,4,5-trisphosphate receptor type 1 (InsP3R1) from human uteri and a leukaemic cell line, HL-60. Northern-blot analysis showed that approx. 10 kb of InsP3R1 mRNA is expressed in human uteri, oviducts and HL-60 cells. The predicted amino acid sequence of human InsP3R1 (2695 amino acids) has 99% identity with that of the mouse SI-/SII- splicing counterpart. Western-blot analysis with anti-(mouse InsP3R1) antibodies showed that InsP3R1 protein of human uteri and oviducts of approx 220 kDa is immunostained. Northern-blot analysis of HL-60 cell differentiation along the neutrophilic lineage induced by retinoic acid or dimethylsulphoxide showed an accompanying enhanced expression of InsP3R1 mRNA. Immunohistochemical analysis of the cerebella of spinocerebellar degeneration patients showed a variable loss of Purkinje cells with an altered pattern of immunostaining. The InsP3R1 gene (Insp3r1) was localized to the 3P25-26 region of human chromosome 3. The data presented here clearly show that InsP3R1 exists widely in human tissues and may play critical roles in various kinds of cellular functions. Images Figure 2 Figure 3 Figure 5 Figure 6 Figure 7 Figure 8 PMID:7945203

  1. Chromosome

    MedlinePlus

    Chromosomes are structures found in the center (nucleus) of cells that carry long pieces of DNA. DNA ... is the building block of the human body. Chromosomes also contain proteins that help DNA exist in ...

  2. A Comprehensive Genetic Map of Murine Chromosome 11 Reveals Extensive Linkage Conservation between Mouse and Human

    PubMed Central

    Buchberg, A. M.; Brownell, E.; Nagata, S.; Jenkins, N. A.; Copeland, N. G.

    1989-01-01

    Interspecific backcross animals from a cross between C57BL/6J and Mus spretus mice were used to generate a comprehensive linkage map of mouse chromosome 11. The relative map positions of genes previously assigned to mouse chromosome 11 by somatic cell hybrid or genetic backcross analysis were determined (Erbb, Rel, Il-3, Csfgm, Trp53-1, Evi-2, Erba, Erbb-2, Csfg, Myhs, Cola-1, Myla, Hox-2 and Pkca). We also analyzed genes that we suspected would map to chromosome 11 by virtue of their location in human chromosomes and the known linkage homologies that exist between murine chromosome 11 and human chromosomes (Mpo, Ngfr, Pdgfr and Fms). Two of the latter genes, Mpo and Ngfr, mapped to mouse chromosome 11. Both genes also mapped to human chromosome 17, extending the degree of linkage conservation observed between human chromosome 17 and mouse chromosome 11. Pdgfr and Fms, which are closely linked to Il-3 and Csfgm in humans on chromosome 5, mapped to mouse chromosome 18 rather than mouse chromosome 11, thereby defining yet another conserved linkage group between human and mouse chromosomes. The mouse chromosome 11 linkage map generated in these studies substantially extends the framework for identifying homologous genes in the mouse that are involved in human disease, for elucidating the genes responsible for several mouse mutations, and for gaining insights into chromosome evolution and genome organization. PMID:2567264

  3. The human osmoregulatory Na{sup +}/myo-inositol cotransporter gene (SLC5A3): Molecular cloning and localization to chromosome 21

    SciTech Connect

    Berry, G.T.; Mallee, J.J.; Muenke, M.

    1995-01-20

    A human Na{sup +}/myo-inositol cotransporter (SLC5A3) gene was cloned; sequencing revealed a single intron-free open reading frame of 2157 nucleotides. Containing 718 amino acid residues, the predicted protein is highly homologous to the product of the canine osmoregulatory SLC5A3 gene. The SLC5A3 protein is number 3 of the solute carrier family 5 and was previously designated SMIT. Using fluorescence in situ hybridization, the human SLC5A3 gene was localized to band q22 on chromosome 21. Many tissues including brain demonstrate gene expression. The inability of a trisomic 21 cell to downregulate expression of three copies of this osmoregulatory gene could result in increased flux of both myo-inositol and Na{sup +} across the plasma membrane. The potential consequences include perturbations in the cell membrane potential and tissue osmolyte levels. The SLC5A3 gene may play a role in the pathogenesis of Down syndrome. 54 refs., 4 figs.

  4. The Divergence of Neandertal and Modern Human Y Chromosomes.

    PubMed

    Mendez, Fernando L; Poznik, G David; Castellano, Sergi; Bustamante, Carlos D

    2016-04-01

    Sequencing the genomes of extinct hominids has reshaped our understanding of modern human origins. Here, we analyze ∼120 kb of exome-captured Y-chromosome DNA from a Neandertal individual from El Sidrón, Spain. We investigate its divergence from orthologous chimpanzee and modern human sequences and find strong support for a model that places the Neandertal lineage as an outgroup to modern human Y chromosomes-including A00, the highly divergent basal haplogroup. We estimate that the time to the most recent common ancestor (TMRCA) of Neandertal and modern human Y chromosomes is ∼588 thousand years ago (kya) (95% confidence interval [CI]: 447-806 kya). This is ∼2.1 (95% CI: 1.7-2.9) times longer than the TMRCA of A00 and other extant modern human Y-chromosome lineages. This estimate suggests that the Y-chromosome divergence mirrors the population divergence of Neandertals and modern human ancestors, and it refutes alternative scenarios of a relatively recent or super-archaic origin of Neandertal Y chromosomes. The fact that the Neandertal Y we describe has never been observed in modern humans suggests that the lineage is most likely extinct. We identify protein-coding differences between Neandertal and modern human Y chromosomes, including potentially damaging changes to PCDH11Y, TMSB4Y, USP9Y, and KDM5D. Three of these changes are missense mutations in genes that produce male-specific minor histocompatibility (H-Y) antigens. Antigens derived from KDM5D, for example, are thought to elicit a maternal immune response during gestation. It is possible that incompatibilities at one or more of these genes played a role in the reproductive isolation of the two groups.

  5. The Divergence of Neandertal and Modern Human Y Chromosomes.

    PubMed

    Mendez, Fernando L; Poznik, G David; Castellano, Sergi; Bustamante, Carlos D

    2016-04-01

    Sequencing the genomes of extinct hominids has reshaped our understanding of modern human origins. Here, we analyze ∼120 kb of exome-captured Y-chromosome DNA from a Neandertal individual from El Sidrón, Spain. We investigate its divergence from orthologous chimpanzee and modern human sequences and find strong support for a model that places the Neandertal lineage as an outgroup to modern human Y chromosomes-including A00, the highly divergent basal haplogroup. We estimate that the time to the most recent common ancestor (TMRCA) of Neandertal and modern human Y chromosomes is ∼588 thousand years ago (kya) (95% confidence interval [CI]: 447-806 kya). This is ∼2.1 (95% CI: 1.7-2.9) times longer than the TMRCA of A00 and other extant modern human Y-chromosome lineages. This estimate suggests that the Y-chromosome divergence mirrors the population divergence of Neandertals and modern human ancestors, and it refutes alternative scenarios of a relatively recent or super-archaic origin of Neandertal Y chromosomes. The fact that the Neandertal Y we describe has never been observed in modern humans suggests that the lineage is most likely extinct. We identify protein-coding differences between Neandertal and modern human Y chromosomes, including potentially damaging changes to PCDH11Y, TMSB4Y, USP9Y, and KDM5D. Three of these changes are missense mutations in genes that produce male-specific minor histocompatibility (H-Y) antigens. Antigens derived from KDM5D, for example, are thought to elicit a maternal immune response during gestation. It is possible that incompatibilities at one or more of these genes played a role in the reproductive isolation of the two groups. PMID:27058445

  6. Chromosome speciation: Humans, Drosophila, and mosquitoes

    PubMed Central

    Ayala, Francisco J.; Coluzzi, Mario

    2005-01-01

    Chromosome rearrangements (such as inversions, fusions, and fissions) may play significant roles in the speciation between parapatric (contiguous) or partly sympatric (geographically overlapping) populations. According to the “hybrid-dysfunction” model, speciation occurs because hybrids with heterozygous chromosome rearrangements produce dysfunctional gametes and thus have low reproductive fitness. Natural selection will, therefore, promote mutations that reduce the probability of intercrossing between populations carrying different rearrangements and thus promote their reproductive isolation. This model encounters a disabling difficulty: namely, how to account for the spread in a population of a chromosome rearrangement after it first arises as a mutation in a single individual. The “suppressed-recombination” model of speciation points out that chromosome rearrangements act as a genetic filter between populations. Mutations associated with the rearranged chromosomes cannot flow from one to another population, whereas genetic exchange will freely occur between colinear chromosomes. Mutations adaptive to local conditions will, therefore, accumulate differentially in the protected chromosome regions so that parapatric or partially sympatric populations will genetically differentiate, eventually evolving into different species. The speciation model of suppressed recombination has recently been tested by gene and DNA sequence comparisons between humans and chimpanzees, between Drosophila species, and between species related to Anopheles gambiae, the vector of malignant malaria in Africa. PMID:15851677

  7. Repeat Sequences and Base Correlations in Human Y Chromosome Palindromes

    NASA Astrophysics Data System (ADS)

    Jin, Neng-zhi; Liu, Zi-xian; Qi, Yan-jiao; Qiu, Wen-yuan

    2009-06-01

    On the basis of information theory and statistical methods, we use mutual information, n-tuple entropy and conditional entropy, combined with biological characteristics, to analyze the long range correlation and short range correlation in human Y chromosome palindromes. The magnitude distribution of the long range correlation which can be reflected by the mutual information is P5>P5a>P5b (P5a and P5b are the sequences that replace solely Alu repeats and all interspersed repeats with random uncorrelated sequences in human Y chromosome palindrome 5, respectively); and the magnitude distribution of the short range correlation which can be reflected by the n-tuple entropy and the conditional entropy is P5>P5a>P5b>random uncorrelated sequence. In other words, when the Alu repeats and all interspersed repeats replace with random uncorrelated sequence, the long range and short range correlation decrease gradually. However, the random uncorrelated sequence has no correlation. This research indicates that more repeat sequences result in stronger correlation between bases in human Y chromosome. The analyses may be helpful to understand the special structures of human Y chromosome palindromes profoundly.

  8. Small Supernumerary Marker Chromosomes in Human Infertility.

    PubMed

    Armanet, Narjes; Tosca, Lucie; Brisset, Sophie; Liehr, Thomas; Tachdjian, Gérard

    2015-01-01

    Small supernumerary marker chromosomes (sSMC) are structurally abnormal chromosomes that cannot be unambiguously identified by banding cytogenetics. The objective of this study was to provide an overview of sSMC frequency and characterization in a context of infertility and to review the literature describing sSMC in relation with male and female infertility. Therefore, a systematic literature review on sSMC associated with infertility was conducted by means of a PubMed literature and a sSMC database (http://ssmc-tl.com/sSMC.html) search. A total of 234 patients with infertility were identified as carriers of sSMC. All chromosomes, except chromosomes 10, 19 and the X, were involved in sSMC, and in 72% the sSMC originated from acrocentric chromosomes. Euchromatic imbalances were caused by the presence of sSMC in 30% of the cases. Putative genes have been identified in only 1.2% of sSMC associated with infertility. The implication of sSMC in infertility could be due to a partial trisomy of some genes but also to mechanical effects perturbing meiosis. Further precise molecular and interphase-architecture studies on sSMC are needed in the future to characterize the relationship between this chromosomal anomaly and human infertility.

  9. Novel methods for physical mapping of the human genome applied to the long arm of chromosome 5

    SciTech Connect

    McClelland, M.

    1991-12-01

    The object of our current grant is to develop novel methods for mapping of the human genome. The techniques to be assessed were: (1) three methods for the production of unique sequence clones from the region of interest; (2) novel methods for the production and separation of multi-megabase DNA fragments; (3) methods for the production of physical linking clones'' that contain rare restriction sites; (4) application of these methods and available resources to map the region of interest. Progress includes: In the first two years methods were developed for physical mapping and the production of arrayed clones; We have concentrated on developing rare- cleavage tools based or restriction endonucleases and methylases; We studied the effect of methylation on enzymes used for PFE mapping of the human genome; we characterized two new isoschizomers of rare cutting endonucleases; we developed a reliable way to produce partial digests of DNA in agarose plugs and applied it to the human genome; and we applied a method to double the apparent specificity of the rare-cutter'' endonucleases.

  10. Novel methods for physical mapping of the human genome applied to the long arm of chromosome 5. Final report

    SciTech Connect

    McClelland, M.

    1991-12-01

    The object of our current grant is to develop novel methods for mapping of the human genome. The techniques to be assessed were: (1) three methods for the production of unique sequence clones from the region of interest; (2) novel methods for the production and separation of multi-megabase DNA fragments; (3) methods for the production of ``physical linking clones`` that contain rare restriction sites; (4) application of these methods and available resources to map the region of interest. Progress includes: In the first two years methods were developed for physical mapping and the production of arrayed clones; We have concentrated on developing rare- cleavage tools based or restriction endonucleases and methylases; We studied the effect of methylation on enzymes used for PFE mapping of the human genome; we characterized two new isoschizomers of rare cutting endonucleases; we developed a reliable way to produce partial digests of DNA in agarose plugs and applied it to the human genome; and we applied a method to double the apparent specificity of the ``rare-cutter`` endonucleases.

  11. The Divergence of Neandertal and Modern Human Y Chromosomes

    PubMed Central

    Mendez, Fernando L.; Poznik, G. David; Castellano, Sergi; Bustamante, Carlos D.

    2016-01-01

    Sequencing the genomes of extinct hominids has reshaped our understanding of modern human origins. Here, we analyze ∼120 kb of exome-captured Y-chromosome DNA from a Neandertal individual from El Sidrón, Spain. We investigate its divergence from orthologous chimpanzee and modern human sequences and find strong support for a model that places the Neandertal lineage as an outgroup to modern human Y chromosomes—including A00, the highly divergent basal haplogroup. We estimate that the time to the most recent common ancestor (TMRCA) of Neandertal and modern human Y chromosomes is ∼588 thousand years ago (kya) (95% confidence interval [CI]: 447–806 kya). This is ∼2.1 (95% CI: 1.7–2.9) times longer than the TMRCA of A00 and other extant modern human Y-chromosome lineages. This estimate suggests that the Y-chromosome divergence mirrors the population divergence of Neandertals and modern human ancestors, and it refutes alternative scenarios of a relatively recent or super-archaic origin of Neandertal Y chromosomes. The fact that the Neandertal Y we describe has never been observed in modern humans suggests that the lineage is most likely extinct. We identify protein-coding differences between Neandertal and modern human Y chromosomes, including potentially damaging changes to PCDH11Y, TMSB4Y, USP9Y, and KDM5D. Three of these changes are missense mutations in genes that produce male-specific minor histocompatibility (H-Y) antigens. Antigens derived from KDM5D, for example, are thought to elicit a maternal immune response during gestation. It is possible that incompatibilities at one or more of these genes played a role in the reproductive isolation of the two groups. PMID:27058445

  12. Aup1, a novel gene on mouse Chromosome 6 and human Chromosome 2p13

    SciTech Connect

    Jang, Wonhee; Weber, J.S.; Meisler, M.H.

    1996-09-01

    We have cloned a novel mouse cDNA, Aup1, encoding a predicted protein of 410 amino acid residues. The 1.5-kb Aup1 transcript is ubiquitously expressed in mouse tissues. An evolutionary relationship to the Caenorhabditis elegans predicted protein F44b9.5 is indicated by the 35% identity and 53% conservation of the amino acid sequences. Nineteen related human ESTs spanning 80% of the protein have also been identified, with a predicted amino acid sequence identity of 86% between the human and the mouse proteins. The gene has been mapped to a conserved linkage group on human chromosome 2p13 and mouse Chromosome 6. Aup1 was eliminated as a candidate gene for two closely linked disorders, human LGMD2B and mouse mnd2. 15 refs., 2 figs.

  13. Mapping genes to human chromosome 19

    SciTech Connect

    Connolly, Sarah

    1996-05-01

    For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. These localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.

  14. The DNA sequence and analysis of human chromosome 14.

    PubMed

    Heilig, Roland; Eckenberg, Ralph; Petit, Jean-Louis; Fonknechten, Núria; Da Silva, Corinne; Cattolico, Laurence; Levy, Michaël; Barbe, Valérie; de Berardinis, Véronique; Ureta-Vidal, Abel; Pelletier, Eric; Vico, Virginie; Anthouard, Véronique; Rowen, Lee; Madan, Anup; Qin, Shizhen; Sun, Hui; Du, Hui; Pepin, Kymberlie; Artiguenave, François; Robert, Catherine; Cruaud, Corinne; Brüls, Thomas; Jaillon, Olivier; Friedlander, Lucie; Samson, Gaelle; Brottier, Philippe; Cure, Susan; Ségurens, Béatrice; Anière, Franck; Samain, Sylvie; Crespeau, Hervé; Abbasi, Nissa; Aiach, Nathalie; Boscus, Didier; Dickhoff, Rachel; Dors, Monica; Dubois, Ivan; Friedman, Cynthia; Gouyvenoux, Michel; James, Rose; Madan, Anuradha; Mairey-Estrada, Barbara; Mangenot, Sophie; Martins, Nathalie; Ménard, Manuela; Oztas, Sophie; Ratcliffe, Amber; Shaffer, Tristan; Trask, Barbara; Vacherie, Benoit; Bellemere, Chadia; Belser, Caroline; Besnard-Gonnet, Marielle; Bartol-Mavel, Delphine; Boutard, Magali; Briez-Silla, Stéphanie; Combette, Stephane; Dufossé-Laurent, Virginie; Ferron, Carolyne; Lechaplais, Christophe; Louesse, Claudine; Muselet, Delphine; Magdelenat, Ghislaine; Pateau, Emilie; Petit, Emmanuelle; Sirvain-Trukniewicz, Peggy; Trybou, Arnaud; Vega-Czarny, Nathalie; Bataille, Elodie; Bluet, Elodie; Bordelais, Isabelle; Dubois, Maria; Dumont, Corinne; Guérin, Thomas; Haffray, Sébastien; Hammadi, Rachid; Muanga, Jacqueline; Pellouin, Virginie; Robert, Dominique; Wunderle, Edith; Gauguet, Gilbert; Roy, Alice; Sainte-Marthe, Laurent; Verdier, Jean; Verdier-Discala, Claude; Hillier, LaDeana; Fulton, Lucinda; McPherson, John; Matsuda, Fumihiko; Wilson, Richard; Scarpelli, Claude; Gyapay, Gábor; Wincker, Patrick; Saurin, William; Quétier, Francis; Waterston, Robert; Hood, Leroy; Weissenbach, Jean

    2003-02-01

    Chromosome 14 is one of five acrocentric chromosomes in the human genome. These chromosomes are characterized by a heterochromatic short arm that contains essentially ribosomal RNA genes, and a euchromatic long arm in which most, if not all, of the protein-coding genes are located. The finished sequence of human chromosome 14 comprises 87,410,661 base pairs, representing 100% of its euchromatic portion, in a single continuous segment covering the entire long arm with no gaps. Two loci of crucial importance for the immune system, as well as more than 60 disease genes, have been localized so far on chromosome 14. We identified 1,050 genes and gene fragments, and 393 pseudogenes. On the basis of comparisons with other vertebrate genomes, we estimate that more than 96% of the chromosome 14 genes have been annotated. From an analysis of the CpG island occurrences, we estimate that 70% of these annotated genes are complete at their 5' end. PMID:12508121

  15. A transcription map of the regions surrounding the CSF1R locus on human chromosome 5q31: Candidate genes for diastrophic dysplasia

    SciTech Connect

    Clines, G.; Lovett, M.

    1994-09-01

    Diastrophic dysplasia (DTD) is an autosomal recessive disorder of unknown pathogenesis that is characterized by abnormal skeletal and cartilage growth. Phenotypic characteristics of the disorder include short stature, scoliosis, and deformation of the first metacarpal. The diastrophic dysplasia gene has been localized to chromosome 5q31-33, within {approximately}60 kb of the colony stimulating factor 1 receptor gene (CSF1R). We have used direct cDNA selection to build a transcription map across {approximately}250 kb surrounding and including the CSF1R locus. cDNA pools from human placenta, activated T cells, cerebellum, Hela cells, fetal brain, chondrocytes, chondrosarcomas and osteosarcomas were multiplexed in these selections. After two rounds of selection, an analysis revealed that {approximately}70% of the selected cDNAs were contained within the contig. DNA sequencing and cosmid mapping data from a collection of 310 clones revealed the presence of three new genes in this region that show no appreciable homologies on sequence database searches, as well as cDNA clones from the CSF1R and the PDGFRB loci (another of the known genes in the region). An additional cDNA was found with 100% homology to the gene encoding human ribosomal protein L7 (RPL7). This cDNA comprised {approximately}25% of all selected clones. However, further analysis of the genomic contig revealed the presence of an RPL7 processed pseudogene in very close proximity to the CSF1R and PDGFRB genes. The selection of processed pseudogenes is one previously anticipated artifact of selection metholodolgies, but has not been previously observed. Mutational analysis of the three new genes is underway in diastrophic dysplasia families, as is derivation of full length cDNA clones and the expansion of this detailed transcription map into a larger genomic contig.

  16. Effects of cellular differentiation, chromosomal integration and 5-aza-2'-deoxycytidine treatment on human papillomavirus-16 DNA methylation in cultured cell lines.

    PubMed

    Kalantari, Mina; Lee, Denis; Calleja-Macias, Itzel E; Lambert, Paul F; Bernard, Hans-Ulrich

    2008-05-10

    Human papillomavirus-16 (HPV-16) genomes in cell culture and in situ are affected by polymorphic methylation patterns, which can repress the viral transcription. In order to understand some of the underlying mechanisms, we investigated changes of the methylation of HPV-16 DNA in cell cultures in response to cellular differentiation, to recombination with cellular DNA, and to an inhibitor of methylation. Undifferentiated W12E cells, derived from a precancerous lesion, contained extrachromosomal HPV-16 DNA with a sporadically methylated enhancer-promoter segment. Upon W12E cell differentiation, the viral DNA was demethylated, suggesting a link between differentiation and the epigenetic state of HPV-16 DNA. The viral genomes present in two W12I clones, in which individual copies of the HPV-16 genome have integrated into cellular DNA (type 1 integrants), were unmethylated, akin to that seen in the cervical carcinoma cell line SiHa (also a type 1 integrant). This finding is consistent with hypomethylation being necessary for continued viral gene expression. In contrast, two of three type 2 integrant W12I clones, containing concatemers of HPV-16 genomes integrated into the cellular DNA contained hypermethylated viral DNA, as observed in the cervical carcinoma cell line CaSki (also a type 2 integrant). A third, type 2, W12I clone, interestingly with fewer copies of the viral genome, contained unmethylated HPV-16 genomes. Epithelial differentiation of W12I clones did not lead to demethylation of chromosomally integrated viral genomes as was seen for extrachromosomal HPV-16 DNA in W12E clones. Hypomethylation of CaSki cells in the presence of the DNA methylation inhibitor 5-aza-2'-deoxycytidine reduced the cellular viability, possibly as a consequence of toxic effects of an excess of HPV-16 gene products. Our data support a model wherein (i) the DNA methylation state of extrachromosomal HPV16 replicons and epithelial differentiation are inversely coupled during the viral

  17. Radiation-induced chromosomal instability in human mammary epithelial cells

    NASA Astrophysics Data System (ADS)

    Durante, M.; Grossi, G. F.; Yang, T. C.

    Karyotypes of human cells surviving X- and alpha-irradiation have been studied. Human mammary epithelial cells of the immortal, non-tumorigenic cell line H184B5 F5-1 M/10 were irradiated and surviving clones isolated and expanded in culture. Cytogenetic analysis was performed using dedicated software with an image analyzer. We have found that both high- and low-LET radiation induced chromosomal instability in long-term cultures, but with different characteristics. Complex chromosomal rearrangements were observed after X-rays, while chromosome loss predominated after alpha-particles. Deletions were observed in both cases. In clones derived from cells exposed to alpha-particles, some cells showed extensive chromosome breaking and double minutes. Genomic instability was correlated to delayed reproductive death and neoplastic transformation. These results indicate that chromosomal instability is a radiation-quality-dependent effect which could determine late genetic effects, and should therefore be carefully considered in the evaluation of risk for space missions.

  18. Radiation-induced chromosomal instability in human mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Durante, M.; Grossi, G. F.; Yang, T. C.

    1996-01-01

    Karyotypes of human cells surviving X- and alpha-irradiation have been studied. Human mammary epithelial cells of the immortal, non-tumorigenic cell line H184B5 F5-1 M/10 were irradiated and surviving clones isolated and expanded in culture. Cytogenetic analysis was performed using dedicated software with an image analyzer. We have found that both high- and low-LET radiation induced chromosomal instability in long-term cultures, but with different characteristics. Complex chromosomal rearrangements were observed after X-rays, while chromosome loss predominated after alpha-particles. Deletions were observed in both cases. In clones derived from cells exposed to alpha-particles, some cells showed extensive chromosome breaking and double minutes. Genomic instability was correlated to delayed reproductive death and neoplastic transformation. These results indicate that chromosomal instability is a radiation-quality-dependent effect which could determine late genetic effects, and should therefore be carefully considered in the evaluation of risk for space missions.

  19. Molecular genetics of the human X chromosome.

    PubMed Central

    Davies, K E

    1985-01-01

    The human X chromosome will soon be mapped at 10 cM intervals. This will permit the localisation of any X linked disorder provided that informative families are available for linkage analysis. The location of RFLPs currently in use for clinical diagnosis is summarised. The next decade should witness the elucidation of the molecular basis of some of the more common defects, such as the muscular dystrophies and X linked mental retardation. PMID:2995673

  20. OCTOBASE: ACEDB implementation of human chromosome 8

    SciTech Connect

    Wood, S.; Durbin, R.; Ritter, O.

    1994-09-01

    ACEDB, A C. elegans Database is a generalized genome database that was originally written to meet the needs of the C. elegans community. Additions and refinements to the original database are continually being made. Documentation, code and data available from anonymous FTP servers at lirmm, lirmm.fr, cele,mrc-lmb,cam.ac.uk and ncbi.nim.nih.gov. ACEDB can be used to create new databases without the need for reprogramming, and has been implemented for a number of different species as well as several human chromosomes. It displays data through a graphical interface in a manner that closely resembles the way that geneticists model their data. We have chosen to name the chromosome 8 database that relies upon the ACEDB implementation OCTOBASE. This database allows the user to view the chromosome at all levels from the cytogenetic ideogram to the DNA sequence. Besides allowing displays that span several orders of magnitude, the database will also allow simultaneously display of several types of genetic map, such as the linkage, STS content and physical map. The database also provides an excellent tool for the entry of routine laboratory data as it is collected. The gridded clone display is particularly useful for data entry. Since the database is generalized it can also be custom modified to meet the needs of individual users. Overall OCTOBASE meets the needs of the community for entry of the large amounts for data that are now being collected for chromosome 8.

  1. Engineering targeted chromosomal amplifications in human breast epithelial cells.

    PubMed

    Springer, Simeon; Yi, Kyung H; Park, Jeenah; Rajpurohit, Anandita; Price, Amanda J; Lauring, Josh

    2015-07-01

    Chromosomal amplifications are among the most common genetic alterations found in human cancers. However, experimental systems to study the processes that lead to specific, recurrent amplification events in human cancers are lacking. Moreover, some common amplifications, such as that at 8p11-12 in breast cancer, harbor multiple driver oncogenes, which are poorly modeled by conventional overexpression approaches. We sought to develop an experimental system to model recurrent chromosomal amplification events in human cell lines. Our strategy is to use homologous-recombination-mediated gene targeting to deliver a dominantly selectable, amplifiable marker to a specified chromosomal location. We used adeno-associated virus vectors to target human MCF-7 breast cancer cells at the ZNF703 locus, in the recurrent 8p11-12 amplicon, using the E. coli inosine monophosphate dehydrogenase (IMPDH) enzyme as a marker. We applied selective pressure using IMPDH inhibitors. Surviving clones were found to have increased copy number of ZNF703 (average 2.5-fold increase) by droplet digital PCR and FISH. Genome-wide array comparative genomic hybridization confirmed that amplifications had occurred on the short arm of chromosome 8, without changes on 8q or other chromosomes. Patterns of amplification were variable and similar to those seen in primary human breast cancers, including "sawtooth" patterns, distal copy number loss, and large continuous regions of copy number gain. This system will allow study of the cis- and trans-acting factors that are permissive for chromosomal amplification and provide a model to analyze oncogene cooperativity in amplifications harboring multiple candidate driver genes.

  2. Syntenic conservation between humans and cattle. I. Human chromosome 9.

    PubMed

    Threadgill, D W; Womack, J E

    1990-09-01

    Bovine X hamster hybrid somatic cells have been used to investigate the syntenic relationship of nine loci in the bovine that have homologous loci on human chromosome 9. Six loci, ALDH1, ALDOB, C5, GGTB2, GSN, and ITIL, were assigned to the previously identified bovine syntenic group U18 represented by ACO1, whereas the other three loci, ABL, ASS, and GRP78, mapped to a new, previously unidentified autosomal syntenic group. Additionally, a secondary locus, ABLL, which cross-hybridized with the ABL probe, was mapped to bovine syntenic group U1 with the HSA 1 loci PGD and ENO1. The results predict that ACO1 will map proximal to ALDH1; GRP78 distal to ITIL and C5; GSN proximal to AK1, ABL, and ASS on HSA 9; GRP78 to MMU 2; and ITIL and GSN to MMU 4. PMID:2081596

  3. Chromosome abnormalities in human arrested preimplantation embryos: A multiple-probe FISH study

    SciTech Connect

    Munne, S.; Grifo, J.; Cohen, J. ); Weier, H.U.G. )

    1994-07-01

    Numerical chromosome abnormalities were studied in single blastomeres from arrested or otherwise morphologically abnormal human preimplantation embryos. A 6-h FISH procedure with fluorochrome-labeled DNA probes was developed to determine numerical abnormalities of chromosomes X, Y, and 18. The three chromosomes were stained and detected simultaneously in 571 blastomeres from 131 embryos. Successful analysis including biopsy, fixation, and FISH analysis was achieved in 86.5% of all blastomeres. The procedure described here offers a reliable alternative to sexing of embryos by PCR and allows simultaneous ploidy assessment. For the three chromosomes tested, numerical aberrations were found in 56.5% of the embroys. Most abnormal embryos were polyploid or mosaics, and 6.1% were aneuploid for gonosomes or chromosome 18. Extrapolation of these results to all human chromosomes suggests that the majority of abnormally developing and arrested human embryos carry numerical chromosome abnormalities. 44 refs., 1 fig., 4 tabs.

  4. Mapping of the Gene for the Human Telomerase Reverse Transcriptase, hTERT, to Chromosome 5p15.33 by Fluorescence in Situ Hybridization1

    PubMed Central

    Bryce, Lisa A; Morrison, Norma; Hoare, Stacey F; Muir, Sharon; Keith, W Nicol

    2000-01-01

    Abstract Telomerase, the enzyme that maintains the ends of chromosomes, is absent from the majority of somatic cells but is present and active in most tumours. The gene for the reverse transcriptase component of telomerase (hTERT) has recently been identified. A cDNA clone of this gene was used as a probe to identify three genomic bacterial artificial chromosome (BAC) clones, one of which was used as a probe to map hTERT by fluorescence in situ hybridization (FISH) to chromosome 5p15.33. This BAC probe was further used to look at copy number of the hTERT region in immortal cell lines. We found that 10/15 immortal cell lines had a modal copy number of 3 or more per cell, with one cell line (CaSki) having a modal copy number of 11. This suggests that increases in copy number of the hTERT gene region do occur, and may well be one route to upregulating telomerase levels in tumour cells. 5p15 gains and amplifications have been documented for various tumour types, including non-small cell lung carcinoma, squamous cell carcinoma of head and neck, and uterine cervix cancer, making hTERT a potential target. PMID:10935505

  5. Assignment of human {alpha}-synuclein (SNCA) and {beta}-synuclein (SNCB) genes to chromosomes 4q21 and 5q35

    SciTech Connect

    Spillantini, M.G.; Goedert, M.; Divane, A.

    1995-05-20

    The authors previously identified two human brain proteins of 140 and 134 amino acids by virtue of their reactivity with a monoclonal antibody raised against a tangle preparation from Alzheimer disease brain. The 140-amino-acid protein is homologous to synuclein from Torpedo electroplaques and rat brain and identical to the precursor of the non-A{beta} component of Alzheimer disease amyloid plaques. The 134-amino-acid protein is homologous to bovine phosphoneuroprotein 14. In view fo the fact that both proteins are 61% identical in sequence, they have called them {alpha}-synuclein and {beta}-synuclein, respectively. Both proteins are present in nerve terminals, where they may be involved in the events mediating exocytosis of synaptic vesicles following nerve stimulation. They have now determined the chromosomal localizations of the {alpha}-synuclein and {beta}-synuclein genes. To map the two genes analyzed a panel of monochromosomal human-rodent somatic cell hybride by polymerase chain reaction and performed fluorescence in situ hybridization on metaphase spreads f human chromosomes.

  6. Chromosomal localization of the human fibromodulin gene

    SciTech Connect

    Roughley, P.J.; Sztrolovics, R.; Grover, J.

    1994-09-01

    The identification and mapping of genes is a fundamental step in understanding inherited diseases. This study reports the chromosomal localization of the human gene encoding fibromodulin, a collagen-binding proteoglycan which exhibits a wide distribution in connective tissue extracellular matrices. Attempts to localize the gene utilizing a probe covering the published coding region of the human fibromodulin cDNA were unsuccessful. Thus, in order to obtain an alternate probe, the 3{prime}-untranslated region of the cDNA was cloned utilizing the 3{prime}-RACE protocol. Southern blot analysis of human genomic DNA with probes covering either the coding sequence or the 3{prime}-untranslated region revealed simple patterns, indicative of a single-copy gene. Fluorescence in situ hybridization analysis with the 3{prime}-untranslated region probe resulted in hybridization at two chromosomal regions. The majority of signals were observed at 1q32, but some signals were also observed at 9q34.1. The localization of the fibromodulin gene to chromosome 1 was confirmed by the polymerase chain reaction analysis of genomic DNA from a panel of somatic cell hybrid lines. In addition to allowing the gene localization, cloning of the 3{prime}-untranslated region demonstrates that the human fibromodulin cDNA possesses an insert of approximately 160 base pairs which is not present in the published bovine sequence. The human sequence also possesses a single polyadenylation signal, yielding a 3 kb mRNA which was observed in Northern blotting experiments. These results now provide the necessary information to evaluate the potential role of fibromodulin in genetic disorders of connective tissues.

  7. Two-dimensional electrophoretic mobility shift assay: identification and mapping of transcription factor CTCF target sequences within an FXYD5-COX7A1 region of human chromosome 19.

    PubMed

    Vetchinova, Anna S; Akopov, Sergey B; Chernov, Igor P; Nikolaev, Lev G; Sverdlov, Eugene D

    2006-07-01

    An approach for fast identification and mapping of transcription factor binding sites within long genomic sequences is proposed. Using this approach, 10 CCCTC-binding factor (CTCF) binding sites were identified within a 1-Mb FXYD5-COX7A1 human chromosome 19 region. In vivo binding of CTCF to these sites was verified by chromatin immunoprecipitation assay. CTCF binding sites were mapped within gene introns and intergenic regions, and some of them contained Alu-like repeated elements. PMID:16701069

  8. Mapping genes on human chromosome 20

    SciTech Connect

    Keith, T.; Phipps, P.; Serino, K.

    1994-09-01

    While a substantial number of genes have been physically localized to human chromosome 20, few have been genetically mapped. In the process of developing a genetic linkage map of chromosome 20, we have mapped microsatellite polymorphisms associated with six genes. Three of these had highly informative polymorphisms (greater than 0.70) that were originally identified by other investigators. These include avian sarcoma oncogene homolog (SRC), ribophorin II (RPN2), and phosphoenolpyruvate carboxykinase (PCK1). Polymorphisms associated with two genes were determined following a screen of their DNA sequences in GenBank. These include dinucleotide polymorphisms in introl II of cystatin c (CST3) and in the promoter region of neuroendocrine convertase 2 (NEC2) with heterozygosities of 0.52 and 0.54, respectively. A sixth gene, prodynorphin (PDYN) was mapped following the identification of a dinucleotide repeat polymorphism (heterozygosity of 0.35) in a cosmid subclone from a YAC homologous to the original phage clone. CA-positive cosmid subclones from a YAC for an additional gene, guanine nucleotide binding protein, alpha (GNAS10), have been identified and sequencing is in progress. Similar efforts were utilized to identify a microsatellite polymorphism from a half-YAC cloned by W. Brown and localized by FISH to 20pter. This polymorphism is highly informative, with a heterozygosity of 0.83, and serves to delimit the genetic map of the short arm of this chromosome.

  9. Assignment of the human fast skeletal troponin T gene (TNNT3) to chromosome 11p15.5: Evidence for the presence of 11pter in a monochromosome 9 somatic cell hybrid in NIGMS mapping panel 2

    SciTech Connect

    Mao, Chengjian; Jha, P.K.; Sarkar, S.

    1996-02-01

    Human fast skeletal troponin T (TnT{sub f}), the tropomyosin binding component of the multisubunit troponin complex, plays an important role in the Ca{sup 2+} regulation of striated muscle contraction. Specific primers designed from the 3{prime} end of human TnT{sub f} cDNA were used to amplify an intronic region by polymerase chain reaction (PCR). This TnT{sub f}-specific PCR product was detected from two somatic cell hybrids containing human chromosomes 9 and 11, respectively, in NIGMS mapping panel 2. However, further studies with other somatic hybrid cell lines (Bios Laboratory) localized the TnT{sub f} genomic probe generated by extended PCR, showing the sublocalization of the gene to band p15.5 on chromosome 11. This locus is of specific interest, as Beckwith-Wiedemann syndrome and various childhood and adult tumor-related abnormalities have been mapped to this region. The study also indicates the presence of an 11pter region in the NIGMS cell hybrid GM10611, which has previously been reported to contain only human chromosome 9. 11 refs., 2 figs.

  10. Significance of abnormalities of chromosomes 5 and 8 in chondroblastoma.

    PubMed

    Swarts, S J; Neff, J R; Johansson, S L; Nelson, M; Bridge, J A

    1998-04-01

    Tumor specific chromosomal abnormalities have been identified in several histologic subtypes of benign and malignant bone tumors. These anomalies have proven to be useful diagnostically. Characterization of recurrent chromosomal abnormalities also has provided direction for molecular investigations of pathogenetically important genes. Cytogenetic reports of chondroblastoma, a rare benign bone tumor, are few. Cytogenetic analysis of a benign and a malignant chondroblastoma in this study revealed the following abnormal chromosomal complements: 47,XY,+5,t(5;5)(p10;q10) and 45, XY,del(2)(p23),del(3)(q23q27),dup(8)(q12q21.), del(11) (q14q23), -13, add (17) (q25) x 2, respectively. Although a specific chromosomal abnormality has not yet emerged for chondroblastoma, abnormalities of chromosomes 5 and 8 have been reported previously in this neoplasm, suggesting preferential involvement of these two chromosomes. PMID:9584382

  11. Human structural variation: mechanisms of chromosome rearrangements

    PubMed Central

    Weckselblatt, Brooke; Rudd, M. Katharine

    2015-01-01

    Chromosome structural variation (SV) is a normal part of variation in the human genome, but some classes of SV can cause neurodevelopmental disorders. Analysis of the DNA sequence at SV breakpoints can reveal mutational mechanisms and risk factors for chromosome rearrangement. Large-scale SV breakpoint studies have become possible recently owing to advances in next-generation sequencing (NGS) including whole-genome sequencing (WGS). These findings have shed light on complex forms of SV such as triplications, inverted duplications, insertional translocations, and chromothripsis. Sequence-level breakpoint data resolve SV structure and determine how genes are disrupted, fused, and/or misregulated by breakpoints. Recent improvements in breakpoint sequencing have also revealed non-allelic homologous recombination (NAHR) between paralogous long interspersed nuclear element (LINE) or human endogenous retrovirus (HERV) repeats as a cause of deletions, duplications, and translocations. This review covers the genomic organization of simple and complex constitutional SVs, as well as the molecular mechanisms of their formation. PMID:26209074

  12. Construction and availability of human chromosome-specific gene libraries

    SciTech Connect

    Fuscoe, J.C.; Van Dilla, M.A.; Deaven, L.L.

    1985-06-14

    This report briefly describes Phase I of the project, the production of complete digest fibraries. Each laboratory is currently in the process of sorting individual human chromosomes from normal human fibroblasts or human X hamster hybrids. The goal of 4 x 10/sup 6/ chromosomes for cloning purposes has been achieved. Each laboratory is also in the process of cloning the chromosomal DNA, after complete digestion with a 6-cutter, into the bacteriophage vector Charon 21A. 3 refs.

  13. The DNA sequence and biological annotation of human chromosome 1.

    PubMed

    Gregory, S G; Barlow, K F; McLay, K E; Kaul, R; Swarbreck, D; Dunham, A; Scott, C E; Howe, K L; Woodfine, K; Spencer, C C A; Jones, M C; Gillson, C; Searle, S; Zhou, Y; Kokocinski, F; McDonald, L; Evans, R; Phillips, K; Atkinson, A; Cooper, R; Jones, C; Hall, R E; Andrews, T D; Lloyd, C; Ainscough, R; Almeida, J P; Ambrose, K D; Anderson, F; Andrew, R W; Ashwell, R I S; Aubin, K; Babbage, A K; Bagguley, C L; Bailey, J; Beasley, H; Bethel, G; Bird, C P; Bray-Allen, S; Brown, J Y; Brown, A J; Buckley, D; Burton, J; Bye, J; Carder, C; Chapman, J C; Clark, S Y; Clarke, G; Clee, C; Cobley, V; Collier, R E; Corby, N; Coville, G J; Davies, J; Deadman, R; Dunn, M; Earthrowl, M; Ellington, A G; Errington, H; Frankish, A; Frankland, J; French, L; Garner, P; Garnett, J; Gay, L; Ghori, M R J; Gibson, R; Gilby, L M; Gillett, W; Glithero, R J; Grafham, D V; Griffiths, C; Griffiths-Jones, S; Grocock, R; Hammond, S; Harrison, E S I; Hart, E; Haugen, E; Heath, P D; Holmes, S; Holt, K; Howden, P J; Hunt, A R; Hunt, S E; Hunter, G; Isherwood, J; James, R; Johnson, C; Johnson, D; Joy, A; Kay, M; Kershaw, J K; Kibukawa, M; Kimberley, A M; King, A; Knights, A J; Lad, H; Laird, G; Lawlor, S; Leongamornlert, D A; Lloyd, D M; Loveland, J; Lovell, J; Lush, M J; Lyne, R; Martin, S; Mashreghi-Mohammadi, M; Matthews, L; Matthews, N S W; McLaren, S; Milne, S; Mistry, S; Moore, M J F; Nickerson, T; O'Dell, C N; Oliver, K; Palmeiri, A; Palmer, S A; Parker, A; Patel, D; Pearce, A V; Peck, A I; Pelan, S; Phelps, K; Phillimore, B J; Plumb, R; Rajan, J; Raymond, C; Rouse, G; Saenphimmachak, C; Sehra, H K; Sheridan, E; Shownkeen, R; Sims, S; Skuce, C D; Smith, M; Steward, C; Subramanian, S; Sycamore, N; Tracey, A; Tromans, A; Van Helmond, Z; Wall, M; Wallis, J M; White, S; Whitehead, S L; Wilkinson, J E; Willey, D L; Williams, H; Wilming, L; Wray, P W; Wu, Z; Coulson, A; Vaudin, M; Sulston, J E; Durbin, R; Hubbard, T; Wooster, R; Dunham, I; Carter, N P; McVean, G; Ross, M T; Harrow, J; Olson, M V; Beck, S; Rogers, J; Bentley, D R; Banerjee, R; Bryant, S P; Burford, D C; Burrill, W D H; Clegg, S M; Dhami, P; Dovey, O; Faulkner, L M; Gribble, S M; Langford, C F; Pandian, R D; Porter, K M; Prigmore, E

    2006-05-18

    The reference sequence for each human chromosome provides the framework for understanding genome function, variation and evolution. Here we report the finished sequence and biological annotation of human chromosome 1. Chromosome 1 is gene-dense, with 3,141 genes and 991 pseudogenes, and many coding sequences overlap. Rearrangements and mutations of chromosome 1 are prevalent in cancer and many other diseases. Patterns of sequence variation reveal signals of recent selection in specific genes that may contribute to human fitness, and also in regions where no function is evident. Fine-scale recombination occurs in hotspots of varying intensity along the sequence, and is enriched near genes. These and other studies of human biology and disease encoded within chromosome 1 are made possible with the highly accurate annotated sequence, as part of the completed set of chromosome sequences that comprise the reference human genome.

  14. Localization of human somatostatin receptor 5 gene (SSTR5) to chromosome band 16p13.3 by fluorescence in situ hybridization

    SciTech Connect

    Takeda, J.; Fernald, A.A.; Beau, M.L.

    1995-04-10

    Somatostatin is a 14-amino-acid polypeptide that is widely distributed throughout the central nervous system and peripheral tissues. It potently inhibits basal and stimulated secretion from a wide variety of endocrine and exocrine cells and functions as a neurotransmitter/neuromodulator in the central nervous system with effects on locomotor activity and cognitive function. Somatostatin also has antiproliferative effects and may be an important hormonal regulator of cell proliferation and differentiation. Recent studies have shown that the physiological effects of somatostatin are mediated by a family of somatostatin receptors. They are all predicted to be membrane glycoproteins with seven {alpha}-helical membrane-spanning regions and members of the G-protein-coupled receptor superfamily. The receptors have been named, chronologically, sst{sub 1}, sst{sub 2}, and sst{sub 3}. However, the sequence of a fourth subtype was determined simultaneously by two different groups, and sst{sub 4} was assigned to two proteins of different sequence and functional properties. The nomenclature of these two proteins has been resolved, with the sst{sub 4} and the sst{sub 5} receptors denoting the proteins cloned by Bruno et. al. and O`Carroll et. al., respectively. 9 refs., 1 fig.

  15. Mapping of low-frequency chimeric yeast artificial chromosome libraries from human chromosomes 16 and 21 by fluorescence in situ hybridization and quantitative image analysis

    SciTech Connect

    Marrone, B.L.; Campbell, E.W.; Anzick, S.L.; Shera, K.; Campbell, M.; Yoshida, T.M.; McCormick, M.K.; Deaven, L. )

    1994-05-01

    Yeast artificial chromosome (YAC) clones from low-frequency chimeric libraries of human chromosomes 16 and 21 were mapped onto human diploid fibroblast metaphase chromosomes using fluorescence in situ hybridization (FISH) and digital imaging microscopy. YACs mapped onto chromosome 21 were selected to provide subregional location and ordering of known and unknown markers on the long arm of chromosome 21, particularly in the Down syndrome region (q22). YACs mapped onto chromosome 16 were selected to overlap regions spanning chromosome 16 cosmid maps. YAC clones were indirectly labeled with fluorescein, and the total DNA of the chromosome was counterstained with propidium iodide. A single image containing both the FISH signal and the whole chromosome was acquired for each chromosome of interest containing the fluorescent probe signal in a metaphase spread. From the digitized image, the fluorescence intensity profile through the long axis of the chromosome gave the total chromosome length and the probe position. The map position of the probe was expressed as the fractional length (FL) of the total chromosome relative to the end of the short arm (Flpter). From each clone hybridized, 20-40 chromosome images were analyzed. Thirty-eight YACs were mapped onto chromosome 16, and their FLs were distributed along the short and long arms. On chromosome 21, 47 YACs were mapped, including 12 containing known markers. To confirm the order of a dense population of YACs within the Down syndrome region, a two-color mapping strategy was used in which an anonymous YAC was located relative to one or two known markers on the metaphase chromosome. The chromosome FL maps have a 1- to 2-Mb resolution, and the FL measurement of each probe has a typical standard error of 0.5-1 Mb. 14 refs., 3 figs., 3 tabs.

  16. Flow cytometry measurements of human chromosome kinetochore labeling

    SciTech Connect

    Fantes, J.A.; Green, D.K.; Malloy, P.; Sumner, A.T.

    1989-03-01

    A method for the preparation and measurement of immunofluorescent human chromosome centromeres in suspension is described using CREST antibodies, which bind to the centromeric region of chromosomes. Fluorescein isothiocyanate (FITC)-conjugated antihuman antibodies provide the fluorescent label. Labeled chromosomes are examined on microscope slides and by flow cytometry. In both cases a dye which binds to DNA is added to provide identification of the chromosome groups. Sera from different CREST patients vary in their ability to bind to chromosome arms in addition to the centromeric region. Flow cytometry and microfluorimetry measurements have shown that with a given CREST serum the differences in kinetochore fluorescence between chromosomes are only minor. Flow cytometry experiments to relate the number of dicentric chromosomes, induced by in vitro radiation of peripheral blood cells to the slightly increased number of chromosomes with above-average kinetochore fluorescence did not produce decisive radiation dosimetry results.

  17. Origin of human chromosome 2: An ancestral telomere-telomere fusion

    SciTech Connect

    Ijdo, J.W.; Baldini, A.; Ward, D.C.; Reeders, S.T.; Wells, R.A. )

    1991-10-15

    The authors identified two allelic genomic cosmids from human chromosome 2, c8.1 and c29B, each containing two inverted arrays of the vertebrate telomeric repeat in a head-to-head arrangement, 5{prime}(TTAGGG){sub n}-(CCCTAA){sub m}3{prime}. Sequences flanking this telomeric repeat are characteristic of present-day human pretelomeres. BAL-31 nuclease experiments with yeast artificial chromosome clones of human telomeres and fluorescence in situ hybridization reveal that sequences flanking these inverted repeats hybridize both to band 2q13 and to different, but overlapping, subsets of human chromosome ends. They conclude that the locus cloned in cosmids c8.1 and c29B is the relic of an ancient telomere-telomere fusion and marks the point at which two ancestral ape chromosomes fused to give rise to human chromosome 2.

  18. Assignment of human myocyte-specific enhancer binding factor 2C (hMEF2C) to human chromosome 5q14 and evidence that MEF2C is evolutionarily conserved

    SciTech Connect

    Krainc, D.; Lipton, S.A.; Haas, M.; Ward, D.C.

    1995-10-10

    Human myocyte-specific enhancer binding factor 2C (hMEF2C) belongs to the MEF2 subfamily of the MADS (MCM1, AGAMOUS, DEF A, serum response factor) family of transcription factors. Members of the MADS family share a conserved domain - the MADS domain - that is necessary for DNA binding. Highly conserved versions of the MADS domain and of an adjacent domain that is known as the MEF2 domain are found in members of the MEF2 subfamily. Both of these domains are necessary for binding to the MEF2 regulatory element. This regulatory element is known to be functionally important in a variety of muscle-specific genes and possibly in the brain creatine kinase gene. The MEF2C gene product activates transcription by binding to the MEF2 element. hMEF2C is expressed at high levels in postmitotic neurons in the brain, where it is most abundant in the cerebral cortex, and is also expressed in differentiated myotubes. Several lines of evidence suggest the existence of a rat homologue of MEF2C, and a mouse homologue has been cloned. The mouse gene was mapped to mouse chromosome 13 in a region that is syntenic to human 5q13-q15. 12 refs., 1 fig.

  19. Genomics and genetics of human and primate y chromosomes.

    PubMed

    Hughes, Jennifer F; Rozen, Steve

    2012-01-01

    In mammals, the Y chromosome plays the pivotal role in male sex determination and is essential for normal sperm production. Yet only three Y chromosomes have been completely sequenced to date--those of human, chimpanzee, and rhesus macaque. While Y chromosomes are notoriously difficult to sequence owing to their highly repetitive genomic landscapes, these dedicated sequencing efforts have generated tremendous yields in medical, biological, and evolutionary insight. Knowledge of the complex structural organization of the human Y chromosome and a complete catalog of its gene content have provided a deeper understanding of the mechanisms that generate disease-causing mutations and large-scale rearrangements. Variation among human Y-chromosome sequences has been an invaluable tool for understanding relationships among human populations. Comprehensive comparisons of the human Y-chromosome sequence with those of other primates have illuminated aspects of Y-chromosome evolutionary dynamics over much longer timescales (>25 million years compared with 100,000 years). The future sequencing of additional Y chromosomes will provide a basis for a more comprehensive understanding of the evolution of Y chromosomes and their roles in reproductive biology.

  20. The human Y chromosome: function, evolution and disease.

    PubMed

    Quintana-Murci, L; Krausz, C; McElreavey, K

    2001-05-15

    The human Y chromosome is strictly paternally inherited and, in most of its length, does not recombine during male meiosis. These features make the Y a very useful genetic marker for different purposes. In the last decade, the Y has been increasingly used to investigate the evolution, migrations and range expansions of modern humans. The possibility to construct highly informative Y chromosome haplotypes has also had a significant impact in forensic studies and paternity testing. All these studies assume that the Y chromosome markers used are selectively neutral. However, recent experimental and statistical analyses suggest that both positive and negative selection are acting on the Y chromosome and, consequently, may influence Y chromosome haplotype distribution in the general population. Current data suggest that the effects of selection on patterns of Y chromosome distribution are minimal, however as interest focuses on biological functions of the Y chromosome which have a major impact on male fitness such as fertility, these assumptions may be challenged. This review briefly describes the genes and biological functions of the human Y chromosome and its use in disentangling the origin and history of human populations. An overview of the role of selection acting on the Y chromosome from the perspective of human population histories and disease is given.

  1. Regional mapping of loci from human chromosome 2q to sheep chromosome 2q

    SciTech Connect

    Ansari, H.A.; Pearce, P.D.; Maher, D.W.; Malcolm, A.A.; Wood, N.J.; Phua, S.H.; Broad, T.E. )

    1994-03-01

    The human chromosome 2q loci, fibronectin 1 (FN1), the [alpha]1 chain of type III collagen (COL3A1), and the [delta] subunit of the muscle acetylcholine receptor (CHRND) have been regionally assigned to sheep chromosome 2q by in situ hybridization. COL3A1 is pericentromeric (2q12-q21), while FN1 and CHRND are in the subterminal region at 2q41-q44 and 2q42-qter, respectively. The mapping of FN1 assigns the sheep synthenic group U11, which contains FN1, villin 1 (VIL1), isocitrate dehydrogenase 1 (IDH1), and [gamma] subunit of the muscle acetylcholine receptor (CHRNG), to sheep chromosome 2q. Inhibin-[alpha] (INHA) is also assigned to sheep chromosome 2q as FN1 and INHA compose sheep linkage group 3. These seven loci are members of a conserved chromosomal segment in human, mouse, and sheep. 23 refs., 2 figs., 1 tab.

  2. Chromosome Conformation Capture in Primary Human Cells.

    PubMed

    Cortesi, Alice; Bodega, Beatrice

    2016-01-01

    3D organization of the genome, its structural and regulatory function of cell identity, is acquiring prominent features in epigenetics studies; more efforts have been done to develop techniques that allow studying nuclear structure. Chromosome conformation capture (3C) has been set up in 2002 from Dekker and from that moment great investments were made to develop genomics variants of 3C technology (4C, 5C, Hi-C) providing new tools to investigate the shape of the genome in a more systematic and unbiased manner. 3C method allows scientists to fix dynamic and variable 3D interactions in nuclear space, and consequently to study which sequences interact, how a gene is regulated by different and distant enhancer, or how a set of enhancer could regulate transcriptional units; to follow the conformation that mediates regulation change in development; and to evaluate if this fine epigenetic mechanism is impaired in disease condition. PMID:27659988

  3. Assignment of the lactotransferrin gene to human chromosome 3 and to mouse chromosome 9.

    PubMed

    Teng, C T; Pentecost, B T; Marshall, A; Solomon, A; Bowman, B H; Lalley, P A; Naylor, S L

    1987-11-01

    Lactotransferrin (LTF), a member of the transferrin family of genes, is the major iron-binding protein in milk and body secretions. The amino acid sequence of LTF consists of two homologous domains homologous to proteins in the transferrin family. Recent isolation of cDNA encoding mouse LTF has expedited the mapping of both mouse and human LTF genes. Southern blot analysis of DNA from mouse-Chinese hamster and human-mouse somatic cell hybrids maps the LTF gene to mouse chromosome 9 and to human chromosome 3, respectively. Furthermore, analysis of cell hybrids containing defined segments of human chromosome 3 demonstrates that the gene is located in the 3q21-qter region. These results suggest that LTF and associated genes of the transferrin family have existed together on the same chromosomal region for 300-500 million years. PMID:3478818

  4. Non-meiotic chromosome instability in human immature oocytes

    PubMed Central

    Daina, Gemma; Ramos, Laia; Rius, Mariona; Obradors, Albert; del Rey, Javier; Giralt, Magda; Campillo, Mercedes; Velilla, Esther; Pujol, Aïda; Martinez-Pasarell, Olga; Benet, Jordi; Navarro, Joaquima

    2014-01-01

    Aneuploidy has been a major issue in human gametes and is closely related to fertility problems, as it is known to be present in cleavage stage embryos and gestational losses. Pre-meiotic chromosome abnormalities in women have been previously described. The aim of this study is to assess the whole-chromosome complement in immature oocytes to find those abnormalities caused by mitotic instability. For this purpose, a total of 157 oocytes at the germinal vesicle or metaphase I stage, and discarded from IVF cycles, were analysed by CGH. Fifty-six women, between 18 and 45 years old (mean 32.5 years), including 32 IVF patients (25–45 years of age) and 24 IVF oocyte donors (18–33 years of age), were included in the study. A total of 25/157 (15.9%) of the oocytes analysed, obtained from three IVF clinics, contained chromosome abnormalities, including both aneuploidy (24/157) and structural aberrations (9/157). Independently of the maternal age, the incidence of abnormal oocytes which originated before meiosis is 15.9%, and these imbalances were found in 33.9% of the females studied. This work sheds light on the relevance of mitotic instability responsible for the generation of the abnormalities present in human oocytes. PMID:23695274

  5. Roles of the Y chromosome genes in human cancers.

    PubMed

    Kido, Tatsuo; Lau, Yun-Fai Chris

    2015-01-01

    Male and female differ genetically by their respective sex chromosome composition, that is, XY as male and XX as female. Although both X and Y chromosomes evolved from the same ancestor pair of autosomes, the Y chromosome harbors male-specific genes, which play pivotal roles in male sex determination, germ cell differentiation, and masculinization of various tissues. Deletions or translocation of the sex-determining gene, SRY, from the Y chromosome causes disorders of sex development (previously termed as an intersex condition) with dysgenic gonads. Failure of gonadal development results not only in infertility, but also in increased risks of germ cell tumor (GCT), such as gonadoblastoma and various types of testicular GCT. Recent studies demonstrate that either loss of Y chromosome or ectopic expression of Y chromosome genes is closely associated with various male-biased diseases, including selected somatic cancers. These observations suggest that the Y-linked genes are involved in male health and diseases in more frequently than expected. Although only a small number of protein-coding genes are present in the male-specific region of Y chromosome, the impacts of Y chromosome genes on human diseases are still largely unknown, due to lack of in vivo models and differences between the Y chromosomes of human and rodents. In this review, we highlight the involvement of selected Y chromosome genes in cancer development in men.

  6. Genome annotation of a 1.5 Mb region of human chromosome 6q23 encompassing a quantitative trait locus for fetal hemoglobin expression in adults

    PubMed Central

    Close, James; Game, Laurence; Clark, Barnaby; Bergounioux, Jean; Gerovassili, Ageliki; Thein, Swee Lay

    2004-01-01

    Background Heterocellular hereditary persistence of fetal hemoglobin (HPFH) is a common multifactorial trait characterized by a modest increase of fetal hemoglobin levels in adults. We previously localized a Quantitative Trait Locus for HPFH in an extensive Asian-Indian kindred to chromosome 6q23. As part of the strategy of positional cloning and a means towards identification of the specific genetic alteration in this family, a thorough annotation of the candidate interval based on a strategy of in silico / wet biology approach with comparative genomics was conducted. Results The ~1.5 Mb candidate region was shown to contain five protein-coding genes. We discovered a very large uncharacterized gene containing WD40 and SH3 domains (AHI1), and extended the annotation of four previously characterized genes (MYB, ALDH8A1, HBS1L and PDE7B). We also identified several genes that do not appear to be protein coding, and generated 17 kb of novel transcript sequence data from re-sequencing 97 EST clones. Conclusion Detailed and thorough annotation of this 1.5 Mb interval in 6q confirms a high level of aberrant transcripts in testicular tissue. The candidate interval was shown to exhibit an extraordinary level of alternate splicing – 19 transcripts were identified for the 5 protein coding genes, but it appears that a significant portion (14/19) of these alternate transcripts did not have an open reading frame, hence their functional role is questionable. These transcripts may result from aberrant rather than regulated splicing. PMID:15169551

  7. The human decorin gene: Intron-exon organization, discovery of two alternatively spliced exons in the 5[prime] untralsated region, and mapping of the gene to chromosome 12q23

    SciTech Connect

    Danielson, K.G.; Fazzio, A.; Cohen, I.; Cannizzaro, L.A.; Eichstetter, I.; Iozzo, R.V. )

    1993-01-01

    Decorin is a chondroitin/dermatan sulfate proteoglycan expressed by most vascular and avascular connective tissues and, because of its ability to interact with collagen and growth factors, has been implicated in the control of matrix assembly and cellular growth. To understand the molecular mechanisms involved in regulating its tissue expression, we have isolated a number of genomic clones encoding the complete decorin gene. The human decorin gene spans over 38 kb of continuous DNA sequence and contains eight exons and very large introns, two of which are 5.4 and > 13.2 kb. We have discovered two alternatively spliced leader exons, exons Ia and Ib, in the 5[prime] untranslated region. These exons were identified by cloning and sequencing cDNAs obtained by polymerase chain reaction amplification of a fibroblast cDNA library. Using Northern blotting or reverse transcriptase PCR, we detected the two leader exons in a variety of mRNAs isolated from human cell lines and tissues. Interestingly, sequences highly (74-87%) homologous to exons Ia and lb are found in the 5[prime]untranslated region of avian and bovine decorin, respectively. This high degree of conservation among species suggests regulatory functions for these leader exons. In the 3' untranslated region there are several polyadenylation sites, and at least two of these sites could give rise to the transcripts of [approx]1.6 and [approx]1.9 kb, typically detected in a variety of tissues and cells. Using a genomic clone as the labeled probe and in situ hybridization of human metaphase chromosomes, we have mapped the decorin gene to the discrete region of human chromosome 12q23. This sturdy provides the molecular basis for discerning the transcriptional control of the decorin gene and offers the opportunity to investigate genetic disorders linked to this important human gene. 57 refs., 11 figs., 3 tabs.

  8. Hierarchical radial and polar organisation of chromosomes in human sperm.

    PubMed

    Millan, N M; Lau, P; Hann, M; Ioannou, D; Hoffman, D; Barrionuevo, M; Maxson, W; Ory, S; Tempest, H G

    2012-10-01

    It is well established that chromosomes occupy distinct positions within the interphase nuclei, conferring a potential functional implication to the genome. In addition, alterations in the nuclear organisation patterns have been associated with disease phenotypes (e.g. cancer or laminopathies). The human sperm is the smallest cell in the body with specific DNA packaging and the mission of delivering the paternal genome to the oocyte during fertilisation. Studies of nuclear organisation in the sperm have postulated nonrandom chromosome position and have proposed a chromocentre model with the centromeres facing toward the interior and the telomeres toward the periphery of the nucleus. Most studies have assessed the nuclear address in the sperm longitudinally predominantly using centromeric or telomeric probes and to a lesser extent with whole chromosome paints. To date, studies investigating the radial organisation of human sperm have been limited. The purpose of this study was to utilise whole chromosome paints for six clinically important chromosomes (18, 19, 21, 22, X, and Y) to investigate nuclear address by assessing their radial and longitudinal nuclear organisation. A total of 10,800 sperm were analysed in nine normozoospermic individuals. The results have shown nonrandom chromosome position for all chromosomes using both methods of analysis. We present novel radial and polar analysis of chromosome territory localization within the human sperm nucleus. Specifically, a hierarchical organisation was observed radially with chromosomes organised from the interior to the periphery (chromosomes 22, 21, Y, X, 19, and 18 respectively) and polar organisation from the sperm head to tail (chromosomes X, 19, Y, 22, 21, and 18, respectively). We provide evidence of defined nuclear organisation in the human sperm and discuss the function of organisation and potential possible clinical ramifications of these results in regards to male infertility and early human development

  9. Conserved synteny between pig chromosome 8 and human chromosome 4 but rearranged and distorted linkage maps

    SciTech Connect

    Ellegren, H.; Edfors-Lilja, I.; Anderson, L. ); Wintero, A.K. )

    1993-09-01

    The porcine genes encoding interleukin 2, alcohol dehydrogenase (class I) gamma polypeptide, and osteopontin were mapped to chromosome 8 by linkage analysis. Together with previous assignments to this chromosome (the albumin, platelet-derived growth factor receptor A, and fibrinogen genes), an extensive syntenic homology with human chromosome 4 was discovered. Loci from about three-quarters of the q arm of human chromosome 4 are on pig chromosome 8. However, the linear order of the markers is not identical in the two species, and there are several examples of interspecific differences in the recombination fractions between adjacent markers. The conserved synteny between man and the pig gives strong support to a previous suggestion that a synteny group present in the ancestor of mammalian species has been retained on human chromosome 4q. Since loci from this synteny group are found on two cattle chromosomes, the bovine rearrangement must have occurred after the split of Suidae and Bovidae within Artiodactyla. 29 refs., 3 figs., 1 tab.

  10. Deficit of mitonuclear genes on the human X chromosome predates sex chromosome formation.

    PubMed

    Dean, Rebecca; Zimmer, Fabian; Mank, Judith E

    2015-02-01

    Two taxa studied to date, the therian mammals and Caenorhabditis elegans, display underrepresentations of mitonuclear genes (mt-N genes, nuclear genes whose products are imported to and act within the mitochondria) on their X chromosomes. This pattern has been interpreted as the result of sexual conflict driving mt-N genes off of the X chromosome. However, studies in several other species have failed to detect a convergent biased distribution of sex-linked mt-N genes, leading to questions over the generality of the role of sexual conflict in shaping the distribution of mt-N genes. Here we tested whether mt-N genes moved off of the therian X chromosome following sex chromosome formation, consistent with the role of sexual conflict, or whether the paucity of mt-N genes on the therian X is a chance result of an underrepresentation on the ancestral regions that formed the X chromosome. We used a synteny-based approach to identify the ancestral regions in the platypus and chicken genomes that later formed the therian X chromosome. We then quantified the movement of mt-N genes on and off of the X chromosome and the distribution of mt-N genes on the human X and ancestral X regions. We failed to find an excess of mt-N gene movement off of the X. The bias of mt-N genes on ancestral therian X chromosomes was also not significantly different from the biases on the human X. Together our results suggest that, rather than conflict driving mt-N genes off of the mammalian X, random biases on chromosomes that formed the X chromosome could explain the paucity of mt-N genes in the therian lineage.

  11. Deficit of mitonuclear genes on the human X chromosome predates sex chromosome formation.

    PubMed

    Dean, Rebecca; Zimmer, Fabian; Mank, Judith E

    2015-02-01

    Two taxa studied to date, the therian mammals and Caenorhabditis elegans, display underrepresentations of mitonuclear genes (mt-N genes, nuclear genes whose products are imported to and act within the mitochondria) on their X chromosomes. This pattern has been interpreted as the result of sexual conflict driving mt-N genes off of the X chromosome. However, studies in several other species have failed to detect a convergent biased distribution of sex-linked mt-N genes, leading to questions over the generality of the role of sexual conflict in shaping the distribution of mt-N genes. Here we tested whether mt-N genes moved off of the therian X chromosome following sex chromosome formation, consistent with the role of sexual conflict, or whether the paucity of mt-N genes on the therian X is a chance result of an underrepresentation on the ancestral regions that formed the X chromosome. We used a synteny-based approach to identify the ancestral regions in the platypus and chicken genomes that later formed the therian X chromosome. We then quantified the movement of mt-N genes on and off of the X chromosome and the distribution of mt-N genes on the human X and ancestral X regions. We failed to find an excess of mt-N gene movement off of the X. The bias of mt-N genes on ancestral therian X chromosomes was also not significantly different from the biases on the human X. Together our results suggest that, rather than conflict driving mt-N genes off of the mammalian X, random biases on chromosomes that formed the X chromosome could explain the paucity of mt-N genes in the therian lineage. PMID:25637223

  12. Chromosome aberrations in human blood lymphocytes exposed to energetic protons

    NASA Astrophysics Data System (ADS)

    Hada, Megumi; George, Ms Kerry; Cucinotta, Francis A.

    During space flight, astronauts are exposed to space radiation consisting of high-energy protons, high charge and energy (HZE) nuclei, as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary particles have a higher LET value than primary protons and are therefore expected to have a higher relative biological effectiveness (RBE). To investigate this theory, we exposed human peripheral blood lymphocytes to protons with energies of 250 MeV, 800MeV, 2 GeV, or 2.5 GeV. LET values for these protons ranged from 0.4 to 0.2 keV/µm. and doses ranged from 0.2 to 3 Gy. Over this energy range the probability of nuclear reaction leading to secondary radiation, and the multiplicity of reaction products such as neutrons and mesons increases substantially. The effect of aluminum and polyethylene shielding was also assessed using the 2 GeV and 2.5GeV proton beams. After exposure lymphocytes were stimulated to divide and chromosomes were collected from cells in the first G2 and metaphase cell cycle after exposure using a chemical induced premature chromosome condensation (PCC) technique. Dose response data for chromosome damage was analyzed using the fluorescence in situ hybridization (FISH) chromosome painting technique. Selected samples were also analyzed with multicolor FISH (mFISH) and multicolor banding FISH (mBAND) techniques. Data indicates that the dose response for simple-type exchanges is similar for proton and gamma exposure, whereas protons induce higher yields of complex exchanges that are energy dependent. RBE values will be presented for each proton energy, and the effects of shielding and possible cytogenetic signatures of proton exposure will be discussed.

  13. Chromosome Aberration in Human Blood Lymphocytes Exposed to Energetic Protons

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, Kerry A.; Cucinotta, F. A.

    2008-01-01

    During space flight, astronauts are exposed to a space radiation consisting of high-energy protons, high charge and energy (HZE) nuclei, as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary particles have a higher LET value than primary protons and therefore expected to have a higher relative biological effectiveness (RBE). To investigate this theory, we exposed human peripheral blood lymphocytes to protons with energies of 250 MeV, 800MeV, 2 GeV, or 2.5 GeV. LET values for these protons ranged from 0.4 to 0.2 keV/micrometer. and doses ranged from 0.2 to 3 Gy. Over this energy the probability of nuclear reaction leading to secondary radiation, and the multiplicity of reaction produces such as neutrons and mesons increases substantially. The effect of aluminum and polyethylene shielding was also assessed using the 2 GeV and 2.5GeV proton beams. After exposure lymphocytes were stimulated to divide and chromosomes were collected from cells in the first G2 and metaphase cell cycle after exposure using a chemical induced premature chromosome condensation (PCC) technique. Dose response data for chromosome damage was analyzed using the fluorescence in situ hybridization (FISH) chromosome painting technique. Selected samples were also analyzed with multicolor FISH (mFISH) and multicolor banding FISH (mBAND) techniques. Data indicates that the dose response for simple-type exchanges is similar for proton and gamma exposure, whereas protons induce higher yields of complex exchanges that are LET dependent. RBE values will be presented for each proton energy, and the effects of shielding and possible cytogenetic signatures of proton exposure will be discussed.

  14. Correlation of physical and genetic maps of human chromosome 16

    SciTech Connect

    Sutherland, G.R.

    1991-01-01

    This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentially 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.

  15. Spectral karyotyping analysis of human and mouse chromosomes

    PubMed Central

    Padilla-Nash, Hesed M; Barenboim-Stapleton, Linda; Difilippantonio, Michael J; Ried, Thomas

    2016-01-01

    Classical banding methods provide basic information about the identities and structures of chromosomes on the basis of their unique banding patterns. Spectral karyotyping (SKY), and the related multiplex fluorescence in situ hybridization (M-FISH), are chromosome-specific multicolor FISH techniques that augment cytogenetic evaluations of malignant disease by providing additional information and improved characterization of aberrant chromosomes that contain DNA sequences not identifiable using conventional banding methods. SKY is based on cohybridization of combinatorially labeled chromosome-painting probes with unique fluorochrome signatures onto human or mouse metaphase chromosome preparations. Image acquisition and analysis use a specialized imaging system, combining Sagnac interferometer and CCD camera images to reconstruct spectral information at each pixel. Here we present a protocol for SKY analysis using commercially available SkyPaint probes, including procedures for metaphase chromosome preparation, slide pretreatment and probe hybridization and detection. SKY analysis requires approximately 6 d. PMID:17406576

  16. Human chromosomes 6 and 21 are required for sensitivity to human interferon. gamma

    SciTech Connect

    Jung, V.; Rashidbaigi, A.; Jones, C.; Tischfield, J.A.; Shows, T.B.; Pestka, S.

    1987-06-01

    The human interferon ..gamma.. receptor has previously been assigned to chromosome 6. Chromosome 6 also encodes HLA, the human class I major histocompatibility antigens. However, the presence of chromosome 6 in hamster-human hybrids is by itself insufficient to confer sensitivity to human immune interferon as measured by the induction of human HLA. Human chromosome 21 was found to be the second chromosome essential for HLA inducibility. Similar results were found with mouse-human somatic cell hybrids. Thus, at least two steps are involved in the action of human interferon ..gamma..: the binding of interferon ..gamma.. to its receptor coded by chromosome 6 and the linkage of this binding event through a factor coded by chromosome 21 to trigger biological action. Both of these steps are species-specific.

  17. Disruption of human vigilin impairs chromosome condensation and segregation.

    PubMed

    Wei, Ling; Xie, Xiaoyan; Li, Junhong; Li, Ran; Shen, Wenyan; Duan, Shuwang; Zhao, Rongce; Yang, Wenli; Liu, Qiuying; Fu, Qiang; Qin, Yang

    2015-11-01

    Appropriate packaging and condensation are critical for eukaryotic chromatin's accommodation and separation during cell division. Human vigilin, a multi-KH-domain nucleic acid-binding protein, is associated with alpha satellites of centromeres. DDP1, a vigilin's homolog, is implicated with chromatin condensation and segregation. The expression of vigilin was previously reported to elevate in highly proliferating tissues and increased in a subset of hepatocellular carcinoma patients. Other studies showed that vigilin interacts with CTCF, contributes to regulation of imprinted genes Igf2/H19, and colocalizes with HP1α on heterochromatic satellite 2 and β-satellite repeats. These studies indicate that human vigilin might be involved in chromatin remodeling and regular cell growth. To investigate the potential role of human vigilin in cell cycle, the correlations between vigilin and chromosomal condensation and segregation were studied. Depletion of human vigilin by RNA interference in HepG2 cells resulted in chromosome undercondensation and various chromosomal defects during mitotic phase, including chromosome misalignments, lagging chromosomes, and chromosome bridges. Aberrant polyploid nucleus in telophase was also observed. Unlike the abnormal staining pattern of chromosomes, the shape of spindle was normal. Furthermore, the chromatin showed a greater sensitivity to MNase digestion. Collectively, our findings show that human vigilin apparently participates in chromatin condensation and segregation.

  18. Disruption of human vigilin impairs chromosome condensation and segregation.

    PubMed

    Wei, Ling; Xie, Xiaoyan; Li, Junhong; Li, Ran; Shen, Wenyan; Duan, Shuwang; Zhao, Rongce; Yang, Wenli; Liu, Qiuying; Fu, Qiang; Qin, Yang

    2015-11-01

    Appropriate packaging and condensation are critical for eukaryotic chromatin's accommodation and separation during cell division. Human vigilin, a multi-KH-domain nucleic acid-binding protein, is associated with alpha satellites of centromeres. DDP1, a vigilin's homolog, is implicated with chromatin condensation and segregation. The expression of vigilin was previously reported to elevate in highly proliferating tissues and increased in a subset of hepatocellular carcinoma patients. Other studies showed that vigilin interacts with CTCF, contributes to regulation of imprinted genes Igf2/H19, and colocalizes with HP1α on heterochromatic satellite 2 and β-satellite repeats. These studies indicate that human vigilin might be involved in chromatin remodeling and regular cell growth. To investigate the potential role of human vigilin in cell cycle, the correlations between vigilin and chromosomal condensation and segregation were studied. Depletion of human vigilin by RNA interference in HepG2 cells resulted in chromosome undercondensation and various chromosomal defects during mitotic phase, including chromosome misalignments, lagging chromosomes, and chromosome bridges. Aberrant polyploid nucleus in telophase was also observed. Unlike the abnormal staining pattern of chromosomes, the shape of spindle was normal. Furthermore, the chromatin showed a greater sensitivity to MNase digestion. Collectively, our findings show that human vigilin apparently participates in chromatin condensation and segregation. PMID:26032007

  19. Number and size of human X chromosome fragments transferred to mouse cells by chromosome-mediated gene transfer

    SciTech Connect

    Olsen, A.S.; McBride, O.W.; Moore, D.E.

    1981-05-01

    Labeled probes of unique-sequence human X chromosomal deoxyribonucleic acid, prepared by two different procedures, were used to measure the amount of human X chromosomal deoxyribonucleic acid in 12 mouse cell lines expressing human hypoxanthine phosphoribosyltransferase after chromosome-mediated gene transfer. The amount of X chromosomal deoxyribonucleic acid detected by this procedure ranged from undetectable levels in the three stable transformants and some unstable transformants examined to about 20% of the human X chromosome in two unstable transformants. Reassociation kinetics of the X chromosomal probe with deoxyribonucleic acid from the two unstable transformants containing 15 to 20% of the human X chromosome indicate that a single copy of these sequences is present. In one of these lines, the X chromosomal sequences exist as multiple fragments which were not concordantly segregated when the cells were selected for loss of hprt.

  20. Sex chromosome evolution: platypus gene mapping suggests that part of the human X chromosome was originally autosomal.

    PubMed Central

    Watson, J M; Spencer, J A; Riggs, A D; Graves, J A

    1991-01-01

    To investigate the evolution of the mammalian sex chromosomes, we have compared the gene content of the X chromosomes in the mammalian groups most distantly related to man (marsupials and monotremes). Previous work established that genes on the long arm of the human X chromosome are conserved on the X chromosomes in all mammals, revealing that this region was part of an ancient mammalian X chromosome. However, we now report that several genes located on the short arm of the human X chromosome are absent from the platypus X chromosome, as well as from the marsupial X chromosome. Because monotremes and marsupials diverged independently from eutherian mammals, this finding implies that the whole human X short arm region is a relatively recent addition to the X chromosome in eutherian mammals. Images PMID:1763040

  1. The transfer of human artificial chromosomes via cryopreserved microcells.

    PubMed

    Uno, Narumi; Uno, Katsuhiro; Zatti, Susi; Ueda, Kana; Hiratsuka, Masaharu; Katoh, Motonobu; Oshimura, Mitsuo

    2013-10-01

    Microcell-mediated chromosome transfer (MMCT) technology enables a single and intact mammalian chromosome or megabase-sized chromosome fragments to be transferred from donor to recipient cells. The conventional MMCT method is performed immediately after the purification of microcells. The timing of the isolation of microcells and the preparation of recipient cells is very important. Thus, ready-made microcells can improve and simplify the process of MMCT. Here, we established a cryopreservation method to store microcells at -80 °C, and compared these cells with conventionally- (immediately-) prepared cells with respect to the efficiency of MMCT and the stability of a human artificial chromosome (HAC) transferred to human HT1080 cells. The HAC transfer in microcell hybrids was confirmed by FISH analysis. There was no significant difference between the two methods regarding chromosome transfer efficiency and the retention rate of HAC. Thus, cryopreservation of ready-to-use microcells provides an improved and simplified protocol for MMCT.

  2. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved

    PubMed Central

    Meng, Hao; Agbagwa, Ikechukwu O.; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

    2016-01-01

    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history. PMID:26760298

  3. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved.

    PubMed

    Zhang, Minjie; Wang, Chuan-Chao; Yang, Caiyun; Meng, Hao; Agbagwa, Ikechukwu O; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

    2016-01-01

    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history. PMID:26760298

  4. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved.

    PubMed

    Zhang, Minjie; Wang, Chuan-Chao; Yang, Caiyun; Meng, Hao; Agbagwa, Ikechukwu O; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

    2016-01-01

    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history.

  5. The IPP gene is assigned to human chromosome 1p32-1p22

    SciTech Connect

    Chang-Yeh, A.; Huang, R.C.C. ); Jabs, E.W.; Li, Xiang ); Dracopoli, N.C. )

    1993-01-01

    We previously reported the isolation and characterization of a novel mouse gene that is promoted by an intracisternal A-particle (IAP) LTR and is expressed in placental tissue (mouse IAP-promoted placenta gene, Ipp). Based on restriction fragment length polymorphism (RFLP) studies using inbred strains and recombinant inbred (RI) mice, we have established the linkage between the Ipp gene and several loci on distal mouse chromosome 4. In this publication, we report the partial sequence of a human cDNA clone isolated from a human placental library that has 83% identity to the 3[prime]region of the Ipp cDNA. For human chromosome mapping, two 20-base oligonucleotides within the homologous region were used as primers for polymerase chain reactions (PCR) to chromosome-specific DNAs from two somatic cell hybrid panels and several hybrid cell lines carrying breakpoints on human chromosome 1p. We have assigned this human homolog of the Ipp (IPP) gene to chromosome 1 at 1p32-1p22, based on analysis of PCR products. With this assignment, the homology between mouse chromosome 4 and human chromosome 1 is maintained (5). 7 refs., 1 fig.

  6. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  7. Chromosomal duplications in bacteria, fruit flies, and humans

    SciTech Connect

    Lupski, J.R.; Weinstock, G.M.; Roth, J.R.

    1996-01-01

    Tandem duplication of chromosomal segments has been recognized as a frequent mutational mechanism in several genetic model systems. In bacteria, fruit flies, and humans, duplications form by similar molecular mechanisms and appear to be important in genome evolution. 80 refs.

  8. Chromosome region-specific libraries for human genome analysis

    SciTech Connect

    Kao, Fa-Ten.

    1991-01-01

    We have made important progress since the beginning of the current grant year. We have further developed the microdissection and PCR- assisted microcloning techniques using the linker-adaptor method. We have critically evaluated the microdissection libraries constructed by this microtechnology and proved that they are of high quality. We further demonstrated that these microdissection clones are useful in identifying corresponding YAC clones for a thousand-fold expansion of the genomic coverage and for contig construction. We are also improving the technique of cloning the dissected fragments in test tube by the TDT method. We are applying both of these PCR cloning technique to human chromosomes 2 and 5 to construct region-specific libraries for physical mapping purposes of LLNL and LANL. Finally, we are exploring efficient procedures to use unique sequence microclones to isolate cDNA clones from defined chromosomal regions as valuable resources for identifying expressed gene sequences in the human genome. We believe that we are making important progress under the auspices of this DOE human genome program grant and we will continue to make significant contributions in the coming year. 4 refs., 4 figs.

  9. CREB Binds to Multiple Loci on Human Chromosome 22

    PubMed Central

    Euskirchen, Ghia; Royce, Thomas E.; Bertone, Paul; Martone, Rebecca; Rinn, John L.; Nelson, F. Kenneth; Sayward, Fred; Luscombe, Nicholas M.; Miller, Perry; Gerstein, Mark; Weissman, Sherman; Snyder, Michael

    2004-01-01

    The cyclic AMP-responsive element-binding protein (CREB) is an important transcription factor that can be activated by hormonal stimulation and regulates neuronal function and development. An unbiased, global analysis of where CREB binds has not been performed. We have mapped for the first time the binding distribution of CREB along an entire human chromosome. Chromatin immunoprecipitation of CREB-associated DNA and subsequent hybridization of the associated DNA to a genomic DNA microarray containing all of the nonrepetitive DNA of human chromosome 22 revealed 215 binding sites corresponding to 192 different loci and 100 annotated potential gene targets. We found binding near or within many genes involved in signal transduction and neuronal function. We also found that only a small fraction of CREB binding sites lay near well-defined 5′ ends of genes; the majority of sites were found elsewhere, including introns and unannotated regions. Several of the latter lay near novel unannotated transcriptionally active regions. Few CREB targets were found near full-length cyclic AMP response element sites; the majority contained shorter versions or close matches to this sequence. Several of the CREB targets were altered in their expression by treatment with forskolin; interestingly, both induced and repressed genes were found. Our results provide novel molecular insights into how CREB mediates its functions in humans. PMID:15082775

  10. Chromosome Conformation of Human Fibroblasts Grown in 3-Dimensional Spheroids

    PubMed Central

    Chen, Haiming; Comment, Nicholas; Chen, Jie; Ronquist, Scott; Hero, Alfred; Ried, Thomas; Rajapakse, Indika

    2015-01-01

    In the study of interphase chromosome organization, genome-wide chromosome conformation capture (Hi-C) maps are often generated using 2-dimensional (2D) monolayer cultures. These 2D cells have morphological deviations from cells that exist in 3-dimensional (3D) tissues in vivo, and may not maintain the same chromosome conformation. We used Hi-C maps to test the extent of differences in chromosome conformation between human fibroblasts grown in 2D cultures and those grown in 3D spheroids. Significant differences in chromosome conformation were found between 2D cells and those grown in spheroids. Intra-chromosomal interactions were generally increased in spheroid cells, with a few exceptions, while inter-chromosomal interactions were generally decreased. Overall, chromosomes located closer to the nuclear periphery had increased intra-chromosomal contacts in spheroid cells, while those located more centrally had decreased interactions. This study highlights the necessity to conduct studies on the topography of the interphase nucleus under conditions that mimic an in vivo environment. PMID:25738643

  11. Cloning of the cDNA for the human ATP synthase OSCP subunit (ATP5O) by exon trapping and mapping to chromosome 21q22.1-q22.2

    SciTech Connect

    Chen, Haiming; Morris, M.A.; Rossier, C.

    1995-08-10

    Exon trapping was used to clone portions of potential genes from human chromosome 21. One trapped sequence showed striking homology with the bovine and rat ATP synthase OSCP (oligomycin sensitivity conferring protein) subunit. We subsequently cloned the full-length human ATP synthase OSCP cDNA (GDB/HGMW approved name ATP50) from infant brain and muscle libraries and determined its nucleotide and deduced amino acid sequence (EMBL/GenBank Accession No. X83218). The encoded polypeptide contains 213 amino acids, with more than 80% identity to bovine and murine ATPase OSCP subunits and over 35% identity to Saccharomyces cerevisiae and sweet potato sequences. The human ATP5O gene is located at 21q22.1-q22.2, just proximal to D21S17, in YACs 860G11 and 838C7 of the Chumakov et al. YAC contig. The gene is expressed in all human tissues examined, most strongly in muscle and heart. This ATP5O subunit is a key structural component of the stalk of the mitochondrial respiratory chain F{sub 1}F{sub 0}-ATP synthase and as such may contribute in a gene dosage-dependent manner to the phenotype of Down syndrome (trisomy 21). 39 refs., 5 figs.

  12. Induction of chromosome aberrations in cultured human lymphocytes treated with ethoxyquin.

    PubMed

    Blaszczyk, A; Osiecka, R; Skolimowski, J

    2003-12-01

    The chromosomal aberration test was employed to investigate the effect in vitro of a known antioxidant and food preservative, ethoxyquin (EQ, 1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline) on human chromosomes. The studies were undertaken because there are no published in vitro data on genotoxicity of EQ in mammalian cells and there are many reports pointing out that it may be harmful to animals and human beings. Lymphocytes obtained from three healthy donors were incubated with EQ (0.01-0.5mM) both with and without metabolic activation. Stability studies performed by HPLC analysis showed that EQ was stable under the conditions of the lymphocyte cultures. The results of the chromosome aberration assay showed that EQ induces chromosome aberrations: gaps and breaks as well as dicentrics and atypical translocation chromosomes.

  13. Chromosome Conformation Capture Carbon Copy (5C) in Budding Yeast.

    PubMed

    Belton, Jon-Matthew; Dekker, Job

    2015-06-01

    Chromosome conformation capture carbon copy (5C) is a high-throughput method for detecting ligation products of interest in a chromosome conformation capture (3C) library. 5C uses ligation-mediated amplification (LMA) to generate carbon copies of 3C ligation product junctions using single-stranded oligonucleotide probes. This procedure produces a 5C library of short DNA molecules which represent the interactions between the corresponding restriction fragments. The 5C library can be amplified using universal primers containing the Illumina paired-end adaptor sequences for subsequent high-throughput sequencing.

  14. The HOX-5 and surfeit gene clusters are linked in the proximal portion of mouse chromosome 2.

    PubMed

    Stubbs, L; Huxley, C; Hogan, B; Evans, T; Fried, M; Duboule, D; Lehrach, H

    1990-04-01

    Using an interspecies backcross, we have mapped the HOX-5 and surfeit (surf) gene clusters within the proximal portion of mouse chromosome 2. While the HOX-5 cluster of homeobox-containing genes has been localized to chromosome 2, bands C3-E1, by in situ hybridization, its more precise position relative to the genes and cloned markers of chromosome 2 was not known. Surfeit, a tight cluster of at least six highly conserved "housekeeping" genes, has not been previously mapped in mouse, but has been localized to human chromosome 9q, a region of the human genome with strong homology to proximal mouse chromosome 2. The data presented here place HOX-5 in the vicinity of the closely linked set of developmental mutations rachiterata, lethargic, and fidget and place surf close to the proto-oncogene Abl, near the centromere of chromosome 2.

  15. Chromosomal translocation engineering to recapitulate primary events of human cancer.

    PubMed

    Forster, A; Pannell, R; Drynan, L; Cano, F; Chan, N; Codrington, R; Daser, A; Lobato, N; Metzler, M; Nam, C-H; Rodriguez, S; Tanaka, T; Rabbitts, T

    2005-01-01

    Mouse models of human cancers are important for understanding determinants of overt disease and for "preclinical" development of rational therapeutic strategies; for instance, based on macrodrugs. Chromosomal translocations underlie many human leukemias, sarcomas, and epithelial tumors. We have developed three technologies based on homologous recombination in mouse ES cells to mimic human chromosome translocations. The first, called the knockin method, allows creation of fusion genes like those typical of translocations of human leukemias and sarcomas. Two new conditional chromosomal translocation mimics have been developed. The first is a method for generating reciprocal chromosomal translocations de novo using Cre-loxP recombination (translocator mice). In some cases, there is incompatible gene orientation and the translocator model cannot be applied. We have developed a different model (invertor mice) for these situations. This method consists of introducing an inverted cDNA cassette into the intron of a target gene and bringing the cassette into the correct transcriptional orientation by Cre-loxP recombination. We describe experiments using the translocator model to generate MLL-mediated neoplasias and the invertor method to generate EWS-ERG-mediated cancer. These methods mimic the situation found in human chromosome translocations and provide the framework for design and study of human chromosomal translocations in mice.

  16. Human Chromosome 21: Mapping of the chromosomes and cloning of cDNAs

    SciTech Connect

    Antonarakis, S.E.

    1991-09-01

    The objective of the research funded by DOE grant DE-FG02-89ER60857 from 6/15/89 to 8/31/91 was to contribute to the physical mapping of human chromosome 21 (HC21) by cloning large fragments of DNA into Yeast Artificial Chromosomes (YACs) and identify YACs that map on HC21. A total of 54 sequence tagged sites (STS) have been developed and mapped in our laboratory to HC21 and can be used as initial reference points for YAC identification and construction of overlapping clones. A small YAC library was constructed which is HC21 specific. DNA from somatic cell hybrid WAV17 or from flow-sorted HC21 was partially digested with EcoRI, ligated into vectors PJS97, PJS98, and YACs have been obtained with average size insert of more than 300 kb. This library has been deposited in D. Patterson's lab for the Joint YAC screening effort. Additional YAC libraries from ICI Pharmaceuticals or from Los Alamos National Laboratories have been screened with several STS and positive YACs have been identified. Work in progress includes screening of YAC libraries in order to construct overlapping clones, characterization of the cloning ends of YACs, characterization of additional STS and cloning of HC21 specific cDNAs. 15 refs., 2 figs., 5 tabs.

  17. Chromosomal localization and structure of the human type II IMP dehydrogenase gene

    SciTech Connect

    Glesne, D.; Huberman, E. |; Collart, F.; Varkony, T.; Drabkin, H.

    1994-05-01

    We determined the chromosomal localization and structure of the gene encoding human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC 1.1.1.205), an enzyme associated with cellular proliferation, malignant transformation, and differentiation. Using polymerase chain reaction (PCR) primers specific for type II IMPDH, we screened a panel of human-Chinese hamster cell somatic hybrids and a separate deletion panel of chromosome 3 hybrids and localized the gene to 3p21.1{yields}p24.2. Two overlapping yeast artificial chromosome clones containing the full gene for type II IMPDH were isolated and a physical map of 117 kb of human genomic DNA in this region of chromosome 3 was constructed. The gene for type II IMPDH was localized and oriented on this map and found to span no more than 12.5 kb.

  18. Human decorin gene: Intron-exon junctions and chromosomal localization

    SciTech Connect

    Vetter, U.; Young, M.F.; Fisher, L.W. ); Vogel, W.; Just, W. )

    1993-01-01

    All of the protein-encoding exons and the 3[prime]flanking region of the human decorin gene have been cloned an partially sequenced. The locations of the intron-exon junctions within the coding portion of the gene were identical to those found for the homologous human gene, biglycan. The sizes of the introns in the decorin gene, however, were substantially larger than those of the same introns of the biglycan gene. Portions of introns 1, 2, and 3 as well as exon 1 were not found during our extensive screening process. The 5[prime] end of intron 2 was found to have an AG-rich region followed immediately by a CT-rich region. Furthermore, the 5[prime] end of intron 3 was very rich in thymidine, whereas the 3[prime] end of intron 7 was rich in adenosine. Several cDNA clones constructed from cultured human bone cell mRNA were found to contain a different sequence at the 5[prime] end compared to that previously published for mRNA from a human embryonic fibroblast cell line. We were also unable to find the alternate 3[prime] flanking region of the previously published cDNA sequence. We have mapped the human decorin gene by in situ methods to chromosome 12q2l.3. 30 refs., 3 figs., 1 tab.

  19. Abnormal chromosome behavior in human oocytes which remained unfertilized during human in vitro fertilization.

    PubMed

    Spielmann, H; Krüger, C; Stauber, M; Vogel, R

    1985-09-01

    Chromosomal abnormalities and abnormal embryonic development have previously been observed after human in vitro fertilization (IVF). Chromosomal abnormalities may arise not only after fertilization but even earlier during meiotic maturation of human oocytes in culture. Since chromosomal analysis is simple in oocytes during meiotic maturation, the chromosomal status was analyzed in oocytes which remained unfertilized in a human in vitro fertilization program. In 50 fertilization attempts the chromosomes of 62 unfertilized oocytes could be analyzed; 45 of them were in the process of meiotic maturation. In three oocytes two small polar bodies were observed 16-18 hr after insemination in the absence of fertilization. In one oocyte abnormal chromosome behavior was found during the first meiotic division, and in four oocytes during metaphase of the second meiotic division. These data suggest that chromosomal analysis of unfertilized oocytes in human IVF may improve the understanding human oocyte maturation and fertilization.

  20. The fibulin-1 gene (FBLN1) is located on human chromosome 22 and on mouse chromosome 15

    SciTech Connect

    Mattei, M.G.; Pan, T.C.; Zhang, R.Z.

    1994-07-15

    Fibulin-1 is a calcium-binding glycoprotein present in the extracellular matrix and in the serum. The gene coding for fibulin-1 (FBLN1) was located by in situ hybridization of {sup 3}H-labeled cDNA probes to human and mouse metaphase chromosomes. The gene was assigned to the q13.2-q13.3 region of human chromosome 22 and to the E-F band of mouse chromosome 15. The finding extends the evolutionary conservation between human chromosome 22 and mouse chromosome 15. 11 refs., 2 figs.

  1. The DNA sequence of the human X chromosome

    PubMed Central

    Ross, Mark T.; Grafham, Darren V.; Coffey, Alison J.; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R.; Burrows, Christine; Bird, Christine P.; Frankish, Adam; Lovell, Frances L.; Howe, Kevin L.; Ashurst, Jennifer L.; Fulton, Robert S.; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C.; Hurles, Matthew E.; Andrews, T. Daniel; Scott, Carol E.; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P.; Hunt, Sarah E.; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L.; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Ainscough, Rachael; Ambrose, Kerrie D.; Ansari-Lari, M. Ali; Aradhya, Swaroop; Ashwell, Robert I. S.; Babbage, Anne K.; Bagguley, Claire L.; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E.; Barlow, Karen F.; Barrett, Ian P.; Bates, Karen N.; Beare, David M.; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M.; Brown, Andrew J.; Brown, Mary J.; Bonnin, David; Bruford, Elspeth A.; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M.; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C.; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y.; Clarke, Graham; Clee, Chris M.; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G.; Conquer, Jen S.; Corby, Nicole; Connor, Richard E.; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; DeShazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K. James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L.; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E.; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G.; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A.; Hawes, Alicia; Heath, Paul D.; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J.; Huckle, Elizabeth J.; Hume, Jennifer; Hunt, Paul J.; Hunt, Adrienne R.; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J.; Joseph, Shirin S.; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K.; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J.; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K.; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M.; Loulseged, Hermela; Loveland, Jane E.; Lovell, Jamieson D.; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H.; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L.; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C.; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O’Dell, Christopher N.; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V.; Pearson, Danita M.; Pelan, Sarah E.; Perez, Lesette; Porter, Keith M.; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A.; Schlessinger, David; Schueler, Mary G.; Sehra, Harminder K.; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M.; Shownkeen, Ratna; Skuce, Carl D.; Smith, Michelle L.; Sotheran, Elizabeth C.; Steingruber, Helen E.; Steward, Charles A.; Storey, Roy; Swann, R. Mark; Swarbreck, David; Tabor, Paul E.; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C.; d’Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L.; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L.; Whiteley, Mathew N.; Wilkinson, Jane E.; Willey, David L.; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L.; Wray, Paul W.; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J.

    2009-01-01

    The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence. PMID:15772651

  2. The DNA sequence of the human X chromosome.

    PubMed

    Ross, Mark T; Grafham, Darren V; Coffey, Alison J; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R; Burrows, Christine; Bird, Christine P; Frankish, Adam; Lovell, Frances L; Howe, Kevin L; Ashurst, Jennifer L; Fulton, Robert S; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C; Hurles, Matthew E; Andrews, T Daniel; Scott, Carol E; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P; Hunt, Sarah E; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A; Worley, Kim C; Ainscough, Rachael; Ambrose, Kerrie D; Ansari-Lari, M Ali; Aradhya, Swaroop; Ashwell, Robert I S; Babbage, Anne K; Bagguley, Claire L; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E; Barlow, Karen F; Barrett, Ian P; Bates, Karen N; Beare, David M; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M; Brown, Andrew J; Brown, Mary J; Bonnin, David; Bruford, Elspeth A; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y; Clarke, Graham; Clee, Chris M; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G; Conquer, Jen S; Corby, Nicole; Connor, Richard E; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; Deshazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A; Hawes, Alicia; Heath, Paul D; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J; Huckle, Elizabeth J; Hume, Jennifer; Hunt, Paul J; Hunt, Adrienne R; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J; Joseph, Shirin S; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M; Loulseged, Hermela; Loveland, Jane E; Lovell, Jamieson D; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O'Dell, Christopher N; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V; Pearson, Danita M; Pelan, Sarah E; Perez, Lesette; Porter, Keith M; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A; Schlessinger, David; Schueler, Mary G; Sehra, Harminder K; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M; Shownkeen, Ratna; Skuce, Carl D; Smith, Michelle L; Sotheran, Elizabeth C; Steingruber, Helen E; Steward, Charles A; Storey, Roy; Swann, R Mark; Swarbreck, David; Tabor, Paul E; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C; d'Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L; Whiteley, Mathew N; Wilkinson, Jane E; Willey, David L; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L; Wray, Paul W; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J; Hillier, Ladeana W; Willard, Huntington F; Wilson, Richard K; Waterston, Robert H; Rice, Catherine M; Vaudin, Mark; Coulson, Alan; Nelson, David L; Weinstock, George; Sulston, John E; Durbin, Richard; Hubbard, Tim; Gibbs, Richard A; Beck, Stephan; Rogers, Jane; Bentley, David R

    2005-03-17

    The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence.

  3. Genome-wide significant schizophrenia risk variation on chromosome 10q24 is associated with altered cis-regulation of BORCS7, AS3MT, and NT5C2 in the human brain.

    PubMed

    Duarte, Rodrigo R R; Troakes, Claire; Nolan, Matthew; Srivastava, Deepak P; Murray, Robin M; Bray, Nicholas J

    2016-09-01

    Chromosome 10q24.32-q24.33 is one of the most robustly supported risk loci to emerge from genome-wide association studies (GWAS) of schizophrenia. However, extensive linkage disequilibrium makes it difficult to distinguish the actual susceptibility gene(s) at the locus, limiting its value for improving biological understanding of the condition. In the absence of coding changes that can account for the association, risk is likely conferred by altered regulation of one or more genes in the region. We, therefore, used highly sensitive measures of allele-specific expression to assess cis-regulatory effects associated with the two best-supported schizophrenia risk variants (SNP rs11191419 and indel ch10_104957618_I/rs202213518) on the primary positional candidates BORCS7, AS3MT, CNNM2, and NT5C2 in the human brain. Heterozygosity at rs11191419 was associated with increased allelic expression of BORCS7 and AS3MT in the fetal and adult brain, and with reduced allelic expression of NT5C2 in the adult brain. Heterozygosity at ch10_104957618_I was associated with reduced allelic expression of NT5C2 in both the fetal and adult brain. Comparisons between cDNA ratios in heterozygotes and homozygotes for the risk alleles indicated that cis-effects on NT5C2 expression in the adult dorsolateral prefrontal cortex could be largely accounted for by genotype at these two risk variants. While not excluding effects on other genes in the region, this study implicates altered neural expression of BORCS7, AS3MT, and NT5C2 in susceptibility to schizophrenia arising from genetic variation at the chromosome 10q24 locus. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc.

  4. Genome‐wide significant schizophrenia risk variation on chromosome 10q24 is associated with altered cis‐regulation of BORCS7, AS3MT, and NT5C2 in the human brain

    PubMed Central

    Duarte, Rodrigo R. R.; Troakes, Claire; Nolan, Matthew; Srivastava, Deepak P.; Murray, Robin M.

    2016-01-01

    Chromosome 10q24.32‐q24.33 is one of the most robustly supported risk loci to emerge from genome‐wide association studies (GWAS) of schizophrenia. However, extensive linkage disequilibrium makes it difficult to distinguish the actual susceptibility gene(s) at the locus, limiting its value for improving biological understanding of the condition. In the absence of coding changes that can account for the association, risk is likely conferred by altered regulation of one or more genes in the region. We, therefore, used highly sensitive measures of allele‐specific expression to assess cis‐regulatory effects associated with the two best‐supported schizophrenia risk variants (SNP rs11191419 and indel ch10_104957618_I/rs202213518) on the primary positional candidates BORCS7, AS3MT, CNNM2, and NT5C2 in the human brain. Heterozygosity at rs11191419 was associated with increased allelic expression of BORCS7 and AS3MT in the fetal and adult brain, and with reduced allelic expression of NT5C2 in the adult brain. Heterozygosity at ch10_104957618_I was associated with reduced allelic expression of NT5C2 in both the fetal and adult brain. Comparisons between cDNA ratios in heterozygotes and homozygotes for the risk alleles indicated that cis‐effects on NT5C2 expression in the adult dorsolateral prefrontal cortex could be largely accounted for by genotype at these two risk variants. While not excluding effects on other genes in the region, this study implicates altered neural expression of BORCS7, AS3MT, and NT5C2 in susceptibility to schizophrenia arising from genetic variation at the chromosome 10q24 locus. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc. PMID:27004590

  5. Independent Histories of Human Y Chromosomes from Melanesia and Australia

    PubMed Central

    Kayser, Manfred; Brauer, Silke; Weiss, Gunter; Schiefenhövel, Wulf; Underhill, Peter A.; Stoneking, Mark

    2001-01-01

    To investigate the origins and relationships of Australian and Melanesian populations, 611 males from 18 populations from Australia, Melanesia, and eastern/southeastern Asia were typed for eight single-nucleotide polymorphism (SNP) loci and seven short tandem-repeat loci on the Y chromosome. A unique haplotype, DYS390.1del/RPS4Y711T, was found at a frequency of 53%–69% in Australian populations, whereas the major haplotypes found in Melanesian populations (M4G/M5T/M9G and DYS390.3del/RPS4Y711T) are absent from the Australian populations. The Y-chromosome data thus indicate independent histories for Australians and Melanesians, a finding that is in agreement with evidence from mtDNA but that contradicts some analyses of autosomal loci, which show a close relationship between Australian and Melanesian (specifically, highland Papua New Guinean) populations. Since the Australian and New Guinean landmasses were connected when first colonized by humans ⩾50,000 years ago but separated some 8,000 years ago, a possible way to reconcile all the genetic data is to infer that the Y-chromosome and mtDNA results reflect the past 8,000 years of independent history for Australia and New Guinea, whereas the autosomal loci reflect the long preceding period of common origin and shared history. Two Y-chromosome haplotypes (M119C/M9G and M122C/M9G) that originated in eastern/southeastern Asia are present in coastal and island Melanesia but are rare or absent in both Australia and highland Papua New Guinea. This distribution, along with demographic analyses indicating that population expansions for both haplotypes began ∼4,000–6,000 years ago, suggests that these haplotypes were brought to Melanesia by the Austronesian expansion. Most of the populations in this study were previously typed for mtDNA SNPs; population differentiation is greater for the Y chromosome than for mtDNA and is significantly correlated with geographic distance, a finding in agreement with results of

  6. Noninvolvement of the X chromosome in radiation-induced chromosome translocations in the human lymphoblastoid cell line TK6

    SciTech Connect

    Jordan, R.; Schwartz, J.L. )

    1994-03-01

    Fluorescence in situ hybridization procedures were used to examine the influence of chromosome locus on the frequency and type of chromosome aberrations induced by [sup 60]Co [gamma] rays in the human lymphoblastoid cell line TK6. Aberrations involving the X chromosome were compared to those involving the similarly sized autosome chromosome 7. When corrected for DNA content, acentric fragments were induced with equal frequency in the X and 7 chromosomes. Dose-dependent increases in chromosomal interchanges involving chromosome 7 were noted, and the frequencies of balanced translocations and dicentrics produced were approximately equal. Chromosome interchanges involving the X chromosome were rare and showed no apparent dose dependence. Thus, while chromosomes 7 and X are equally sensitive to the induction of chromosome breaks, the X chromosome is much less likely to interact with autosomes than chromosome 7. The noninvolvement of the X chromosome in translocations with autosomes may reflect a more peripheral and separate location for the X chromosome in the mammalian nucleus. 20 refs., 2 figs., 1 tab.

  7. The human chromosome. Electron microscopic observations on chromatin fiber organization.

    PubMed

    Abuelo, J G; Moore, D E

    1969-04-01

    Human lymphocytes were grown in short-term tissue culture and were arrested in metaphase with Colcemid. Their chromosomes were prepared by the Langmuir trough-critical point drying technique and were examined under the electron microscope. In addition, some chromosomes were digested with trypsin, Pronase, or DNase. The chromosomes consist entirely of tightly packed, 240 +/- 50-A chromatin fibers. Trypsin and Pronase treatments induce relaxation of fiber packing and reveal certain underlying fiber arrangements. Furthermore, trypsin treatment demonstrates that the chromatin fiber has a 25-50 A trypsin-resistant core surrounded by a trypsin-sensitive sheath. DNase digestion suggests that this core contains DNA.

  8. Gene order is conserved within the human chromosome 21 linkage group on mouse chromosome 10

    SciTech Connect

    Irving, N.G.; Cabin, D.E.; Swanson, D.A.; Reeves, R.H. )

    1994-05-01

    One hundred progeny from each of two intersubspecific mouse backcrosses were used to construct a comparative genetic map of a region of mouse chromosome 10 (MMU10) that is homologous to the distal tip of the long arm of human chromosome 21 (HSA21). The analysis included five genes and three simple sequence repeat markers, two of which flanked the HSA21-homologous cluster on either side. Analysis of 200 backcross progeny detected at least one crossover between each pair of adjacent genes and demonstrated that the proximal to distal orientation of the cluster was reversed between human and mouse. The order was determined to be Fyn-1-D10Mit20-S100b-Col6a1-Itgb2-Pfk1/D10Mit7-D10Mit11. Comparative mapping supports the order of corresponding markers on HSA21 determined using pulsed-field gel electrophoresis and radiation hybrid line data. However, sequence tagged site content mapping of human yeast artificial chromosomes (YACs) yielded conflicting data on the relative positions of human COL6A1 and S100B on HSA21. This discrepancy was resolved here by demonstrating that several key YACs used in the human contig analysis were mistyped for S100B. The murine map reported here provides a scaffold for construction of physical maps and yeast artificial chromosome contigs that will be useful in the development of mouse models for the study of Down syndrome. 28 refs., 4 figs., 2 tabs.

  9. The human [gamma]-aminobutyric acid receptor subunit [beta]3 and [alpha]5 gene cluster in chromosome 15q11-q13 is rich in highly polymorphic (CA)[sub n] repeats

    SciTech Connect

    Glatt, K.; Lalande, M. ); Sinnett, D. )

    1994-01-01

    The [gamma]-aminobutyric acid (GABA[sub A]) receptor [beta]33 (GABRB3) and [alpha]5 (GABRA5) subunit genes have been localized to the Angelman and Prader-Willi syndrome region of chromosome 15q11-q13. GABRB3, which encompasses 250 kb, is located 100 kb proximal of GABRA5, with the two genes arranged in head-to-head transcriptional orientation. In screening 135 kb of cloned DNA within a 260-kb interval extending from within GABRB3 to the 5[prime] end of GABRA5, 10 new (CA), repeats have been identified. Five of these have been analyzed in detail and found to be highly polymorphic, with the polymorphism information content (PIC) ranging from 0.7 to 0.85 and with heterozygosities of 67 to 94%. In the clones from GABRB3/GABRA5 region, therefore, the frequency of (CA)[sub n] with PICs [ge] 0.7 is 1 per 27 kb. Previous estimates of the density of (CA)[sub n] with PICs [ge] 0.7 in the human genome have been approximately 10-fold lower. The GABRB3/GABRA5 region appears, therefore, to be enriched for highly informative (CA)[sub n]. This set of closely spaced, short tandem repeat polymorphisms will be useful in the molecular analyses of Prader-Willi and Angelman syndromes and in high-resolution studies of genetic recombination within this region. 21 refs., 2 figs., 1 tab.

  10. The pronatriodilatin gene is located on the distal short arm of human chromosome 1 and on mouse chromosome 4.

    PubMed

    Yang-Feng, T L; Floyd-Smith, G; Nemer, M; Drouin, J; Francke, U

    1985-11-01

    Atrial natriuretic factors (ANF) are polypeptides having natriuretic, diuretic, and smooth muscle-relaxing activities that are synthesized from a single larger precursor: pronatriodilatin. Chromosomal assignment of the gene coding for human pronatriodilatin was accomplished by in situ hybridization of a [3H]-labeled pronatriodilatin probe to human chromosome preparations and by Southern blot analysis of somatic cell hybrid DNAs with normal and rearranged chromosomes 1. The human pronatriodilatin gene was mapped to the distal short arm of chromosome 1, in band 1p36. Southern blot analysis of mouse X Chinese hamster somatic cell hybrids was used to assign the mouse pronatriodilatin gene to chromosome 4. This assignment adds another locus to the conserved syntenic group of homologous genes located on the distal half of the short arm of human chromosome 1 and on mouse chromosome 4.

  11. Ribosomal protein gene mapping and human chromosomal disorders

    SciTech Connect

    Kenmochi, N.; Goodman, N.; Page, D.C.

    1994-09-01

    In Drosophila, the Minute phenotype (reduced body size, diminished viability and fertility, and short, thin bristles) results from heterozygous deficiencies (deletions) at any one of 50 loci scattered about the genome. A handful of these Minute loci have been molecularly characterized, and all have been found to encode ribosomal proteins. Thus, the Minute phenotype appears to result from reduced protein synthetic capacity in flies with one rather than two copies of a given ribosomal protein (rp) gene. We are pursuing the possibility that similar reductions in protein synthetic capacity--again resulting from rp gene deficiencies--might underlie phenotypes associated with certain chromosomal disorders in humans. We and our colleagues have reported findings consistent with a role for RPS4 deficiency in the etiology of certain features of Turner syndrome, a complex human disorder classically associated with an XO karyotype. We are intrigued by the possibility that deficiencies of other human rp genes might cause phenotypic abnormalities similar to those seen in Turner syndrome--just as deficiencies of any of a number of Drosophila rp genes cause the Minute phenotype. We must first learn the chromosomal map position of each of the estimated 83 human rp genes. The task of mapping the functional (intron-containing) rp genes is complicated by the existence of processed pseudogenes elsewhere in the genome. To date, we have assigned (or confirmed the previous assignment of) 38 rp genes to individual human chromosomes by PCR analysis of human-rodent somatic cell hybrids containing subsets of human chromosomes, with all but four chromosomes carrying at least one rp gene. We have also identified more than 100 large-insert human YAC (yeast artificial chromosome) clones that contain individual rp genes. Such screening of YAC libraries will result in precise positioning of the rp genes on the emerging physical map of the human genome.

  12. Physical mapping of human chromosome 16. Annual progress report

    SciTech Connect

    Sutherland, G.R.

    1993-08-01

    We aim to isolate cDNAs mapping to human chromosome 16 and localise such cDNAs on the high resolution physical map. In collaboration with LANL, PCR primers will be synthesised from cDNA sequences mapped to chromosome 16 and used as ESTs in the generation of mega-YAC contigs for this chromosome. Probing of high density cosmid grids will enable integration of the ESTs into cosmid contigs and location of the cosmid contigs on the YAC contig. A hn-cDNA library has been constructed from the hybrid CY18 which contains chromosome 16 as the only human chromosome. A modified screening protocol has been successfully developed and 15 hn-cDNA clones have been sequenced and localised on the hybrid map. Sequence analysis of four of these revealed that they were known cDNAs, which are now mapped to chromosome 16. Development of techniques to allow the isolation of longer cDNAs from the identified exons is in progress. This will depend on PCR amplification of cDNAs from a total human CDNA library.

  13. The sequence and analysis of duplication rich human chromosome 16

    SciTech Connect

    Martin, J; Han, C; Gordon, L A; Terry, A; Prabhakar, S; She, X; Xie, G; Hellsten, U; Chan, Y M; Altherr, M; Couronne, O; Aerts, A; Bajorek, E; Black, S; Blumer, H; Branscomb, E; Brown, N; Bruno, W J; Buckingham, J; Callen, D F; Campbell, C S; Campbell, M L; Campbell, E W; Caoile, C; Challacombe, J F; Chasteen, L A; Chertkov, O; Chi, H C; Christensen, M; Clark, L M; Cohn, J D; Denys, M; Detter, J C; Dickson, M; Dimitrijevic-Bussod, M; Escobar, J; Fawcett, J J; Flowers, D; Fotopulos, D; Glavina, T; Gomez, M; Gonzales, E; Goodstein, D; Goodwin, L A; Grady, D L; Grigoriev, I; Groza, M; Hammon, N; Hawkins, T; Haydu, L; Hildebrand, C E; Huang, W; Israni, S; Jett, J; Jewett, P B; Kadner, K; Kimball, H; Kobayashi, A; Krawczyk, M; Leyba, T; Longmire, J L; Lopez, F; Lou, Y; Lowry, S; Ludeman, T; Manohar, C F; Mark, G A; McMurray, K L; Meincke, L J; Morgan, J; Moyzis, R K; Mundt, M O; Munk, A C; Nandkeshwar, R D; Pitluck, S; Pollard, M; Predki, P; Parson-Quintana, B; Ramirez, L; Rash, S; Retterer, J; Ricke, D O; Robinson, D; Rodriguez, A; Salamov, A; Saunders, E H; Scott, D; Shough, T; Stallings, R L; Stalvey, M; Sutherland, R D; Tapia, R; Tesmer, J G; Thayer, N; Thompson, L S; Tice, H; Torney, D C; Tran-Gyamfi, M; Tsai, M; Ulanovsky, L E; Ustaszewska, A; Vo, N; White, P S; Williams, A L; Wills, P L; Wu, J; Wu, K; Yang, J; DeJong, P; Bruce, D; Doggett, N A; Deaven, L; Schmutz, J; Grimwood, J; Richardson, P; Rokhsar, D S; Eichler, E E; Gilna, P; Lucas, S M; Myers, R M; Rubin, E M; Pennacchio, L A

    2005-04-06

    Human chromosome 16 features one of the highest levels of segmentally duplicated sequence among the human autosomes. We report here the 78,884,754 base pairs of finished chromosome 16 sequence, representing over 99.9% of its euchromatin. Manual annotation revealed 880 protein-coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes, and 3 RNA pseudogenes. These genes include metallothionein, cadherin, and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobase pairs were identified and result in gene content differences among humans. While the segmental duplications of chromosome 16 are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events likely to have had an impact on the evolution of primates and human disease susceptibility.

  14. Architecture and anatomy of the chromosomal locus in human chromosome 21 encoding the Cu/Zn superoxide dismutase.

    PubMed Central

    Levanon, D; Lieman-Hurwitz, J; Dafni, N; Wigderson, M; Sherman, L; Bernstein, Y; Laver-Rudich, Z; Danciger, E; Stein, O; Groner, Y

    1985-01-01

    The SOD-1 gene on chromosome 21 and approximately 100 kb of chromosomal DNA from the 21q22 region have been isolated and characterized. The gene which is present as a single copy per haploid genome spans 11 kb of chromosomal DNA. Heteroduplex analysis and DNA sequencing reveals five rather small exons and four introns that interrupt the coding region. The donor sequence at the first intron contains an unusual variant dinucleotide 5'-G-C, rather than the highly conserved 5'-GT. The unusual splice junction is functional in vivo since it was detected in both alleles of the SOD-1 gene, which were defined by differences in the length of restriction endonuclease fragments (RFLPs) that hybridize to the cDNA probe. Genomic blots of human DNA isolated from cells trisomic for chromosome 21 (Down's syndrome patients) show the normal pattern of bands. At the 5' end of gene there are the 'TATA' and 'CAT' promoter sequences as well as four copies of the -GGCGGG- hexanucleotide. Two of these -GC- elements are contained within a 13 nucleotide inverted repeat that could form a stem-loop structure with stability of -33 kcal. The 3'-non coding region of the gene contains five short open reading-frames starting with ATG and terminating with stop codons. Images Fig. 1. Fig. 3. Fig. 7. PMID:3160582

  15. Rejoining of prematurely condensed chromosomes in radiosensitive xrs-5 cells

    SciTech Connect

    Okayasu, R. |; Iliakis, G.

    1995-12-31

    Xrs-5 cells, a radiosensitive, DNA double strand break repair deficient mutant of CHO cells have been studied with the premature chromosome condensation (PCC) technique. This mutant displayed a higher number of initial chromosome breaks with x-ray treatment as well as partial deficiency in the rejoining of interphase chromosome breaks with the standard PCC protocol. Moreover, hypertonic treatment during the incubation period which allowed for PCC did not change the yield of PCC breaks in x-irradiated xrs-5 cells. Notably the number of PCC breaks after treatment with hypertonic media is similar in CHO and xrs-5 cells. Recently, a gene product responsible for the xrs phenotype was identified as a Ku-like DNA end binding protein. The present paper summarizes completed information regarding the induction and repair of the {alpha}- and {beta}-forms of PCC breaks in xrs-5 cells and demonstrates that this gene product predominantly affects the fast form ({beta}-form) of interphase chromosome breaks.

  16. Cryptorchidism due to chromosome 5q inversion duplication.

    PubMed

    Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R

    2013-12-01

    We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

  17. Correlation of chromosome patterns in human leukemic cells with exposure to chemicals and/or radiation

    SciTech Connect

    Rowley, J.D.

    1992-06-01

    This project seeks to defining the chromosome segments associated with radiation induced leukemogenesis (treatment-related acute myeloid leukemia, or t-AML). Towards these goals genetic analysis of human chromosomes 5 and 7 continues to investigate correlation of treatment with balanced and unbalanced chromosomal translocations. Progress is being made in cloning the breakpoints in balanced translocations in t-AML, that is to clone the t(9;11) and t(11;19) breakpoints, to clone the t(3;21)(q26;q22) breakpoints and to determine the relationship of these translocations to prior exposure to topoisomerase II inhibitors. 11 figs. 3 figs.

  18. The genes for the {alpha}-type HC3 (PMSA2) and {beta}-type HC5 (PMSB1) subunits of human proteasomes map to chromosomes 6q27 and 7p12-p13 by fluorescence in situ hybridization

    SciTech Connect

    Okumura, Katsuzumi; Nogami, Masahiro; Taguchi, Hiroshi

    1995-05-20

    The authors have determined the locations of the genes for the two subunits, HC3 and HC5, by fluorescence in situ hybridization (FISH). Chromosome spreads were obtained from phytohemagglutinin-stimulated blood lymphocytes of a healthy donor after thymidine synchronization and bromodeoxyuridine incorporation by the method of Takahashi et al. Genomic DNA fragments of HC3 (4.3 kb, including exons 3, 4, and 5) and HC5 (7.5 kb including exons 1 and 2) (11) were labeled with biotin-16-dUTP by nick-translation. In situ hybridization was performed according to Lichter et al. in the presence of COT-1 DNA as a competitor. Hybridized probe was detected with FITC-conjugated avidin without further signal amplification. Comparison of the fluorescence signals and the banding patterns of the chromosomes indicated that the HC3 and HC5 genes were located on chromosome band 6q27 and 7p12-p13, respectively.

  19. Chromosomal localization of human RNA polymerase II subunit genes

    SciTech Connect

    Acker, J.; Wintzerith, M.; Vigneron, M.; Kedinger, C. ); Mattei, M.G.; Roeckel, N.; Depetris, D. )

    1994-04-01

    The eukaryotic DNA-dependent RNA polymerase II (or B) is composed of 10 to 14 polypeptides ranging from 220 to 10 kDa. To gain further insight into the molecular structure and function of these subunits, the authors have undertaken the molecular cloning of nucleotide sequences corresponding to the human enzyme. The cDNAs of five subunits (hRPB220, hRPB140, hRPB33, hRPB25, and hRPB14.5) have been isolated. Using in situ hybridization, they show that the genes of these subunits have distinct chromosomal locations (17p13, 4q12, 16q13-q21, 19p13.3, and 19q12, respectively). Thus, if assembly of active polymerase molecules requires coordinated expression from these independent genes, mechanisms that ensure tight coregulation of the corresponding promoters must exist. 20 refs., 2 figs., 1 tab.

  20. CAPER: a chromosome-assembled human proteome browsER.

    PubMed

    Guo, Feifei; Wang, Dan; Liu, Zhongyang; Lu, Liang; Zhang, Wei; Sun, Haiyan; Zhang, Hongxing; Ma, Jie; Wu, Songfeng; Li, Ning; Jiang, Ying; Zhu, Weimin; Qin, Jun; Xu, Ping; Li, Dong; He, Fuchu

    2013-01-01

    High-throughput mass spectrometry and antibody-based experiments have begun to produce a large amount of proteomic data sets. Chromosome-based visualization of these data sets and their annotations can help effectively integrate, organize, and analyze them. Therefore, we developed a web-based, user-friendly Chromosome-Assembled human Proteome browsER (CAPER). To display proteomic data sets and related annotations comprehensively, CAPER employs two distinct visualization strategies: track-view for the sequence/site information and the correspondence between proteome, transcriptome, genome, and chromosome and heatmap-view for the qualitative and quantitative functional annotations. CAPER supports data browsing at multiple scales through Google Map-like smooth navigation, zooming, and positioning with chromosomes as the reference coordinate. Both track-view and heatmap-view can mutually switch, providing a high-quality user interface. Taken together, CAPER will greatly facilitate the complete annotation and functional interpretation of the human genome by proteomic approaches, thereby making a significant contribution to the Chromosome-Centric Human Proteome Project and even the human physiology/pathology research. CAPER can be accessed at http://www.bprc.ac.cn/CAPE .

  1. Structure of human chromosomes studied by atomic force microscopy.

    PubMed

    Tamayo, Javier

    2003-03-01

    In this work human chromosomes have been treated with RNase and pepsin to remove the layer of cellular material that covers the standard preparations on glass slides. This allows characterization of the topography of chromosomes at nanometer scale in air and in physiological solution by atomic force microscopy. Imaging of the dehydrated structure in air indicates radial arrangement of chromatin loops as the last level of DNA packing. However, imaging in liquid reveals a last level of organization consisting of a hierarchy of bands and coils. Additionally force curves between the tip and the chromosome in liquid are consistent with radial chromatin loops. These results and previous electron microscopy studies are analyzed, and a model is proposed for the chromosome structure in which radial loops and helical coils coexist.

  2. Evaluating the relationship between spermatogenic silencing of the X chromosome and evolution of the Y chromosome in chimpanzee and human.

    PubMed

    Mulugeta Achame, Eskeatnaf; Baarends, Willy M; Gribnau, Joost; Grootegoed, J Anton

    2010-12-14

    Chimpanzees and humans are genetically very similar, with the striking exception of their Y chromosomes, which have diverged tremendously. The male-specific region (MSY), representing the greater part of the Y chromosome, is inherited from father to son in a clonal fashion, with natural selection acting on the MSY as a unit. Positive selection might involve the performance of the MSY in spermatogenesis. Chimpanzees have a highly polygamous mating behavior, so that sperm competition is thought to provide a strong selective force acting on the Y chromosome in the chimpanzee lineage. In consequence of evolution of the heterologous sex chromosomes in mammals, meiotic sex chromosome inactivation (MSCI) results in a transcriptionally silenced XY body in male meiotic prophase, and subsequently also in postmeiotic repression of the sex chromosomes in haploid spermatids. This has evolved to a situation where MSCI has become a prerequisite for spermatogenesis. Here, by analysis of microarray testicular expression data representing a small number of male chimpanzees and men, we obtained information indicating that meiotic and postmeiotic X chromosome silencing might be more effective in chimpanzee than in human spermatogenesis. From this, we suggest that the remarkable reorganization of the chimpanzee Y chromosome, compared to the human Y chromosome, might have an impact on its meiotic interactions with the X chromosome and thereby on X chromosome silencing in spermatogenesis. Further studies will be required to address comparative functional aspects of MSCI in chimpanzee, human, and other placental mammals.

  3. Large-scale polymorphism near the ends of several human chromosomes analyzed by using fluorescence in situ hybridization (FISH)

    SciTech Connect

    Trask, B.J.; Friedman, C.; Giorgi, D.

    1994-09-01

    We have discovered a large DNA segment that is polymorphically present at the ends of several human chromosomes. The segment, f7501, was originally derived form a human chromosome 19-specific cosmid library. FISH was used to determine the cosmid`s chromosomal distribution on 44 unrelated humans and several closely related primates. The human subjects represent a diversity of reproductively isolated ethnic populations. FISH analysis revealed that sequences highly homologous to the cosmid`s insert are present on both homologs at 3q, 15q,. and 19p in almost all individuals (88, 85, and 87 of 88 homologs, respectively). Other chromosomes sites were labeled much more rarely in the sampled individuals. For example, 56 of the 88 analyzed chromosomes 11 were labeled (18+/+, 6-/-, and 20+/- individuals). In contrast, 2q was labeled on only 1/88 sampled chromosomes. The termini of 2q, 5q, 6p, 6q, 7p, 8p, 9p, 9q, 11p, 12q, 16p, 19q, and 20q and an interstitial site at 2q13-14 were labeled in at least one individual of the set. EcoR1-fragments derived from the cosmid showed the same hybridization pattern as the entire cosmid, indicating that at least 40 kbp is shared by these chromosome ends. Ethnic differences in the allele frequency of these polymorphic variants was observed. For example, signals were observed on 8/10 and 7/10 of the chromosomes 7p and 16q, respectively, derived form Biakan Pygmies, but these sites were infrequently labeled in non-Pygmy human populations (2/68, respectively). This region has undergone significant changes in chromosome location during human evolution. Strong signal was seen on chimpanzee and gorilla chromosome 3, which is homologous to human chromosome 4, a chromosome unlabeled in any of the humans we have analyzed.

  4. Induction of chromosome aberrations in human cells by charged particles

    NASA Technical Reports Server (NTRS)

    Wu, H.; Durante, M.; George, K.; Yang, T. C.

    1997-01-01

    Chromosome aberrations induced by high-energy charged particles in normal human lymphocytes and human fibroblasts have been investigated. The charged particles included 250 MeV/nucleon protons, 290 MeV/nucleon carbon ions and 1 GeV/nucleon iron ions. The energies of the charged particles were higher than in most of the studies reported in the literature. Lymphocytes were stimulated to grow immediately after irradiation, while fibroblasts were incubated at 37 degrees C for 24 h for repair. Chromosomes were collected at the first mitosis after irradiation and chromosome aberrations were scored using the fluorescence in situ hybridization (FISH) technique with a whole-chromosome 4 probe. Chromosome aberrations were classified as reciprocal exchanges, incomplete exchanges, deletions and complex exchanges. The relative biological effectiveness (RBE) for each type of aberration was calculated by dividing a dose of 4 Gy by the dose of the charged particles producing the same effect as 4 Gy of gamma rays. Results of this study showed that complex aberrations have the highest RBE for radiation of high linear energy transfer (LET) for human lymphocytes, but for fibroblasts, the greatest effect was for incomplete exchanges. For both lymphocytes and fibroblasts, iron ions induced a similar fraction of aberrant cells.

  5. Construction of a chromosome specific library of human MARs and mapping of matrix attachment regions on human chromosome 19.

    PubMed

    Nikolaev, L G; Tsevegiyn, T; Akopov, S B; Ashworth, L K; Sverdlov, E D

    1996-04-01

    Using a novel procedure a representative human chromosome 19-specific library was constructed of short sequences, which bind preferentially to the nuclear matrix (matrix attachment regions, or MARs). Judging by 20 clones sequenced so far, the library contains > 50% of human inserts, about 90% of which are matrix-binding by the in vitro test. Computer analysis of sequences of eight human MARs did not reveal any significant homologies with the EMBL Nucleotide Data Base entries as well as between MARs themselves. Eight MARs were assigned to individual positions on the chromosome 19 physical map. The library constructed can serve as a good source of MAR sequences for comparative analysis and classification and for further chromosome mapping of MARs as well.

  6. Construction of a chromosome specific library of human MARs and mapping of matrix attachment regions on human chromosome 19.

    PubMed Central

    Nikolaev, L G; Tsevegiyn, T; Akopov, S B; Ashworth, L K; Sverdlov, E D

    1996-01-01

    Using a novel procedure a representative human chromosome 19-specific library was constructed of short sequences, which bind preferentially to the nuclear matrix (matrix attachment regions, or MARs). Judging by 20 clones sequenced so far, the library contains > 50% of human inserts, about 90% of which are matrix-binding by the in vitro test. Computer analysis of sequences of eight human MARs did not reveal any significant homologies with the EMBL Nucleotide Data Base entries as well as between MARs themselves. Eight MARs were assigned to individual positions on the chromosome 19 physical map. The library constructed can serve as a good source of MAR sequences for comparative analysis and classification and for further chromosome mapping of MARs as well. PMID:8614638

  7. Paternal-age effects on sperm aneuploidy investigated in mice and humans by three-chromosome fluorescence in situ hybridization

    SciTech Connect

    Wyrobek, A.J.; Lowe, X.; Holland, N.T.

    1994-09-01

    We conducted a cross-species comparison of the effects of paternal age on sperm aneuploidy in mice and humans. A new murine assay was developed to detect sperm hyperhaploidy and polyploidy for chromosomes X, Y, and 8 using fluorescence in situ hybridization with chromosome-specific DNA probes, to serve as a direct corollate to the three-chromosome method developed early for human sperm. Sperm aneuploidy was evaluated in eight male B6C3F1 male mice (aged 22.5-30.5 mo) and compared to young controls (2.4 mo). The aged group showed significant ({approximately}2.0-fold) increases in hyperhaploidies involving chromosomes X, Y and 8, with the greatest effects seen in the oldest animals. Sperm aneuploidy was also evaluated in two groups of healthy men who differed in mean age [46.8{plus_minus}3.1 (n=4) vs. 28.5{plus_minus}5.0 (n=10) yrs], using the three-chromosome method. The older group showed a statistically significant increase in hyperhaploid sperm for both sex chromosomes. Additional controlled human studies are planned. Taken together, the murine and human data are consistent with a positive effect of paternal age on sperm aneuploidy. In both species, the strongest age effect was observed for hyperhaploidies of chromosome Y. Future studies are needed to investigate the shape of the age-effect curve and to evaluate chromosomal differences, especially for humans in their late reproductive years.

  8. Technologies for large-scale physical mapping of human chromosomes

    SciTech Connect

    Beugelsdijk, T.J.

    1994-12-01

    Since its inception 6 years ago, the Human Genome Project has made rapid progress towards its ultimate goal of developing the complete sequence of all human chromosomes. This progress has been made possible through the development of automated devices by laboratories throughout the world that aid the molecular biologist in various phases of the project. The initial phase involves the generation of physical and genetic maps of each chromosome. This task is nearing completion at a low resolution level with several instances of very high detailed maps being developed for isolated chromosomes. In support of the initial mapping thrust of this program, the robotics and automation effort at Los Alamos National Laboratory has developed DNA gridding technologies along with associated database and user interface systems. This paper will discuss these systems in detail and focus on the formalism developed for subsystems which allow for facile system integration.

  9. Localization of the oncogene c-erbA2 to human chromosome 3.

    PubMed

    Rider, S H; Gorman, P A; Shipley, J M; Moore, G; Vennstrom, B; Solomon, E; Sheer, D

    1987-05-01

    The human c-erbA1 gene has been previously mapped to chromosome 17. We have now mapped c-erbA2 to the short arm of chromosome 3, using a human genomic probe in Southern analysis of DNA from a panel of human/mouse somatic cell hybrids. In situ hybridization using the same probe on metaphase chromosomes has enabled fine chromosome mapping of c-erbA2 to the chromosome region 3p21-pter. PMID:3674756

  10. Frequent, unconventional structural changes of the human Y chromosome

    SciTech Connect

    Chen, T.R.

    1994-09-01

    Six human cell lines in which the Y/autosome translocations were suspected by the conventional chromosome banding study exhibited unconventional, complex structural rearrangements of the Y chromosome. These translocations included Yqter{r_arrow}Yq12::Ycen{r_arrow}Yp11 (or Yq11{r_arrow}Ycen)::9pter{r_arrow}9qter; insertion of Ycen interstitially to an autosome; interstitial insertion of two Yq12 segments separated by an euchromatic non-Y segment; and multiple Y/autosomal translocations containing unequal Yq12 segments. These markers required three or more breaks/reunions. Loci of breaks and retaining segments of the Y chromosome were identified by the combination of conventional chromosome bandings, fluorescence in situ hybridization, and Southern blot DNA analyses. Extensive structural rearrangements involving the Y chromosome were evident. The heterochromatic Y segments retained in cell lines of male donor origins at a distinctively higher rate than the euchromatic Y arms. The Y/A markers were present in all cells and paired Y/As were found in some cell lines. These facts strongly suggested that at least some of these markers were present in the tissue explant, but not entirely derived newly in vitro. These naturally occurring structural changes of the Y chromosomes are very complex, and often rather unique. Therefore, a single Y/A marker chromosome may be used solely to identify a cell line; cell lines with the unique aberration(s) can be collated to construct a Y segment sequential panel for mapping genes; and the unique Y/A translocations can be used to discriminate a DNA segment at multiple sites on the Y chromosome arm simultaneously.

  11. Sequence, genomic structure, and chromosomal assignment of human DOC-2

    SciTech Connect

    Albertsen, H.M.; Williams, B.; Smith, S.A.

    1996-04-15

    DOC-2 is a human gene originally identified as a 767-bp cDNA fragment isolated from normal ovarian epithelial cells by differential display against ovarian carcinoma cells. We have now determined the complete cDNA sequence of the 3.2-kb DOC-2 transcript and localized the gene to chromosome 5. A 12.5-kb genomic fragment at the 5{prime}-end of DOC-2 has also been sequenced, revealing the intron-exon structure of the first eight exons (788 bases) of the DOC-2 gene. Translation of the DOC-2 cDNA predicts a hydrophobic protein of 770 amino acid residues with a molecular weight of 82.5 kDa. Comparison of the DNA and amino acid sequences of DOC-2 to publicly accessible sequence data-bases revealed 83% identity to p96, a murine-responsive phosphoprotein. In addition, about 45% identity was observed between the first 140 N-terminal residues of DOC-2 and the Caenorhabditas elegans M110.5 and Drosophila melanoaster Dab genes. 14 refs., 3 figs.

  12. The TP53 dependence of radiation-induced chromosome instability in human lymphoblastoid cells

    NASA Technical Reports Server (NTRS)

    Schwartz, Jeffrey L.; Jordan, Robert; Evans, Helen H.; Lenarczyk, Marek; Liber, Howard

    2003-01-01

    The dose and TP53 dependence for the induction of chromosome instability were examined in cells of three human lymphoblastoid cell lines derived from WIL2 cells: TK6, a TP53-normal cell line, NH32, a TP53-knockout created from TK6, and WTK1, a WIL2-derived cell line that spontaneously developed a TP53 mutation. Cells of each cell line were exposed to (137)Cs gamma rays, and then surviving clones were isolated and expanded in culture for approximately 35 generations before the frequency and characteristics of the instability were analyzed. The presence of dicentric chromosomes, formed by end-to-end fusions, served as a marker of chromosomal instability. Unexposed TK6 cells had low levels of chromosomal instability (0.002 +/- 0.001 dicentrics/cell). Exposure of TK6 cells to doses as low as 5 cGy gamma rays increased chromosome instability levels nearly 10-fold to 0.019 +/- 0.008 dicentrics/cell. There was no further increase in instability levels beyond 5 cGy. In contrast to TK6 cells, unexposed cultures of WTK1 and NH32 cells had much higher levels of chromosome instability of 0.034 +/- 0.007 and 0.041 +/- 0.009, respectively, but showed little if any effect of radiation on levels of chromosome instability. The results suggest that radiation exposure alters the normal TP53-dependent cell cycle checkpoint controls that recognize alterations in telomere structure and activate apoptosis.

  13. Paternal Age and Numerical Chromosome Abnormalities in Human Spermatozoa.

    PubMed

    Donate, Anna; Estop, Anna M; Giraldo, Jesús; Templado, Cristina

    2016-01-01

    This study explores the relationship between numerical chromosome abnormalities in sperm and age in healthy men. We performed FISH in the spermatozoa of 10 donors from the general population: 5 men younger than 40 years of age and 5 fertile men older than 60 years of age. For each chromosome, 1,000 sperm nuclei were analyzed, with a total of 15,000 sperm nuclei for each donor. We used a single sperm sample per donor, thus minimizing intra-donor variability and optimizing consistent analysis. FISH with a TelVysion assay, which provides data on aneuploidy of 19 chromosomes, was used in order to gain a more genome-wide perspective of the level of aneuploidy. Aneuploidy and diploidy rates observed in the younger and older groups were compared. There were no significant differences in the incidence of autosomal disomy, sex chromosome disomy, total chromosome disomy, diploidy, nor total numerical abnormalities between younger and older men. This work confirms that aneuploidy of the sex chromosomes is more common than that of autosomes and that this does not change with age. Our results suggest that some probe combinations have a tendency to indicate higher levels of diploidy, thus potentially affecting FISH results and highlighting the limitations of FISH. PMID:27322585

  14. Defined chromosomal assignment of CLN5 demonstrates that at least four genetic loci are involved in the pathogenesis of human ceroid lipofuscinoses

    SciTech Connect

    Savukoski, M.; Peltonen, L.; Santavuori, P.; Kestilae, M. |; Williams, R.; Jaervelae, I.; Sharp, J.; Harris, J.; Gardiner, M.

    1994-10-01

    We demonstrate here that at least four genetically separate loci are involved in the pathogenesis of human neuronal ceroid lipofuscinoses (NCLs), fatal brain disorders of children. Earlier the assignments of the infantile and juvenile subtypes of NCL to 1p32 and 16p12 had revealed two loci; and here a variant subtype of the late-infantile form of NCL is mapped to a well-defined region on 13q21.1-q32, whereas the clinically similar, classical form of late-infantile NCL was found to represent the fourth, yet-unidentified NCL locus. The linkage disequilibrium was crucial for locus assignment in our highly limited family material, and the data exemplify the significance of this phenomenon in the random mapping of rare human diseases. 22 refs., 4 figs., 3 tabs.

  15. A complex chromosomal rearrangement involving chromosomes 2, 5, and X in autism spectrum disorder.

    PubMed

    Griesi-Oliveira, Karina; Moreira, Danielle de Paula; Davis-Wright, Nicole; Sanders, Stephan; Mason, Christopher; Orabona, Guilherme Müller; Vadasz, Estevão; Bertola, Débora Romeo; State, Matthew W; Passos-Bueno, Maria Rita

    2012-07-01

    Here, we describe a female patient with autism spectrum disorder and dysmorphic features that harbors a complex genetic alteration, involving a de novo balanced translocation t(2;X)(q11;q24), a 5q11 segmental trisomy and a maternally inherited isodisomy on chromosome 5. All the possibly damaging genetic effects of such alterations are discussed. In light of recent findings on ASD genetic causes, the hypothesis that all these alterations might be acting in orchestration and contributing to the phenotype is also considered.

  16. [Developing a physical map of human chromosome 22]. Progress report

    SciTech Connect

    Simon, M.I.

    1991-12-31

    We have developed bacterial F-factor based systems for cloning large fragments of human DNA in E. coli. In addition to large size, these systems are capable of maintaining human DNA with a high degree of stability. The cosmid size clones are called Fosmids and the clones containing larger inserts (100--200 kb) are called bacterial artificial chromosomes (BACs). The ultimate test of the effectiveness of cloning and mapping technology is the degree to which it can be efficiently applied to solve complex mapping problems. We, therefore, plan to use the large fragment cloning procedure as well as a variety of other approaches to generate a complete map of overlapping clones corresponding to human chromosome 22. We have thus far prepared two human chromosome 22 specific Fosmid libraries and we are in the process of constructing a chromosome 22 specific BAC library composed of fragments larger than 100 kb. We will further optimize the technology so that libraries of fragments larger than 200 kb can be readily prepared.

  17. (Developing a physical map of human chromosome 22)

    SciTech Connect

    Simon, M.I.

    1991-01-01

    We have developed bacterial F-factor based systems for cloning large fragments of human DNA in E. coli. In addition to large size, these systems are capable of maintaining human DNA with a high degree of stability. The cosmid size clones are called Fosmids and the clones containing larger inserts (100--200 kb) are called bacterial artificial chromosomes (BACs). The ultimate test of the effectiveness of cloning and mapping technology is the degree to which it can be efficiently applied to solve complex mapping problems. We, therefore, plan to use the large fragment cloning procedure as well as a variety of other approaches to generate a complete map of overlapping clones corresponding to human chromosome 22. We have thus far prepared two human chromosome 22 specific Fosmid libraries and we are in the process of constructing a chromosome 22 specific BAC library composed of fragments larger than 100 kb. We will further optimize the technology so that libraries of fragments larger than 200 kb can be readily prepared.

  18. Construction of DNA libraries from flow sorted human chromosomes

    SciTech Connect

    Deaven, L.L.; McCormick, M.K.; Grady, D.L.

    1994-09-01

    We have constructed a series of DNA libraries from flow-sorted chromosomes. Small insert, complete digest libraries cloned into the EcoRI insertion site of Charon 21A are available from the American Type Culture Collection, Rockville, MD. Partial digest libraries cloned into cosmid (sCos1) or phage (Charon 40) vectors have been constructed for chromosomes 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, X and Y. Purity estimates by in situ analysis of sorted chromosomes, flow karyotype analysis, and plaque or colony hybridization indicate that most of these libraries are 90-95% pure. Additional cosmid library constructions, 5-10X arrays of libraries into microtiter plates, and high density membrane arrays of libraries are in progress. Recently, we have completed YAC libraries for chromosomes 5, 9, 16, and 21. These libraries are made from complete DNA digests using the rare cutters Clal, SacII, EagI, or NotI/NheI. The average insert size is {similar_to}200 kb, and chimera frequencies are low (1-10%). Libraries have also been constructed using M13 or bluescript vectors (chromosomes 5, 7, 17) to generate STS markers for the selection of chromosome-specific inserts from total genomic AC libraries. Because of the advantages of insert size and stability associated with BAC and PAC cloning systems, we are currently attempting to adapt pBAC108L and pCYPAC1 vectors for use with flow-sorted chromosomal DNA.

  19. Molecular characterization of the pericentric inversion that causes differences between chimpanzee chromosome 19 and human chromosome 17.

    PubMed

    Kehrer-Sawatzki, Hildegard; Schreiner, Bettina; Tänzer, Simone; Platzer, Matthias; Müller, Stefan; Hameister, Horst

    2002-08-01

    A comparison of the human genome with that of the chimpanzee is an attractive approach to attempts to understand the specificity of a certain phenotype's development. The two karyotypes differ by one chromosome fusion, nine pericentric inversions, and various additions of heterochromatin to chromosomal telomeres. Only the fusion, which gave rise to human chromosome 2, has been characterized at the sequence level. During the present study, we investigated the pericentric inversion by which chimpanzee chromosome 19 differs from human chromosome 17. Fluorescence in situ hybridization was used to identify breakpoint-spanning bacterial artificial chromosomes (BACs) and plasmid artificial chromosomes (PACs). By sequencing the junction fragments, we localized breakpoints in intergenic regions rich in repetitive elements. Our findings suggest that repeat-mediated nonhomologous recombination has facilitated inversion formation. No addition or deletion of any sequence element was detected at the breakpoints or in the surrounding sequences. Next to the break, at a distance of 10.2-39.1 kb, the following genes were found: NGFR and NXPH3 (on human chromosome 17q21.3) and GUC2D and ALOX15B (on human chromosome 17p13). The inversion affects neither the genomic structure nor the gene-activity state with regard to replication timing of these genes.

  20. Characterization of human PGD blastocysts with unbalanced chromosomal translocations and human embryonic stem cell line derivation?

    PubMed

    Frydman, N; Féraud, O; Bas, C; Amit, M; Frydman, R; Bennaceur-Griscelli, A; Tachdjian, G

    2009-01-01

    Novel embryonic stem cell lines derived from embryos carrying structural chromosomal abnormalities obtained after preimplantation genetic diagnosis (PGD) are of interest to study in terms of the influence of abnormalities on further development. A total of 22 unbalanced blastocysts obtained after PGD were analysed for structural chromosomal defects. Morphological description and chromosomal status of these blastocysts was established and they were used to derive human embryonic stem cell (ESC) lines. An outgrowth of cells was observed for six blastocysts (6/22; 27%). For two blastocysts, the exact morphology was unknown since they were at early stage, and for four blastocysts, the inner cell mass was clearly visible. Fifteen blastocysts carried an unbalanced chromosomal defect linked to a reciprocal translocation, resulting in a positive outgrowth of cells for five blastocysts. One human ESC line was obtained from a blastocyst carrying a partial chromosome-21 monosomy and a partial chromosome-1 trisomy. Six blastocysts carried an unbalanced chromosomal defect linked to a Robertsonian translocation, and one showed a positive outgrowth of cells. One blastocyst carried an unbalanced chromosomal defect linked to an insertion and no outgrowth was observed. The efficiency of deriving human ESC lines with constitutional chromosomal disorders was low and probably depends on the initial morphological aspect of the blastocysts and/or the type of the chromosomal disorders.

  1. Molecular characterization of the pericentric inversion of chimpanzee chromosome 11 homologous to human chromosome 9.

    PubMed

    Kehrer-Sawatzki, Hildegard; Szamalek, Justyna M; Tänzer, Simone; Platzer, Matthias; Hameister, Horst

    2005-05-01

    In addition to the fusion of human chromosome 2, nine pericentric inversions are the most conspicuous karyotype differences between humans and chimpanzees. In this study we identified the breakpoint regions of the pericentric inversion of chimpanzee chromosome 11 (PTR 11) homologous to human chromosome 9 (HSA 9). The break in homology between PTR 11p and HSA 9p12 maps to pericentromeric segmental duplications, whereas the breakpoint region orthologous to 9q21.33 is located in intergenic single-copy sequences. Close to the inversion breakpoint in PTR 11q, large blocks of alpha satellites are located, which indicate the presence of the centromere. Since G-banding analysis and the comparative BAC analyses performed in this study imply that the inversion breaks occurred in the region homologous to HSA 9q21.33 and 9p12, but not within the centromere, the structure of PTR 11 cannot be explained by a single pericentric inversion. In addition to this pericentric inversion of PTR 11, further events like centromere repositioning or a second smaller inversion must be assumed to explain the structure of PTR 11 compared with HSA 9.

  2. GANP protein encoded on human chromosome 21/mouse chromosome 10 is associated with resistance to mammary tumor development.

    PubMed

    Kuwahara, Kazuhiko; Yamamoto-Ibusuki, Mutsuko; Zhang, Zhenhuan; Phimsen, Suchada; Gondo, Naomi; Yamashita, Hiroko; Takeo, Toru; Nakagata, Naomi; Yamashita, Daisuke; Fukushima, Yoshimi; Yamamoto, Yutaka; Iwata, Hiroji; Saya, Hideyuki; Kondo, Eisaku; Matsuo, Keitaro; Takeya, Motohiro; Iwase, Hirotaka; Sakaguchi, Nobuo

    2016-04-01

    Human chromosome 21 is known to be associated with the high risk of hematological malignancy but with resistance to breast cancer in the study of Down syndrome. In human cancers, we previously observed the significant alterations of the protein expression encoded by the ganp/MCM3AP gene on human chromosome 21q22.3. Here, we investigated GANP protein alterations in human breast cancer samples (416 cases) at various stages by immunohistochemical analysis. This cohort study clearly showed that expression of GANP is significantly decreased in human breast cancer cases with poor prognosis as an independent risk factor (relapse-free survival, hazard ratio = 2.37, 95% confidence interval, 1.27-4.42, P = 0.007 [univariate analysis]; hazard ratio = 2.70, 95% confidence interval, 1.42-5.13, P = 0.002 [multivariate analysis]). To investigate whether the altered GANP expression is associated with mammary tumorigenesis, we created mutant mice that were conditionally deficient in the ganp/MCM3AP gene using wap-cre recombinase transgenic mice. Mammary gland tumors occurred at a very high incidence in female mammary gland-specific GANP-deficient mice after severe impairment of mammary gland development during pregnancy. Moreover, tumor development also occurred in female post parous GANP-heterodeficient mice. GANP has a significant role in the suppression of DNA damage caused by estrogen in human breast cancer cell lines. These results indicated that the GANP protein is associated with breast cancer resistance. PMID:26749495

  3. The sequence and analysis of duplication rich human chromosome 16

    SciTech Connect

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  4. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    DOE R&D Accomplishments Database

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  5. Report on the Second International Workshop on Human Chromosome 9

    SciTech Connect

    Kwiatkowski, D.J.; Armour, J.; Bale, A.E.

    1993-12-31

    The Second International Workshop on Human Chromosome 9 was held in Chatham, Massachusetts on April 18--20, 1993. Fifty-three abstracts were received and the data presented on posters. The purpose of the meeting was to bring together all interested investigators working on the map of chromosome 9, many of whom had disease-specific interests. After a brief presentation of interests and highlighted results, the meeting broke up into the following subgroups for production of consensus maps: 9p; 9cen-q32; 9q32 ter. A global mapping group also met. Reports of each of these working groups is presented in the summary.

  6. M-BAND Study of Radiation-Induced Chromosome Aberrations in Human Epithelial Cells: Radiation Quality and Dose Rate Effects

    NASA Technical Reports Server (NTRS)

    Hada, Megumi; Cucinotta, Francis; Wu, Honglu

    2009-01-01

    The advantage of the multicolor banding in situ hybridization (mBAND) technique is its ability to identify both inter- (translocation to unpainted chromosomes) and intra- (inversions and deletions within a single painted chromosome) chromosome aberrations simultaneously. To study the detailed rearrangement of low- and high-LET radiation induced chromosome aberrations in human epithelial cells (CH184B5F5/M10) in vitro, we performed a series of experiments with Cs-137 gamma rays of both low and high dose rates, neutrons of low dose rate and 600 MeV/u Fe ions of high dose rate, with chromosome 3 painted with multi-binding colors. We also compared the chromosome aberrations in both 2- and 3-dimensional cell cultures. Results of these experiments revealed the highest chromosome aberration frequencies after low dose rate neutron exposures. However, detailed analysis of the radiation induced inversions revealed that all three radiation types induced a low incidence of simple inversions. Most of the inversions in gamma-ray irradiated samples were accompanied by other types of intra-chromosomal aberrations but few inversions were accompanied by inter-chromosomal aberrations. In contrast, neutrons and Fe ions induced a significant fraction of inversions that involved complex rearrangements of both inter- and intrachromosomal exchanges. The location of the breaks involved in chromosome exchanges was analyzed along the painted chromosome. The breakpoint distribution was found to be randomly localized on chromosome 3 after neutron or Fe ion exposure, whereas non-random distribution with clustering breakpoints was observed after -ray exposure. Our comparison of chromosome aberration yields between 2- and 3-dimensional cell cultures indicated a significant difference for gamma exposures, but not for Fe ion exposures. These experimental results indicated that the track structure of the radiation and the cellular/chromosome structure can both affect radiation-induced chromosome

  7. Chromosomal aberrations induced by in vitro irradiation: comparisons between human sperm and lymphocytes

    SciTech Connect

    Brandriff, B.F.; Gordon, L.A.; Ashworth, L.K.; Carrano, A.V.

    1988-01-01

    Types and frequencies of structural aberrations in human sperm and lymphocyte chromosomes from one donor were compared after in vitro irradiation with 100, 200, and 400 rad in order to determine if cells with dramatically different chromatin configurations are similarly affected and to investigate the feasibility of using lymphocytes as surrogates for germ cells in risk estimation. Sperm chromosomes were analyzed after fusion with eggs from the golden hamster. Total frequencies of induced aberrations were similar in the two cell types. However, the relative frequencies of rejoined lesions (dicentrics), compared with unrejoined lesions (chromosome breaks and acentric fragments), were different. At the three doses tested, a constant ratio of 5 dicentrics in lymphocytes for every dicentric in sperm was induced. Conversely, for every chromosome break or acentric fragment induced in lymphocytes, 1.7 such events were induced in sperm at the three doses tested.

  8. Identification, genome mapping, and CTCF binding of potential insulators within the FXYD5-COX7A1 locus of human chromosome 19q13.12.

    PubMed

    Akopov, Sergey B; Ruda, Vera M; Batrak, Vera V; Vetchinova, Anna S; Chernov, Igor P; Nikolaev, Lev G; Bode, Jürgen; Sverdlov, Eugene D

    2006-10-01

    Identification of insulators is one of the most difficult problems in functional mapping of genomes. For this reason, up to now only a few insulators have been described. In this article we suggest an approach that allows direct isolation of insulators by a simple positive-negative selection based on blocking enhancer effects by insulators. The approach allows selection of fragments capable of blocking enhancers from mixtures of genomic fragments prepared from up to 1-Mb genomic regions. Using this approach, a 1-Mb human genome locus was analyzed and eight potential insulators were selected. Five of the eight sequences were positioned in intergenic regions and two were within introns. The genes of the alpha-polypeptide H+/K+ exchanging ATPase (ATP4A) and amyloid beta (A4) precursor-like protein 1 (APLP1) within the locus studied were found to be flanked by insulators on both sides. Both genes are characterized by distinct tissue-specific expression that differs from the tissue specificity of the surrounding genes. The data obtained are consistent with the conception that insulators subdivide genomic DNA into loop domains that comprise genes characterized by similar expression profiles. Using chromatin immunoprecipitation assay, we demonstrated also that at least six of the putative insulators revealed in this work could bind the CTCF transcription factor in vivo. We believe that the proposed approach could be a useful instrument for functional analysis of genomes.

  9. Identification, genome mapping, and CTCF binding of potential insulators within the FXYD5-COX7A1 locus of human chromosome 19q13.12.

    PubMed

    Akopov, Sergey B; Ruda, Vera M; Batrak, Vera V; Vetchinova, Anna S; Chernov, Igor P; Nikolaev, Lev G; Bode, Jürgen; Sverdlov, Eugene D

    2006-10-01

    Identification of insulators is one of the most difficult problems in functional mapping of genomes. For this reason, up to now only a few insulators have been described. In this article we suggest an approach that allows direct isolation of insulators by a simple positive-negative selection based on blocking enhancer effects by insulators. The approach allows selection of fragments capable of blocking enhancers from mixtures of genomic fragments prepared from up to 1-Mb genomic regions. Using this approach, a 1-Mb human genome locus was analyzed and eight potential insulators were selected. Five of the eight sequences were positioned in intergenic regions and two were within introns. The genes of the alpha-polypeptide H+/K+ exchanging ATPase (ATP4A) and amyloid beta (A4) precursor-like protein 1 (APLP1) within the locus studied were found to be flanked by insulators on both sides. Both genes are characterized by distinct tissue-specific expression that differs from the tissue specificity of the surrounding genes. The data obtained are consistent with the conception that insulators subdivide genomic DNA into loop domains that comprise genes characterized by similar expression profiles. Using chromatin immunoprecipitation assay, we demonstrated also that at least six of the putative insulators revealed in this work could bind the CTCF transcription factor in vivo. We believe that the proposed approach could be a useful instrument for functional analysis of genomes. PMID:17019650

  10. Human chromosome 3 mediates growth arrest and suppression of apoptosis in microcell hybrids.

    PubMed Central

    Speevak, M D; Chevrette, M

    1996-01-01

    Chemotherapeutic treatment of tumor cells leads either to tumor cell death (usually by apoptosis) or to the formation of drug-resistant subpopulations. Known mechanisms of cancer cell drug resistance include gene amplification and increased expression of drug transporters. On the other hand, normal cells survive many forms of chemotherapy with minimal damage probably because of their capacity for growth arrest and stringent control of apoptosis. Microcell hybrids between B78 (murine melanoma) and HSF5 (normal human fibroblasts) were analyzed to identify a new human chromosomal region involved in the promotion of drug-induced growth arrest and suppression of apoptosis. In these hybrids, the presence of human chromosome 3 was strongly associated with suppression of apoptosis via G1 and G2 growth arrest during exposure to the antimetabolite N-phosphonoacetyl-L-aspartate (PALA), suggesting that a gene(s) on chromosome 3 serves an antiproliferative role in a drug-responsive growth arrest pathway. PMID:8628288

  11. Large-scale oscillation of structure-related DNA sequence features in human chromosome 21

    NASA Astrophysics Data System (ADS)

    Li, Wentian; Miramontes, Pedro

    2006-08-01

    Human chromosome 21 is the only chromosome in the human genome that exhibits oscillation of the (G+C) content of a cycle length of hundreds kilobases (kb) ( 500kb near the right telomere). We aim at establishing the existence of a similar periodicity in structure-related sequence features in order to relate this (G+C)% oscillation to other biological phenomena. The following quantities are shown to oscillate with the same 500kb periodicity in human chromosome 21: binding energy calculated by two sets of dinucleotide-based thermodynamic parameters, AA/TT and AAA/TTT bi- and tri-nucleotide density, 5'-TA-3' dinucleotide density, and signal for 10- or 11-base periodicity of AA/TT or AAA/TTT. These intrinsic quantities are related to structural features of the double helix of DNA molecules, such as base-pair binding, untwisting or unwinding, stiffness, and a putative tendency for nucleosome formation.

  12. Structure and chromosomal localization of the gene encoding the human myelin protein zero (MPZ)

    SciTech Connect

    Hayasaka, Kiyoshi; Himoro, Masato; Takada, Goro ); Wang, Yimin; Takata, Mizuho; Minoshima, Shinsei; Shimizu, Nobuyoshi; Miura, Masayuki; Uyemura, Keiichi )

    1993-09-01

    The authors describe the cloning, characterization, and chromosomal mapping of the human myelin protein zero (MPZ) gene (a structural protein of myelin and an adhesive glycoprotein of the immunoglobulin superfamily). The gene is about 7 kb long and consists of six exons corresponding of the functional domains. All exon-intron junction sequences conform to the GT/AG rule. The 5[prime]-flanking region of the gene has a TA-rich element (TATA-like box), two CAAT boxes, and a single defined transcription initiation site detected by the primer extension method. The gene for human MPZ was assigned to chromosome 1q22-q23 by spot blot hybridization of flow-sorted human chromosomes and fluorescence in situ hybridization. The localization of the MPZ gene coincides with the locus for Charcot-Marie-Tooth disease type 1B, determined by linkage analysis. 20 refs., 3 figs., 1 tab.

  13. Hexavalent chromium induces chromosome instability in human urothelial cells.

    PubMed

    Wise, Sandra S; Holmes, Amie L; Liou, Louis; Adam, Rosalyn M; Wise, John Pierce

    2016-04-01

    Numerous metals are well-known human bladder carcinogens. Despite the significant occupational and public health concern of metals and bladder cancer, the carcinogenic mechanisms remain largely unknown. Chromium, in particular, is a metal of concern as incidences of bladder cancer have been found elevated in chromate workers, and there is an increasing concern for patients with metal hip implants. However, the impact of hexavalent chromium (Cr(VI)) on bladder cells has not been studied. We compared chromate toxicity in two bladder cell lines; primary human urothelial cells and hTERT-immortalized human urothelial cells. Cr(VI) induced a concentration- and time-dependent increase in chromosome damage in both cell lines, with the hTERT-immortalized cells exhibiting more chromosome damage than the primary cells. Chronic exposure to Cr(VI) also induced a concentration-dependent increase in aneuploid metaphases in both cell lines which was not observed after a 24h exposure. Aneuploidy induction was higher in the hTERT-immortalized cells. When we correct for uptake, Cr(VI) induces a similar amount of chromosome damage and aneuploidy suggesting that the differences in Cr(VI) sensitivity between the two cells lines were due to differences in uptake. The increase in chromosome instability after chronic chromate treatment suggests this may be a mechanism for chromate-induced bladder cancer, specifically, and may be a mechanism for metal-induced bladder cancer, in general. PMID:26908176

  14. Hexavalent chromium induces chromosome instability in human urothelial cells.

    PubMed

    Wise, Sandra S; Holmes, Amie L; Liou, Louis; Adam, Rosalyn M; Wise, John Pierce

    2016-04-01

    Numerous metals are well-known human bladder carcinogens. Despite the significant occupational and public health concern of metals and bladder cancer, the carcinogenic mechanisms remain largely unknown. Chromium, in particular, is a metal of concern as incidences of bladder cancer have been found elevated in chromate workers, and there is an increasing concern for patients with metal hip implants. However, the impact of hexavalent chromium (Cr(VI)) on bladder cells has not been studied. We compared chromate toxicity in two bladder cell lines; primary human urothelial cells and hTERT-immortalized human urothelial cells. Cr(VI) induced a concentration- and time-dependent increase in chromosome damage in both cell lines, with the hTERT-immortalized cells exhibiting more chromosome damage than the primary cells. Chronic exposure to Cr(VI) also induced a concentration-dependent increase in aneuploid metaphases in both cell lines which was not observed after a 24h exposure. Aneuploidy induction was higher in the hTERT-immortalized cells. When we correct for uptake, Cr(VI) induces a similar amount of chromosome damage and aneuploidy suggesting that the differences in Cr(VI) sensitivity between the two cells lines were due to differences in uptake. The increase in chromosome instability after chronic chromate treatment suggests this may be a mechanism for chromate-induced bladder cancer, specifically, and may be a mechanism for metal-induced bladder cancer, in general.

  15. Human chromosome-specific DNA libraries: construction and availability

    SciTech Connect

    Van Dilla, M.A.; Deaven, L.L.; Albright, K.L.; Allen, N.A.; Aubuchon, M.R.; Bartholdi, M.F.; Brown, N.C.; Campbell, E.W.; Carrano, A.V.; Clark, L.M.; Cram, L.S.

    1986-06-01

    The goal of the National Laboratory Gene Library Project at the Los Alamos and Lawrence Livermore National Laboratories is the production of chromosome-specific human gene libraries and their distribution to the scientific community for studies of the molecular biology of genes and chromosomes, and for the study and diagnosis of genetic disease. The specific aim of Phase I of the project is the production of complete digest (4 kb average insert size) libraries from each of the 24 human chromosomal types purified by flow sorting. The bacteriophage vector is Charon 21A, which has both Eco R1 and Hind III insertion sites accommodating human DNA fragments up to 9.1 kb in size. Each laboratory has undertaken production of a complete set of chromosome-specific libraries, Los Alamos with Eco R1 and Livermore with Hind III; most of this task has now been accomplished. Close to 1200 library aliquots have been sent to about 300 laboratories world-wide through February 1986, at which time repository and distribution functions were transferred to the American Type Culture Collection, Rockville, MD. Following Phase I, libraries will be constructed with large inserts in a more advanced, recently developed bacteriophage vector (about 20 kb inserts) or in a cosmid vector (about 40 kb inserts), and with characteristics better suited to basic studies of gene structure and function.

  16. Distribution of Chromosome Breakpoints in Human Epithelial Cells Exposed to Low- and High-LET Radiations

    NASA Technical Reports Server (NTRS)

    Hada, Megumi; Cucinotta, Francis; Wu, Honglu

    2009-01-01

    The advantage of the multicolor banding in situ hybridization (mBAND) technique is not only its ability to identify simultaneously both inter- and intrachromosome exchanges, but also the ability to measure the breakpoint location along the length of the chromosome in a precision that is unmatched with other traditional banding techniques. Breakpoints on specific regions of a chromosome have been known to associate with specific cancers. The breakpoint distribution in cells after low- and high-LET radiation exposures will also provide the data for biophysical modeling of the chromatin structure, as well as the data for the modeling the formation of radiation-induced chromosome aberrations. In a series of experiments, we studied low- and high-LET radiation-induced chromosome aberrations using the mBAND technique with chromosome 3 painted in 23 different colored bands. Human epithelial cells (CH1 84B5F5/M10) were exposed in vitro to Cs- 137 rays at both low and high dose rates, secondary neutrons with a broad energy spectrum at a low dose rate and 600 MeV/u Fe ions at a high dose rate. The data of both inter- and intrachromosome aberrations involving the painted chromosome have been reported previously. Here we present data of the location of the chromosome breaks along the length of chromosome 3 in the cells after exposures to each of the four radiation scenarios. In comparison to the expected breakpoint distribution based on the length of the bands, the observed distribution appeared to be non-random for both the low- and high-LET radiations. In particular, hot spots towards both ends of the chromosome were found after low-LET irradiations of either low or high dose rates. For both high-LET radiation types (Fe ions and neutrons), the breakpoint distributions were similar, and were much smoother than that for low-LET radiation. The dependence of the breakpoint distribution on the radiation quality requires further investigations.

  17. Inferring human history in East Asia from Y chromosomes

    PubMed Central

    2013-01-01

    East Asia harbors substantial genetic, physical, cultural and linguistic diversity, but the detailed structures and interrelationships of those aspects remain enigmatic. This question has begun to be addressed by a rapid accumulation of molecular anthropological studies of the populations in and around East Asia, especially by Y chromosome studies. The current Y chromosome evidence suggests multiple early migrations of modern humans from Africa via Southeast Asia to East Asia. After the initial settlements, the northward migrations during the Paleolithic Age shaped the genetic structure in East Asia. Subsequently, recent admixtures between Central Asian immigrants and northern East Asians enlarged the genetic divergence between southern and northern East Asia populations. Cultural practices, such as languages, agriculture, military affairs and social prestige, also have impacts on the genetic patterns in East Asia. Furthermore, application of Y chromosome analyses in the family genealogy studies offers successful showcases of the utility of genetics in studying the ancient history. PMID:23731529

  18. Mapping of the taurine transporter gene to mouse chromosome 6 and to the short arm of human chromosome 3

    SciTech Connect

    Patel, A.; Uhl, G.R.; Gregor, P.

    1995-01-01

    Transport proteins have essential functions in the uptake of neurotransmitters and neuromodulators. We have mapped the gene encoding the taurine transporter, Taut, to the central region of mouse chromosome 6. Analysis of a cross segregating the neurological mutant mnd2 excluded Taut as a candidate gene for this closely linked mutation. To map the human taurine transporter gene, TAUT, a sequence-tagged site (STS) corresponding to the 3{prime} untranslated region of the human cDNA was developed. TAUT was assigned to human chromosome 3 by typing this STS on a panel of somatic cell hybrids. Further analysis of a hybrid panel containing defined deletions of chromosome 3 suggested that TAUT maps to 3p21-p25. These data extend a conserved linkage group on mouse chromosome 6 and human chromosome 3p. Deletion of TAUT might contribute to some phenotypic features of the 3p{sup -} syndrome. 32 refs., 3 figs.

  19. Chromosomal Instability in the progeny of human irradiated cells

    NASA Astrophysics Data System (ADS)

    Testard, I.; Boissière, A.; Martins, L. M.; Sabatier, L.

    Manned space missions recently increased in number and duration, thus it became important to estimate the biological risks encountered by astronauts. They are exposed to cosmic and galactic rays, a complex mixture of different radiations. In addition to the measurements realized by physical dosimeters, it becomes essential to estimate real biologically effective doses and compare them to physical doses. Biological dosimetry of radiation exposures has been widely performed using cytogenetic analysis of chromosomes. This approach has been used for many years in order to estimate absorbed doses in accidental or chronic overexposures of humans. Recent studies show that some alterations can appear many cell generations after the initial radiation exposure as a delayed genomic instability. This delayed instability is characterized by the accumulation of cell alterations leading to cell transformation, delayed cell death and mutations. Chromosome instability was shown in vitro in different model systems (Sabatier et al., 1992; Marder and Morgan, 1993; Kadhim et al., 1994 and Holmberg et al., 1993, 1995). All types of radiation used induce chromosome instability; however, heavy ions cause the most damage. The period of chromosome instability followed by the formation of clones with unbalanced karyotypes seems to be shared by cancer cells. The shortening of telomere sequences leading to the formation of telomere fusions is an important factor in the appearance of this chromosome instability.

  20. The DNA sequence and biology of human chromosome 19

    SciTech Connect

    Grimwood, J; Gordon, L A; Olsen, A; Terry, A; Schmutz, J; Lamerdin, J; Hellsten, U; Goodstein, D; Couronne, O; Tran-Gyamfi, M

    2004-04-06

    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high GC content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9% of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in Mendelian disorders, including familial hypercholesterolemia and insulin-resistant diabetes. Nearly one quarter of these genes belong to tandemly arranged families, encompassing more than 25% of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, and segments of coding and non-coding conservation with the distant fish species Takifugu.

  1. The DNA sequence and biology of human chromosome 19

    SciTech Connect

    Grimwood, Jane; Gordon, Laurie A.; Olsen, Anne; Terry, Astrid; Schmutz, Jeremy; Lamerdin, Jane; Hellsten, Uffe; Goodstein, David; Couronne, Olivier; Tran-Gyamfi, Mary; Aerts, Andrea; Altherr, Michael; Ashworth, Linda; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caenepeel, Sean; Carrano, Anthony; Caoile, Chenier; Chan, Yee Man; Christensen, Mari; Cleland, Catherine A.; Copeland, Alex; Dalin, Eileen; Dehal, Paramvir; Denys, Mirian; Detter, John C.; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Garcia, Carmen; Georgescu, Anca M.; Glavina, Tijana; Gomez, Maria; Gonzales, Eldelyn; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Ho, Issac; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Larionov, Vladimer; Leem, Sun-Hee; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Malfatti, Stephanie; Martinez, Diego; McCready, Paula; Medina, Catherine; Morgan, Jenna; Nelson, Kathryn; Nolan, Matt; Ovcharenko, Ivan; Pitluck, Sam; Pollard, Martin; Popkie, Anthony P.; Predki, Paul; Quan, Glenda; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanine; Salamov, Asaf; Salazar, Angelica; She, Xinwei; Smith, Doug; Slezak, Tom; Solovyev, Victor; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wagner, Mark; Wheeler, Jeremy; Wu, Kevin; Xie, Gary; Yang, Joan; Dubchak, Inna; Furey, Terrence S.; DeJong, Pieter; Dickson, Mark; Gordon, David; Eichler, Evan E.; Pennacchio, Len A.; Richardson, Paul; Stubbs, Lisa; Rokhsar, Daniel S.; Myers, Richard M.; Rubin, Edward M.; Lucas, Susan M.

    2003-09-15

    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high G1C content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9 percent of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in mendelian disorders, including familial hypercholesterolaemia and insulin-resistant diabetes. Nearly one-quarter of these genes belong to tandemly arranged families, encompassing more than 25 percent of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, a nd segments of coding and non-coding conservation with the distant fish species Takifugu.

  2. The mapping of novel genes to human chromosome 19

    SciTech Connect

    Buenaventura, J.M.

    1994-12-01

    The principle goal of our laboratory is the discovery of new genes on human chromosome 19. One of the strategies to achieve this goal is through the use of cDNA clones known as {open_quotes}expressed sequence tags{close_quotes} (ESTs). ESTs, short segments of sequence from a cDNA clone that correspond to the mRNA, occur as unique regions in the genome and, therefore, can be used as markers for specific positions. In collaboration with researchers from Genethon in France, fifteen cDNA clones from a normalized human infant brain cDNA library were tested and determined to map to chromosome 19. A verification procedure is then followed to confirm assignment to chromosome 19. First, primers for each cDNA clone are developed and then amplified by polymerase chain reaction from genomic DNA. Next, a {sup 32}P-radiolabeled probe is made by polymerase chain reaction for each clone and then hybridized against filters containing an LLNL chromosome 19-specific cosmid library to find putative locations on the chromosome. The location is then verified by running a polymerase chain reactions from the positive cosmids. With the Browser database at LLNL, additional information about the positive cosmids can be found. Through use of the BLAST database at the National Library of Medicine, homologous sequences to the clones can be found. Among the fifteen cDNA clones received from Genethon, all have been amplified by polymerase chain reaction. Three have turned out as repetitive elements in the genome. Ten have been mapped to specific locations on chromosome 19. Putative locations have been found for the remaining two clones and thus verification testing will proceed.

  3. Synteny mapping of five human chromosome 7 genes on bovine chromosomes 4 and 21.

    PubMed

    Antoniou, E; Womack, J E; Grosz, M D

    1999-01-01

    Five genes on human chromosome 7 (HSA 7) were assigned to bovine chromosome 21 (BTA 21) and 4 (BTA 4) using a bovine-rodent somatic hybrid cell panel. These five genes were alpha-I subunit of adenylate cyclase-inhibiting G-protein (GNAI1), alpha/beta preprotachykinin (TAC1), reelin (RELN), c-AMP dependant protein kinase type II beta regulatory chain (PRKAR2B) and apolipoprotein A1 regulatory protein 1 (TFCOUP2). Four genes mapped to BTA 4 (GNAI1, TAC1, RELN, PRKAR2B) while one gene mapped to BTA 21 (TFCOUP2). This study confirms the synteny conservation between HSA 7 and BTA 4, finely maps the breakpoints of conserved synteny on HSA 7 and defines a new synteny conservation between HSA 7 and BTA 21.

  4. Distal 5q trisomy resulting from an X;5 translocation detected by chromosome painting.

    PubMed

    Abuelo, D N; Ahsanuddin, A N; Mark, H F

    2000-10-23

    We describe the case of a 13-year-old girl with an apparently de novo unbalanced translocation resulting in the presence of additional chromosomal material on the short arm of one X chromosome, which was detected by conventional G-banding studies. Fluorescence in situ hybridization (FISH) using the Chromoprobe Multiprobe-M protocol confirmed that the additional chromosomal material originated from chromosome 5. The karyotype of this patient is now established to be 46,X,der(X) t(X;5)(p22.3;q33), with a deletion of Xp22.3-pter and partial trisomy of 5q33-qter. The distal 5q trisomy genotype has been associated with clinical signs that include growth and mental retardation, eczema, craniofacial anomalies, and malformations of heart, lungs, abdomen, limbs, and genitalia. Our patient also has short stature, a prominent nasal bridge, a flat philtrum, a thin upper lip, dental caries, and limb and cardiac malformations, but she appears to be mildly affected compared with previously reported cases. This is the first case of distal 5q trisomy arising from a translocation with the X chromosome. Replication studies on this patient show that the derivative t(X;5) chromosome is late replicating in almost all cells examined, which indicates that this chromosome is preferentially inactivated. However, the translocated segment of chromosome 5 appears to be early replicating, which implies that the trisomic 5q segment is transcriptionally active. We cannot determine from these studies whether all or only some genes in this segment are expressed, but this patient's relatively mild clinical signs suggest that the critical region(s) that contribute to the distal 5q trisomy phenotype are at least partly suppressed. A review of other patients with X-chromosome translocations indicates that many but not all of them also have attenuated phenotypes. The mechanism of inactivation of autosomal material attached to the X chromosome is complex, with varying effects on the phenotype of the

  5. Chromosomal analysis in young vs. senescent human fibroblasts by FISH

    SciTech Connect

    Mukheriee, A.B.; Thomas, S.

    1994-09-01

    Almost all previous studies on chromosomal analysis related to in vitro aging of human fibroblasts were done using only metaphase chromosomes. However, this procedure might provide only partial information since the aneuploidy presumably hidden in interphase cells would remain undetected. We, therefore, have analyzed aneuploidy both at interphase and at metaphase. Female (IMR-90) and male (IMR-91) cells were grown from the lowest to the highest population doubling levels and aneuploidy analysis was done by FISH with {alpha}-satellite DNA probes of 15 autosomes and 2 sex chromosomes. Our data on total aneuploidy in young cells indicate that significantly higher proportions of cells with aneuploidy are detected at interphase as opposed to metaphase. This presumably indicates that during active division of young cells, a greater proportion of cells with aneuploidy than diploidy is selected against entry to mitosis. In contrast, both cell strains at senescence exhibit significantly lower proportions of nuclei with aneuploidy at interphase as compared to that of young cells. This probably indicates that during senescense, a greater proportion of cells with aneuploidy than diploidy is selected against prolonged survival in culture. Our study shows that cellular dynamics with respect to aneuploidy involving various chromosomes differs significantly at interphase and at mitosis during in vitro aging of human fibroblasts.

  6. A FISH approach for mapping the human genome using Bacterial Artificial Chromosomes (BACs)

    SciTech Connect

    Hubert, R.S.; Chen, X.N.; Mitchell, S.

    1994-09-01

    As the Human Genome Project progresses, large insert cloning vectors such as BACs, P1, and P1 Artificial Chromosomes (PACs) will be required to complement the YAC mapping efforts. The value of the BAC vector for physical mapping lies in the stability of the inserts, the lack of chimerism, the length of inserts (up to 300 kb), the ability to obtain large amounts of pure clone DNA and the ease of BAC manipulation. These features helped us design two approaches for generating physical mapping reagents for human genetic studies. The first approach is a whole genome strategy in which randomly selected BACs are mapped, using FISH, to specific chromosomal bands. To date, 700 BACs have been mapped to single chromosome bands at a resolution of 2-5 Mb in addition to BACs mapped to 14 different centromeres. These BACs represent more than 90 Mb of the genome and include >70% of all human chromosome bands at the 350-band level. These data revealed that >97% of the BACs were non-chimeric and have a genomic distribution covering most gaps in the existing YAC map with excellent coverage of gene-rich regions. In the second approach, we used YACs to identify BACs on chromosome 21. A 1.5 Mb contig between D21S339 and D21S220 nears completion within the Down syndrome congenital heart disease (DS-CHD) region. Seventeen BACs ranging in size from 80 kb to 240 kb were ordered using 14 STSs with FISH confirmation. We have also used 40 YACs spanning 21q to identify, on average, >1 BAC/Mb to provide molecular cytogenetic reagents and anchor points for further mapping. The contig generated on chromosome 21 will be helpful in isolating the genes for DS-CHD. The physical mapping reagents generated using the whole genome approach will provide cytogenetic markers and mapped genomic fragments that will facilitate positional cloning efforts and the identification of genes within most chromosomal bands.

  7. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai

    2010-03-01

    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  8. [Intraspecific chromosomal variability in human pathogenic fungi, especially in Histoplasma capsulatum].

    PubMed

    Romero-Martínez, Rafael; Canteros, Cristina; Taylor, Maria Lucia

    2004-12-01

    The ploidy, karyotype, and chromosome length polymorphism (CLP) of human pathogenic fungi were revised with emphasis on Histoplasma capsulatum, the causative agent of the systemic mycosis, histoplasmosis. Currently, different systems of gel electrophoresis are being used to determine fungal electrokaryotypes (EK). By renaturation kinetic and genomic reconstruction in H. capsulatum strains (G-186AS and Downs), estimated genome sizes of 23 and 32 Mb were determined for both strains, respectively. The haploid state was proposed for both strains, although aneuploidy was suggested for the Downs strain. Contour-clamped homogeneous electric field (CHEF), field inversion gel electrophoresis (FIGE), and Southern blot using different probes showed the presence of six to seven chromosomes in the Downs strain (low virulence), whereas four chromosomes were identified in the G-186B strain (high virulence). The use of these methods in the three major H. capsulatum reference strains (G-217B and Downs from the United States of America, G-186B from Panama) revealed distinct chromosome sizes, from 0.5 to 5.7 Mb, with CLP associated with chromosomes size and mobility. Recently, by CHEF, using 19 H. capsulatum isolates from Latin-America and the G-186B strain, five to seven chromosomes with 1.1 to 11.2 Mb molecular sizes were revealed, which again suggested CLP in H. capsulatum. However, to elucidate the EKs polymorphism in H. capsulatum and its relationship with the isolates phenotype more studies are needed to understand the mechanisms controlling ploidy variability.

  9. Effects of alpha-particles on survival and chromosomal aberrations in human mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Durante, M.; Grossi, G. F.; Gialanella, G.; Pugliese, M.; Nappo, M.; Yang, T. C.

    1995-01-01

    We have studied the radiation responses of a human mammary epithelial cell line, H184B5 F5-1 M/10. This cell line was derived from primary mammary cells after treatment with chemicals and heavy ions. The F5-1 M/10 cells are immortal, density-inhibited in growth, and non-tumorigenic in athymic nude mice and represent an in vitro model of the human epithelium for radiation studies. Because epithelial cells are the target of alpha-particles emitted from radon daughters, we concentrated our studies on the efficiency of alpha-particles. Confluent cultures of M/10 cells were exposed to accelerated alpha-particles [beam energy incident at the cell monolayer = 3.85 MeV, incident linear energy transfer (LET) in cell = 109 keV/microns] and, for comparison, to 80 kVp x-rays. The following endpoints were studied: (1) survival, (2) chromosome aberrations at the first postirradiation mitosis, and (3) chromosome alterations at later passages following irradiation. The survival curve was exponential for alpha-particles (D0 = 0.73 +/- 0.04 Gy), while a shoulder was observed for x-rays (alpha/beta = 2.9 Gy; D0 = 2.5 Gy, extrapolation number 1.6). The relative biological effectiveness (RBE) of high-LET alpha-particles for human epithelial cell killing was 3.3 at 37% survival. Dose-response curves for the induction of chromosome aberrations were linear for alpha-particles and linearquadratic for x-rays. The RBE for the induction of chromosome aberrations varied with the type of aberration scored and was high (about 5) for chromosome breaks and low (about 2) for chromosome exchanges.(ABSTRACT TRUNCATED AT 250 WORDS).

  10. Synteny conservation of the Huntington's disease gene and surrounding loci on mouse Chromosome 5.

    PubMed

    Grosson, C L; MacDonald, M E; Duyao, M P; Ambrose, C M; Roffler-Tarlov, S; Gusella, J F

    1994-07-01

    The mouse homologs of the Huntington's disease (HD) gene and 17 other human Chromosome (Chr) 4 loci (including six previously unmapped) were localized by use of an interspecific cross. All loci mapped in a continuous linkage group on mouse Chr 5, distal to En2 and I16, whose human counterparts are located on Chr 7. The relative order of the loci on human Chr 4 and mouse Chr 5 was maintained, except for a break between D5H4S115E and Idua/rd, with relocation of the latter to the opposite end of the map. The mouse HD homolog (Hdh) mapped within a cluster of seven genes that were completely linked in our data set. In human these loci span a approximately 1.8 Mb stretch of human 4p16.3 that has been entirely cloned. To date, there is no phenotypic correspondence between human and mouse mutations mapping to this region of synteny conservation.

  11. Human sperm chromosomes. Long-term effect of cancer treatment

    SciTech Connect

    Genesca, A.; Caballin, M.R.; Miro, R.; Benet, J.; Bonfill, X.; Egozcue, J. )

    1990-06-01

    The long-term cytogenetic effect of radio- or chemotherapy or both on male germ cells was evaluated by study of the chromosomal abnormalities in spermatozoa of four men treated for cancer 5-18 years earlier. The cytogenetic analysis of 422 sperm metaphases showed no differences in the aneuploidy rate. The incidence of structural chromosome aberrations was 14.0%, however, which is much higher than in controls. Thus, the high incidence of structurally aberrant spermatozoa observed in our long-term study indicates that antitumoral treatments affect stem-cell spermatogonia and that aberrant cells can survive germinal selection and produce abnormal spermatozoa.

  12. The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) (CHC1) is localized to human chromosome 1p36.1

    SciTech Connect

    Nishimoto, T.; Seino, H.; Seki, N. |; Hori, T.A.

    1994-10-01

    The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) encodes a chromosomal protein of 45 kDa that has seven internal homologous repeats and functions as a guanine nucleotide releasing factor on the nuclear Ras-like small G protein. We report here the precise localization of the RCC1 gene to human chromosome 1p36.1. There is a conserved region of homology between the 1p36 region of human and a distal region of mouse chromosome 4. Thus, the assignment of the human gene encoding RCC1 adds another marker to the conserved region of homology between human chromosome 1p and mouse chromosome 4. 17 refs., 1 fig.

  13. YAC contig and cell hybrid mapping of six expressed sequences encoded by human chromosome 21

    SciTech Connect

    Yu, J.; Cox, M.; Patterson, D.

    1994-09-01

    The candidate gene approach for positional cloning requires a sufficient number of expressed gene sequences from the chromosomal region of interest. Trisomy for human chromosome 21 results in Down syndrome (DS). However, only a limited number of genes on chromosome 21 have been identified and cloned. We used 1,000 single-copy microclones from a microdissection library of chromosome 21 to screen various cDNA libraries and isolated 9 cDNA clones, of which 6 contain unique sequences: 21E-C1, C3, C4, C5, C7, C10. Using a refined regional mapping panel of chromosome 21 which comprised 24 cell hybrids and divided the chromosome into 33 subregions, we assigned 21E-C1 and C7 to subregion No. 22 (distal q22.1), 21E-C3 to No. 25 (proximal q22.2), 21E-C4 to No. 23 (very distal q22.1), 21E-C5 to No. 31 (proximal q22.3), and 21E-C10 to No. 28 (middle q22.2). In addition, we identified YAC clones corresponding to these cDNA clones using the complete YAC contig spanning the entire chromosome 21q. On the average, 10 positive YAC clones were identified for each cDNA. The mapping positions for the 6 cDNAs determined by the STSs in the YAC contig agree well with the cytogenetic map constructed by the hybrid panel. These cDNA clones with refined mapping positions on chromosome 21 should be useful as candidate genes for the specific component phenotypes of DS assigned to the region.

  14. Strict evolutionary conservation followed rapid gene loss on human and rhesus Y chromosomes.

    PubMed

    Hughes, Jennifer F; Skaletsky, Helen; Brown, Laura G; Pyntikova, Tatyana; Graves, Tina; Fulton, Robert S; Dugan, Shannon; Ding, Yan; Buhay, Christian J; Kremitzki, Colin; Wang, Qiaoyan; Shen, Hua; Holder, Michael; Villasana, Donna; Nazareth, Lynne V; Cree, Andrew; Courtney, Laura; Veizer, Joelle; Kotkiewicz, Holland; Cho, Ting-Jan; Koutseva, Natalia; Rozen, Steve; Muzny, Donna M; Warren, Wesley C; Gibbs, Richard A; Wilson, Richard K; Page, David C

    2012-02-22

    The human X and Y chromosomes evolved from an ordinary pair of autosomes during the past 200-300 million years. The human MSY (male-specific region of Y chromosome) retains only three percent of the ancestral autosomes' genes owing to genetic decay. This evolutionary decay was driven by a series of five 'stratification' events. Each event suppressed X-Y crossing over within a chromosome segment or 'stratum', incorporated that segment into the MSY and subjected its genes to the erosive forces that attend the absence of crossing over. The last of these events occurred 30 million years ago, 5 million years before the human and Old World monkey lineages diverged. Although speculation abounds regarding ongoing decay and looming extinction of the human Y chromosome, remarkably little is known about how many MSY genes were lost in the human lineage in the 25 million years that have followed its separation from the Old World monkey lineage. To investigate this question, we sequenced the MSY of the rhesus macaque, an Old World monkey, and compared it to the human MSY. We discovered that during the last 25 million years MSY gene loss in the human lineage was limited to the youngest stratum (stratum 5), which comprises three percent of the human MSY. In the older strata, which collectively comprise the bulk of the human MSY, gene loss evidently ceased more than 25 million years ago. Likewise, the rhesus MSY has not lost any older genes (from strata 1-4) during the past 25 million years, despite its major structural differences to the human MSY. The rhesus MSY is simpler, with few amplified gene families or palindromes that might enable intrachromosomal recombination and repair. We present an empirical reconstruction of human MSY evolution in which each stratum transitioned from rapid, exponential loss of ancestral genes to strict conservation through purifying selection.

  15. Maternal uniparental disomy for human chromosome 14, due to loss of a chromosome 14 from somatic cells with t(13; 14) trisomy 14

    SciTech Connect

    Antonarakis, S.E.; Blouin, J.L.; Maher, J.; Avramopoulos, D.; Thomas, G.; Talbot, C.C. Jr. )

    1993-06-01

    Uniparental disomy (UPD) for particular chromosomes is increasingly recognized as a cause of abnormal phenotypes in humans. The authors recently studied a 9-year-old female with a de novo Robertsonian translocation t(13;14), short stature, mild developmental delay, scoliosis, hyperextensible joints, hydrocephalus that resolved spontaneously during the first year of life, and hyperchloesterolemia. To determine the parental origin of chromosomes 13 and 14 in the proband, they have studied the genotypes of DNA polymorphic markers due to (GT)n repeats in the patient and her parents' blood DNA. The genotypes of markers D14S43, D14S45, D14S49, and D14S54 indicated maternal UPD for chromosome 14. There was isodisomy for proximal markers and heterodisomy for distal markers, suggesting a recombination event on maternal chromosomes 14. In addition, DNA analysis first revealed -- and subsequent cytogenetic analysis confirmed -- that there was mosaic trisomy 14 in 5% of blood lymphocytes. There was normal (biparental) inheritance for chromosome 13, and there was no evidence of false paternity in genotypes of 11 highly polymorphic markers on human chromosome 21. Two cases of maternal UPD for chromosome 14 have previously been reported, one with a familial rob t(13;14) and the other with a t(14;14). There are several similarities among these patients, and a [open quotes]maternal UPD chromosome 14 syndrome[close quotes] is emerging; however, the contribution of the mosaic trisomy 14 to the phenotype cannot be evaluated. The study of de novo Robertsonian translocations of the type reported here should reveal both the extent of UPD in these events and the contribution of particular chromosomes involved in certain phenotypes. 33 refs., 3 figs., 1 tab.

  16. A Comprehensive Survey of Human Y-Chromosomal Microsatellites

    PubMed Central

    Kayser, Manfred ; Kittler, Ralf ; Erler, Axel ; Hedman, Minttu ; Lee, Andrew C. ; Mohyuddin, Aisha ; Mehdi, S. Qasim ; Rosser, Zoë ; Stoneking, Mark ; Jobling, Mark A. ; Sajantila, Antti ; Tyler-Smith, Chris 

    2004-01-01

    We have screened the nearly complete DNA sequence of the human Y chromosome for microsatellites (short tandem repeats) that meet the criteria of having a repeat-unit size of ⩾3 and a repeat count of ⩾8 and thus are likely to be easy to genotype accurately and to be polymorphic. Candidate loci were tested in silico for novelty and for probable Y specificity, and then they were tested experimentally to identify Y-specific loci and to assess their polymorphism. This yielded 166 useful new Y-chromosomal microsatellites, 139 of which were polymorphic, in a sample of eight diverse Y chromosomes representing eight Y-SNP haplogroups. This large sample of microsatellites, together with 28 previously known markers analyzed here—all sharing a common evolutionary history—allowed us to investigate the factors influencing their variation. For simple microsatellites, the average repeat count accounted for the highest proportion of repeat variance (∼34%). For complex microsatellites, the largest proportion of the variance (again, ∼34%) was explained by the average repeat count of the longest homogeneous array, which normally is variable. In these complex microsatellites, the additional repeats outside the longest homogeneous array significantly increased the variance, but this was lower than the variance of a simple microsatellite with the same total repeat count. As a result of this work, a large number of new, highly polymorphic Y-chromosomal microsatellites are now available for population-genetic, evolutionary, genealogical, and forensic investigations. PMID:15195656

  17. A verified minimal YAC contig for human chromosome 21

    SciTech Connect

    Graw, S.L.; Patterson, D.; Drabkin, H.

    1994-09-01

    The goal of this project is the construction of a verified YAC contig of the complete long arm of human chromosome 21 utilizing YACs from the CEPH and St. Louis libraries. The YACs in this contig have been analyzed for size by PFGE, tested for chimerism by FISH or end-cloning, and verified for STS content by PCR. This last analysis has revealed a number of cases of conflict with the published STS order. To establish correct order, we have utilized STS content analysis of somatic cell hybrids containing portions of chromosome 21. Additional problems being addressed include completeness of coverage and possible deletions or gaps. Questions of completeness of the CEPH 810 YAC set arose after screening with 57 independently derived probes failed to identify clones for 11 (19%). Ten of the 11, however, do detect chromosome 21 cosmids when used to screen Lawrence Livermore library LL21NC02`G,` a cosmid library constructed from flow-sorted chromosomes 21. Remaining gaps in the contig are being closed by several methods. These include YAC fingerprinting and conversion of YACs to cosmids. In addition, we are establishing the overlap between the physical NotI map and the YAC contig by testing YACs for NotI sites and screening the YACs in the contig for the presence of NotI-linking clones.

  18. Detection of in-situ hybridization to human metaphase chromosomes by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Okamoto, Naoaki; Ishikawa, Mitsuru

    2000-04-01

    Detection of in situ hybridization to human metaphase chromosomes provides important information about gene mappings and about analysis of chromosomal disorders. We applied atomic force microscopy (AFM) to the detection of in situ hybridization to get better resolution as compared to light microscopy. Chromosomes were spread over a glass substrate and hybridized with DNA probes labeled with biotin or digoxigenin. The hybridized probes were reacted with streptavidin or anti-digoxigenin antibody, both of which were conjugated with 5-nm gold colloidal particles. We missed direct detection of the conjugated gold colloidal particles by micro-meter scale AFM scanning , but obtained clear topographic difference between the site of hybridization and the chromosome arm with the help of silver enhancement. We thus clearly detected the in situ hybridization using chromosome painting probes, alpha satellite probes, and locus specific gene probes by AFM. The in situ hybridization to DNA fiber was also detected by AFM. The detection of in situ hybridization by AFM has advantages over fluorescence in situ hybridization: no reduction of signal intensity under light irradiation. Application of AFM to the detection of in situ hybridization will be a useful method to analyze chromosomes.

  19. The human FGF9 gene maps to chromosomal region 13q11-q12

    SciTech Connect

    Mattei, M.G. Penault-Llorca, F.; Coulier, F.; Birnbaum, D.

    1995-10-10

    The FGF gene family (fibroblast growth factor) currently comprises nine members: FGF1 to FGF9. FGFs are peptide regulatory factors acting through four distinct tyrosine kinase receptors and involved in various biological processes during embryogenesis and adult life, including implantation, morphogenesis, angiogenesis, and possibly tumorigensis. To date the chromosomal localizations of only seven human FGF and eight mouse Fgf genes are known. They are localized in various areas of the human and mouse genomes, except for FGF3 and FGF4, which are tandemly linked on chromosome 11 in humans and 7 in mice. The determination of the chromosomal localization of FGF and FGF receptor genes has often been instrumental in linking human disease or mouse spontaneous mutations to molecular alterations and is therefore of particular interest. Radioactive chromosomal in situ hybridization was used to map the most recently isolated member of the family, FGF9, in the human genome. The probe for FGF9 was pFGF9-FP, a plasmid containing a 0.5-kb product of amplification by polymerase chain reaction derived from our previous experiments and subcloned into a Bluescript vector. In situ hybridization was performed according to published procedures. 9 refs., 1 fig.

  20. Chromosomal localization of the human vesicular amine transporter genes

    SciTech Connect

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. )

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  1. Mechanisms of chromosomal rearrangement in the human genome

    PubMed Central

    2010-01-01

    Many human cancers are associated with characteristic chromosomal rearrangements, especially hematopoietic cancers such as leukemias and lymphomas. The first and most critical step in the rearrangement process is the induction of two DNA double-strand breaks (DSB). In all cases, at least one of the two DSBs is generated by a pathologic process, such as (1) randomly-positioned breaks due to ionizing radiation, free radical oxidative damage, or spontaneous hydrolysis; (2) breaks associated with topoisomerase inhibitor treatment; or (3) breaks at direct or inverted repeat sequences, mediated by unidentified strand breakage mechanisms. In lymphoid cells, one of the two requisite DSBs is often physiologic, the result of V(D)J recombination or class switch recombination (CSR) at the lymphoid antigen receptor loci. The RAG complex, which causes the DSBs in V(D)J recombination, can cause (4) sequence-specific, pathologic DSBs at sites that fit the consensus of their normal V(D)J recombination signal targets; or (5) structure-specific, pathologic DSBs at regions of single- to double-strand transition. CSR occurs specifically in the B-cell lineage, and requires (6) activation-induced cytidine deaminase (AID) action at sites of single-stranded DNA, which may occur pathologically outside of the normal target loci of class switch recombination regions and somatic hypermutation (SHM) zones. Recent work proposes a seventh mechanism: the sequential action of AID and the RAG complex at CpG sites provides a coherent model for the pathologic DSBs at some of the most common sites of translocation in human lymphoma – the bcl-2 gene in follicular lymphoma and diffuse large B-cell lymphoma, and the bcl-1 gene in mantle cell lymphoma. PMID:20158866

  2. Chromosome surveys of human populations: between epidemiology and anthropology.

    PubMed

    de Chadarevian, Soraya

    2014-09-01

    It is commonly held that after 1945 human genetics turned medical and focussed on the individual rather than on the study of human populations that had become discredited. However, a closer look at the research practices at the time quickly reveals that human population studies, using old and new tools, prospered in this period. The essay focuses on the rise of chromosome analysis as a new tool for the study of human populations. It reviews a broad array of population studies ranging from newborn screening programmes to studies of isolated or 'primitive' people. Throughout, it highlights the continuing role of concerns and opportunities raised by the propagation of atomic energy for civilian and military uses, the collection of large data bases and computers, and the role of international organisations like the World Health Organisation and the International Biological Programme in shaping research agendas and carving out a space for human heredity in the postwar era.

  3. Chromosomal mapping of the human histone gene H2AZ to 4q24 by fluorescence in situ hybridization

    SciTech Connect

    Popescu, N.; Zimonjic, D.; Hatch, C.; Bonner, W. )

    1994-03-15

    The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21. Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.

  4. Chromosome painting between human and lorisiform prosimians: evidence for the HSA 7/16 synteny in the primate ancestral karyotype.

    PubMed

    Nie, Wenhui; O'Brien, Patricia C M; Fu, Beiyuan; Wang, Jinhuan; Su, Weiting; Ferguson-Smith, Malcolm A; Robinson, Terence J; Yang, Fengtang

    2006-02-01

    Multidirectional chromosome painting with probes derived from flow-sorted chromosomes of humans (Homo sapiens, HSA, 2n = 46) and galagos (Galago moholi, GMO, 2n = 38) allowed us to map evolutionarily conserved chromosomal segments among humans, galagos, and slow lorises (Nycticebus coucang, NCO, 2n = 50). In total, the 22 human autosomal painting probes detected 40 homologous chromosomal segments in the slow loris genome. The genome of the slow loris contains 16 sytenic associations of human homologues. The ancient syntenic associations of human chromosomes such as HSA 3/21, 7/16, 12/22 (twice), and 14/15, reported in most mammalian species, were also present in the slow loris genome. Six associations (HSA 1a/19a, 2a/12a, 6a/14b, 7a/12c, 9/15b, and 10a/19b) were shared by the slow loris and galago. Five associations (HSA 1b/6b, 4a/5a, 11b/15a, 12b/19b, and 15b/16b) were unique to the slow loris. In contrast, 30 homologous chromosome segments were identified in the slow loris genome when using galago chromosome painting probes. The data showed that the karyotypic differences between these two species were mainly due to Robertsonian translocations. Reverse painting, using galago painting probes onto human chromosomes, confirmed most of the chromosome homologies between humans and galagos established previously, and documented the HSA 7/16 association in galagos, which was not reported previously. The presence of the HSA 7/16 association in the slow loris and galago suggests that the 7/16 association is an ancestral synteny for primates. Based on our results and the published homology maps between humans and other primate species, we propose an ancestral karyotype (2n = 60) for lorisiform primates.

  5. Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

    SciTech Connect

    Warburton, P.E.; Gosden, J.; Lawson, D.

    1996-04-15

    Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

  6. The CEPH consortium linkage map of human chromosome 16

    SciTech Connect

    Kozman, H.M.; Mulley, J.C.; Keith, T.P.

    1995-01-01

    A Centre d`Etude du Polymorphisme Humain (CEPH) consortium map of human chromosome 16 has been constructed. The map contains 158 loci defined by 191 different probe/restriction enzyme combinations or primer pairs. The marker genotypes, contributed by 9 collaborating laboratories, originated from the CEPH families DNA. A total of 60 loci, with an average heterozygosity of 68%, have been placed on the framework genetic map. The genetic map contains 7 genes. The length of the sex-averaged map is 165 cM, with a mean genetic distance between loci of 2.8 cM; the median distance between markers is 2.0 cM. The male map length is 136 cM, and the female map length is 197 cM. The map covers virtually the entire chromosome, from D16S85, within 170 to 430 kb of the 16p telomere, to D16S303 at 16qter. The markers included in the linkage map have been physically mapped on a partial human chromosome 16 somatic cell hybrid panel, thus anchoring the genetic map to the cytogenetic-based physical map. 39 refs., 2 figs., 6 tabs.

  7. The CEPH consortium linkage map of human chromosome 16

    SciTech Connect

    Mulley, J.C.; Kozman, H.M.; Sutherland, G.R.

    1994-09-01

    A Centre d`Etude du Polymorphisme Humain (CEPH) consortium map of human chromosome 16 has been constructed. The map contains 158 loci defined by 191 different probe/restriction enzyme combinations or primer pairs. The marker genotypes, contributed by 9 collaborating laboratories, originated from the CEPH families DNA. A total of 60 loci, with an average heterozygosity of 68%, have been placed on the framework genetic map. The genetic map contains 7 genes. The length of the sex-average map is 165 cM, with a mean genetic distance between loci of 2.8 cM; the median distance between markers is 2.0 cM. The male map length is 136 cM and the female map length is 197 cM. The map virtually covers the entire chromosome, from D16S85, within 170 to 430 Kb of the 16p telomere, to D16S303 at 16qter. The markers included in the linkage map have been physically mapped on a partial human chromosome 16 somatic cell hybrid panel, thus anchoring the genetic map to the cytogenetic-based physical map.

  8. 3D Chromosome Regulatory Landscape of Human Pluripotent Cells.

    PubMed

    Ji, Xiong; Dadon, Daniel B; Powell, Benjamin E; Fan, Zi Peng; Borges-Rivera, Diego; Shachar, Sigal; Weintraub, Abraham S; Hnisz, Denes; Pegoraro, Gianluca; Lee, Tong Ihn; Misteli, Tom; Jaenisch, Rudolf; Young, Richard A

    2016-02-01

    In this study, we describe the 3D chromosome regulatory landscape of human naive and primed embryonic stem cells. To devise this map, we identified transcriptional enhancers and insulators in these cells and placed them within the context of cohesin-associated CTCF-CTCF loops using cohesin ChIA-PET data. The CTCF-CTCF loops we identified form a chromosomal framework of insulated neighborhoods, which in turn form topologically associating domains (TADs) that are largely preserved during the transition between the naive and primed states. Regulatory changes in enhancer-promoter interactions occur within insulated neighborhoods during cell state transition. The CTCF anchor regions we identified are conserved across species, influence gene expression, and are a frequent site of mutations in cancer cells, underscoring their functional importance in cellular regulation. These 3D regulatory maps of human pluripotent cells therefore provide a foundation for future interrogation of the relationships between chromosome structure and gene control in development and disease. PMID:26686465

  9. HACking the centromere chromatin code: insights from human artificial chromosomes.

    PubMed

    Bergmann, Jan H; Martins, Nuno M C; Larionov, Vladimir; Masumoto, Hiroshi; Earnshaw, William C

    2012-07-01

    The centromere is a specialized chromosomal region that serves as the assembly site of the kinetochore. At the centromere, CENP-A nucleosomes form part of a chromatin landscape termed centrochromatin. This chromatin environment conveys epigenetic marks regulating kinetochore formation. Recent work sheds light on the intricate relationship between centrochromatin state, the CENP-A assembly pathway and the maintenance of centromere function. Here, we review the emerging picture of how chromatin affects mammalian kinetochore formation. We place particular emphasis on data obtained from Human Artificial Chromosome (HAC) biology and the targeted engineering of centrochromatin using synthetic HACs. We discuss implications of these findings, which indicate that a delicate balance of histone modifications and chromatin state dictates both de novo centromere formation and the maintenance of centromere identity in dividing cell populations. PMID:22825423

  10. HACking the centromere chromatin code: insights from human artificial chromosomes.

    PubMed

    Bergmann, Jan H; Martins, Nuno M C; Larionov, Vladimir; Masumoto, Hiroshi; Earnshaw, William C

    2012-07-01

    The centromere is a specialized chromosomal region that serves as the assembly site of the kinetochore. At the centromere, CENP-A nucleosomes form part of a chromatin landscape termed centrochromatin. This chromatin environment conveys epigenetic marks regulating kinetochore formation. Recent work sheds light on the intricate relationship between centrochromatin state, the CENP-A assembly pathway and the maintenance of centromere function. Here, we review the emerging picture of how chromatin affects mammalian kinetochore formation. We place particular emphasis on data obtained from Human Artificial Chromosome (HAC) biology and the targeted engineering of centrochromatin using synthetic HACs. We discuss implications of these findings, which indicate that a delicate balance of histone modifications and chromatin state dictates both de novo centromere formation and the maintenance of centromere identity in dividing cell populations.

  11. DNA Secondary Structure at Chromosomal Fragile Sites in Human Disease

    PubMed Central

    Thys, Ryan G; Lehman, Christine E; Pierce, Levi C. T; Wang, Yuh-Hwa

    2015-01-01

    DNA has the ability to form a variety of secondary structures that can interfere with normal cellular processes, and many of these structures have been associated with neurological diseases and cancer. Secondary structure-forming sequences are often found at chromosomal fragile sites, which are hotspots for sister chromatid exchange, chromosomal translocations, and deletions. Structures formed at fragile sites can lead to instability by disrupting normal cellular processes such as DNA replication and transcription. The instability caused by disruption of replication and transcription can lead to DNA breakage, resulting in gene rearrangements and deletions that cause disease. In this review, we discuss the role of DNA secondary structure at fragile sites in human disease. PMID:25937814

  12. Structure and chromosomal localization of the human homeobox gene Prox 1

    SciTech Connect

    Zinovieva, R.D.; Duncan, M.K.; Johnson, T.R.

    1996-08-01

    The genomic organization and nucleotide sequence of the human homeobox gene Prox 1 as well as its chromosomal localization have been determined. This gene spans more than 40 kb, consists of at least 5 exons, and encodes an 83-kDa protein. It shows 89% identity with the chicken sequence at the nucleotide level in the coding region, while the human and chicken proteins are 94% identical. Among the embryonic tissues analyzed (lens, brain, lung, liver, and kidney), the human Prox 1 gene is most actively expressed i the developing lens, similar to the expression pattern of the chicken Prox 1 gene. The Prox 1 gene was mapped to human chromosome 1q32.2-q32.3. 26 refs., 6 figs.

  13. The gene for PAX7, a member of the paired-box-containing genes, is localized on human chromosome arm 1p36

    SciTech Connect

    Shapiro, D.N.; Morris, S.W. Univ. of Tennessee College of Medicine, Memphis, TN ); Sublett, J.E.; Li, Baitao; Valentine, M.B. ); Noll, M. )

    1993-09-01

    The murine Pax-7 gene and the cognate human gene, formerly designated HuP1, are members of the multigene paired-box-containing class of developmental regulatory genes first identified in Drosophila. By analysis of somatic cell hybrids segregating human chromosomes, the gene encoding PAX7 was localized to human chromosome 1. Fluorescence in situ hybridization confirmed this assignment and allowed mapping of the gene to the terminal region of the short arm (1p36) of the extensive homology between human chromosome 1p and the distal segment of mouse chromosome 4, extending from bands C5 through E2. 19 refs., 1 fig.

  14. Correlations between isochores and chromosomal bands in the human genome

    SciTech Connect

    Saccone, S.; Della Valle, G. ); De Sario, A.; Bernardi, G. ); Wiegant, J.; Raap, A.K. )

    1993-11-15

    The human genome is made up of long DNA segments, the isochores, which are compositionally homogeneous and can be subdivided into a small number of families characterized by different G+C levels. Chromosome in situ suppression hybridization (in which excess unlabeled human DNA is added to suppress hybridization of repeated sequences present in the probe, enabling enhanced observation of single-copy sequences) of DNA fractions characterized by an increasing G+C level was carried out to determine the distribution of [open quotes]single-copy[close quotes] sequences corresponding to isochore families L1 + L2, H1, H2, and H3 on metaphase chromosomes. This produced a banding pattern progressing from a relatively diffuse staining to an R-banding, to a T-banding. More specifically, the results showed that (i) T-bands are formed by the G+C-richest isochores of the H3 family and by part of the G+C-rich isochores of the H1 and H2 families (with a predominance of the latter); (ii) R[prime]-bands (namely, R-bands exclusive of T-bands) are formed to almost equal extents by G+C-rich isochores of the H1 families (with a minor contribution of the H2 and H3 families) and by G+C-poor isochores of the L1 + L2 families; (iii) G-bands essentially consist of G+C-poor isochores from the L1 + L2 families, with a minor contribution of isochores from the H1 family. These results not only clarify the correlations between DNA base composition and chromosomal bands but also provide information on the distribution of genes in chromosomes, gene concentration increasing with the G+C levels of isochores.

  15. Chromosomal loci of 50 human keratinocyte cDNAs assigned by fluorescence in situ hybridization

    SciTech Connect

    Morishima, Yohich; Ariyama, Takeshi; Yamanishi, Kiyofumi

    1995-07-20

    The chromosomal loci of expressed genes provide useful information for a candidate gene approach to the genes responsible for genetic diseases. A large set of randomly isolated cDNAs catalogued by partial sequencing can serve as a resource for accessing and isolating these disease genes. Using fluorescence in situ hybridization, we examined the chromosomal loci of 217 human keratinocyte-derived cDNAs, with independent novel sequence tags at the 3{prime} end region. Among them, we determined the loci of 50 cDNAs. Single-pass sequencing of these from the 5{prime} ends indicated that 39 cDNAs still can be produced for new genes. These cDNAs with identified chromosomal loci are powerful tools that can be used to help elucidate the genes responsible for hereditary skin disorders. 42 refs., 3 figs., 2 tabs.

  16. Comparative chromosome painting in mammals: Human and the Indian muntjac (Muntiacus muntjak vaginalis)

    SciTech Connect

    Yang, Fengtang; Mueller, S.; Ferguson-Smith, M.A.

    1997-02-01

    We have used human chromosome-specific painting probes for in situ hybridization on Indian muntjac (Muntiacus muntjak vaginalis, 2n = 6, 7) metaphase chromosomes to identify the homologous chromosome regions of the entire human chromosome set. Chromosome rearrangements that have been involved in the karyotype evolution of these two species belonging to different mammalian orders were reconstructed based on hybridization patterns. Although, compared to human chromosomes, the karyotype of the Indian muntjac seems to be highly rearranged, we could identify a limited number of highly conserved homologous chromosome regions for each of the human chromosome-specific probes. We identified 48 homologous autosomal chromosome segments, which is in the range of the numbers found in other artiodactyls and carnivores recently analyzed by chromosome painting. The results demonstrate that the reshuffling of the muntjac karyotype is mostly due to fusions of huge blocks of entire chromosomes. This is in accordance with previous chromosome painting analyses between various Muntjac species and contrasts the findings for some other mammals (e.g., gibbons, mice) that show exceptional chromosome reshuffling due to multiple reciprocal translocation events. 21 refs., 3 figs.

  17. Chromosomal protein HMG-14 gene maps to the Down syndrome region of human chromosome 21 and is overexpressed in mouse trisomy 16

    SciTech Connect

    Pash, J.; Popescu, N.; Matocha, M.; Rapoport, S.; Bustin, M. )

    1990-05-01

    The gene for human high-mobility-group (HMG) chromosomal protein HMG-14 is located in region 21q22.3, a region associated with the pathogenesis of Down syndrome, one of the most prevalent human birth defects. The expression of this gene is analyzed in mouse embryos that are trisomic in chromosome 16 and are considered to be an animal model for Down syndrome. RNA blot-hybridization analysis and detailed analysis of HMG-14 protein levels indicate that mouse trisomy 16 embryos have approximately 1.5 times more HMG-14 mRNA and protein than their normal littermates, suggesting a direct gene dosage effect. The HMG-14 gene may be an additional marker for the Down syndrome. Chromosomal protein HMG-14 is a nucleosomal binding protein that may confer distinct properties to the chromatin structure of transcriptionally active genes and therefore may be a contributing factor in the etiology of the syndrome.

  18. Mapping of guanylin to murine chromosome 4 and human chromosome 1p34-p35

    SciTech Connect

    Sciaky, D.; Cohen, M.B.; Jenkins, N.A.

    1995-03-20

    Guanylin is a 15-amino-acid peptide similar in structure and in function to ST{sub a}, the heat stable enterotoxin of enterotoxigenic Escherichia coli (4). Both guanylin and ST{sub a} bind guanylyl cyclase-C (GC-C), resulting in increased levels of intracellular cGMP and induction of Cl- secretion (4) via the cystic fibrosis transmembrane regulator (CFM) (2). Guanylin is a highly regulated intestinal gene that is differentially expressed along the duodenal-to-colonic and villus-to-crypt axes. Guanylin mRNA abundance is maximal in the distal small intestine and proximal colon, where the mRNA is detected mainly in differentiated villus epithelial cells and superficial colonic epithelial cells, respectively. The murine guanylin gene (Guca2) has been isolated and sequenced; the gene is 1.7 kb and consists of 3 exons. We report here the mapping of Guca2 to mouse chromosome 4 by linkage analysis and to human chromosome region 1p34-p35 using fluorescence in situ hybridization (FISH). 20 refs., 2 figs.

  19. Chromosome region-specific libraries for human genome analysis

    SciTech Connect

    Kao, Fa-Ten.

    1992-08-01

    During the grant period progress has been made in the successful demonstration of regional mapping of microclones derived from microdissection libraries; successful demonstration of the feasibility of converting microclones with short inserts into yeast artificial chromosome clones with very large inserts for high resolution physical mapping of the dissected region; Successful demonstration of the usefulness of region-specific microclones to isolate region-specific cDNA clones as candidate genes to facilitate search for the crucial genes underlying genetic diseases assigned to the dissected region; and the successful construction of four region-specific microdissection libraries for human chromosome 2, including 2q35-q37, 2q33-q35, 2p23-p25 and 2p2l-p23. The 2q35-q37 library has been characterized in detail. The characterization of the other three libraries is in progress. These region-specific microdissection libraries and the unique sequence microclones derived from the libraries will be valuable resources for investigators engaged in high resolution physical mapping and isolation of disease-related genes residing in these chromosomal regions.

  20. Radiation-induced chromosome damage in human lymphocytes

    PubMed Central

    Lloyd, D. C.; Dolphin, G. W.

    1977-01-01

    ABSTRACT Analysis for chromosome aberrations in human peripheral blood lymphocytes has been developed as an indicator of dose from ionising radiation. This paper outlines the mechanism of production of aberrations, the technique for their analysis and the dose-effect relationships for various types of radiation. During the past ten years the National Radiological Protection Board has developed a service for the UK in which estimates of dose from chromosome aberration analysis are made on people known or suspected of being accidentally over-exposed. This service can provide estimates where no physical dosemeter was worn and is frequently able to resolve anomalous or disputed data from routine film badges. Several problems in the interpretation of chromosome aberration yields are reviewed. These include the effects of partial body irradiation and the response to variations in dose rate and the intermittent nature of some exposures. The dosimetry service is supported by a research programme which includes surveys of groups of patients irradiated for medical purposes. Two surveys are described. In the first, lymphocyte aberrations were examined in rheumatiod arthritis patients receiving intra-articular injections of colloidal radiogold or radioyttrium. A proportion of the nuclide leaked from the joint into the regional lymphatic system. In the second survey a comparison was made between the cytogenetic and physical estimates of whole body dose in patients receiving iodine 131 for thyroid carcinoma. Images PMID:338021

  1. Transillumination spatially modulated illumination microscopy for human chromosome imaging

    NASA Astrophysics Data System (ADS)

    Pitris, Costas; Heracleous, Peter; Patsalis, Philippos

    2005-03-01

    Human chromosome analysis is an essential task in cytogenetics, especially in prenatal screening, genetic syndrome diagnosis, cancer pathology research and mutagen dosimetry. Chromosomal analysis begins with the creation of a karyotype, which is a layout of chromosome images organized by decreasing size in pairs. Both manual and automatic classification of chromosomes are limited by the resolution of the microscope and imaging system used. One way to improve the results of classification and even detect subtleties now remaining undetected, is to enhance the resolution of the images. It is possible to achieve lateral resolution beyond the classical limit, by using spatially modulated illumination (SMI) in a wide-field, non-confocal microscope. In this case, the sample is illuminated with spatially modulated light, which makes normally inaccessible high-resolution information visible in the observed image by shifting higher frequencies within the OTF limits of the microscope. Although, SMI microscopes have been reported in the past, this manuscript reports the development of a transillumination microscope for opaque, non-fluorescent samples. The illumination path consisted of a light source illuminating a ruled grating which was subsequently imaged on the sample. The grating was mounted on a rotating and translating stage so that the magnification and rotation of the pattern could be adjusted. The imaging lens was a 1.25 NA oil immersion objective. Test samples showed resolution improvement, as judged from a comparison of the experimentally obtained FWHM. Further studies using smaller fringe distance or laser interference pattern illumination will be evaluated to further optimize the SMI results.

  2. Cloning and chromosomal localization of the three human syntrophin genes

    SciTech Connect

    Feener, C.A.; Anderson, M.D.S.; Selig, S.

    1994-09-01

    Dystrophin, the protein product the Duchenne muscular dystrophy locus, is normally found to be associated with a complex of proteins. Among these dystrophin-associated proteins are the syntrophins, a group of 59 kDa membrane-associated proteins. When the syntrophins are purified based upon their association with dystrophin, they have been shown previously to form two distinct groups, the acidic ({alpha}) and basic ({beta}) forms. Based on peptide and rodent cDNA sequences, three separate syntrophin genes have been cloned and characterized from human tissues. The predicted amino acid sequences from these cDNA reveal that these proteins are related but are distinct with respect to charge, as predicted from their biochemistry. The family consists of one acidic ({alpha}-syntrophin, analogous to mouse syntrophin-1) and two basic ({beta}{sub 1}-syntrophin; and {beta}{sub 2}-syntrophin, analogous to mouse syntrophin-2) genes. Each of the three genes are widely expressed in a variety of human tissues, but the relative abundance of the three are unique with respect to each other. {alpha}-syntrophin is expressed primarily in skeletal muscle and heart as a single transcript. {beta}{sub 1}-syntrophin is expressed widely in up to five distinct transcript sizes, and is most abundant in brain. The human chromosomal locations of the three syntrophins are currently being mapped. {beta}{sub 1}-syntrophin maps to chromosome 8q23-24 and {beta}{sub 2}-syntrophin to chromosome 16. The {alpha}-syntrophin gene will be mapped accordingly. Although all three genes are candidates for neuromuscular diseases, the predominant expression of {alpha}-syntrophin in skeletal muscle and heart makes it a strong candidate to be involved in a neuromuscular disease.

  3. Functional gene groups are concentrated within chromosomes, among chromosomes and in the nuclear space of the human genome.

    PubMed

    Thévenin, Annelyse; Ein-Dor, Liat; Ozery-Flato, Michal; Shamir, Ron

    2014-09-01

    Genomes undergo changes in organization as a result of gene duplications, chromosomal rearrangements and local mutations, among other mechanisms. In contrast to prokaryotes, in which genes of a common function are often organized in operons and reside contiguously along the genome, most eukaryotes show much weaker clustering of genes by function, except for few concrete functional groups. We set out to check systematically if there is a relation between gene function and gene organization in the human genome. We test this question for three types of functional groups: pairs of interacting proteins, complexes and pathways. We find a significant concentration of functional groups both in terms of their distance within the same chromosome and in terms of their dispersal over several chromosomes. Moreover, using Hi-C contact map of the tendency of chromosomal segments to appear close in the 3D space of the nucleus, we show that members of the same functional group that reside on distinct chromosomes tend to co-localize in space. The result holds for all three types of functional groups that we tested. Hence, the human genome shows substantial concentration of functional groups within chromosomes and across chromosomes in space.

  4. Fatness QTL on chicken chromosome 5 and interaction with sex

    PubMed Central

    Abasht, Behnam; Pitel, Frédérique; Lagarrigue, Sandrine; Le Bihan-Duval, Elisabeth; Le Roy, Pascale; Demeure, Olivier; Vignoles, Florence; Simon, Jean; Cogburn, Larry; Aggrey, Sammy; Vignal, Alain; Douaire, Madeleine

    2006-01-01

    Quantitative trait loci (QTL) affecting fatness in male chickens were previously identified on chromosome 5 (GGA5) in a three-generation design derived from two experimental chicken lines divergently selected for abdominal fat weight. A new design, established from the same pure lines, produced 407 F2 progenies (males and females) from 4 F1-sire families. Body weight and abdominal fat were measured on the F2 at 9 wk of age. In each sire family, selective genotyping was carried out for 48 extreme individuals for abdominal fat using seven microsatellite markers from GGA5. QTL analyses confirmed the presence of QTL for fatness on GGA5 and identified a QTL by sex interaction. By crossing one F1 sire heterozygous at the QTL with lean line dams, three recombinant backcross 1 (BC1) males were produced and their QTL genotypes were assessed in backcross 2 (BC2) progenies. These results confirmed the QTL by sex interaction identified in the F2 generation and they allow mapping of the female QTL to less than 8 Mb at the distal part of the GGA5. They also indicate that fat QTL alleles were segregating in both fat and lean lines. PMID:16635451

  5. Multigenerational autosomal dominant inheritance of 5p chromosomal deletions.

    PubMed

    Zhang, Bin; Willing, Marcia; Grange, Dorothy K; Shinawi, Marwan; Manwaring, Linda; Vineyard, Marisa; Kulkarni, Shashikant; Cottrell, Catherine E

    2016-03-01

    Deletion of the short arm of chromosome 5 (5p-) is associated with phenotypic features including a cat-like cry in infancy, dysmorphic facial features, microcephaly, and intellectual disability, and when encompassing a minimal critical region, may be defined as Cri-du-Chat syndrome (CdCS). Most 5p deletions are de novo in origin, and familial cases are often associated with translocation and inversion. Herein, we report three multigenerational families carrying 5p terminal deletions of different size transmitted in an autosomal dominant manner causing variable clinical findings. Terminal 5p deletions and the mode of inheritance were clinically characterized and molecularly analyzed by a combination of microarray and fluorescence in situ hybridization analyses. Shared phenotypic features documented in this cohort included neuropsychiatric findings, poor growth, and dysmorphic facial features. This study supports newly recognized effects of aberrant SEMA5A and CTNND2 dosage on severity of autistic and cognitive phenotypes. Comparative analysis of the breakpoints narrows the critical region for the cat-like cry down to an interval less than 1 Mb encompassing a candidate gene ICE1, which regulates small nuclear RNA transcription. This study also indicates that familial terminal 5p deletion is a rare presentation displaying intra- and inter-familial phenotypic variability, the latter of which may be attributed to size and gene content of the deletion. The observed intra-familial phenotypic heterogeneity suggests that additional modifying elements including genetic and environmental factors may have an impact on the clinical manifestations observed in 5p deletion carriers, and in time, further high resolution studies of 5p deletion breakpoints will continue to aid in defining genotype-phenotype correlations. PMID:26601658

  6. Multigenerational autosomal dominant inheritance of 5p chromosomal deletions.

    PubMed

    Zhang, Bin; Willing, Marcia; Grange, Dorothy K; Shinawi, Marwan; Manwaring, Linda; Vineyard, Marisa; Kulkarni, Shashikant; Cottrell, Catherine E

    2016-03-01

    Deletion of the short arm of chromosome 5 (5p-) is associated with phenotypic features including a cat-like cry in infancy, dysmorphic facial features, microcephaly, and intellectual disability, and when encompassing a minimal critical region, may be defined as Cri-du-Chat syndrome (CdCS). Most 5p deletions are de novo in origin, and familial cases are often associated with translocation and inversion. Herein, we report three multigenerational families carrying 5p terminal deletions of different size transmitted in an autosomal dominant manner causing variable clinical findings. Terminal 5p deletions and the mode of inheritance were clinically characterized and molecularly analyzed by a combination of microarray and fluorescence in situ hybridization analyses. Shared phenotypic features documented in this cohort included neuropsychiatric findings, poor growth, and dysmorphic facial features. This study supports newly recognized effects of aberrant SEMA5A and CTNND2 dosage on severity of autistic and cognitive phenotypes. Comparative analysis of the breakpoints narrows the critical region for the cat-like cry down to an interval less than 1 Mb encompassing a candidate gene ICE1, which regulates small nuclear RNA transcription. This study also indicates that familial terminal 5p deletion is a rare presentation displaying intra- and inter-familial phenotypic variability, the latter of which may be attributed to size and gene content of the deletion. The observed intra-familial phenotypic heterogeneity suggests that additional modifying elements including genetic and environmental factors may have an impact on the clinical manifestations observed in 5p deletion carriers, and in time, further high resolution studies of 5p deletion breakpoints will continue to aid in defining genotype-phenotype correlations.

  7. A locus regulating bronchial hyperresponsiveness maps to chromosome 5q

    SciTech Connect

    Levitt, R.C.; Meyers, D.A.; Bleecker, E.R.

    1994-09-01

    Bronchial hyperresponsiveness (BHR) is one of the hallmarks of asthma. BHR correlates well with asthmatic symptoms and the response to treatment. Moreover, BHR appears to be closely related to airways inflammation. Numerous studies have demonstrated a familial aggregation; however, this phenotype is not likely inherited as a simple Mendelian trait. BHR is also closely associated with total serum IgE levels, as are allergy and asthma. We studied 92 families from Northern Holland ascertained through a parent with asthma who were originally studied between 1962-1970. Since there are a number of candidate genes on chromosome 5q potentially important in producing BHR, families were genotyped for markers in this region. These genes regulate IgE production and the cellular elements that are likely involved in inflammation associated with BHR, allergy and asthma. They include IL-4, IL-3, IL-5, IL-9, IL-12, IL-13 and GM-CSF. Linkage of BHR with markers on 5q was tested using a model free sib-pair method. The data suggest a locus for BHR maps near the cytokine gene cluster on 5q. This region appears critical in producing susceptibility to BHR and possibly to asthma.

  8. The human glutamate receptor delta 2 gene (GRID2) maps to chromosome 4q22.

    PubMed

    Hu, W; Zuo, J; De Jager, P L; Heintz, N

    1998-01-01

    We isolated the human glutamate receptor delta 2 (GRID2) gene, which has 97.0% identity in amino acid sequence to the mouse glutamate receptor delta 2 (Grid2) gene. We subsequently mapped this gene to human chromosome 4q22 by radiation hybrid mapping and by hybridization to two overlapping human yeast artificial chromosomes that are located in 4q22. The Grid2 gene, which is mutated in lurcher (Lc) mice, maps to mouse chromosome 6. Thus, the mapping of the GRID2 gene to human chromosome 4q22 confirms and refines a region of synteny between mouse and human genomes.

  9. Inter- and Intra-Chromosomal Aberrations in Human Cells Exposed in vitro to High and Low LET Radiations

    NASA Technical Reports Server (NTRS)

    Hada, M.; Wilkins, R.; Saganti, P. B.; Gersey, B.; Cucinotta, F. A.; Wu, H.

    2006-01-01

    Energetic heavy ions pose a health risk to astronauts in extended ISS and future Mars missions. High-LET heavy ions are particularly effective in causing various biological effects including cell inactivation, genetic mutations and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied chromosome aberrations in human lymphocytes and fibroblasts induced by both low- and high-LET radiation using FISH and multicolor fluorescence in situ hybridization (mFISH) techniques. In this study, we exposed human epithelial cells in vitro to gamma rays and energetic particles of varying types and energies and dose rates, and analyzed chromosomal damages using the multicolor banding in situ hybridization (mBAND) procedure. Confluent human epithelial cells (CH184B5F5/M10) were exposed to energetic heavy ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory, high energy neutron at the Los Alamos Nuclear Science Center (LANSCE) or Cs-137-gamma radiation source at the University of Texas, MD Anderson Cancer Center. After colcemid and Calyculin A treatment, cells were fixed and painted with XCyte3 mBAND kit (MetaSystems) and chromosome aberrations were analyzed with mBAND analysis system (MetaSystems). With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). The results of the mBAND study showed a higher ratio of inversion involved with interchromosomal exchange in heavy ions compared to -ray irradiation. Analysis of chromosome aberrations using mBAND has the potential to provide useful information on human cell response to space-like radiation.

  10. Mapping the Stability of Human Brain Asymmetry across Five Sex-Chromosome Aneuploidies

    PubMed Central

    Lin, Amy; Clasen, Liv; Lee, Nancy Raitano; Wallace, Gregory L.; Lalonde, Francois; Blumenthal, Jonathan; Giedd, Jay N.

    2015-01-01

    The human brain displays stereotyped and early emerging patterns of cortical asymmetry in health. It is unclear if these asymmetries are highly sensitive to genetic and environmental variation or fundamental features of the brain that can survive severe developmental perturbations. To address this question, we mapped cortical thickness (CT) asymmetry in a group of genetically defined disorders known to impact CT development. Participants included 137 youth with one of five sex-chromosome aneuploidies [SCAs; XXX (n = 28), XXY (n = 58), XYY (n = 26), XXYY (n = 20), and XXXXY (n = 5)], and 169 age-matched typically developing controls (80 female). In controls, we replicated previously reported rightward inferior frontal and leftward lateral parietal CT asymmetry. These opposing frontoparietal CT asymmetries were broadly preserved in all five SCA groups. However, we also detected foci of shifting CT asymmetry with aneuploidy, which fell almost exclusively within regions of significant CT asymmetry in controls. Specifically, X-chromosome aneuploidy accentuated normative rightward inferior frontal asymmetries, while Y-chromosome aneuploidy reversed normative rightward medial prefrontal and lateral temporal asymmetries. These findings indicate that (1) the stereotyped normative pattern of opposing frontoparietal CT asymmetry arises from developmental mechanisms that can withstand gross chromosomal aneuploidy and (2) X and Y chromosomes can exert focal, nonoverlapping and directionally opposed influences on CT asymmetry within cortical regions of significant asymmetry in health. Our study attests to the resilience of developmental mechanisms that support the global patterning of CT asymmetry in humans, and motivates future research into the molecular bases and functional consequences of sex chromosome dosage effects on CT asymmetry. PMID:25568109

  11. Mapping the stability of human brain asymmetry across five sex-chromosome aneuploidies.

    PubMed

    Lin, Amy; Clasen, Liv; Lee, Nancy Raitano; Wallace, Gregory L; Lalonde, Francois; Blumenthal, Jonathan; Giedd, Jay N; Raznahan, Armin

    2015-01-01

    The human brain displays stereotyped and early emerging patterns of cortical asymmetry in health. It is unclear if these asymmetries are highly sensitive to genetic and environmental variation or fundamental features of the brain that can survive severe developmental perturbations. To address this question, we mapped cortical thickness (CT) asymmetry in a group of genetically defined disorders known to impact CT development. Participants included 137 youth with one of five sex-chromosome aneuploidies [SCAs; XXX (n = 28), XXY (n = 58), XYY (n = 26), XXYY (n = 20), and XXXXY (n = 5)], and 169 age-matched typically developing controls (80 female). In controls, we replicated previously reported rightward inferior frontal and leftward lateral parietal CT asymmetry. These opposing frontoparietal CT asymmetries were broadly preserved in all five SCA groups. However, we also detected foci of shifting CT asymmetry with aneuploidy, which fell almost exclusively within regions of significant CT asymmetry in controls. Specifically, X-chromosome aneuploidy accentuated normative rightward inferior frontal asymmetries, while Y-chromosome aneuploidy reversed normative rightward medial prefrontal and lateral temporal asymmetries. These findings indicate that (1) the stereotyped normative pattern of opposing frontoparietal CT asymmetry arises from developmental mechanisms that can withstand gross chromosomal aneuploidy and (2) X and Y chromosomes can exert focal, nonoverlapping and directionally opposed influences on CT asymmetry within cortical regions of significant asymmetry in health. Our study attests to the resilience of developmental mechanisms that support the global patterning of CT asymmetry in humans, and motivates future research into the molecular bases and functional consequences of sex chromosome dosage effects on CT asymmetry.

  12. International study of factors affecting human chromosome translocations

    PubMed Central

    Sigurdson, Alice J.; Ha, Mina; Hauptmann, Michael; Bhatti, Parveen; Sram, Radim J.; Beskid, Olena; Tawn, E. Janet; Whitehouse, Caroline A.; Lindholm, Carita; Nakano, Mimako; Kodama, Yoshiaki; Nakamura, Nori; Vorobtsova, Irena; Oestreicher, Ursula; Stephan, Günther; Yong, Lee C.; Bauchinger, Manfred; Schmid, Ernst; Chung, Hai Won; Darroudi, Firouz; Roy, Laurence; Voisin, Phillipe; Barquinero, Joan F.; Livingston, Gordon; Blakey, David; Hayata, Isamu; Zhang, Wei; Wang, Chunyan; Bennett, L. Michelle; Littlefield, L. Gayle; Edwards, Alan A.; Kleinerman, Ruth A.; Tucker, James D.

    2009-01-01

    Chromosome translocations in peripheral blood lymphocytes of normal, healthy humans increase with age, but the effects of gender, race, and cigarette smoking on background translocation yields have not been examined systematically. Further, the shape of the relationship between age and translocation frequency (TF) has not been definitively determined. We collected existing data from sixteen laboratories in North America, Europe, and Asia on TFs measured in peripheral blood lymphocytes by fluorescence in situ hybridization whole chromosome painting among 1933 individuals. In Poisson regression models, age, ranging from newborns (cord blood) to 85 years, was strongly associated with TF and this relationship showed significant upward curvature at older ages vs. a linear relationship (p <0.001). Ever smokers had significantly higher TFs than non-smokers (rate ratio (RR) = 1.19, 95% confidence interval (CI), 1.09–1.30) and smoking modified the effect of age on TFs with a steeper age-related increase among ever smokers compared to non-smokers (p<0.001). TFs did not differ by gender. Interpreting an independent effect of race was difficult owing to laboratory variation. Our study is three times larger than any pooled effort to date, confirming a suspected curvilinear relationship of TF with age. The significant effect of cigarette smoking has not been observed with previous pooled studies of TF in humans. Our data provide stable estimates of background TF by age, gender, race, and smoking status and suggest an acceleration of chromosome damage above age 60 and among those with a history of smoking cigarettes. PMID:18337160

  13. Convergent evolution of chicken Z and human X chromosomes by expansion and gene acquisition.

    PubMed

    Bellott, Daniel W; Skaletsky, Helen; Pyntikova, Tatyana; Mardis, Elaine R; Graves, Tina; Kremitzki, Colin; Brown, Laura G; Rozen, Steve; Warren, Wesley C; Wilson, Richard K; Page, David C

    2010-07-29

    In birds, as in mammals, one pair of chromosomes differs between the sexes. In birds, males are ZZ and females ZW. In mammals, males are XY and females XX. Like the mammalian XY pair, the avian ZW pair is believed to have evolved from autosomes, with most change occurring in the chromosomes found in only one sex--the W and Y chromosomes. By contrast, the sex chromosomes found in both sexes--the Z and X chromosomes--are assumed to have diverged little from their autosomal progenitors. Here we report findings that challenge this assumption for both the chicken Z chromosome and the human X chromosome. The chicken Z chromosome, which we sequenced essentially to completion, is less gene-dense than chicken autosomes but contains a massive tandem array containing hundreds of duplicated genes expressed in testes. A comprehensive comparison of the chicken Z chromosome with the finished sequence of the human X chromosome demonstrates that each evolved independently from different portions of the ancestral genome. Despite this independence, the chicken Z and human X chromosomes share features that distinguish them from autosomes: the acquisition and amplification of testis-expressed genes, and a low gene density resulting from an expansion of intergenic regions. These features were not present on the autosomes from which the Z and X chromosomes originated but were instead acquired during the evolution of Z and X as sex chromosomes. We conclude that the avian Z and mammalian X chromosomes followed convergent evolutionary trajectories, despite their evolving with opposite (female versus male) systems of heterogamety. More broadly, in birds and mammals, sex chromosome evolution involved not only gene loss in sex-specific chromosomes, but also marked expansion and gene acquisition in sex chromosomes common to males and females.

  14. Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation

    SciTech Connect

    Yang, Tracy Chui-hsu; Craise, L.M; Prioleau, J.C.; Stampfer, M.R.; Rhim, J.S.

    1990-11-01

    For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude nice. Neoplastic transformation was achieved by irradiation cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level. 15 refs., 9 figs., 2 tabs.

  15. Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation

    NASA Technical Reports Server (NTRS)

    Craise, L. M.; Prioleau, J. C.; Stampfer, M. R.; Rhim, J. S.; Yang, TC-H (Principal Investigator)

    1992-01-01

    For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude mice. Neoplastic transformation was achieved by irradiating cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level.

  16. Chromosomal changes in cultured human epithelial cells transformed by low- and high-let radiation

    NASA Astrophysics Data System (ADS)

    Chui-Hsu Yang, Tracy; Craise, Laurie M.; Prioleau, John C.; Stampfer, Martha R.; Rhim, Johng S.

    1992-07-01

    For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude mice. Neoplastic transformation was achieved by irradiating cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level.

  17. [THE INFLUENCE OF THE PREPARATION PRETREATMENT ON IN SITU DETECTION OF 5-METHYLCYTOSINE IN METAPHASE CHROMOSOMES AND IN INTERPHASE NUCLEI].

    PubMed

    Grudinina, N A; Sasina, L K; Noniashvili, E M; Neronova, E G; Pavlinova, L I; Suchkova, I O; Sofronov, G A; Patkin, E L

    2015-01-01

    Qualitative and quantitate analysis of DNA methylation in situ at the level of cells, chromosomes and chromosomal domains is extremely important for the diagnosis and treatment of various diseases, the study of ageing and the consequences of environmental impacts. An important question arises, whether the revealed in situ methylation pattern reflects DNA methylation per se and (or) availability of the DNA for antibodies, which in turn depends on the peculiarities of chromatin structure and chromosome condensation. These events can lead to an incorrect evaluation of the actual pattern of DNA methylation. To avoid this shortcoming as far as possible, we have modified the most widely used method of revealing 5-methylcytosine in situ with monoclonal antibodies. Here we have shown that the detection of DNA methylation staining of chromosomes including C-heterochromatin, chromosomal arms and sister chromatids is drastically dependent on pretreatment of chromosomal preparations for immunocytochemical study using fluorescent antibodies. Using undifferentiated stem cells of mouse embryonal carcinoma line F9, it has been found that change in preparations storage results in a sharp fluorescence decrease up to complete disappearance of the signal in centromeric heterochromatin. With the help of the method described in the work, we have first revealed the asymmetry of sister chromatids methylation in metaphase chromosomes of F9 cell and lymphocytes of human periphery blood. This may lead to asymmetry of transcriptional signature of daughter cells after division. The proposed here modification of 5-methylcytosine detection in situ provides a more complete characterization of methylation of chromosomes and chromosomal domains, compared to previously published methods. PMID:26591571

  18. A PCR-based genetic linkage map of human chromosome 16

    SciTech Connect

    Shen, Y.; Kozman, H.M.; Thompson, A.

    1994-07-01

    A high-resolution cytogenetic-based physical map and a genetic linkage map of human chromosome 16 have been developed based on 79 PCR-typable genetic markers and 2 Southern-based RFLP markers. The PCR-based markers were previously-characterized polymorphic (AC){sub n} repeats. Two approaches have led to the characterization of 47 highly informative genetic markers spread along chromosome 16, some of which are closely linked to disease loci. In addition, 22 markers (D16S401-423) previously genetically mapped were also physically mapped. Ten markers characterized by other laboratories were physically mapped and genotyped on the CEPH families. These 32 markers were incorporated into the PCR-based map. Seventy-two markers have heterozygosities >0.50 and 51 of these markers >0.70. By multipoint linkage analysis a framework genetic map and a comprehensive genetic map were constructed. The length of the sex-averaged framework genetic map if 152.1 cM. The average distance and the median distance between markers on this map are 3.2 and 2.7 cM, respectively, and the largest gap is 15.9 cM. These maps were anchored to the high-resolution cytogenetic map (on average 1.5 Mb per interval). Together these integrated genetic and physical maps of human chromosome 16 provide the basis for the localization and ultimately the isolation of disease genes that map to this chromosome. 1 fig., 3 tabs.

  19. Structural variability of human chromosome 9 in relation to its evolution.

    PubMed

    Hansmann, I

    1976-03-12

    Human chromosome 9 shows a high susceptibility for structural rearrangements, particularly pericentric inversions, which often are transmitted. Three types of pericentric inversions can be observed on No. 9: 1) Type I, showing the total constitutive heterochromatin in the short arm. 2) Type II with part of the C heterochromatin on the short arm, the rest located on the long arm proximal to the centromere. 3) Type III: a subtelocentric chromosome with part of the C heterochromatin in the very short arm and the rest located interstitially on the long arm. With these inversions as well as with other structural rearrangements, e.g. translocations, the break-points are located preferentially within the C heterochromatin or close to the heterochromatic-euchromatic junctions. These findings are in contrast to the findings in lymphocytes from 5 patients with fancomi's and after irradiation in vitro, reported in the literature. In lymphocytes break-points seem to be distributed more or less by chance. These observations together led us to speculate that human chromosome 9 primarily was an acrocentric chrosome; in morphology and at least in some functions similar to D- and G-group chromosomes. During evolution this acrocentric chromsome changed to a submetacentric one due to a pericentric inversion.

  20. Wolfram syndrome maps to distal human chromosome 4p

    SciTech Connect

    Polymeropoulos, M.H.; Swift, R.; Swift, M.

    1994-09-01

    Wolfram syndrome (MIM 222300) is an autosomal recessive disorder defined by the occurrence of diabetes mellitus and progressive bilateral optic atrophy. Wolfram syndrome homozygotes develop widespread nervous system abnormalities; in particular, they exhibit severe behavioral difficulties that often lead to suicide attempts or psychiatric hospitalizations. The Wolfram syndrome gene also predisposes heterozygous carriers to psychiatric disorders. Since these heterozygotes are common in the general population, the Wolfram syndrome gene may contribute significantly to the overall burden of psychiatric illness. Based on a linkage analysis of 11 families segregating for this syndrome, using microsatellite repeat polymorphisms throughout the human genome, we found the Wolfram syndrome gene to be linked to markers on the short arm of human chromosome 4, with Zmax=6.46 at {theta}=0.02 for marker D4S431.

  1. Rapid human chromosome aberration analysis using fluorescence in situ hybridization.

    PubMed

    Lucas, J N; Tenjin, T; Straume, T; Pinkel, D; Moore, D; Litt, M; Gray, J W

    1989-07-01

    We have used in situ hybridization of repeat-sequence DNA probes, specific to the paracentromric locus 1q12 and the telomeric locus 1p36, to fluorescently stain regions that flank human chromosome 1p. This procedure was used for fast detection of structural aberrations involving human chromosome 1p in two separate experiments. In one, human lymphocytes were irradiated with 0, 0.8, 1.6, 2.4 and 3.2 Gy of 137Cs gamma-rays. In the other, human lymphocytes were irradiated with 0, 0.09, 0.18, 2.0, 3.1 and 4.1 Gy of 60Co gamma-rays. The frequencies (per cell) of translocations and dicentrics with one breakpoint in 1p and one elsewhere in the genome were determined for cells irradiated at each dose point. These frequencies both increased with dose, D, in a linear-quadratic manner. The delta, alpha, and beta coefficients resulting from a fit of the equation f(D)=delta + alphaD + betaD2 to the translocation frequency dose-response data were 0.0025, 0.0027 and 0.0037 for 137Cs gamma-rays, and 0.0010, 0.0041, and 0.0057 for 60Co gamma-rays. The delta, alpha, and beta coefficients resulting from a fit to the dicentric frequency dose-response data were 0.0005, 0.0010 and 0.0028 for 137Cs gamma-rays and 0.0001, 0.0002 and 0.0035, for 60Co gamma-rays. Approximately 32,000 metaphase spreads were scored in this study. The average analysis rate was over two metaphase spreads per minute. However, an experienced analyst was able to find and score one metaphase spread every 10s. The importance of this new cytogenetic analysis technique for biological dosimetry and in vivo risk assessment is discussed.

  2. Isolation and chromosomal localization of the human endothelial nitric oxide synthase (NOS3) gene

    SciTech Connect

    Robinson, L.J.; Michel, T.; Weremowicz, S.; Morton, C.C. )

    1994-01-15

    Endothelial NOS activity is a major determinant of vascular tone and blood pressure, and in several important (and sometimes hereditary) disease states, such as hypertension, diabetes, and atherosclerosis, the endothelial NO signaling system appears to be abnormal. To explore the relationship of the endothelial NOS activity, the authors isolated the human gene encoding the endothelial NOS. Genomic clones containing the 5[prime] end of this gene were identified in a human genomic library by applying a polymerase chain reaction (PCR)-based approach. Identification of the human gene for endothelial NOS (NOS3) was confirmed by nucleotide sequence analysis of the first coding exon, which was found to be identical to its cognate cDNA. The NOS3 gene spans at least 20 kb and appears to contain multiple introns. The transcription start site and promoter region of the NOS3 gene were identified by primer extension and ribonuclease protection assays. Sequencing of the putative promoter revealed consensus sequences for the shear stress-response element, as well as cytokine-responsive cis regulatory sequences, both possible important to the roles played by NOS3 in the normal and the diseased cardiovascular system. The authors also mapped the chromosomal location of the NOS3 gene. First, a chromosomal panel of human-rodent somatic cell hybrids was screened using PCR with oligonucleotide primers derived from the NOS3 genomic clone. The specificity of the amplified PCR product was confirmed by human and hamster genomic DNA controls, as well as by Southern blot analysis, using the NOS3 cDNA as probe. Definitive chromosomal assignment of the NOS3 gene to human chromosome 7 was based upon 0% discordancy; fluorescence in situ hybridization sublocalized the NOS3 gene to 7q36. The identification and characterization of the NOS3 gene may lead to further insights into heritable disease states associated with this gene product. 41 refs., 3 figs., 1 tab.

  3. Chromosome 1 localization of the human alpha-L-fucosidase structural gene with a homologous site on chromosome 2.

    PubMed

    Fowler, M L; Nakai, H; Byers, M G; Fukushima, H; Eddy, R L; Henry, W M; Haley, L L; O'Brien, J S; Shows, T B

    1986-01-01

    Two cDNA clones coding for human alpha-L-fucosidase, one from the coding region and the other primarily from the 3' untranslated region, were used to map the location of the alpha-L-fucosidase gene. Southern filter analysis of somatic cell hybrid lines mapped the structural gene to the short arm of human chromosome 1, and in situ hybridization to chromosomes of human leukocytes further localized the homologous area to the 1p36.1----p34.1 region, with the most likely location being the distal region of 1p34. Further Southern filter analysis detected a second site of homology on chromosome 2. This alpha-L-fucosidase-like site has been designated FUCA1L.

  4. Independent intrachromosomal recombination events underlie the pericentric inversions of chimpanzee and gorilla chromosomes homologous to human chromosome 16.

    PubMed

    Goidts, Violaine; Szamalek, Justyna M; de Jong, Pieter J; Cooper, David N; Chuzhanova, Nadia; Hameister, Horst; Kehrer-Sawatzki, Hildegard

    2005-09-01

    Analyses of chromosomal rearrangements that have occurred during the evolution of the hominoids can reveal much about the mutational mechanisms underlying primate chromosome evolution. We characterized the breakpoints of the pericentric inversion of chimpanzee chromosome 18 (PTR XVI), which is homologous to human chromosome 16 (HSA 16). A conserved 23-kb inverted repeat composed of satellites, LINE and Alu elements was identified near the breakpoints and could have mediated the inversion by bringing the chromosomal arms into close proximity with each other, thereby facilitating intrachromosomal recombination. The exact positions of the breakpoints may then have been determined by local DNA sequence homologies between the inversion breakpoints, including a 22-base pair direct repeat. The similarly located pericentric inversion of gorilla (GGO) chromosome XVI, was studied by FISH and PCR analysis. The p- and q-arm breakpoints of the inversions in PTR XVI and GGO XVI were found to occur at slightly different locations, consistent with their independent origin. Further, FISH studies of the homologous chromosomal regions in macaque and orangutan revealed that the region represented by HSA BAC RP11-696P19, which spans the inversion breakpoint on HSA 16q11-12, was derived from the ancestral primate chromosome homologous to HSA 1. After the divergence of orangutan from the other great apes approximately 12 million years ago (Mya), a duplication of the corresponding region occurred followed by its interchromosomal transposition to the ancestral chromosome 16q. Thus, the most parsimonious interpretation is that the gorilla and chimpanzee homologs exhibit similar but nonidentical derived pericentric inversions, whereas HSA 16 represents the ancestral form among hominoids.

  5. Assessment of aneuploidy in human oocytes and preimplantation embryos by chromosome painting

    SciTech Connect

    Rougier, N.; Viegas-Pequignot, E.; Plachot, M.

    1994-09-01

    The poor quality of chromosome preparations often observed after fixation of oocytes and embryos did not usually allow accurate identification of chromosomes involved in non-disjunctions. We, therefore, used chromosome painting to determine the incidence of abnormalities for chromosomes 1 and 7. A total of 50 oocytes inseminated for IVF and showing no signs of fertilization as well as 37 diploid embryos donated for research were fixed according to the Dyban`s technique. Fluorescence in situ hybridization was carried out using whole chromosome painting DNA probes specific for human chromosome 1 and 7. The incidence of aneuploidy was 28%, 10% and 60% for metaphase II, polar body and sperm chromosomes, respectively. The high incidence of aneuploidy observed in sperm prematurely condensed sperm chromosomes is due to the fact that usually far less than 23 sperm chromatids are observed, maybe as a consequence of incomplete chromosome condensation. Thirty seven embryos were analyzed with the same probes. 48% of early embryos were either monosomic 1 or 7 or mosaics comprising blastomeres with 1, 2 or 3 signals. Thus, 8 among the 11 abnormal embryos had hypodiploid cells (25 to 37 chromosomes) indicating either an artefactual loss of chromosomes or a complex anomaly of nuclear division (maltinucleated blastomeres, abnormal migration of chromosomes at anaphase). We therefore calculated a {open_quotes}corrected{close_quotes} incidence of aneuploidy for chromosomes 1 or 7 in early embryos: 18%. 86% of the blastocysts showed mosaicism 2n/3 or 4n as a consequence of the formation of the syncitiotrophoblast. To conclude, chromosome painting is an efficient method to accurately identify chromosomes involved in aneuploidy. This technique should allow us to evaluate the incidence of non-disjunction for all chromosome pairs. Our results confirm the high incidence of chromosome abnormalities occurring as a consequence of meiotic or mitotic non-disjunctions in human oocytes and embryos.

  6. Analysis of human spermatozoa for Y chromosomal nondisjunction

    SciTech Connect

    Kapp, R.W. Jr.; Jacobson, C.B.

    1980-01-01

    The YFF sperm assay, which is a quantification of the incidence of sperm with two fluorescent bodies (YFF . two fluorescent bodies), was performed to measure Y chromosomal nondisjunction. Three categories of human subjects were analyzed: 1) nonexposed, 2) exposed to antineoplastic agents - ie, chemo- and radiation therapy, and 3) dibromochloropropane (DBCP)-exposed. The individuals exposed to antineoplastic agents showed a three- to four-fold increase in the incidence of YFF sperm three to six weeks after the initiation of exposure to Adriamycin and X-irradiation. The maximum percentages of YFF per 1,000 sperm for each individual in this exposed group was analyzed by Wilcoxon's distribution free rank sum test using a one-sided alternative. The exposed individuals' maximum YFF percentages were statistically significantly increased when compared to the maximum YFF values of the nonexposed controls. The individuals exposed to the nematocide DBCP also exhibited a statistically significant increase in the number of sperm containing two Y chromosomes as determined by chi-square analysis with one degree of freedom (P less than 0.01). Data presented herein show statistically significant increases in the incidence of double Y chromosomes as measured by the presence of YFF sperm following exposure to Adriamycin, X-irradiation, and DBCP. It is suggested that men who have a history of antineoplastic therapy could be evaluated for evidence of Y-Y nondisjunction with this method. In the event of an increased YFF sperm level, genetic counseling and amniocentesis should be made available to the spouse where pregnancy has occurred. Further, because this procedure measures gametic mutation, is relatively simple, and is noninvasive, it should be considered for inclusion as part of a battery of medical tests for monitoring industrial populations.

  7. Suggestive evidence for association of human chromosome 18q12-q21 and its orthologue on rat and mouse chromosome 18 with several autoimmune diseases.

    PubMed

    Merriman, T R; Cordell, H J; Eaves, I A; Danoy, P A; Coraddu, F; Barber, R; Cucca, F; Broadley, S; Sawcer, S; Compston, A; Wordsworth, P; Shatford, J; Laval, S; Jirholt, J; Holmdahl, R; Theofilopoulos, A N; Kono, D H; Tuomilehto, J; Tuomilehto-Wolf, E; Buzzetti, R; Marrosu, M G; Undlien, D E; Rønningen, K S; Ionesco-Tirgoviste, C; Shield, J P; Pociot, F; Nerup, J; Jacob, C O; Polychronakos, C; Bain, S C; Todd, J A

    2001-01-01

    Some immune system disorders, such as type 1 diabetes, multiple sclerosis (MS), and rheumatoid arthritis (RA), share common features: the presence of autoantibodies and self-reactive T-cells, and a genetic association with the major histocompatibility complex. We have previously published evidence, from 1,708 families, for linkage and association of a haplotype of three markers in the D18S487 region of chromosome 18q21 with type 1 diabetes. Here, the three markers were typed in an independent set of 627 families and, although there was evidence for linkage (maximum logarithm of odds score [MLS] = 1.2; P = 0.02), no association was detected. Further linkage analysis revealed suggestive evidence for linkage of chromosome 18q21 to type 1 diabetes in 882 multiplex families (MLS = 2.2; lambdas = 1.2; P = 0.001), and by meta-analysis the orthologous region (also on chromosome 18) is linked to diabetes in rodents (P = 9 x 10(-4)). By meta-analysis, both human chromosome 18q12-q21 and the rodent orthologous region show positive evidence for linkage to an autoimmune phenotype (P = 0.004 and 2 x 10(-8), respectively, empirical P = 0.01 and 2 x 10(-4), respectively). In the diabetes-linked region of chromosome 18q12-q21, a candidate gene, deleted in colorectal carcinoma (DCC), was tested for association with human autoimmunity in 3,380 families with type 1 diabetes, MS, and RA. A haplotype ("2-10") of two newly characterized microsatellite markers within DCC showed evidence for association with autoimmunity (P = 5 x 10(-6)). Collectively, these data suggest that a locus (or loci) exists on human chromosome 18q12-q21 that influences multiple autoimmune diseases and that this association might be conserved between species. PMID:11147786

  8. Characterization of four human YAC libraries for clone size, chimerism and X chromosome sequence representation.

    PubMed Central

    Nagaraja, R; Kere, J; MacMillan, S; Masisi, M J; Johnson, D; Molini, B J; Halley, G R; Wein, K; Trusgnich, M; Eble, B

    1994-01-01

    Four collections of human X-specific YACs, derived from human cells containing supernumerary X chromosomes or from somatic cell hybrids containing only X human DNA were characterized. In each collection, 80-85% of YAC strains contained a single X YAC. Five thousand YACs from the various libraries were sized, and cocloning was assessed in subsets by the fraction of YAC insert-ends with non-X sequences. Cocloning was substantial, ranging up to 50% for different collections; and in agreement with previous indications, in all libraries the larger the YACs, the higher the level of cocloning. In libraries made from human-hamster hybrid cells, expected numbers of clones were recovered by STS-based screening; but unexpectedly, the two collections from cells with 4 or 5 X chromosomes yielded numbers of YACs corresponding to an apparent content of only about two X equivalents. Thus it is possible that the DNA of inactive X chromosomes is poorly cloned into YACs, speculatively perhaps because of its specialized chromatin structure. Images PMID:8078777

  9. Genetic linkage analysis of familial amyotrophic lateral sclerosis using human chromosome 21 microsatellite DNA markers

    SciTech Connect

    Rosen, D.R.; Sapp, P.; O`Regan, J.; McKenna-Yasek, D.; Schlumpf, K.S.; Haines, J.L.; Gusella, J.F.; Horvitz, H.R.; Brown, R.H. Jr.

    1994-05-15

    Amyotrophic lateral sclerosis (ALS; Lou Gehrig`s Disease) is a lethal neurodegenerative disease of upper and lower motorneurons in the brain and spinal cord. We previously reported linkage of a gene for familial ALS (FALS) to human chromosome 21 using 4 restriction fragment length polymorphism DNA markers and identified disease-associated mutations in the superoxide dismutase (SOD)-1 gene in some ALS families. We report here the genetic linkage data that led us to examine the SOD-1 gene for mutations. We also report a new microsatellite DNA marker for D21S63, derived from the cosmid PW517. Ten microsatellite DNA markers, including the new marker D21S63, were used to reinvestigate linkage of FALS to chromosome 21. Genetic linkage analysis performed with 13 ALS familes for these 10 DNA markers confirmed the presence of a FALS gene on chromosome 21. The highest total 2-point LOD score for all families was 4.33, obtained at a distance of 10 cM from the marker D21S223. For 5 ALS families linked to chromosome 21, a peak 2-point LOD score of 5.94 was obtained at the DNA marker D21S223. A multipoint score of 6.50 was obtained with the markers D21S213, D21S223, D21S167, and FALS for 5 chromosome 21-linked ALS families. The haplotypes of these families for the 10 DNA markers reveal recombination events that further refined the location of the FALS gene to a segment of approximately 5 megabases (Mb) between D21S213 and D21S219. The only characterized gene within this segment was SOD-1, the structural gene for Cu, Zn SOD. 30 refs., 4 figs., 4 tabs.

  10. Mapping and ordered cloning of the human X chromosome

    SciTech Connect

    Caskey, C.T.; Nelson, D.L.

    1992-12-01

    Progress is reported on gathering X chromosome specific libraries and integrating those with the library produced in this project. Further studies on understanding Fragile X Syndrome and other hereditary diseases related to the X chromosome are described. (DT)

  11. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    SciTech Connect

    D'Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. ); Antonacci, R. )

    1993-11-01

    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  12. First Survey of the Wheat Chromosome 5A Composition through a Next Generation Sequencing Approach

    PubMed Central

    Vitulo, Nicola; Albiero, Alessandro; Forcato, Claudio; Campagna, Davide; Dal Pero, Francesca; Bagnaresi, Paolo; Colaiacovo, Moreno; Faccioli, Primetta; Lamontanara, Antonella; Šimková, Hana; Kubaláková, Marie; Perrotta, Gaetano; Facella, Paolo; Lopez, Loredana; Pietrella, Marco; Gianese, Giulio; Doležel, Jaroslav; Giuliano, Giovanni; Cattivelli, Luigi; Valle, Giorgio; Stanca, A. Michele

    2011-01-01

    Wheat is one of the world's most important crops and is characterized by a large polyploid genome. One way to reduce genome complexity is to isolate single chromosomes using flow cytometry. Low coverage DNA sequencing can provide a snapshot of individual chromosomes, allowing a fast characterization of their main features and comparison with other genomes. We used massively parallel 454 pyrosequencing to obtain a 2x coverage of wheat chromosome 5A. The resulting sequence assembly was used to identify TEs, genes and miRNAs, as well as to infer a virtual gene order based on the synteny with other grass genomes. Repetitive elements account for more than 75% of the genome. Gene content was estimated considering non-redundant reads showing at least one match to ESTs or proteins. The results indicate that the coding fraction represents 1.08% and 1.3% of the short and long arm respectively, projecting the number of genes of the whole chromosome to approximately 5,000. 195 candidate miRNA precursors belonging to 16 miRNA families were identified. The 5A genes were used to search for syntenic relationships between grass genomes. The short arm is closely related to Brachypodium chromosome 4, sorghum chromosome 8 and rice chromosome 12; the long arm to regions of Brachypodium chromosomes 4 and 1, sorghum chromosomes 1 and 2 and rice chromosomes 9 and 3. From these similarities it was possible to infer the virtual gene order of 392 (5AS) and 1,480 (5AL) genes of chromosome 5A, which was compared to, and found to be largely congruent with the available physical map of this chromosome. PMID:22028874

  13. The Human Proteome Organization Chromosome 6 Consortium: Integrating chromosome-centric and biology/disease driven strategies

    PubMed Central

    Borchers, C.H.; Kast, J.; Foster, L.J.; Siu, K.W.M.; Overall, C.M.; Binkowski, T.A.; Hildebrand, W.H.; Scherer, A.; Mansoor, M.; Keown, P.A.

    2014-01-01

    The Human Proteome Project (HPP) is designed to generate a comprehensive map of the protein-based molecular architecture of the human body, to provide a resource to help elucidate biological and molecular function, and to advance diagnosis and treatment of diseases. Within this framework, the chromosome-based HPP (C-HPP) has allocated responsibility for mapping individual chromosomes by country or region, while the biology/disease HPP (B/D-HPP) coordinates these teams in cross-functional disease-based groups. Chromosome 6 (Ch6) provides an excellent model for integration of these two tasks. This metacentric chromosome has a complement of 1002–1034 genes that code for known, novel or putative proteins. Ch6 is functionally associated with more than 120 major human diseases, many with high population prevalence, devastating clinical impact and profound societal consequences. The unique combination of genomic, proteomic, metabolomic, phenomic and health services data being drawn together within the Ch6 program has enormous potential to advance personalized medicine by promoting robust biomarkers, subunit vaccines and new drug targets. The strong liaison between the clinical and laboratory teams, and the structured framework for technology transfer and health policy decisions within Canada will increase the speed and efficacy of this transition, and the value of this translational research. Biological significance Canada has been selected to play a leading role in the international Human Proteome Project, the global counterpart of the Human Genome Project designed to understand the structure and function of the human proteome in health and disease. Canada will lead an international team focusing on chromosome 6, which is functionally associated with more than 120 major human diseases, including immune and inflammatory disorders affecting the brain, skeletal system, heart and blood vessels, lungs, kidney, liver, gastrointestinal tract and endocrine system. Many of

  14. New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes for radiation molecular cytogenetics

    PubMed Central

    Repin, Mikhail V; Golubev, Pavel I; Repina, Ludmila A

    2009-01-01

    Background The objective of this work is to obtain the correct relative DNA contents of chromosomes in the normal male and female human diploid genomes for the use at FISH analysis of radiation-induced chromosome aberrations. Results The relative DNA contents of chromosomes in the male and female human diploid genomes have been calculated from the publicly available international Human Genome Project data. New sequence-based data on the relative DNA contents of human chromosomes were compared with the data recommended by the International Atomic Energy Agency in 2001. The differences in the values of the relative DNA contents of chromosomes obtained by using different approaches for 15 human chromosomes, mainly for large chromosomes, were below 2%. For the chromosomes 13, 17, 20 and 22 the differences were above 5%. Conclusion New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes were obtained. This approach, based on the genome sequence, can be recommended for the use in radiation molecular cytogenetics. PMID:19500331

  15. Cell-autonomous correction of ring chromosomes in human induced pluripotent stem cells

    NASA Astrophysics Data System (ADS)

    Bershteyn, Marina; Hayashi, Yohei; Desachy, Guillaume; Hsiao, Edward C.; Sami, Salma; Tsang, Kathryn M.; Weiss, Lauren A.; Kriegstein, Arnold R.; Yamanaka, Shinya; Wynshaw-Boris, Anthony

    2014-03-01

    Ring chromosomes are structural aberrations commonly associated with birth defects, mental disabilities and growth retardation. Rings form after fusion of the long and short arms of a chromosome, and are sometimes associated with large terminal deletions. Owing to the severity of these large aberrations that can affect multiple contiguous genes, no possible therapeutic strategies for ring chromosome disorders have been proposed. During cell division, ring chromosomes can exhibit unstable behaviour leading to continuous production of aneuploid progeny with low viability and high cellular death rate. The overall consequences of this chromosomal instability have been largely unexplored in experimental model systems. Here we generated human induced pluripotent stem cells (iPSCs) from patient fibroblasts containing ring chromosomes with large deletions and found that reprogrammed cells lost the abnormal chromosome and duplicated the wild-type homologue through the compensatory uniparental disomy (UPD) mechanism. The karyotypically normal iPSCs with isodisomy for the corrected chromosome outgrew co-existing aneuploid populations, enabling rapid and efficient isolation of patient-derived iPSCs devoid of the original chromosomal aberration. Our results suggest a fundamentally different function for cellular reprogramming as a means of `chromosome therapy' to reverse combined loss-of-function across many genes in cells with large-scale aberrations involving ring structures. In addition, our work provides an experimentally tractable human cellular system for studying mechanisms of chromosomal number control, which is of critical relevance to human development and disease.

  16. Human phenol sulfotransferase STP2 gene: Molecular cloning, structural characterization, and chromosomal localization

    SciTech Connect

    Her, C.; Raftogianis, R.; Weinshilboum, R.M.

    1996-05-01

    Sulfonation is an important pathway in the biotransformation of many drugs, xenobiotics, neurotransmitters, and steroid hormones. The thermostable (TS) form of phenol sulfotransferase (PST) preferentially catalyzes the sulfonation of {open_quotes}simple{close_quotes} planar phenols, and levels of activity of TS PST in human tissues are controlled by inheritance. Two different human liver TS PST cDNAs have been cloned that encode proteins with amino acid sequences that are 96% identical. We have determined the structure and chromosomal localization of the gene for one of these two cDNAs, STP2, as a step toward understanding molecular genetic mechanisms involved in the regulation of this enzyme activity in humans. STP2 spans approximately 5.1 kb and contains nine exons that range in length from 74 to 347 bp. The locations of most STP2 exon-intron splice junctions are identical to those of a gene for the thermolabile form of PST in humans, STM; a rat PST gene; a human estrogen ST (EST) gene, STE; and a guinea pig EST gene. The two initial STP2 exons, IA and IB, were identified by performing 5{prime}-rapid amplification of cDNA ends with human liver cDNA as template. Exons IA and IB are noncoding and represent two different human liver TS PST cDNA 5{prime}untranslated region sequences. The two apparent 5{prime}-ons IA and IB, contain no canonical TATA boxes, but do contain CCAAT elements. STP2 was localized to human chromosome 16 by performing the PCR with DNA from NIGMS human/rodent somatic cell hybrids as template. Structural characterization of STP2 will make it possible to begin to study molecular genetic mechanisms involved in the regulation of TS PST activity in human tissues. 63 refs., 7 figs., 1 tab.

  17. Chromosome Studies of Virus-infected Semi-continuous Human Embryonic Liver Cells

    PubMed Central

    Zuckerman, A. J.; Taylor, P. E.; Jacobs, J. P.; Jones, C. A.

    1970-01-01

    Semi-continuous human embryonic liver cells infected with San Carlos virus 3 exhibited an increased frequency of chromosomal breaks and other chromosomal abnormalities when compared with uninoculated control cultures. The chromosomes of cells inoculated with AR-17 virus retained their normal structure. The strain of liver cells used in this study is essentially diploid. It represents the first strain of diploid cells so far described from human liver. ImagesFigs. 2-3Fig. 1 PMID:4985032

  18. Regional localization of the gene for thyroid peroxidase to human chromosome 2p25 and mouse chromosome 12C

    SciTech Connect

    Endo, Yuichi; Onogi, Satoshi; Fujita, Teizo

    1995-02-10

    Thyroid peroxidase (TPO) plays a central role in thyroid gland function. The enzyme catalyzes two important reactions of thyroid hormone synthesis, i.e., the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Previously, we isolated the cDNAs encoding human and mouse TPOs and assigned the human TPO gene to the short arm of chromosome 2 by somatic cell hybrid mapping. By a similar analysis of DNA from somatic cell hybrids, the human TPO gene was mapped to 2pter-p12. The mouse TPO gene was localized to chromosome 12 using a rat TPO cDNA as a probe to hybridize with mouse-hamster somatic cell hybrids. In this study, we used fluorescence in situ hybridization (FISH) to confirm the localization of human and mouse TPO genes to human chromosome 2 and mouse chromosome 12 and to assign them regionally to 2p25 and 12C, respectively. 7 refs., 1 fig.

  19. Human cytomegalovirus: bacterial artificial chromosome (BAC) cloning and genetic manipulation.

    PubMed

    Paredes, Anne M; Yu, Dong

    2012-02-01

    The understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  20. Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation

    PubMed Central

    Paredes, Anne M.; Yu, Dong

    2011-01-01

    Our understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  1. A mouse embryonic stem cell bank for inducible overexpression of human chromosome 21 genes

    PubMed Central

    2010-01-01

    Background Dosage imbalance is responsible for several genetic diseases, among which Down syndrome is caused by the trisomy of human chromosome 21. Results To elucidate the extent to which the dosage imbalance of specific human chromosome 21 genes perturb distinct molecular pathways, we developed the first mouse embryonic stem (ES) cell bank of human chromosome 21 genes. The human chromosome 21-mouse ES cell bank includes, in triplicate clones, 32 human chromosome 21 genes, which can be overexpressed in an inducible manner. Each clone was transcriptionally profiled in inducing versus non-inducing conditions. Analysis of the transcriptional response yielded results that were consistent with the perturbed gene's known function. Comparison between mouse ES cells containing the whole human chromosome 21 (trisomic mouse ES cells) and mouse ES cells overexpressing single human chromosome 21 genes allowed us to evaluate the contribution of single genes to the trisomic mouse ES cell transcriptome. In addition, for the clones overexpressing the Runx1 gene, we compared the transcriptome changes with the corresponding protein changes by mass spectroscopy analysis. Conclusions We determined that only a subset of genes produces a strong transcriptional response when overexpressed in mouse ES cells and that this effect can be predicted taking into account the basal gene expression level and the protein secondary structure. We showed that the human chromosome 21-mouse ES cell bank is an important resource, which may be instrumental towards a better understanding of Down syndrome and other human aneuploidy disorders. PMID:20569505

  2. Physical mapping of the human t-cell receptor beta gene complex, using yeast artificial chromosomes

    SciTech Connect

    Hashim, Y.; So, A.K.; Kearney, L.

    1995-04-01

    Yeast artificial chromosomes (YACs) were used to construct a physical map of the germline human T-cell {beta} chain gene complex (TCRB). Variable region genes (BV) for the 25 known subfamilies were used as probes to screen the ICRF AM4x YAC library. Of the five positive YACs identified, one YAC designated B3, 820 kilobase pairs (kbp) in size, scored positive for all 25 TCRBV subfamilies plus the constant region genes (BC) when analyzed by pulse field gel electrophoresis. Restriction enzyme mapping of B3 located TCRBV and TCRBC gene regions to 4 Sfi I fragments of 280, 110, 90, and 125 kbp and was in accordance with published data. In addition, comparison of hybridization results of Sfi I-restricted B3 and genomic DNA from the parental cell line GM1416B revealed identical banding patterns. The data thus showed YAC B3 encoded a complete and unrearranged TCRB gene locus of some 600-620 kbp. The map was further resolved by locating restriction sites for Sal I and Bss HII on B3, giving more precise localization of the individual TCRBV gene families. Fluorescent in situ hybridization of B3 to spreads of human metaphase chromosomes localized B3 to 7q35. However, two additional signals were obtained; one attributable to the TCRBV orphon cluster on 9p21, the second to the long arm of chromosome 2. Polymerase chain reaction amplification of a chromosome 2 somatic cell hybrid, using primers for all 25 TCRBV gene families, revealed that the signal was not attributable to a second orphon cluster. It is suggested that B3 is a chimeric YAC with an intact TCRB locus flanked by chromosome 2 sequences. 32 refs., 5 figs., 1 tab.

  3. Analysis of human chromosome 21 for a locus conferring susceptibility to Hirschsprung Disease

    SciTech Connect

    Bolk, S.; Duggan, D.J.; Chakravarti, A.

    1994-09-01

    It has been estimated that approximately 5% of patients diagnosed with Hirschsprung disease (HSCR), or aganglionic megacolon, have trisomy 21. Since the incidence of Hirschsprung disease is 1/5000 live births and the incidence of trisomy 21 is approximately 1/1000 live births, the observed occurrence of HSCR in trisomy 21 is fifty times higher than expected. We propose that at least one locus on chromosome 21 predisposes to HSCR. Although at fifty times elevated risk, only 1% of Down Syndrome cases have HSCR. Thus additional genes or genetic events are necessary for HSCR to manifest in patients with trisomy 21. Based on segregation analysis, Badner et al. postulated that recessive genes may be responsible for up to 80% of HSCR. We postulate that at least one such gene is on chromosome 21 and increased homozygosity for common recessive HSCR mutations may be one cause for the elevated risk of HSCR in cases of trisomy 21. To map such a chromosome 21 locus, we are searching for segments of human chromosome 21 which are identical by descent from the parent in whom non-disjunction occurred. These segments will arise either from meiosis I (followed by a crossover between the centromere and the locus) or from meiosis II (followed by no crossovers). Nine nuclear families with a proband diagnosed with HSCR and Down Syndrome have been genotyped for 18 microsatellite markers spanning human chromosome 21q. In all nine cases analyzed thus far, trisomy 21 resulted from maternal non-disjunction at meiosis I. At this point no single IBD region is apparent. Therefore, additional families are being ascertained and additional markers at high density are being genotyped to map the HSCR locus.

  4. On the association between chromosomal rearrangements and genic evolution in humans and chimpanzees

    PubMed Central

    Marques-Bonet, Tomàs; Sànchez-Ruiz, Jesús; Armengol, Lluís; Khaja, Razi; Bertranpetit, Jaume; Lopez-Bigas, Núria; Rocchi, Mariano; Gazave, Elodie; Navarro, Arcadi

    2007-01-01

    Background The role that chromosomal rearrangements might have played in the speciation processes that have separated the lineages of humans and chimpanzees has recently come into the spotlight. To date, however, results are contradictory. Here we revisit this issue by making use of the available human and chimpanzee genome sequence to study the relationship between chromosomal rearrangements and rates of DNA sequence evolution. Results Contrary to previous findings for this pair of species, we show that genes located in the rearranged chromosomes that differentiate the genomes of humans and chimpanzees, especially genes within rearrangements themselves, present lower divergence than genes elsewhere in the genome. Still, there are considerable differences between individual chromosomes. Chromosome 4, in particular, presents higher divergence in genes located within its rearrangement. Conclusion A first conclusion of our analysis is that divergence is lower for genes located in rearranged chromosomes than for those in colinear chromosomes. We also report that non-coding regions within rearranged regions tend to have lower divergence than non-coding regions outside them. These results suggest an association between chromosomal rearrangements and lower non-coding divergence that has not been reported before, even if some chromosomes do not follow this trend and could be potentially associated with a speciation episode. In summary, without excluding it, our results suggest that chromosomal speciation has not been common along the human and chimpanzee lineage. PMID:17971225

  5. PTEN regulates EG5 to control spindle architecture and chromosome congression during mitosis.

    PubMed

    He, Jinxue; Zhang, Zhong; Ouyang, Meng; Yang, Fan; Hao, Hongbo; Lamb, Kristy L; Yang, Jingyi; Yin, Yuxin; Shen, Wen H

    2016-01-01

    Architectural integrity of the mitotic spindle is required for efficient chromosome congression and accurate chromosome segregation to ensure mitotic fidelity. Tumour suppressor PTEN has multiple functions in maintaining genome stability. Here we report an essential role of PTEN in mitosis through regulation of the mitotic kinesin motor EG5 for proper spindle architecture and chromosome congression. PTEN depletion results in chromosome misalignment in metaphase, often leading to catastrophic mitotic failure. In addition, metaphase cells lacking PTEN exhibit defects of spindle geometry, manifested prominently by shorter spindles. PTEN is associated and co-localized with EG5 during mitosis. PTEN deficiency induces aberrant EG5 phosphorylation and abrogates EG5 recruitment to the mitotic spindle apparatus, leading to spindle disorganization. These data demonstrate the functional interplay between PTEN and EG5 in controlling mitotic spindle structure and chromosome behaviour during mitosis. We propose that PTEN functions to equilibrate mitotic phosphorylation for proper spindle formation and faithful genomic transmission. PMID:27492783

  6. PTEN regulates EG5 to control spindle architecture and chromosome congression during mitosis

    PubMed Central

    He, Jinxue; Zhang, Zhong; Ouyang, Meng; Yang, Fan; Hao, Hongbo; Lamb, Kristy L.; Yang, Jingyi; Yin, Yuxin; Shen, Wen H.

    2016-01-01

    Architectural integrity of the mitotic spindle is required for efficient chromosome congression and accurate chromosome segregation to ensure mitotic fidelity. Tumour suppressor PTEN has multiple functions in maintaining genome stability. Here we report an essential role of PTEN in mitosis through regulation of the mitotic kinesin motor EG5 for proper spindle architecture and chromosome congression. PTEN depletion results in chromosome misalignment in metaphase, often leading to catastrophic mitotic failure. In addition, metaphase cells lacking PTEN exhibit defects of spindle geometry, manifested prominently by shorter spindles. PTEN is associated and co-localized with EG5 during mitosis. PTEN deficiency induces aberrant EG5 phosphorylation and abrogates EG5 recruitment to the mitotic spindle apparatus, leading to spindle disorganization. These data demonstrate the functional interplay between PTEN and EG5 in controlling mitotic spindle structure and chromosome behaviour during mitosis. We propose that PTEN functions to equilibrate mitotic phosphorylation for proper spindle formation and faithful genomic transmission. PMID:27492783

  7. PTEN regulates EG5 to control spindle architecture and chromosome congression during mitosis.

    PubMed

    He, Jinxue; Zhang, Zhong; Ouyang, Meng; Yang, Fan; Hao, Hongbo; Lamb, Kristy L; Yang, Jingyi; Yin, Yuxin; Shen, Wen H

    2016-08-05

    Architectural integrity of the mitotic spindle is required for efficient chromosome congression and accurate chromosome segregation to ensure mitotic fidelity. Tumour suppressor PTEN has multiple functions in maintaining genome stability. Here we report an essential role of PTEN in mitosis through regulation of the mitotic kinesin motor EG5 for proper spindle architecture and chromosome congression. PTEN depletion results in chromosome misalignment in metaphase, often leading to catastrophic mitotic failure. In addition, metaphase cells lacking PTEN exhibit defects of spindle geometry, manifested prominently by shorter spindles. PTEN is associated and co-localized with EG5 during mitosis. PTEN deficiency induces aberrant EG5 phosphorylation and abrogates EG5 recruitment to the mitotic spindle apparatus, leading to spindle disorganization. These data demonstrate the functional interplay between PTEN and EG5 in controlling mitotic spindle structure and chromosome behaviour during mitosis. We propose that PTEN functions to equilibrate mitotic phosphorylation for proper spindle formation and faithful genomic transmission.

  8. Chromosomal Rearrangements as Barriers to Genetic Homogenization between Archaic and Modern Humans.

    PubMed

    Rogers, Rebekah L

    2015-12-01

    Chromosomal rearrangements, which shuffle DNA throughout the genome, are an important source of divergence across taxa. Using a paired-end read approach with Illumina sequence data for archaic humans, I identify changes in genome structure that occurred recently in human evolution. Hundreds of rearrangements indicate genomic trafficking between the sex chromosomes and autosomes, raising the possibility of sex-specific changes. Additionally, genes adjacent to genome structure changes in Neanderthals are associated with testis-specific expression, consistent with evolutionary theory that new genes commonly form with expression in the testes. I identify one case of new-gene creation through transposition from the Y chromosome to chromosome 10 that combines the 5'-end of the testis-specific gene Fank1 with previously untranscribed sequence. This new transcript experienced copy number expansion in archaic genomes, indicating rapid genomic change. Among rearrangements identified in Neanderthals, 13% are transposition of selfish genetic elements, whereas 32% appear to be ectopic exchange between repeats. In Denisovan, the pattern is similar but numbers are significantly higher with 18% of rearrangements reflecting transposition and 40% ectopic exchange between distantly related repeats. There is an excess of divergent rearrangements relative to polymorphism in Denisovan, which might result from nonuniform rates of mutation, possibly reflecting a burst of transposable element activity in the lineage that led to Denisovan. Finally, loci containing genome structure changes show diminished rates of introgression from Neanderthals into modern humans, consistent with the hypothesis that rearrangements serve as barriers to gene flow during hybridization. Together, these results suggest that this previously unidentified source of genomic variation has important biological consequences in human evolution.

  9. Chromosomal Rearrangements as Barriers to Genetic Homogenization between Archaic and Modern Humans.

    PubMed

    Rogers, Rebekah L

    2015-12-01

    Chromosomal rearrangements, which shuffle DNA throughout the genome, are an important source of divergence across taxa. Using a paired-end read approach with Illumina sequence data for archaic humans, I identify changes in genome structure that occurred recently in human evolution. Hundreds of rearrangements indicate genomic trafficking between the sex chromosomes and autosomes, raising the possibility of sex-specific changes. Additionally, genes adjacent to genome structure changes in Neanderthals are associated with testis-specific expression, consistent with evolutionary theory that new genes commonly form with expression in the testes. I identify one case of new-gene creation through transposition from the Y chromosome to chromosome 10 that combines the 5'-end of the testis-specific gene Fank1 with previously untranscribed sequence. This new transcript experienced copy number expansion in archaic genomes, indicating rapid genomic change. Among rearrangements identified in Neanderthals, 13% are transposition of selfish genetic elements, whereas 32% appear to be ectopic exchange between repeats. In Denisovan, the pattern is similar but numbers are significantly higher with 18% of rearrangements reflecting transposition and 40% ectopic exchange between distantly related repeats. There is an excess of divergent rearrangements relative to polymorphism in Denisovan, which might result from nonuniform rates of mutation, possibly reflecting a burst of transposable element activity in the lineage that led to Denisovan. Finally, loci containing genome structure changes show diminished rates of introgression from Neanderthals into modern humans, consistent with the hypothesis that rearrangements serve as barriers to gene flow during hybridization. Together, these results suggest that this previously unidentified source of genomic variation has important biological consequences in human evolution. PMID:26399483

  10. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  11. Physical mapping of genetic markers on the short arm of chromosome 5

    SciTech Connect

    Gersh, M.; Goodart, S.A.; Overhauser, J.

    1994-12-01

    The deletion of the short arm of chromosome 5 is associated with the cri-du-chat syndrome. In addition, loss of this portion of a chromosome is a common cytogenetic marker in a number of malignancies. However, to date, no genes associated with these disorders have been identified. Physical maps are the first step in isolating causative genes, and genes involved in autosomal recessive disorders are now routinely mapped through the identification of linked markers. Extensive genetic maps based upon polymorphic short tandem repeats (STRs) have provided researchers with a large number of markers to which such disorders can be genetically mapped. However, the physical locations of many of these STRs have not been determined. Toward the goal of integrating the human genetic maps with the physical maps, a 5p somatic cell hybrid deletion mapping panel that was derived from patients with 5p deletions or translocations was used to physically map 47 STRs that have been used to construct genetic maps of 5p. These data will be useful in the localization of disease genes that map to 5p and may be involved in the etiology of the cri-du-chat syndrome. 26 refs., 1 fig.

  12. Kinesin 5B (KIF5B) is required for progression through female meiosis and proper chromosomal segregation in mitotic cells.

    PubMed

    Kidane, Dawit; Sakkas, Denny; Nottoli, Timothy; McGrath, James; Sweasy, Joann B

    2013-01-01

    The fidelity of chromosomal segregation during cell division is important to maintain chromosomal stability in order to prevent cancer and birth defects. Although several spindle-associated molecular motors have been shown to be essential for cell division, only a few chromosome arm-associated motors have been described. Here, we investigated the role of Kinesin 5b (Kif5b) during female mouse meiotic cell development and mitotic cell division. RNA interference (RNAi)-mediated silencing of Kif5b in mouse oocytes induced significant delay in germinal vesicle breakdown (GVBD) and failure in extrusion of the first polar body (PBE). In mitotic cells, knockdown of Kif5b leads to centrosome amplification and a chromosomal segregation defect. These data suggest that KIF5B is critical in suppressing chromosomal instability at the early stages of female meiotic cell development and mitotic cell division.

  13. Human sperm chromosome analysis after subzonal sperm insemination of hamster oocytes

    SciTech Connect

    Cozzi, J.

    1994-09-01

    Sperm microinjection techniques, subzonal sperm insemination (SUZI) and intracytoplasmic sperm injection (ICSI), have achieved a wide spread clinical application for the treatment of male infertility. To date, only one study has focused on sperm karyotypes after microinjection. Martin et al. reported a very high incidence of abnormal human sperm complements after ICSI into hamster oocytes. In the present study, are reported the first human sperm karyotypes after SUZI of hamster oocytes. Spermatozoa from two control donors were treated by calcium ionophore A23187 and injected under the zona of hamster eggs. The microinjected eggs were then cultured for cytogenetic analysis of the pronuclei. Out of 47 analyzed sperm chromosome metaphases, 5 (10.6%) were abnormal, 4 (8.5%) were hypohaploid and 1 (2.1%) had a structural abnormality. The sex ratio was not significantly different from the expected 1:1 ratio. Rates of chromosomal abnormalities in microinjected spermatozoa were similar to those observed in spermatozoa inseminated with zona free eggs, suggesting that SUZI procedure per se does not increase sperm chromosomal abnormalities.

  14. Stability of Radiation Induced Chromosome Damage in Human Peripheral Blood Lymphocytes

    NASA Technical Reports Server (NTRS)

    Cucinotta, F. A.; George, K.; Willingham, V.

    2006-01-01

    Chromosome damage in an individual's peripheral blood lymphocytes can be an indicator of radiation exposure and this data can be used to evaluate dose after accidental or occupational exposure. Evidence suggests that the yield of chromosome damage in lymphocytes is also a relevant biomarker of cancer risk in humans that reflects individual cancer susceptibility. It follows that biomonitoring studies can be used to uncover subjects who are particularly susceptible to radiation damage and therefore at higher risk of cancer. Translocations and other stable aberrations are commonly believed to persist in peripheral blood cells for many years after exposure, and it has been suggested that translocations can be used for assessing retrospective radiation doses or chronic exposures. However, recent investigations suggest that translocations might not always persist indefinitely. We measured chromosome aberrations in the blood lymphocytes of six astronauts before their respective missions of approximately 3 to 6 months onboard the international space station, and again at various intervals up to 5 years after flight. In samples collected a few days after return to earth, the yield of chromosome translocations had significantly increased compared with preflight values, and results indicate that biodosimetry estimates lie within the range expected from physical dosimetry. However, for five of the astronauts, follow up analysis revealed a temporal decline in translocations with half-lives ranging from 10 to 58 months. The yield of exchanges remained unchanged for the sixth astronaut during an observation period of 5 months post-flight. These results may indicate complications with the use of stable aberrations for retrospective dose reconstruction and could affect cancer risk predictions that are estimated from yields of chromosome damage obtained shortly after exposure.

  15. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, K.; Cucinotta, F. A.

    2010-01-01

    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to 28Si- ions with energies ranging from 90 to 600 MeV/u, or to 56Fe-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Fe beams in this study ranged from 145 to 440 keV/micron and the LET of the Si ions ranged from 48 to 158 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to -rays. The estimates of RBE(sub max) values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBE(sub max) value for Fe ions was obtained with the 600-Mev/u beam, and the highest RBE(sub max) value for Si ions was obtained with the 170 MeV/u beam. For both ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/ m for Si, and decreasing with further increase in LET. Additional studies for low doses 28Si-ions down to 0.02 Gy will be discussed.

  16. High- and low-LET Radiation-induced Chromosome Aberrations in Human Epithelial Cells Cultured in 3-dimensional Matrices

    NASA Technical Reports Server (NTRS)

    Hada, M.; George K.; Cucinotta, F. A.; Wu, H.

    2008-01-01

    Energetic heavy ions pose a great health risk to astronauts who participate in extended ISS missions and will be an even greater concern for future manned lunar and Mars missions. High-LET heavy ions are particularly effective in causing various biological effects, including cell inactivation, genetic mutations, cataracts and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied low- and high-LET radiation-induced chromosome aberrations in human epithelial cells cultured in 2-dimension (2D) using the multicolor banding fluorescence in situ hybridization (mBAND) technique. However, it has been realized that the biological response to radiation insult in a 2D in vitro cellular environment can differ significantly from the response in 3-dimension (3D) or at the actual tissue level. In this study, we cultured human epithelial cells in 3D to provide a more suitable model for human tissue. Human mammary epithelial cells (CH184B5F5/M10) were grown in Matrigel to form 3D structures, and exposed to Fe-ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory or 137Cs-gamma radiation source at the University of Texas MD Anderson Cancer Center. After exposure, cells were allowed to repair for 16hr before dissociation and subcultured at low density in 2D. G2 and metaphase chromosomes in the first cell cycle were collected in the first cell cycle after irradiation using a chemical-induced premature chromosome condensation (PCC) technique, and chromosome aberrations were analyzed using mBAND technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). Our data indicate a significant difference in the

  17. X Chromosome of female cells shows dynamic changes in status during human somatic cell reprogramming.

    PubMed

    Kim, Kun-Yong; Hysolli, Eriona; Tanaka, Yoshiaki; Wang, Brandon; Jung, Yong-Wook; Pan, Xinghua; Weissman, Sherman Morton; Park, In-Hyun

    2014-06-01

    Induced pluripotent stem cells (iPSCs) acquire embryonic stem cell (ESC)-like epigenetic states, including the X chromosome. Previous studies reported that human iPSCs retain the inactive X chromosome of parental cells, or acquire two active X chromosomes through reprogramming. Most studies investigated the X chromosome states in established human iPSC clones after completion of reprogramming. Thus, it is still not fully understood when and how the X chromosome reactivation occurs during reprogramming. Here, we report a dynamic change in the X chromosome state throughout reprogramming, with an initial robust reactivation of the inactive X chromosome followed by an inactivation upon generation of nascent iPSC clones. iPSCs with two active X chromosomes or an eroded X chromosome arise in passaging iPSCs. These data provide important insights into the plasticity of the X chromosome of human female iPSCs and will be crucial for the future application of such cells in cell therapy and X-linked disease modeling. PMID:24936474

  18. X Chromosome of Female Cells Shows Dynamic Changes in Status during Human Somatic Cell Reprogramming

    PubMed Central

    Kim, Kun-Yong; Hysolli, Eriona; Tanaka, Yoshiaki; Wang, Brandon; Jung, Yong-Wook; Pan, Xinghua; Weissman, Sherman Morton; Park, In-Hyun

    2014-01-01

    Summary Induced pluripotent stem cells (iPSCs) acquire embryonic stem cell (ESC)-like epigenetic states, including the X chromosome. Previous studies reported that human iPSCs retain the inactive X chromosome of parental cells, or acquire two active X chromosomes through reprogramming. Most studies investigated the X chromosome states in established human iPSC clones after completion of reprogramming. Thus, it is still not fully understood when and how the X chromosome reactivation occurs during reprogramming. Here, we report a dynamic change in the X chromosome state throughout reprogramming, with an initial robust reactivation of the inactive X chromosome followed by an inactivation upon generation of nascent iPSC clones. iPSCs with two active X chromosomes or an eroded X chromosome arise in passaging iPSCs. These data provide important insights into the plasticity of the X chromosome of human female iPSCs and will be crucial for the future application of such cells in cell therapy and X-linked disease modeling. PMID:24936474

  19. Identification of microsatellite markers linked to the human leptin receptor gene on chromosome 1

    SciTech Connect

    Winick, J.D.; Friedman, J.M.; Stoffel, M.

    1996-08-15

    This report describes the localization of the human leptin receptor gene to human chromosome 1 using polymerase chain reaction of somatic cell hybrids. Leptin is a secreted protein important in the regulation of body weight. 16 refs., 1 fig.

  20. Chromosomal mutations and chromosome loss measured in a new human-hamster hybrid cell line, ALC: studies with colcemid, ultraviolet irradiation, and 137Cs gamma-rays

    NASA Technical Reports Server (NTRS)

    Kraemer, S. M.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

    1997-01-01

    Small mutations, megabase deletions, and aneuploidy are involved in carcinogenesis and genetic defects, so it is important to be able to quantify these mutations and understand mechanisms of their creation. We have previously quantified a spectrum of mutations, including megabase deletions, in human chromosome 11, the sole human chromosome in a hamster-human hybrid cell line AL. S1- mutants have lost expression of a human cell surface antigen, S1, which is encoded by the M1C1 gene at 11p13 so that mutants can be detected via a complement-mediated cytotoxicity assay in which S1+ cells are killed and S1- cells survive. But loss of genes located on the tip of the short arm of 11 (11p15.5) is lethal to the AL hybrid, so that mutants that have lost the entire chromosome 11 die and escape detection. To circumvent this, we fused AL with Chinese hamster ovary (CHO) cells to produce a new hybrid, ALC, in which the requirement for maintaining 11p15.5 is relieved, allowing us to detect mutations events involving loss of 11p15.5. We evaluated the usefulness of this hybrid by conducting mutagenesis studies with colcemid, 137Cs gamma-radiation and UV 254 nm light. Colcemid induced 1000 more S1- mutants per unit dose in ALC than in AL; the increase for UV 254 nm light was only two-fold; and the increase for 137Cs gamma-rays was 12-fold. The increase in S1- mutant fraction in ALC cells treated with colcemid and 137Cs gamma-rays were largely due to chromosome loss and 11p deletions often containing a breakpoint within the centromeric region.

  1. Isolation and refined regional mapping of expressed sequences from human chromosome 21

    SciTech Connect

    Kao, F.T.; Yu, J.; Patterson, D.

    1994-10-01

    To increase candidate genes from human chromosome 21 for the analysis of Down syndrome and other genetic diseases localized on this chromosome, we have isolated and studied 9 cDNA clones encoded by chromosome 21. For isolating cDNAs, single-copy microclones from a chromosome 21 microdissection library were used in direct screening of various cDNA libraries. Seven of the cDNA clones have been regionally mapped on chromosome 21 using a comprehensive hybrid mapping panel comprising 24 cell hybrids that divide the chromosome into 33 subregions. These cDNA clones with refined mapping positions should be useful for identification and cloning of genes responsible for the specific component phenotypes of Down syndrome and other diseases on chromosome 21, including progressive myoclonus epilepsy in 21q22.3. 12 refs., 2 figs., 1 tab.

  2. Localization of serum biotinidase (BTD) to human chromosome 3 in band p25

    SciTech Connect

    Cole, H.; Wolf, B.; Weremowicz, S.

    1994-08-01

    Biotinidase (EC 3.5.1.12) recycles the vitamin biotin by catalyzing the hydrolysis of biocytin, the product of biotin-dependent carboxylase degradation, to biotin and lysine. Biotinidase deficiency is a metabolic disorder that is inherited as an autosomal recessive trait and can be successfully treated with biotin supplementation. Children with biotinidase deficiency who are not treated usually exhibit neurological and cutaneous abnormalities. We have cloned and sequenced the cDNA for human serum biotinidase and now report the chromosomal localization of the gene encoding the enzyme. Fluorescence in situ hybridization (FISH) techniques using a genomic fragment mapped the locus of the biotinidase gene to chromosome 3 in band p25. 4 refs., 1 fig.

  3. Mutagenicity and human chromosomal effect of stevioside, a sweetener from Stevia rebaudiana Bertoni.

    PubMed Central

    Suttajit, M; Vinitketkaumnuen, U; Meevatee, U; Buddhasukh, D

    1993-01-01

    Leaves of Stevia rebaudiana Bertoni have been popularly used as a sweetener in foods and beverages for diabetics and obese people due to their potent sweetener stevioside. In this report, stevioside and steviol were tested for mutagenicity in Salmonella typhimurium strains TA98 and TA100 and for chromosomal effects on cultured human lymphocytes. Stevioside was not mutagenic at concentrations up to 25 mg/plate, but showed direct mutagenicity to only TA98 at 50 mg/plate. However, steviol did not exhibit mutagenicity in either TA98 or TA100, with or without metabolic activation. No significant chromosomal effect of stevioside and steviol was observed in cultured blood lymphocytes from healthy donors (n = 5). This study indicates that stevioside and steviol are neither mutagenic nor clastogenic in vitro at the limited doses; however, in vivo genotoxic tests and long-term effects of stevioside and steviol are yet to be investigated. PMID:8143647

  4. Comparative analysis of a conserved zinc finger gene cluster on human chromosome 19q and mouse chromosome 7

    SciTech Connect

    Shannon, M.; Mucenski, M.L.; Stubbs, L.

    1996-04-01

    Several lines of evidence now suggest that many of the zinc-finger-containing (ZNF) genes in the human genome are arranged in clusters. However, little is known about the structure or function of the clusters or about their conservation throughout evolution. Here, we report the analysis of a conserved ZNF gene cluster located in human chromosome 19q13.2 and mouse chromosome 7. Our results indicate that the human cluster consists of at least 10 related Kruppel-associated box (KRAB)-containing ZNF genes organized in tandem over a distance of 350-450 kb. Two cDNA clones representing genes in the murine cluster have been studied in detail. The KRAB A domains of these genes are nearly identical and are highly similar to human 19q13.2-derived KRAB sequences, but DNA-binding ZNF domains and other portions of the genes differ considerably. The two murine genes display distinct expression patterns, but are coexpressed in some adult tissues. These studies pave the way for a systematic analysis of the evolution of structure and function of genes within the numerous clustered ZNF families located on human chromosome 19 and elsewhere in the human and mouse genomes. 32 refs., 7 figs.

  5. Topology, structures, and energy landscapes of human chromosomes

    PubMed Central

    Zhang, Bin; Wolynes, Peter G.

    2015-01-01

    Chromosome conformation capture experiments provide a rich set of data concerning the spatial organization of the genome. We use these data along with a maximum entropy approach to derive a least-biased effective energy landscape for the chromosome. Simulations of the ensemble of chromosome conformations based on the resulting information theoretic landscape not only accurately reproduce experimental contact probabilities, but also provide a picture of chromosome dynamics and topology. The topology of the simulated chromosomes is probed by computing the distribution of their knot invariants. The simulated chromosome structures are largely free of knots. Topologically associating domains are shown to be crucial for establishing these knotless structures. The simulated chromosome conformations exhibit a tendency to form fibril-like structures like those observed via light microscopy. The topologically associating domains of the interphase chromosome exhibit multistability with varying liquid crystalline ordering that may allow discrete unfolding events and the landscape is locally funneled toward “ideal” chromosome structures that represent hierarchical fibrils of fibrils. PMID:25918364

  6. Topology, structures, and energy landscapes of human chromosomes.

    PubMed

    Zhang, Bin; Wolynes, Peter G

    2015-05-12

    Chromosome conformation capture experiments provide a rich set of data concerning the spatial organization of the genome. We use these data along with a maximum entropy approach to derive a least-biased effective energy landscape for the chromosome. Simulations of the ensemble of chromosome conformations based on the resulting information theoretic landscape not only accurately reproduce experimental contact probabilities, but also provide a picture of chromosome dynamics and topology. The topology of the simulated chromosomes is probed by computing the distribution of their knot invariants. The simulated chromosome structures are largely free of knots. Topologically associating domains are shown to be crucial for establishing these knotless structures. The simulated chromosome conformations exhibit a tendency to form fibril-like structures like those observed via light microscopy. The topologically associating domains of the interphase chromosome exhibit multistability with varying liquid crystalline ordering that may allow discrete unfolding events and the landscape is locally funneled toward "ideal" chromosome structures that represent hierarchical fibrils of fibrils.

  7. Human Xq24-Xq28: approaches to mapping with yeast artificial chromosomes.

    PubMed Central

    Wada, M; Little, R D; Abidi, F; Porta, G; Labella, T; Cooper, T; Della Valle, G; D'Urso, M; Schlessinger, D

    1990-01-01

    One hundred twenty-seven yeast strains with artificial chromosomes containing Xq24-Xqter human DNA were obtained starting from a human/hamster somatic cell hybrid. The clones were characterized with respect to their insert size, stability, and representation of a set of Xq24-Xqter DNA probes. The inserts of the clones add up to 19.3 megabase (Mb) content, or about 0.4 genomic equivalents of that portion of the X chromosome, with a range of 40-650 kb in individual YACs. Eleven clones contained more than one YAC, the additional ones usually having hamster DNA inserts; the individual YACs could be separated by extracting the total DNA from such strains and using it to retransform yeast cells. One of the YACs, containing the probe for the DXS49 locus, was grossly unstable, throwing off smaller versions of an initial 300-kb YAC during subculture; the other YACs appeared to breed true on subculture. Of 52 probes tested, 12 found cognate YACs; the YACs included one with the glucose-6-phosphate dehydrogense gene and another containing four anonymous probe sequences (DX13, St14, cpx67, and cpx6). Xq location of YACs is being verified by in situ hybridization to metaphase chromosomes, and fingerprinting and hybridization methods are being used to detect YACs that overlap. Images Figure 3 Figure 1 Figure 2 Figure 4 Figure 5 Figure 6 PMID:2294758

  8. miR-28-5p promotes chromosomal instability in VHL-associated cancers by inhibiting Mad2 translation.

    PubMed

    Hell, Michael P; Thoma, Claudio R; Fankhauser, Niklaus; Christinat, Yann; Weber, Thomas C; Krek, Wilhelm

    2014-05-01

    Chromosomal instability enables tumor development, enabled in part by aberrant expression of the mitotic checkpoint protein Mad2. Here we identify a novel regulatory mechanism for Mad2 expression involving miR-28-5p-mediated inhibition of Mad2 translation, and we demonstrate that this mechanism is triggered by inactivation of the tumor suppressor VHL, the most common event in clear cell renal cell carcinoma (ccRCC). In VHL-positive cancer cells, enhanced expression of miR-28-5p diminished Mad2 levels and promoted checkpoint weakness and chromosomal instability. Conversely, in checkpoint-deficient VHL-negative renal carcinoma cells, inhibition of miR-28-5p function restored Mad2 levels, mitotic checkpoint proficiency, and chromosomal stability. Notably, chromosome missegregation errors and aneuploidy that were produced in a mouse model of acute renal injury (as a result of kidney-specific ablation of pVHL function) were reverted in vivo also by genetic inhibition of miR-28-5p. Finally, bioinformatic analyses in human ccRCC associated loss of VHL with increased miR-28-5p expression and chromosomal instability. Together, our results defined miR-28-5p as a critical regulator of Mad2 translation and mitotic checkpoint function. By identifying a potential mediator of chromosomal instability in VHL-associated cancers, our work also suggests a novel microRNA-based therapeutic strategy to target aneuploid cells in VHL-associated cancers.

  9. Geminin overexpression prevents the completion of topoisomerase IIα chromosome decatenation, leading to aneuploidy in human mammary epithelial cells

    PubMed Central

    2011-01-01

    Introduction The nuclear enzyme topoisomerase IIα (TopoIIα) is able to cleave DNA in a reversible manner, making it a valuable target for agents such as etoposide that trap the enzyme in a covalent bond with the 5′ DNA end to which it cleaves. This prevents DNA religation and triggers cell death in cancer cells. However, development of resistance to these agents limits their therapeutic use. In this study, we examined the therapeutic targeting of geminin for improving the therapeutic potential of TopoIIα agents. Methods Human mammary epithelial (HME) cells and several breast cancer cell lines were used in this study. Geminin, TopoIIα and cell division cycle 7 (Cdc7) silencing were done using specific small interfering RNA. Transit or stable inducible overexpression of these proteins and casein kinase Iε (CKIε) were also used, as well as several pharmacological inhibitors that target TopoIIα, Cdc7 or CKIε. We manipulated HME cells that expressed H2B-GFP, or did not, to detect chromosome bridges. Immunoprecipitation and direct Western blot analysis were used to detect interactions between these proteins and their total expression, respectively, whereas interactions on chromosomal arms were detected using a trapped in agarose DNA immunostaining assay. TopoIIα phosphorylation by Cdc7 or CKIε was done using an in vitro kinase assay. The TopoGen decatenation kit was used to measure TopoIIα decatenation activity. Finally, a comet assay and metaphase chromosome spread were used to detect chromosome breakage and changes in chromosome condensation or numbers, respectively. Results We found that geminin and TopoIIα interact primarily in G2/M/early G1 cells on chromosomes, that geminin recruits TopoIIα to chromosomal decatenation sites or vice versa and that geminin silencing in HME cells triggers the formation of chromosome bridges by suppressing TopoIIα access to chromosomal arms. CKIε kinase phosphorylates and positively regulates TopoIIα chromosome

  10. 5-fluoro-orotic acid induces chromosome alterations in genetically manipulated strains of Candida albicans.

    PubMed

    Wellington, Melanie; Kabir, M Anaul; Rustchenko, Elena

    2006-01-01

    We previously reported the occurrence of chromosome alterations in a Candida albicans prototrophic strain 3153A treated with 5-fluoro-orotic acid (5-FOA). In this study we investigated the mutagenic properties of 5-FOA with two derivatives of C. albicans strain CAF4-2 (ura3/ura3), each containing an ectopic copy of URA3 gene (ura3/ ura3 URA3) on a different chromosome. As expected, after the ura3/ura3 URA3 constructs were applied to 5-FOA containing solid medium, the "pop-outs" that lost URA3 appeared. However most of the "pop-outs" acquired various chromosome alterations. Thus constructs exposed to 5-FOA should be examined for chromosome alterations or the use of 5-FOA should be avoided. PMID:17040068

  11. Identification of the human {beta}A2 crystallin gene (CRYBA2): Localization of the gene on human chromosome 2 and of the homologous gene on mouse chromosome 1

    SciTech Connect

    Hulsebos, T.J.M.; Cerosaletti, K.M.; Fournier, R.E.K.

    1995-08-10

    By using primers synthesized on the basis of the bovine {beta}A2 crystalline gene sequence, we amplified exons 5 and 6 of the human gene (CRYBA2). CRYBA2 was assigned to human chromosome 2 by concordance analysis in human x rodent somatic cell hybrids using the amplified PCR products as probe. Regional localization to 2q34-q36 was established by hybridizing the CRYBA2 probe to microcell and radiation hybrids containing defined fragments of chromosome 2 as the only human contribution. The CRYBA2 probe was also used to localize, by interspecific backcross mapping, the mouse gene (Cryba2) to the central portion of chromosome 1 in a region of known human chromosome 2 homology. Finally, we demonstrate that in both species the {beta}A2 crystallin gene is linked but separable from the {gamma}A crystallin gene. The {beta}A2 crystallin gene is a candidate gene for human and mouse hereditary cataract. 32 refs., 4 figs.

  12. A review of thresholding strategies applied to human chromosome segmentation.

    PubMed

    Poletti, Enea; Zappelli, Francesca; Ruggeri, Alfredo; Grisan, Enrico

    2012-11-01

    Karyotype analysis is a widespread procedure in cytogenetics to assess the presence of genetic defects by the visualization of the structure of chromosomes. The procedure is lengthy and repetitive and an effective automatic analysis would greatly help the cytogeneticist routine work. Still, automatic segmentation and the full disentangling of chromosomes are open issues. The first step in every automatic procedure is the thresholding step, which detect blobs that represent either single chromosomes or clusters of chromosomes. The better the thresholding step, the easier is the subsequent disentanglement of chromosome clusters into single entities. We implemented eleven thresholding methods, i.e. the ones that appear in the literature as the best performers, and compared their performance in segmenting chromosomes and chromosome clusters in cytogenetic Q-band images. The images are affected by the presence of hyper- or hypo-fluorescent regions and by a contrast variability between the stained chromosomes and the background. A thorough analysis of the results highlights that, although every single algorithm shows peculiar strong/weak points, Adaptive Threshold and Region Based Level Set have the overall best performance. In order to provide the scientific community with a public dataset, the data and manual segmentation used in this paper are available for public download at http://bioimlab.dei.unipd.it.

  13. Ring chromosome 5 associated with severe growth retardation as the sole major physical abnormality

    SciTech Connect

    Migliori, M.V.; Pettinari, A.; Cherubini, V.; Bartolotta, E.; Pecora, R.

    1994-01-01

    The authors report on a case of ring chromosome 5 in a 36-month-old girl with severe growth retardation, clinodactyly, mild psychological abnormalities, and normal facial appearance. Endocrine tests showed partial growth hormone deficiency. Cytogenetic investigation failed to demonstrate any apparent microscopic deletion of either the short or long arm of chromosome 5 as a consequence of ring formation. In 12% of cells examined, the ring was either absent or present in multiple copies. Only 3 previous cases of ring chromosome 5 have been reported in association with short stature of prenatal onset and minor anomalies, without mental retardation. 12 refs., 3 figs.

  14. Syntenic assignment of human chromosome 1 homologous loci in the bovine.

    PubMed

    Threadgill, D S; Threadgill, D W; Moll, Y D; Weiss, J A; Zhang, N; Davey, H W; Wildeman, A G; Womack, J E

    1994-08-01

    Three mouse chromosomes (MMU 1, 3, and 4) carry homologs of human chromosome 1 (HSA 1) genes. A similar situation is found in the bovine, where five bovine chromosomes (BTA 2, 3, 5, 16, and unassigned syntenic group U25) contain homologs of HSA 1 loci. To evaluate further the syntenic relationship of HSA 1 homologs in cattle, 10 loci have been physically mapped through segregation analysis in bovine-rodent hybrid somatic cells. These loci, chosen for their location on HSA 1, are antithrombin 3 (AT3), renin (REN), complement component receptor 2 (CR2), phosphofructokinase muscle type (PFKM), Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog (FGR), alpha fucosidase (FUCA1), G-protein beta 1 subunit (GNB1), alpha 1A amylase, (AMY1), the neuroblastoma RAS viral (v-ras) oncogene homolog (NRAS), and alpha skeletal actin (ACTA1). AT3, REN, CR2, and GNB1 mapped to BTA 16, PFKM to BTA 5, AMY1A and NRAS to BTA 3, FGR and FUCA1 to BTA 2, and ACTA1 to BTA 28. PMID:8001974

  15. Isolation, expression, and chromosomal localization of the human mitochondrial capsule selenoprotein gene (MCSP)

    SciTech Connect

    Aho, Hanne; Schwemmer, M.; Tessmann, D.; Murphy, D.

    1996-03-01

    The mitochondrial capsule selenoprotein (MCS) (HGMW-approved symbol MCSP) is one of three proteins that are important for the maintenance and stabilization of the crescent structure of the sperm mitochondria. We describe here the isolation of a cDNA, the exon-intron organization, the expression, and the chromosomal localization of the human MCS gene. Nucleotide sequence analysis of the human and mouse MCS cDNAs reveals that the 5{prime}- and 3{prime}-untranslated sequences are more conserved (71%) than the coding sequences (59%). The open reading frame encodes a 116-amino-acid protein and lacks the UGA codons, which have been reported to encode the selenocysteines in the N-terminal of the deduced mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein (39%). The most striking homology lies in the dicysteine motifs. Northern and Southern zooblot analyses reveal that the MCS gene in human, baboon, and bovine is more conserved than its counterparts in mouse and rat. The single intron in the human MCS gene is approximately 6 kb and interrupts the 5{prime}-untranslated region at a position equivalent to that in the mouse and rat genes. Northern blot and in situ hybridization experiments demonstrate that the expression of the human MCS gene is restricted to haploid spermatids. The human gene was assigned to q21 of chromosome 1. 30 refs., 9 figs.

  16. The nature of chromosomal aberrations detected in humans exposed to benzene.

    PubMed

    Zhang, Luoping; Eastmond, David A; Smith, Martyn T

    2002-01-01

    Benzene is an established cause of human leukemia that is thought to act by producing chromosomal aberrations and altered in cell differentiation. In several recent studies increased levels of chromosomal aberrations in peripheral blood lymphocytes were correlated with a heightened risk of cancer, especially hematological malignancies. Thus, chromosomal aberrations may be a predictor of future leukemia risk. Previous studies exploring whether benzene exposure induces chromosomal aberrations have yielded mostly positive results. However, it remains unclear whether the chromosomal aberrations induced by benzene occur in a distinct pattern. Here, we thoroughly review the major chromosome studies published to date in benzene-exposed workers, benzene-poisoned and preleukemia patients, and leukemia cases associated with benzene expose. Although three cytogenetic markers (chromosomal aberrations, sister chromatid exchanges, and micronuclei) are commonly examined, our primary focus is on studies of chromosomal aberrations, because only this marker has so far been correlated with increased cancer risk. This review surveys the published literature, analyzes the study results, and discusses the characteristics of effects reported. In most studies of currently exposed workers, increases in chromosomal aberrations were observed. However, due to the relatively small number of affected individuals and variability in the reported aberrations, firm conclusions cannot be made about the involvement of specific chromosomes or chromosome regions. Further, in leukemia cases associated with benzene exposure, there is no evidence of a unique pattern of benzene-induced chromosomal aberrations in humans. Leukemia cases associated with benzene exposure are, however, more likely to contain clonal chromosome aberrations then those arising de novo in the general population.

  17. Comparative study of artificial chromosome centromeres in human and murine cells

    PubMed Central

    Moralli, Daniela; Jefferson, Andrew; Valeria Volpi, Emanuela; Larin Monaco, Zoia

    2013-01-01

    Human artificial chromosomes (HAC) are a valuable tool in the analysis of complex chromatin structures such as the human centromere because of their small size and relative simplicity compared with normal human chromosomes. This report includes a comprehensive study of the centromere and chromatin composition of HAC, expressing human genes, generated in human cells and transferred to murine cells. The analysis involved chromatin immuno-precipitation and immuno-FISH on metaphase chromosomes and chromatin fibres. In both the cell types, the HAC consisted of alphoid and non-alphoid DNA and were mainly euchromatic in composition, although a pericentromeric heterochromatic region was present on all the HAC. Fibre-FISH and chromatin immuno-precipitation data indicated that the position of the centromere differed between HAC in human cells and in murine cells. Our work highlights the importance and utilisation of HAC for understanding the epigenetic aspects of chromosome biology. PMID:23403904

  18. Extinction of albumin gene expression in a panel of human chromosome 2 microcell hybrids

    SciTech Connect

    Cerosaletti, K.M.; Fournier, R.E.K.

    1996-02-01

    Expression of the serum albumin gene is extinguished in rat hepatoma microcell hybrids that retain mouse chromosome 1. These data define a trans-dominant extinguisher locus, Tse-2, on mouse chromosome 1. To localize the human TSE2 locus, we prepared and characterized rat/human microcell hybrids that contained either human chromosome 1 or chromosome 2, the genetic homologues of mouse chromosome 1. Rat hepatoma microcell hybrids retaining a derivative human chromosome 1 [der 1 t(1;17)(p34.3;q11.2)] expressed their serum albumin genes at levels similar to those of parental hepatoma cells. In contrast, microcell transfer of human chromosome 2 into rat hepatoma recipients produced karyotypically heterogeneous collections of hybrid clones, some of which displayed dramatic albumin extinction phenotypes. For example, albumin mRNA levels in hapatoma x fibroblast whole-cell hybrids. Expression of several other liver genes, including {alpha}1-antitrypsin, aldolase B, alcohol dehydrogenase, and phosphoenolpyruvate carboxykinase, was also affected in some of the microcell hybrids, but expression of these genes was no concordant with expression of albumin. Hybrid segregants were prepared from the albumin-extinguished hybrids, and reexpression of albumin mRNA and protein was observed in sublines that had lost or fragmented human chromosome 2. Finally, expression of mRNAs encoding the liver-enriched transactivators HNF-1, HNF-4, HNF-3{alpha}, and HNF-3{beta} was not affected in any of the chromosome 2-containing hybrids. These data define and map a genetic locus on human chromosome 2 that extinguishes albumin gene expression in trans, and they suggest that TSE2-mediated extinction is independent of HNF-1, -4, -3{alpha}, and -3{beta} expression. 61 refs., 2 figs., 3 tabs.

  19. Detection of sex chromosomal aneuploidies X-X, Y-Y, and X-Y in human sperm using two-chromosome fluorescence in situ hybridization

    SciTech Connect

    Wyrobek, A.J.; Robbins, W.A. |; Pinkel, D.; Weier, H.U.; Mehraein, Y. |

    1994-10-15

    Sex chromosome aneuploidy is the most common numerical chromosomal abnormality in humans at birth and a substantial portion of these abnormalities involve paternal chromosomes. An efficient method is presented for using air-dried smears of human semen to detect the number of X and Y chromosomes in sperm chromatin using two-chromosome fluorescence in situ hybridization. Air-dried semen smears were pre-treated with dithiothreitol and 3,4-diiodosalicylate salt to decondense the sperm chromatin and then were hybridized with repetitive sequence DNA probes that had been generated by PCR and differentially labeled. Hybridizations with X and Y specific probes showed the expected ratio of 50%X:50%Y bearing sperm. Sperm carrying extra fluorescence domains representing disomy for the X or Y chromosomes occurred at frequencies of {approximately} 4 per 10,000 sperm each. Cells carrying both X and Y fluorescence domains occurred at a frequency of {approximately} 6/10,000. Thus, the overall frequency of sperm that carried an extra sex chromosome was 1.4/1,000. The frequencies of sperm carrying sex chromosome aneuploidies determined by hybridization did not differ statistically from those reported from the same laboratory using the human-sperm/hamster-egg cytogenetic technique. Multi-chromosome fluorescence in situ hybridization to sperm is a promising method for assessing sex-ratio alterations in human semen and for determining the fraction of sperm carrying sex or other chromosome aneuploidies which may be transmissible to offspring. 44 refs., 1 fig., 3 tabs.

  20. A new region of conservation is defined between human and mouse X chromosomes

    SciTech Connect

    Dinulos, M.B.; Disteche, C.M.; Bassi, M.T.

    1996-07-01

    Comparative mapping of the X chromosome in eutherian mammals have revealed distinct regions of conservation as well as evolutionary rearrangements between human and mouse. Recently, we and others mapped the murine homologue of CLCN4 (Chloride channel 4) to band F4 of the X chromosome in Mus spretus but to chromosome 7 in laboratory strains. We now report the mapping of the murine homologues of APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), two genes that are located on the human X chromosome at band p22.3 and in close proximity to CLCN4. Interestingly, Oa1 and Apxl map to bands F2-F3 in both M. spretus and the laboratory strain C57BL/6J, defining a new rearrangement between human and mouse X chromosomes. 17 refs., 2 figs., 1 tab.

  1. Supernumerary marker chromosome 5 diagnosed by M-FISH in a child with congenital heart defect and unusual face.

    PubMed

    Sarri, C; Gyftodimou, Y; Grigoriadou, M; Pandelia, E; Kalogirou, S; Kokotas, H; Mrasek, K; Weise, A; Petersen, M B

    2006-01-01

    We describe a female patient with a small supernumerary marker chromosome (sSMC) present in mosaic and characterized in detail by fluorescence in situ hybridization (FISH) using all 24 human whole chromosome painting probes, multicolor banding (MCB) and subcentromere specific multicolor FISH (subcenM-FISH). The sSMC was demonstrated to be derived from chromosome 5 and the karyotype of our patient was as follows: 47,XX,+mar.ish r(5)(::p13.2 approximately p13.3-->q11.2::) [60%]/46,XX [40%]. Partial trisomy for the proximal 5p and q chromosomal regions is a rare event. A critical region exists at 5p13 for the phenotype associated with duplication 5p. As far as we know, eight similar cases have been published up to now. We describe a new case which, to our knowledge, is the first characterized in such detail. The role of uniparental disomy (UPD) in cases of SMC is also discussed. PMID:16954675

  2. Cloning and characterization of CpG islands of the human chromosome 1p36 region

    SciTech Connect

    Ellmeier, W.; Barnas, C.; Kobrna, A.

    1996-02-15

    This article reports on the localization of CpG islands to human chromosome 1p36 as a means for the isolation of genes using hybridization techniques. Two cDNA clones encode the human transcription factor E2F-2 and the dominant-negative helix-loop-helix gene ID3. Further information regarding the organization of human chromosome 1 was accomplished using electrophoresis. 11 refs., 3 figs.

  3. Continuous chromosomal instability in human pluripotent stem cells - the role of DNA replication.

    PubMed

    Lamm, Noa; Kerem, Batsheva

    2016-07-01

    Human pluripotent stem cells (hPSCs) frequently acquire chromosomal aberrations, including aneuploidy, during culture. Recently, we identified a replication stress-based mechanism leading to ongoing chromosomal instability in aneuploid hPSCs that may also operate during the initiation of instability in diploid cells. PMID:27652327

  4. X Chromosome Abnormalities and Cognitive Development: Implications for Understanding Normal Human Development.

    ERIC Educational Resources Information Center

    Walzer, Stanley

    1985-01-01

    Argues that knowledge from studies of individuals with sex chromosome abnormalities can further understanding of aspects of normal human development. Studies of XO girls, XXY boys, XXX girls, and males with a fragile X chromosome are summarized to demonstrate how results contribute to knowledge about normal cognitive development and about…

  5. Chromosomes and causation of human cancer and leukemia. XXX. Banding studies of primary intestinal tumors.

    PubMed

    Sonta, S; Sandberg, A A

    1978-01-01

    The chromosomes of 15 primary intestinal tumors were analyzed with a banding technique. Of the 15 tumors, 12 had some chromosomal abnormalities (8 with numerical changes and 4 with both numerical and structural abnormalities) and in the remaining three no karyotypic abnormalities were found. No common marker chromosomes were seen among the various tumors and no two tumors with chromosomal changes and identical karyotypes, though some chromosomes were involved more often than others. Excessive chromosomes in the primary tumors were usually due to extra chromosomes in the following groups (numbers of tumors involved are shown in parenthesis): No. 8 (7), No. 13 (4), No. 15 (4), No. 17 (6) and No. 21 (6). On the other hand, chromosomes losses, though much less frequent, involved chromosomes No. 5, No. 6, No. 7, No. 10 and No. 16. Most of the tumor cells with chromosomal changes were hyperdiploid and usually contained less than 60 chromosomes. Only one tumor contained hypodiploid cells. The cytogenetic data presented on primary intestinal tumors indicate that they consist primarily of numerical changes, relative infrequency (when compared to metastases) and small number (1-4) of markers. PMID:626926

  6. Painting Analysis of Chromosome Aberrations Induced by Energetic Heavy Ions in Human Cells

    NASA Technical Reports Server (NTRS)

    Wu, Honglu

    2006-01-01

    FISH, mFISH, mBAND, telomere and centromere probes have been used to study chromosome aberrations induced in human cells exposed to low-and high-LET radiation in vitro. High-LET induced damages are mostly a single track effect. Unrejoined chromosome breaks (incomplete exchanges) and complex type aberrations were higher for high-LET. Biosignatures may depend on the method the samples are collected. Recent mBAND analysis has revealed more information about the nature of intra-chromosome exchanges. Whether space flight/microgravity affects radiation-induced chromosome aberration frequencies is still an open question.

  7. The human immediate early gene BRF1 maps to chromosome 14q22-q24

    SciTech Connect

    Maclean, K.N.; Bustin, S.A.; McKay, I.A.; See, C.G.

    1995-11-01

    BRF1 (Butyrate response factor 1) is a member of an immediate early gene family specifying putative nuclear transcription factors. A repeat motif incorporating two Cys and two His is highly conserved between family members identified from yeast, Drosophila, mouse, rat, and human. The chromosome localization of none of the human genes has been determined thus far. Using the polymerase chain reaction on a human-rodent hybrid panel, we have localized BRF1 to chromosome 14. This was confirmed by direct sequencing of the PCR fragment. Using fluorescence in situ hybridization, the chromosome localization of BRF1 was further determined as 14q22-q24. 15 refs., 1 fig.

  8. Functional annotation of the human chromosome 7 "missing" proteins: a bioinformatics approach.

    PubMed

    Ranganathan, Shoba; Khan, Javed M; Garg, Gagan; Baker, Mark S

    2013-06-01

    The chromosome-centric human proteome project aims to systematically map all human proteins, chromosome by chromosome, in a gene-centric manner through dedicated efforts from national and international teams. This mapping will lead to a knowledge-based resource defining the full set of proteins encoded in each chromosome and laying the foundation for the development of a standardized approach to analyze the massive proteomic data sets currently being generated. The neXtProt database lists 946 proteins as the human proteome of chromosome 7. However, 170 (18%) proteins of human chromosome 7 have no evidence at the proteomic, antibody, or structural levels and are considered "missing" in this study as they lack experimental support. We have developed a protocol for the functional annotation of these "missing" proteins by integrating several bioinformatics analysis and annotation tools, sequential BLAST homology searches, protein domain/motif and gene ontology (GO) mapping, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Using the BLAST search strategy, homologues for reviewed non-human mammalian proteins with protein evidence were identified for 90 "missing" proteins while another 38 had reviewed non-human mammalian homologues. Putative functional annotations were assigned to 27 of the remaining 43 novel proteins. Proteotypic peptides have been computationally generated to facilitate rapid identification of these proteins. Four of the "missing" chromosome 7 proteins have been substantiated by the ENCODE proteogenomic peptide data.

  9. Characteristics of chromosome instability in the human lymphoblast cell line WTK1

    NASA Technical Reports Server (NTRS)

    Schwartz, J. L.; Jordan, R.; Evans, H. H.

    2001-01-01

    The characteristics of spontaneous and radiation-induced chromosome instability were determined in each of 50 individual clones isolated from control populations of human lymphoblasts (WTK1), as well as from populations of these cells previously exposed to two different types of ionizing radiation, Fe-56 and Cs-137. The types of chromosome instability did not appear to change in clones surviving radiation exposure. Aneuploidy, polyploidy, chromosome dicentrics and translocations, and chromatid breaks and gaps were found in both control and irradiated clones. The primary effect of radiation exposure was to increase the number of cells within any one clone that had chromosome alterations. Chromosome instability was associated with telomere shortening and elevated levels of apoptosis. The results suggest that the proximal cause of chromosome instability is telomere shortening.

  10. Karyotyping human and mouse cells using probes from single-sorted chromosomes and open source software.

    PubMed

    Potapova, Tamara A; Unruh, Jay R; Box, Andrew C; Bradford, William D; Seidel, Christopher W; Slaughter, Brian D; Sivagnanam, Shamilene; Wu, Yuping; Li, Rong

    2015-12-01

    Multispectral karyotyping analyzes all chromosomes in a single cell by labeling them with chromosome-specific probes conjugated to unique combinations of fluorophores. Currently available multispectral karyotyping systems require the purchase of specialized equipment and reagents. However, conventional laser scanning confocal microscopes that are capable of separating multiple overlapping emission spectra through spectral imaging and linear unmixing can be utilized for classifying chromosomes painted with multicolor probes. Here, we generated multicolor chromosome paints from single-sorted human and mouse chromosomes and developed the Karyotype Identification via Spectral Separation (KISS) analysis package, a set of freely available open source ImageJ tools for spectral unmixing and karyotyping. Chromosome spreads painted with our multispectral probe sets can be imaged on widely available spectral laser scanning confocal microscopes and analyzed using our ImageJ tools. Together, our probes and software enable academic labs with access to a laser-scanning spectral microscope to perform multicolor karyotyping in a cost-effective manner.

  11. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human.

    PubMed

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  12. Flow analysis of human chromosome sets by means of mixing-stirring device

    NASA Astrophysics Data System (ADS)

    Zenin, Valeri V.; Aksenov, Nicolay D.; Shatrova, Alla N.; Klopov, Nicolay V.; Cram, L. Scott; Poletaev, Andrey I.

    1997-05-01

    A new mixing and stirring device (MSD) was used to perform flow karyotype analysis of single human mitotic chromosomes analyzed so as to maintain the identity of chromosomes derived from the same cell. An improved method for cell preparation and intracellular staining of chromosomes was developed. The method includes enzyme treatment, incubation with saponin and separation of prestained cells from debris on a sucrose gradient. Mitotic cells are injected one by one in the MSD which is located inside the flow chamber where cells are ruptured, thereby releasing chromosomes. The set of chromosomes proceeds to flow in single file fashion to the point of analysis. The device works in a stepwise manner. The concentration of cells in the sample must be kept low to ensure that only one cell at a time enters the breaking chamber. Time-gated accumulation of data in listmode files makes it possible to separate chromosome sets comprising of single cells. The software that was developed classifies chromosome sets according to different criteria: total number of chromosomes, overall DNA content in the set, and the number of chromosomes of certain types. This approach combines the high performance of flow cytometry with the advantages of image analysis. Examples obtained with different human cell lines are presented.

  13. The human tissue transglutaminase gene maps on chromosome 20q12 by in situ fluorescence hybridization

    SciTech Connect

    Gentile, V.; Davies, P.J.A. ); Baldini, A. )

    1994-03-15

    A cDNA encoding for the human tissue transglutaminase gene has been used to identify the chromosomal localization of the corresponding structural gene. The precise chromosomal and subregional localizations have been established by using in situ fluorescence mapping with a recombinant [lambda]-Zap phage containing the full cDNA coding sequence. The study showed that the human tissue transglutaminase gene is localized on chromosome 20 and, more precisely, within the band 20q12. To date, this is the third member of the transglutaminase gene family to be mapped. Human factor XIIIa (plasma transglutaminase), human keratinocyte transglutaminase (type I), and human tissue transglutaminase (type II) genes, although codifying for homologous enzymes, are localized on three different chromosomes. 16 refs., 1 fig.

  14. Structural organization and chromosomal assignment of the human prostacyclin receptor gene

    SciTech Connect

    Ogawa, Yoshihiro; Tanaka, Issei; Inoue, Miho

    1995-05-01

    Prostacyclin receptor is a member of the prostanoid receptor family in the G protein-coupled receptor superfamily with seven transmembrane domains. The authors report here the isolation and structural organization of the human prostacyclin receptor gene. Southern blot analysis demonstrated a single copy of the human prostacyclin receptor gene in the human genome. The human prostacyclin receptor gene spanned approximately 7.0 kb and was composed of three exons separated by two introns. The first intron occurred in the 5`-untranslated region, 13 bp upstream to the ATG start codon. The second intron was located at the end of the sixth transmembrane domain, thereby separating it from the downstream coding region and the 3`-untranslated region. By primer extension analysis, the transcription initiation sites were mapped 870-872 bp upstream to the ATG start codon. The 1.2-kb human prostacyclin receptor 5`-flanking region lacked conventional TATA and CCAAT boxes, but it contained several cis-acting regulatory elements including an inverted CCAAT box (Y box) and two copies of SP-1 binding sites. Using human-rodent somatic hybrid cell DNA, the human prostacyclin receptor gene was assigned to human chromosome 19. The present study helps establish the genetic basis for prostacyclin receptor research and provides further insight into the molecular mechanisms underlying the prostanoid receptor family. 38 refs., 6 figs.

  15. A gene involved in control of human cellular senescence on human chromosome 1q

    SciTech Connect

    Hensler, P.J.; Pereira-Smith, O.M. ); Annab, L.A.; Barrett, J.C. )

    1994-04-01

    Normal cells in culture exhibit limited division potential and have been used as a model for cellular senescence. In contrast, tumor-derived or carcinogen- or virus-transformed cells are capable of indefinite division. Fusion of normal human diploid fibroblasts with immortal human cells yielded hybrids having limited life spans, indicating that cellular senescence was dominant. Fusions of various immortal human cell lines with each other led to the identification of four complementation groups for indefinite division. The purpose of this study was to determine whether human chromosome 1 could complement the recessive immortal defect of human cell lines assigned to one of the four complementation groups. Using microcell fusion, the authors introduced a single normal human chromosome 1 into immortal human cell lines representing the complementation groups and determined that it caused loss of proliferative potential of an osteosarcoma-derived cell line (TE85), a cytomegalovirus-transformed lung fibroblast cell line (CMV-Mj-HEL-1), and a Ki-ras[sup +]-transformed derivative of TE85 (143B TK[sup [minus

  16. Localization of the structural gene for human apolipoprotein A-I on the long arm of human chromosome 11.

    PubMed Central

    Cheung, P; Kao, F T; Law, M L; Jones, C; Puck, T T; Chan, L

    1984-01-01

    Apolipoprotein A-I (apo A-I), the major apolipoprotein in human high density lipoproteins, is involved in the disease atherosclerosis. Cloned apo A-I cDNA (pA1-3) was used as a probe in chromosome mapping studies to detect the human apo A-I structural gene sequence in human-Chinese hamster cell hybrids. Southern blot analysis of 13 hybrids localized the gene to human chromosome 11. Confirmation of the chromosomal assignment was obtained by analysis of a hybrid (J1) containing a single human chromosome, no. 11. Regional mapping was achieved by using deletion subclones of J1 that localized the human apo A-I structural gene to the region 11q13 leads to qter. Since the human apolipoprotein C-III (apo C-III) structural gene is closely linked to apo A-I, it can be assigned to the same region on the long arm of chromosome 11. By extension of methods previously described, it now appears possible to carry out fine-structure analysis of this and related gene regions on chromosome 11 and to study the biochemical concomitants of these genes and of genes on other chromosomes for analysis of their role in atherosclerosis. Images PMID:6420790

  17. Y chromosome and mitochondrial DNA characterization of Pasiegos, a human isolate from Cantabria (Spain).

    PubMed

    Maca-Meyer, N; Sánchez-Velasco, P; Flores, C; Larruga, J-M; González, A-M; Oterino, A; Leyva-Cobián, F

    2003-07-01

    Mitochondrial DNA sequences and Y chromosome haplotypes were characterized in Pasiegos, a human isolate from Cantabria, and compared with those of other Cantabrian and neighbouring Northern Spain populations. Cantabria appears to be a genetically heterogeneous community. Whereas Lebaniegos do not differ from their eastern Basque and western Asturian and Galician neighbours, Pasiegos and other non-Lebaniego Cantabrians show significant differences with all of them. Pasiegos are peculiar for their high frequencies of Y chromosomal markers (E-M81) with North African assignation, and Y chromosomal (R-SRY2627) and mtDNA (V, I, U5) markers related to northern European populations. This dual geographic contribution is more in agreement with the complex demographic history of this isolate, as opposed to recent drift effects. The high incidence in Cantabrians with pre-V and V mtDNA haplotypes, considered as a signal of Postglacial recolonization in Europe from south-western refugees, points to such refugees as a better candidate population than Basques for this expansion. However, this does not discount a conjoint recolonization.

  18. Haplotyping the human leukocyte antigen system from single chromosomes

    PubMed Central

    Murphy, Nicholas M.; Burton, Matthew; Powell, David R.; Rossello, Fernando J.; Cooper, Don; Chopra, Abha; Hsieh, Ming Je; Sayer, David C.; Gordon, Lavinia; Pertile, Mark D; Tait, Brian D.; Irving, Helen R.; Pouton, Colin W.

    2016-01-01

    We describe a method for determining the parental HLA haplotypes of a single individual without recourse to conventional segregation genetics. Blood samples were cultured to identify and sort chromosome 6 by bivariate flow cytometry. Single chromosome 6 amplification products were confirmed with a single nucleotide polymorphism (SNP) array and verified by deep sequencing to enable assignment of both alleles at the HLA loci, defining the two haplotypes. This study exemplifies a rapid and efficient method of haplotyping that can be applied to any chromosome pair, or indeed all chromosome pairs, using a single sorting operation. The method represents a cost-effective approach to complete phasing of SNPs, which will facilitate a deeper understanding of the links between SNPs, gene regulation and protein function. PMID:27461731

  19. Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content.

    PubMed

    Hughes, Jennifer F; Skaletsky, Helen; Pyntikova, Tatyana; Graves, Tina A; van Daalen, Saskia K M; Minx, Patrick J; Fulton, Robert S; McGrath, Sean D; Locke, Devin P; Friedman, Cynthia; Trask, Barbara J; Mardis, Elaine R; Warren, Wesley C; Repping, Sjoerd; Rozen, Steve; Wilson, Richard K; Page, David C

    2010-01-28

    The human Y chromosome began to evolve from an autosome hundreds of millions of years ago, acquiring a sex-determining function and undergoing a series of inversions that suppressed crossing over with the X chromosome. Little is known about the recent evolution of the Y chromosome because only the human Y chromosome has been fully sequenced. Prevailing theories hold that Y chromosomes evolve by gene loss, the pace of which slows over time, eventually leading to a paucity of genes, and stasis. These theories have been buttressed by partial sequence data from newly emergent plant and animal Y chromosomes, but they have not been tested in older, highly evolved Y chromosomes such as that of humans. Here we finished sequencing of the male-specific region of the Y chromosome (MSY) in our closest living relative, the chimpanzee, achieving levels of accuracy and completion previously reached for the human MSY. By comparing the MSYs of the two species we show that they differ radically in sequence structure and gene content, indicating rapid evolution during the past 6 million years. The chimpanzee MSY contains twice as many massive palindromes as the human MSY, yet it has lost large fractions of the MSY protein-coding genes and gene families present in the last common ancestor. We suggest that the extraordinary divergence of the chimpanzee and human MSYs was driven by four synergistic factors: the prominent role of the MSY in sperm production, 'genetic hitchhiking' effects in the absence of meiotic crossing over, frequent ectopic recombination within the MSY, and species differences in mating behaviour. Although genetic decay may be the principal dynamic in the evolution of newly emergent Y chromosomes, wholesale renovation is the paramount theme in the continuing evolution of chimpanzee, human and perhaps other older MSYs.

  20. A Familial Cri-du-Chat/5p Deletion Syndrome Resulted from Rare Maternal Complex Chromosomal Rearrangements (CCRs) and/or Possible Chromosome 5p Chromothripsis

    PubMed Central

    Zhang, Ya-nan; Dong, Xing-sheng; Huang, Yang-yu; Son, Xin-ming; Lu, Xinyan; Chen, Zheng

    2013-01-01

    Cri-du-Chat syndrome (MIM 123450) is a chromosomal syndrome characterized by the characteristic features, including cat-like cry and chromosome 5p deletions. We report a family with five individuals showing chromosomal rearrangements involving 5p, resulting from rare maternal complex chromosomal rearrangements (CCRs), diagnosed post- and pre-natally by comprehensive molecular and cytogenetic analyses. Two probands, including a 4½-year-old brother and his 2½-year- old sister, showed no diagnostic cat cry during infancy, but presented with developmental delay, dysmorphic and autistic features. Both patients had an interstitial deletion del(5)(p13.3p15.33) spanning ∼26.22 Mb. The phenotypically normal mother had de novo CCRs involving 11 breakpoints and three chromosomes: ins(11;5) (q23;p14.1p15.31),ins(21;5)(q21;p13.3p14.1),ins(21;5)(q21;p15.31p15.33),inv(7)(p22q32)dn. In addition to these two children, she had three first-trimester miscarriages, two terminations due to the identification of the 5p deletion and one delivery of a phenotypically normal daughter. The unaffected daughter had the maternal ins(11;5) identified prenatally and an identical maternal allele haplotype of 5p. Array CGH did not detect any copy number changes in the mother, and revealed three interstitial deletions within 5p15.33-p13.3, in the unaffected daughter, likely products of the maternal insertions ins(21;5). Chromothripsis has been recently reported as a mechanism drives germline CCRs in pediatric patients with congenital defects. We postulate that the unique CCRs in the phenotypically normal mother could resulted from chromosome 5p chromothripsis, that further resulted in the interstitial 5p deletions in the unaffected daughter. Further high resolution sequencing based analysis is needed to determine whether chromothripsis is also present as a germline structural variation in phenotypically normal individuals in this family. PMID:24143197

  1. A familial Cri-du-Chat/5p deletion syndrome resulted from rare maternal complex chromosomal rearrangements (CCRs) and/or possible chromosome 5p chromothripsis.

    PubMed

    Gu, Heng; Jiang, Jian-hui; Li, Jian-ying; Zhang, Ya-nan; Dong, Xing-sheng; Huang, Yang-yu; Son, Xin-ming; Lu, Xinyan; Chen, Zheng

    2013-01-01

    Cri-du-Chat syndrome (MIM 123450) is a chromosomal syndrome characterized by the characteristic features, including cat-like cry and chromosome 5p deletions. We report a family with five individuals showing chromosomal rearrangements involving 5p, resulting from rare maternal complex chromosomal rearrangements (CCRs), diagnosed post- and pre-natally by comprehensive molecular and cytogenetic analyses. Two probands, including a 4½-year-old brother and his 2½-year- old sister, showed no diagnostic cat cry during infancy, but presented with developmental delay, dysmorphic and autistic features. Both patients had an interstitial deletion del(5)(p13.3p15.33) spanning ≈ 26.22 Mb. The phenotypically normal mother had de novo CCRs involving 11 breakpoints and three chromosomes: ins(11;5) (q23;p14.1p15.31),ins(21;5)(q21;p13.3p14.1),ins(21;5)(q21;p15.31p15.33),inv(7)(p22q32)dn. In addition to these two children, she had three first-trimester miscarriages, two terminations due to the identification of the 5p deletion and one delivery of a phenotypically normal daughter. The unaffected daughter had the maternal ins(11;5) identified prenatally and an identical maternal allele haplotype of 5p. Array CGH did not detect any copy number changes in the mother, and revealed three interstitial deletions within 5p15.33-p13.3, in the unaffected daughter, likely products of the maternal insertions ins(21;5). Chromothripsis has been recently reported as a mechanism drives germline CCRs in pediatric patients with congenital defects. We postulate that the unique CCRs in the phenotypically normal mother could resulted from chromosome 5p chromothripsis, that further resulted in the interstitial 5p deletions in the unaffected daughter. Further high resolution sequencing based analysis is needed to determine whether chromothripsis is also present as a germline structural variation in phenotypically normal individuals in this family. PMID:24143197

  2. New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree

    PubMed Central

    Karafet, Tatiana M.; Mendez, Fernando L.; Meilerman, Monica B.; Underhill, Peter A.; Zegura, Stephen L.; Hammer, Michael F.

    2008-01-01

    Markers on the non-recombining portion of the human Y chromosome continue to have applications in many fields including evolutionary biology, forensics, medical genetics, and genealogical reconstruction. In 2002, the Y Chromosome Consortium published a single parsimony tree showing the relationships among 153 haplogroups based on 243 binary markers and devised a standardized nomenclature system to name lineages nested within this tree. Here we present an extensively revised Y chromosome tree containing 311 distinct haplogroups, including two new major haplogroups (S and T), and incorporating approximately 600 binary markers. We describe major changes in the topology of the parsimony tree and provide names for new and rearranged lineages within the tree following the rules presented by the Y Chromosome Consortium in 2002. Several changes in the tree topology have important implications for studies of human ancestry. We also present demography-independent age estimates for 11 of the major clades in the new Y chromosome tree. PMID:18385274

  3. New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree.

    PubMed

    Karafet, Tatiana M; Mendez, Fernando L; Meilerman, Monica B; Underhill, Peter A; Zegura, Stephen L; Hammer, Michael F

    2008-05-01

    Markers on the non-recombining portion of the human Y chromosome continue to have applications in many fields including evolutionary biology, forensics, medical genetics, and genealogical reconstruction. In 2002, the Y Chromosome Consortium published a single parsimony tree showing the relationships among 153 haplogroups based on 243 binary markers and devised a standardized nomenclature system to name lineages nested within this tree. Here we present an extensively revised Y chromosome tree containing 311 distinct haplogroups, including two new major haplogroups (S and T), and incorporating approximately 600 binary markers. We describe major changes in the topology of the parsimony tree and provide names for new and rearranged lineages within the tree following the rules presented by the Y Chromosome Consortium in 2002. Several changes in the tree topology have important implications for studies of human ancestry. We also present demography-independent age estimates for 11 of the major clades in the new Y chromosome tree.

  4. Expanded conserved linkage group between human 16p13 and the Scid region of the mouse chromosome 16

    SciTech Connect

    Deng, Z.M.; Siciliano, M.J.; Davisson, M.T.

    1994-09-01

    Knowledge of homologies between human and mouse chromosomes is essential for understanding chromosomal evolution and the development of experimental models for human disease. We have reported the identification of a conserved linkage group between human 16p13 and the centromeric portion of the mouse 16. Defining the extent of this linkage conservation has significant biomedical implications since that region of mouse genome contains the Scid mutation and the human 16p13 contains genes that are involved in DNA repair and certain types of human leukemia as well as other diseases such as Rubinstein-Taybi Syndrome. Here, this conserved linkage group has been defined and expanded. It now contains 5 genetic loci and spans more than 3 Mb in human and 23 cM in mouse. The 5 loci are PRM1,2 (protamine 1 and 2), NOP3 (a subclone of D16S237), GSPT1 (a gene involved in the regulation of G1 to S phase transition), MYH11 (a human smooth muscle myosin heavy chain gene) and MRP (multi-drug resistant-associated protein gene). Using a panel of human-rodent hybrids that are informative for different portions of human 16, we have established the following order on human 16p: telomere-NOP3-PRM1,2-GSPT1-(MYH11,MRP)-centromere. The genes were assigned to the mouse chromosome 16 by a mouse-Chinese hamster somatic cell hybrid panel informative for mouse chromosomes. Linkage analysis using backcross mice informative for the Scid mutation indicated the following order and genetic distance (in cM) in mouse: centromere-Nop3-11.7-Prm1-1.4-Gspt1-8.2-(Myh11,Mrp)-1.4-Scid-telomere.

  5. Destabilized SMC5/6 complex leads to chromosome breakage syndrome with severe lung disease

    PubMed Central

    van der Crabben, Saskia N.; Hennus, Marije P.; McGregor, Grant A.; Ritter, Deborah I.; Nagamani, Sandesh C.S.; Wells, Owen S.; Harakalova, Magdalena; Chinn, Ivan K.; Alt, Aaron; Vondrova, Lucie; Hochstenbach, Ron; van Montfrans, Joris M.; Terheggen-Lagro, Suzanne W.; van Lieshout, Stef; van Roosmalen, Markus J.; Renkens, Ivo; Duran, Karen; Nijman, Isaac J.; Kloosterman, Wigard P.; Hennekam, Eric; van Hasselt, Peter M.; Wheeler, David A.; Palecek, Jan J.; Lehmann, Alan R.; Oliver, Antony W.; Pearl, Laurence H.; Plon, Sharon E.; Murray, Johanne M.

    2016-01-01

    The structural maintenance of chromosomes (SMC) family of proteins supports mitotic proliferation, meiosis, and DNA repair to control genomic stability. Impairments in chromosome maintenance are linked to rare chromosome breakage disorders. Here, we have identified a chromosome breakage syndrome associated with severe lung disease in early childhood. Four children from two unrelated kindreds died of severe pulmonary disease during infancy following viral pneumonia with evidence of combined T and B cell immunodeficiency. Whole exome sequencing revealed biallelic missense mutations in the NSMCE3 (also known as NDNL2) gene, which encodes a subunit of the SMC5/6 complex that is essential for DNA damage response and chromosome segregation. The NSMCE3 mutations disrupted interactions within the SMC5/6 complex, leading to destabilization of the complex. Patient cells showed chromosome rearrangements, micronuclei, sensitivity to replication stress and DNA damage, and defective homologous recombination. This work associates missense mutations in NSMCE3 with an autosomal recessive chromosome breakage syndrome that leads to defective T and B cell function and acute respiratory distress syndrome in early childhood. PMID:27427983

  6. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  7. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  8. Cloning, chromosomal mapping, and expression of human fetal brain type I adenylyl cyclase

    SciTech Connect

    Villacres, E.C.; Xia, Z.; Bookbinder, L.H.; Edelhoff, S.; Disteche, C.M.; Storm, D.R.

    1993-05-01

    The neural-specific calmodulin-sensitive adenylyl cyclase (type I), which was first cloned from bovine brain, has been implicated in learning and memory. The objective of this study was to clone and determine the chromosomal localization of human fetal brain type I adenylyl cyclase. A 3.8-kb cDNA clone was isolated that contained sequence coinciding with the 3{prime} end 2553 nucleotides of the bovine open reading frame. This clone shows 87% nucleotide and 92% translated amino acid sequence identity to the bovine clone. The most significant sequence differences were in the carboxy-terminal 100 amino acid residues. This region contains one of several possible calmodulin binding domains and the only putative cAMP-dependent protein kinase A phosphorylation site. A chimera was constructed that contained the 5{prime} half of the bovine type I adenylyl cyclase and the 3{prime} half of the human type I adenylyl cyclase. The activity of the chimeric gene product and its sensitivity to calmodulin and calcium were indistinguishable from those of the bovine type I adenylyl cyclase. In situ hybridization was used to localize the human type I adenylyl cyclase gene to the proximal portion of the short arm of chromosome 7. 36 refs., 4 figs.

  9. Radiosensitivity of chromosomes in two successive mitotic cycles of human lymphocytes

    SciTech Connect

    Luchnik, N.V.; Poryadkova, N.A.

    1988-11-01

    A culture of human lymphocytes was irradiated with /gamma/-quanta in a dose of 0.5 Gy with different ratios of cells in first (M1) and second (M2) mitotic cycle and the frequency of aberrations induced at stage G2 was analyzed. With increase in interval of time between the start of culturing and irradiation, total yield of aberrations increased in a regular way. However, if the M1:M2 ratio is considered, then it turns out that in M2 chromosomes are /approximately/1.5 times more sensitive than in M1: within the limits of each cycle, radiosensitivity is constant and does not depend on its duration. It was established in accordance with data of other authors that 5-bromodeoxyuridine (5-BdU) increases radiosensitivity materially.

  10. Regulation of DNA replication and chromosomal polyploidy by the MLL-WDR5-RBBP5 methyltransferases

    PubMed Central

    Lu, Fei; Wu, Xiaojun; Yin, Feng; Chia-Fang Lee, Christina; Yu, Min; Mihaylov, Ivailo S.; Yu, Jiekai; Sun, Hong

    2016-01-01

    ABSTRACT DNA replication licensing occurs on chromatin, but how the chromatin template is regulated for replication remains mostly unclear. Here, we have analyzed the requirement of histone methyltransferases for a specific type of replication: the DNA re-replication induced by the downregulation of either Geminin, an inhibitor of replication licensing protein CDT1, or the CRL4CDT2 ubiquitin E3 ligase. We found that siRNA-mediated reduction of essential components of the MLL-WDR5-RBBP5 methyltransferase complexes including WDR5 or RBBP5, which transfer methyl groups to histone H3 at K4 (H3K4), suppressed DNA re-replication and chromosomal polyploidy. Reduction of WDR5/RBBP5 also prevented the activation of H2AX checkpoint caused by re-replication, but not by ultraviolet or X-ray irradiation; and the components of MLL complexes co-localized with the origin recognition complex (ORC) and MCM2-7 replicative helicase complexes at replication origins to control the levels of methylated H3K4. Downregulation of WDR5 or RBBP5 reduced the methylated H3K4 and suppressed the recruitment of MCM2-7 complexes onto replication origins. Our studies indicate that the MLL complexes and H3K4 methylation are required for DNA replication but not for DNA damage repair. PMID:27744293

  11. The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23

    SciTech Connect

    Li, S.S.L.; Sharief, F.S. )

    1993-09-01

    Human prostatic acid phosphatase (ACPP) has been used as a diagnostic marker for prostate cancer. It is synthesized under androgen regulation and secreted by the epithelial cells of the prostate gland. The authors have confirmed the previous assignment of the ACPP gene to chromosome 3 by probing a panel of 25 human-Chinese hamster somatic cell hybrids, and they have further localized the ACPP gene to chromosome 3q21-q23 by fluorescence in situ hybridization. 10 refs., 1 fig.

  12. Chromosomal localization of murine and human oligodendrocyte-specific protein genes

    SciTech Connect

    Bronstein, J.M.; Wu, S.; Korenberg, J.R.

    1996-06-01

    Oligodendrocyte-specific protein (OSP) is a recently described protein present only in myelin of the central nervous system. Several inherited disorders of myelin are caused by mutations in myelin genes but the etiology of many remain unknown. We mapped the location of the mouse OSP gene to the proximal region of chromosome 3 using two sets of multilocus crosses and to human chromosome 3 using somatic cell hybrids. Fine mapping with fluorescence in situ hybridization placed the OSP gene at human chromosome 3q26.2-q26.3. To date, there are no known inherited neurological disorders that localize to these regions. 24 refs., 2 figs.

  13. Discovery of Genetic Variation on Chromosome 5q22 Associated with Mortality in Heart Failure

    PubMed Central

    Smith, J. Gustav; Felix, Janine F.; Morrison, Alanna C.; Trompet, Stella; Wilk, Jemma B.; Gidlöf, Olof; Morley, Michael; Joehanes, Roby; Ligthart, Symen; Shan, Xiaoyin; Bis, Joshua C.; Sjögren, Marketa; Ngwa, Julius; Stott, David J.; Aguilar, David; Rice, Kenneth M.; Sesso, Howard D.; Demissie, Serkalem; Buckley, Brendan M.; Taylor, Kent D.; Ford, Ian; Yao, Chen; Liu, Chunyu; Sotoodehnia, Nona; van der Harst, Pim; Stricker, Bruno H. Ch.; Kritchevsky, Stephen B.; Liu, Yongmei; Gaziano, J. Michael; Hofman, Albert; Moravec, Christine S.; Uitterlinden, André G.; Kellis, Manolis; van Meurs, Joyce B.; Margulies, Kenneth B.; Dehghan, Abbas; Levy, Daniel; Olde, Björn; Psaty, Bruce M.; Cupples, L. Adrienne; Jukema, J. Wouter; Djousse, Luc; Franco, Oscar H.; Boerwinkle, Eric; Boyer, Laurie A.; Newton-Cheh, Christopher; Butler, Javed; Vasan, Ramachandran S.; Cappola, Thomas P.; Smith, Nicholas L.

    2016-01-01

    Failure of the human heart to maintain sufficient output of blood for the demands of the body, heart failure, is a common condition with high mortality even with modern therapeutic alternatives. To identify molecular determinants of mortality in patients with new-onset heart failure, we performed a meta-analysis of genome-wide association studies and follow-up genotyping in independent populations. We identified and replicated an association for a genetic variant on chromosome 5q22 with 36% increased risk of death in subjects with heart failure (rs9885413, P = 2.7x10-9). We provide evidence from reporter gene assays, computational predictions and epigenomic marks that this polymorphism increases activity of an enhancer region active in multiple human tissues. The polymorphism was further reproducibly associated with a DNA methylation signature in whole blood (P = 4.5x10-40) that also associated with allergic sensitization and expression in blood of the cytokine TSLP (P = 1.1x10-4). Knockdown of the transcription factor predicted to bind the enhancer region (NHLH1) in a human cell line (HEK293) expressing NHLH1 resulted in lower TSLP expression. In addition, we observed evidence of recent positive selection acting on the risk allele in populations of African descent. Our findings provide novel genetic leads to factors that influence mortality in patients with heart failure. PMID:27149122

  14. Clinical and molecular cytogenetic studies in ring chromosome 5: report of a child with congenital abnormalities.

    PubMed

    Basinko, Audrey; Giovannucci Uzielli, Maria Luisa; Scarselli, Gloria; Priolo, Manuela; Timpani, Giuseppina; De Braekeleer, Marc

    2012-02-01

    We report here a child with a ring chromosome 5 (r(5)) associated with facial dysmorphology and multiple congenital abnormalities. Fluorescent in situ hybridization (FISH) using bacterial artificial chromosome (BAC) clones was performed to determine the breakpoints involved in the r(5). The 5p deletion extended from 5p13.2-3 to 5pter and measured 34.61 Mb (range: 33.7-35.52 Mb) while the 5q deletion extended from 5q35.3 to 5qter and measured 2.44 Mb (range: 2.31-2.57 Mb). The patient presented signs such as microcephaly, hypertelorism, micrognathia and epicanthal folds, partially recalling those of a deletion of the short arm of chromosome 5 and the "cri-du-chat" syndrome. The most striking phenotypic features were the congenital heart abnormalities which have been frequently reported in deletions of the distal part of the long arm of chromosome 5 and in rings leading to a 5q35-5qter deletion. However, the NKX2-5 gene, which has been related to congenital heart defects, was not deleted in our patient, nor presumably to some other patients with 5q35.3-5qter deletion. We propose that VEGFR3, deleted in our patient, could be a candidate gene for the congenital heart abnormalities observed.

  15. Clinical and molecular cytogenetic studies in ring chromosome 5: report of a child with congenital abnormalities.

    PubMed

    Basinko, Audrey; Giovannucci Uzielli, Maria Luisa; Scarselli, Gloria; Priolo, Manuela; Timpani, Giuseppina; De Braekeleer, Marc

    2012-02-01

    We report here a child with a ring chromosome 5 (r(5)) associated with facial dysmorphology and multiple congenital abnormalities. Fluorescent in situ hybridization (FISH) using bacterial artificial chromosome (BAC) clones was performed to determine the breakpoints involved in the r(5). The 5p deletion extended from 5p13.2-3 to 5pter and measured 34.61 Mb (range: 33.7-35.52 Mb) while the 5q deletion extended from 5q35.3 to 5qter and measured 2.44 Mb (range: 2.31-2.57 Mb). The patient presented signs such as microcephaly, hypertelorism, micrognathia and epicanthal folds, partially recalling those of a deletion of the short arm of chromosome 5 and the "cri-du-chat" syndrome. The most striking phenotypic features were the congenital heart abnormalities which have been frequently reported in deletions of the distal part of the long arm of chromosome 5 and in rings leading to a 5q35-5qter deletion. However, the NKX2-5 gene, which has been related to congenital heart defects, was not deleted in our patient, nor presumably to some other patients with 5q35.3-5qter deletion. We propose that VEGFR3, deleted in our patient, could be a candidate gene for the congenital heart abnormalities observed. PMID:22193390

  16. The use of DAPI fluorescence lifetime imaging for investigating chromatin condensation in human chromosomes

    PubMed Central

    Estandarte, Ana Katrina; Botchway, Stanley; Lynch, Christophe; Yusuf, Mohammed; Robinson, Ian

    2016-01-01

    Chromatin undergoes dramatic condensation and decondensation as cells transition between the different phases of the cell cycle. The organization of chromatin in chromosomes is still one of the key challenges in structural biology. Fluorescence lifetime imaging (FLIM), a technique which utilizes a fluorophore’s fluorescence lifetime to probe changes in its environment, was used to investigate variations in chromatin compaction in fixed human chromosomes. Fixed human metaphase and interphase chromosomes were labeled with the DNA minor groove binder, DAPI, followed by measurement and imaging of the fluorescence lifetime using multiphoton excitation. DAPI lifetime variations in metaphase chromosome spreads allowed mapping of the differentially compacted regions of chromatin along the length of the chromosomes. The heteromorphic regions of chromosomes 1, 9, 15, 16, and Y, which consist of highly condensed constitutive heterochromatin, showed statistically significant shorter DAPI lifetime values than the rest of the chromosomes. Differences in the DAPI lifetimes for the heteromorphic regions suggest differences in the structures of these regions. DAPI lifetime variations across interphase nuclei showed variation in chromatin compaction in interphase and the formation of chromosome territories. The successful probing of differences in chromatin compaction suggests that FLIM has enormous potential for application in structural and diagnostic studies. PMID:27526631

  17. Human germ cell formation in xenotransplants of induced pluripotent stem cells carrying X chromosome aneuploidies.

    PubMed

    Dominguez, Antonia A; Chiang, H Rosaria; Sukhwani, Meena; Orwig, Kyle E; Reijo Pera, Renee A

    2014-09-22

    Turner syndrome is caused by complete or partial loss of the second sex chromosome and is characterized by spontaneous fetal loss in >90% of conceptions. Survivors possess an array of somatic and germline clinical characteristics. Induced pluripotent stem cells (iPSCs) offer an opportunity for insight into genetic requirements of the X chromosome linked to Turner syndrome. We derived iPSCs from Turner syndrome and control individuals and examined germ cell development as a function of X chromosome composition. We demonstrate that two X chromosomes are not necessary for reprogramming or maintenance of pluripotency and that there are minimal differences in gene expression, at the single cell level, linked to X chromosome aneuploidies. Formation of germ cells, as assessed in vivo through a murine xenotransplantation model, indicated that undifferentiated iPSCs, independent of X chromosome composition, are capable of forming germ-cell-like cells (GCLCs) in vivo. In combination with clinical data regarding infertility in women with X chromosome aneuploidies, results suggest that two intact X chromosomes are not required for human germ cell formation, qualitatively or quantitatively, but rather are likely to be required for maintenance of human germ cells to adulthood.

  18. The use of DAPI fluorescence lifetime imaging for investigating chromatin condensation in human chromosomes.

    PubMed

    Estandarte, Ana Katrina; Botchway, Stanley; Lynch, Christophe; Yusuf, Mohammed; Robinson, Ian

    2016-01-01

    Chromatin undergoes dramatic condensation and decondensation as cells transition between the different phases of the cell cycle. The organization of chromatin in chromosomes is still one of the key challenges in structural biology. Fluorescence lifetime imaging (FLIM), a technique which utilizes a fluorophore's fluorescence lifetime to probe changes in its environment, was used to investigate variations in chromatin compaction in fixed human chromosomes. Fixed human metaphase and interphase chromosomes were labeled with the DNA minor groove binder, DAPI, followed by measurement and imaging of the fluorescence lifetime using multiphoton excitation. DAPI lifetime variations in metaphase chromosome spreads allowed mapping of the differentially compacted regions of chromatin along the length of the chromosomes. The heteromorphic regions of chromosomes 1, 9, 15, 16, and Y, which consist of highly condensed constitutive heterochromatin, showed statistically significant shorter DAPI lifetime values than the rest of the chromosomes. Differences in the DAPI lifetimes for the heteromorphic regions suggest differences in the structures of these regions. DAPI lifetime variations across interphase nuclei showed variation in chromatin compaction in interphase and the formation of chromosome territories. The successful probing of differences in chromatin compaction suggests that FLIM has enormous potential for application in structural and diagnostic studies. PMID:27526631

  19. Genetic Diversity on the Human X Chromosome Does Not Support a Strict Pseudoautosomal Boundary

    PubMed Central

    Cotter, Daniel J.; Brotman, Sarah M.

    2016-01-01

    Unlike the autosomes, recombination between the X chromosome and the Y chromosome is often thought to be constrained to two small pseudoautosomal regions (PARs) at the tips of each sex chromosome. PAR1 spans the first 2.7 Mb of the proximal arm of the human sex chromosomes, whereas the much smaller PAR2 encompasses the distal 320 kb of the long arm of each sex chromosome. In addition to PAR1 and PAR2, there is a human-specific X-transposed region that was duplicated from the X to the Y chromosome. The X-transposed region is often not excluded from X-specific analyses, unlike the PARs, because it is not thought to routinely recombine. Genetic diversity is expected to be higher in recombining regions than in nonrecombining regions because recombination reduces the effect of linked selection. In this study, we investigated patterns of genetic diversity in noncoding regions across the entire X chromosome of a global sample of 26 unrelated genetic females. We found that genetic diversity in PAR1 is significantly greater than in the nonrecombining regions (nonPARs). However, rather than an abrupt drop in diversity at the pseudoautosomal boundary, there is a gradual reduction in diversity from the recombining through the nonrecombining regions, suggesting that recombination between the human sex chromosomes spans across the currently defined pseudoautosomal boundary. A consequence of recombination spanning this boundary potentially includes increasing the rate of sex-linked disorders (e.g., de la Chapelle) and sex chromosome aneuploidies. In contrast, diversity in PAR2 is not significantly elevated compared to the nonPARs, suggesting that recombination is not obligatory in PAR2. Finally, diversity in the X-transposed region is higher than in the surrounding nonPARs, providing evidence that recombination may occur with some frequency between the X and Y chromosomes in the X-transposed region. PMID:27010023

  20. Genetic Diversity on the Human X Chromosome Does Not Support a Strict Pseudoautosomal Boundary.

    PubMed

    Cotter, Daniel J; Brotman, Sarah M; Wilson Sayres, Melissa A

    2016-05-01

    Unlike the autosomes, recombination between the X chromosome and the Y chromosome is often thought to be constrained to two small pseudoautosomal regions (PARs) at the tips of each sex chromosome. PAR1 spans the first 2.7 Mb of the proximal arm of the human sex chromosomes, whereas the much smaller PAR2 encompasses the distal 320 kb of the long arm of each sex chromosome. In addition to PAR1 and PAR2, there is a human-specific X-transposed region that was duplicated from the X to the Y chromosome. The X-transposed region is often not excluded from X-specific analyses, unlike the PARs, because it is not thought to routinely recombine. Genetic diversity is expected to be higher in recombining regions than in nonrecombining regions because recombination reduces the effect of linked selection. In this study, we investigated patterns of genetic diversity in noncoding regions across the entire X chromosome of a global sample of 26 unrelated genetic females. We found that genetic diversity in PAR1 is significantly greater than in the nonrecombining regions (nonPARs). However, rather than an abrupt drop in diversity at the pseudoautosomal boundary, there is a gradual reduction in diversity from the recombining through the nonrecombining regions, suggesting that recombination between the human sex chromosomes spans across the currently defined pseudoautosomal boundary. A consequence of recombination spanning this boundary potentially includes increasing the rate of sex-linked disorders (e.g., de la Chapelle) and sex chromosome aneuploidies. In contrast, diversity in PAR2 is not significantly elevated compared to the nonPARs, suggesting that recombination is not obligatory in PAR2. Finally, diversity in the X-transposed region is higher than in the surrounding nonPARs, providing evidence that recombination may occur with some frequency between the X and Y chromosomes in the X-transposed region.

  1. Bioinformatics Annotation of Human Y Chromosome-Encoded Protein Pathways and Interactions.

    PubMed

    Rengaraj, Deivendran; Kwon, Woo-Sung; Pang, Myung-Geol

    2015-09-01

    We performed a comprehensive analysis of human Y chromosome-encoded proteins, their pathways, and their interactions using bioinformatics tools. From the NCBI annotation release 107 of human genome, we retrieved a total of 66 proteins encoded on Y chromosome. Most of the retrieved proteins were also matched with the proteins listed in the core databases of the Human Proteome Project including neXtProt, PeptideAtlas, and the Human Protein Atlas. When we examined the pathways of human Y-encoded proteins through KEGG database and Pathway Studio software, many of proteins fall into the categories related to cell signaling pathways. Using the STRING program, we found a total of 49 human Y-encoded proteins showing strong/medium interaction with each other. While using the Pathway studio software, we found that a total of 16 proteins interact with other chromosome-encoded proteins. In particular, the SRY protein interacted with 17 proteins encoded on other chromosomes. Additionally, we aligned the sequences of human Y-encoded proteins with the sequences of chimpanzee and mouse Y-encoded proteins using the NCBI BLAST program. This analysis resulted in a significant number of orthologous proteins between human, chimpanzee, and mouse. Collectively, our findings provide the scientific community with additional information on the human Y chromosome-encoded proteins.

  2. Correlation of physical and genetic maps of human chromosome 16

    SciTech Connect

    Sutherland, G.R.

    1990-01-01

    This project is now progressing strongly. Thirteen somatic cell hybrids containing rearranged {number sign}16 chromosomes have been constructed, bringing the total number of hybrids constructed by the group to 27 which divides chromosome 16 into 29 regions. 170 probes have been mapped into these regions. Although this is the second progress report for this contract it essentially contains all the work carried out since the first progress report covered a period of less than three months during which little had been done other than setting up. The project has been progressing very well and has led to numerous collaborations with other groups involved in mapping this chromosome or studying genes on it. 7 refs., 1 fig., 2 tabs.

  3. Chromosome Aberrations in Human Epithelial Cells Exposed Los Alamos High-Energy Secondary Neutrons: M-BAND Analysis

    NASA Technical Reports Server (NTRS)

    Hada, M.; Saganti, P. B.; Gersey, B.; Wilkins, R.; Cucinotta, F. A.; Wu, H.

    2007-01-01

    High-energy secondary neutrons, produced by the interaction of galactic cosmic rays (GCR) with the atmosphere, spacecraft structure and planetary surfaces, contribute a significant fraction to the dose equivalent radiation measurement in crew members and passengers of commercial aviation travel as well as astronauts in space missions. The Los Alamos Nuclear Science Center (LANSCE) neutron facility's 30L beam line (4FP30L-A/ICE House) is known to generate neutrons that simulate the secondary neutron spectrum of the Earth's atmosphere at high altitude. The neutron spectrum is also similar to that measured onboard spacecrafts like the MIR and the International Space Station (ISS). To evaluate the biological damage, we exposed human epithelial cells in vitro to the LANSCE neutron beams with an entrance dose rate of 2.5 cGy/hr, and studied the induction of chromosome aberrations that were identified with multicolor-banding in situ hybridization (mBAND) technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of inter-chromosomal aberrations (translocation to unpainted chromosomes) and intra-chromosomal aberrations (inversions and deletions within a single painted chromosome). Compared to our previous results with gamma-rays and 600 MeV/nucleon Fe ions of high dose rate at NSRL (NASA Space Radiation Laboratory at Brookhaven National Laboratory), the neutron data from the LANSCE experiments showed significantly higher frequency of chromosome aberrations. However, detailed analysis of the inversion type revealed that all of the three radiation types in the study induced a low incidence of simple inversions. Most of the inversions in gamma-ray irradiated samples were accompanied by other types of intrachromosomal aberrations but few inversions were accompanied by interchromosomal aberrations. In contrast, neutrons and Fe ions induced a significant fraction of inversions that involved complex rearrangements of both

  4. High-Resolution BAC-Based Map of the Central Portion of Mouse Chromosome 5

    PubMed Central

    Crabtree, Jonathan; Wiltshire, Tim; Brunk, Brian; Zhao, Shaying; Schug, Jonathan; Stoeckert, Christian J.; Bucan, Maja

    2001-01-01

    The current strategy for sequencing the mouse genome involves the combination of a whole-genome shotgun approach with clone-based sequencing. High-resolution physical maps will provide a foundation for assembling contiguous segments of sequence. We have established a bacterial artificial chromosome (BAC)-based map of a 5-Mb region on mouse Chromosome 5, encompassing three gene families: receptor tyrosine kinases (PdgfraKit-Kdr), nonreceptor protein-tyrosine type kinases (Tec–Txk), and type-A receptors for the neurotransmitter GABA (Gabra2, Gabrb1, Gabrg1, and Gabra4). The construction of a BAC contig was initiated by hybridization screening the C57BL/6J (RPCI-23) BAC library, using known genes and sequence tagged sites (STSs). Additional overlapping clones were identified by searching the database of available restriction fingerprints for the RPCI-23 and RPCI-24 libraries. This effort resulted in the selection of >600 BAC clones, 251 kb of BAC-end sequences, and the placement of 40 known and/or predicted genes within this 5-Mb region. We use this high-resolution map to illustrate the integration of the BAC fingerprint map with a radiation-hybrid map via assembled expressed sequence tags (ESTs). From annotation of three representative BAC clones we demonstrate that up to 98% of the draft sequence for each contig could be ordered and oriented using known genes, BAC ends, consensus sequences for transcript assemblies, and comparisons with orthologous human sequence. For functional studies, annotation of sequence fragments as they are assembled into 50–200-kb stretches will be remarkably valuable. PMID:11591652

  5. The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

    NASA Technical Reports Server (NTRS)

    Hada, M.; George, Kerry; Cucinotta, F. A.

    2011-01-01

    Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to Si-28-ions with energies ranging from 90 to 600 MeV/u, Ti-48-ions with energies ranging from 240 to 1000 MeV/u, or to Fe-56-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Si beams in this study ranged from 48 to 158 keV/ m, the LET of the Ti ions ranged from 107 to 240 keV/micron, and the LET of the Fe-ions ranged from 145 to 440 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to gamma-rays. The estimates of RBEmax values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, 21.4+/-1.7 to 28.3+/-2.4 for Ti ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBEmax value for Fe ions was obtained with the 600 MeV/u beam, the highest RBEmax value for Ti ions was obtained 1000 MeV/u beam, and the highest RBEmax value for Si ions was obtained with the 170 MeV/u beam. For Si and Fe ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/micron for Si, and decreasing with further increase in LET. Additional studies for low doses Si-28-ions down to 0.02 Gy will be discussed.

  6. Metaphase chromosome and nucleoid differences between CHO-K1 and its radiosensitive derivative xrs-5

    SciTech Connect

    Schwartz, J.L. |; Cowan, J.M.; Moan, E.; Sedita, B.A.; Stephens, J.; Vaughan, A.T.M.

    1992-05-01

    The Chinese hamster ovary (CHO) cell line xrs-5 is a radiation-sensitive mutant isolated from CHO-K1 cells. The radiation sensitivity is associated with a defect in DNA double-strand break rejoining. Chromatin structure also appears altered in xrs-5 cells compared to the parental CHO-K1 cells. Metaphase chromosomes from xrs-5 are more condensed in appearance than CHO-K1 chromosomes. The overcondensed look is not the result of colcemid sensitivity. Electron microscopy studies suggest that xrs-5 metaphase chromosomes have larger loops of chromatin extending out from the chromosome core. There are also differences between CHO-K1 and xrs-5 cells in the size and fluorescence pattern of ethidium bromide-stained nucleoid preparations. These results suggest that there is a fundamental difference between CHO-K1 and xrs-5 in either the organization of the supercoiled loops of DNA attached to the nuclear matrix or in the nature of the proteins that attach the DNA to the matrix. These alterations in chromosome structure may underlie, in part, the radiation sensitivity of xrs-5 cells.

  7. A cluster of novel serotonin receptor 3-like genes on human chromosome 3.

    PubMed

    Karnovsky, Alla M; Gotow, Lisa F; McKinley, Denise D; Piechan, Julie L; Ruble, Cara L; Mills, Cynthia J; Schellin, Kathleen A B; Slightom, Jerry L; Fitzgerald, Laura R; Benjamin, Christopher W; Roberds, Steven L

    2003-11-13

    The ligand-gated ion channel family includes receptors for serotonin (5-hydroxytryptamine, 5-HT), acetylcholine, GABA, and glutamate. Drugs targeting subtypes of these receptors have proven useful for the treatment of various neuropsychiatric and neurological disorders. To identify new ligand-gated ion channels as potential therapeutic targets, drafts of human genome sequence were interrogated. Portions of four novel genes homologous to 5-HT(3A) and 5-HT(3B) receptors were identified within human sequence databases. We named the genes 5-HT(3C1)-5-HT(3C4). Radiation hybrid (RH) mapping localized these genes to chromosome 3q27-28. All four genes shared similar intron-exon organizations and predicted protein secondary structure with 5-HT(3A) and 5-HT(3B). Orthologous genes were detected by Southern blotting in several species including dog, cow, and chicken, but not in rodents, suggesting that these novel genes are not present in rodents or are very poorly conserved. Two of the novel genes are predicted to be pseudogenes, but two other genes are transcribed and spliced to form appropriate open reading frames. The 5-HT(3C1) transcript is expressed almost exclusively in small intestine and colon, suggesting a possible role in the serotonin-responsiveness of the gut.

  8. Chromosomal localization of TIL, a gene encoding a protein related to the Drosophila transmembrane receptor Toll, to human chromosome 4p14

    SciTech Connect

    Taguchi, Takahiro; Testa, J.R.; Mitcham, J.L.; Dower, S.K.; Sims, J.E.

    1996-03-05

    This report describes the localization of the the TIL gene to human chromosome 4p14 using fluorescence in situ hybridization. This gene encodes a protein which is related to the Drosophila transmembrane receptor Toll and the mammalian interleukin-1 receptor, which share similarities in structure and function. The Drosophila gene is also important during embryonic development, which makes TIL a candidate locus for human congenital malformations that are genetically linked to human chromosome 4. 17 refs., 1 fig.

  9. Sex chromosome loss and aging: In situ hybridization studies on human interphase nuclei

    SciTech Connect

    Guttenbach, M.; Koschorz, B.; Bernthaler, U.

    1995-11-01

    A total of 1,000 lymphocyte interphase nuclei per proband from 90 females and 138 males age 1 wk to 93 years were analyzed by in situ hybridization for loss of the X and Y chromosomes, respectively. Both sex chromosomes showed an age-dependent loss. In males, Y hypoploidy was very low up to age 15 years (0.05%) but continuously increased to a frequency of 1.34% in men age 76-80 years. In females, the baseline level for X chromosome loss is much higher than that seen for the Y chromosome in males. Even prepubertal females show a rate of X chromosome loss on the order of 1.5%-2.5%, rising to {approximately}4.5%-5% in women older than 75 years. Dividing the female probands into three biological age groups on the basis of sex hormone function (<13 years, 13-51 years, and >51 years), a significant correlation of X chromosome loss versus age could clearly be demonstrated in women beyond age 51 years. Females age 51-91 years showed monosomy X at a rate from 3.2% to 5.1%. In contrast to sex chromosomal loss, the frequency of autosomal monosomies does not change during the course of aging: chromosome 1 and chromosome 17 monosomic cells were found with a constant incidence of 1.2% and 1%, respectively. These data also indicate that autosome loss in interphase nuclei is not a function of chromosome size. 34 refs., 5 figs., 6 tabs.

  10. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  11. Gene for familial psoriasis susceptibility mapped to the distal end of human chromosome 17q

    SciTech Connect

    Tomfohrde, J.; Barnes, R.; Bowcock, A.; Fernandez-Vina, M.A.; Stastny, P.; Silverman, A.; Young, M.; Lory, D.; Morris, L.; Menter, A.

    1994-05-20

    A gene involved in psoriasis susceptibility was localized to the distal region of human chromosomes 17q as a result of a genome-wide linkage analysis with polymorphic microsatellites and eight multiply affected psoriasis kindreds. In the family which showed the strongest evidence for linkage, the recombination fraction between a psoriasis susceptibility locus and D17S784 was 0.04 with a maximum two-point lod score of 5.33. There was also evidence for genetic heterogeneity and although none of the linked families showed any association with HLA-Cw6, two unlinked families showed weak levels of association. This study demonstrates that is some families, psoriasis susceptibility is due to variation at a single major genetic locus other than the human lymphocyte antigen locus. 28 refs., 2 figs., 1 tab.

  12. Genomic Instability in Human Pluripotent Stem Cells Arises from Replicative Stress and Chromosome Condensation Defects.

    PubMed

    Lamm, Noa; Ben-David, Uri; Golan-Lev, Tamar; Storchová, Zuzana; Benvenisty, Nissim; Kerem, Batsheva

    2016-02-01

    Human pluripotent stem cells (hPSCs) frequently acquire chromosomal aberrations such as aneuploidy in culture. These aberrations progressively increase over time and may compromise the properties and clinical utility of the cells. The underlying mechanisms that drive initial genomic instability and its continued progression are largely unknown. Here, we show that aneuploid hPSCs undergo DNA replication stress, resulting in defective chromosome condensation and segregation. Aneuploid hPSCs show altered levels of actin cytoskeletal genes controlled by the transcription factor SRF, and overexpression of SRF rescues impaired chromosome condensation and segregation defects in aneuploid hPSCs. Furthermore, SRF downregulation in diploid hPSCs induces replication stress and perturbed condensation similar to that seen in aneuploid cells. Together, these results suggest that decreased SRF expression induces replicative stress and chromosomal condensation defects that underlie the ongoing chromosomal instability seen in aneuploid hPSCs. A similar mechanism may also operate during initiation of instability in diploid cells.

  13. Assignment of the Gene for Adenine Phosphoribosyltransferase to Human Chromosome 16 by Mouse-Human Somatic Cell Hybridization

    PubMed Central

    Tischfield, Jay A.; Ruddle, Frank H.

    1974-01-01

    A series of mouse-human hybrids was prepared from mouse cells deficient in adenine phosphoribosyltransferase (EC 2.4.2.7) and normal human cells. The hybrids were made in medium containing adenine and alanosine, an antimetabolite known to inhibit de novo adenylic acid biosynthesis. The mouse cells, unable to utilize exogenous adenine, were killed in this medium, but the hybrids proliferated as a consequence of their retaining the human aprt gene. The hybrids were then exposed to the adenine analogs 2,6-diaminopurine and 2-fluoroadenine to select for cells that had lost this gene. Before exposure to the adenine analogs, the expression of human adenine phosphoribosyltransferase by the hybrids was strongly associated only with the presence of human chromosome 16, and afterwards this was the only human chromosome consistently lost. This observation suggests that the human aprt gene can be assigned to chromosome 16. Images PMID:4129802

  14. Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

    SciTech Connect

    Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F. )

    1988-08-01

    Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

  15. Loss of heterozygosity in human ductal breast tumors indicates a recessive mutation on chromosome 13

    SciTech Connect

    Lundberg, C.; Skoog, L.; Cavenee, W.K.; Nordenskjoeld, M.

    1987-04-01

    The genotypes at chromosomal loci defined by recombinant DNA probes revealing restriction fragment length polymorphisms were determined in constitutional and tumor tissue from 10 cases of ductal breast cancer: eight premenopausal females and two males. Somatic loss of constitutional heterozygosity was observed at loci on chromosome 13 in primary tumor tissue from three females and one male. In two cases, specific loss of heterozygosity at three distinct genetic loci along the length of the chromosome was observed. In another case, concurrent loss of alleles at loci on chromosomes 2, 13, 14, and 20 was detected, whereas a fourth case showed loss of heterozygosity for chromosomes 5 and 13. In each instance, the data were consistent with loss of one of the homologous chromosomes by mitotic nondisjunction. Analysis of loci on several other chromosomes showed retention of constitutional heterozygosity suggesting the relative specificity of the events. In contrast, similar analyses of other breast cancers, including comedocarcinoma, medullary carcinoma, and juvenile secretory carcinoma, showed no loss of alleles at loci on chromosome 13. These data indicate that the pathogenesis of ductal breast cancer may, in a substantial proportion of cases, involve unmasking of a recessive locus on chromosome 13 and suggest the involvement of such a locus in heritable forms of this disease.

  16. Localization of a novel natural killer triggering receptor locus to human chromosome 3p23-p21 and mouse chromosome 9

    SciTech Connect

    Young, H.A.; Jenkins, N.A.; Copeland, N.G.; Simek, S.; Lerman, M.I.; Zbar, B.; Glenn, G.; Ortaldo, J.R.; Anderson, S.K.

    1993-05-01

    A novel gene (NKTR) that is involved in the recognition of tumor cells by large granular lymphocytes (LGLs) has been assigned to the short arm of human chromosome 3 in the region 3p23-p21 by somatic cell hybrid analysis. Interspecific backcross analysis revealed that the murine homologue maps to the distal end of mouse chromosome 9 and is closely linked to the locus coding for cholecystokinin (Cck). This region of mouse 9 shares a region of homology with human 3p. Thus, the placement of NKTR in these regions confirms and extends the relationship between these human and mouse chromosomes. 11 refs., 2 figs.

  17. Cloning and primary structure of a human islet isoform of glutamic acid decarboxylase from chromosome 10

    SciTech Connect

    Karlsen, A.E.; Hagopian, W.A.; Grubin, C.E.; Dube, S.; Disteche, C.M.; Adler, D.A.; Baermeier, H.; Lernmark, A. ); Mathewes, S.; Grant, F.J.; Foster, D. )

    1991-10-01

    Glutamic acid decarboxylase which catalyzes formation of {gamma}-aminobutyric acid from L-glutamic acid, is detectable in different isoforms with distinct electrophoretic and kinetic characteristics. GAD has also been implicated as an autoantigen in the vastly differing autoimmune disease stiff-man syndrome and insulin-dependent diabetes mellitus. Despite the differing GAD isoforms, only one type of GAD cDNA (GAD-1), localized to a syntenic region of chromosome 2, has been isolated from rat, mouse, and cat. Using sequence information from GAD-1 to screen a human pancreatic islet cDNA library, the authors describe the isolation of an additional GAD cDNA (GAD-2), which was mapped to the short arm of human chromosome 10. Genomic Southern blotting with GAD-2 demonstrated a hybridization pattern different form that detected by GAD-1. GAD-2 recognizes a 5.6-kilobase transcript in both islets and brain, in contrast to GAD-1, which detects a 3.7-kilobase transcript in brain only. The deduced 585-amino acid sequence coded for by GAD-2 shows < 65% identify to previously published, highly conserved GAD-1 brain sequences, which show > 96% deduced amino acid sequence homology among the three species.

  18. Analysis of Heavy Ion-Induced Chromosome Aberrations in Human Fibroblast Cells Using In Situ Hybridization

    NASA Technical Reports Server (NTRS)

    Wu, Honglu; Durante, Marco; Furusawa, Yoshiya; George, Kerry; Kawata, Tetsuya; Cucinotta, Francis A.

    2003-01-01

    Confluent human fibroblast cells (AG1522) were irradiated with gamma rays, 490 MeV/nucleon Si, or with Fe ions at either 200 or 500 MeV/nucleon. The cells were allowed to repair at 37 0 C for 24 hours after exposure, and a chemically induced premature chromosome condensation (PCC) technique was used to condense chromosomes in the G2 phase of the cell cycle. Unrejoined chromosomal breaks and complex exchanges were analyzed in the irradiated samples. In order to verify that chromosomal breaks were truly unrejoined, chromosome aberrations were analyzed using a combination of whole chromosome specific probes and probes specific for the telomere region of the chromosome. Results showed that the frequency of unrejoined chromosome breaks was higher after high-LET radiation, and consequently, the ratio of incomplete to complete exchanges increased steadily with LET up to 440 keV/micron, the highest LET value in the present study. For samples exposed to 200 MeV/nucleon Fe ions, chromosome aberrations were analyzed using the multicolor FISH (mFISH) technique that allows identification of both complex and truly incomplete exchanges. Results of the mFISH study showed that 0.7 and 3 Gy dose of the Fe ions produced similar ratios of complex to simple exchanges and incomplete to complete exchanges, values for which were higher than those obtained after a 6 Gy gamma exposure. After 0.7 Gy of Fe ions, most complex aberrations were found to involve three or four chromosomes, indicating the maximum number of chromosome domains traversed by a single Fe ion track. 2

  19. UV-A breakage sensitivity of human chromosomes as measured by COMET-FISH depends on gene density and not on the chromosome size.

    PubMed

    Rapp, A; Bock, C; Dittmar, H; Greulich, K O

    2000-07-01

    COMET-FISH, a single cell-based combination of COMET-assay (also known as single cell gel electrophoresis (SCGE)) with fluorescence in situ hybridization (FISH) allows region specific studies on DNA stability and damage. COMET-FISH can be used to investigate UV-A-induced DNA damage of selected whole chromosomes. In the present work, a modified COMET-FISH protocol with whole chromosome painting probes was used to study whether UV-A-induced DNA damage is distributed randomly over the whole genome or occurs at preferred sites. The study was performed with 12 different chromosome painting probes (for chromosomes 1, 2, 3, 8, 9, 11, 14, 18, 19, 21, X and Y). The results on human lymphocytes irradiated with 500 kJ/m2 at a wavelength of 365 nm indicate that the induced number of chromatin strand breaks does not correlate with the chromosome size. They therefore are distributed in a non-random manner. For example, fragments of the gene-rich chromosome chromosome 1 were found in the comet tail in only 3% of the examined cells, and thus chromosome 1 is rather stable, whereas fragmentation of the gene-poor chromosome 8 was observed in 25% of all comets. On the basis of all 12 chromosomes analyzed, an inverse correlation between the density of active genes and the sensitivity toward UV-A radiation is found. PMID:11079471

  20. The morbid anatomy of the human genome: chromosomal location of mutations causing disease.

    PubMed Central

    McKusick, V A; Amberger, J S

    1993-01-01

    Information is given in tabular form derived from a synopsis of the human gene map which has been updated continuously since 1973 as part of Mendelian Inheritance in Man (Johns Hopkins University Press, 10th ed, 1992) and of OMIM (Online Mendelian Inheritance in Man, available generally since 1987). The part of the synopsis reproduced here consists of chromosome by chromosome gene lists of loci for which there are associated disorders (table 1), a pictorial representation of this information (fig 1a-d), and an index of disorders for which the causative mutations have been mapped (table 2). In table 1, information on genes that have been located to specific chromosomal positions and are also the site of disease producing mutations is arranged by chromosome, starting with chromosome 1 and with the end of the short arm of the chromosome in each case. In table 2 an alphabetized list of these disorders and the chromosomal location of the mutation in each case are provided. Both in the 'Disorder' field of table 1 and in table 2, the numbers 1, 2, or 3 in parentheses after the name of the disorder indicate that its chromosomal location was determined by mapping of the wildtype gene (1), by mapping of the clinical phenotype (2), or by both strategies (3). PMID:8423603

  1. Radiation protection of human lymphocyte chromosomes in vitro by orientin and vicenin.

    PubMed

    Vrinda, B; Uma Devi, P

    2001-11-15

    Orientin (Ot) and Vicenin (Vc), two water-soluble flavonoids isolated from the leaves of Indian holy basil Ocimum sanctum have shown significant protection against radiation lethality and chromosomal aberrations in vivo. In the present study the protective effect of Ot and Vc against radiation induced chromosome damage in cultured human peripheral lymphocytes was determined by micronucleus test. In order to select the most effective drug concentration, fresh whole blood was exposed to 4Gy of cobalt-60 gamma-radiation with or without a 30 min pre-treatment with 6.25, 12.5, 15.0, 17.5 or 20 microM of Ot/Vc. Micronucleus (MN) assay was done by cytochalasin induced cytokinesis block method. Radiation significantly increased the MN frequency (16 times normal). Pre-treatment with either Ot or Vc at all concentrations significantly (P<0.05-0.001) reduced the MN count in a concentration dependent manner, with the optimum effect at 17.5 microM. Therefore, fresh blood samples were incubated with/without 17.5 microM Ot/Vc for 30 min and then exposed to 0.5-4Gy of gamma-radiation. Radiation increased the MN frequency linearly (r(2)=0.99) with dose. Pre-treatment with Ot or Vc significantly (P<0.01-0.001) reduced the MN counts to 51-67% of RT alone values, giving DMFs of 2.62 (Ot) and 2.48 (Vc). Both the compounds showed significant antioxidant activity in vitro at the above concentrations, which was significantly higher than that of DMSO at equimolar concentrations. Thus, the results demonstrate that both the flavonoids give significant protection to the human lymphocytes against the clastogenic effect of radiation at low, non-toxic concentrations. The radioprotection seems to be associated with their antioxidant activity. The clinical potential of these protectors in cancer therapy needs to be investigated. PMID:11673069

  2. Organization, structure, chromosomal assignment, and expression of the gene encoding the human endothelin-A receptor.

    PubMed

    Hosoda, K; Nakao, K; Tamura, N; Arai, H; Ogawa, Y; Suga, S; Nakanishi, S; Imura, H

    1992-09-15

    We have isolated and characterized the gene for the human endothelin-A receptor. Southern blot analyses demonstrated a single copy gene for the receptor. The gene spans more than 40 kilobases and contains eight exons and seven introns. Intron 1 exists in the 5'-noncoding region, and introns 2-7 occur in the coding region. The locations of introns 2-7 exist before or after the regions encoding the membrane-spanning domains. The transcription start site, determined by primer extension experiments, is 502 base pairs upstream of the methionine initiation codon. The 5'-flanking region lacks a typical TATA box but contains a potential SP-1-binding site 27 base pairs upstream of the transcription start site. Using human-rodent somatic hybrid cell DNA, the gene was assigned to human chromosome 4. Northern blot analyses revealed a 4.3-kilobase mRNA in a wide variety of human tissues, at the highest level in the aorta and at a substantial level in the cultured human mesangial cells. This is the first report of cloning of a gene for a member of the endothelin receptor family. The present study should give a clue to the discovery of possible disorders of the endothelin-A receptor, as well as facilitate the elucidation of the mechanisms by which the gene expression is regulated.

  3. Transmission of clonal chromosomal abnormalities in human hematopoietic stem and progenitor cells surviving radiation exposure.

    PubMed

    Kraft, Daniela; Ritter, Sylvia; Durante, Marco; Seifried, Erhard; Fournier, Claudia; Tonn, Torsten

    2015-07-01

    In radiation-induced acute myeloid leukemia (rAML), clonal chromosomal abnormalities are often observed in bone marrow cells of patients, suggesting that their formation is crucial in the development of the disease. Since rAML is considered to originate from hematopoietic stem and progenitor cells (HSPC), we investigated the frequency and spectrum of radiation-induced chromosomal abnormalities in human CD34(+) cells. We then measured stable chromosomal abnormalities, a possible biomarker of leukemia risk, in clonally expanded cell populations which were grown for 14 days in a 3D-matrix (CFU-assay). We compared two radiation qualities used in radiotherapy, sparsely ionizing X-rays and densely ionizing carbon ions (29 and 60-85 keV/μm, doses between 0.5 and 4 Gy). Only a negligible number of de novo arising, unstable aberrations (≤ 0.05 aberrations/cell, 97% breaks) were measured in the descendants of irradiated HSPC. However, stable aberrations were detected in colonies formed by irradiated HSPC. All cells of the affected colonies exhibited one or more identical aberrations, indicating their clonal origin. The majority of the clonal rearrangements (92%) were simple exchanges such as translocations (77%) and pericentric inversions (15%), which are known to contribute to the development of rAML. Carbon ions were more efficient in inducing cell killing (maximum of ∼ 30-35% apoptotic cells for 2 Gy carbon ions compared to ∼ 25% for X-rays) and chromosomal aberrations in the first cell-cycle after exposure (∼ 70% and ∼ 40% for 1 Gy of carbon ions and X-rays, respectively), with a higher fraction of non-transmissible aberrations. In contrast, for both radiation qualities the percentage of clones with chromosomal abnormalities was similar (40%). Using the frequency of colonies with clonal aberrations as a surrogate marker for the leukemia risk following radiotherapy of solid tumors, charged particle therapy is not expected to lead to an increased risk of

  4. Transmission of clonal chromosomal abnormalities in human hematopoietic stem and progenitor cells surviving radiation exposure.

    PubMed

    Kraft, Daniela; Ritter, Sylvia; Durante, Marco; Seifried, Erhard; Fournier, Claudia; Tonn, Torsten

    2015-07-01

    In radiation-induced acute myeloid leukemia (rAML), clonal chromosomal abnormalities are often observed in bone marrow cells of patients, suggesting that their formation is crucial in the development of the disease. Since rAML is considered to originate from hematopoietic stem and progenitor cells (HSPC), we investigated the frequency and spectrum of radiation-induced chromosomal abnormalities in human CD34(+) cells. We then measured stable chromosomal abnormalities, a possible biomarker of leukemia risk, in clonally expanded cell populations which were grown for 14 days in a 3D-matrix (CFU-assay). We compared two radiation qualities used in radiotherapy, sparsely ionizing X-rays and densely ionizing carbon ions (29 and 60-85 keV/μm, doses between 0.5 and 4 Gy). Only a negligible number of de novo arising, unstable aberrations (≤ 0.05 aberrations/cell, 97% breaks) were measured in the descendants of irradiated HSPC. However, stable aberrations were detected in colonies formed by irradiated HSPC. All cells of the affected colonies exhibited one or more identical aberrations, indicating their clonal origin. The majority of the clonal rearrangements (92%) were simple exchanges such as translocations (77%) and pericentric inversions (15%), which are known to contribute to the development of rAML. Carbon ions were more efficient in inducing cell killing (maximum of ∼ 30-35% apoptotic cells for 2 Gy carbon ions compared to ∼ 25% for X-rays) and chromosomal aberrations in the first cell-cycle after exposure (∼ 70% and ∼ 40% for 1 Gy of carbon ions and X-rays, respectively), with a higher fraction of non-transmissible aberrations. In contrast, for both radiation qualities the percentage of clones with chromosomal abnormalities was similar (40%). Using the frequency of colonies with clonal aberrations as a surrogate marker for the leukemia risk following radiotherapy of solid tumors, charged particle therapy is not expected to lead to an increased risk of

  5. Reciprocal chromosome painting among human, aardvark, and elephant (superorder Afrotheria) reveals the likely eutherian ancestral karyotype

    PubMed Central

    Yang, F.; Alkalaeva, E. Z.; Perelman, P. L.; Pardini, A. T.; Harrison, W. R.; O'Brien, P. C. M.; Fu, B.; Graphodatsky, A. S.; Ferguson-Smith, M. A.; Robinson, T. J.

    2003-01-01

    The Afrotheria, a supraordinal grouping of mammals whose radiation is rooted in Africa, is strongly supported by DNA sequence data but not by their disparate anatomical features. We have used flow-sorted human, aardvark, and African elephant chromosome painting probes and applied reciprocal painting schemes to representatives of two of the Afrotherian orders, the Tubulidentata (aardvark) and Proboscidea (elephants), in an attempt to shed additional light on the evolutionary affinities of this enigmatic group of mammals. Although we have not yet found any unique cytogenetic signatures that support the monophyly of the Afrotheria, embedded within the aardvark genome we find the strongest evidence yet of a mammalian ancestral karyotype comprising 2n = 44. This karyotype includes nine chromosomes that show complete conserved synteny to those of man, six that show conservation as single chromosome arms or blocks in the human karyotype but that occur on two different chromosomes in the ancestor, and seven neighbor-joining combinations (i.e., the synteny is maintained in the majority of species of the orders studied so far, but which corresponds to two chromosomes in humans). The comparative chromosome maps presented between human and these Afrotherian species provide further insight into mammalian genome organization and comparative genomic data for the Afrotheria, one of the four major evolutionary clades postulated for the Eutheria. PMID:12552116

  6. Highly stable maintenance of a mouse artificial chromosome in human cells and mice.

    PubMed

    Kazuki, Kanako; Takehara, Shoko; Uno, Narumi; Imaoka, Natsuko; Abe, Satoshi; Takiguchi, Masato; Hiramatsu, Kei; Oshimura, Mitsuo; Kazuki, Yasuhiro

    2013-12-01

    Human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) display several advantages as gene delivery vectors, such as stable episomal maintenance that avoids insertional mutations and the ability to carry large gene inserts including the regulatory elements. Previously, we showed that a MAC vector developed from a natural mouse chromosome by chromosome engineering was more stably maintained in adult tissues and hematopoietic cells in mice than HAC vectors. In this study, to expand the utility for a gene delivery vector in human cells and mice, we investigated the long-term stability of the MACs in cultured human cells and transchromosomic mice. We also investigated the chromosomal copy number-dependent expression of genes on the MACs in mice. The MAC was stably maintained in human HT1080 cells in vitro during long-term culture. The MAC was stably maintained at least to the F8 and F4 generations in ICR and C57BL/6 backgrounds, respectively. The MAC was also stably maintained in hematopoietic cells and tissues derived from old mice. Transchromosomic mice containing two or four copies of the MAC were generated by breeding. The DNA contents were comparable to the copy number of the MACs in each tissue examined, and the expression of the EGFP gene on the MAC was dependent on the chromosomal copy number. Therefore, the MAC vector may be useful not only for gene delivery in mammalian cells but also for animal transgenesis.

  7. Thermolabile phenol sulfotransferase gene (STM): Localization to human chromosome 16p11.2

    SciTech Connect

    Aksoy, I.A.; Her, C.; Weinshilboum, M.

    1994-09-01

    Thermolabile (TL) phenol sulfotransferase (PST) catalyzes the sulfate conjugation of phenolic monoamine neurotransmitters such as dopamine and serotonin. We recently cloned a cDNA for human liver TL PST and expressed it in COS-1 cells. We now report the chromosomal localization of the human TL PST gene (STM) as well as its partial sequence. DNA from NIGMS Human/Rodent Somatic Cell Hybrid Mapping Panels 1 and 2 was screened by use of the PCR, and the STM gene was mapped to chromosome 16. Regional localization to 16p11.2 was performed by PCR analysis of a high-resolution mouse/human somatic cell hybrid panel that contained defined portions of human chromosome 16. 15 refs., 2 figs.

  8. Structure, sequence, expression, and chromosomal localization of the human V{sub 1a} vasopressin receptor gene

    SciTech Connect

    Thibonnier, M.; Graves, M.K.; Wagner, M.S.

    1996-02-01

    We recently reported the structure and functional expression of a human V{sub 1a} vasopressin receptor (V{sub 1a}R) cDNA isolated from human liver cDNA libraries. To understand further the expression and regulation of the V{sub 1a}R, we now describe the genomic characteristics, tissue expression, chromosomal localization, and regional mapping of the human V{sub 1a}R gene, AVPR1A. Tissue distribution of the human V{sub 1a}R mRNA explored by Northern blot analysis of various human tissues or organs revealed the presence of a 5.5-kb mRNA transcript expressed in the liver and to a lesser degree in the heart, the kidney, and skeletal muscle. Screening of human genomic libraries revealed that the human AVPR1A gene is included entirely within a 6.4-kb rated by a 2.2-kb intron located before the corresponding seventh transmembrane domain of the receptor sequence. The first exon also contains 2 kb of 5{prime}-untranslated region, and the second exon includes 1 kb of 3{prime}-untranslated region. 5{prime}-RACE analysis of human liver mRNA by PCR localized the V{sub 1a}R mRNA transcription start site 1973 bp upstream of the translation the intron sequence were used as primers in polymerase chain reaction (PCR) analysis of human/rodent somatic cell hybrids. AVPR1A was localized by PCR analysis of a somatic cell hybrid panel to chromosome 12. Fluorescence in situ hybridization using a yeast artificial chromosome physically mapped AVPR1A to region 12q14-q15. 34 refs., 4 figs.

  9. Localization of a human homolog of the mouse Tiam-1 gene to chromosome 21q22.1

    SciTech Connect

    Haiming Chen; Antonarakis, S.E.

    1995-11-01

    Exon trapping was applied to genomic DNA from a chromosome 21-specific cosmid library (LL21NC02-Q) to clone portions of genes from this chromosome. Among a large number of trapped exons, three showed striking homology to different regions of the cDNA for the mouse T-lymphoma invasion and metastasis gene (Tiam-1) at both nucleotide and predicted amino acid sequence levels, suggesting that these three exons are part of a human homolog of the mouse Tiam-1 gene. We mapped this presumed human TIAM1 gene to chromosome 21 by using appropriate somatic cell hybrids, YACs, and cosmids. The TIAM1 gene localizes to YAC 760H5 of the I. Chumakov et al. YAC contig between markers D21S298 and D21S404 in band 21q22.1. This human gene (which is a member of the group of guanine nucleotide-dissociation stimulators that modulate the activity of Rho-like proteins) may be important in the development or metastasis of malignancies that are associated with abnormalities on chromosome 21, including the various forms of leukemia frequent in trisomy 21. 25 refs., 2 figs.

  10. Human chromokinesins promote chromosome congression and spindle microtubule dynamics during mitosis

    PubMed Central

    Wandke, Cornelia; Barisic, Marin; Sigl, Reinhard; Rauch, Veronika; Wolf, Frank; Amaro, Ana C.; Tan, Chia H.; Pereira, Antonio J.; Kutay, Ulrike; Maiato, Helder; Meraldi, Patrick

    2012-01-01

    Chromokinesins are microtubule plus end–directed motor proteins that bind to chromosome arms. In Xenopus egg cell-free extracts, Xkid and Xklp1 are essential for bipolar spindle formation but the functions of the human homologues, hKID (KIF22) and KIF4A, are poorly understood. By using RNAi-mediated protein knockdown in human cells, we find that only co-depletion delayed progression through mitosis in a Mad2-dependent manner. Depletion of hKID caused abnormal chromosome arm orientation, delayed chromosome congression, and sensitized cells to nocodazole. Knockdown of KIF4A increased the number and length of microtubules, altered kinetochore oscillations, and decreased kinetochore microtubule flux. These changes were associated with failures in establishing a tight metaphase plate and an increase in anaphase lagging chromosomes. Co-depletion of both chromokinesins aggravated chromosome attachment failures, which led to mitotic arrest. Thus, hKID and KIF4A contribute independently to the rapid and correct attachment of chromosomes by controlling the positioning of chromosome arms and the dynamics of microtubules, respectively. PMID:22945934

  11. Developmental potential of clinically discarded human embryos and associated chromosomal analysis

    PubMed Central

    Yao, Guidong; Xu, Jiawei; Xin, Zhimin; Niu, Wenbin; Shi, Senlin; Jin, Haixia; Song, Wenyan; Wang, Enyin; Yang, Qingling; Chen, Lei; Sun, Yingpu

    2016-01-01

    Clinically discarded human embryos, which are generated from both normal and abnormal fertilizations, have the potential of developing into blastocysts. A total of 1,649 discarded human embryos, including zygotes containing normal (2PN) and abnormal (0PN, 1PN, 3PN and ≥4PN) pronuclei and prematurely cleaved embryos (2Cell), were collected for in vitro culture to investigate their developmental potential and chromosomal constitution using an SNP array-based chromosomal analysis. We found that blastocyst formation rates were 63.8% (for 2Cell embryos), 22.6% (2PN), 16.7% (0PN), 11.2% (3PN) and 3.6% (1PN). SNP array-based chromosomal analysis of the resultant blastocysts revealed that the percentages of normal chromosomes were 55.2% (2Cell), 60.7% (2PN), 44.4% (0PN) and 47.4% (0PN). Compared with clinical preimplantation genetic diagnosis (PGD) data generated with clinically acceptable embryos, results of the SNP array-based chromosome analysis on blastocysts from clinically discarded embryos showed similar values for the frequency of abnormal chromosome occurrence, aberrant signal classification and chromosomal distribution. The present study is perhaps the first systematic analysis of the developmental potential of clinically discarded embryos and provides a basis for future studies. PMID:27045374

  12. Human chromokinesins promote chromosome congression and spindle microtubule dynamics during mitosis.

    PubMed

    Wandke, Cornelia; Barisic, Marin; Sigl, Reinhard; Rauch, Veronika; Wolf, Frank; Amaro, Ana C; Tan, Chia H; Pereira, Antonio J; Kutay, Ulrike; Maiato, Helder; Meraldi, Patrick; Geley, Stephan

    2012-09-01

    Chromokinesins are microtubule plus end-directed motor proteins that bind to chromosome arms. In Xenopus egg cell-free extracts, Xkid and Xklp1 are essential for bipolar spindle formation but the functions of the human homologues, hKID (KIF22) and KIF4A, are poorly understood. By using RNAi-mediated protein knockdown in human cells, we find that only co-depletion delayed progression through mitosis in a Mad2-dependent manner. Depletion of hKID caused abnormal chromosome arm orientation, delayed chromosome congression, and sensitized cells to nocodazole. Knockdown of KIF4A increased the number and length of microtubules, altered kinetochore oscillations, and decreased kinetochore microtubule flux. These changes were associated with failures in establishing a tight metaphase plate and an increase in anaphase lagging chromosomes. Co-depletion of both chromokinesins aggravated chromosome attachment failures, which led to mitotic arrest. Thus, hKID and KIF4A contribute independently to the rapid and correct attachment of chromosomes by controlling the positioning of chromosome arms and the dynamics of microtubules, respectively. PMID:22945934

  13. Construction of a transcription map surrounding the BRCA1 locus of human chromosome 17

    SciTech Connect

    Brody, L.C.; Castilla, L.H.; McKinley, D.R.

    1995-01-01

    We have used a combination of methods to survey approximately 600 kb of genomic DNA surrounding the BRCA1 gene for transcribed sequences. We have cloned a set of fragments representing at least 26 genes. The DNA sequence of these clones reveals that 5 are previously cloned genes; the precise chromosomal location of 2 was previously unknown, and 3 have been cloned and mapped by others to this interval. Three other genes, including BRCA1 itself, have recently been mapped independently to this region. Sequences from 11 genes are similar but not identical matches to known genes; 5 of these appear to be the human homologues of genes cloned from other species. Another 7 genes have no similarity with known genes. In addition, 39 putative exons and 14 expressed sequence tags have been identified and mapped to individual cosmids. This transcript map provides a detailed description of gene organization for this region of the genome. 64 refs., 4 figs., 1 tab.

  14. Chromosome aberrations induced in human lymphocytes by D-T neutrons

    SciTech Connect

    Lloyd, D.C.; Edwards, A.A.; Prosser, J.S.; Bolton, D.; Sherwin, A.G.

    1984-06-01

    Unstable chromosome aberrations induced by in vitro irradiation with D-T neutrons have been analyzed in human blood lymphocytes. With respect to 250 kVp X rays a maximum limiting RBE at low doses of 4.1 was obtained for dicentric aberrations. Using aberrations as markers in mixed cultures of irradiated and unirradiated cells permits an assessment of interphase death plus mitotic delay. The low-dose RBE for this effect is 2.5. Assuming all unstable aberrations observed at metaphase would lead to cell death by nondisjunction allows an assessment of mitotic death. The low-dose RBE for this effect is 4.5. The data are compared with similar work obtained earlier with /sup 242/Cm ..cap alpha.. particles. The application of the present work to cytogenetic assessment of dose after accidental exposure to D-T neutrons is discussed.

  15. Tissue specificity of methylation of cytosines in regulatory regions of four genes located in the locus FXYD5-COX7A1 of human chromosome 19: correlation with their expression level.

    PubMed

    Chalaya, T V; Akopov, S B; Nikolaev, L G; Sverdlov, E D

    2006-03-01

    In this study, we compared degree of methylation of selected CpG sites in CCGG sequences located in promoter regions of four human genes with expression level of these genes in several human cell lines and tissues. These genes were subdivided into two groups according to the dependence of their expression on CpG methylation in the 5 -regions. The first group, characterized by clear correlation of methylation with the transcription level, includes housekeeping gene COX6B (the absence of methylation unambiguously correlates with expression) and urothelium-specific uroplakin gene (the methylation coincides with absence of expression). The second group includes genes that are expressed in many, but not all tissues and cells. For these genes (LEAP-1 and ATP4A), there was no correlation between methylation and expression. It is possible that methylation provides some basal level of gene repression, which is overcome by binding of tissue-specific transcription factors, whereas lack of methylation gives the opportunity for gene expression in various cells and tissues. PMID:16545066

  16. Painting analysis of chromosome aberrations induced by energetic heavy ions in human cells

    NASA Astrophysics Data System (ADS)

    Wu, H.; Hada, M.; Cucinotta, F. A.

    Energetic heavy ions pose a great health risk to astronauts in extended ISS and future exploration missions High-LET heavy ions are particularly effective in causing various biological effects including cell inactivation genetic mutations and cancer induction Most of these biological endpoints are closely related to chromosomal damage which can be utilized as a biomarker for radiation insults Over the years we have studied chromosomal damage in human fibroblast epithelia and lymphocyte cells exposed in vitro to energetic charged particles generated at several accelerator facilities in the world Various fluorescence in situ hybridization painting techniques have been used to identify from only the telomere region of the chromosome to every chromosome in a human cell We will summarize the results of the investigations and discuss the unique radiation signatures and biomarkers for space radiation exposure

  17. Use of chromosome translocations for measuring prior environment exposures in humans

    SciTech Connect

    Tucker, J. D.

    1997-05-01

    Recent advances in cytogenetic methodology are beginning to have a major impact upon our ability to provide assessments of environmental exposure in humans. The advent of fluorescent-based techniques for `painting` whole chromosomes has made the analysis of chromosome translocations rapid, specific, sensitive and routine. Chromosome painting has been used to address a wide variety of scientific questions, resulting in an increased understanding of the biological consequences of adverse environmental exposure. This paper describes the use of chromosome translocations as a biological marker of exposure and effect in humans. The relevance of translocations is discussed, as are the advantages and disadvantages of painting compared to classical cytogenetic methods for translocation evaluation. The factors to consider in the use of translocations as a retrospective indicator of exposure are then described. Several theoretical parameters that are important to the use of translocations are provided, and the paper concludes with a vision for the future of cytogenetic methodology.

  18. Structural instability of human tandemly repeated DNA sequences cloned in yeast artificial chromosome vectors.

    PubMed Central

    Neil, D L; Villasante, A; Fisher, R B; Vetrie, D; Cox, B; Tyler-Smith, C

    1990-01-01

    The suitability of yeast artificial chromosome vectors (YACs) for cloning human Y chromosome tandemly repeated DNA sequences has been investigated. Clones containing DYZ3 or DYZ5 sequences were found in libraries at about the frequency anticipated on the basis of their abundance in the genome, but clones containing DYZ1 sequences were under-represented and the three clones examined contained junctions between DYZ1 and DYZ2. One DYZ3 clone was quite stable and had a long-range structure corresponding to genomic DNA. All other clones had long-range structures which either did not correspond to genomic DNA, or were too unstable to allow a simple comparison. The effects of the transformation process and host genotype on YAC structural stability were investigated. Gross structural rearrangements were often associated with re-transformation of yeast by a YAC. rad1-deficient yeast strains showed levels of instability similar to wild-type for all YAC clones tested. In rad52-deficient strains, DYZ5 containing YACs were as unstable as in the wild-type host, but DYZ1/DYZ2 or DYZ3 containing YACs were more stable. Thus the use of rad52 hosts for future library construction is recommended, but some sequences will still be unstable. Images PMID:2183192

  19. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8

    SciTech Connect

    Burkin, D.J.; Jones, C. ); Kimbro, K.S.; Taylor, M.W. ); Barr, B.L.; Gupta, S.L. )

    1993-07-01

    Indoleamine 2,3-dioxygenase (IDO) is the first enzyme in the catabolic pathway for tryptophan. This extrahepatic enzyme differs from the hepatic enzyme, tryptophan 2,3-dioxygenase (TDO), in molecular as well as enzymatic characteristics, although both enzymes catalyze the same reaction: cleavage of tryptophan into N-formylkynurenine. The induction of IDO by IFN-[gamma] plays a role in the antigrowth effect of IFN-[gamma] in cell cultures and in the inhibition of intracellular pathogens, e.g., Toxoplasma gondii and Chlamydia psittaci. Tryptophan is also the precursor for the synthesis of serotonin, and reduced levels of tryptophan and serotonin found in AIDS patients have been correlated with the presence of IFN-[gamma] and consequent elevation of IDO activity. The IDO enzyme has been purified and characterized, and its cDNA and genomic DNA clones have been isolated and analyzed. DNA from hybrid cells containing fragments of human chromosome 8 was used to determine the regional localization of the IDO gene on chromosome 8. The hybrids R30-5B and R30-2A contain 8p11 [yields] qter and 8q13 [yields] qter, respectively. Hybrid 229-3A contains the 8pter [yields] q11. The hybrid R30-2A was negative for the IDO gene, whereas R30-5B and 229-3A were positive as analyzed by PCR and verified by Southern blotting. Only the region close to the centromere is shared by R30-5B and 229-3A hybrids. The results indicate that the IDO gene is located on chromosome 8p11 [yields] q11.

  20. Chromosome aberrations in human lymphocytes induced by 250 MeV protons: effects of dose, dose rate and shielding

    NASA Technical Reports Server (NTRS)

    George, K.; Willingham, V.; Wu, H.; Gridley, D.; Nelson, G.; Cucinotta, F. A.

    2002-01-01

    Although the space radiation environment consists predominantly of energetic protons, astronauts inside a spacecraft are chronically exposed to both primary particles as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary neutrons and secondary charged particles can have an LET value that is greater than the primary protons and, therefore, produce a higher relative biological effectiveness (RBE). Using the accelerator facility at Loma Linda University, we exposed human lymphocytes in vitro to 250 MeV protons with doses ranging from 0 to 60 cGy at three different dose rates: a low dose rate of 7.5 cGy/h, an intermediate dose rate of 30 cGy/h and a high dose rate of 70 cGy/min. The effect of 15 g/cm2 aluminum shielding on the induction of chromosome aberrations was investigated for each dose rate. After exposure, lymphocytes were incubated in growth medium containing phytohemagglutinin (PHA) and chromosome spreads were collected using a chemical-induced premature chromosome condensation (PCC) technique. Aberrations were analyzed using the fluorescence in situ hybridization (FISH) technique with three different colored chromosome-painting probes. The frequency of reciprocal and complex-type chromosome exchanges were compared in shielded and unshielded samples. c2002 COSPAR. Published by Elsevier Science Ltd. All rights reserved.

  1. Localization of the tight junction protein gene TJP1 to human chromosome 15q13, distal to the Prader-Willi/Angelman region, and to mouse chromosome 7

    SciTech Connect

    Mohandas, T.K.; Chen, X.N.; Korenberg, J.R.

    1995-12-10

    The gene encoding the tight junction (zonula occludens) protein, TJP1, was mapped to human chromosome 15q13 by fluorescence in situ hybridization (FISH) using a cDNA probe. The Jackson Laboratory backcross DNA panel derived from the cross (C57BL/6JEi X SPRET/Ei) F1 females X SPRET/Ei males was used to map the mouse Tjp1 to chromosome 7 near position 30 on the Chromosome Committee Map, a region with conserved homology to human chromosome 15q13. FISH studies on metaphases from patients with the Prader-Willi (PWS) or the Angelman syndrome (AS) showed that TJP1 maps close but distal to the PWS/AS chromosome region. 13 refs., 2 figs.

  2. Correlation of chromosome patterns in human leukemic cells with exposure to chemicals and/or radiation. Progress report, July 1992--August 1993

    SciTech Connect

    Rowley, J.D.

    1993-09-01

    Progress in identification of chromosomal transformations associated with leukemogenesis is described. In particular progress in DNA cloning of chromosomal break points in human cancer patients is described.

  3. Painting Analysis of Chromosome Aberrations Induced by Energetic Heavy Ions in Human Cells

    NASA Technical Reports Server (NTRS)

    Wu, Honglu; Hada, Megumi; Cucinotta, Francis

    2007-01-01

    This viewgraph presentation reviews some of the techniques used to analyze the damage done to chromosome from ion radiation. Fluorescence in situ hybridization (FISH), mFISH, mBAND, telomere and centromereprobes have been used to study chromosome aberrations induced in human cells exposed to low-and high-LET radiation in vitro. There is some comparison of the different results from the various techniques. The results of the study are summarized.

  4. [239Pu and chromosomal aberrations in human peripheral blood lymphocytes].

    PubMed

    Okladnikova, N D; Osovets, S V; Kudriavtseva, T I

    2009-01-01

    The genome status in somatic cells was assessed using the chromosomal aberration (CA) test in peripheral blood lymphocytes from 194 plutonium workers exposed to occupational radiation mainly from low-transportable compounds of airborne 230Pu. Pu body burden at the time of cytogenetic study varied from values close to the method sensitivity to values multiply exceeding the permissible level. Standard (routine) methods of peripheral blood lymphocytes cultivation were applied. Chromatid- and chromosomal-type structural changes were estimated. Aberrations were estimated per 100 examined metaphase cells. The quantitative relationship between the CA frequency and Pu body burden and the absorbed dose to the lung was found. Mathematical processing of results was carried out based on the phenomenological model. The results were shown as theoretical and experimental curves. The threshold of the CA yield was 0.43 +/- 0.03 kBq (Pu body burden) and 6.12 +/- 1.20 cGy (absorbed dose to the lung).

  5. Chromosomal Haplotypes by Genetic Phasing of Human Families

    PubMed Central

    Roach, Jared C.; Glusman, Gustavo; Hubley, Robert; Montsaroff, Stephen Z.; Holloway, Alisha K.; Mauldin, Denise E.; Srivastava, Deepak; Garg, Vidu; Pollard, Katherine S.; Galas, David J.; Hood, Leroy; Smit, Arian F.A.

    2011-01-01

    Assignment of alleles to haplotypes for nearly all the variants on all chromosomes can be performed by genetic analysis of a nuclear family with three or more children. Whole-genome sequence data enable deterministic phasing of nearly all sequenced alleles by permitting assignment of recombinations to precise chromosomal positions and specific meioses. We demonstrate this process of genetic phasing on two families each with four children. We generate haplotypes for all of the children and their parents; these haplotypes span all genotyped positions, including rare variants. Misassignments of phase between variants (switch errors) are nearly absent. Our algorithm can also produce multimegabase haplotypes for nuclear families with just two children and can handle families with missing individuals. We implement our algorithm in a suite of software scripts (Haploscribe). Haplotypes and family genome sequences will become increasingly important for personalized medicine and for fundamental biology. PMID:21855840

  6. Mapping of mutation causing Friedreich's ataxia to human chromosome 9.

    PubMed

    Chamberlain, S; Shaw, J; Rowland, A; Wallis, J; South, S; Nakamura, Y; von Gabain, A; Farrall, M; Williamson, R

    1988-07-21

    Friedreich's ataxia is an autosomal recessive disease with progressive degeneration of the central and peripheral nervous system. The biochemical abnormality underlying the disorder has not been identified. Prompted by the success in localizing the mutations causing Duchenne muscular dystrophy, Huntington's disease and cystic fibrosis, we have undertaken molecular genetic linkage studies to determine the chromosomal site of the Friedreich's ataxia mutation as an initial step towards the isolation and characterization of the defective gene. We report the assignment of the gene mutation for this disorder to chromosome 9p22-CEN by genetic linkage to an anonymous DNA marker MCT112 and the interferon-beta gene probe. In contrast to the clinical variation seen for the disorder, no evidence of genetic heterogeneity is observed.

  7. Structure and expression of Strabismus 1 gene on human chromosome 1q21-q23.

    PubMed

    Katoh, Masaru

    2002-06-01

    Xenopus Strabismus (Stbm) is a negative regulator of the WNT - beta-catenin signaling pathway. Strabismus 1 (STB1/VangL2) and Strabismus 2 (STB2/Vangl1) are human homologues of Xenopus Stbm and Drosophila Stbm/ Van Gogh (Vang) STB1 and STB2 are four-transmembrane-type proteins with Dishevelled-binding motif. STB2 and CASQ2 genes are located on human chromosome 1p13.3-p11 with an interval less than 5 kb. Here, STB1 gene and CASQ1 gene were found to be located on human chromosome 1q21-q23 with an interval of about 210 kb including Nicastrin, COPA, PXF, H326 and PEA15 genes. Exon-intron structure was well conserved between STB1 and STB2 genes. STB1-CASQ1 gene cluster and STB2-CASQ2 gene cluster might be generated due to duplication of ancestral gene cluster, and several genes might be inserted into the STB1-CASQ1 intergenic region during or after gene-cluster duplication. STB1 mRNA was relatively highly expressed in prostate, trachea, thymus, lymph node, placenta, fetal kidney, fetal brain, and fetal lung. In adult brain, STB1 mRNA was more highly expressed in cerebellum, corpus callosum, amygdala, and medulla oblongata. STB1 mRNA was moderately expressed in K-562 (chronic myelogenous leukemia), G-361 (melanoma), and MKN7 (gastric cancer). On the other hand, STB1 mRNA was almost undetectable in several human cancer cell lines, and was down-regulated in 4 out of 14 cases of primary kidney tumors, and in 2 out of 3 cases of primary lung cancer. Loss-of-function mutation of STB1 gene might lead to carcinogenesis through activation of the WNT - beta-catenin signaling pathway.

  8. Polymorphic X-chromosome inactivation of the human TIMP1 gene.

    PubMed Central

    Anderson, C L; Brown, C J

    1999-01-01

    X inactivation silences most but not all of the genes on one of the two X chromosomes in mammalian females. The human X chromosome preserves its activation status when isolated in rodent/human somatic-cell hybrids, and hybrids retaining either the active or inactive X chromosome have been used to assess the inactivation status of many X-linked genes. Surprisingly, the X-linked gene for human tissue inhibitor of metalloproteinases (TIMP1) is expressed in some but not all inactive X-containing somatic-cell hybrids, suggesting that this gene is either prone to reactivation or variable in its inactivation. Since many genes that escape X inactivation are clustered, we examined the expression of four genes (ARAF1, ELK1, ZNF41, and ZNF157) within approximately 100 kb of TIMP1. All four genes were expressed only from the active X chromosome, demonstrating that the factors allowing TIMP1 expression from the inactive X chromosome are specific to the TIMP1 gene. To determine if this variable inactivation of TIMP1 is a function of the hybrid-cell environment or also is observed in human cells, we developed an allele-specific assay to assess TIMP1 expression in human females. Expression of two alleles was detected in some female cells with previously demonstrated extreme skewing of X inactivation, indicating TIMP1 expression from the inactive chromosome. However, in other cells, no expression of TIMP1 was observed from the inactive X chromosome, suggesting that TIMP1 inactivation is polymorphic in human females. PMID:10441576

  9. Paternal uniparental isodisomy for human chromosome 20 and absence of external ears

    SciTech Connect

    Spinner, N.B.; Rand, E.; McDonald-McGinn, D.M.

    1994-09-01

    Uniparental disomy can cause disease if the involved chromosomal region contains imprinted genes. Uniparental disomy for portions of human chromosomes 6, 7, 9, 11, 14 and 15 have been associated with abnormal phenotypes. We studied a patient with multiple abnormalities including an absent left ear with a small right ear remnant, microcephaly, congenital heart disease and Hirschprung`s disease. Cytogenetics revealed a 45,XY,-20,-20,+ter rea(20;20)(p13;p13) in 10/10 cells from bone marrow and 20/20 cells from peripheral blood. Analysis of a skin culture revealed a second cell line with trisomy 20 resulting from an apparently normal chromosome 20 in addition to the terminally rearranged chromosome, in 8/100 cells studied. The unusual phenotype of our patient was not consistent with previously reported cases of deletions of 20p or mosaic trisomy 20. We hypothesized that the patient`s phenotype could either result from deletion of both copies of a gene near the p arm terminus of chromosome 20 or from uniparental disomy of chromosome 20. There were no alterations or rearrangements of PTP-alpha (which maps to distal 20p) by Southern or Northern blot analysis. A chromosome 20 sub-telomeric probe was found to be present on the rearranged 20 by FISH suggesting that subtelomeric sequences have not been lost as a consequece of this rearrangement. To determine the parental origin of the 2 chromosome 20`s in the terminal rearrangement, we studied the genotypes of the proband and his parents in lymphoblastoid cell lines at 8 polymorphic loci. Genotypes at D20S115, D20S186, and D20S119 indicated that there was paternal isodisomy. Other loci were uninformative. This is the first example of uniparental disomy for chromosome 20. Further studies are warranted to correlate phenotype with uniparental inheritance of this chromosome.

  10. [The dependence of the level of chromosome aberrations in human lymphocytes on the duration of their cultivation under ultraviolet irradiation].

    PubMed

    Rushkovskiĭ, S R; Bezrukov, V F; Bariliak, I R

    1998-01-01

    The effect of duration of cultivation of lymphocytes of human UV-irradiated peripheral blood on the chromosomal aberration rate was studied. Under prolonged cultivation the more irradiated blood samples revealed higher level of chromosomal aberrations. The existence of UV-induced delayed chromosomal instability is supposed that may be found under prolonged cultivation. The mechanisms of this phenomenon are discussed.

  11. Molecular cloning, genomic organization, and chromosomal localization of the human pancreatitis-associated protein (PAP) gene

    SciTech Connect

    Dusetti, N.J.; Frigerio, J.M.; Dagorn, J.C.; Iovanna, J.L. ); Fox, M.F.; Swallow, D.M. )

    1994-01-01

    Pancreatitis-associated protein (PAP) is a secretory pancreatic protein present in small amounts in normal pancreas and overexpressed during the acute phase of pancreatitis. In this paper, the authors describe the cloning, characterization, and chromosomal mapping of the human PAP gene. The gene spans 2748 bp and contains six exons interrupted by five introns. The gene has a typical promoter containing the sequences TATAAA and CCAAT 28 and 52 bp upstream of the cap site, respectively. They found striking similarities in genomic organization as well as in the promoter sequences between the human and rat PAP genes. The human PAP gene was mapped to chromosome 2p12 using rodent-human hybrid cells and in situ chromosomal hybridization. This localization coincides with that of the reg/lithostathine gene, which encodes a pancreatic secretory protein structurally related to PAP, suggesting that both genes derived from the same ancestral gene by duplication. 35 refs., 4 figs., 1 tab.

  12. Chromosomal localization of the gene for human B-cell antigen CD40

    SciTech Connect

    Ramesh, N.; Geha, R. ); Ramesh, V.; Gusella, J.F. )

    1993-05-01

    CD40 is a surface glycoprotein expressed on all human B lymphocytes and plays an important role in B-cell development, growth, and differentiation. Anti-CD40 monoclonal antibodies cause isotype switching in B cells treated with IL-4. CD40 is a member of a family of proteins that include low-affinity nerve growth factor receptor, TNF receptor, and the antigen Fas. The ligand for CD40 had been recently identified and had been assigned to the X chromosome. Using a panel of human-rodent somatic cell hybrids, the authors now show that CD40 maps to human chromosome 20.

  13. An improved method for producing radiation hybrids applied to human chromosome 19

    SciTech Connect

    Jackson, C.L.

    1992-01-01

    At the initiation of the grant we had just produced radiation hybrids from a monochromosomal microcell hybrid containing human chromosome 19 as its only human component. Radiation hybrids were produced using doses of radiation ranging from 1000--8000 rads. Lethally irradiated cells were then fused to hamster recipients (CHTG49) and selected for growth in histidinol. Approximately 240 clones were isolated and 75 clones were expanded for the isolation of DNA. This report describes in situ hybridization studies and the introduction of markers into human chromosome 19.

  14. Mapping of the gene for the Mel{sub 1a}-melatonin receptor to human chromosome 4 (MTNR1A) and mouse chromosome 8 (Mtnr1a)

    SciTech Connect

    Slaugenhaupt, S.A. |; Liebert, C.B.; Altherr, M.R.

    1995-05-20

    The pineal hormone melatonin elicits potent circadian and reproductive effects in mammals. The authors report the chromosomal location of the gene for the Mel{sub 1a}-melatonin receptor that likely mediates these circadian and reproductive actions. PCR analysis of human-rodent somatic cell hybrids showed that the receptor gene (MTNR1A) maps to human chromosome 4q35.1. An interspecific backcross analysis revealed that the mouse gene (Mtnr1a) maps to the proximal portion of chromosome 8. These loci may be involved in genetically based circadian and neuroendocrine disorders. 14 refs., 1 fig.

  15. Functional human artificial chromosomes are generated and stably maintained in human embryonic stem cells

    PubMed Central

    Mandegar, Mohammad A.; Moralli, Daniela; Khoja, Suhail; Cowley, Sally; Chan, David Y.L.; Yusuf, Mohammed; Mukherjee, Sayandip; Blundell, Michael P.; Volpi, Emanuela V.; Thrasher, Adrian J.; James, William; Monaco, Zoia L.

    2011-01-01

    We present a novel and efficient non-integrating gene expression system in human embryonic stem cells (hESc) utilizing human artificial chromosomes (HAC), which behave as autonomous endogenous host chromosomes and segregate correctly during cell division. HAC are important vectors for investigating the organization and structure of the kinetochore, and gene complementation. HAC have so far been obtained in immortalized or tumour-derived cell lines, but never in stem cells, thus limiting their potential therapeutic application. In this work, we modified the herpes simplex virus type 1 amplicon system for efficient transfer of HAC DNA into two hESc. The deriving stable clones generated green fluorescent protein gene-expressing HAC at high frequency, which were stably maintained without selection for 3 months. Importantly, no integration of the HAC DNA was observed in the hESc lines, compared with the fibrosarcoma-derived control cells, where the exogenous DNA frequently integrated in the host genome. The hESc retained pluripotency, differentiation and teratoma formation capabilities. This is the first report of successfully generating gene expressing de novo HAC in hESc, and is a significant step towards the genetic manipulation of stem cells and potential therapeutic applications. PMID:21593218

  16. Functional human artificial chromosomes are generated and stably maintained in human embryonic stem cells.

    PubMed

    Mandegar, Mohammad A; Moralli, Daniela; Khoja, Suhail; Cowley, Sally; Chan, David Y L; Yusuf, Mohammed; Mukherjee, Sayandip; Blundell, Michael P; Volpi, Emanuela V; Thrasher, Adrian J; James, William; Monaco, Zoia L

    2011-08-01

    We present a novel and efficient non-integrating gene expression system in human embryonic stem cells (hESc) utilizing human artificial chromosomes (HAC), which behave as autonomous endogenous host chromosomes and segregate correctly during cell division. HAC are important vectors for investigating the organization and structure of the kinetochore, and gene complementation. HAC have so far been obtained in immortalized or tumour-derived cell lines, but never in stem cells, thus limiting their potential therapeutic application. In this work, we modified the herpes simplex virus type 1 amplicon system for efficient transfer of HAC DNA into two hESc. The deriving stable clones generated green fluorescent protein gene-expressing HAC at high frequency, which were stably maintained without selection for 3 months. Importantly, no integration of the HAC DNA was observed in the hESc lines, compared with the fibrosarcoma-derived control cells, where the exogenous DNA frequently integrated in the host genome. The hESc retained pluripotency, differentiation and teratoma formation capabilities. This is the first report of successfully generating gene expressing de novo HAC in hESc, and is a significant step towards the genetic manipulation of stem cells and potential therapeutic applications. PMID:21593218

  17. Overexpression and Mislocalization of the Chromosomal Segregation Protein Separase in Multiple Human Cancers

    PubMed Central

    Meyer, Rene; Fofanov, Viacheslav; Panigrahi, Anil K.; Merchant, Fatima; Zhang, Nenggang; Pati, Debananda

    2009-01-01

    Purpose Separase, an endopeptidase, plays a pivotal role in chromosomal segregation by separating sister chromatids during the metaphase to anaphase transition. Using a mouse mammary tumor model we have recently demonstrated that overexpression of Separase induces aneuploidy and tumorigenesis (Zhang et al., 2008, PNAS 105:13033). In the present study, we have investigated the expression level of Separase across a wide range of human tumors. Experimental Design To examine the expression levels and localization of Separase in human tumors, we have performed immunofluorescence microscopy using human Separase antibody and tumor tissue arrays from osteosarcoma, colorectal, breast, and prostate cancers with appropriate normal controls. Results We show that Separase is significantly overexpressed in osteosarcoma, breast and prostate tumor specimens. There is a strong correlation of tumor status with the localization of Separase into the nucleus throughout all stages of the cell cycle. Unlike the normal control tissues, where Separase localization is exclusively cytoplasmic in non dividing cells, human tumor samples show significantly higher number of resting cells with a strong nuclear Separase staining. Additionally, overexpression of Separase transcript strongly correlates with high incidence of relapse, metastasis and lower 5 year overall survival rate in breast and prostate cancer patients. Conclusion These results further strengthen our hypothesis that Separase might be an oncogene, whose overexpression induces tumorigenesis, and indicates that Separase overexpression and aberrant nuclear localization are common in many tumor types and may predict outcome in some human cancers. PMID:19351757

  18. The human genes for hemophilia A and hemophilia B flank the X chromosome fragile site at Xq27.3.

    PubMed Central

    Purrello, M; Alhadeff, B; Esposito, D; Szabo, P; Rocchi, M; Truett, M; Masiarz, F; Siniscalco, M

    1985-01-01

    Two DNA recombinant clones, shown by separate studies to contain DNA sequences homologous to the genes coding for the human blood coagulation Factors VIII and IX, were hybridized in situ to metaphases or prometaphases derived from patients with the fragile-X syndrome and from a normal control. The results of these experiments indicate that (i) both genes are located in the subtelomeric region of the long arm of the human X chromosome flanking the fragile site at Xq27.3, (ii) the resolution of this localization is approximately 0.5% the length of the human haploid genome, i.e., 1.8 X 10(7) bp, (iii) the linear order of loci within the above region is Factor IX-fragile site-Factor VIII-Xqter. Both the localization and the linear order of these loci have been confirmed by Southern blotting studies using the same molecular probes and a panel of rodent-human somatic cell hybrids known to have retained different segments of the human X chromosome. The findings described herein and the knowledge that Factor IX deficiency recombines freely with at least two loci of the G6PD cluster support our hypothesis that the chromosomal region which includes the fragile-X site is normally a region of high meiotic recombination. Images Fig. 2. Fig. 3. PMID:3924593

  19. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  20. Chromosomes of older humans are more prone to aminopterine-induced breakage

    SciTech Connect

    Esposito, D. North Shore Univ. Hospital, Long Island, NY ); Fassina, G. Istituto Scientifico Tumori, Genova ); Szabo, P.; Weksler, M. ); De Angelis, P.; Siniscalco, M. ); Rodgers, L. )

    1989-02-01

    The authors have adopted a simplified version of the cell hybrid cotransfer method to test the hypothesis that human lymphocytes derived from elderly individuals have a higher chromosome instability. Peripheral blood lymphocytes from old male individuals and young controls were fused with a Chinese hamster cell line (CHO-YH21), yielding 10 HAT-resistant rodent-human clones from the old propositi and 22 from the young controls. Both series of hybrid clones were analyzed with respect to the retention of the enzyme glucose-6-phosphate dehydrogenase and the surface antigen MIC2 identified by monoclonal antibody 12E7, two human X chromosome-linked markers located at opposite ends of the X chromosome. Cell hybrid clones with an X chromosome from a young control retained both markers in about 70% of the cells. In contrast, cell hybrid clones with an X chromosome from an old donor retained the MIC2 marker in only 30% of their cells. Slot-blot hybridization studies have established that the observed loss of the MIC2 marker is due to loss of the coding gene, not to suppression of its expression. T lymphocytes from old donors were also found to have an LD{sub 50} for aminopterine significantly lower than the concentration of this drug in the HAT medium used to grow the hybrids. They speculate that the higher rate of chromosomal breakage and of marker loss observed along the old-age X chromosomes could be the result of molecular scars accumulated with aging at sites of constitutive chromosomal fragility.

  1. Chromosomal mapping of the gene (INPP5A) encoding the 43-kDa membrane-associated inositol polyphosphate 5-phosphatase to 10q26.3 by fluorescence in situ hybridization

    SciTech Connect

    Mitchell, C.A.; Speed, C.J.; Nicholl, J.; Sutherland, G.R.

    1996-01-01

    This report discusses the localization of a membrane-associated inositol polyphosphate 5-phosphatase gene to human chromosome 10q26.3 using fluorescence in situ hybridization. This 43-kDa 5-phosphatase does not map to the same location as any other 5-phosphatase enzymes. 13 refs., 1 fig.

  2. Induction of chromosome aberrations and mitotic arrest by cytomegalovirus in human cells

    SciTech Connect

    AbuBakar, S.; Au, W.W.; Legator, M.S.; Albrecht, T.

    1988-01-01

    Human cytomegalovirus (CMV) is potentially an effective but often overlooked genotoxic agent in humans. We report here evidence that indicates that infection by CMV can induce chromosome alterations and mitotic inhibition. The frequency of chromosome aberrations induced was dependent on the input multiplicity of infection (m.o.i.) for human lung fibroblasts (LU), but not for human peripheral blood lymphocytes (PBLs) when both cell types were infected at the GO phase of the cell cycle. The aberrations induced by CMV were mostly chromatid breaks and chromosome pulverizations that resembled prematurely condensed S-phase chromatin. Pulverized chromosomes were not observed in LU cells infected with virus stocks that had been rendered nonlytic by UV-irradiation at 24,000 ergs/mm2 or from infection of human lymphocytes. In LU cells infected with UV-irradiated CMV, the frequency of aberrations induced was inversely dependent on the extent of the exposure of the CMV stock to the UV-light. In permissive CMV infection of proliferating LU cells at 24 hr after subculture, a high percentage (greater than 40%) of the metaphase cells were arrested at their first metaphase and displayed severely condensed chromosomes when harvested 48 hr later. A significant increase (p less than 0.05) in the chromosome aberration frequency was also observed. Our study shows that CMV infection is genotoxic to host cells. The types and extent of damage are dependent on the viral genome expression and on the cell cycle stage of the cells at the time of infection. The possible mechanisms for induction of chromosome damage by CMV are discussed.

  3. Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

    PubMed

    Waye, J S; Willard, H F

    1986-09-01

    The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.

  4. Human Artificial Chromosomes for Gene Delivery and the Development of Animal Models

    PubMed Central

    Kazuki, Yasuhiro; Oshimura, Mitsuo

    2011-01-01

    Random integration of conventional gene delivery vectors such as viruses, plasmids, P1 phage-derived artificial chromosomes, bacterial artificial chromosomes and yeast artificial chromosomes can be associated with transgene silencing. Furthermore, integrated viral sequences can activate oncogenes adjacent to the insertion site resulting in cancer. Various human artificial chromosomes (HACs) exhibit several potential characteristics desired for an ideal gene delivery vector, including stable episomal maintenance and the capacity to carry large genomic loci with their regulatory elements, thus allowing the physiological regulation of the introduced gene in a manner similar to that of native chromosomes. HACs have been generated mainly using either a “top-down approach” (engineered chromosomes), or a “bottom-up approach” (de novo artificial chromosomes). The recent emergence of stem cell–based tissue engineering has opened up new avenues for gene and cell therapies. This review describes the lessons learned and prospects identified mainly from studies in the construction of HACs and HAC-mediated gene expression systems in cultured cells, as well as in animals. PMID:21750534

  5. Global patterns of large copy number variations in the human genome reveal complexity in chromosome organization.

    PubMed

    Veerappa, Avinash M; Suresh, Raviraj V; Vishweswaraiah, Sangeetha; Lingaiah, Kusuma; Murthy, Megha; Manjegowda, Dinesh S; Padakannaya, Prakash; Ramachandra, Nallur B

    2015-01-01

    Global patterns of copy number variations (CNVs) in chromosomes are required to understand the dynamics of genome organization and complexity. For this study, analysis was performed using the Affymetrix Genome-Wide Human SNP Array 6.0 chip and CytoScan High-Density arrays. We identified a total of 44 109 CNVs from 1715 genomes with a mean of 25 CNVs in an individual, which established the first drafts of population-specific CNV maps providing a rationale for prioritizing chromosomal regions. About 19 905 ancient CNVs were identified across all chromosomes and populations at varying frequencies. CNV count, and sometimes CNV size, contributed to the bulk CNV size of the chromosome. Population specific lengthening and shortening of chromosomal length was observed. Sex bias for CNV presence was largely dependent on ethnicity. Lower CNV inheritance rate was observed for India, compared to YRI and CEU. A total of 33 candidate CNV hotspots from 5382 copy number (CN) variable region (CNVR) clusters were identified. Population specific CNV distribution patterns in p and q arms disturbed the assumption that CNV counts in the p arm are less common compared to long arms, and the CNV occurrence and distribution in chromosomes is length independent. This study unraveled the force of independent evolutionary dynamics on genome organization and complexity across chromosomes and populations. PMID:26390810

  6. Preimplantation genetic diagnosis of a large pericentric inversion of chromosome 5.

    PubMed

    Iwarsson, E; Ahrlund-Richter, L; Inzunza, J; Rosenlund, B; Fridström, M; Hillensjö, T; Sjöblom, P; Nordenskjöld, M; Blennow, E

    1998-07-01

    We report the first established pregnancy using preimplantation genetic diagnosis in order to avoid chromosomal imbalance in the progeny of a woman carrying a large inversion of chromosome 5. This is also the first time where it has been possible to study the distribution of balanced and unbalanced gametes in a female inversion carrier. In total, 23 embryos were biopsied in two separate treatments and analysed by fluorescent in-situ hybridization. Of these, 10 were unbalanced, nine were balanced and for four the analysis was inconclusive. The diagnostic procedure was performed within 3.5 h. This allowed the biopsied embryos to be transferred the same day as the biopsy was taken (day 3). Two embryos were transferred each time, and in the second treatment a twin pregnancy with two chromosomally balanced fetuses was established. Healthy twins were delivered at 34 weeks of gestation.

  7. Correlation of chromosome patterns in human leukemic cells with exposure to chemicals and/or radiation. Comprehensive progress report, July 1991--June 1992

    SciTech Connect

    Rowley, J.D.

    1992-06-01

    This project seeks to defining the chromosome segments associated with radiation induced leukemogenesis (treatment-related acute myeloid leukemia, or t-AML). Towards these goals genetic analysis of human chromosomes 5 and 7 continues to investigate correlation of treatment with balanced and unbalanced chromosomal translocations. Progress is being made in cloning the breakpoints in balanced translocations in t-AML, that is to clone the t(9;11) and t(11;19) breakpoints, to clone the t(3;21)(q26;q22) breakpoints and to determine the relationship of these translocations to prior exposure to topoisomerase II inhibitors. 11 figs. 3 figs.

  8. The human enamel protein gene amelogenin is expressed from both the X and the Y chromosomes

    SciTech Connect

    Salido, E.C. ); Yen, P.H.; Koprivnikar, K.; Shapiro, L.J. ); Yu, Lohchung )

    1992-02-01

    Amelogenins, a family of extracellular matrix proteins of the dental enamel, are transiently but abundantly expressed by ameloblasts during tooth development. In this paper the authors report the characterization of the AMGX and AMGY genes on the short arms of the human X and Y chromosomes which encode the amelogenins. Their studies on the expression of the amelogenin genes in male developing tooth buds showed that both the AMGX and AMGY genes are transcriptionally active and encode potentially functional proteins. They have isolated genomic and cDNA clones form both the AMGX and AMGY loci and have studied the sequence organization of these two genes. Reverse transcriptase (RT)PCR amplification of the 5[prime] portion of the amelogenin transcripts revealed several alternatively spliced products. This information will be useful for studying the molecular basis of X-linked amelogenesis imperfecta, for understanding the evolution and regulation of gene expression on the mammalian sex chromosomes, and for investigating the role of amelogenin genes during tooth development.

  9. Detection of chromosomal aneuploidy in human preimplantation embryos by next-generation sequencing.

    PubMed

    Wang, Li; Wang, Xiaohong; Zhang, Jianguang; Song, Zhuo; Wang, Shufang; Gao, Yang; Wang, Jun; Luo, Yaning; Niu, Ziru; Yue, Xiaojing; Xu, Genming; Cram, David S; Yao, Yuanqing

    2014-05-01

    Embryos produced by assisted reproductive technologies are commonly associated with a high level of aneuploidy. Currently, 24-chromosome profiling of embryo biopsy samples by array-based methods is available to identify euploid embryos for transfer that have a higher potential for implantation and development to term. From a laboratory and patient perspective, there is a need to explore the feasibility of developing an alternative method for routine aneuploidy assessment of embryos that would be more comprehensive, cost-effective, and efficient. We speculated that aneuploidy could be readily assessed in test single-cell biopsy samples by first performing whole genome amplification followed by library generation, massively parallel shot-gun sequencing, and finally bioinformatics analysis to quantitatively compare the ratio of uniquely mapped reads to reference cells. Using Down syndrome as an example, the copy number change for chromosome 21 was consistently 1.5-fold higher in multiple cell and single-cell samples with a 47,XX,+21 karyotype. Applying the validated sequencing strategy to 10 sister blastomeres from a single human embryo, we showed that the aneuploidy status called by sequencing was consistent with short tandem repeat allelic profiling. These validation studies indicate that aneuploidy detection using sequencing-based methodology is feasible for further improving the practice of preimplantation genetic diagnosis. PMID:24648399

  10. Isoform-Level Gene Expression Profiles of Human Y Chromosome Azoospermia Factor Genes and Their X Chromosome Paralogs in the Testicular Tissue of Non-Obstructive Azoospermia Patients.

    PubMed

    Ahmadi Rastegar, Diba; Sharifi Tabar, Mehdi; Alikhani, Mehdi; Parsamatin, Pouria; Sahraneshin Samani, Fazel; Sabbaghian, Marjan; Sadighi Gilani, Mohammad Ali; Mohammad Ahadi, Ali; Mohseni Meybodi, Anahita; Piryaei, Abbas; Ansari-Pour, Naser; Gourabi, Hamid; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2015-09-01

    The human Y chromosome has an inevitable role in male fertility because it contains many genes critical for spermatogenesis and the development of the male gonads. Any genetic variation or epigenetic modification affecting the expression pattern of Y chromosome genes may thus lead to male infertility. In this study, we performed isoform-level gene expression profiling of Y chromosome genes within the azoospermia factor (AZF) regions, their X chromosome counterparts, and few autosomal paralogues in testicular biopsies of 12 men with preserved spermatogenesis and 68 men with nonobstructive azoospermia (NOA) (40 Sertoli-cell-only syndrome (SCOS) and 28 premiotic maturation arrest (MA)). This was undertaken using quantitative real-time PCR (qPCR) at the transcript level and Western blotting (WB) and immunohistochemistry (IHC) at the protein level. We profiled the expression of 41 alternative transcripts encoded by 14 AZFa, AZFb, and AZFc region genes (USP9Y, DDX3Y, XKRY, HSFY1, CYORF15A, CYORF15B, KDM5D, EIF1AY, RPS4Y2, RBMY1A1, PRY, BPY2, DAZ1, and CDY1) as well as their X chromosome homologue transcripts and a few autosomal homologues. Of the 41 transcripts, 18 were significantly down-regulated in men with NOA when compared with those of men with complete spermatogenesis. In contrast, the expression of five transcripts increased significantly in NOA patients. Furthermore, to confirm the qPCR results at the protein level, we performed immunoblotting and IHC experiments (based on 24 commercial and homemade antibodies) that detected 10 AZF-encoded proteins. In addition, their localization in testis cell types and organelles was determined. Interestingly, the two missing proteins, XKRY and CYORF15A, were detected for the first time. Finally, we focused on the expression patterns of the significantly altered genes in 12 MA patients with successful sperm retrieval compared to those of 12 MA patients with failed sperm retrieval to predict the success of sperm retrieval in

  11. Chromosomal patterns in Warthin's tumor. A second type of human benign salivary gland neoplasm.

    PubMed

    Mark, J; Dahlenfors, R; Stenman, G; Nordquist, A

    1990-05-01

    The cytogenetical observations in eight successfully cultured human adenolymphomas are reported. When the results were considered with those of two previously reported cases, three main stemline groups could be distinguished: (a) one with a normal karyotype and noted as a primary or secondary stemline in all hitherto studied tumors; (b) a second group with only numerical changes, either loss of the Y chromosome or trisomy or monosomy 5; and (c) a third group with only structural changes, as a rule with one or two reciprocal translocations. With regard to the last group, studies of many more cases are necessary to decide whether distinctive subgroups exist. Analyses using molecular methods are also urgently needed to clarify whether the normal stemline cells contain submicroscopic changes.

  12. Microfluidic extraction, stretching and analysis of human chromosomal DNA from single cells†

    PubMed Central

    Benítez, Jaime J.; Topolancik, Juraj; Tian, Harvey C.; Wallin, Christopher B.; Latulippe, David R.; Szeto, Kylan; Murphy, Patrick J.; Cipriany, Benjamin R.; Levy, Stephen L.; Soloway, Paul D.; Craighead, Harold G.

    2014-01-01

    We describe a microfluidic device for the extraction, purification and stretching of human chromosomal DNA from single cells. A two-dimensional array of micropillars in a microfluidic polydimethylsiloxane channel was designed to capture a single human cell. Megabase-long DNA strands released from the cell upon lysis are trapped in the micropillar array and stretched under optimal hydrodynamic flow conditions. Intact chromosomal DNA is entangled in the array, while other cellular components are washed from the channel. To demonstrate the entrapment principle, a single chromosome was hybridized to whole chromosome paints, and imaged by fluorescence microscopy. DNA extracted from a single cell and small cell populations (less than 100) was released from the device by restriction endonuclease digestion under continuous flow and collected for offchip analysis. Quantification of the extracted material reveals that the microdevice efficiently extracts essentially all chromosomal DNA. The device described represents a novel platform to perform a variety of analyses on chromosomal DNA at the single cell level. PMID:23018789

  13. Microfluidic extraction, stretching and analysis of human chromosomal DNA from single cells.

    PubMed

    Benítez, Jaime J; Topolancik, Juraj; Tian, Harvey C; Wallin, Christopher B; Latulippe, David R; Szeto, Kylan; Murphy, Patrick J; Cipriany, Benjamin R; Levy, Stephen L; Soloway, Paul D; Craighead, Harold G

    2012-11-21

    We describe a microfluidic device for the extraction, purification and stretching of human chromosomal DNA from single cells. A two-dimensional array of micropillars in a microfluidic polydimethylsiloxane channel was designed to capture a single human cell. Megabase-long DNA strands released from the cell upon lysis are trapped in the micropillar array and stretched under optimal hydrodynamic flow conditions. Intact chromosomal DNA is entangled in the array, while other cellular components are washed from the channel. To demonstrate the entrapment principle, a single chromosome was hybridized to whole chromosome paints, and imaged by fluorescence microscopy. DNA extracted from a single cell and small cell populations (less than 100) was released from the device by restriction endonuclease digestion under continuous flow and collected for off-chip analysis. Quantification of the extracted material reveals that the microdevice efficiently extracts essentially all chromosomal DNA. The device described represents a novel platform to perform a variety of analyses on chromosomal DNA at the single cell level.

  14. Phylogenetic Origin of Human Chromosomes 7, 16, and 19 and their Homologs in Placental Mammals

    PubMed Central

    Richard, Florence; Lombard, Martine; Dutrillaux, Bernard

    2000-01-01

    The origin of human chromosomes (HSA) 7, 16, and 19 was studied by comparing data obtained from chromosome banding, chromosome painting, and gene mapping in species belonging to 11 orders of placental mammals (Eutherians). This allowed us to propose the reconstruction of their presumed ancestral forms. The HSA7 homologs were composed of two parts, the largest forming an acrocentric. The smallest formed one arm of a small submetacentric; the other arm was composed of sequences homologous to the short arm of HSA16 (HSA16p). The sequences homologous to the long arm of HSA16 (HSA16q) were associated with sequences homologous to the long arm of HSA19 (HSA19q) and formed another submetacentric. From their origin, these chromosomes underwent the following rearrangements to give rise to current human chromosomes: centromeric fission of the two submetacentrics in ancestors of all primates (∼80 million years ago); fusion of the HSA19p and HSA19q sequences, originating the current HSA19, in ancestors of all simians (∼55 million years ago); fusions of the HSA16p and HSA16q sequences, originating the current HSA16 and the two components of HSA7 before the separation of Cercopithecoids and Hominoids (∼35 million years ago); and finally, pericentric and paracentric inversions of the homologs to HSA7 after the divergence of orangutan and gorilla, respectively. Thus, compared with HSA16 and HSA19, HSA7 is a fairly recent chromosome shared by man and chimpanzee only. PMID:10810086

  15. Genomic structure and chromosomal mapping of the human CD22 gene

    SciTech Connect

    Wilson, G.L.; Kozlow, E.; Kehrl, J.H. ); Najfeld, V. ); Menniger, J.; Ward, D. )

    1993-06-01

    The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12 to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.

  16. Early and Late Damages in Chromosome 3 of Human Lymphocytes After Radiation Exposure

    NASA Technical Reports Server (NTRS)

    Sunagawa, Mayumi; Mangala, Lingegowda; Zhang, Ye; Kahdim, Munira; Wilson, Bobby; Cucinotta, Francis A.; Wu, Honglu

    2011-01-01

    Tumor formation in humans or animals is a multi-step process. An early stage of cancer development is believed to be genomic instability (GI) which accelerates the mutation rate in the descendants of the cells surviving radiation exposure. GI is defined as elevated or persistent genetic damages occurring many generations after the cells are exposed. While early studies have demonstrated radiation-induced GI in several cell types as detected in endpoints such as mutation, apoptosis and damages in chromosomes, the dependence of GI on the quality of radiation remains uncertain. To investigate GI in human lymphocytes induced by both low- and high-LET radiation, we initially exposed white blood cells collected from healthy subjects to gamma rays in vitro, and cultured the cells for multiple generations. Chromosome aberrations were analyzed in cells collected at first mitosis post irradiation and at several intervals during the culture period. Among a number of biological endpoints planned for the project, the multi-color banding fluorescent in situ hybridization (mBAND) allows identification of inversions that were expected to be stable. We present here early and late chromosome aberrations detected with mBAND in chromosome 3 after gamma exposure. Comparison of chromosome damages in between human lymphocytes and human epithelial cells is also discussed

  17. Isolation and mapping of 68 RFLP markers on human chromosome 6

    SciTech Connect

    Saito, Susumo SRL Inc., Tokyo ); Okui, Keiko; Tokino, Takashi; Nakamura, Yusuke ); Oshimura, Mitsuo )

    1992-01-01

    The authors have isolated 68 new RFLP markers on human chromosome 6. Of these, 64 were localized on chromosomal bands by the fluorescent in-situ hybridization (FISH) method, 25 on the short arm and 39 on the long arm. Their distribution was uneven; the makers were localized predominantly in regions of R-positive banding. Eleven markers defined VNTR loci. This expanded collection of DNA markers will contribute to high-resolution linkage mapping of genes causing inherited disorders and will provide useful reagents for isolation of putative tumor-suppressor genes on chromosome 6 that appear to be involved in malignancies. Furthermore, the new markers will be guideposts for detailed linkage and physical maps of this chromosome.

  18. An integrated physical map of 210 markers assigned to the short arm of human chromosome 11

    SciTech Connect

    Redeker, E.; Hoovers, J.M.N.; Alders, M.

    1994-06-01

    Using a panel of patient cell lines with chromosomal breakpoints, the authors constructed a physical map for the short arm of human chromosome 11. They focused on 11p15, a chromosome band harboring at least 25 known genes and associated with the Beckwith-Wiedemann syndrome, several childhood tumors, and genomic imprinting. This underlines the need for a physical map for this region. They divided the short arm of chromosome 11 into 18 breakpoint regions, and a large series of new and previously described genes and markers was mapped within these intervals using fluorescence in situ hybridization. Cosmid fingerprint analysis showed that 19 of these markers were included in cosmid contigs. A detailed 10-Mb pulsed-field physical map of the region 11p15.3-pter was constructed. These three different approaches enabled the high-resolution mapping of 210 markers, including 22 known genes. 64 refs., 6 figs., 3 tabs.

  19. The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis.

    PubMed

    Hong, Ye; Sonneville, Remi; Agostinho, Ana; Meier, Bettina; Wang, Bin; Blow, J Julian; Gartner, Anton

    2016-03-01

    Meiotic recombination is essential for the repair of programmed double strand breaks (DSBs) to generate crossovers (COs) during meiosis. The efficient processing of meiotic recombination intermediates not only needs various resolvases but also requires proper meiotic chromosome structure. The Smc5/6 complex belongs to the structural maintenance of chromosome (SMC) family and is closely related to cohesin and condensin. Although the Smc5/6 complex has been implicated in the processing of recombination intermediates during meiosis, it is not known how Smc5/6 controls meiotic DSB repair. Here, using Caenorhabditis elegans we show that the SMC-5/6 complex acts synergistically with HIM-6, an ortholog of the human Bloom syndrome helicase (BLM) during meiotic recombination. The concerted action of the SMC-5/6 complex and HIM-6 is important for processing recombination intermediates, CO regulation and bivalent maturation. Careful examination of meiotic chromosomal morphology reveals an accumulation of inter-chromosomal bridges in smc-5; him-6 double mutants, leading to compromised chromosome segregation during meiotic cell divisions. Interestingly, we found that the lethality of smc-5; him-6 can be rescued by loss of the conserved BRCA1 ortholog BRC-1. Furthermore, the combined deletion of smc-5 and him-6 leads to an irregular distribution of condensin and to chromosome decondensation defects reminiscent of condensin depletion. Lethality conferred by condensin depletion can also be rescued by BRC-1 depletion. Our results suggest that SMC-5/6 and HIM-6 can synergistically regulate recombination intermediate metabolism and suppress ectopic recombination by controlling chromosome architecture during meiosis.

  20. The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis

    PubMed Central

    Hong, Ye; Sonneville, Remi; Agostinho, Ana; Meier, Bettina; Wang, Bin; Blow, J. Julian; Gartner, Anton

    2016-01-01

    Meiotic recombination is essential for the repair of programmed double strand breaks (DSBs) to generate crossovers (COs) during meiosis. The efficient processing of meiotic recombination intermediates not only needs various resolvases but also requires proper meiotic chromosome structure. The Smc5/6 complex belongs to the structural maintenance of chromosome (SMC) family and is closely related to cohesin and condensin. Although the Smc5/6 complex has been implicated in the processing of recombination intermediates during meiosis, it is not known how Smc5/6 controls meiotic DSB repair. Here, using Caenorhabditis elegans we show that the SMC-5/6 complex acts synergistically with HIM-6, an ortholog of the human Bloom syndrome helicase (BLM) during meiotic recombination. The concerted action of the SMC-5/6 complex and HIM-6 is important for processing recombination intermediates, CO regulation and bivalent maturation. Careful examination of meiotic chromosomal morphology reveals an accumulation of inter-chromosomal bridges in smc-5; him-6 double mutants, leading to compromised chromosome segregation during meiotic cell divisions. Interestingly, we found that the lethality of smc-5; him-6 can be rescued by loss of the conserved BRCA1 ortholog BRC-1. Furthermore, the combined deletion of smc-5 and him-6 leads to an irregular distribution of condensin and to chromosome decondensation defects reminiscent of condensin depletion. Lethality conferred by condensin depletion can also be rescued by BRC-1 depletion. Our results suggest that SMC-5/6 and HIM-6 can synergistically regulate recombination intermediate metabolism and suppress ectopic recombination by controlling chromosome architecture during meiosis. PMID:27010650

  1. The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis.

    PubMed

    Hong, Ye; Sonneville, Remi; Agostinho, Ana; Meier, Bettina; Wang, Bin; Blow, J Julian; Gartner, Anton

    2016-03-01

    Meiotic recombination is essential for the repair of programmed double strand breaks (DSBs) to generate crossovers (COs) during meiosis. The efficient processing of meiotic recombination intermediates not only needs various resolvases but also requires proper meiotic chromosome structure. The Smc5/6 complex belongs to the structural maintenance of chromosome (SMC) family and is closely related to cohesin and condensin. Although the Smc5/6 complex has been implicated in the processing of recombination intermediates during meiosis, it is not known how Smc5/6 controls meiotic DSB repair. Here, using Caenorhabditis elegans we show that the SMC-5/6 complex acts synergistically with HIM-6, an ortholog of the human Bloom syndrome helicase (BLM) during meiotic recombination. The concerted action of the SMC-5/6 complex and HIM-6 is important for processing recombination intermediates, CO regulation and bivalent maturation. Careful examination of meiotic chromosomal morphology reveals an accumulation of inter-chromosomal bridges in smc-5; him-6 double mutants, leading to compromised chromosome segregation during meiotic cell divisions. Interestingly, we found that the lethality of smc-5; him-6 can be rescued by loss of the conserved BRCA1 ortholog BRC-1. Furthermore, the combined deletion of smc-5 and him-6 leads to an irregular distribution of condensin and to chromosome decondensation defects reminiscent of condensin depletion. Lethality conferred by condensin depletion can also be rescued by BRC-1 depletion. Our results suggest that SMC-5/6 and HIM-6 can synergistically regulate recombination intermediate metabolism and suppress ectopic recombination by controlling chromosome architecture during meiosis. PMID:27010650

  2. Genetic variations in GRIA1 on chromosome 5q33 related to asparaginase hypersensitivity

    PubMed Central

    Chen, Shih-Hsiang; Pei, Deqing; Yang, Wenjian; Cheng, Cheng; Jeha, Sima; Cox, Nancy J.; Evans, William E.; Pui, Ching-Hon; Relling, Mary V.

    2010-01-01

    The genetic variations that lead to asparaginase allergy are unknown. We interrogated over 500,000 single nucleotide polymorphisms (SNPs) in 485 children with acute lymphoblastic leukemia (ALL): 322 in a discovery and 163 in a validation cohort. From the top 100 SNPs associated with allergy in the discovery cohort, chromosome 5 was overrepresented compared to other chromosomes (p = 0.00032), hosting 10 SNPs annotated to genes. Among these 10 SNPs, one SNP (rs4958381), in GRIA1 on chromosome 5q33, replicated in the validation cohort (p = 1.8 × 10−5, 2.9 × 10−3, and 3.5 × 10−7 in the discovery, validation, and combined cohorts, respectively). Four additional SNPs annotated to GRIA1 were also significantly associated with allergy (p < 0.05) in both cohorts. Chromosome 5q33 has previously been associated with asthma and atopy. These data contribute to the growing body of evidence that there is an inherited component to predisposition to drug allergy. PMID:20592726

  3. Evaluating the Y chromosomal timescale in human demographic and lineage dating

    PubMed Central

    2014-01-01

    Y chromosome is a superb tool for inferring human evolution and recent demographic history from a paternal perspective. However, Y chromosomal substitution rates obtained using different modes of calibration vary considerably, and have produced disparate reconstructions of human history. Here, we discuss how substitution rate and date estimates are affected by the choice of different calibration points. We argue that most Y chromosomal substitution rates calculated to date have shortcomings, including a reliance on the ambiguous human-chimpanzee divergence time, insufficient sampling of deep-rooting pedigrees, and using inappropriate founding migrations, although the rates obtained from a single pedigree or calibrated with the peopling of the Americas seem plausible. We highlight the need for using more deep-rooting pedigrees and ancient genomes with reliable dates to improve the rate estimation. PMID:25215184

  4. Multiplex single-nucleotide polymorphism typing of the human Y chromosome using TaqMan probes

    PubMed Central

    2011-01-01

    Background The analysis of human Y-chromosome variation in the context of population genetics and forensics requires the genotyping of dozens to hundreds of selected single-nucleotide polymorphisms (SNPs). In the present study, we developed a 121-plex (121 SNPs in a single array) TaqMan array capable of distinguishing most haplogroups and subhaplogroups on the Y-chromosome human phylogeny in Europe. Results We present data from 264 samples from several European areas and ethnic groups. The array developed in this study shows >99% accuracy of assignation to the Y human phylogeny (with an average call rate of genotypes >96%). Conclusions We have created and evaluated a robust and accurate Y-chromosome multiplex which minimises the possible errors due to mixup when typing the same sample in several independent reactions. PMID:21627798

  5. Reduced Y-Chromosome, but Not Mitochondrial DNA, Diversity in Human Populations from West New Guinea

    PubMed Central

    Kayser, Manfred; Brauer, Silke; Weiss, Gunter; Schiefenhövel, Wulf; Underhill, Peter; Shen, Peidong; Oefner, Peter; Tommaseo-Ponzetta, Mila; Stoneking, Mark

    2003-01-01

    To investigate the paternal population history of New Guinea, 183 individuals from 11 regional populations of West New Guinea (WNG) and 131 individuals from Papua New Guinea (PNG) were analyzed at 26 binary markers and seven short-tandem-repeat loci from the nonrecombining part of the human Y chromosome and were compared with 14 populations of eastern and southeastern Asia, Polynesia, and Australia. Y-chromosomal diversity was low in WNG compared with PNG and with most other populations from Asia/Oceania; a single haplogroup (M-M4) accounts for 75% of WNG Y chromosomes, and many WNG populations have just one Y haplogroup. Four Y-chromosomal lineages (haplogroups M-M4, C-M208, C-M38, and K-M230) account for 94% of WNG Y chromosomes and 78% of all Melanesian Y chromosomes and were identified to have most likely arisen in Melanesia. Haplogroup C-M208, which in WNG is restricted to the Dani and Lani, two linguistically closely related populations from the central and western highlands of WNG, was identified as the major Polynesian Y-chromosome lineage. A network analysis of associated Y-chromosomal short-tandem-repeat haplotypes suggests two distinct population expansions involving C-M208—one in New Guinea and one in Polynesia. The observed low levels of Y-chromosome diversity in WNG contrast with high levels of mtDNA diversity reported for the same populations. This most likely reflects extreme patrilocality and/or biased male reproductive success (polygyny). Our data further provide evidence for primarily female-mediated gene flow within the highlands of New Guinea but primarily male-mediated gene flow between highland and lowland/coastal regions. PMID:12532283

  6. Isolation, characterization, and regional mapping of microclones from a human chromosome 21 microdissection library

    SciTech Connect

    Yu, J.; Hartz, J.; Yisheng Xu; Gemmill, R.M.; Patterson, D.; Kao, Faten ); Gemmill, R.M.; Patterson, D.; Kao, Fa-Ten ); Korenberg, J.R. )

    1992-08-01

    Thirty-four unique-sequence microclones were isolated from a previously described microdissection library of human chromosome 21 and were regionally mapped using a cell hybrid mapping panel which consists of six cell hybrids and divides chromosome 21 into eight regions. The mapping results showed that the microclones were unevenly distributed along chromosome 21, with the majority of microclones located in the distal half portion of the long arm, between 21q21.3 and 21qter. The number of unique-sequence clones began to decrease significantly from 21q21.2 to centromere and extending to the short arm. This finding is consistent with those reported in other chromosome 21 libraries. Thus, it may be inferred that the proximal portion of the long arm of chromosome 21 contains higher proportions of repetitive sequences, rather than unique sequences of genes. The microclones were also characterized for insert size and were used to identify the corresponding genomic fragments generated by HindIII. In addition, the authors demonstrated that the microclones with short inserts can be efficiently used to identify YAC (yeast artificial chromosome) clones with large inserts, for increased genomic coverage for high-resolution physical mapping. They also used 200 unique-sequence microclones to screen a human liver cDNA library and identified two cDNA clones which were regionally assigned to the 21q21.3-q22.1 region. Thus, generation of unique-sequence microclones from chromosome 21 appears to be useful to isolate and regionally map many cDNA clones, among which will be candidate genes for important diseases on chromosome 21, including Down syndrome, Alzheimer disease, amyotrophic lateral sclerosis, and one form of epilepsy.

  7. The CEPH consortium linkage map of human chromosome 11

    SciTech Connect

    Litt, M.; Kramer, P.; Kort, E.

    1995-05-01

    The CEPH consortium framework map of chromosome 11 is presented. The map was generated from CEPH family DNAs with 181 probe/enzyme combinations contributed by 20 laboratories. Seventy-seven of the loci are defined by microsatellite polymorphisms that can be typed by the PCR. A total of 42 loci have been placed on the map with likelihood support of at least 1000:1. The female, male, and sex-average maps extend for 179.6, 110.8, and 145.3 cM, respectively. The largest interval on the sex-average map is less than 11 cM, and the average distance between uniquely placed loci is 4 cM. The genotypic data obtained for map construction have been used to identify the positions of crossovers on the chromosomes of CEPH family children, allowing the localization of new markers without computationally intensive likelihood models and providing a basis for efficient extension of the linkage map to higher resolution. 36 refs., 4 figs., 4 tabs.

  8. Loss of both CSF1R (FMS) alleles in patients with myelodysplasia and a chromosome 5 deletion

    SciTech Connect

    Boultwood, J.; Rack, K.; Buckle, V.J.; Wainscoat, J.S. ); Kelly, S. ); Madden, J.; Oscier, D.G. ); Sakaguchi, A.Y.; Wang, Lingmei )

    1991-07-15

    A high proportion of patients with myelodysplasia show characteristic karyotypic abnormalities in bone marrow cells. The most distinctive of the myelodysplastic syndromes is the 5q- syndrome characterized by refractory anemia, poorly lobulated megakaryocytes, and an interstitial deletion of the long arm of chromosome 5 (5q deletion) as the sole karyotypic abnormality. Recently, several genes encoding hemopoietic growth factors and receptors, have been localized to the long arm of chromosome 5, and there has been much speculation that deletion of one or more of these genes may be critical to the pathogenesis of the associated myeloid disorders. One candidate gene is CSF1R. The authors have carried out a molecular examination of the CSF1R, both on the 5q- chromosome and on the apparently normal homologous chromsome 5, in 10 patients with myelodysplasia and a 5q deletion. They have found, using restriction fragment length polymorphism analysis and gene dosage experiments, that all 10 patients showed deletion of CSF1R. The homozygous CSF1R loss has been confirmed in 2 patients by an in situ hybridization technique comparing the signal in affected cells to that in control sex-mismatched cells on the same slides. This loss of one CSF1R allele, together with loss in some cells of the remaining allele on the homologous chromsome 5, in patients with myelodysplasia indicates that this is a region of critical gene loss on 5q. The loss of the hemopoietic growth factor receptor gene CSF1R may be important in the pathogenesis of human myeloid leukemia.

  9. The non-coding RNA composition of the mitotic chromosome by 5′-tag sequencing

    PubMed Central

    Meng, Yicong; Yi, Xianfu; Li, Xinhui; Hu, Chuansheng; Wang, Ju; Bai, Ling; Czajkowsky, Daniel M.; Shao, Zhifeng

    2016-01-01

    Mitotic chromosomes are one of the most commonly recognized sub-cellular structures in eukaryotic cells. Yet basic information necessary to understand their structure and assembly, such as their composition, is still lacking. Recent proteomic studies have begun to fill this void, identifying hundreds of RNA-binding proteins bound to mitotic chromosomes. However, by contrast, there are only two RNA species (U3 snRNA and rRNA) that are known to be associated with the mitotic chromosome, suggesting that there are many mitotic chromosome-associated RNAs (mCARs) not yet identified. Here, using a targeted protocol based on 5′-tag sequencing to profile the mammalian mCAR population, we report the identification of 1279 mCARs, the majority of which are ncRNAs, including lncRNAs that exhibit greater conservation across 60 vertebrate species than the entire population of lncRNAs. There is also a significant enrichment of snoRNAs and specific SINE RNAs. Finally, ∼40% of the mCARs are presently unannotated, many of which are as abundant as the annotated mCARs, suggesting that there are also many novel ncRNAs in the mCARs. Overall, the mCARs identified here, together with the previous proteomic and genomic data, constitute the first comprehensive catalogue of the molecular composition of the eukaryotic mitotic chromosomes. PMID:27016738

  10. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  11. Molecular Dissection of the Basal Clades in the Human Y Chromosome Phylogenetic Tree

    PubMed Central

    Scozzari, Rosaria; Massaia, Andrea; D’Atanasio, Eugenia; Myres, Natalie M.; Perego, Ugo A.; Trombetta, Beniamino; Cruciani, Fulvio

    2012-01-01

    One hundred and forty-six previously detected mutations were more precisely positioned in the human Y chromosome phylogeny by the analysis of 51 representative Y chromosome haplogroups and the use of 59 mutations from literature. Twenty-two new mutations were also described and incorporated in the revised phylogeny. This analysis made it possible to identify new haplogroups and to resolve a deep trifurcation within haplogroup B2. Our data provide a highly resolved branching in the African-specific portion of the Y tree and support the hypothesis of an origin in the north-western quadrant of the African continent for the human MSY diversity. PMID:23145109

  12. Molecular dissection of the basal clades in the human Y chromosome phylogenetic tree.

    PubMed

    Scozzari, Rosaria; Massaia, Andrea; D'Atanasio, Eugenia; Myres, Natalie M; Perego, Ugo A; Trombetta, Beniamino; Cruciani, Fulvio

    2012-01-01

    One hundred and forty-six previously detected mutations were more precisely positioned in the human Y chromosome phylogeny by the analysis of 51 representative Y chromosome haplogroups and the use of 59 mutations from literature. Twenty-two new mutations were also described and incorporated in the revised phylogeny. This analysis made it possible to identify new haplogroups and to resolve a deep trifurcation within haplogroup B2. Our data provide a highly resolved branching in the African-specific portion of the Y tree and support the hypothesis of an origin in the north-western quadrant of the African continent for the human MSY diversity.

  13. A pathway from chromosome transfer to engineering resulting in human and mouse artificial chromosomes for a variety of applications to bio-medical challenges.

    PubMed

    Oshimura, Mitsuo; Uno, Narumi; Kazuki, Yasuhiro; Katoh, Motonobu; Inoue, Toshiaki

    2015-02-01

    Microcell-mediated chromosome transfer (MMCT) is a technique to transfer a chromosome from defined donor cells into recipient cells and to manipulate chromosomes as gene delivery vectors and open a new avenue in somatic cell genetics. However, it is difficult to uncover the function of a single specific gene via the transfer of an entire chromosome or fragment, because each chromosome or fragment contains a set of numerous genes. Thus, alternative tools are human artificial chromosome (HAC) and mouse artificial chromosome (MAC) vectors, which can carry a gene or genes of interest. HACs/MACs have been generated mainly by either a "top-down approach" (engineered creation) or a "bottom-up approach" (de novo creation). HACs/MACs with one or more acceptor sites exhibit several characteristics required by an ideal gene delivery vector, including stable episomal maintenance and the capacity to carry large genomic loci plus their regulatory elements, thus allowing the physiological regulation of the introduced gene in a manner similar to that of native chromosomes. The MMCT technique is also applied for manipulating HACs and MACs in donor cells and delivering them to recipient cells. This review describes the lessons learned and prospects identified from studies on the construction of HACs and MACs, and their ability to drive exogenous gene expression in cultured cells and transgenic animals via MMCT. New avenues for a variety of applications to bio-medical challenges are also proposed.

  14. Final report. Human artificial episomal chromosome (HAEC) for building large genomic libraries

    SciTech Connect

    Jean-Michael H. Vos

    1999-12-09

    Collections of human DNA fragments are maintained for research purposes as clones in bacterial host cells. However for unknown reasons, some regions of the human genome appear to be unclonable or unstable in bacteria. Their team has developed a system using episomes (extrachromosomal, autonomously replication DNA) that maintains large DNA fragments in human cells. This human artificial episomal chromosomal (HAEC) system may prove useful for coverage of these especially difficult regions. In the broader biomedical community, the HAEC system also shows promise for use in functional genomics and gene therapy. Recent improvements to the HAEC system and its application to mapping, sequencing, and functionally studying human and mouse DNA are summarized. Mapping and sequencing the human genome and model organisms are only the first steps in determining the function of various genetic units critical for gene regulation, DNA replication, chromatin packaging, chromosomal stability, and chromatid segregation. Such studies will require the ability to transfer and manipulate entire functional units into mammalian cells.

  15. Structure and chromosomal localization of a human water channel (AQP3) gene

    SciTech Connect

    Ishibashi, Kenichi; Sasaki, Sei; Saito, Fumiko

    1995-05-20

    A cDNA encoding rat AQP3, a water channel and a member of the MIP family, that is expressed predominantly in kidney medulla and colon was cloned recently. To determine the structure, tissue distribution, and chromosomal localization of the human AQP3 gene, the authors screened a human kidney cDNA library with rat AQP3 probe and isolated a cDNA coding for human AQP3 protein. The deduced amino acid sequence of human AQP3 was 91% identical to rat AQP3. Human AQP3 mRNA was expressed in colon, kidney, liver, pancreas, lung, peripheral leukocytes, spleen, and prostate. The human AQP3 gene was mapped to 7q36.2-q36.3 by chromosome fluorescence in situ hybridization. 10 refs., 3 figs.

  16. Identification of chromosomal errors in human preimplantation embryos with oligonucleotide DNA microarray.

    PubMed

    Liang, Lifeng; Wang, Cassie T; Sun, Xiaofang; Liu, Lian; Li, Man; Witz, Craig; Williams, Daniel; Griffith, Jason; Skorupski, Josh; Haddad, Ghassan; Gill, Jimmy; Wang, Wei-Hua

    2013-01-01

    A previous study comparing the performance of different platforms for DNA microarray found that the oligonucleotide (oligo) microarray platform containing 385K isothermal probes had the best performance when evaluating dosage sensitivity, precision, specificity, sensitivity and copy number variations border definition. Although oligo microarray platform has been used in some research fields and clinics, it has not been used for aneuploidy screening in human embryos. The present study was designed to use this new microarray platform for preimplantation genetic screening in the human. A total of 383 blastocysts from 72 infertility patients with either advanced maternal age or with previous miscarriage were analyzed after biopsy and microarray. Euploid blastocysts were transferred to patients and clinical pregnancy and implantation rates were measured. Chromosomes in some aneuploid blastocysts were further analyzed by fluorescence in-situ hybridization (FISH) to evaluate accuracy of the results. We found that most (58.1%) of the blastocysts had chromosomal abnormalities that included single or multiple gains and/or losses of chromosome(s), partial chromosome deletions and/or duplications in both euploid and aneuploid embryos. Transfer of normal euploid blastocysts in 34 cycles resulted in 58.8% clinical pregnancy and 54.4% implantation rates. Examination of abnormal blastocysts by FISH showed that all embryos had matching results comparing microarray and FISH analysis. The present study indicates that oligo microarray conducted with a higher resolution and a greater number of probes is able to detect not only aneuploidy, but also minor chromosomal abnormalities, such as partial chromosome deletion and/or duplication in human embryos. Preimplantation genetic screening of the aneuploidy by DNA microarray is an advanced technology used to select embryos for transfer and improved embryo implantation can be obtained after transfer of the screened normal embryos.

  17. A novel tandem repeat sequence located on human chromosome 4p: isolation and characterization.

    PubMed

    Kogi, M; Fukushige, S; Lefevre, C; Hadano, S; Ikeda, J E

    1997-06-01

    In an effort to analyze the genomic region of the distal half of human chromosome 4p, to where Huntington disease and other diseases have been mapped, we have isolated the cosmid clone (CRS447) that was likely to contain a region with specific repeat sequences. Clone CRS447 was subjected to detailed analysis, including chromosome mapping, restriction mapping, and DNA sequencing. Chromosome mapping by both a human-CHO hybrid cell panel and FISH revealed that CRS447 was predominantly located in the 4p15.1-15.3 region. CRS447 was shown to consist of tandem repeats of 4.7-kb units present on chromosome 4p. A single EcoRI unit was subcloned (pRS447), and the complete sequence was determined as 4752 nucleotides. When pRS447 was used as a probe, the number of copies of this repeat per haploid genome was estimated to be 50-70. Sequence analysis revealed that it contained two internal CA repeats and one putative ORF. Database search established that this sequence was unreported. However, two homologous STS markers were found in the database. We concluded that CRS447/pRS447 is a novel tandem repeat sequence that is mainly specific to human chromosome 4p.

  18. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    PubMed Central

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  19. The Three-Dimensional Structure of Human Interphase Chromosomes Is Related to the Transcriptome Map▿

    PubMed Central

    Goetze, Sandra; Mateos-Langerak, Julio; Gierman, Hinco J.; de Leeuw, Wim; Giromus, Osdilly; Indemans, Mireille H. G.; Koster, Jan; Ondrej, Vladan; Versteeg, Rogier; van Driel, Roel

    2007-01-01

    The three-dimensional (3D) organization of the chromosomal fiber in the human interphase nucleus is an important but poorly understood aspect of gene regulation. Here we quantitatively analyze and compare the 3D structures of two types of genomic domains as defined by the human transcriptome map. While ridges are gene dense and show high expression levels, antiridges, on the other hand, are gene poor and carry genes that are expressed at low levels. We show that ridges are in general less condensed, more irregularly shaped, and located more closely to the nuclear center than antiridges. Six human cell lines that display different gene expression patterns and karyotypes share these structural parameters of chromatin. This shows that the chromatin structures of these two types of genomic domains are largely independent of tissue-specific variations in gene expression and differentiation state. Moreover, we show that there is remarkably little intermingling of chromatin from different parts of the same chromosome in a chromosome territory, neither from adjacent nor from distant parts. This suggests that the chromosomal fiber has a compact structure that sterically suppresses intermingling. Together, our results reveal novel general aspects of 3D chromosome architecture that are related to genome structure and function. PMID:17420274

  20. Constructing chromosome- and region-specific cosmid maps of the human genome.

    PubMed

    Carrano, A V; de Jong, P J; Branscomb, E; Slezak, T; Watkins, B W

    1989-01-01

    A chromosome-specific ordered set of cosmids would be a significant contribution toward understanding human chromosome structure and function. We are developing two parallel approaches for creating an ordered cosmid library of human chromosome 19 and other selected subregions of the human genome. The "bottom up" approach is used to establish sets of overlapping cosmids as islands or "contigs" along the chromosome, while the "top down" approach, using pulsed-field gel electrophoresis and yeast cloning, will establish a large-fragment map and close the inevitable gaps remaining from the "bottom up" approach. Source DNA consists of a single homolog of chromosome 19 from a hamster--human hybrid cell and human fragments cloned in yeast artificial chromosomes. We have constructed cosmid libraries in a vector that facilitates cloning small amounts of DNA, allows transcription of the insert termini, and contains unique sites for partial-digest mapping. Computer simulations of cosmid contig building suggest that near-optimal efficiency can be achieved with high-density restriction fragment digest schemes that can detect 20-30% overlap between cosmids. We developed the chemistry and data analysis tools to compare the ordering efficiencies of several cosmid restriction digest fingerprinting strategies. Restriction fragments from a four-cutter digest are labeled with a fluorochrome, separated by polyacrylamide gel electrophoresis, and detected after laser excitation as they traverse a fixed point in the gel. We have also developed the software to rapidly process the output signal to define and analyze the fragment peaks. Up to three cosmids (or three different digests of the same cosmid) plus a size standard are analyzed simultaneously in a single gel lane.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2698823

  1. Search for a schizophrenia susceptibility locus of human chromosome 22

    SciTech Connect

    Coon, H.; Hoff, M.; Holik, J.

    1994-06-15

    We used 10 highly informative DNA polymorphic markers and genetic linkage analysis to examine whether a gene locus predisposing to schizophrenia is located on chromosome 22, in 105 families with schizophrenia and schizoaffective disorder. The LOD score method, including analysis for heterogeneity, provided no conclusive evidence of linkage under a dominant, recessive, or penetrance free model of inheritance. Affected sib-pair analysis was inconclusive. Affected Pedigree Member (APM) analysis gave only suggestive evidence for linkage. Multipoint APM analysis, using 4 adjacent loci including D22S281 and IL2RB, a region of interest from the APM analysis, gave non-significant results for the three different weighting functions. 18 refs., 1 fig., 7 tabs.

  2. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    SciTech Connect

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole

    2005-09-10

    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  3. Preparation and characterization of ordered libraries of transcribable sequences from human chromosome 19 from hybrid human-hamster cells

    SciTech Connect

    Obradovick, D.; Borodin, A.M.; Kopantsev, E.P.

    1994-08-20

    Improvements in the preparation of chromosome-specific libraries of transcribable sequences from the human genome using somatic hybrid cells are described. One of the main advantages of the new method is the enrichment of the starting material with human-specific heterogeneous nuclear RNA (hnRNA) sequences at each of the three steps in library construction. The method was used to prepare a chromosome-specific library from a hybrid cell line. The resulting ranged library was characterized. The primary structures of 80 randomly selected clones were determined, and these were analyzed. Some 95% of the clones were found to be human-specific and to have arisen from hnRNA, and the chromosomal localizations of a number of clones were identified. The advantages and disadvantages of the method are discussed. 34 refs., 3 figs., 2 tabs.

  4. Scale invariant correlations between genes and SNPs on Human chromosome 1 reveal potential evolutionary mechanisms.

    PubMed

    Kendal, Wayne S

    2007-03-21

    The local density of gene structures and single nucleotide polymorphisms (SNPs) along human chromosomes appears inhomogeneous. In chromosome 1, the density patterns from both these elements are shown here to exhibit similar scale invariant clustering, as well as long-ranged and scale invariant auto- and cross-correlations. The local densities of these elements sites can be accurately represented by the scale invariant exponential dispersion models, a group of stochastic models that act as limiting distributions for a wide range of generalized linear models. The scale invariant Poisson-gamma (PG) distribution is the most applicable of these models, since it describes the above findings and it lends itself to a stochastic mechanism for the accumulation of segmental chromosomal changes. This PG model describes the summation of neutral chromosomal mutations, deletions, rearrangements and recombinations, within chromosomal segments that are distinguished by their evolutionary genealogies. Scale invariance is a necessary property if such a description is to remain valid at different measurement scales. The observed density patterns, and proposed model, presumably represent the convergent summation of multiple stochastic processes within the evolutionary history of the chromosome. PMID:17137602

  5. Functional evidence for a second tumor suppressor gene on human chromosome 17.

    PubMed Central

    Chen, P; Ellmore, N; Weissman, B E

    1994-01-01

    The development and progression of human tumors often involves inactivation of tumor suppressor gene function. Observations that specific chromosome deletions correlate with distinct groups of cancer suggest that some types of tumors may share common defective tumor suppressor genes. In support of this notion, our initial studies showed that four human carcinoma cell lines belong to the same complementation group for tumorigenic potential. In this investigation, we have extended these studies to six human soft tissue sarcoma cell lines. Our data showed that hybrid cells between a peripheral neuroepithelioma (PNET) cell line and normal human fibroblasts or HeLa cells were nontumorigenic. However, hybrid cells between the PNET cell line and five other soft tissue sarcoma cell lines remained highly tumorigenic, suggesting at least one common genetic defect in the control of tumorigenic potential in these cells. To determine the location of this common tumor suppressor gene, we examined biochemical and molecular polymorphic markers in matched pairs of tumorigenic and nontumorigenic hybrid cells between the PNET cell line and a normal human fibroblast. The data showed that loss of the fibroblast-derived chromosome 17 correlated with the conversion from nontumorigenic to tumorigenic cells. Transfer of two different chromosome 17s containing a mutant form of the p53 gene into the PNET cell line caused suppression of tumorigenic potential, implying the presence of a second tumor suppressor gene on chromosome 17. Images PMID:8264622

  6. Chromosome localization and orientation of the simple sequence repeat of human satellite I DNA.

    PubMed

    Meyne, J; Goodwin, E H; Moyzis, R K

    1994-04-01

    The predominant chromosomal locations of human satellite I DNA were detected using fluorescent in situ hybridization (FISH). Synthetic deoxyoligonucleotides designed from consensus sequences of the simple sequence repeats of satellite 1 were used as probes. The most abundant satellite I repeat, the -A-B-A-B-A- form, is located at the pericentromeric regions of chromosomes 3, 4, 13, 14, 15, 21, and 22. The less abundant -B-B-B-form was not detected on chromosome 4, but was present at all the other locations. A variation of FISH that allows strand-specific hybridization of single-stranded probes (CO-FISH) determined that the human satellite I sequences are predominantly arranged in head-to-tail fashion along the DNA strand. PMID:8055716

  7. Chromosome mapping of five human cardiac and skeletal muscle sarcoplasmic reticulum protein genes

    SciTech Connect

    Otsu, K.; Fujii, J.; MacLennan, D.H. ); Periasamy, M. ); Difilippantonio, M.; Uppender, M.; Ward, D.C. )

    1993-08-01

    Fluorescence in situ hybridization (FISH) experiments were performed using genomic and complementary DNA probes in order to determine the location on human chromosomes for five genes expressed in cardiac and skeletal muscle sarcoplasmic reticulum. The chromosome location of each gene was determined in terms of both cytogenetic bands and fractional chromosome length. The ATP2A2 gene, expressing the SERCA2 isoform of the Ca[sup 2+] pump, maps to bands 12q23-q24.1, the phospholamban gene (PLN) to 6q22.1, the human skeletal muscle calsequestrin gene (CASQ1) to band 1q21, the cardiac calsequestrin gene (CASQ2) to bands 1p11-p13.3, and the cardiac calcium release channel gene (RYR2) to the interval between band 1q42.1 (distal) and band 1q43 (proximal). 13 refs., 1 fig.

  8. Rearrangement of a common cellular DNA domain on chromosome 4 in human primary liver tumors

    SciTech Connect

    Pasquinelli, C.; Garreau, F.; Bougueleret, L.; Cariani, E.; Thiers, V.; Croissant, O.; Hadchouel, M.; Tiollais, P.; Brechot, C. ); Grzeschik, K.H. )

    1988-02-01

    Hepatitis B virus (HBV) DNA integration has been shown to occur frequently in human hepatocellular carcinomas. The authors have investigated whether common cellular DNA domains might be rearranged, possibly by HBV integration, in human primary liver tumors. Unique cellular DNA sequences adjacent to an HBV integration site were isolated from a patient with hepatitis B surface antigen-positive hepatocellular carcinoma. These probes detected rearrangement of this cellular region of chromosomal DNA in 3 of 50 additional primary liver tumors studied. Of these three tumor samples, two contained HBV DNA, without an apparent link between the viral DNA and the rearranged allele; HBV DNA sequences were not detected in the third tumor sample. By use of a panel of somatic cell hybrids, these unique cellular DNA sequences were shown to be located on chromosome 4. Therefore, this region of chromosomal DNA might be implicated in the formation of different tumors at one step of liver cell transformation, possible related to HBV integration.

  9. Genetic mapping of the Mx influenza virus resistance gene within the region of mouse chromosome 16 that is homologous to human chromosome 21

    SciTech Connect

    Reeves, R.H.; O'Hara, B.F.; Pavan, W.J.; Gearhart, J.D.; Haller, O.

    1988-11-01

    A total of 318 progeny from four backcrosses involving different laboratory strains and subspecies of Mus musculus were analyzed to map the Mx gene to the region of mouse chromosome 16 (MMU 16) which is homologous to human chromosome 21 (HSA 21). This result suggests that Mx will be found in the region of HSA 21 which has been implicated in Down syndrome when inherited in three copies.

  10. Isolation and mapping of human chromosome 21 cDNA: Progress in constructing a chromosome 21 expression map

    SciTech Connect

    Jan-Fang Cheng; Boyartchuk, V.; Zhu Y.

    1994-09-01

    We have isolated 175 cDNA clones from a fetal brain library by direct cDNA selection using genomic DNA isolated from pools of human chromosome 21 (HC21) cosmids. DNA sequences have revealed that 16 of these cDNA clones contain overlapping sequences. Of the other 159 cDNA sequences, 10 match previously identified HC21 genes, and 9 match previously determined cDNA sequences, including the Wilms tumor related transcript (QM), the human testican cDNA, the mammalian calponin cDNA, and 6 anonymous expressed sequence tags. All isolated cDNAs were hybridized to their corresponding cosmids, which suggests that they originated from HC21. We have localized 92 cDNA clones to previously reported HC21q YACs. The remaining unmapped cDNAs contain either sequences not included in the isolated HC21q YACs or sequences that hybridize to yeast DNA. The cDNAs not included in the YACs should be useful in isolating new YACs to bridge the gaps. PCR primers were derived from 4 novel cDNA sequences that had been mapped to the YACs in the suspected Down syndrome region and used in RT-PCR analysis. All 4 primer sequences amplified RNA fragments with the expected sizes, suggesting that these sequences could be used for expression analysis. The construction of a chromosome 21 cDNA map not only is important in the refinement of physical maps, but also will identify a set of genes in the disease regions for detailed characterization. 30 refs., 2 figs., 2 tabs.

  11. Early and Late Chromosome Damages in Human Lymphocytes Induced by Gamma Rays and Fe Ions

    NASA Technical Reports Server (NTRS)

    Sunagawa, Mayumi; Zhang, Ye; Yeshitla, Samrawit; Kadhim, Munira; Wilson, Bobby; Wu, Honglu

    2014-01-01

    Chromosomal translocations and inversions are considered stable, and cells containing these types of chromosome aberrations can survive multiple cell divisions. An efficient method to detect an inversion is multi-color banding fluorescent in situ hybridization (mBAND) which allows identification of both inter- and intrachromosome aberrations simultaneously. Post irradiation, chromosome aberrations may also arise after multiple cell divisions as a result of genomic instability. To investigate the stable or late-arising chromosome aberrations induced after radiation exposure, we exposed human lymphocytes to gamma rays and Fe ions ex vivo, and cultured the cells for multiple generations. Chromosome aberrations were analyzed in cells collected at first mitosis and at several time intervals during the culture period post irradiation. With gamma irradiation, about half of the damages observed at first mitosis remained after 7 day- and 14 day- culture, suggesting the transmissibility of damages to the surviving progeny. Detailed analysis of chromosome break ends participating in exchanges revealed a greater fraction of break ends involved in intrachromosome aberrations in the 7- and 14-day samples in comparison to the fraction at first mitosis. In particular, simple inversions were found at 7 and 14 days, but not at the first mitosis, suggesting that some of the aberrations might be formed days post irradiation. In contrast, at the doses that produced similar frequencies of gamma-induced chromosome aberrations as observed at first mitosis, a significantly lower yield of aberrations remained at the same population doublings after Fe ion exposure. At these equitoxic doses, more complex type aberrations were observed for Fe ions, indicating that Fe ion-induced initial chromosome damages are more severe and may lead to cell death. Comparison between low and high doses of Fe ion irradiation in the induction of late damages will also be discussed.

  12. Sequence divergence and chromosomal rearrangements during the evolution of human p